WorldWideScience

Sample records for aperiodic blue variables

  1. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  2. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  3. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  4. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  5. Variable blue straggler stars in NGC 5466

    International Nuclear Information System (INIS)

    Harris, H.C.; Mateo, M.; Olszewski, E.W.; Nemec, J.M.

    1990-01-01

    Nine variable blue stragglers have been found in the globular cluster NGC 5466. The six dwarf Cepheids in this cluster coexist in the instability strip with other nonvariable stars. The three eclipsing binaries are among the hottest of the blue stragglers. The hypothesis is discussed that all blue stragglers in this cluster have undergone mass transfer in close binaries. Under this hypothesis, rotation and spin-down play important roles in controlling the evolution of blue stragglers in old clusters and in affecting some of their observational properties. 14 refs

  6. ENERGY-DEPENDENT POWER SPECTRAL STATES AND ORIGIN OF APERIODIC VARIABILITY IN BLACK HOLE BINARIES

    International Nuclear Information System (INIS)

    Yu Wenfei; Zhang Wenda

    2013-01-01

    We found that the black hole candidate MAXI J1659–152 showed distinct power spectra, i.e., power-law noise (PLN) versus band-limited noise (BLN) plus quasi-periodic oscillations (QPOs) below and above about 2 keV, respectively, in observations with Swift and the Rossi X-ray Timing Explorer during the 2010 outburst, indicating a high energy cutoff of the PLN and a low energy cutoff of the BLN and QPOs around 2 keV. The emergence of the PLN and the fading of the BLN and QPOs initially took place below 2 keV when the source entered the hard intermediate state and settled in the soft state three weeks later. The evolution was accompanied by the emergence of the disk spectral component and decreases in the amplitudes of variability in the soft and hard X-ray bands. Our results indicate that the PLN is associated with an optically thick disk in both hard and intermediate states, and the power spectral state is independent of the X-ray energy spectral state in a broadband view. We suggest that in the hard or intermediate state, the BLN and QPOs emerge from the innermost hot flow subjected to Comptonization, while the PLN originates from the optically thick disk farther out. The energy cutoffs of the PLN and the BLN or QPOs then follow the temperature of the seed photons from the inner edge of the optically thick disk, while the high frequency cutoff of the PLN follows the orbital frequency of the inner edge of the optically thick disk as well.

  7. On the thickness of accretion curtains on magnetized compact objects from analysis of their fast aperiodic time variability.

    Science.gov (United States)

    Semena, Andrey

    It is widely accepted that accretion onto magnetized compact objects is channelled to some areas close to magnetic poles of the star. Thickness of this channelled accretion flow intimately depends on details of penetration of highly conducting plasma of the flow to the compact object magnetosphere, i.e. on magnetic diffusivity etc. Until now our knowledge of these plasma properties is scarce. In our work we present our attempts to estimate the thickness of the plasma flow on top of the magnetosphere from observations of accreting intermediate polars (magnetized white dwarfs). We show that properties of aperiodic noise of accreting intermediate polars can be used to put constrains on cooling time of hot plasma, heated in the standing shock wave above the WD surface. Estimates of the cooling time and the mass accretion rate provide us a tool to measure the density of post-shock plasma and the cross-sectional area of the accretion funnel at the WD surface. We have studied aperiodic noise of emission of one of the brightest intermediate polar EX Hya with the help of data in optical and X-ray energy bands. We put an upper limit on the plasma cooling timescale tau <0.2-0.5 sec, on the fractional area of the accretion curtain footprint f < 1.6 × 10(-4) . We show that measurements of accretion column footprints, combined with results of the eclipse mapping, can be used to obtain an upper limit on the penetration depth of the accretion disc plasma at the boundary of the magnetosphere, Delta r / r ≈ 10(-3) If the magnetospheres of accreting neutron stars have similar plasma penetration depths at their boundaries, we predict that footprints of their accretion columns should be very small, with fractional areas < 10(-6) .

  8. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  9. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  10. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  11. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  12. The Missing Luminous Blue Variables and the Bistability Jump

    NARCIS (Netherlands)

    Smith, N.; Vink, J.S.; de Koter, A.

    2004-01-01

    We discuss an interesting feature of the distribution of luminous blue variables (LBVs) on the H-R diagram, and we propose a connection with the bistability jump seen in the winds of early-type supergiants. There appears to be a deficiency of quiescent LBVs on the S Doradus instability strip at

  13. Spectroscopy and Interferometry of the Winds of Luminous Blue Variables

    Science.gov (United States)

    Richardson, Noel D.

    2012-04-01

    Massive stars are rare, but emit most of the light we observe in the Universe and create many of the heavy elements in the Universe. In this dissertation, I explore the winds of the massive luminous blue variable (LBV) stars. New observational approaches and long time-series are utilized in order to examine the basic observable properties of the stars and the mass lost during their lifetimes. The mass lost through a hot star's wind impacts its long-term evolution. In order to study the winds and the long-term changes of the stars, hot stars with some of the strongest winds (the luminous blue variables or LBVs) were studied in detail with optical spectroscopy and photometry. A 25-year survey on the prototype P Cygni is presented, where the long-term changes are documented for many parameters that have not been examined before. In addition, we present a detailed study of the H-band emitting region through interferometric imaging with the CHARA Array and the MIRC beam combiner as well as spectrophotometry. A detailed study of the Hα line variability of the LBV η Carinae near its recent periastron is presented. The LBV candidate HDE 326823 is found to be a binary system with variability driven by the close binary companion and Roche lobe overflow. Finally, I present a three-year study of many LBVs in the Milky Way Galaxy and Magellanic Clouds for a statistically significant survey of the long-term variability properties of these rare stars as a population. These results show that all the sample stars exhibit similar types of variability, although with different amplitudes. Future studies of LBV winds are outlined, as well as a short discussion of Georgia State University's Hard Labor Creek Observatory for these types of studies.

  14. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  15. Temporal variability of green and blue water footprint worldwide

    Science.gov (United States)

    Tamea, Stefania; Lomurno, Marianna; Tuninetti, Marta; Laio, Francesco; Ridolfi, Luca

    2016-04-01

    Water footprint assessment is becoming widely used in the scientific literature and it is proving useful in a number of multidisciplinary contexts. Given this increasing popularity, measures of green and blue water footprint (or virtual water content, VWC) require evaluations of uncertainty and variability to quantify the reliability of proposed analyses. As of today, no studies are known to assess the temporal variability of crop VWC at the global scale; the present contribution aims at filling this gap. We use a global high-resolution distributed model to compute the VWC of staple crops (wheat and maize), basing on the soil water balance, forced by hydroclimatic imputs, and on the total crop evapotranspiration in multiple growing seasons. Crop actual yield is estimated using country-based yield data, adjusted to account for spatial variability, allowing for the analysis of the different role played by climatic and management factors in the definition of crop yield. The model is then run using hydroclimatic data, i.e., precipitation and potential evapotranspiration, for the period 1961-2013 as taken from the CRU database (CRU TS v. 3.23) and using the corresponding country-based yield data from FAOSTAT. Results provide the time series of total evapotranspiration, actual yield and VWC, with separation between green and blue VWC, and the overall volume of water used for crop production, both at the cell scale (5x5 arc-min) and aggregated at the country scale. Preliminary results indicate that total (green+blue) VWC is, in general, weekly dependent on hydroclimatic forcings if water for irrigation is unlimited, because irrigated agriculture allows to compensate temporary water shortage. Conversely, most part of the VWC variability is found to be determined by the temporal evolution of crop yield. At the country scale, the total water used by countries for agricultural production has seen a limited change in time, but the marked increase in the water-use efficiency

  16. Active Luminous Blue Variables in the Large Magellanic Cloud

    Energy Technology Data Exchange (ETDEWEB)

    Walborn, Nolan R. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Gamen, Roberto C.; Lajús, Eduardo Fernández [Instituto de Astrofísica de La Plata, CONICET–UNLP and Facultad de Ciencias Astronómicas y Geofísicas, UNLP, Paseo del Bosque s/n, La Plata (Argentina); Morrell, Nidia I. [Las Campanas Observatory, Carnegie Observatories, Casilla 601, La Serena (Chile); Barbá, Rodolfo H. [Departamento de Física y Astronomía, Universidad de La Serena, Cisternas 1200 Norte, La Serena (Chile); Angeloni, Rodolfo, E-mail: walborn@stsci.edu, E-mail: rgamen@fcaglp.unlp.edu.ar, E-mail: eflajus@fcaglp.unlp.edu.ar, E-mail: nmorrell@lco.cl, E-mail: rbarba@dfuls.cl, E-mail: rangelon@gemini.edu [Gemini Observatory, Colina El Pino, Casilla 603, La Serena (Chile)

    2017-07-01

    We present extensive spectroscopic and photometric monitoring of two famous and currently highly active luminous blue variables (LBVs) in the Large Magellanic Cloud (LMC), together with more limited coverage of three further, lesser known members of the class. R127 was discovered as an Ofpe/WN9 star in the 1970s but entered a classical LBV outburst in or about 1980 that is still in progress, thus enlightening us about the minimum state of such objects. R71 is currently the most luminous star in the LMC and continues to provide surprises, such as the appearance of [Ca ii] emission lines, as its spectral type becomes unprecedentedly late. Most recently, R71 has developed inverse P Cyg profiles in many metal lines. The other objects are as follows: HDE 269582, now a “second R127” that has been followed from Ofpe/WN9 to A type in its current outburst; HDE 269216, which changed from late B in 2014 to AF in 2016, its first observed outburst; and R143 in the 30 Doradus outskirts. The light curves and spectroscopic transformations are correlated in remarkable detail and their extreme reproducibility is emphasized, both for a given object and among all of them. It is now believed that some LBVs proceed directly to core collapse. One of these unstable LMC objects may thus oblige in the near future, teaching us even more about the final stages of massive stellar evolution.

  17. Confirmation of the Luminous Blue Variable Status of MWC 930

    Directory of Open Access Journals (Sweden)

    A. S. Miroshnichenko

    2014-01-01

    Full Text Available We present spectroscopic and photometric observations of the emission-line star MWC 930 (V446 Sct during its long-term optical brightening in 2006–2013. Based on our earlier data we suggested that the object has features found in Luminous Blue Variables (LBV, such as a high luminosity (~3 105 L⊙, a low wind terminal velocity (~140 km s−1, and a tendency to show strong brightness variations (~1 mag over 20 years. For the last ~7 years it has been exhibiting a continuous optical and near-IR brightening along with a change of the emission-line spectrum appearance and cooling of the star’s photosphere. We present the object’s V-band light curve, analyze the spectral variations, and compare the observed properties with those of other recognized Galactic LBVs, such as AG Car and HR Car. Overall we conclude the MWC 930 is a bona fide Galactic LBV that is currently in the middle of an S Dor cycle.

  18. Luminous blue variables and the fates of very massive stars.

    Science.gov (United States)

    Smith, Nathan

    2017-10-28

    Luminous blue variables (LBVs) had long been considered massive stars in transition to the Wolf-Rayet (WR) phase, so their identification as progenitors of some peculiar supernovae (SNe) was surprising. More recently, environment statistics of LBVs show that most of them cannot be in transition to the WR phase after all, because LBVs are more isolated than allowed in this scenario. Additionally, the high-mass H shells around luminous SNe IIn require that some very massive stars above 40  M ⊙ die without shedding their H envelopes, and the precursor outbursts are a challenge for understanding the final burning sequences leading to core collapse. Recent evidence suggests a clear continuum in pre-SN mass loss from super-luminous SNe IIn, to regular SNe IIn, to SNe II-L and II-P, whereas most stripped-envelope SNe seem to arise from a separate channel of lower-mass binary stars rather than massive WR stars.This article is part of the themed issue 'Bridging the gap: from massive stars to supernovae'. © 2017 The Author(s).

  19. Active Luminous Blue Variables in the Large Magellanic Cloud

    Science.gov (United States)

    Walborn, Nolan R.; Gamen, Roberto C.; Morrell, Nidia I.; Barbá, Rodolfo H.; Fernández Lajús, Eduardo; Angeloni, Rodolfo

    2017-07-01

    We present extensive spectroscopic and photometric monitoring of two famous and currently highly active luminous blue variables (LBVs) in the Large Magellanic Cloud (LMC), together with more limited coverage of three further, lesser known members of the class. R127 was discovered as an Ofpe/WN9 star in the 1970s but entered a classical LBV outburst in or about 1980 that is still in progress, thus enlightening us about the minimum state of such objects. R71 is currently the most luminous star in the LMC and continues to provide surprises, such as the appearance of [Ca II] emission lines, as its spectral type becomes unprecedentedly late. Most recently, R71 has developed inverse P Cyg profiles in many metal lines. The other objects are as follows: HDE 269582, now a “second R127” that has been followed from Ofpe/WN9 to A type in its current outburst; HDE 269216, which changed from late B in 2014 to AF in 2016, its first observed outburst; and R143 in the 30 Doradus outskirts. The light curves and spectroscopic transformations are correlated in remarkable detail and their extreme reproducibility is emphasized, both for a given object and among all of them. It is now believed that some LBVs proceed directly to core collapse. One of these unstable LMC objects may thus oblige in the near future, teaching us even more about the final stages of massive stellar evolution.

  20. Active Luminous Blue Variables in the Large Magellanic Cloud

    International Nuclear Information System (INIS)

    Walborn, Nolan R.; Gamen, Roberto C.; Lajús, Eduardo Fernández; Morrell, Nidia I.; Barbá, Rodolfo H.; Angeloni, Rodolfo

    2017-01-01

    We present extensive spectroscopic and photometric monitoring of two famous and currently highly active luminous blue variables (LBVs) in the Large Magellanic Cloud (LMC), together with more limited coverage of three further, lesser known members of the class. R127 was discovered as an Ofpe/WN9 star in the 1970s but entered a classical LBV outburst in or about 1980 that is still in progress, thus enlightening us about the minimum state of such objects. R71 is currently the most luminous star in the LMC and continues to provide surprises, such as the appearance of [Ca ii] emission lines, as its spectral type becomes unprecedentedly late. Most recently, R71 has developed inverse P Cyg profiles in many metal lines. The other objects are as follows: HDE 269582, now a “second R127” that has been followed from Ofpe/WN9 to A type in its current outburst; HDE 269216, which changed from late B in 2014 to AF in 2016, its first observed outburst; and R143 in the 30 Doradus outskirts. The light curves and spectroscopic transformations are correlated in remarkable detail and their extreme reproducibility is emphasized, both for a given object and among all of them. It is now believed that some LBVs proceed directly to core collapse. One of these unstable LMC objects may thus oblige in the near future, teaching us even more about the final stages of massive stellar evolution.

  1. A 'variable' stellar object in a variable blue nebula V-V 1-7

    International Nuclear Information System (INIS)

    Rao, N.K.; Gilra, D.P.

    1981-01-01

    V-V 1-7 is supposed to be one of the few planetary nebulae with Ao central stars and was included in the planetary-nebula catalogue as PK 235 + 1 0 1. The nebula was seen on the blue Palomar Observatory Sky Survey (POSS) print but not on the red print; as a result it was thought that it might be a reflection nebula. However, the symmetry of the nebula around the central star (HD 62001), and also the ultraviolet photometric variability of this central star led others to suggest that the nebula might be a nova shell. Subsequently it was found that the nebula V-V 1-7 has disappeared. It is not seen on any direct plate known to us except the POSS blue plate. In this paper the disappearance is reported (along with the nebula) of a stellar object, which appears within the 'nebular shell' of V-V 1-7 on the POSS blue plate, but not on the red plate. (author)

  2. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  3. On the Variability of Blue Straggler Stars in the Globular Cluster M53

    Directory of Open Access Journals (Sweden)

    Soo-Chang Rey

    1998-06-01

    Full Text Available We present the results of a search for photometric variable blue straggler stars (BSSs in the globular cluster M53. Six of the 151 probable BSSs are identified as variable candidates based on the robust variable star detection technique of Welch & Stetson (1993. Most variable BSS candidates appear to occupy the instability strip in the color-magnitude diagram, and they appear to have visual light amplitudes of 0.2 mag - 0.3 mag. Further observations are required, however, to resolve the nature of variability between pulsating stars and eclipsing binaries for these variable BSS candidates.

  4. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  5. Inter-Annual Variability in Blue Whale Distribution off Southern Sri Lanka between 2011 and 2012

    Directory of Open Access Journals (Sweden)

    Asha de Vos

    2014-07-01

    Full Text Available Blue whale (Balaenoptera musculus movements are often driven by the availability of their prey in space and time. While globally blue whale populations undertake long-range migrations between feeding and breeding grounds, those in the northern Indian Ocean remain in low latitude waters throughout the year with the implication that the productivity of these waters is sufficient to support their energy needs. A part of this population remains around Sri Lanka where they are usually recorded close to the southern coast during the Northeast Monsoon. To investigate inter-annual variability in sighting locations, we conducted systematic Conductivity-Temperature-Depth (CTD and visual surveys between January–March 2011 and January–March 2012. In 2011, there was a notable decrease in inshore sightings compared to 2009 and 2012 (p < 0.001. CTD data revealed that in 2011 there was increased freshwater in the upper water column accompanied by deeper upwelling than in 2012. We hypothesise that anomalous rainfall, along with higher turbidity resulting from river discharge, affected the productivity of the inshore waters and caused a shift in blue whale prey and, consequently, the distribution of the whales themselves. An understanding of how predators and their prey respond to environmental variability is important for predicting how these species will respond to long-term changes. This is especially important given the rapid temperature increases predicted for the semi-enclosed northern Indian Ocean.

  6. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  7. Periodic and aperiodic synchronization in skilled action

    Directory of Open Access Journals (Sweden)

    Fred eCummins

    2011-12-01

    Full Text Available Synchronized action is considered as a manifestation of shared skill. Most synchronized behaviors in humans and other animals are based on periodic repetition. Aperiodic synchronization of complex action is found in the experimental task of synchronous speaking, in which naive subjects read a common text in lock step. The demonstration of synchronized behavior without a periodic basis is presented as a challenge for theoretical understanding. A unified treatment of periodic and aperiodic synchronization is suggested by replacing the sequential processing model of cognitivist approaches with the more local notion of a task-specific sensorimotor coordination. On this view, skilled action is the imposition of constraints on the co-variation of movement and sensory flux such that the boundary conditions that define the skill are met. This non-cognitivist approach originates in the work of John Dewey. It allows a unification of the treatment of sensorimotor synchronization in simple rhythmic behavior and in complex skilled behavior and it suggests that skill sharing is a uniquely human trait of considerable import.

  8. Robust Optimization of Aperiodic Photonic Structures

    Science.gov (United States)

    Nohadani, Omid; Meng Teo, Kwong; Bertsimas, Dimitris

    2007-03-01

    In engineering design, the physical properties of a system can often only be described by numerical simulation. Optimization of such systems is usually accomplished heuristically without taking into account that there are implementation errors that lead to very suboptimal, and often, infeasible solutions. We present a novel robust optimization method for electromagnetic scattering problems with large degrees of freedom, and report on results when this technique is applied to optimization of aperiodic dielectric structures. The spatial configuration of 50 dielectric scattering cylinders is optimized to match a desired target function such that the optimal arrangement is robust against placement and prototype errors. Our optimization method inherently improves the robustness of the optimized solution with respect to relevant errors and is suitable for real-world design of materials with novel electromagnetic functionalities.

  9. Surface plasmon field enhancements in deterministic aperiodic structures.

    Science.gov (United States)

    Shugayev, Roman

    2010-11-22

    In this paper we analyze optical properties and plasmonic field enhancements in large aperiodic nanostructures. We introduce extension of Generalized Ohm's Law approach to estimate electromagnetic properties of Fibonacci, Rudin-Shapiro, cluster-cluster aggregate and random deterministic clusters. Our results suggest that deterministic aperiodic structures produce field enhancements comparable to random morphologies while offering better understanding of field localizations and improved substrate design controllability. Generalized Ohm's law results for deterministic aperiodic structures are in good agreement with simulations obtained using discrete dipole method.

  10. Prolonged Sitting is Associated with Attenuated Heart Rate Variability during Sleep in Blue-Collar Workers

    Directory of Open Access Journals (Sweden)

    David M Hallman

    2015-11-01

    Full Text Available Prolonged sitting is associated with increased risk for cardiovascular diseases and mortality. However, research into the physiological determinants underlying this relationship is still in its infancy. The aim of the study was to determine the extent to which occupational and leisure-time sitting are associated with nocturnal heart rate variability (HRV in blue-collar workers. The study included 138 blue-collar workers (mean age 45.5 (SD 9.4 years. Sitting-time was measured objectively for four days using tri-axial accelerometers (Actigraph GT3X+ worn on the thigh and trunk. During the same period, a heart rate monitor (Actiheart was used to sample R-R intervals from the electrocardiogram. Time and frequency domain indices of HRV were only derived during nighttime sleep, and used as markers of cardiac autonomic modulation. Regression analyses with multiple adjustments (age, gender, body mass index, smoking, job-seniority, physical work-load, influence at work, and moderate-to-vigorous physical activity were used to investigate the association between sitting time and nocturnal HRV. We found that occupational sitting-time was negatively associated (p < 0.05 with time and frequency domain HRV indices. Sitting-time explained up to 6% of the variance in HRV, independent of the covariates. Leisure-time sitting was not significantly associated with any HRV indices (p > 0.05. In conclusion, objectively measured occupational sitting-time was associated with reduced nocturnal HRV in blue-collar workers. This indicates an attenuated cardiac autonomic regulation with increasing sitting-time at work regardless of moderate-to-vigorous physical activity. The implications of this association for cardiovascular disease risk warrant further investigation via long-term prospective studies and intervention studies.

  11. Investigation of Regional Drivers for Discharge Variability in the Blue Nile Basin under Climate Change Conditions

    Science.gov (United States)

    Tecklenburg, J.; Hattermann, F. F.; Liersch, S.

    2012-04-01

    A discharge time series is the result of complex and interacting processes. Important for the runoff variability are catchment characteristics like the basin size and shape, gradient of altitude and exposition as well as micro- and macroclimatic conditions. The discharge dynamic of the Blue Nile is predominantly controlled by the monsoon variability. Due to the steep gradients in the Ethiopian highlands, the surface flow component represents the main fraction of the total discharge. The composition of discharge and the resulting time response of river runoff is further a function of subsurface retention and surface roughness. Thus, the soil surface characteristics and thereby the land use are main factors controlling formation of local water availability in the Upper Blue Nile basin. During the last 30 years the continual transformation of forest and grassland to cropland reduced the total forest area of Ethiopia to 2.5 % with respect to the total area. Regarding the discharge formation process, land cover change supports generation of surface flow because of degradation of the surface roughness with two mainly negative effects: more surface runoff and less vegetation cover leads to erosion and degradation of soils. On the other hand, the water available for plants (soil moisture) may be reduced by a decreasing infiltration rate. Both effects have consequences for agricultural production and lead to an increasing demand for irrigation. Thus, the combination of the processes may accelerate the negative environmental response which makes the system highly vulnerable and sensitive to changes in driving forces. This study aims at analyzing the correlation of possible regional drivers with the inter-seasonal and inter-annual variability of subcatchment discharge generation. The study will be carried out applying the eco-hydrological model SWIM (Soil and Water Integrated Model) driven by observed and scenario climate data. Based on satellite image information the effect

  12. Effect of Topography on Rainfall Variability in the Blue Nile River Basin

    Science.gov (United States)

    Muluneh, S. H.; Bitew, M. M.; Gebremichael, M.

    2012-12-01

    The effect of topography on rainfall variability in the East Africa highlands is one the poorly studied rainfall processes. We deployed 70 rain gauges and 5 complete weather sensors along four transects in the complex terrain region of the Blue Nile River Basin. The transects span along elevation ranges from about 600 m in lowland areas around the border between Sudan and Ethiopia to 4000 m in the central Ethiopia mountains. A summer monsoon rainfall of 2012 recorded at high temporal scale from the newly deployed and existing rain gauges along the transects was used for this study. Based on the data obtained from the sensors, we present the effect of topography on the spatial and temporal variability of rainfall. The results on the rainfall variability, effect of topography on rainfall rate and space time variability of rainfall will have significant importance for the understanding of rainfall processes, for evaluation of accuracy of satellite based rainfall estimates, for designing of ways of merging satellite rainfall estimates and ground based observations given sparsely distributed rain gauges.

  13. Aperiodic space-time modulation for pure frequency mixing

    Science.gov (United States)

    Taravati, Sajjad

    2018-03-01

    This paper experimentally demonstrates the effects of inharmonic photonic transition in tailored aperiodic space-time refractive index modulated media. Such effects introduce a pure frequency mixing based on the simultaneous and distinct shifts in the spatial and temporal frequencies. The medium is characterized with a periodic temporal modulation and a tailored aperiodic spatially modulated permittivity and permeability, yielding aperiodic, large and tunable photonic band gaps. Since the medium is time periodic, an infinite number of space-time mixing products are generated with a distance equal to the temporal frequency of the pump wave. However, thanks to the tailored spatial aperiodicity of the medium and associated photonic band gaps, transition to unwanted space-time mixing products is prohibited. Interesting features include tunability of the operation frequencies of the mixer via space-time modulation parameters, high isolation, linear response, and possibility of conversion gain due to the transfer of energy and momentum of the space-time modulation to the input wave. We derive the analytical solution for such mixer with aperiodic space-modulated permittivity and permeability and periodic time modulation, and then provide the synthesis procedure which takes into account the effects of space-time modulation inhomogeneity. Finally, to see the effect of the tailoring of space modulation, we compare the experimental results of the aperiodic space-time modulated pure mixer with those of the conventional periodic uniform space-time modulated medium.

  14. Connecting the progenitors, pre-explosion variability and giant outbursts of luminous blue variables with Gaia16cfr

    Science.gov (United States)

    Kilpatrick, Charles D.; Foley, Ryan J.; Drout, Maria R.; Pan, Yen-Chen; Panther, Fiona H.; Coulter, David A.; Filippenko, Alexei V.; Marion, G. Howard; Piro, Anthony L.; Rest, Armin; Seitenzahl, Ivo R.; Strampelli, Giovanni; Wang, Xi E.

    2018-02-01

    We present multi-epoch, multicolour pre-outburst photometry and post-outburst light curves and spectra of the luminous blue variable (LBV) outburst Gaia16cfr discovered by the Gaia satellite on 2016 December 1 UT. We detect Gaia16cfr in 13 epochs of Hubble Space Telescope imaging spanning phases of 10 yr to 8 months before the outburst and in Spitzer Space Telescope imaging 13 yr before outburst. Pre-outburst optical photometry is consistent with an 18 M⊙ F8 I star, although the star was likely reddened and closer to 30 M⊙. The pre-outburst source exhibited a significant near-infrared excess consistent with a 120 au shell with 4 × 10-6 M⊙ of dust. We infer that the source was enshrouded by an optically thick and compact shell of circumstellar material from an LBV wind, which formed a pseudo-photosphere consistent with S Dor-like variables in their 'maximum' phase. Within a year of outburst, the source was highly variable on 10-30 d time-scales. The outburst light curve closely matches that of the 2012 outburst of SN 2009ip, although the observed velocities are significantly slower than in that event. In H α, the outburst had an excess of blueshifted emission at late times centred around -1500 km s-1, similar to that of double-peaked Type IIn supernovae and the LBV outburst SN 2015bh. From the pre-outburst and post-outburst photometry, we infer that the outburst ejecta are evolving into a dense, highly structured circumstellar environment from precursor outbursts within years of the 2016 December event.

  15. Applications the Lagrangian description in aperiodic flows

    Science.gov (United States)

    Mendoza, Carolina; Mancho, Ana Maria

    2012-11-01

    We use several recently developed Lagrangian tools for describing transport in general aperiodic flows. In our approach the first step is based in a Lagrangian descriptor (the so called function M). It measures the length of particle trajectories on the ocean surface over a given interval of time. We describe its output over satellite altimetry data on the Kuroshio current. The technique is combined with the direct computation of manifolds of Distinguished Hyperbolic trajectories and a very detailed description of transport is achieved across an eddy and a jet on the Kuroshio current,. A second velocity data set is examined with the M function tool. These are obtained from the HYCOM project on the Gulf of Mexico during the time of the oil-spill. We have identified underlying Lagrangian structures and dynamics. We acknowledge to the hospitality of the university of Delaware and the assistance of Bruce Lipphardt and Helga Huntley in accessing the model data sets. We acknowledge to the grants: UPM-AL12-PAC-09, Becas de Movilidad de Caja Madrid 2011, MTM2011-26696 and ILINK-0145.

  16. Dust composition and mass-loss return from the luminous blue variable R71 in the LMC

    NARCIS (Netherlands)

    Guha Niyogi, S.; Min, M.; Meixner, M.; Waters, L.B.F.M.; Seale, J.; Tielens, A.G.G.M.

    2014-01-01

    Context. We present an analysis of mid- and far-infrared (IR) spectrum and spectral energy distribution (SED) of the luminous blue variable (LBV) R71 in the Large Magellanic Cloud (LMC). Aims. This work aims to understand the overall contribution of high-mass LBVs to the total dust-mass budget of

  17. THE RED NOVA-LIKE VARIABLE IN M31-A BLUE CANDIDATE IN QUIESCENCE

    International Nuclear Information System (INIS)

    Shara, Michael M.; Zurek, David; Prialnik, Dina; Yaron, Ofer; Kovetz, Attay

    2010-01-01

    M31-RV was an extraordinarily luminous (∼10 6 L sun ) eruptive variable, displaying very cool temperatures (roughly 1000 K) as it faded. While this object's peak luminosity matched or exceeded those of the brightest known classical novae, its red colors and cool spectra were very different from those of classical novae. The photometric behavior of M31-RV (and several other very red novae, i.e., luminous eruptive red variables) has led to several models of this apparently new class of astrophysical object. We list these models, which predict very red eruptions and very red remnants decades after the eruptions. One of the most detailed models is that of 'mergebursts'. Mergebursts are (hypothetical) mergers of close binary stars, predicted to rival or exceed the brightest classical novae in luminosity, but to be much cooler and redder than classical novae, and to become slowly hotter and bluer as they age. This prediction suggests two stringent and definitive tests of the mergeburst hypothesis. First, there should always be a cool red remnant, and NOT a hot blue remnant at the site of such an outburst. Second, the inflated envelope of a mergeburst event should be slowly contracting; hence, it must display a slowly rising effective temperature. We have searched the location of M31-RV in multiple observatory archives. Our search revealed a luminous, UV-bright object within 0.''4 (1.5σ of the astrometric position) of M31-RV in archival WFPC2 images taken 10 years after the outburst. Recent Hubble imagery, 20 years after the outburst, determines that this object is still hot and fading; it remains much too hot to be a mergeburst. Furthermore, the effective temperature of this object is declining, contrary to the prediction for mergebursts. If we have correctly identified M31-RV's remnant, it cannot be a mergeburst-but its behavior is consistent with theoretical nova models which erupt on a low-mass white dwarf. Future Hubble UV and visible images could determine if the

  18. Simulation Methods for Multiperiodic and Aperiodic Nanostructured Dielectric Waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    , L. Dal Negro, Optical gap formation and localization properties of optical modes in deterministic aperiodic photonic structures, Opt. Express 16, 18813, 2008 [2] E. Maciá, Exploiting aperiodic designs in nanophotonic devices, Rep Prog Phys 75, 036502, 2012 [3] C. Kluge, J. Adam, N. Barié, P. J....... Jakobs, M. Guttmann, M. Gerken, Multiperiodic nanostructures for photon control, Opt. Express 22, A1363-A1371, 2014 [4] L. T. Neustock, S. Jahns, J. Adam, M. Gerken, Optical waveguides with compound grating nanostructures for refractive index sensing, J. of Sensors, 6174527, 2016...

  19. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  20. Application of Artificial Neural Networks (ANNs for Weight Predictions of Blue Crabs (Callinectes sapidus RATHBUN, 1896 Using Predictor Variables

    Directory of Open Access Journals (Sweden)

    C. TURELI BILEN

    2011-10-01

    Full Text Available An evaluation of the performance of artificial networks (ANNs to estimate the weights of blue crab (Callinectes sapidus catches in Yumurtalık Cove (Iskenderun Bay that uses measured predictor variables is presented, including carapace width (CW, sex (male, female and female with eggs, and sampling month. Blue crabs (n=410 were collected each month between 15 September 1996 and 15 May 1998. Sex, CW, and sampling month were used and specified in the input layer of the network. The weights of the blue crabs were utilized in the output layer of the network. A multi-layer perception architecture model was used and was calibrated with the Levenberg Marguardt (LM algorithm. Finally, the values were determined by the ANN model using the actual data. The mean square error (MSE was measured as 3.3, and the best results had a correlation coefficient (R of 0.93. We compared the predictive capacity of the general linear model (GLM versus the Artificial Neural Network model (ANN for the estimation of the weights of blue crabs from independent field data. The results indicated the higher performance capacity of the ANN to predict weights compared to the GLM (R=0.97 vs. R=0.95, raw variable when evaluated against independent field data.

  1. A method to identify aperiodic disturbances in the ionosphere

    Directory of Open Access Journals (Sweden)

    J.-S. Wang

    2014-05-01

    Full Text Available In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM, a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  2. Aperiodic Multiprocessor Scheduling for Real-Time Stream Processing Applications

    NARCIS (Netherlands)

    Wiggers, M.H.

    2009-01-01

    This thesis is concerned with the computation of buffer capacities that guarantee satisfaction of timing and resource constraints for task graphs with aperiodic task execution rates that are executed on run-time scheduled resources. Stream processing applications such as digital radio baseband

  3. Diurnal rainfall variability over the Upper Blue Nile Basin: a remote sensing based approach

    NARCIS (Netherlands)

    Rientjes, T.H.M.; Haile, A.T.; Fenta, A.A.

    2013-01-01

    In this study we aim to assess the diurnal cycle of rainfall across the Upper Blue Nile (UBN) basin using satellite observations from Tropical Rainfall Measuring Mission (TRMM). Seven years (2002-2008) of Precipitation Radar (PR) and TRMM Microwave Imager (TMI) data are used and analyses are based

  4. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  5. Two bi-stability jumps in theoretical wind models for massive stars and the implications for luminous blue variable supernovae

    Science.gov (United States)

    Petrov, Blagovest; Vink, Jorick S.; Gräfener, Götz

    2016-05-01

    Luminous blue variables (LBVs) have been suggested to be the direct progenitors of supernova Types IIb and IIn, with enhanced mass loss prior to explosion. However, the mechanism of this mass loss is not yet known. Here, we investigate the qualitative behaviour of theoretical stellar wind mass loss as a function of Teff across two bi-stability jumps in blue supergiant regime and also in proximity to the Eddington limit, relevant for LBVs. To investigate the physical ingredients that play a role in the radiative acceleration we calculate blue supergiant wind models with the CMFGEN non-local thermodynamic equilibrium model atmosphere code over an effective temperature range between 30 000 and 8800 K. Although our aim is not to provide new mass-loss rates for BA supergiants, we study and confirm the existence of two bi-stability jumps in mass-loss rates predicted by Vink et al. However, they are found to occur at somewhat lower Teff (20 000 and 9000 K, respectively) than found previously, which would imply that stars may evolve towards lower Teff before strong mass loss is induced by the bi-stability jumps. When the combined effects of the second bi-stability jump and the proximity to Eddington limit are accounted for, we find a dramatic increase in the mass-loss rate by up to a factor of 30. Further investigation of both bi-stability jumps is expected to lead to a better understanding of discrepancies between empirical modelling and theoretical mass-loss rates reported in the literature, and to provide key inputs for the evolution of both normal AB supergiants and LBVs, as well as their subsequent supernova Type II explosions.

  6. Engineering aperiodic nanostructured surfaces for scattering-based optical devices

    Science.gov (United States)

    Lee, Yuk Kwan Sylvanus

    Novel optical devices such as biosensors, color displays and authentication devices can be obtained from the distinctive light scattering properties of resonant nanoparticles and nanostructured arrays. These arrays can be optimized through the choice of material, particle morphology and array geometry. In this thesis, by engineering the multi-frequency colorimetric responses of deterministic aperiodic nanostructured surfaces (DANS) with various spectral Fourier properties, I designed, fabricated and characterized scattering-based devices for optical biosensing and structural coloration applications. In particular, using analytical and numerical optimization, colorimetric biosensors are designed and fabricated with conventional electron beam lithography, and characterized using dark-field scattering imaging as well as image autocorrelation analysis of scattered intensity in the visible spectral range. These sensors, which consist of aperiodic surfaces ranging from quasi-periodic to pseudo-random structures with flat Fourier spectra, sustain highly complex structural resonances that enable a novel optical sensing approach beyond the traditional Bragg scattering. To this end, I have experimentally demonstrated that DANS with engineered structural colors are capable of detecting nanoscale protein monolayers with significantly enhanced sensitivity over periodic structures. In addition, different aperiodic arrays of gold (Au) nanoparticles are integrated with polydimethylsiloxane (PDMS) microfluidic structures by soft-lithographic micro-imprint techniques. Distinctive scattering spectral shifts and spatial modifications of structural color patterns in response to refractive index variations were simultaneously measured. The successful integration of DANS with microfluidics technology has introduced a novel opto-fluidic sensing platform for label-free and multiplexed lab-on-a-chip applications. Moreover, by studying the isotropic scattering properties of homogenized

  7. Simulation methods for multiperiodic and aperiodic nanostructured dielectric waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    2017-01-01

    on Rudin–Shapiro, Fibonacci, and Thue–Morse binary sequences. The near-field and far-field properties are computed employing the finite-element method (FEM), the finite-difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). The results show that all three methods......, a comparison of experimental results and simulation results obtained with three different simulation methods is presented. We fabricated and characterized multiperiodic nanostructured dielectric waveguides with two and three compound periods as well as deterministic aperiodic nanostructured waveguides based...

  8. Investigation of Aperiodic Time Processes with Autocorrelation and Fourier Analysis

    Science.gov (United States)

    Exner, Marie Luise

    1958-01-01

    Autocorrelation and frequency analyses of a series of aperiodic time events, in particular, filtered noises and sibilant sounds, were made. The position and band width of the frequency ranges are best obtained from the frequency analysis, but the energies contained in the several bands are most easily obtained from the autocorrelation function. The mean number of zero crossings of the time function was determined from the curvature of the latter function in the vicinity of the zero crossing, and also with the aid of a decimal counter. The second method was found to be more exact.

  9. Variability in the carbon storage of seagrass habitats and its implications for global estimates of blue carbon ecosystem service.

    Directory of Open Access Journals (Sweden)

    Paul S Lavery

    Full Text Available The recent focus on carbon trading has intensified interest in 'Blue Carbon'-carbon sequestered by coastal vegetated ecosystems, particularly seagrasses. Most information on seagrass carbon storage is derived from studies of a single species, Posidonia oceanica, from the Mediterranean Sea. We surveyed 17 Australian seagrass habitats to assess the variability in their sedimentary organic carbon (C org stocks. The habitats encompassed 10 species, in mono-specific or mixed meadows, depositional to exposed habitats and temperate to tropical habitats. There was an 18-fold difference in the Corg stock (1.09-20.14 mg C org cm(-3 for a temperate Posidonia sinuosa and a temperate, estuarine P. australis meadow, respectively. Integrated over the top 25 cm of sediment, this equated to an areal stock of 262-4833 g C org m(-2. For some species, there was an effect of water depth on the C org stocks, with greater stocks in deeper sites; no differences were found among sub-tidal and inter-tidal habitats. The estimated carbon storage in Australian seagrass ecosystems, taking into account inter-habitat variability, was 155 Mt. At a 2014-15 fixed carbon price of A$25.40 t(-1 and an estimated market price of $35 t(-1 in 2020, the C org stock in the top 25 cm of seagrass habitats has a potential value of $AUD 3.9-5.4 bill. The estimates of annual C org accumulation by Australian seagrasses ranged from 0.093 to 6.15 Mt, with a most probable estimate of 0.93 Mt y(-1 (10.1 t. km(-2 y(-1. These estimates, while large, were one-third of those that would be calculated if inter-habitat variability in carbon stocks were not taken into account. We conclude that there is an urgent need for more information on the variability in seagrass carbon stock and accumulation rates, and the factors driving this variability, in order to improve global estimates of seagrass Blue Carbon storage.

  10. BONA FIDE, STRONG-VARIABLE GALACTIC LUMINOUS BLUE VARIABLE STARS ARE FAST ROTATORS: DETECTION OF A HIGH ROTATIONAL VELOCITY IN HR CARINAE

    International Nuclear Information System (INIS)

    Groh, J. H.; Damineli, A.; Moises, A. P.; Teodoro, M.; Hillier, D. J.; Barba, R.; Fernandez-Lajus, E.; Gamen, R. C.; Solivella, G.

    2009-01-01

    We report optical observations of the luminous blue variable (LBV) HR Carinae which show that the star has reached a visual minimum phase in 2009. More importantly, we detected absorptions due to Si IV λλ4088-4116. To match their observed line profiles from 2009 May, a high rotational velocity of v rot ≅ 150 ± 20 km s -1 is needed (assuming an inclination angle of 30 deg.), implying that HR Car rotates at ≅0.88 ± 0.2 of its critical velocity for breakup (v crit ). Our results suggest that fast rotation is typical in all strong-variable, bona fide galactic LBVs, which present S-Dor-type variability. Strong-variable LBVs are located in a well-defined region of the HR diagram during visual minimum (the 'LBV minimum instability strip'). We suggest this region corresponds to where v crit is reached. To the left of this strip, a forbidden zone with v rot /v crit >1 is present, explaining why no LBVs are detected in this zone. Since dormant/ex LBVs like P Cygni and HD 168625 have low v rot , we propose that LBVs can be separated into two groups: fast-rotating, strong-variable stars showing S-Dor cycles (such as AG Car and HR Car) and slow-rotating stars with much less variability (such as P Cygni and HD 168625). We speculate that supernova (SN) progenitors which had S-Dor cycles before exploding (such as in SN 2001ig, SN 2003bg, and SN 2005gj) could have been fast rotators. We suggest that the potential difficulty of fast-rotating Galactic LBVs to lose angular momentum is additional evidence that such stars could explode during the LBV phase.

  11. Habitat suitability index model for brook trout in streams of the Southern Blue Ridge Province: surrogate variables, model evaluation, and suggested improvements

    Science.gov (United States)

    Christoper J. Schmitt; A. Dennis Lemly; Parley V. Winger

    1993-01-01

    Data from several sources were collated and analyzed by correlation, regression, and principal components analysis to define surrrogate variables for use in the brook trout (Salvelinus fontinalis) habitat suitability index (HSI) model, and to evaluate the applicability of the model for assessing habitat in high elevation streams of the southern Blue Ridge Province (...

  12. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  13. Luminous and variable stars in M31 and M33. II. Luminous blue variables, candidate LBVs, Fe II emission line stars, and other supergiants

    International Nuclear Information System (INIS)

    Humphreys, Roberta M.; Davidson, Kris; Weis, Kerstin; Bomans, D. J.; Burggraf, Birgitta

    2014-01-01

    An increasing number of non-terminal eruptions are being found in the numerous surveys for optical transients. Very little is known about these giant eruptions, their progenitors and their evolutionary state. A greatly improved census of the likely progenitor class, including the most luminous evolved stars, the luminous blue variables (LBVs), and the warm and cool hypergiants is now needed for a complete picture of the final pre-supernova stages of very massive stars. We have begun a survey of the evolved and unstable luminous star populations in several nearby resolved galaxies. In this second paper on M31 and M33, we review the spectral characteristics, spectral energy distributions, circumstellar ejecta, and evidence for mass loss for 82 luminous and variable stars. We show that many of these stars have warm circumstellar dust including several of the Fe II emission line stars, but conclude that the confirmed LBVs in M31 and M33 do not. The confirmed LBVs have relatively low wind speeds even in their hot, quiescent or visual minimum state compared to the B-type supergiants and Of/WN stars which they spectroscopically resemble. The nature of the Fe II emission line stars and their relation to the LBV state remains uncertain, but some have properties in common with the warm hypergiants and the sgB[e] stars. Several individual stars are discussed in detail. We identify three possible candidate LBVs and three additional post-red supergiant candidates. We suggest that M33-013406.63 (UIT301,B416) is not an LBV/S Dor variable, but is a very luminous late O-type supergiant and one of the most luminous stars or pair of stars in M33.

  14. Analyzing the variability of sediment yield: A case study from paired watersheds in the Upper Blue Nile basin, Ethiopia

    Science.gov (United States)

    Ebabu, Kindiye; Tsunekawa, Atsushi; Haregeweyn, Nigussie; Adgo, Enyew; Meshesha, Derege Tsegaye; Aklog, Dagnachew; Masunaga, Tsugiyuki; Tsubo, Mitsuru; Sultan, Dagnenet; Fenta, Ayele Almaw; Yibeltal, Mesenbet

    2018-02-01

    Improved knowledge of watershed-scale spatial and temporal variability of sediment yields (SY) is needed to design erosion control strategies, particularly in the most severely eroded areas. The present study was conducted to provide this knowledge for the humid tropical highlands of Ethiopia using the Akusity and Kasiry paired watersheds in the Guder portion of the Upper Blue Nile basin. Discharge and suspended sediment concentration data were monitored during the rainy season of 2014 and 2015 using automatic flow stage sensors, manual staff gauges and a depth-integrated sediment sampler. The SY was calculated using empirical discharge-sediment curves for different parts of each rainy season. The measured mean daily sediment concentration differed greatly between years and watersheds (0.51 g L- 1 in 2014 and 0.92 g L- 1 in 2015 for Kasiry, and 1.04 g L- 1 in 2014 and 2.20 g L- 1 in 2015 for Akusity). Sediment concentrations at both sites decreased as the rainy season progressed, regardless of the rainfall pattern, owing to depletion of the sediment supply and limited transport capacity of the flows caused by increased vegetation cover. Rainy season SYs for Kasiry were 7.6 t ha- 1 in 2014 and 27.2 t ha- 1 in 2015, while in Akusity SYs were 25.7 t ha- 1 in 2014 and 71.2 t ha- 1 in 2015. The much larger values in 2015 can be partly explained by increased rainfall and larger peak flow events. The magnitude and timing of peak flow events are major determinants of the amount and variability of SYs. Thus, site-specific assessment of such events is crucial to reveal SY dynamics of small watersheds in tropical highland environments.

  15. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Xie Yong E-mail: xie813@263.net; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-10-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells.

  16. A Meta-Analysis of Aperiodic Noise Stress on Human Performance

    National Research Council Canada - National Science Library

    Saxton, B. M; Ross, J. M; Braczyk, A; Conway, G. E; Szalma, J. L; Hancock, P. A

    2006-01-01

    Aperiodic noise, also known as intermittent noise, is a pervasive and influential source of stress across military environments, and can be defined by the changes in its intensity over a given period of time...

  17. Partitioning Evapotranspiration into Green and Blue Water Sources: Understanding Temporal Dynamics (2001-2015) and Spatial Variability in the Conterminous United States

    Science.gov (United States)

    Velpuri, N. M.; Senay, G. B.

    2017-12-01

    Information on how much of direct rain water (green water) and/or non-rain water (blue water) are being productively used by the crops/vegetation is critical for efficient water resources management. In this study, we developed a simple but robust methodology to partition actual evapotranspiration (ET) into green (rainfall-based) and blue (surface water/groundwater) sources. We combined two 1 km MODIS-based actual evapotranspiration datasets, one obtained from a root zone water balance model and another from an energy balance model, to partition annual ET into green water ET (GWET) and blue water ET (BWET). Time series maps of GWET and BWET were produced for the conterminous United States (CONUS) over 2001-2015 and spatial variability and dynamics of blue and green water ET were analyzed. Our results indicate that average green and blue water sources for all land cover types in CONUS account for nearly 70% and 30% of the total ET, respectively. The ET in the eastern US arises mostly from green water, and in the western US, it is mostly from blue water sources. Analysis of the BWET in the 16 selected irrigated areas in CONUS revealed interesting results. While the magnitude of the BWET showed a gradual decline from west to east, the increase in coefficient of variation from west to east confirmed greater use of supplemental irrigation in the central and eastern US. We also established relationships between hydro-climatic regions and their blue water requirements. This study provides insights into the relative contributions and the spatiotemporal dynamics of GWET and BWET, which could lead to improved water resources management.

  18. Bias driven coherent carrier dynamics in a two-dimensional aperiodic potential

    NARCIS (Netherlands)

    de Moura, F. A. B. F.; Viana, L. P.; Lyra, M. L.; Malyshev, Victor; Dominguez-Adame, F.

    2008-01-01

    We study the dynamics of an electron wave-packet in a two-dimensional square lattice with an aperiodic site potential in the presence of an external uniform electric field. The aperiodicity is described by epsilon(m) = V cos(pi alpha m(x)(nu x)) cos(pi alpha m(y)(nu y)) at lattice sites (m(x),m(y)),

  19. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  20. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  1. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure.

    Science.gov (United States)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-12-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air-cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one.

  2. Nature versus nurture: Luminous blue variable nebulae in and near massive stellar clusters at the galactic center

    International Nuclear Information System (INIS)

    Lau, R. M.; Herter, T. L.; Adams, J. D.; Morris, M. R.

    2014-01-01

    Three luminous blue variables (LBVs) are located in and near the Quintuplet Cluster at the Galactic center: the Pistol Star, G0.120-0.048, and qF362. We present imaging at 19, 25, 31, and 37 μm of the region containing these three LBVs, obtained with SOFIA using FORCAST. We argue that Pistol and G0.120-0.048 are identical 'twins' that exhibit contrasting nebulae due to the external influence of their different environments. Our images reveal the asymmetric, compressed shell of hot dust surrounding the Pistol Star and provide the first detection of the thermal emission from the symmetric, hot dust envelope surrounding G0.120-0.048. However, no detection of hot dust associated with qF362 is made. Dust and gas composing the Pistol nebula are primarily heated and ionized by the nearby Quintuplet Cluster stars. The northern region of the Pistol nebula is decelerated due to the interaction with the high-velocity (2000 km s –1 ) winds from adjacent Wolf-Rayet Carbon (WC) stars. From fits to the spectral energy distribution (SED) of the Pistol nebula with the DustEM code we determine that the Pistol nebula is composed of a distribution of very small, transiently heated grains (10 to ∼ 35 Å) having a total dust mass of 0.03 M ☉ , and that it exhibits a gradient of decreasing grain size from south to north due to differential sputtering by the winds from the WC stars. The total IR luminosity of the Pistol nebula is 5.2 × 10 5 L ☉ . Dust in the G0.120-0.048 nebula is primarily heated by the central star; however, the nebular gas is ionized externally by the Arches Cluster. Unlike the Pistol nebula, the G0.120-0.048 nebula is freely expanding into the surrounding medium. A grain size distribution identical to that of the non-sputtered region of the Pistol nebula satisfies the constraints placed on the G0.120-0.048 nebula from DustEM model fits to its SED and implies a total dust mass of 0.021 M ☉ . The total IR luminosity of the G0.120-0.048 nebula is

  3. Nature versus nurture: Luminous blue variable nebulae in and near massive stellar clusters at the galactic center

    Energy Technology Data Exchange (ETDEWEB)

    Lau, R. M.; Herter, T. L.; Adams, J. D. [Astronomy Department, 202 Space Sciences Building, Cornell University, Ithaca, NY 14853-6801 (United States); Morris, M. R. [Department of Physics and Astronomy, University of California, Los Angeles, 430 Portola Plaza, Los Angeles, CA 90095-1547 (United States)

    2014-04-20

    Three luminous blue variables (LBVs) are located in and near the Quintuplet Cluster at the Galactic center: the Pistol Star, G0.120-0.048, and qF362. We present imaging at 19, 25, 31, and 37 μm of the region containing these three LBVs, obtained with SOFIA using FORCAST. We argue that Pistol and G0.120-0.048 are identical 'twins' that exhibit contrasting nebulae due to the external influence of their different environments. Our images reveal the asymmetric, compressed shell of hot dust surrounding the Pistol Star and provide the first detection of the thermal emission from the symmetric, hot dust envelope surrounding G0.120-0.048. However, no detection of hot dust associated with qF362 is made. Dust and gas composing the Pistol nebula are primarily heated and ionized by the nearby Quintuplet Cluster stars. The northern region of the Pistol nebula is decelerated due to the interaction with the high-velocity (2000 km s{sup –1}) winds from adjacent Wolf-Rayet Carbon (WC) stars. From fits to the spectral energy distribution (SED) of the Pistol nebula with the DustEM code we determine that the Pistol nebula is composed of a distribution of very small, transiently heated grains (10 to ∼ 35 Å) having a total dust mass of 0.03 M {sub ☉}, and that it exhibits a gradient of decreasing grain size from south to north due to differential sputtering by the winds from the WC stars. The total IR luminosity of the Pistol nebula is 5.2 × 10{sup 5} L {sub ☉}. Dust in the G0.120-0.048 nebula is primarily heated by the central star; however, the nebular gas is ionized externally by the Arches Cluster. Unlike the Pistol nebula, the G0.120-0.048 nebula is freely expanding into the surrounding medium. A grain size distribution identical to that of the non-sputtered region of the Pistol nebula satisfies the constraints placed on the G0.120-0.048 nebula from DustEM model fits to its SED and implies a total dust mass of 0.021 M {sub ☉}. The total IR luminosity of the G

  4. Organizational justice is related to heart rate variability in white-collar workers, but not in blue-collar workers-findings from a cross-sectional study.

    Science.gov (United States)

    Herr, Raphael M; Bosch, Jos A; van Vianen, Annelies E M; Jarczok, Marc N; Thayer, Julian F; Li, Jian; Schmidt, Burkhard; Fischer, Joachim E; Loerbroks, Adrian

    2015-06-01

    Perceived injustice at work predicts coronary heart disease. Vagal dysregulation represents a potential psychobiological pathway. We examined associations between organizational justice and heart rate variability (HRV) indicators. Grounded in social exchange and psychological contract theory, we tested predictions that these associations are more pronounced among white-collar than among blue-collar workers. Cross-sectional data from 222 blue-collar and 179 white-collar men were used. Interactional and procedural justice were measured by questionnaire. Ambulatory HRV was assessed across 24 h. Standardized regression coefficients (β) were calculated. Among white-collar workers, interactional justice showed positive relationships with 24-h HRV, which were strongest during sleeping time (adjusted βs≥0.26; p values≤0.01). No associations were found for blue-collar workers. A comparable but attenuated pattern was observed for procedural justice. Both dimensions of organizational injustice were associated with lowered HRV among white-collar workers. The impact of justice and possibly its association with health seems to differ by occupational groups.

  5. Assessment of the impact of climate change on spatiotemporal variability of blue and green water resources under CMIP3 and CMIP5 models in a highly mountainous watershed

    Science.gov (United States)

    Fazeli Farsani, Iman; Farzaneh, M. R.; Besalatpour, A. A.; Salehi, M. H.; Faramarzi, M.

    2018-04-01

    The variability and uncertainty of water resources associated with climate change are critical issues in arid and semi-arid regions. In this study, we used the soil and water assessment tool (SWAT) to evaluate the impact of climate change on the spatial and temporal variability of water resources in the Bazoft watershed, Iran. The analysis was based on changes of blue water flow, green water flow, and green water storage for a future period (2010-2099) compared to a historical period (1992-2008). The r-factor, p-factor, R 2, and Nash-Sutcliff coefficients for discharge were 1.02, 0.89, 0.80, and 0.80 for the calibration period and 1.03, 0.76, 0.57, and 0.59 for the validation period, respectively. General circulation models (GCMs) under 18 emission scenarios from the IPCC's Fourth (AR4) and Fifth (AR5) Assessment Reports were fed into the SWAT model. At the sub-basin level, blue water tended to decrease, while green water flow tended to increase in the future scenario, and green water storage was predicted to continue its historical trend into the future. At the monthly time scale, the 95% prediction uncertainty bands (95PPUs) of blue and green water flows varied widely in the watershed. A large number (18) of climate change scenarios fell within the estimated uncertainty band of the historical period. The large differences among scenarios indicated high levels of uncertainty in the watershed. Our results reveal that the spatial patterns of water resource components and their uncertainties in the context of climate change are notably different between IPCC AR4 and AR5 in the Bazoft watershed. This study provides a strong basis for water supply-demand analyses, and the general analytical framework can be applied to other study areas with similar challenges.

  6. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  7. Asymptotic period of an aperiodic Markov chain and the strong ratio limit property

    NARCIS (Netherlands)

    van Doorn, Erik A.

    We introduce the concept of asymptotic period for an irreducible and aperiodic discrete-time Markov chain on a countable state space. If the chain is transient its asymptotic period may be larger than one. We present some sufficient conditions and, in the more restricted setting of birth-death

  8. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. UXOR Hunting among Algol Variables

    Science.gov (United States)

    Poxon, M.

    2015-06-01

    The class of variable typified by UX Orionis (UXORs or UXors) are young stars characterised by aperiodic or semiperiodic fades from maximum. This has led to several of the class being formerly catalogued as Algol-type eclipsing binaries (EAs), which can show superficially similar light variations. With this in view, I propose a campaign to search for more UX Ori type stars.

  11. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  12. Spatial and spectral detection of protein monolayers with deterministic aperiodic arrays of metal nanoparticles

    Science.gov (United States)

    Lee, Sylvanus Y.; Amsden, Jason J.; Boriskina, Svetlana V.; Gopinath, Ashwin; Mitropolous, Alexander; Kaplan, David L.; Omenetto, Fiorenzo G.; Negro, Luca Dal

    2010-01-01

    Light scattering phenomena in periodic systems have been investigated for decades in optics and photonics. Their classical description relies on Bragg scattering, which gives rise to constructive interference at specific wavelengths along well defined propagation directions, depending on illumination conditions, structural periodicity, and the refractive index of the surrounding medium. In this paper, by engineering multifrequency colorimetric responses in deterministic aperiodic arrays of nanoparticles, we demonstrate significantly enhanced sensitivity to the presence of a single protein monolayer. These structures, which can be readily fabricated by conventional Electron Beam Lithography, sustain highly complex structural resonances that enable a unique optical sensing approach beyond the traditional Bragg scattering with periodic structures. By combining conventional dark-field scattering micro-spectroscopy and simple image correlation analysis, we experimentally demonstrate that deterministic aperiodic surfaces with engineered structural color are capable of detecting, in the visible spectral range, protein layers with thickness of a few tens of Angstroms. PMID:20566892

  13. Aperiodicity in one-way Markov cycles and repeat times of large earthquakes in faults

    OpenAIRE

    Tejedor, Alejandro; Gómez, Javier; Pacheco, Amalio F.

    2011-01-01

    A common use of Markov Chains is the simulation of the seismic cycle in a fault, i.e. as a renewal model for the repetition of its characteristic earthquakes. This representation is consistent with Reid's elastic rebound theory. Here it is proved that in {\\it any} one-way Markov cycle, the aperiodicity of the corresponding distribution of cycle lengths is always lower than one. This fact concurs with observations of large earthquakes in faults all over the world.

  14. Blue lesions.

    Science.gov (United States)

    Longo, Caterina; Scope, Alon; Lallas, Aimilios; Zalaudek, Iris; Moscarella, Elvira; Gardini, Stefano; Argenziano, Giuseppe; Pellacani, Giovanni

    2013-10-01

    Blue color is found in a wide range of malignant and benign melanocytic and nonmelanocytic lesions and in lesions that result from penetration of exogenous materials, such as radiation or amalgam tattoo or traumatic penetration of particles. Discriminating between different diagnostic entities that display blue color relies on careful patient examination and lesion assessment. Dermoscopically, the extent, distribution, and patterns created by blue color can help diagnose lesions with specificity and differentiate between benign and malignant entities. This article provides an overview of the main diagnoses whereby blue color can be found, providing simple management rules for these lesions. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Kepler sheds new and unprecedented light on the variability of a blue supergiant: Gravity waves in the O9.5Iab star HD 188209

    Science.gov (United States)

    Aerts, C.; Símon-Díaz, S.; Bloemen, S.; Debosscher, J.; Pápics, P. I.; Bryson, S.; Still, M.; Moravveji, E.; Williamson, M. H.; Grundahl, F.; Fredslund Andersen, M.; Antoci, V.; Pallé, P. L.; Christensen-Dalsgaard, J.; Rogers, T. M.

    2017-06-01

    Stellar evolution models are most uncertain for evolved massive stars. Asteroseismology based on high-precision uninterrupted space photometry has become a new way to test the outcome of stellar evolution theory and was recently applied to a multitude of stars, but not yet to massive evolved supergiants.Our aim is to detect, analyse and interpret the photospheric and wind variability of the O9.5 Iab star HD 188209 from Kepler space photometry and long-term high-resolution spectroscopy. We used Kepler scattered-light photometry obtained by the nominal mission during 1460 d to deduce the photometric variability of this O-type supergiant. In addition, we assembled and analysed high-resolution high signal-to-noise spectroscopy taken with four spectrographs during some 1800 d to interpret the temporal spectroscopic variability of the star. The variability of this blue supergiant derived from the scattered-light space photometry is in full in agreement with the one found in the ground-based spectroscopy. We find significant low-frequency variability that is consistently detected in all spectral lines of HD 188209. The photospheric variability propagates into the wind, where it has similar frequencies but slightly higher amplitudes. The morphology of the frequency spectra derived from the long-term photometry and spectroscopy points towards a spectrum of travelling waves with frequency values in the range expected for an evolved O-type star. Convectively-driven internal gravity waves excited in the stellar interior offer the most plausible explanation of the detected variability. Based on photometric observations made with the NASA Kepler satellite and on spectroscopic observations made with four telescopes: the Nordic Optical Telescope operated by NOTSA and the Mercator Telescope operated by the Flemish Community, both at the Observatorio del Roque de los Muchachos (La Palma, Spain) of the Instituto de Astrofísica de Canarias, the T13 2.0 m Automatic Spectroscopic

  16. A Blue Lagoon Function

    DEFF Research Database (Denmark)

    Markvorsen, Steen

    2007-01-01

    We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$.......We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$....

  17. Homogenization procedures for the constitutive material modeling and analysis of aperiodic micro-structures

    Science.gov (United States)

    Aghalaya Manjunatha, Preetham

    Composite materials are the well-known substitutes for traditional metals in various industries because of their micro-structural character. Micro-structures provide a high strength-to-weight ratio, which makes them suitable for manufacturing large variety of applications ranging from simple toys to complicated space/aircraft structures. Since, these materials are widely used in high performance structures, their stress/thermal analysis issues are of major concern. Due to the high degree of material heterogeneity, it is extremely difficult to analyze such structures. Homogenization (rigorous averaging) is a process that overcomes the difficulty of modeling each micro-structure. It replaces an individual micro-structure by an equivalent material model representation (unit cell). Periodic micro-structures appear in regular intervals throughout the domain, in contrast aperiodic micro-structures follows an irregular pattern. Further, this method bridges the analysis gap between micro and macro domain of the structures. In this thesis, Homogenization procedure based on anti-periodic displacement fields for aperiodic micro-structures and aperiodic boundary conditions are considered to model the constitutive material matrix. This work could be easily implemented with the traditional finite element packages. In addition, it eventually increases the convergence accuracy and reduces the high computational expenses. Different problems are analyzed by the implementation of digital image processing schemes for the extraction of a unit cell around the Gauss quadrature points and the mesh-generation. In the future, this research defines a new path for the analysis of any random heterogeneous materials by its ease of implementation and the state-of-the-art micro-structure material modeling capabilities and digital image based micro-meshing.

  18. Rapidly tunable optical parametric oscillator based on aperiodic quasi-phase matching.

    Science.gov (United States)

    Descloux, Delphine; Dherbecourt, Jean-Baptiste; Melkonian, Jean-Michel; Raybaut, Myriam; Lai, Jui-Yu; Drag, Cyril; Godard, Antoine

    2016-05-16

    A new optical parametric oscillator (OPO) architecture with high tuning speed capability is demonstrated. This device exploits the versatility offered by aperiodic quasi-phase matching (QPM) to provide a broad parametric gain spectrum without changing the temperature, angle, or position of the nonlinear crystal. Rapid tuning is then straightforwardly achieved using a fast intracavity spectral filter. This concept is demonstrated here for a picosecond synchronously pumped OPO containing an aperiodically poled MgO-doped LiNbO3 crystal and a rapidly tunable spectral filter based on a diffraction grating. Tuning over 160 nm around 3.86 μm is achieved at fixed temperature and a fast tuning over 30 nm in 40 μs is demonstrated. Different configurations are tested and compared. The cavity length detuning is analyzed and discussed. This device is successfully used to detect N2O by absorption. This approach could be generalized to other spectral ranges (e.g., visible) and temporal regimes (e.g., continuous-wave or nanosecond).

  19. Blue gods, blue oil, and blue people.

    Science.gov (United States)

    Fairbanks, V F

    1994-09-01

    Studies of the composition of coal tar, which began in Prussia in 1834, profoundly affected the economies of Germany, Great Britain, India, and the rest of the world, as well as medicine and surgery. Such effects include the collapse of the profits of the British indigo monopoly, the growth in economic power of Germany based on coal tar chemistry, and an economic crisis in India that led to more humane tax laws and, ultimately, the independence of India and the end of the British Empire. Additional consequences were the development of antiseptic surgery and the synthesis of a wide variety of useful drugs that have eradicated infections and alleviated pain. Many of these drugs, particularly the commonly used analgesics, sulfonamides, sulfones, and local anesthetics, are derivatives of aniline, originally called "blue oil" or "kyanol." Some of these aniline derivatives, however, have also caused aplastic anemia, agranulocytosis, and methemoglobinemia (that is, "blue people"). Exposure to aniline drugs, particularly when two or three aniline drugs are taken concurrently, seems to be the commonest cause of methemoglobinemia today.

  20. Luminous and Variable Stars in M31 and M33. IV. Luminous Blue Variables, Candidate LBVs, B[e] Supergiants, and the Warm Hypergiants: How to Tell Them Apart

    Energy Technology Data Exchange (ETDEWEB)

    Humphreys, Roberta M.; Gordon, Michael S.; Hahn, David [Minnesota Institute for Astrophysics, 116 Church Street SE, University of Minnesota, Minneapolis, MN 55455 (United States); Martin, John C. [University of Illinois Springfield, Springfield, IL 62703 (United States); Weis, Kerstin, E-mail: roberta@umn.edu [Astronomical Institute, Ruhr-Universitaet Bochum (Germany)

    2017-02-10

    In this series of papers we have presented the results of a spectroscopic survey of luminous stars in the nearby spirals M31 and M33. Here, we present spectroscopy of 132 additional stars. Most have emission-line spectra, including luminous blue variables (LBVs) and candidate LBVs, Fe ii emission line stars, the B[e] supergiants, and the warm hypergiants. Many of these objects are spectroscopically similar and are often confused with each other. We examine their similarities and differences and propose the following guidelines that can be used to help distinguish these stars in future work. (1) The B[e] supergiants have emission lines of [O i] and [Fe ii] in their spectra. Most of the spectroscopically confirmed sgB[e] stars also have warm circumstellar dust in their spectral energy distributions (SEDs). (2) Confirmed LBVs do not have the [O i] emission lines in their spectra. Some LBVs have [Fe ii] emission lines, but not all. Their SEDs show free–free emission in the near-infrared but no evidence for warm dust . Their most important and defining characteristic is the S Dor-type variability. (3) The warm hypergiants spectroscopically resemble the LBVs in their dense wind state and the B[e] supergiants. However, they are very dusty. Some have [Fe ii] and [O i] emission in their spectra like the sgB[e] stars, but are distinguished by their A- and F-type absorption-line spectra. In contrast, the B[e] supergiant spectra have strong continua and few if any apparent absorption lines. Candidate LBVs should share the spectral characteristics of the confirmed LBVs with low outflow velocities and the lack of warm circumstellar dust.

  1. Luminous and Variable Stars in M31 and M33. IV. Luminous Blue Variables, Candidate LBVs, B[e] Supergiants, and the Warm Hypergiants: How to Tell Them Apart

    International Nuclear Information System (INIS)

    Humphreys, Roberta M.; Gordon, Michael S.; Hahn, David; Martin, John C.; Weis, Kerstin

    2017-01-01

    In this series of papers we have presented the results of a spectroscopic survey of luminous stars in the nearby spirals M31 and M33. Here, we present spectroscopy of 132 additional stars. Most have emission-line spectra, including luminous blue variables (LBVs) and candidate LBVs, Fe ii emission line stars, the B[e] supergiants, and the warm hypergiants. Many of these objects are spectroscopically similar and are often confused with each other. We examine their similarities and differences and propose the following guidelines that can be used to help distinguish these stars in future work. (1) The B[e] supergiants have emission lines of [O i] and [Fe ii] in their spectra. Most of the spectroscopically confirmed sgB[e] stars also have warm circumstellar dust in their spectral energy distributions (SEDs). (2) Confirmed LBVs do not have the [O i] emission lines in their spectra. Some LBVs have [Fe ii] emission lines, but not all. Their SEDs show free–free emission in the near-infrared but no evidence for warm dust . Their most important and defining characteristic is the S Dor-type variability. (3) The warm hypergiants spectroscopically resemble the LBVs in their dense wind state and the B[e] supergiants. However, they are very dusty. Some have [Fe ii] and [O i] emission in their spectra like the sgB[e] stars, but are distinguished by their A- and F-type absorption-line spectra. In contrast, the B[e] supergiant spectra have strong continua and few if any apparent absorption lines. Candidate LBVs should share the spectral characteristics of the confirmed LBVs with low outflow velocities and the lack of warm circumstellar dust.

  2. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  3. Swinging multi-source industrial CT systems for aperiodic dynamic imaging.

    Science.gov (United States)

    Wu, Weiwen; Yu, Hengyong; Gong, Changcheng; Liu, Fenglin

    2017-10-02

    The goal of this paper is to develop a new architecture for industrial computed tomography (ICT) aiming at dynamically imaging an aperiodic changing object. We propose a data acquisition approach with multiple x-ray source/detector pairs targeting a continuously changeable object with corresponding timeframes. In this named swinging multi-source CT (SMCT) structure, each source and its associated detector swing forth and back within a certain angle for CT scanning. In the SMCT system design, we utilize a circular journal bearing based setup to replace the normal CT slip ring by weakening the scanning speed requirement. Inspired by the prior image constrained compressed sensing (PICCS) algorithm, we apply a modified PICCS algorithm for the SMCT (SM-PICCS). Our numerical simulation and realistic specimen experiment studies demonstrate the feasibility of the proposed approach.

  4. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  5. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  6. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  7. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...... on the IEEE 14-bus and the Nordic32 test systems where results show that the method can efficiently determine the required active power redispatch to avoid an imminent instability....

  8. Velocity Fluctuations Driven by the Damped, Aperiodic Mode in the Intergalactic Medium

    Science.gov (United States)

    Kolberg, U.; Schlickeiser, R.; Yoon, P. H.

    2017-08-01

    On account of its finite temperature, the unmagnetized intergalactic medium (IGM) is subject to thermal fluctuations. Due to the fundamental coupling between particles and fields in a plasma, the field fluctuations generate current densities by means of the Lorentz force and thereby affect both the density and the velocity fluctuations of the particles. Recently, a new damped, aperiodic mode was discovered that dominates field fluctuations in the IGM. Apart from its impact on the transport properties of the IGM that determine the propagation of cosmic rays, previous research has shown that this mode provides turbulent magnetic seed fields of 6× {10}-18 {{G}} that are an essential ingredient in the generation of cosmic magnetic fields. The current investigation addresses the influence of the mode on the particle motion. In order to describe the corresponding state of the turbulence, both the spectrum and the integrated total value of the mode-driven proton velocity fluctuations are computed. It is found that the latter amounts to 1.16× {10}8{ T}47/2{n}-7-1/2 {cm} {{{s}}}-1 assuming a temperature of {T}e={T}p={10}4{T}4 {{K}} and a density of {n}e={n}p={10}-7{n}-7 {{cm}}-3. This value is two orders of magnitude larger than the thermal velocity. If the IGM neutrals adopt the same velocities as the protons by mutual charge exchange and elastic collisions (ambipolar diffusion), atomic lines propagating through the IGM are expected to display spectral broadening, enhanced by a factor of 90 beyond the thermal level in the case of hydrogen. This opens the window to a first direct observation of the damped aperiodic mode. Other observational techniques such as dispersion measure, rotation measure, and scintillation data are not applicable in this case because the mode is a transverse one, and, as such, it does not induce the required density fluctuations, as is shown here.

  9. Posthuman blues

    CERN Document Server

    Tonnies, Mac

    2013-01-01

    Posthuman Blues, Vol. I is first volume of the edited version of the popular weblog maintained by author Mac Tonnies from 2003 until his tragic death in 2009. Tonnies' blog was a pastiche of his original fiction, reflections on his day-to-day life, trenchant observations of current events, and thoughts on an eclectic range of material he culled from the Internet. What resulted was a remarkably broad portrait of a thoughtful man and the complex times in which he lived, rendered with intellige...

  10. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  11. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  12. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  13. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  14. Aperiodic and randomized dielectric mirrors: alternatives to metallic back reflectors for solar cells.

    Science.gov (United States)

    Lin, Albert; Zhong, Yan-Kai; Fu, Sze-Ming; Tseng, Chi Wei; Yan, Sheng Lun

    2014-05-05

    Dielectric mirrors have recently emerged for solar cells due to the advantages of lower cost, lower temperature processing, higher throughput, and zero plasmonic absorption as compared to conventional metallic counterparts. Nonetheless, in the past, efforts for incorporating dielectric mirrors into photovoltaics were not successful due to limited bandwidth and insufficient light scattering that prevented their wide usage. In this work, it is shown that the key for ultra-broadband dielectric mirrors is aperiodicity, or randomization. In addition, it has been proven that dielectric mirrors can be widely applicable to thin-film and thick wafer-based solar cells to provide for light trapping comparable to conventional metallic back reflectors at their respective optimal geometries. Finally, the near-field angular emission plot of Poynting vectors is conducted, and it further confirms the superior light-scattering property of dielectric mirrors, especially for diffuse medium reflectors, despite the absence of surface plasmon excitation. The preliminary experimental results also confirm the high feasibility of dielectric mirrors for photovoltaics.

  15. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  16. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  17. Rainfall variability and estimation for hydrologic modeling : a remote sensing based study at the source basin of the Upper Blue Nile river

    NARCIS (Netherlands)

    Haile, A.T.

    2010-01-01

    Rainfall is one of the meteorological forcing terms in hydrologic modelling and therefore its spatial variability in coverage, frequency and intensity affects simulation results. Rainfall variability in particular under the effect of orography adjacent to a large water body is not fully explored.

  18. Organizational justice is related to heart rate variability in white-collar workers, but not in blue-collar workers - findings from a cross-sectional study

    NARCIS (Netherlands)

    Herr, R.M.; Bosch, J.A.; van Vianen, A.E.M.; Jarczok, M.N.; Thayer, J.F.; Li, J.; Schmidt, B.; Fischer, J.E.; Loerbroks, A.

    2015-01-01

    Background: Perceived injustice at work predicts coronary heart disease. Vagal dysregulation represents a potential psychobiological pathway. Purpose: We examined associations between organizational justice and heart rate variability (HRV) indicators. Grounded in social exchange and psychological

  19. [Anaphylaxis to blue dyes].

    Science.gov (United States)

    Langner-Viviani, F; Chappuis, S; Bergmann, M M; Ribi, C

    2014-04-16

    In medicine, vital blue dyes are mainly used for the evaluation of sentinel lymph nodes in oncologic surgery. Perioperative anaphylaxis to blue dyes is a rare but significant complication. Allergic reactions to blue dyes are supposedly IgE-mediated and mainly caused by triarylmethanes (patent blue and isosulfane blue) and less frequently by methylene blue. These substances usually do not feature on the anesthesia record and should not be omitted from the list of suspects having caused the perioperative reaction, in the same manner as latex and chlorhexidine. The diagnosis of hypersensitivity to vital blue dyes can be established by skin test. We illustrate this topic with three clinical cases.

  20. Retirement blues.

    Science.gov (United States)

    Heller-Sahlgren, Gabriel

    2017-07-01

    This paper analyses the short- and longer-term effects of retirement on mental health in ten European countries. It exploits thresholds created by state pension ages in an individual-fixed effects instrumental-variable set-up, borrowing intuitions from the regression-discontinuity design literature, to deal with endogeneity in retirement behaviour. The results display no short-term effects of retirement on mental health, but a large negative longer-term impact. This impact survives a battery of robustness tests, and applies to women and men as well as people of different educational and occupational backgrounds similarly. Overall, the findings suggest that reforms inducing people to postpone retirement are not only important for making pension systems solvent, but with time could also pay a mental health dividend among the elderly and reduce public health care costs. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Blue cures blue but be cautious

    Directory of Open Access Journals (Sweden)

    Pranav Sikka

    2011-01-01

    Full Text Available Methemoglobinemia is a disorder characterized by the presence of >1% methemoglobin (metHb in the blood. Spontaneous formation of methemoglobin is normally counteracted by protective enzyme systems, for example, nicotinamide adenine dinucleotide phosphate (NADPH methemoglobin reductase. Methemoglobinemia is treated with supplemental oxygen and methylene blue (1-2 mg/kg administered slow intravenously, which acts by providing an artificial electron acceptor for NADPH methemoglobin reductase. But known or suspected glucose-6-phosphate dehydrogenase (G6PD deficiency is a relative contraindication to the use of methylene blue because G6PD is the key enzyme in the formation of NADPH through pentose phosphate pathway and G6PD-deficient individuals generate insufficient NADPH to efficiently reduce methylene blue to leukomethylene blue, which is necessary for the activation of the NADPH-dependent methemoglobin reductase system. So, we should be careful using methylene blue in methemoglobinemia patient before G6PD levels.

  2. Blue-Green Algae

    Science.gov (United States)

    ... people with hepatitis C or hepatitis B. HIV/AIDS. Research on the effects of blue-green algae in people with HIV/AIDS has been inconsistent. Some early research shows that taking 5 grams of blue-green ...

  3. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  4. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  5. Blue Ocean Thinking

    Science.gov (United States)

    Orem, Donna

    2016-01-01

    This article describes a concept called the "blue ocean thinking strategy," developed by W. Chan Kim and Renée Mauborgne, professors at INSEAD, an international graduate school of business in France. The "blue ocean" thinking strategy considers opportunities to create new markets for services, rather than focusing solely on…

  6. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor

    Energy Technology Data Exchange (ETDEWEB)

    Gentili, Pier Luigi, E-mail: pierluigi.gentili@unipg.it [Department of Chemistry, Biology and Biotechnology, University of Perugia, 06123 Perugia (Italy); Gotoda, Hiroshi [Department of Mechanical Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu-shi, Shiga 525-8577 (Japan); Dolnik, Milos; Epstein, Irving R. [Department of Chemistry, Brandeis University, Waltham, Massachusetts 02454-9110 (United States)

    2015-01-15

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  7. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor.

    Science.gov (United States)

    Gentili, Pier Luigi; Gotoda, Hiroshi; Dolnik, Milos; Epstein, Irving R

    2015-01-01

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  8. ON THE NATURE OF THE PROTOTYPE LUMINOUS BLUE VARIABLE AG CARINAE. I. FUNDAMENTAL PARAMETERS DURING VISUAL MINIMUM PHASES AND CHANGES IN THE BOLOMETRIC LUMINOSITY DURING THE S-Dor CYCLE

    International Nuclear Information System (INIS)

    Groh, J. H.; Damineli, A.; Hillier, D. J.; Whitelock, P. A.; Marang, F.; Rossi, C.

    2009-01-01

    We present a detailed spectroscopic analysis of the luminous blue variable (LBV) AG Carinae (AG Car) during the last two visual minimum phases of its S-Dor cycle (1985-1990 and 2000-2003). The analysis reveals an overabundance of He, N, and Na, and a depletion of H, C, and O, on the surface of the AG Car, indicating the presence of a CNO-processed material. Furthermore, the ratio N/O is higher on the stellar surface than in the nebula. We found that the minimum phases of AG Car are not equal to each other, since we derived a noticeable difference between the maximum effective temperature achieved during 1985-1990 (22, 800 K) and 2000-2001 (17,000 K). Significant differences between the wind parameters in these two epochs were also noticed. While the wind terminal velocity was 300 km s -1 in 1985-1990, it was as low as 105 km s -1 in 2001. The mass-loss rate, however, was lower from 1985-1990 (1.5 x 10 -5 M sun yr -1 ) than from 2000-2001 (3.7 x 10 -5 M sun yr -1 ). We found that the wind of AG Car is significantly clumped (f ≅ 0.10-0.25) and that clumps must be formed deep in the wind. We derived a bolometric luminosity of 1.5 x 10 6 L sun during both minimum phases which, contrary to the common assumption, decreases to 1.0 x 10 6 L sun as the star moves toward the maximum flux in the V band. Assuming that the decrease in the bolometric luminosity of AG Car is due to the energy used to expand the outer layers of the star, we found that the expanding layers contain roughly 0.6-2 M sun . Such an amount of mass is an order of magnitude lower than the nebular mass around AG Car, but is comparable to the nebular mass found around lower-luminosity LBVs and to that of the Little Homunculus of Eta Car. If such a large amount of mass is indeed involved in the S Dor-type variability, we speculate that such instability could be a failed Giant Eruption, with several solar masses never becoming unbound from the star.

  9. Blue ocean strategy.

    Science.gov (United States)

    Kim, W Chan; Mauborgne, Renée

    2004-10-01

    Despite a long-term decline in the circus industry, Cirque du Soleil profitably increased revenue 22-fold over the last ten years by reinventing the circus. Rather than competing within the confines of the existing industry or trying to steal customers from rivals, Cirque developed uncontested market space that made the competition irrelevant. Cirque created what the authors call a blue ocean, a previously unknown market space. In blue oceans, demand is created rather than fought over. There is ample opportunity for growth that is both profitable and rapid. In red oceans--that is, in all the industries already existing--companies compete by grabbing for a greater share of limited demand. As the market space gets more crowded, prospects for profits and growth decline. Products turn into commodities, and increasing competition turns the water bloody. There are two ways to create blue oceans. One is to launch completely new industries, as eBay did with online auctions. But it's much more common for a blue ocean to be created from within a red ocean when a company expands the boundaries of an existing industry. In studying more than 150 blue ocean creations in over 30 industries, the authors observed that the traditional units of strategic analysis--company and industry--are of limited use in explaining how and why blue oceans are created. The most appropriate unit of analysis is the strategic move, the set of managerial actions and decisions involved in making a major market-creating business offering. Creating blue oceans builds brands. So powerful is blue ocean strategy, in fact, that a blue ocean strategic move can create brand equity that lasts for decades.

  10. Thermodynamically stable blue phases.

    Science.gov (United States)

    Castles, F; Morris, S M; Terentjev, E M; Coles, H J

    2010-04-16

    We show theoretically that flexoelectricity stabilizes blue phases in chiral liquid crystals. Induced internal polarization reduces the elastic energy cost of splay and bend deformations surrounding singular lines in the director field. The energy of regions of double twist is unchanged. This in turn reduces the free energy of the blue phase with respect to that of the chiral nematic phase, leading to stability over a wider temperature range. The theory explains the discovery of large temperature range blue phases in highly flexoelectric "bimesogenic" and "bent-core" materials, and predicts how this range may be increased further.

  11. Blue Ribbon Panel Report

    Science.gov (United States)

    An NCI Cancer Currents blog by the NCI acting director thanking the cancer community for contributing to the Cancer Moonshot Blue Ribbon Panel report, which was presented to the National Cancer Advisory Board on September 7.

  12. New York Blue

    Data.gov (United States)

    Federal Laboratory Consortium — New York Blue is used cooperatively by the Laboratory and Stony Brook University as part of the New York Center for Computation Sciences. Ranked as the 28th fastest...

  13. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  14. The Blue Compact Dwarf Galaxy IZw18

    NARCIS (Netherlands)

    Musella, I.; Marconi, M.; Fiorentino, G.; Clementini, G.; Aloisi, A.; Annibali, F.; Contreras, R.; Saha, A.; Tosi, M.; van der Marel, R. P.

    2012-01-01

    We present the results obtained for the Blue compact galaxy IZw18 on the basis of ACS HST data obtained from our group. In particular, we discuss the stellar population and the variable stars content of this galaxy to get information about its star formation history and distance.

  15. Statistical thermodynamics of supercapacitors and blue engines

    NARCIS (Netherlands)

    van Roij, R.H.H.G.

    2013-01-01

    We study the thermodynamics of electrode-electrolyte systems, for instance supercapacitors filled with an ionic liquid or blue-energy devices filled with river- or sea water. By a suitable mapping of thermodynamic variables, we identify a strong analogy with classical heat engines. We introduce

  16. Natural Blue Food Colour

    DEFF Research Database (Denmark)

    Roda-Serrat, Maria Cinta

    In recent years, there has been a growing tendency to avoid the use of artificial colorants and additives in food products, especially after some studies linked their consumption with behavioural changes in children. However, the incorporation of colorants from natural origin remains a challenge...... for food technologists, as these are typically less vivid and less stable than their synthetic alternatives. Regarding blue colorants, phycocyanins from cyanobacteria are currently in the spotlight as promising new natural blue colorants. Phycocyanins are proteins which blue colour results from...... the presence of the chromophore phycocyanobilin (PCB), a covalently attached linear tetrapyrrole. The applications of phycocyanins as food colorants are however limited, as they show poor stability in certain conditions of pH, light and temperature. Cleavage of PCB from the protein followed by careful product...

  17. The "Blue Banana" Revisited

    NARCIS (Netherlands)

    Faludi, A.K.F.

    2015-01-01

    This essay is about the “Blue Banana”. Banana is the name given subsequently by others to a Dorsale européenne (European backbone) identified empirically by Roger Brunet. In a background study to the Communication of the European Commission ‘Europe 2000’, Klaus Kunzmann and Michael Wegener put

  18. The Blue Baby Syndrome

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 8; Issue 10. The Blue Baby Syndrome - Nitrate Poisoning in Humans. Deepanjan Majumdar. General Article Volume 8 Issue 10 October 2003 pp 20-30. Fulltext. Click here to view fulltext PDF. Permanent link:

  19. [Blue light and eye health].

    Science.gov (United States)

    Zou, Leilei; Dai, Jinhui

    2015-01-01

    Blue light, with the wavelength between 400 nm and 500 nm, has caused public concern because of the injury to the retinal cells. Meanwhile, it is important in circadian rhythm regulation, scotopic vision and ocular growth. Is the blue light safe? Should it be eliminated from the daily life? Here we review the effect and safety of the blue light.

  20. Functional continuity: did field-induced oriented aperiodic constraints at Life's origin aid its sequence-based evolution?

    Science.gov (United States)

    Mitra-Delmotte, G.; Mitra, A. N.

    2014-04-01

    A non-biological analog undergoing Darwinian-like evolution could have enhanced the probability of many crucial independent bottom-up emergent steps, engendered within its premises, and smoothen the inanimate-animate transition. Now, the higher-level environment-mutable DNA sequences influence the lower-level pattern of oriented templates (enzymes, lipid membranes, RNA) in the organized cell matrix and hence their associated substrate-dynamics; note how templates are akin to local fields, kinetically constraining reactant orientations. Since the lowerlevel is likely the more primitive of the two (rather than Cairns-Smith's "readily available" rigid clay crystal sequence-based replicators as a memory-like basis for slowly mutating predecessor-patterns enroute to complex RNA-based Darwinian evolution), a gradual thermodynamic-to-kinetic transition in an isotropic medium, is proposed as driven by some order-parameter --via "available" field-responsive dipolar colloid networks, as apart from bio-organics, mineral colloids also can display liquid crystal (LC) phases (see [1]). An access to solid-like orientational order in a fluid matrix suggests how aperiodic patterns can be influenced and sustained (a la homeostasis) via external inhomogeneous fields (e.g. magnetic rocks); this renders these cooperative networks with potential as confining host-media, whose environment-sensitivity can not only influence their sterically-coupled guest-substrates but also their network properties (the latter can enable 'functions' like spontaneous transport under non-equilibrium suggesting a natural basis for their selection by the environment). In turn LC systems could have been preceded by even simpler anisotropic fluid hosts, viz., external field-induced mineral magnetic nanoparticle (MNP) aggregates. Indeed, the capacity of an MNP to couple its magnetic and rotational d.o.f.s suggests how an environment-sensitive field-influenced network of interacting dipolar colloids close to

  1. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  2. Anomalous Cepheids and population II blue stragglers

    Science.gov (United States)

    Nemec, James M.

    Recent studies of anomalous Cepheids (ACs) and population II blue stragglers (BSs), including photometrically variable BSs (VBSs), are reviewed. The VBSs represent about 25 percent of the BSs, the majority of which are SX Phe short-period variables in the Cepheid instability strip. Mass estimates derived using various techniques suggest that both ACs and BSs are relatively massive (about 1.0-1.6 solar mass). The recent discovery that two BSs in the globular cluster NGC 5466 are contact binaries, and the earlier discovery that one of the BSs in Omega Cen is an eclipsing binary, provide direct evidence that at least some BSs are binary systems.

  3. Blue ocean leadership.

    Science.gov (United States)

    Kim, W Chan; Mauborgne, Renée

    2014-05-01

    Ten years ago, two INSEAD professors broke ground by introducing "blue ocean strategy," a new model for discovering uncontested markets that are ripe for growth. In this article, they apply their concepts and tools to what is perhaps the greatest challenge of leadership: closing the gulf between the potential and the realized talent and energy of employees. Research indicates that this gulf is vast: According to Gallup, 70% of workers are disengaged from their jobs. If companies could find a way to convert them into engaged employees, the results could be transformative. The trouble is, managers lack a clear understanding of what changes they could make to bring out the best in everyone. Here, Kim and Mauborgne offer a solution to that problem: a systematic approach to uncovering, at each level of the organization, which leadership acts and activities will inspire employees to give their all, and a process for getting managers throughout the company to start doing them. Blue ocean leadership works because the managers' "customers"-that is, the people managers oversee and report to-are involved in identifying what's effective and what isn't. Moreover, the approach doesn't require leaders to alter who they are, just to undertake a different set of tasks. And that kind of change is much easier to implement and track than changes to values and mind-sets.

  4. Tunable photonic crystals with partial bandgaps from blue phase colloidal crystals and dielectric-doped blue phases.

    Science.gov (United States)

    Stimulak, Mitja; Ravnik, Miha

    2014-09-07

    Blue phase colloidal crystals and dielectric nanoparticle/polymer doped blue phases are demonstrated to combine multiple components with different symmetries in one photonic material, creating a photonic crystal with variable and micro-controllable photonic band structure. In this composite photonic material, one contribution to the band structure is determined by the 3D periodic birefringent orientational profile of the blue phases, whereas the second contribution emerges from the regular array of the colloidal particles or from the dielectric/nanoparticle-doped defect network. Using the planewave expansion method, optical photonic bands of the blue phase I and II colloidal crystals and related nanoparticle/polymer doped blue phases are calculated, and then compared to blue phases with no particles and to face-centred-cubic and body-centred-cubic colloidal crystals in isotropic background. We find opening of local band gaps at particular points of Brillouin zone for blue phase colloidal crystals, where there were none in blue phases without particles or dopants. Particle size and filling fraction of the blue phase defect network are demonstrated as parameters that can directly tune the optical bands and local band gaps. In the blue phase I colloidal crystal with an additionally doped defect network, interestingly, we find an indirect total band gap (with the exception of one point) at the entire edge of SC irreducible zone. Finally, this work demonstrates the role of combining multiple - by symmetry - differently organised components in one photonic crystal material, which offers a novel approach towards tunable soft matter photonic materials.

  5. Variable Stars Observed in the Galactic Disk by AST3-1 from Dome A, Antarctica

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lingzhi; Ma, Bin; Hu, Yi; Liu, Qiang; Shang, Zhaohui [Key Laboratory of Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China); Li, Gang; Fu, Jianning [Department of Astronomy, Beijing Normal University, Beijing, 100875 (China); Wang, Lifan; Cui, Xiangqun; Du, Fujia; Gong, Xuefei; Li, Xiaoyan; Li, Zhengyang; Yuan, Xiangyan; Zhou, Jilin [Chinese Center for Antarctic Astronomy, Nanjing 210008 (China); Ashley, Michael C. B. [School of Physics, University of New South Wales, NSW 2052 (Australia); Pennypacker, Carl R. [Center for Astrophysics, Lawrence Berkeley National Laboratory, Berkeley, CA (United States); York, Donald G., E-mail: wanglingzhi@bao.ac.cn [Department of Astronomy and Astrophysics and Enrico Fermi Institute, University of Chicago, Chicago, IL 60637 (United States)

    2017-03-01

    AST3-1 is the second-generation wide-field optical photometric telescope dedicated to time-domain astronomy at Dome A, Antarctica. Here, we present the results of an i -band images survey from AST3-1 toward one Galactic disk field. Based on time-series photometry of 92,583 stars, 560 variable stars were detected with i magnitude ≤16.5 mag during eight days of observations; 339 of these are previously unknown variables. We tentatively classify the 560 variables as 285 eclipsing binaries (EW, EB, and EA), 27 pulsating variable stars ( δ Scuti, γ Doradus, δ Cephei variable, and RR Lyrae stars), and 248 other types of variables (unclassified periodic, multiperiodic, and aperiodic variable stars). Of the eclipsing binaries, 34 show O’Connell effects. One of the aperiodic variables shows a plateau light curve and another variable shows a secondary maximum after peak brightness. We also detected a complex binary system with an RS CVn-like light-curve morphology; this object is being followed-up spectroscopically using the Gemini South telescope.

  6. Instant BlueStacks

    CERN Document Server

    Judge, Gary

    2013-01-01

    Get to grips with a new technology, understand what it is and what it can do for you, and then get to work with the most important features and tasks. A fast-paced, example-based approach guide for learning BlueStacks.This book is for anyone with a Mac or PC who wants to run Android apps on their computer. Whether you want to play games that are freely available for Android but not your computer, or you want to try apps before you install them on a physical device or use it as a development tool, this book will show you how. No previous experience is needed as this is written in plain English

  7. Blue phases as photonic crystals

    Science.gov (United States)

    Bohley, Christian; Scharf, Toralf

    2003-12-01

    The Liquid Crystalline Blue Phases (LC BPs) and their diffraction patterns were investigated experimentally and theoretically. We stabilized Blue Phases and measured their diffraction pattern for different wavelengths of monochromatic light with the help of a conoscopic setup of a polarization microscope. Moreover, the diffraction patterns were calculated with the help of a 4x4 matrix method which allows amplitude and phase investigations.

  8. Blue moons and Martian sunsets.

    Science.gov (United States)

    Ehlers, Kurt; Chakrabarty, Rajan; Moosmüller, Hans

    2014-03-20

    The familiar yellow or orange disks of the moon and sun, especially when they are low in the sky, and brilliant red sunsets are a result of the selective extinction (scattering plus absorption) of blue light by atmospheric gas molecules and small aerosols, a phenomenon explainable using the Rayleigh scattering approximation. On rare occasions, dust or smoke aerosols can cause the extinction of red light to exceed that for blue, resulting in the disks of the sun and moon to appear as blue. Unlike Earth, the atmosphere of Mars is dominated by micron-size dust aerosols, and the sky during sunset takes on a bluish glow. Here we investigate the role of dust aerosols in the blue Martian sunsets and the occasional blue moons and suns on Earth. We use the Mie theory and the Debye series to calculate the wavelength-dependent optical properties of dust aerosols most commonly found on Mars. Our findings show that while wavelength selective extinction can cause the sun's disk to appear blue, the color of the glow surrounding the sun as observed from Mars is due to the dominance of near-forward scattering of blue light by dust particles and cannot be explained by a simple, Rayleigh-like selective extinction explanation.

  9. Photometry of faint blue stars

    International Nuclear Information System (INIS)

    Kilkenny, D.; Hill, P.W.; Brown, A.

    1977-01-01

    Photometry on the uvby system is given for 61 faint blue stars. The stars are classified by means of the Stromgren indices, using criteria described in a previous paper (Kilkenny and Hill (1975)). (author)

  10. Ecology of blue straggler stars

    CERN Document Server

    Carraro, Giovanni; Beccari, Giacomo

    2015-01-01

    The existence of blue straggler stars, which appear younger, hotter, and more massive than their siblings, is at odds with a simple picture of stellar evolution. Such stars should have exhausted their nuclear fuel and evolved long ago to become cooling white dwarfs. They are found to exist in globular clusters, open clusters, dwarf spheroidal galaxies of the Local Group, OB associations and as field stars. This book summarises the many advances in observational and theoretical work dedicated to blue straggler stars. Carefully edited extended contributions by well-known experts in the field cover all the relevant aspects of blue straggler stars research: Observations of blue straggler stars in their various environments; Binary stars and formation channels; Dynamics of globular clusters; Interpretation of observational data and comparison with models. The book also offers an introductory chapter on stellar evolution written by the editors of the book.

  11. Yellow taxis have fewer accidents than blue taxis because yellow is more visible than blue.

    Science.gov (United States)

    Ho, Teck-Hua; Chong, Juin Kuan; Xia, Xiaoyu

    2017-03-21

    Is there a link between the color of a taxi and how many accidents it has? An analysis of 36 mo of detailed taxi, driver, and accident data (comprising millions of data points) from the largest taxi company in Singapore suggests that there is an explicit link. Yellow taxis had 6.1 fewer accidents per 1,000 taxis per month than blue taxis, a 9% reduction in accident probability. We rule out driver difference as an explanatory variable and empirically show that because yellow taxis are more noticeable than blue taxis-especially when in front of another vehicle, and in street lighting-other drivers can better avoid hitting them, directly reducing the accident rate. This finding can play a significant role when choosing colors for public transportation and may save lives as well as millions of dollars.

  12. [Acute blue urticaria following subcutaneous injection of patent blue dye].

    Science.gov (United States)

    Hamelin, A; Vial-Dupuy, A; Lebrun-Vignes, B; Francès, C; Soria, A; Barete, S

    2015-11-01

    Patent blue (PB) is a lymphatic vessel dye commonly used in France for sentinel lymph node detection in breast cancer, and less frequently in melanoma, and which may induce hypersensitivity reactions. We report a case of acute blue urticaria occurring within minutes of PB injection. Ten minutes after PB injection for sentinel lymph node detection during breast cancer surgery, a 49-year-old woman developed generalised acute blue urticaria and eyelid angioedema without bronchospasm or haemodynamic disturbance, but requiring discontinuation of surgery. Skin testing using PB and the anaesthetics given were run 6 weeks after the episode and confirmed PB allergy. PB was formally contra-indicated. Immediate hypersensitivity reactions to PB have been reported for between 0.24 and 2.2% of procedures. Such reactions are on occasion severe, chiefly involving anaphylactic shock. Two mechanisms are probably associated: non-specific histamine release and/or an IgE-mediated mechanism. Skin tests are helpful in confirming the diagnosis of PB allergy. Blue acute urticaria is one of the clinical manifestations of immediate hypersensitivity reactions to patent blue dye. Skin tests must be performed 6 weeks after the reaction in order to confirm the diagnosis and formally contra-indicate this substance. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  13. Model Components of Mangrove Resources Management Based on Blue Economy Concept

    OpenAIRE

    Bidayani, Endang; Soemarno, Soemarno; Harahab, Nuddin; Rudianto, Rudianto

    2016-01-01

    This study was aimed at analyzing variables affecting mangrove resource conservation based on blue economy concept. The model component analysis applied Spearman Rank Correlation test. Result showed that Z-calc.was bigger than Z-tab. (1.64) at 95% confidence level, and therefore, Ho was rejected. This study concluded that resource efficiency, without wastes, social awareness, cyclic system of production, innovation and adaptation, and institution were blue economy concept-based variables. In ...

  14. Blue-emitting laser diodes

    Science.gov (United States)

    Nakano, K.; Ishibashi, A.

    This paper reviews the recent results of blue-emitting laser diodes. These devices are based on ZnMgSSe alloy II-VI semiconductors. Recently we have achieved room temperature continuous-wave operation of ZnMgSSe blue lasers for the first time. ZnMgSSe alloys offer a wide range of band-gap energy from 2.8 to 4.5 eV, while maintaining lattice matching to GaAs substrates. These characteristics make ZnMgSSe suitable for cladding layers of blue lasers. In this article, the feasibilities of ZnMgSSe will be reviewed. The laser structures and characteristics will be also mentioned.

  15. Are blue supergiants descendants of magnetic main sequence stars?

    Science.gov (United States)

    Petermann, Ilka; Langer, Norbert

    2013-06-01

    Red and blue supergiants are, together with luminous blue variables and Wolf-Rayet stars, evolved phases of massive (OB) stars. The position of blue supergiants (BSG) near the main sequence band cannot be reproduced by standard stellar evolution calculations. However, the assumption of a reduced convective core mass during the main sequence (MS) due to strong internal magnetic fields, established in roughly 10% of all stars on the upper MS, can recover this BSG population. For our calculations of the (non-rotating) massive stars at solar metallicity we used the 1D stellar evolution code MESA and compare their evolutionary tracks with positions from stars obtained from the VLT Flames survey of massive stars.

  16. Methylene blue is associated with poor outcomes in vasoplegic shock.

    Science.gov (United States)

    Weiner, Menachem M; Lin, Hung-Mo; Danforth, Dennis; Rao, Srikar; Hosseinian, Leila; Fischer, Gregory W

    2013-12-01

    The purpose of this study was to investigate whether patients who received methylene blue as treatment for vasoplegia during cardiac surgery with cardiopulmonary bypass had decreased morbidity and mortality. Retrospective analysis. Single tertiary care university hospital. Adult patients who suffered from vasoplegia and underwent all types of cardiac surgery with cardiopulmonary bypass at this institution between 2007 and 2008. With IRB approval, the authors reviewed the charts of the identified patients and divided them into 2 groups based on whether they had received methylene blue. Two hundred twenty-six patients were identified who met the inclusion criteria for the study. Fifty-seven of these patients had received methylene blue for vasoplegia. The authors collected data on preoperative and intraoperative variables as well as outcomes. The patients who received methylene blue had higher rates of in-hospital mortality, a compilation of morbidities, as well as renal failure and hyperbilirubinemia. A multiple logistic regression model demonstrated that receiving methylene blue was an independent predictor of in-hospital mortality (p value: 0.007, OR 4.26, 95% CI: 1.49-12.12), compilation of morbidities (p value: 0.001, OR 4.80, 95% CI: 1.85-12.43), and hyperbilirubinemia (p value:methylene blue as treatment for vasoplegia to be independently associated with poor outcomes. While further studies are required, a thorough risk-benefit analysis should be applied before using methylene blue and, perhaps, it should be relegated to rescue use and not as first-line therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Blue light emitting thiogallate phosphor

    Science.gov (United States)

    Dye, Robert C.; Smith, David C.; King, Christopher N.; Tuenge, Richard T.

    1998-01-01

    A crystalline blue emitting thiogallate phosphor of the formula RGa.sub.2 S.sub.4 :Ce.sub.x where R is selected from the group consisting of calcium, strontium, barium and zinc, and x is from about 1 to 10 atomic percent, the phosphor characterized as having a crystalline microstructure on the size order of from about 100 .ANG. to about 10,000 .ANG. is provided together with a process of preparing a crystalline blue emitting thiogallate phosphor by depositing on a substrate by CVD and resultant thin film electroluminescent devices including a layer of such deposited phosphor on an ordinary glass substrate.

  18. Yellow taxis have fewer accidents than blue taxis because yellow is more visible than blue

    OpenAIRE

    Ho, Teck-Hua; Chong, Juin Kuan; Xia, Xiaoyu

    2017-01-01

    Is there a link between the color of a taxi and how many accidents it has? An analysis of 36 mo of detailed taxi, driver, and accident data (comprising millions of data points) from the largest taxi company in Singapore suggests that there is an explicit link. Yellow taxis had 6.1 fewer accidents per 1,000 taxis per month than blue taxis, a 9% reduction in accident probability. We rule out driver difference as an explanatory variable and empirically show that because yellow taxis are more not...

  19. CENSUS OF BLUE STARS IN SDSS DR8

    International Nuclear Information System (INIS)

    Scibelli, Samantha; Newberg, Heidi Jo; Carlin, Jeffrey L.; Yanny, Brian

    2014-01-01

    We present a census of the 12,060 spectra of blue objects ((g – r) 0 < –0.25) in the Sloan Digital Sky Survey (SDSS) Data Release 8 (DR8). As part of the data release, all of the spectra were cross-correlated with 48 template spectra of stars, galaxies, and QSOs to determine the best match. We compared the blue spectra by eye to the templates assigned in SDSS DR8. 10,856 of the objects matched their assigned template, 170 could not be classified due to low signal-to-noise ratio, and 1034 were given new classifications. We identify 7458 DA white dwarfs, 1145 DB white dwarfs, 273 rarer white dwarfs (including carbon, DZ, DQ, and magnetic), 294 subdwarf O stars, 648 subdwarf B stars, 679 blue horizontal branch stars, 1026 blue stragglers, 13 cataclysmic variables, 129 white dwarf-M dwarf binaries, 36 objects with spectra similar to DO white dwarfs, 179, quasi-stellar objects (QSOs), and 10 galaxies. We provide two tables of these objects, sample spectra that match the templates, figures showing all of the spectra that were grouped by eye, and diagnostic plots that show the positions, colors, apparent magnitudes, proper motions, etc., for each classification. Future surveys will be able to use templates similar to stars in each of the classes we identify to automatically classify blue stars, including rare types

  20. The Blue Revolution in Asia

    DEFF Research Database (Denmark)

    Ponte, Stefano; Kelling, Ingrid; Jespersen, Karen Sau

    2014-01-01

    In this article, we examine the upgrading trajectories of selected aquaculture value chains in four Asian countries and the links between upgrading and three factors of value chain governance: coordination mechanisms; types of drivers; and domestic regulation. We find instances of improving produ...... of upgrading the "blue revolution" in Asia...

  1. Blue Ocean vs. Five Forces

    NARCIS (Netherlands)

    A.E. Burke (Andrew); A.J. van Stel (André); A.R. Thurik (Roy)

    2010-01-01

    textabstractThe article reports on the authors' research in the Netherlands which focused on a profit model in Dutch retail stores and a so-called blue-ocean approach which requires a new market that attracts consumers and increases profits. Topics include the competitive strategy approach to

  2. Mobilizing investors for blue growth

    NARCIS (Netherlands)

    Burg, van den Sander W.K.; Stuiver, Marian; Bolman, Bas C.; Wijnen, Roland; Selnes, Trond; Dalton, Gordon

    2017-01-01

    The European Union's Blue Growth Strategy is a long term strategy to support sustainable growth in the marine and maritime sectors, aiming to contribute to innovation and economic growth (European Commission, 2012). The EU sees the financial sector as a key partner to bring about transition to

  3. Nobel Prize for blue LEDs

    International Nuclear Information System (INIS)

    Kraftmakher, Yaakov

    2015-01-01

    A brief review of lighting technologies is presented. Unavoidable restrictions for incandescent light bulbs caused by the Planck distribution and properties of the human eye are illustrated. The efficiency and luminous efficacy of thermal radiation are calculated for various temperatures; the results clearly show the limitations for thermal radiators. The only way to overcome these limitations is using non-thermal radiators, such as fluorescent lamps and light-emitting diodes (LEDs). Unique advantages of LEDs undoubtedly made a revolution in this field. A crucial element of this progress is the blue LEDs (Nobel Prize 2014). Some experiments with a blue and a green LED are described: (i) the luminescence triggered in a green-yellow phosphor inside a white LED by the blue LED; (ii) radiant spectra and ‘efficiency droop’ in the LEDs; (iii) modulation of the blue LED up to 4 MHz; and (iv) the h/e ratio from the turn-on voltage of the green LED. The experiments are suitable for undergraduate laboratories and usable as classroom demonstrations. (paper)

  4. Nobel Prize for blue LEDs

    Science.gov (United States)

    Kraftmakher, Yaakov

    2015-05-01

    A brief review of lighting technologies is presented. Unavoidable restrictions for incandescent light bulbs caused by the Planck distribution and properties of the human eye are illustrated. The efficiency and luminous efficacy of thermal radiation are calculated for various temperatures; the results clearly show the limitations for thermal radiators. The only way to overcome these limitations is using non-thermal radiators, such as fluorescent lamps and light-emitting diodes (LEDs). Unique advantages of LEDs undoubtedly made a revolution in this field. A crucial element of this progress is the blue LEDs (Nobel Prize 2014). Some experiments with a blue and a green LED are described: (i) the luminescence triggered in a green-yellow phosphor inside a white LED by the blue LED; (ii) radiant spectra and ‘efficiency droop’ in the LEDs; (iii) modulation of the blue LED up to 4 MHz; and (iv) the h/e ratio from the turn-on voltage of the green LED. The experiments are suitable for undergraduate laboratories and usable as classroom demonstrations.

  5. Modelling the effects of environmental conditions on the acoustic occurrence and behaviour of Antarctic blue whales.

    Science.gov (United States)

    Shabangu, Fannie W; Yemane, Dawit; Stafford, Kathleen M; Ensor, Paul; Findlay, Ken P

    2017-01-01

    Harvested to perilously low numbers by commercial whaling during the past century, the large scale response of Antarctic blue whales Balaenoptera musculus intermedia to environmental variability is poorly understood. This study uses acoustic data collected from 586 sonobuoys deployed in the austral summers of 1997 through 2009, south of 38°S, coupled with visual observations of blue whales during the IWC SOWER line-transect surveys. The characteristic Z-call and D-call of Antarctic blue whales were detected using an automated detection template and visual verification method. Using a random forest model, we showed the environmental preferences pattern, spatial occurrence and acoustic behaviour of Antarctic blue whales. Distance to the southern boundary of the Antarctic Circumpolar Current (SBACC), latitude and distance from the nearest Antarctic shores were the main geographic predictors of blue whale call occurrence. Satellite-derived sea surface height, sea surface temperature, and productivity (chlorophyll-a) were the most important environmental predictors of blue whale call occurrence. Call rates of D-calls were strongly predicted by the location of the SBACC, latitude and visually detected number of whales in an area while call rates of Z-call were predicted by the SBACC, latitude and longitude. Satellite-derived sea surface height, wind stress, wind direction, water depth, sea surface temperatures, chlorophyll-a and wind speed were important environmental predictors of blue whale call rates in the Southern Ocean. Blue whale call occurrence and call rates varied significantly in response to inter-annual and long term variability of those environmental predictors. Our results identify the response of Antarctic blue whales to inter-annual variability in environmental conditions and highlighted potential suitable habitats for this population. Such emerging knowledge about the acoustic behaviour, environmental and habitat preferences of Antarctic blue whales is

  6. Modelling the effects of environmental conditions on the acoustic occurrence and behaviour of Antarctic blue whales.

    Directory of Open Access Journals (Sweden)

    Fannie W Shabangu

    Full Text Available Harvested to perilously low numbers by commercial whaling during the past century, the large scale response of Antarctic blue whales Balaenoptera musculus intermedia to environmental variability is poorly understood. This study uses acoustic data collected from 586 sonobuoys deployed in the austral summers of 1997 through 2009, south of 38°S, coupled with visual observations of blue whales during the IWC SOWER line-transect surveys. The characteristic Z-call and D-call of Antarctic blue whales were detected using an automated detection template and visual verification method. Using a random forest model, we showed the environmental preferences pattern, spatial occurrence and acoustic behaviour of Antarctic blue whales. Distance to the southern boundary of the Antarctic Circumpolar Current (SBACC, latitude and distance from the nearest Antarctic shores were the main geographic predictors of blue whale call occurrence. Satellite-derived sea surface height, sea surface temperature, and productivity (chlorophyll-a were the most important environmental predictors of blue whale call occurrence. Call rates of D-calls were strongly predicted by the location of the SBACC, latitude and visually detected number of whales in an area while call rates of Z-call were predicted by the SBACC, latitude and longitude. Satellite-derived sea surface height, wind stress, wind direction, water depth, sea surface temperatures, chlorophyll-a and wind speed were important environmental predictors of blue whale call rates in the Southern Ocean. Blue whale call occurrence and call rates varied significantly in response to inter-annual and long term variability of those environmental predictors. Our results identify the response of Antarctic blue whales to inter-annual variability in environmental conditions and highlighted potential suitable habitats for this population. Such emerging knowledge about the acoustic behaviour, environmental and habitat preferences of

  7. 21 CFR 133.106 - Blue cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Blue cheese. 133.106 Section 133.106 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.106 Blue cheese. (a) Description. (1) Blue cheese is the food prepared by the procedure set...

  8. 75 FR 65525 - Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division of...

    Science.gov (United States)

    2010-10-25

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,327] Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division of Wellpoint, Inc., Green Bay, WI; Notice... former workers of Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division...

  9. SPECIAL ISSUE DEVOTED TO THE 80TH BIRTHDAY OF S.A. AKHMANOV: Peculiarities of periodic and aperiodic energy-exchange regimes in the cascade quasi-synchronous parametric frequency conversion

    Science.gov (United States)

    Petnikova, V. M.; Shuvalov, Vladimir V.

    2009-07-01

    The domains of existence and peculiarities of exact analytic solutions of the problem of quasi-synchronous interaction of four plane collinear monochromatic waves — modes in a quadratically nonlinear medium during cascade frequency conversion are analysed. It is shown that the unusual types of multicomponent cnoidal and solitary soliton-like waves (of periodic and aperiodic energy-exchange regimes) are realised. Two of the four components of the latter are proportional to the real and imaginary parts of the well-known Lorentzian dependence, which is commonly used to describe the dispersion of contributions from resonance transitions to the complex permittivity in the case of homogeneous line broadening.

  10. Persistence of circannual rhythms under constant periodic and aperiodic light conditions: sex differences and relationship with the external environment.

    Science.gov (United States)

    Budki, Puja; Rani, Sangeeta; Kumar, Vinod

    2012-11-01

    The timing and duration of gonadal phases in the year indicates that breeding cycles are regulated by endogenous mechanisms. The present study on tropical spotted munia (Lonchura punctulata) investigates whether such mechanisms are based on circannual rhythms, and whether circannual rhythms between sexes differ in their relationship with the light environment. Birds were subjected to 12 h light per day (12L:12D), alternate days of light and darkness (24L:24D, LL/DD) and continuous light (LL), with L=22 lx and D≤1 lx, for 28 months at constant temperature (18±1°C). Groups kept on natural day lengths (NDL) served as controls. Measurement of body mass, gonads and molts of the primary wing feathers and body plumage at regular intervals showed that birds underwent repeated cycles in gonads and molt, but not in body mass. Under NDL, gonadal phases in both sexes cycled with 12 month periods. Under other conditions, males cycled with similar periods of ~11 months, but females cycled with relatively large period variations, ~10-13 months. Gonadal recrudescence-regression phase was longer in males than in females and, in both sexes, longer in the second year compared with the first year. The molt of wing primaries was more closely coupled to gonadal maturation in groups on NDL and 12L:12D than in groups on LL and LL/DD, but this relationship drifted apart in the second year. Body plumage molts were relatively more highly variable in both frequency and pattern in females than in males. It is suggested that annual breeding cycle in spotted munia is regulated by the self-sustained circannual rhythms, which probably interact with the annual photoperiodic cycle to synchronize breeding cycles to calendar year. Both sexes seem to have independent timing strategies, but females appear to share a greater role in defining the reproductive season in relation with the environment.

  11. The Physics of the Blues

    Science.gov (United States)

    Gibson, J. Murray

    2009-03-01

    In looking at the commonalities between music and science, one sees that the musician's palette is based on the principles of physics. The pitch of a musical note is determined by the frequency of the sound wave. The scales that musicians use to create and play music can be viewed as a set of rules. What makes music interesting is how musicians develop those rules and create ambiguity with them. I will discuss the evolution of western musical scales in this context. As a particular example, ``Blue'' notes are very harmonic notes that are missing from the equal temperament scale. The techniques of piano blues and jazz represent the melding of African and Western music into something totally new and exciting. Live keyboard demonstrations will be used. Beyond any redeeming entertainment value the talk will emphasize the serious connections between science and art in music. Nevertheless tips will be accepted.

  12. Thermoluminescence (TL) of Egyptian Blue

    Energy Technology Data Exchange (ETDEWEB)

    Schvoerer, M.; Delavergne, M.-C.; Chapoulie, R.

    1988-01-01

    Egyptian Blue is a synthesized crystalline pictorial pigment with formula CaCuSi/sub 4/O/sub 10/. It has been used in Egypt and Mesopotamia from the 3rd millenium B.C. A preliminary experiment on a recently synthesized sample showed that this pigment is thermoluminescent after ..beta.. irradiation (/sup 90/Sr). As the signal intensity grows linearly with the administered dose within the temperature range commonly used in TL dating, we have been looking for this phenomenon from archaeological pigments. It was encountered with two samples found in excavation. From its intensity and stability we concluded that Egyptian Blue can be dated using TL. This first and positive result encouraged us to extend the method to other types of mineral pigments synthesized by early man, and to suggest that it may be used for direct dating of ancient murals.

  13. Blue breath holding is benign.

    OpenAIRE

    Stephenson, J B

    1991-01-01

    In their recent publication in this journal, Southall et al described typical cyanotic breath holding spells, both in otherwise healthy children and in those with brainstem lesions and other malformations. Their suggestions regarding possible autonomic disturbances may require further study, but they have adduced no scientific evidence to contradict the accepted view that in the intact child blue breath holding spells are benign. Those families in which an infant suffers an 'apparently life t...

  14. Galaxies on the Blue Edge

    OpenAIRE

    Cabanela, J. E.; Dickey, J. M.

    2002-01-01

    We have successfully constructed a catalog of HI-rich galaxies selected from the Minnesota Automated Plate Scanner Catalog of the Palomar Observatory Sky Survey (POSS I) based solely on optical criteria. We identify HI-rich candidates by selecting the bluest galaxies at a given apparent magnitude, those galaxies on the "blue edge" of POSS I color-magnitude parameter space. Subsequent 21-cm observations on the upgraded Arecibo 305m dish detected over 50% of the observed candidates. The detecte...

  15. Blue light regulated shade avoidance.

    Science.gov (United States)

    Keuskamp, Diederik H; Keller, Mercedes M; Ballaré, Carlos L; Pierik, Ronald

    2012-04-01

    Most plants grow in dense vegetation with the risk of being out-competed by neighboring plants. These neighbors can be detected not only through the depletion in light quantity that they cause, but also through the change in light quality, which plants perceive using specific photoreceptors. Both the reduction of the red:far-red ratio and the depletion of blue light are signals that induce a set of phenotypic traits, such as shoot elongation and leaf hyponasty, which increase the likelihood of light capture in dense plant stands. This set of phenotypic responses are part of the so called shade avoidance syndrome (SAS). This addendum discusses recent findings on the regulation of the SAS of Arabidopsis thaliana upon blue light depletion. Keller et al. and Keuskamp et al. show that the low blue light attenuation induced shade avoidance response of seedling and rosette-stage A. thaliana plants differ in their hormonal regulation. These studies also show there is a regulatory overlap with the R:FR-regulated SAS.

  16. Adsorption of Methylene Blue, Bromophenol Blue, and Coomassie Brilliant Blue by α-chitin nanoparticles

    Directory of Open Access Journals (Sweden)

    Solairaj Dhananasekaran

    2016-01-01

    Full Text Available Expelling of dyestuff into water resource system causes major thread to the environment. Adsorption is the cost effective and potential method to remove the dyes from the effluents. Therefore, an attempt was made to study the adsorption of dyestuff (Methylene Blue (MB, Bromophenol Blue (BPB and Coomassie Brilliant Blue (CBB by α-chitin nanoparticles (CNP prepared from Penaeus monodon (Fabricius, 1798 shell waste. On contrary to the most recognizable adsorption studies using chitin, this is the first study using unique nanoparticles of ⩽50 nm used for the dye adsorption process. The results showed that the adsorption process increased with increase in the concentration of CNP, contact time and temperature with the dyestuff, whereas the adsorption process decreased with increase in the initial dye concentration and strong acidic pH. The results from Fourier transform infrared (FTIR spectroscopy confirmed that the interaction between dyestuff and CNP involved physical adsorption. The adsorption process obeys Langmuir isotherm (R2 values were 0.992, 0.999 and 0.992 for MB, BPB and CBB, and RL value lies between 0 and 1 for all the three dyes and pseudo second order kinetics (R2 values were 0.996, 0.999 and 0.996 for MB, BPB and CBB more effectively. The isotherm and kinetic models confirmed that CNP can be used as a suitable adsorbent material for the removal of dyestuff from effluents.

  17. A resolution to the blue whiting (Micromesistius poutassou population paradox?

    Directory of Open Access Journals (Sweden)

    Fabien Pointin

    Full Text Available We provide the strongest evidence to date supporting the existence of two independent blue whiting (Micromesistius poutassou (Risso, 1827 populations in the North Atlantic. In spite of extensive data collected in conjunction with the fishery, the population structure of blue whiting is poorly understood. On one hand, genetic, morphometric, otolith and drift modelling studies point towards the existence of two populations, but, on the other hand, observations of adult distributions point towards a single population. A paradox therefore arises in attempting to reconcile these two sets of information. Here we analyse 1100 observations of blue whiting larvae from the Continuous Plankton Recorder (CPR from 1948-2005 using modern statistical techniques. We show a clear spatial separation between a northern spawning area, in the Rockall Trough, and a southern one, off the Porcupine Seabight. We further show a difference in the timing of spawning between these sites of at least a month, and meaningful differences in interannual variability. The results therefore support the two-population hypothesis. Furthermore, we resolve the paradox by showing that the acoustic observations cited in support of the single-population model are not capable of resolving both populations, as they occur too late in the year and do not extend sufficiently far south to cover the southern population: the confusion is the result of a simple observational artefact. We conclude that blue whiting in the North Atlantic comprises two populations.

  18. Blue Whale (Balaenoptera musculus) Behavior and Group Dynamics as Observed from an Aircraft off Southern California

    OpenAIRE

    Kate Lomac-MacNair; Mari Ann Smultea

    2016-01-01

    Group behavior and interactions of endangered blue whales (Balaenoptera musculus) have not been systematically studied. Such behavioral data are often overlooked when assessing anthropogenic effects. Yet behavioral data are necessary to compare “normal” behaviors with behavior affected by anthropogenic factors of concern relative to effective management and recovery of blue whales. For a baseline study, we hypothesized that the response variables sighting rate, group size, calf pr...

  19. Blue breath holding is benign.

    Science.gov (United States)

    Stephenson, J B

    1991-01-01

    In their recent publication in this journal, Southall et al described typical cyanotic breath holding spells, both in otherwise healthy children and in those with brainstem lesions and other malformations. Their suggestions regarding possible autonomic disturbances may require further study, but they have adduced no scientific evidence to contradict the accepted view that in the intact child blue breath holding spells are benign. Those families in which an infant suffers an 'apparently life threatening event' deserve immense understanding and help, and it behoves investigators to exercise extreme care and self criticism in the presentation of new knowledge which may bear upon their management and their morale. PMID:2001115

  20. Blue Mountain, Humboldt County, Nevada, U.S.A

    Energy Technology Data Exchange (ETDEWEB)

    Ted Fitzpatrick, Brian D. Fairbank

    2005-04-01

    The report documents the drilling of well Deep Blue No.2, the second deep geothermal test hole at the Blue Mountain Geothermal Area, Humboldt County, Nevada. The well was drilled by Noramex Corp, a Nevada company, with funding support from the US Department of Energy, under the DOE’s GRED II Program. Deep Blue No.2 was drilled as a ‘step-out’ hole from Deep Blue No.1, to further evaluate the commercial potential of the geothermal resource. Deep Blue No.2 was designed as a vertical, slim observation test hole to a nominal target depth of 1000 meters (nominal 3400 feet). The well tests an area of projected high temperatures at depth, from temperature gradients measured in a group of shallow drill holes located approximately one kilometer to the northeast of observation hole Deep Blue No.1. The well is not intended for, or designed as, a commercial well or a production well. Deep Blue No.2 was spudded on March 25, 2004 and completed to a total depth of 1127.76m (3700 ft) on April 28, 2004. The well was drilled using conventional rotary drilling techniques to a depth of 201.17 m (660 ft), and continuously cored from 201.17m (660 ft) to 1127.76m (3700 ft). A brief rig-on flow-test was conducted at completion to determine basic reservoir parameters and obtain fluid samples. A permeable fracture zone with measured temperatures of 150 to 167°C (302 to 333°F) occurs between 500 to 750m (1640 to 2461ft). The well was left un-lined in anticipation of the Phase III - Flow and Injection Testing. A further Kuster temperature survey was attempted after the well had been shut in for almost 3 weeks. The well appears to have bridged off at 439m (1440ft) as the Kuster tool was unable to descend past this point. Several attempts to dislodge the obstruction using tube jars were unsuccessful. Deep Blue No.2 encountered variably fractured and veined, fine-grained rocks of the Singas Formation, and intruded by minor strongly altered fine-grained felsic dikes, and less altered

  1. The WFCAM multiwavelength Variable Star Catalog

    Science.gov (United States)

    Ferreira Lopes, C. E.; Dékány, I.; Catelan, M.; Cross, N. J. G.; Angeloni, R.; Leão, I. C.; De Medeiros, J. R.

    2015-01-01

    Context. Stellar variability in the near-infrared (NIR) remains largely unexplored. The exploitation of public science archives with data-mining methods offers a perspective for a time-domain exploration of the NIR sky. Aims: We perform a comprehensive search for stellar variability using the optical-NIR multiband photometric data in the public Calibration Database of the WFCAM Science Archive (WSA), with the aim of contributing to the general census of variable stars and of extending the current scarce inventory of accurate NIR light curves for a number of variable star classes. Methods: Standard data-mining methods were applied to extract and fine-tune time-series data from the WSA. We introduced new variability indices designed for multiband data with correlated sampling, and applied them for preselecting variable star candidates, i.e., light curves that are dominated by correlated variations, from noise-dominated ones. Preselection criteria were established by robust numerical tests for evaluating the response of variability indices to the colored noise characteristic of the data. We performed a period search using the string-length minimization method on an initial catalog of 6551 variable star candidates preselected by variability indices. Further frequency analysis was performed on positive candidates using three additional methods in combination, in order to cope with aliasing. Results: We find 275 periodic variable stars and an additional 44 objects with suspected variability with uncertain periods or apparently aperiodic variation. Only 44 of these objects had been previously known, including 11 RR Lyrae stars on the outskirts of the globular cluster M 3 (NGC 5272). We provide a preliminary classification of the new variable stars that have well-measured light curves, but the variability types of a large number of objects remain ambiguous. We classify most of the new variables as contact binary stars, but we also find several pulsating stars, among which

  2. Electronic properties of blue phosphorene/graphene and blue phosphorene/graphene-like gallium nitride heterostructures.

    Science.gov (United States)

    Sun, Minglei; Chou, Jyh-Pin; Yu, Jin; Tang, Wencheng

    2017-07-05

    Blue phosphorene (BlueP) is a graphene-like phosphorus nanosheet which was synthesized very recently for the first time [Nano Lett., 2016, 16, 4903-4908]. The combination of electronic properties of two different two-dimensional materials in an ultrathin van der Waals (vdW) vertical heterostructure has been proved to be an effective approach to the design of novel electronic and optoelectronic devices. Therefore, we used density functional theory to investigate the structural and electronic properties of two BlueP-based heterostructures - BlueP/graphene (BlueP/G) and BlueP/graphene-like gallium nitride (BlueP/g-GaN). Our results showed that the semiconducting nature of BlueP and the Dirac cone of G are well preserved in the BlueP/G vdW heterostructure. Moreover, by applying a perpendicular electric field, it is possible to tune the position of the Dirac cone of G with respect to the band edge of BlueP, resulting in the ability to control the Schottky barrier height. For the BlueP/g-GaN vdW heterostructure, BlueP forms an interface with g-GaN with a type-II band alignment, which is a promising feature for unipolar electronic device applications. Furthermore, we discovered that both G and g-GaN can be used as an active layer for BlueP to facilitate charge injection and enhance the device performance.

  3. EARLY DOWNHOME BLUES IN AMERICAN CULTURE

    OpenAIRE

    Muhni, Djuhertati Imam

    2012-01-01

    People's traditional music and the way people behave when performing it are symbolic expressions of broad cultural pattern and social organization . In other words music is a part of men's learned heritage . Hence this study is about music in a given culture, specifically blues in American culture . Allen Trachtenberg stated that blues songs are inheritance from the American past for negotiating black people's lives as Americans . In the experience of blues the African-Americans find themselv...

  4. The Red-Blue Transportation Problem

    OpenAIRE

    Vancroonenburg, Wim; Della Croce, Federico; Goossens, Dries; Spieksma, Frits

    2014-01-01

    This paper considers the Red-Blue Transportation Problem (Red-Blue TP), a generalization of the transportation problem where supply nodes are partitioned into two sets and so-called exclusionary constraints are imposed. We encountered a special case of this problem in a hospital context, where patients need to be assigned to rooms. We establish the problem's complexity, and we compare two integer programming formulations. Furthermore, a maximization variant of Red-Blue TP is presented, for...

  5. Morphological responses of wheat to blue light

    Science.gov (United States)

    Barnes, C.; Bugbee, B.

    1992-01-01

    Blue light significantly increased tillering in wheat (Triticum aestivum L.) plants grown at the same photosynthetic photon flux (PPF). Plants were grown under two levels of blue light (400-500 nm) in a controlled environment with continuous irradiation. Plants received either 50 micromoles m-2 s-1 of blue light or 2 micromoles m-2 s-1 blue light from filtered metal halide lamps at a total irradiance of 200 micromoles m-2 s-1 PPF (400-700 nm). Plants tillered an average of 25% more under the higher level of blue light. Blue light also caused a small, but consistent, increase in main culm development, measured as Haun stage. Leaf length was reduced by higher levels of blue light, while plant dry-mass was not significantly affected by blue light. Applying the principle of equivalent light action, the results suggest that tillering and leaf elongation are mediated by the blue-UV light receptor(s) because phytochrome photoequilibrium for each treatment were nearly identical.

  6. Why Blue-Collar Blacks Help Less

    OpenAIRE

    Smith, Sandra Susan; Young, Kara Alexis

    2013-01-01

    Why are blue-collar blacks less likely to help jobseekers than jobholders from other ethnoracial groups or even than more affluent blacks? Drawing from in-depth, semi-structured interviews with 97 black and Latino workers at one large, public sector employer, we find that blue-collar black workers both helped less proactively and rejected more requests for assistance than did blue-collar Latino and white-collar black workers. We attribute blue-collar blacks’ more passive engagement to their...

  7. Hydrological characterization of watersheds in the Blue Nile Basin, Ethiopia

    Directory of Open Access Journals (Sweden)

    S. G. Gebrehiwot

    2011-01-01

    Full Text Available Thirty-two watersheds (31–4350 km2, in the Blue Nile Basin, Ethiopia, were hydrologically characterized with data from a study of water and land resources by the US Department of Interior, Bureau of Reclamation (USBR published in 1964. The USBR document contains data on flow, topography, geology, soil type, and land use for the period 1959 to 1963. The aim of the study was to identify watershed variables best explaining the variation in the hydrological regime, with a special focus on low flows. Moreover, this study aimed to identify variables that may be susceptible to management policies for developing and securing water resources in dry periods. Principal Component Analysis (PCA and Partial Least Square (PLS were used to analyze the relationship between five hydrologic response variables (total flow, high flow, low flow, runoff coefficient, low flow index and 30 potential explanatory watershed variables. The explanatory watershed variables were classified into three groups: land use, climate and topography as well as geology and soil type. Each of the three groups had almost equal influence on the variation in hydrologic variables (R2 values ranging from 0.3 to 0.4. Specific variables from within each of the three groups of explanatory variables were better in explaining the variation. Low flow and low flow index were positively correlated to land use types woodland, dense wet forest and savannah grassland, whereas grazing land and bush land were negatively correlated. We concluded that extra care for preserving low flow should be taken on tuffs/basalts which comprise 52% of the Blue Nile Basin. Land use management plans should recognize that woodland, dense wet forest and savannah grassland can promote higher low flows, while grazing land diminishes low flows.

  8. Prehistory of the Little Blue River Valley, Western Missouri: Archaeological Investigations at Blue Springs Lake.

    Science.gov (United States)

    1989-01-01

    Lake project. The report discusses the geomorphology and vegetation of the Little Blue River valley, Late Quaternary bioclimatic change in Western...54 Aquatic Communities ............................... 58 IV. LATE QUATERNARY BIOCLIMATIC CHANGE IN WESTERN MISSOURI by Rolfe D...City District is presently constructing Blue Springs Lake on the East Fork of the Little Blue River in Jackson County, Missouri. The location of the

  9. The analysis and comparison of blue wool fibre populations found at random on clothing.

    Science.gov (United States)

    Wiggins, K; Drummond, P

    2005-01-01

    Fifty-eight garments were taped and searched for mid to dark blue wool fibres. These were then removed from the tapings, mounted on slides and examined using a high-power microscope (400x). A total of 2,740 blue wool fibres were identified and visible range microspectrophotometry (MSP) was performed on them. Three hundred independent blue wool populations were identified on 56 of the 58 garments searched. The lack of control fibres meant the spectral range of each population was unknown. The number of populations may have been underestimated by grouping together the fibres that had broad single peaks and a lack of distinguishing features in the spectra. Although blue wool is considered to be a common fibre type, 300 unique spectral shapes were identified by the use of microspectrophotometry alone. This demonstrates that the dyes used in the dyeing of blue wool are variable. Showing that many different populations of blue wool occur on a range of garments should ensure that the forensic scientist does not underestimate or understate the strength of evidence in cases where blue wool is found. Hopefully this work will enlighten scientists and enable them to also assess the true value of their findings when other commonly occurring fibres are encountered.

  10. Blue rubber bleb nevus syndrome

    Directory of Open Access Journals (Sweden)

    Rodrigues Daleth

    2000-01-01

    Full Text Available The blue rubber nevus syndrome consists of multiple venous malformations in the skin and gastrointestinal tract associated with intestinal hemorrhage and iron deficiency anemia. Other organs may be involved. The causes of this syndrome are unknown. Its most common presentation is in the form of sporadic cases, but dominant autosomal inheritance has been described. It is a condition that affects both sexes equally, and its occurrence is rare in the black race. We present a case of this syndrome diagnosed in a 11-year-old patient. He had severe anemia and a venous swelling on the trunk. Similar lesions were found in the stomach, bowel, and on his foot. We emphasize the main clinical aspects: intestine, eyes, nasopharynx, parotids, lungs, liver, spleen, heart, brain, pleura, peritoneum, pericardium, skeletal muscles, bladder, and penis lesions, systemic complications that may occur to these patients which are thrombosis and calcification, as well as consumptive coagulopathy and thrombocytopenia that may occur within the nevi.

  11. Blue enhanced light sources: opportunities and risks

    Science.gov (United States)

    Lang, Dieter

    2012-03-01

    Natural daylight is characterized by high proportions of blue light. By proof of a third type of photoreceptor in the human eye which is only sensitive in this spectral region and by subsequent studies it has become obvious that these blue proportions are essential for human health and well being. In various studies beneficial effects of indoor lighting with higher blue spectral proportions have been proven. On the other hand with increasing use of light sources having enhanced blue light for indoor illumination questions are arising about potential health risks attributed to blue light. Especially LED are showing distinct emission characteristics in the blue. Recently the French agency for food, environmental and occupational health & safety ANSES have raised the question on health issues related to LED light sources and have claimed to avoid use of LED for lighting in schools. In this paper parameters which are relevant for potential health risks will be shown and their contribution to risk factors will quantitatively be discussed. It will be shown how to differentiate between photometric parameters for assessment of beneficial as well as hazardous effects. Guidelines will be discussed how blue enhanced light sources can be used in applications to optimally support human health and well being and simultaneously avoid any risks attributed to blue light by a proper design of lighting parameters. In the conclusion it will be shown that no inherent health risks are related to LED lighting with a proper lighting design.

  12. Blue Skies, Coffee Creamer, and Rayleigh Scattering

    Science.gov (United States)

    Liebl, Michael

    2010-01-01

    The first physical explanation of Earths blue sky was fashioned in 1871 by Lord Rayleigh. Many discussions of Rayleigh scattering and approaches to studying it both in and out of the classroom are available. Rayleigh scattering accounts for the blue color of the sky and the orange/red color of the Sun near sunset and sunrise, and a number of…

  13. Blue jay attacks and consumes cedar waxwing

    Science.gov (United States)

    Daniel Saenz; Joshua B. Pierce

    2009-01-01

    Blue Jays (Cyanocitta cristata) are known to be common predators on bird nests (Wilcove 1985, Picman and Schriml 1994). In addition to predation on eggs and nestlings, Blue Jays occasionally prey on fledgling and adult birds (Johnson and Johnson 1976, Dubowy 1985). A majority of reports involve predation on House Sparrows (Passer domesticus) and other small birds (...

  14. Exposure to blue light during lunch break: effects on autonomic arousal and behavioral alertness.

    Science.gov (United States)

    Yuda, Emi; Ogasawara, Hiroki; Yoshida, Yutaka; Hayano, Junichiro

    2017-07-11

    Exposures to melanopsin-stimulating (melanopic) component-rich blue light enhance arousal level. We examined their effects in office workers. Eight healthy university office workers were exposed to blue and orange lights for 30 min during lunch break on different days. We compared the effects of light color on autonomic arousal level assessed by heart rate variability (HRV) and behavioral alertness by psychomotor vigilance tests (PVT). Heart rate was higher and high-frequency (HF, 0.150.45 Hz) power of HRV was lower during exposure to the blue light than to orange light. No significant difference with light color was observed, however, in any HRV indices during PVT or in PVT performance after light exposure. Exposure to blue light during lunch break, compared with that to orange light, enhances autonomic arousal during exposure, but has no sustained effect on autonomic arousal or behavioral alertness after exposure.

  15. Tapered photonic crystal fibers for blue-enhanced supercontinuum generation

    DEFF Research Database (Denmark)

    Møller, Uffe; Sørensen, Simon Toft; Larsen, Casper

    2012-01-01

    Tapering of photonic crystal fibers is an effective way of shifting the blue edge of a supercontinuum spectrum down in the deep-blue. We discuss the optimum taper profile for enhancing the power in the blue edge....

  16. Phytotoxicity of methylene blue to rice seedlings

    Directory of Open Access Journals (Sweden)

    X.Z. Yu

    2015-07-01

    Full Text Available Methylene blue is widely used in various industrial branches. Due to insufficient treatment, its occurrence in wastewater is frequently detected, which may result in serious environment problems to aquatic organisms. Hydroponic experiments were conducted with rice seedlings (Oryza sativa L. cv. XZX 45 exposed to methylene blue to determine the effective concentration using relative growth rate and water use efficiency as response endpoints. Results showed that acute toxicity of methylene blue to rice seedlings was evident. Although a linear decrease in relative growth rate and water use efficiency was observed in rice seedlings with increasing methylene blue concentrations, relative growth rate of rice seedlings was more sensitive to change of methylene blue than water use efficiency. Using non-linear regression, EC-48 h values for 10%, 20% and 50% inhibition of the relative growth rate were estimated to be 1.54, 3.22 and 10.13 mg MB/L for rice seedlings exposed to methylene blue, respectively, while smaller EC were obtained for 96 h exposure. In conclusion, the toxic response of young rice seedlings to methylene blue is obvious and inhibitory effects are highly dependent on response endpoints and the duration of exposure period.

  17. Can greening of aquaculture sequester blue carbon?

    Science.gov (United States)

    Ahmed, Nesar; Bunting, Stuart W; Glaser, Marion; Flaherty, Mark S; Diana, James S

    2017-05-01

    Globally, blue carbon (i.e., carbon in coastal and marine ecosystems) emissions have been seriously augmented due to the devastating effects of anthropogenic pressures on coastal ecosystems including mangrove swamps, salt marshes, and seagrass meadows. The greening of aquaculture, however, including an ecosystem approach to Integrated Aquaculture-Agriculture (IAA) and Integrated Multi-Trophic Aquaculture (IMTA) could play a significant role in reversing this trend, enhancing coastal ecosystems, and sequestering blue carbon. Ponds within IAA farming systems sequester more carbon per unit area than conventional fish ponds, natural lakes, and inland seas. The translocation of shrimp culture from mangrove swamps to offshore IMTA could reduce mangrove loss, reverse blue carbon emissions, and in turn increase storage of blue carbon through restoration of mangroves. Moreover, offshore IMTA may create a barrier to trawl fishing which in turn could help restore seagrasses and further enhance blue carbon sequestration. Seaweed and shellfish culture within IMTA could also help to sequester more blue carbon. The greening of aquaculture could face several challenges that need to be addressed in order to realize substantial benefits from enhanced blue carbon sequestration and eventually contribute to global climate change mitigation.

  18. Age-class separation of blue-winged ducks

    Science.gov (United States)

    Hohman, W.L.; Moore, J.L.; Twedt, D.J.; Mensik, John G.; Logerwell, E.

    1995-01-01

    and flyway differences in remigial measurements and reduced performance of age classification models as evidence of high variability in size of blue-winged ducks' remiges. Variability in remigial size of these and other small-bodied waterfowl may be related to nutrition during molt.

  19. Movements of Blue Sharks (Prionace glauca) across Their Life History

    Science.gov (United States)

    Vandeperre, Frederic; Aires-da-Silva, Alexandre; Fontes, Jorge; Santos, Marco; Serrão Santos, Ricardo; Afonso, Pedro

    2014-01-01

    Spatial structuring and segregation by sex and size is considered to be an intrinsic attribute of shark populations. These spatial patterns remain poorly understood, particularly for oceanic species such as blue shark (Prionace glauca), despite its importance for the management and conservation of this highly migratory species. This study presents the results of a long-term electronic tagging experiment to investigate the migratory patterns of blue shark, to elucidate how these patterns change across its life history and to assess the existence of a nursery area in the central North Atlantic. Blue sharks belonging to different life stages (n = 34) were tracked for periods up to 952 days during which they moved extensively (up to an estimated 28.139 km), occupying large parts of the oceanic basin. Notwithstanding a large individual variability, there were pronounced differences in movements and space use across the species' life history. The study provides strong evidence for the existence of a discrete central North Atlantic nursery, where juveniles can reside for up to at least 2 years. In contrast with previously described nurseries of coastal and semi-pelagic sharks, this oceanic nursery is comparatively vast and open suggesting that shelter from predators is not its main function. Subsequently, male and female blue sharks spatially segregate. Females engage in seasonal latitudinal migrations until approaching maturity, when they undergo an ontogenic habitat shift towards tropical latitudes. In contrast, juvenile males generally expanded their range southward and apparently displayed a higher degree of behavioural polymorphism. These results provide important insights into the spatial ecology of pelagic sharks, with implications for the sustainable management of this heavily exploited shark, especially in the central North Atlantic where the presence of a nursery and the seasonal overlap and alternation of different life stages coincides with a high fishing

  20. Infiltrating giant cellular blue naevus.

    Science.gov (United States)

    Bittencourt, A L; Monteiro, D A; De Pretto, O J

    2007-01-01

    Cellular blue naevi (CBN) measure 1-2 cm in diameter and affect the dermis, occasionally extending into the subcutaneous fat. The case of a 14-year-old boy with a giant CBN (GCBN) involving the right half of the face, the jugal mucosa and the lower eyelid with a tumour that had infiltrated the bone and the maxillary and ethmoidal sinuses is reported. Biopsies were taken from the skin, jugal mucosa and maxillary sinus. The following markers were used in the immunohistochemical evaluation: CD34, CD56, HMB-45, anti-S100, A-103, Melan A and MIB-1. The biopsy specimens showed a biphasic pattern affecting the lower dermis, subcutaneous fat, skeletal muscle, bone, jugal mucosa and maxillary sinus, but there was no histological evidence of malignancy. The tumour cells were CD34-, CD56-, HMB45+, anti-S100+ and A-103+. Melan A was focally expressed. No positive MIB-1 cells were identified. The present case shows that GCBN may infiltrate deeply, with no evidence of malignancy.

  1. Modulatory Effect of Monochromatic Blue Light on Heat Stress Response in Commercial Broilers.

    Science.gov (United States)

    Abdo, Safaa E; El-Kassas, Seham; El-Nahas, Abeer F; Mahmoud, Shawky

    2017-01-01

    In a novel approach, monochromatic blue light was used to investigate its modulatory effect on heat stress biomarkers in two commercial broiler strains (Ross 308 and Cobb 500). At 21 days old, birds were divided into four groups including one group housed in white light, a second group exposed to blue light, a 3rd group exposed to white light + heat stress, and a 4th group exposed to blue light + heat stress. Heat treatment at 33°C lasted for five h for four successive days. Exposure to blue light during heat stress reduced MDA concentration and enhanced SOD and CAT enzyme activities as well as modulated their gene expression. Blue light also reduced the degenerative changes that occurred in the liver tissue as a result of heat stress. It regulated, though variably, liver HSP70 , HSP90 , HSF1 , and HSF3 gene expression among Ross and Cobb chickens. Moreover, the Cobb strain showed better performance than Ross manifested by a significant reduction of rectal temperature in the case of H + B. Furthermore, a significant linear relationship was found between the lowered rectal temperature and the expression of all HSP genes. Generally, the performance of both strains by most assessed parameters under heat stress is improved when using blue light.

  2. The Biology of blue-green algae

    National Research Council Canada - National Science Library

    Carr, Nicholas G; Whitton, B. A

    1973-01-01

    .... Their important environmental roles, their part in nitrogen fixation and the biochemistry of phototrophic metabolism are some of the attractions of blue-geen algae to an increasing number of biologists...

  3. Random lasing in blue phase liquid crystals.

    Science.gov (United States)

    Chen, Chun-Wei; Jau, Hung-Chang; Wang, Chun-Ta; Lee, Chun-Hong; Khoo, I C; Lin, Tsung-Hsien

    2012-10-08

    Random lasing actions have been observed in optically isotropic pure blue-phase and polymer-stabilized blue-phase liquid crystals containing laser dyes. Scattering, interferences and recurrent multiple scatterings arising from disordered platelet texture as well as index mismatch between polymer and mesogen in these materials provide the optical feedbacks for lasing action. In polymer stabilized blue-phase liquid crystals, coherent random lasing could occur in the ordered blue phase with an extended temperature interval as well as in the isotropic liquid state. The dependence of lasing wavelength range, mode characteristics, excitation threshold and other pertinent properties on temperature and detailed make-up of the crystals platelets were obtained. Specifically, lasing wavelengths and mode-stability were found to be determined by platelet size, which can be set by controlling the cooling rate; lasing thresholds and emission spectrum are highly dependent on, and therefore can be tuned by temperature.

  4. SUPPLEMENTARY INFORMATION Protonation of Patented Blue V ...

    Indian Academy of Sciences (India)

    XTreme.ws

    SUPPLEMENTARY INFORMATION. Protonation of Patented Blue V in aqueous solutions: Theoretical and experimental studies. KATERYNA BEVZIUKa, ALEXANDER CHEBOTAREVa, MAKSYM FIZERb,. ANASTASIIA KLOCHKOVAa, KONSTANTIN PLIUTAa and DENYS SNIGURa*. aDepartment of Analytical Chemistry, ...

  5. Substantial Research Secures the Blue Future for our Blue Plant

    Directory of Open Access Journals (Sweden)

    Moustafa Abdel Maksoud

    2016-06-01

    Full Text Available Earth, the blue planet, is our home, and seas and oceans cover more than 70% of its surface. As the earth’s population rapidly increases and available resources decrease, seas and oceans can play a key role in assuring the long-term survival of humankind. Renewable maritime energy has huge potential to provide a considerable part of the earth’s population with decarbonised electricity generation systems. Renewable maritime energy is very flexible and can be harvested above the water’s free surface by using offshore wind turbines, on the water’s surface by using wave energy converters or below the water’s surface by using current or tidal turbines. The supposed conflict between environmental protection measures and economic interests is neither viable nor reasonable. Renewable maritime energy can be the motor for considerable substantial economic growth for many maritime regions and therefore for society at large. The fastest growing sector of renewable maritime energy is offshore wind. The annual report of the European Wind Energy Association from the year 2015 confirms the growing relevance of the offshore wind industry. In 2015, the total installed and grid-connected capacity of wind power was 12,800 MW in the EU and 6,013.4 MW in Germany. 38% of the 2015 annual installation in Germany was offshore, accounting for a capacity of 2,282.4 MW. However, there are a limited number of available installation sites in shallow water, meaning that there is an urgent need to develop new offshore structures for water depths greater than 50m. The persistent trend towards deeper waters has encouraged the offshore wind industry to look for floating wind turbine structures and larger turbines. Floating wind turbine technologies are at an early stage of development and many technical and economic challenges will still need to be faced. Nonetheless, intensive research activities and the employment of advanced technologies are the key factors in

  6. Blue emitting organic semiconductors under high pressure

    DEFF Research Database (Denmark)

    Knaapila, Matti; Guha, Suchismita

    2016-01-01

    This review describes essential optical and emerging structural experiments that use high GPa range hydrostatic pressure to probe physical phenomena in blue-emitting organic semiconductors including π-conjugated polyfluorene and related compounds. The work emphasizes molecular structure and inter......This review describes essential optical and emerging structural experiments that use high GPa range hydrostatic pressure to probe physical phenomena in blue-emitting organic semiconductors including π-conjugated polyfluorene and related compounds. The work emphasizes molecular structure...

  7. Blue Flag: a Symbol of Environmental Protection

    Directory of Open Access Journals (Sweden)

    Ioan Petroman

    2010-10-01

    Full Text Available Blue Flag is a high standard symbol of environmental protection and it is awarded to the beaches and agreement ports by the Foundation of Education for the Environment. The beaches having been awarded this distinction warrant particular protection for their visitors, which is a particular point of tourism attractiveness: the result, they are preferred by tourists and, therefore, by tour operators selling tourism packages for the littoral. In 2009, Romanian beaches were not awarded any Blue Flags.

  8. Effect of Twice-Daily Blue Light Treatment on Matrix-Rich Biofilm Development.

    Science.gov (United States)

    de Sousa, Denise Lins; Lima, Ramille Araújo; Zanin, Iriana Carla; Klein, Marlise I; Janal, Malvin N; Duarte, Simone

    2015-01-01

    The use of blue light has been proposed as a direct means of affecting local bacterial infections, however the use of blue light without a photosensitizer to prevent the biofilm development has not yet been explored. The aim of this study was to determine how the twice-daily treatment with blue light affects the development and composition of a matrix-rich biofilm. Biofilms of Streptococcus mutans UA159 were formed on saliva-coated hydroxyapatite discs for 5 days. The biofilms were exposed twice-daily to non-coherent blue light (LumaCare; 420 nm) without a photosensitizer. The distance between the light and the sample was 1.0 cm; energy density of 72 J cm-2; and exposure time of 12 min 56 s. Positive and negative controls were twice-daily 0.12% chlorhexidine (CHX) and 0.89% NaCl, respectively. Biofilms were analyzed for bacterial viability, dry-weight, and extra (EPS-insoluble and soluble) and intracellular (IPS) polysaccharides. Variable pressure scanning electron microscopy and confocal scanning laser microscopy were used to check biofilm morphology and bacterial viability, respectively. When biofilms were exposed to twice-daily blue light, EPS-insoluble was reduced significantly more than in either control group (CHX and 0.89% NaCl). Bacterial viability and dry weight were also reduced relative to the negative control (0.89% NaCl) when the biofilms were treated with twice-daily blue light. Different morphology was also visible when the biofilms were treated with blue light. Twice-daily treatment with blue light without a photosensitizer is a promising mechanism for the inhibition of matrix-rich biofilm development.

  9. Comparison of Alcian Blue, Trypan Blue, and Toluidine Blue for Visualization of the Primo Vascular System Floating in Lymph Ducts

    Directory of Open Access Journals (Sweden)

    Da-Un Kim

    2015-01-01

    Full Text Available The primo vascular system (PVS, floating in lymph ducts, was too transparent to be observed by using a stereomicroscope. It was only detectable with the aid of staining dyes, for instance, Alcian blue, which was injected into the lymph nodes. Some dyes were absorbed preferentially by the PVS than the lymph wall. It remains a standing problem to know what dyes are absorbed better by the PVS than the lymph walls. Such information would be useful to unravel the biochemical properties of the PVS that are badly in need for obtaining large amount of PVS specimens. In the current work we tried two other familiar dyes which were used in PVS research before. We found that Trypan blue and toluidine blue did not visualize the PVS. Trypan blue was cleared by the natural washing. Toluidine blue did not stain the PVS, but it did leave stained spots in the lymph wall and its surrounding tissues, and it leaked out of the lymph wall to stain surrounding connective tissues. These completely different behaviors of the three dyes were found for the first time in the current work and provide valuable information to elucidate the mechanism through which some special dyes stained the PVS preferentially compared to the lymphatic wall.

  10. Variations on the "Blue-Bottle" Demonstration Using Food Items That Contain FD&C Blue #1

    Science.gov (United States)

    Staiger, Felicia A.; Peterson, Joshua P.; Campbell, Dean J.

    2015-01-01

    Erioglaucine dye (FD&C Blue #1) can be used instead of methylene blue in the classic "blue-bottle" demonstration. Food items containing FD&C Blue #1 and reducing species such as sugars can therefore be used at the heart of this demonstration, which simply requires the addition of strong base such as sodium hydroxide lye.

  11. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...

  12. "Blue-Collar Blues" uurib töösuhteid uutes oludes / Janar Ala

    Index Scriptorium Estoniae

    Ala, Janar, 1979-

    2009-01-01

    Tööproblemaatikat käsitlev näitus "Blue-Collar Blues" Tallinna Kunstihoones ja Tallinna Kunstihoone galeriis 31. jaanuarini 2010, kuraator Anders Härm. Lähemalt belgia-mehhiko kunstniku Francis Alys'e videost, austria kunstniku Oliver Ressleri ning venetsueela-saksa politoloogi Dario Azzelini videost "Viis tehast. Tööliste kontroll Venezuelas"

  13. Dyes adsorption blue vegetable and blue watercolor by natural zeolites modified with surfactants

    International Nuclear Information System (INIS)

    Jardon S, C. C.; Olguin G, M. T.; Diaz N, M. C.

    2009-01-01

    In this work was carried out the dyes removal blue vegetable and blue watercolor of aqueous solutions, to 20 C, at different times and using a zeolite mineral of Parral (Chihuahua, Mexico) modified with hexadecyl trimethyl ammonium bromide or dodecyl trimethyl ammonium bromide. The zeolite was characterized before and after of its adaptation with NaCl and later with HDTMABr and DTMABr. For the materials characterization were used the scanning electron microscopy of high vacuum; elementary microanalysis by X-ray spectroscopy of dispersed energy and X-ray diffraction techniques. It was found that the surfactant type absorbed in the zeolite material influences on the adsorption process of the blue dye. Likewise, the chemical structure between the vegetable blue dye and the blue watercolor, determines the efficiency of the color removal of the water, by the zeolites modified with the surfactants. (Author)

  14. Can short time delays influence the variability of the solar cycle?

    Science.gov (United States)

    Jouve, Laurène; Proctor, Michael R. E.; Lesur, Geoffroy

    2011-08-01

    We present the effects of introducing results of 3D MHD simulations of buoyant magnetic fields in the solar convection zone in 2D mean-field Babcock-Leighton models. In particular, we take into account the time delay introduced by the rise time of the toroidal structures from the base of the convection zone to the solar surface. We find that the delays produce large temporal modulation of the cycle amplitude even when strong and thus rapidly rising flux tubes are considered. The study of a reduced model reveals that aperiodic modulations of the solar cycle appear after a sequence of period doubling bifurcations typical of non-linear systems. We also discuss the memory of such systems and the conclusions which may be drawn concerning the actual solar cycle variability.

  15. Teknologi penyamakan kulit wet blue buaya

    Directory of Open Access Journals (Sweden)

    Bambang Oetojo

    1992-08-01

    Full Text Available For this study it was used 12 pieces of grain salted crocodile skin of 11 up to 14 inch width. All of the crocodile skin were process up to pickling with the same way. Furthermore pickled crocodile skins were process up to pickling with the same way. Furthermore pickled crocodile skins and was done twice. The wet blue output from the research was visual investigated for the coulor using staning scale method. For comparition it was used pickled crocodile skins. Statistical analysis pints out that there is unsignify difference (P<0.05 the influence of the used of basic chrome sulphate to the colour of wet blue crocodile skins. Practical meaning of the research is, for tanning of crocodile skins to the wet blue, it is used 1.5% basic chromium sulphate.

  16. Intraoral blue (Jadassohn-Tieche) nevus.

    Science.gov (United States)

    Hasse, C D; Zoutendam, G L; Gombas, O F

    1978-05-01

    Blue nevus of the oral mucosa is a distinctly uncommon clincial entity. Careful review of the literature yielded thirty-one previously reported cases. The present article reports the occurrence of a blue nevus of the hard palate in a 58-year-old man. It is of interest since it is the smallest (1 by 1 mm.) intraoral blue nevus to be reported. A clinicopathologic study of the previous thirty-one cases and of our case suggests that this lesion has no age or sex predilection. The most common site of occurrence was the hard palate. There appears to be no tendency toward recurrence. A brief review of the historical background, clinical features, theories of possible origin, and differential diagnosis is presented. Excisional biopsy of localized areas of oral pibmentation, together with histopathologic study, is indicated to rule out melanoma.

  17. Influence of blue light spectrum filter on short-wavelength and standard automated perimetries.

    Science.gov (United States)

    Castro, Leonardo Cunha; de Souza, Carlos Eduardo Barbosa; Soriano, Eduardo Sone; Melo, Luiz Alberto Soares; Paranhos, Augusto

    2006-01-01

    To evaluate the influence of a blue light spectrum filter (BLSF), similar in light spectrum transmittance to the intraocular lens Acrysof Natural, on standard automated perimetry (SAP) and short-wavelength automated perimetry (SWAP). Twenty young individuals (automated perimetry (SAP) and short-wavelength automated perimetry (SWAP) with and without a blue light spectrum filter. All patients had intraocular pressure lower than 21 mmHg, normal fundus biomicroscopy, and no crystalline lens opacity. Foveal threshold (FT), mean deviation (MD), and pattern standard deviation (PSD) indexes obtained from the visual field tests and the difference caused by eccentricity in short-wavelength automated perimetry examinations were analyzed using paired t test. Interindividual variability (standard deviation) was calculated using Pitman's test for correlated samples. Statistically significant reductions in the mean deviation (p automated perimetry with the use of the blue light spectrum filter in comparison to short-wavelength automated perimetry without the use of the blue light spectrum filter were observed, but not in standard automated perimetry exams. No other parameters showed statistically significant differences in the short-wavelength automated perimetry and standard automated perimetry tests. Interindividual standard deviation of the test points in the short-wavelength automated perimetry exams increased with eccentricity both with and without the use of the blue light spectrum filter, as sensitivity for inferior and superior hemifields (inferior hemifield minus superior hemifield), but no statistically significant difference in the variability when comparing the use or not of the blue light spectrum filter was noted. When comparing only the four most inferior points and the four most superior points, the inferior-superior difference increases in both situations - without and with the use of the blue light spectrum filter. The difference between without and with the use

  18. Blue light inhibits proliferation of melanoma cells

    Science.gov (United States)

    Becker, Anja; Distler, Elisabeth; Klapczynski, Anna; Arpino, Fabiola; Kuch, Natalia; Simon-Keller, Katja; Sticht, Carsten; van Abeelen, Frank A.; Gretz, Norbert; Oversluizen, Gerrit

    2016-03-01

    Photobiomodulation with blue light is used for several treatment paradigms such as neonatal jaundice, psoriasis and back pain. However, little is known about possible side effects concerning melanoma cells in the skin. The aim of this study was to assess the safety of blue LED irradiation with respect to proliferation of melanoma cells. For that purpose we used the human malignant melanoma cell line SK-MEL28. Cell proliferation was decreased in blue light irradiated cells where the effect size depended on light irradiation dosage. Furthermore, with a repeated irradiation of the melanoma cells on two consecutive days the effect could be intensified. Fluorescence-activated cell sorting with Annexin V and Propidium iodide labeling did not show a higher number of dead cells after blue light irradiation compared to non-irradiated cells. Gene expression analysis revealed down-regulated genes in pathways connected to anti-inflammatory response, like B cell signaling and phagosome. Most prominent pathways with up-regulation of genes were cytochrome P450, steroid hormone biosynthesis. Furthermore, even though cells showed a decrease in proliferation, genes connected to the cell cycle were up-regulated after 24h. This result is concordant with XTT test 48h after irradiation, where irradiated cells showed the same proliferation as the no light negative control. In summary, proliferation of melanoma cells can be decreased using blue light irradiation. Nevertheless, the gene expression analysis has to be further evaluated and more studies, such as in-vivo experiments, are warranted to further assess the safety of blue light treatment.

  19. Time variability of X-ray binaries: observations with INTEGRAL. Modeling

    International Nuclear Information System (INIS)

    Cabanac, Clement

    2007-01-01

    The exact origin of the observed X and Gamma ray variability in X-ray binaries is still an open debate in high energy astrophysics. Among others, these objects are showing aperiodic and quasi-periodic luminosity variations on timescales as small as the millisecond. This erratic behavior must put constraints on the proposed emission processes occurring in the vicinity of the neutrons star or the stellar mass black-hole held by these objects. We propose here to study their behavior following 3 different ways: first we examine the evolution of a particular X-ray source discovered by INTEGRAL, IGR J19140+0951. Using timing and spectral data given by different instruments, we show that the source type is plausibly consistent with a High Mass X-ray Binary hosting a neutrons star. Subsequently, we propose a new method dedicated to the study of timing data coming from coded mask aperture instruments. Using it on INTEGRAL/ISGRI real data, we detect the presence of periodic and quasi-periodic features in some pulsars and micro-quasars at energies as high as a hundred keV. Finally, we suggest a model designed to describe the low frequency variability of X-ray binaries in their hardest state. This model is based on thermal comptonization of soft photons by a warm corona in which a pressure wave is propagating in cylindrical geometry. By computing both numerical simulations and analytical solution, we show that this model should be suitable to describe some of the typical features observed in X-ray binaries power spectra in their hard state and their evolution such as aperiodic noise and low frequency quasi-periodic oscillations. (author) [fr

  20. Blue and Red Light-Evoked Pupil Responses in Photophobic Subjects with TBI.

    Science.gov (United States)

    Yuhas, Phillip T; Shorter, Patrick D; McDaniel, Catherine E; Earley, Michael J; Hartwick, Andrew T E

    2017-01-01

    Photophobia is a common symptom in individuals suffering from traumatic brain injury (TBI). Recent evidence has implicated blue light-sensitive intrinsically photosensitive retinal ganglion cells (ipRGCs) in contributing to the neural circuitry mediating photophobia in migraine sufferers. The goal of this work is to test the hypothesis that ipRGC function is altered in TBI patients with photophobia by assessing pupillary responses to blue and red light. Twenty-four case participants (mean age 43.3; 58% female), with mild TBI and self-reported photophobia, and 12 control participants (mean age 42.6; 58% female) were in this study. After 10 minutes of dark adaptation, blue (470 nm, 1 × 10 phots/s/cm) and red (625 nm, 7 × 10 phots/s/cm) flashing (0.1 Hz) light stimuli were delivered for 30 seconds to the dilated left eye while the right pupil was recorded. The amplitude of normalized pupil fluctuation (constriction and dilation) was quantified using Fourier fast transforms. In both case and control participants, the amplitude of pupil fluctuation was significantly less for the blue light stimuli as compared to the red light stimuli, consistent with a contribution of ipRGCs to these pupil responses. There was no significant difference in the mean pupil fluctuation amplitudes between the two participant groups, but case participants displayed greater variability in their pupil responses to the blue stimulus. Case and control participants showed robust ipRGC-mediated components in their pupil responses to blue light. The results did not support the hypothesis that ipRGCs are "hypersensitive" to light in TBI participants with photophobia. However, greater pupil response variability in the case subjects suggests that ipRGC function may be more heterogeneous in this group.

  1. The effect of blue light on stomatal oscillations and leaf turgor pressure in banana leaves.

    Science.gov (United States)

    Zait, Yotam; Shapira, Or; Schwartz, Amnon

    2017-07-01

    Stomatal oscillations are cyclic opening and closing of stomata, presumed to initiate from hydraulic mismatch between leaf water supply and transpiration rate. To test this assumption, mismatches between water supply and transpiration were induced using manipulations of vapour pressure deficit (VPD) and light spectrum in banana (Musa acuminata). Simultaneous measurements of gas exchange with changes in leaf turgor pressure were used to describe the hydraulic mismatches. An increase of VPD above a certain threshold caused stomatal oscillations with variable amplitudes. Oscillations in leaf turgor pressure were synchronized with stomatal oscillations and balanced only when transpiration equaled water supply. Surprisingly, changing the light spectrum from red and blue to red alone at constant VPD also induced stomatal oscillations - while the addition of blue (10%) to red light only ended oscillations. Blue light is known to induce stomatal opening and thus should increase the hydraulic mismatch, reduce the VPD threshold for oscillations and increase the oscillation amplitude. Unexpectedly, blue light reduced oscillation amplitude, increased VPD threshold and reduced turgor pressure loss. These results suggest that additionally, to the known effect of blue light on the hydroactive opening response of stomata, it can also effect stomatal movement by increased xylem-epidermis water supply. © 2017 John Wiley & Sons Ltd.

  2. Iris color and intraocular pressure: the Blue Mountains Eye Study.

    Science.gov (United States)

    Mitchell, Robert; Rochtchina, Elena; Lee, Anne; Wang, Jie Jin; Mitchell, Paul

    2003-03-01

    To assess the relationship between iris color and intraocular pressure (IOP). Population-based, cross-sectional study. The Blue Mountains Eye Study examined 3,654 largely Caucasian participants, aged 49 to 97 years, from 1992 to 1994. Information was collected about glaucoma risk factors, and Goldmann applanation IOP measurements were taken. Iris color was assessed by comparing the undilated appearance of each eye with three standard photographs. Participants who had previous cataract or glaucoma surgery and those using glaucoma medications were excluded. Mean IOP measurements increased with increasing grades of iris pigmentation. After simultaneous adjustment for variables associated with IOP, mean measurements were 15.92 mm Hg for blue iris color, 16.04 mm Hg for hazel or green, 16.11 mm Hg for tan-brown, and 16.49 mm Hg for dark brown (P for trend = .001). This study demonstrates a modest but statistically significant association between increasing iris color and IOP. Copyright 2003 by Elsevier Science Inc.

  3. Blue whales respond to simulated mid-frequency military sonar.

    Science.gov (United States)

    Goldbogen, Jeremy A; Southall, Brandon L; DeRuiter, Stacy L; Calambokidis, John; Friedlaender, Ari S; Hazen, Elliott L; Falcone, Erin A; Schorr, Gregory S; Douglas, Annie; Moretti, David J; Kyburg, Chris; McKenna, Megan F; Tyack, Peter L

    2013-08-22

    Mid-frequency military (1-10 kHz) sonars have been associated with lethal mass strandings of deep-diving toothed whales, but the effects on endangered baleen whale species are virtually unknown. Here, we used controlled exposure experiments with simulated military sonar and other mid-frequency sounds to measure behavioural responses of tagged blue whales (Balaenoptera musculus) in feeding areas within the Southern California Bight. Despite using source levels orders of magnitude below some operational military systems, our results demonstrate that mid-frequency sound can significantly affect blue whale behaviour, especially during deep feeding modes. When a response occurred, behavioural changes varied widely from cessation of deep feeding to increased swimming speed and directed travel away from the sound source. The variability of these behavioural responses was largely influenced by a complex interaction of behavioural state, the type of mid-frequency sound and received sound level. Sonar-induced disruption of feeding and displacement from high-quality prey patches could have significant and previously undocumented impacts on baleen whale foraging ecology, individual fitness and population health.

  4. Pectoral sound generation in the blue catfish Ictalurus furcatus.

    Science.gov (United States)

    Mohajer, Yasha; Ghahramani, Zachary; Fine, Michael L

    2015-03-01

    Catfishes produce pectoral stridulatory sounds by "jerk" movements that rub ridges on the dorsal process against the cleithrum. We recorded sound synchronized with high-speed video to investigate the hypothesis that blue catfish Ictalurus furcatus produce sounds by a slip-stick mechanism, previously described only in invertebrates. Blue catfish produce a variably paced series of sound pulses during abduction sweeps (pulsers) although some individuals (sliders) form longer duration sound units (slides) interspersed with pulses. Typical pulser sounds are evoked by short 1-2 ms movements with a rotation of 2°-3°. Jerks excite sounds that increase in amplitude after motion stops, suggesting constructive interference, which decays before the next jerk. Longer contact of the ridges produces a more steady-state sound in slides. Pulse pattern during stridulation is determined by pauses without movement: the spine moves during about 14 % of the abduction sweep in pulsers (~45 % in sliders) although movement appears continuous to the human eye. Spine rotation parameters do not predict pulse amplitude, but amplitude correlates with pause duration suggesting that force between the dorsal process and cleithrum increases with longer pauses. Sound production, stimulated by a series of rapid movements that set the pectoral girdle into resonance, is caused by a slip-stick mechanism.

  5. Variability Bugs:

    DEFF Research Database (Denmark)

    Melo, Jean

    Many modern software systems are highly configurable. They embrace variability to increase adaptability and to lower cost. To implement configurable software, developers often use the C preprocessor (CPP), which is a well-known technique, mainly in industry, to deal with variability in code....... Although many researchers suggest that preprocessor-based variability amplifies maintenance problems, there is little to no hard evidence on how actually variability affects programs and programmers. Specifically, how does variability affect programmers during maintenance tasks (bug finding in particular...... be exploited. Variability bugs are not confined to any particular type of bug, error-prone feature, or location. In addition to introducing an exponential number of program variants, variability increases the complexity of bugs due to unintended feature interactions, hidden features, combinations of layers...

  6. Biodecolorization and biodegradation of Reactive Blue by ...

    African Journals Online (AJOL)

    Aspergillus sp. effectively decolorized Reactive Blue and other structurally different synthetic dyes. Agitation was found to be an important parameter, while glucose (99%), sucrose (97%) and mannitol (98%) were the best carbon sources for the decolorization. Decolorization was effective in an acidic environment (pH 3).

  7. Geographical Study of American Blues Culture

    Science.gov (United States)

    Strait, John B.

    2010-01-01

    Music is not often utilized in teaching geography, despite the fact that many scholars orient their research around analyzing both the historical and spatial dimensions of musical expression. This article reports on the use of a teaching module that utilizes blues culture as a lens to understand the geographical history of the United States. The…

  8. Nanotubes based on monolayer blue phosphorus

    KAUST Repository

    Montes Muñoz, Enrique

    2016-07-08

    We demonstrate structural stability of monolayer zigzag and armchair blue phosphorus nanotubes by means of molecular dynamics simulations. The vibrational spectrum and electronic band structure are determined and analyzed as functions of the tube diameter and axial strain. The nanotubes are found to be semiconductors with a sensitive indirect band gap that allows flexible tuning.

  9. Blue whales respond to anthropogenic noise.

    Directory of Open Access Journals (Sweden)

    Mariana L Melcón

    Full Text Available Anthropogenic noise may significantly impact exposed marine mammals. This work studied the vocalization response of endangered blue whales to anthropogenic noise sources in the mid-frequency range using passive acoustic monitoring in the Southern California Bight. Blue whales were less likely to produce calls when mid-frequency active sonar was present. This reduction was more pronounced when the sonar source was closer to the animal, at higher sound levels. The animals were equally likely to stop calling at any time of day, showing no diel pattern in their sensitivity to sonar. Conversely, the likelihood of whales emitting calls increased when ship sounds were nearby. Whales did not show a differential response to ship noise as a function of the time of the day either. These results demonstrate that anthropogenic noise, even at frequencies well above the blue whales' sound production range, has a strong probability of eliciting changes in vocal behavior. The long-term implications of disruption in call production to blue whale foraging and other behaviors are currently not well understood.

  10. Prussian Blue Analogues of Reduced Dimensionality

    NARCIS (Netherlands)

    Gengler, Regis Y. N.; Toma, Luminita M.; Pardo, Emilio; Lloret, Francesc; Ke, Xiaoxing; Van Tendeloo, Gustaaf; Gournis, Dimitrios; Rudolf, Petra

    2012-01-01

    Mixed-valence polycyanides (Prussian Blue analogues) possess a rich palette of properties spanning from room-temperature ferromagnetism to zero thermal expansion, which can be tuned by chemical modifications or the application of external stimuli (temperature, pressure, light irradiation). While

  11. African Retentions in Blues and Jazz.

    Science.gov (United States)

    Meadows, Eddie S.

    1979-01-01

    The perseverance of African musical characteristics among American Blacks is an historic reality. African retentions have been recorded in Black music of the antebellum period. Various African scales and rhythms permeate Black American music today as evidenced in the retentions found in blues and jazz. (RLV)

  12. A Discography of the Real Blues

    Science.gov (United States)

    Tudor, Dean

    1972-01-01

    A short account of the rise and decline of the Blues and a discussion of the artists who performed it is followed by an annotated bibliography of periodicals, books, records and tapes related to this form of Black" music. (184 references) (NH)

  13. Blue laser phase change recording system

    International Nuclear Information System (INIS)

    Hofmann, Holger; Dambach, S.Soeren; Richter, Hartmut

    2002-01-01

    The migration paths from DVD phase change recording with red laser to the next generation optical disk formats with blue laser and high NA optics are discussed with respect to optical aberration margins and disc capacities. A test system for the evaluation of phase change disks with more than 20 GB capacity is presented and first results of the recording performance are shown

  14. [The dangers of blue light: True story!].

    Science.gov (United States)

    Renard, G; Leid, J

    2016-05-01

    The dangers of the blue light are the object of numerous publications, for both the scientific community and the general public. The new prolific development of light sources emitting potentially toxic blue light (415-455nm) ranges from LED (Light Emitting Diodes) lamps for interior lighting to television screens, computers, digital tablets and smartphones using OLED (Organic Light Emitting Diode) or AMOLED (Active-Matrix Organic Light Emitting Diode) technology. First we will review some technical terms and the main characteristics of light perceived by the human eye. Then we will discuss scientific proof of the toxicity of blue light to the eye, which may cause cataract or macular degeneration. Analysis of the light spectra of several light sources, from natural light to LED lamps, will allow us to specify even better the dangers related to each light source. LED lamps, whether used as components for interior lighting or screens, are of concern if they are used for extended viewing times and at short distance. While we can protect ourselves from natural blue light by wearing colored glasses which filter out, on both front and back surfaces, the toxic wavelengths, it is more difficult to protect oneself from LED lamps in internal lighting, the use of which should be restricted to "white warmth" lamps (2700K). As far as OLED or AMOLED screens are concerned, the only effective protection consists of using them occasionally and only for a short period of time. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  15. Biodecolorization and biodegradation of Reactive Blue by ...

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... Aspergillus sp. effectively decolorized Reactive Blue and other structurally different synthetic dyes. Agitation was found to be an important ... Few chemically different dyes such as Reactive Black (75%), Reactive Yellow (70%),. Reactive Red (33%) and ..... Degradation of azo dyes by the lignin degrading ...

  16. Pulse electrodeposition of Prussian Blue thin films

    International Nuclear Information System (INIS)

    Najafisayar, P.; Bahrololoom, M.E.

    2013-01-01

    The effects of pulse electrodeposition parameters like peak current density and frequency on the electrochemical properties of Prussian Blue thin films were investigated. Electrochemical Impedance Spectroscopy, Cyclic Voltammetry and Chronoamperometry tests were carried out on Prussian Blue thin films which were pulse electrodeposited on Indium Tin Oxide coated glass substrates. The results showed that increase in the peak current densities and using higher pulsating frequencies during electrodeposition decreases the charge transfer resistance of the thin films while the diffusion coefficient of electroactive species in the films is increased as a consequence of using the same pulsating parameters. In addition, pulse electrodeposition technique does not alter deposition mechanism and morphology of the Prussian Blue thin films. - Highlights: • Prussian Blue thin films were pulse electrodeposited onto the ITO coated glass. • Pulse current condition affected thin films' electrochemical properties. • High pulsating current and frequency lower thin films' charge transfer resistance. • High pulsating current and frequency increase diffusion coefficient in thin films

  17. Characterization of dough baked via blue laser

    NARCIS (Netherlands)

    Blutinger, Jonathan David; Meijers, Yorán; Chen, Peter Yichen; Zheng, Changxi; Grinspun, Eitan; Lipson, Hod

    2018-01-01

    Depth of heat penetration and temperature must be precisely controlled to optimize nutritional value, appearance, and taste of food products. These objectives can be achieved with the use of a high-resolution blue diode laser—which operates at 445 nm—by adjusting the water content of the dough and

  18. Blue LED irradiation to hydration of skin

    Science.gov (United States)

    Menezes, Priscila F. C.; Requena, Michelle B.; Lizarelli, Rosane F., Z.; Bagnato, Vanderlei S.

    2015-06-01

    Blue LED system irradiation shows many important properties on skin as: bacterial decontamination, degradation of endogenous skin chromophores and biostimulation. In this clinical study we prove that the blue light improves the skin hydration. In the literature none authors reports this biological property on skin. Then this study aims to discuss the role of blue light in the skin hydration. Twenty patients were selected to this study with age between 25-35 years old and phototype I, II and III. A defined area from forearm was pre determined (A = 4.0 cm2). The study was randomized in two treatment groups using one blue light device (power of 5.3mW and irradiance of 10.8mW/cm2). The first treatment group was irradiated with 3J/cm2 (277seconds) and the second with 6J/cm2 (555 seconds). The skin hydration evaluations were done using a corneometer. The measurements were collected in 7, 14, 21 and 30 days, during the treatment. Statistical test of ANOVA, Tukey and T-Student were applied considering 5% of significance. In conclusion, both doses were able to improve the skin hydration; however, 6J/cm2 has kept this hydration for 30 days.

  19. KINETICS AND MECHANISM OF PRUSSIAN BLUE FORMATION ...

    African Journals Online (AJOL)

    Preferred Customer

    This intense blue colored pigment is used in the preparation of paints, printing inks, laundry dye, etc. [1]. The micro-porous character of PB and its analogues find ... industrial applications such as in removal of heavy metal ions in wine production [4], electrochemical application as battery building [5], electronic switching and ...

  20. The Biology of blue-green algae

    National Research Council Canada - National Science Library

    Carr, Nicholas G; Whitton, B. A

    1973-01-01

    .... This book, extensively illustrated and thoroughly referenced, will provide the source material for students, and experienced as well as new research workers should find it of great value. A series of short appendices summarize details of culture collections, media and some specialized aspects of growing blue-green algae.

  1. METHYLENE BLUE ADSORPTION FROM GLYCEROL SOLUTION ...

    African Journals Online (AJOL)

    Preferred Customer

    ABSTRACT. The mechanism of methylene blue adsorption onto the surface of synthetic acicular habit of α- goethite from glycerol solution has been studied through batch experiment at 25, 30 and 35 0C in a glass cell of minimal dead volume. To describe the adsorption results, an attempt was made to fit the data to the ...

  2. The 1993-1994 Blue Ribbon Schools.

    Science.gov (United States)

    Schaefer, Christine M.

    1994-01-01

    This year's 276 Blue Ribbon schools, including 220 public and 56 private schools, are in 45 states and the District of Columbia, with a Department of Defense school in Honshu, Japan. About 70% are headed by women principals. In 89 schools, students from low-income families comprise at least a quarter of the enrollment. Schools are listed by state.…

  3. Approaches to blue light emitting polymers

    International Nuclear Information System (INIS)

    Taylor, R.M.

    2000-01-01

    Blue-light emitting polymers are important for full colour displays. Blue- light emitting polymers, such as poly(fluorene)s have been reported, but tend to be soluble in the conjugated form. The aim of the project was to produce insoluble polymers, prepared via processible soluble precursor polymers, so that multilayer devices could be easily fabricated. Multilayer devices are often required for more efficient light emission. The target materials were derivatives of poly(p-phenylenevinylene) (PPV), a green-yellow emitting polymer. To blue shift the emission of PPV, bulky substituents, namely chloro, phenyl and alkyl, were attached to the vinylic linkage. These bulky substituents were incorporated to introduce steric interactions between the side group and the backbone phenyl protons, to shorten the effective conjugation length and increase the HOMO-LUMO energy gap. Chloro substituents quenched the fluorescence. Phenyl substituents resulted in highly conjugated precursor polymers with low molecular weights, showing blue- green to green emission in the conjugated form. Alkyl substituted PPV derivatives, prepared via chloro or xanthate precursors, were blue-light emitting conjugated polymers, which were electroluminescent in ITO/polymer/AI devices. The PL quantum yields were found to be up to 38%. The incorporation of electron withdrawing groups into the polymers was attempted, to lower the barrier to electron injection. Chloro groups quenched fluorescence and methylsulfone substituents resulted in insoluble polymers, probably due to cross-linking. However a copolymer containing methylsulfone electron withdrawing groups could be prepared. Phenylsulfone substituents were found to give fluorescent polymers which were soluble in the precursor form. (author)

  4. Pianure Blues: From the Dialect of the Plains to the English of the Blues

    Directory of Open Access Journals (Sweden)

    Giovanni Nadiani

    2016-06-01

    Full Text Available In this article the authors describe a joint performance project called Pianure Blues, in which poems in Romagnolo dialect are transposed into English and performed as blues songs, and in which songs from the Anglo-American blues/roots/folk tradition are transposed and performed as poems in Romagnolo dialect – a process they have called ‘trans-staging’. A process in which they are writers and performers and, especially, translators; translators of each other’s voices, stories, landscapes, rhythms and sounds as they look for the bond between places, languages and traditions that seem very distant from each other but which find a common mood and poetic language, a common aesthetic, in their performances. The authors reflect on the creative process involved and on the significance of establishing an intersemiotic dialogue between a ‘minority’ dialect such as Romagnolo and a ‘global’ language such as English, and the blues, have become.

  5. The water use of Indian diets and socio-demographic factors related to dietary blue water footprint.

    Science.gov (United States)

    Harris, Francesca; Green, Rosemary F; Joy, Edward J M; Kayatz, Benjamin; Haines, Andy; Dangour, Alan D

    2017-06-01

    Agriculture accounts for ~90% of India's fresh water use, and there are concerns that future food production will be threatened by insufficient water supply of adequate quality. This study aimed to quantify the water required in the production of diets in India using the water footprint (WF) assessment method. The socio-demographic associations of dietary WFs were explored using mixed effects regression models with a particular focus on blue (irrigation) WF given the importance for Indian agriculture. Dietary data from ~7000 adults living in India were matched to India-specific WF data for food groups to quantify the blue and green (rainfall) WF of typical diets. The mean blue and green WF of diets was 737l/capita/day and 2531l/capita/day, respectively. Vegetables had the lowest WFs per unit mass of product, while roots/tubers had the lowest WFs per unit dietary energy. Poultry products had the greatest blue WFs. Wheat and rice contributed 31% and 19% of the dietary blue WF respectively. Vegetable oils were the highest contributor to dietary green WF. Regional variation in dietary choices meant large differences in dietary blue WFs, whereby northern diets had nearly 1.5 times greater blue WFs than southern diets. Urban diets had a higher blue WF than rural diets, and a higher standard of living was associated with larger dietary blue WFs. This study provides a novel perspective on the WF of diets in India using individual-level dietary data, and demonstrates important variability in WFs due to different food consumption patterns and socio-demographic characteristics. Future dietary shifts towards patterns currently consumed by individuals in higher income groups, would likely increase irrigation requirements putting substantial pressure on India's water resources. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Hubble's View of Little Blue Dots

    Science.gov (United States)

    Kohler, Susanna

    2018-02-01

    The recent discovery of a new type of tiny, star-forming galaxy is the latest in a zoo of detections shedding light on our early universe. What can we learn from the unique little blue dots found in archival Hubble data?Peas, Berries, and DotsGreen pea galaxies identified by citizen scientists with Galaxy Zoo. [Richard Nowell Carolin Cardamone]As telescope capabilities improve and we develop increasingly deeper large-scale surveys of our universe, we continue to learn more about small, faraway galaxies. In recent years, increasing sensitivity first enabled the detection of green peas luminous, compact, low-mass (10 billion solar masses; compare this to the Milky Ways 1 trillion solar masses!) galaxies with high rates of star formation.Not long thereafter, we discovered galaxies that form stars similarly rapidly, but are even smaller only 330 million solar masses, spanning less than 3,000 light-years in size. These tiny powerhouses were termed blueberries for their distinctive color.Now, scientists Debra and Bruce Elmegreen (of Vassar College and IBM Research Division, respectively) report the discovery of galaxies that have even higher star formation rates and even lower masses: little blue dots.Exploring Tiny Star FactoriesThe Elmegreens discovered these unique galaxies by exploring archival Hubble data. The Hubble Frontier Fields data consist of deep images of six distant galaxy clusters and the parallel fields next to them. It was in the archival data for two Frontier Field Parallels, those for clusters Abell 2744 and MAS J0416.1-2403, that the authors noticed several galaxies that stand out as tiny, bright, blue objects that are nearly point sources.Top: a few examples of the little blue dots recently identified in two Hubble Frontier Field Parallels. Bottom: stacked images for three different groups of little blue dots. [Elmegreen Elmegreen 2017]The authors performed a search through the two Frontier Field Parallels, discovering a total of 55 little blue dots

  7. Short-term variability and mass loss in Be stars. II. Physical taxonomy of photometric variability observed by the Kepler spacecraft

    Science.gov (United States)

    Rivinius, Th.; Baade, D.; Carciofi, A. C.

    2016-09-01

    Context. Classical Be stars have been established as pulsating stars. Space-based photometric monitoring missions contributed significantly to that result. However, whether Be stars are just rapidly rotating SPB or β Cep stars, or whether they have to be understood differently, remains debated in the view of their highly complex power spectra. Aims: Kepler data of three known Be stars are re-visited to establish their pulsational nature and assess the properties of additional, non-pulsational variations. The three program stars turned out to be one inactive Be star, one active, continuously outbursting Be star, and one Be star transiting from a non-outbursting into an outbursting phase, thus forming an excellent sample to distill properties of Be stars in the various phases of their life-cycle. Methods: The Kepler data was first cleaned from any long-term variability with Lomb-Scargle based pre-whitening. Then a Lomb-Scargle analysis of the remaining short-term variations was compared to a wavelet analysis of the cleaned data. This offers a new view on the variability, as it enables us to see the temporal evolution of the variability and phase relations between supposed beating phenomena, which are typically not visualized in a Lomb-Scargle analysis. Results: The short-term photometric variability of Be stars must be disentangled into a stellar and a circumstellar part. The stellar part is on the whole not different from what is seen in non-Be stars. However, some of the observed phenomena might be to be due to resonant mode coupling, a mechanism not typically considered for B-type stars. Short-term circumstellar variability comes in the form of either a group of relatively well-defined, short-lived frequencies during outbursts, which are called Štefl frequencies, and broad bumps in the power spectra, indicating aperiodic variability on a time scale similar to typical low-order g-mode pulsation frequencies, rather than true periodicity. Conclusions: From a

  8. Eggshell spottiness reflects maternally transferred antibodies in blue tits.

    Directory of Open Access Journals (Sweden)

    Marie-Jeanne Holveck

    Full Text Available Blue-green and brown-spotted eggshells in birds have been proposed as sexual signals of female physiological condition and egg quality, reflecting maternal investment in the egg. Testing this hypothesis requires linking eggshell coloration to egg content, which is lacking for brown protoporphyrin-based pigmentation. As protoporphyrins can induce oxidative stress, and a large amount in eggshells should indicate either high female and egg quality if it reflects the female's high oxidative tolerance, or conversely poor quality if it reflects female physiological stress. Different studies supported either predictions but are difficult to compare given the methodological differences in eggshell-spottiness measurements. Using the blue tit Cyanistes caeruleus as a model species, we aimed at disentangling both predictions in testing if brown-spotted eggshell could reflect the quality of maternal investment in antibodies and carotenoids in the egg, and at improving between-study comparisons in correlating several common measurements of eggshell coloration (spectral and digital measures, spotted surface, pigmentation indices. We found that these color variables were weakly correlated highlighting the need for comparable quantitative measurements between studies and for multivariate regressions incorporating several eggshell-color characteristics. When evaluating the potential signaling function of brown-spotted eggshells, we thus searched for the brown eggshell-color variables that best predicted the maternal transfer of antibodies and carotenoids to egg yolks. We also tested the effects of several parental traits and breeding parameters potentially affecting this transfer. While eggshell coloration did not relate to yolk carotenoids, the eggs with larger and less evenly-distributed spots had higher antibody concentrations, suggesting that both the quantity and distribution of brown pigments reflected the transfer of maternal immune compounds in egg yolks

  9. The Blue Coma: The Role of Methylene Blue in Unexplained Coma After Cardiac Surgery.

    Science.gov (United States)

    Martino, Enrico Antonio; Winterton, Dario; Nardelli, Pasquale; Pasin, Laura; Calabrò, Maria Grazia; Bove, Tiziana; Fanelli, Giovanna; Zangrillo, Alberto; Landoni, Giovanni

    2016-04-01

    Methylene blue commonly is used as a dye or an antidote, but also can be used off label as a vasopressor. Serotonin toxicity is a potentially lethal and often misdiagnosed condition that can result from drug interaction. Mild serotonin toxicity previously was reported in settings in which methylene blue was used as a dye. The authors report 3 cases of life-threatening serotonin toxicity in patients undergoing chronic selective serotonin reuptake inhibitor (SSRI) therapy who also underwent cardiac surgery and received methylene blue to treat vasoplegic syndrome. An observational study. A cardiothoracic intensive care unit (ICU) in a teaching hospital. Three patients who received methylene blue after cardiac surgery, later discovered to be undergoing chronic SSRI therapy. None. All 3 patients received high doses of fentanyl during general anesthesia. They all developed vasoplegic syndrome and consequently were given methylene blue in the ICU. All 3 patients developed serotonin toxicity, including coma, after this administration and diagnostic tests were negative for acute intracranial pathology. Coma lasted between 1 and 5 days. Two patients were discharged from the ICU shortly after awakening, whereas the third patient experienced a complicated postoperative course for concomitant refractory low-cardiac-output syndrome. Patients undergoing chronic SSRI therapy should not be administered methylene blue to treat vasoplegic syndrome. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Unraveling the Mystery of the Blue Fog: Structure, Properties, and Applications of Amorphous Blue Phase III.

    Science.gov (United States)

    Gandhi, Sahil Sandesh; Chien, Liang-Chy

    2017-12-01

    The amorphous blue phase III of cholesteric liquid crystals, also known as the "blue fog," are among the rising stars in materials science that can potentially be used to develop next-generation displays with the ability to compete toe-to-toe with disruptive technologies like organic light-emitting diodes. The structure and properties of the practically unobservable blue phase III have eluded scientists for more than a century since it was discovered. This progress report reviews the developments in this field from both fundamental and applied research perspectives. The first part of this progress report gives an overview of the 130-years-long scientific tour-de-force that very recently resulted in the revelation of the mysterious structure of blue phase III. The second part reviews progress made in the past decade in developing electrooptical, optical, and photonic devices based on blue phase III. The strong and weak aspects of the development of these devices are underlined and criticized, respectively. The third- and-final part proposes ideas for further improvement in blue phase III technology to make it feasible for commercialization and widespread use. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Pulsating variables

    International Nuclear Information System (INIS)

    1989-01-01

    The study of stellar pulsations is a major route to the understanding of stellar structure and evolution. At the South African Astronomical Observatory (SAAO) the following stellar pulsation studies were undertaken: rapidly oscillating Ap stars; solar-like oscillations in stars; 8-Scuti type variability in a classical Am star; Beta Cephei variables; a pulsating white dwarf and its companion; RR Lyrae variables and galactic Cepheids. 4 figs

  12. Methylene blue for postcardiopulmonary bypass vasoplegic syndrome: A cohort study

    Directory of Open Access Journals (Sweden)

    Michael Mazzeffi

    2017-01-01

    Full Text Available Background: Methylene blue (MB has been used to treat refractory hypotension in a variety of settings. Aims: We sought to determine whether MB improved blood pressure in postcardiopulmonary bypass (CPB vasoplegic syndrome (VS in a complex cardiac surgery population. Furthermore, to determine variables that predicted response to MB. Setting and Design: This was conducted in a tertiary care medical center; this study was a retrospective cohort study. Materials and Methods: Adult cardiac surgery patients who received MB for post-CPB VS over a 2-year period were studied. Mean arterial blood pressure (MAP and vasopressor doses were compared before and after MB, and logistic regression was used to model which variables predicted response. Results: Eighty-eight patients received MB for post-CPB VS during the study period. MB administration was associated with an 8 mmHg increase in MAP (P = 0.004, and peak response occurred at 2 h. Variables that were associated with a positive drug response were deep hypothermic circulatory arrest during surgery and higher MAP at the time of drug administration (P = 0.006 and 0.02. A positive response had no correlation with in-hospital mortality (P = 0.09. Conclusions: MB modestly increases MAP in cardiac surgery patients with VS. Higher MAP at the time of drug administration and surgery with deep hypothermic circulatory arrest predict a greater drug response.

  13. 77 FR 55895 - Permanent Closure of Cincinnati Blue Ash Airport

    Science.gov (United States)

    2012-09-11

    ... Federal Aviation Administration Permanent Closure of Cincinnati Blue Ash Airport AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of permanent closure of Cincinnati Blue Ash Airport (ISZ). SUMMARY: The... Cincinnati advising that on August 29, 2012, it was permanently closing Cincinnati Blue Ash Airport (ISZ...

  14. Aspen biology, community classification, and management in the Blue Mountains

    Science.gov (United States)

    David K. Swanson; Craig L. Schmitt; Diane M. Shirley; Vicky Erickson; Kenneth J. Schuetz; Michael L. Tatum; David C. Powell

    2010-01-01

    Quaking aspen (Populus tremuloides Michx.) is a valuable species that is declining in the Blue Mountains of northeastern Oregon. This publication is a compilation of over 20 years of aspen management experience by USDA Forest Service workers in the Blue Mountains. It includes a summary of aspen biology and occurrence in the Blue Mountains, and a...

  15. Alcian blue-stained particles in a eutrophic lake

    DEFF Research Database (Denmark)

    Worm, J.; Søndergaard, Morten

    1998-01-01

    We used a neutral solution of Alcian Blue to stain transparent particles in eutrophic Lake Frederiksborg Slotss0, Denmark. Alcian Blue-stained particles (ABSP) appeared to be similar to the so-called transparent exopolymer particles (TEP) identified with an acidic solution of Alcian Blue. Our...

  16. 49 CFR 173.216 - Asbestos, blue, brown or white.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Asbestos, blue, brown or white. 173.216 Section... Class 7 § 173.216 Asbestos, blue, brown or white. (a) Asbestos, blue, brown or white, includes each of the following hydrated mineral silicates: chrysolite, crocidolite, amosite, anthophyllite asbestos...

  17. Poporodní blues – česká adaptace dotazníku „Maternity blues questionnaire“

    Czech Academy of Sciences Publication Activity Database

    Takács, L.; Smolík, Filip; Mlíková Seidlerová, J.; Čepický, P.; Hoskovcová, S.

    2016-01-01

    Roč. 81, č. 5 (2016), s. 355-368 ISSN 1210-7832 Institutional support: RVO:68081740 Keywords : EPDS postpartum mood * Maternity Blues Questionnaire * postnatal depression * postpartum blues * postpartum depression Subject RIV: AN - Psychology

  18. Cognitive Variability

    Science.gov (United States)

    Siegler, Robert S.

    2007-01-01

    Children's thinking is highly variable at every level of analysis, from neural and associative levels to the level of strategies, theories, and other aspects of high-level cognition. This variability exists within people as well as between them; individual children often rely on different strategies or representations on closely related problems…

  19. Suppression of vagal cardiac modulation by blue light in healthy subjects.

    Science.gov (United States)

    Yuda, Emi; Ogasawara, Hiroki; Yoshida, Yutaka; Hayano, Junichiro

    2016-10-05

    In the contemporary life environments, our body is increasingly exposed to various sources of colored light, which may affect our physiological functions as non-image-forming effects. We examined the impacts of colored lights on the autonomic functions by the analysis of heart rate variability (HRV). A lighting device consisting of four organic light-emitting diode (OLED) modules (55 × 55 mm 2 ) with adjustable red-green-blue color was secured 24 cm above the eyes of subject lying supine in a light-shielded laboratory. Following a 15-min supine rest, electrocardiogram and respiration were measured continuously during 3-min darkness, 6-min colored OLED illumination, and 3-min darkness under paced breathing (15 breath/min). The measurements were repeated at a 45-min interval for red, green, and blue lights with melanopsin-stimulating photon flux density (MSPFD) of 0.00, 0.10, and 0.20 μmol/m 2 /s, respectively, in 12 healthy subjects (23 ± 2 years, two females). Additionally, the effects of blue lights with 0.20, 0.10, and 0.04 μmol/m 2 /s MSPFD were examined in four healthy subjects (25-39 years, two females). HRV was analyzed for low-frequency (LF, 0.04-0.15 Hz) and high-frequency (HF, 0.20-0.30 Hz) power and LF-to-HF ratio (LF/HF). Compared to darkness before lighting, HF power decreased (P lighting on average of all color lights, whereas HF power showed a greater decrease with blue light than with red and green lights (P lighting (P blue light with 0.20 μmol/m 2 /s MSPFD (P blue light in healthy subjects most likely through melanopsin-dependent non-image-forming effect.

  20. Blue-Detuned Magneto-Optical Trap

    Science.gov (United States)

    Jarvis, K. N.; Devlin, J. A.; Wall, T. E.; Sauer, B. E.; Tarbutt, M. R.

    2018-02-01

    We present the properties and advantages of a new magneto-optical trap (MOT) where blue-detuned light drives "type-II" transitions that have dark ground states. Using 87Rb, we reach a radiation-pressure-limited density exceeding 1 011 cm-3 and a temperature below 30 μ K . The phase-space density is higher than in normal atomic MOTs and a million times higher than comparable red-detuned type-II MOTs, making the blue-detuned MOT particularly attractive for molecular MOTs, which rely on type-II transitions. The loss of atoms from the trap is dominated by ultracold collisions between Rb atoms. For typical trapping conditions, we measure a loss rate of 1.8 (4 )×10-10 cm3 s-1 .

  1. Blue green component and integrated urban design

    Directory of Open Access Journals (Sweden)

    Stanković Srđan M.

    2016-01-01

    Full Text Available This paper aims to demonstrate the hidden potential of blue green components, in a synergetic network, not as separate systems, like used in past. The innovative methodology of the project Blue Green Dream is presented through examples of good practice. A new approach in the project initiate thoughtful planning and remodeling of the settlement for the modern man. Professional and scientific public is looking for way to create more healthy and stimulating place for living. However, offered integrative solutions still remain out of urban and architectural practice. Tested technologies in current projects confirmed measurability of innovative approaches and lessons learned. Scientific and professional contributions are summarized in master's and doctoral theses that have been completed or are in process of writing.

  2. 76 FR 22923 - Wellpoint, Inc. D/B/A/Anthem Blue Cross & Blue Shield Enterprise Provider Data Management Team...

    Science.gov (United States)

    2011-04-25

    .../B/A/Anthem Blue Cross & Blue Shield Enterprise Provider Data Management Team Including On-Site... & Blue Shield, Enterprise Provider Data Management Team, Including On-Site Leased Workers From Kelly... Of Kentucky, Enterprise Provider Data Management Team, Louisville, Kentucky TA-W-74,895B Wellpoint...

  3. Measuring Blue Space Visibility and ‘Blue Recreation’ in the Everyday Lives of Children in a Capital City

    Science.gov (United States)

    Pearson, Amber L.; Bottomley, Ross; Chambers, Tim; Thornton, Lukar; Stanley, James; Smith, Moira; Barr, Michelle; Signal, Louise

    2017-01-01

    Blue spaces (water bodies) may promote positive mental and physical health through opportunities for relaxation, recreation, and social connections. However, we know little about the nature and extent of everyday exposure to blue spaces, particularly in settings outside the home or among children, nor whether exposure varies by individual or household characteristics. Wearable cameras offer a novel, reliable method for blue space exposure measurement. In this study, we used images from cameras worn over two days by 166 children in Wellington, New Zealand, and conducted content and blue space quantification analysis on each image (n = 749,389). Blue space was identified in 24,721 images (3.6%), with a total of 23 blue recreation events. Visual exposure and participation in blue recreation did not differ by ethnicity, weight status, household deprivation, or residential proximity to the coastline. Significant differences in both visual exposure to blue space and participation in blue recreation were observed, whereby children from the most deprived schools had significantly higher rates of blue space exposure than children from low deprivation schools. Schools may be important settings to promote equitable blue space exposures. Childhood exposures to blue space may not follow the expected income inequality trends observed among adults. PMID:28587134

  4. Measuring Blue Space Visibility and 'Blue Recreation' in the Everyday Lives of Children in a Capital City.

    Science.gov (United States)

    Pearson, Amber L; Bottomley, Ross; Chambers, Tim; Thornton, Lukar; Stanley, James; Smith, Moira; Barr, Michelle; Signal, Louise

    2017-05-26

    Blue spaces (water bodies) may promote positive mental and physical health through opportunities for relaxation, recreation, and social connections. However, we know little about the nature and extent of everyday exposure to blue spaces, particularly in settings outside the home or among children, nor whether exposure varies by individual or household characteristics. Wearable cameras offer a novel, reliable method for blue space exposure measurement. In this study, we used images from cameras worn over two days by 166 children in Wellington, New Zealand, and conducted content and blue space quantification analysis on each image ( n = 749,389). Blue space was identified in 24,721 images (3.6%), with a total of 23 blue recreation events. Visual exposure and participation in blue recreation did not differ by ethnicity, weight status, household deprivation, or residential proximity to the coastline. Significant differences in both visual exposure to blue space and participation in blue recreation were observed, whereby children from the most deprived schools had significantly higher rates of blue space exposure than children from low deprivation schools. Schools may be important settings to promote equitable blue space exposures. Childhood exposures to blue space may not follow the expected income inequality trends observed among adults.

  5. Engineering PFLOTRAN for Scalable Performance on Cray XT and IBM BlueGene Architectures

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Richard T [ORNL; Sripathi, Vamsi K [ORNL; Mahinthakumar, Gnanamanika [ORNL; Hammond, Glenn [Pacific Northwest National Laboratory (PNNL); Lichtner, Peter [Los Alamos National Laboratory (LANL); Smith, Barry F [Argonne National Laboratory (ANL)

    2010-01-01

    We describe PFLOTRAN - a code for simulation of coupled hydro-thermal-chemical processes in variably saturated, non-isothermal, porous media - and the approaches we have employed to obtain scalable performance on some of the largest scale supercomputers in the world. We present detailed analyses of I/O and solver performance on Jaguar, the Cray XT5 at Oak Ridge National Laboratory, and Intrepid, the IBM BlueGene/P at Argonne National Laboratory, that have guided our choice of algorithms.

  6. Prediction of objectively measured physical activity and sedentariness among blue-collar workers using survey questionnaires

    OpenAIRE

    Gupta, Nidhi; Heiden, Marina; Mathiassen, Svend Erik; Holtermann, Andreas

    2016-01-01

    OBJECTIVES: We aimed at developing and evaluating statistical models predicting objectively measured occupational time spent sedentary or in physical activity from self-reported information available in large epidemiological studies and surveys.METHODS: Two-hundred-and-fourteen blue-collar workers responded to a questionnaire containing information about personal and work related variables, available in most large epidemiological studies and surveys. Workers also wore accelerometers for 1-4 d...

  7. Nature's palette: the search for natural blue colorants.

    Science.gov (United States)

    Newsome, Andrew G; Culver, Catherine A; van Breemen, Richard B

    2014-07-16

    The food and beverage industry is seeking to broaden the palette of naturally derived colorants. Although considerable effort has been devoted to the search for new blue colorants in fruits and vegetables, less attention has been directed toward blue compounds from other sources such as bacteria and fungi. The current work reviews known organic blue compounds from natural plant, animal, fungal, and microbial sources. The scarcity of blue-colored metabolites in the natural world relative to metabolites of other colors is discussed, and structural trends common among natural blue compounds are identified. These compounds are grouped into seven structural classes and evaluated for their potential as new color additives.

  8. Blue light does not inhibit nodulation in Sesbania rostrata.

    Science.gov (United States)

    Shimomura, Aya; Arima, Susumu; Hayashi, Makoto; Maymon, Maskit; Hirsch, Ann M; Suzuki, Akihiro

    2017-01-02

    Earlier, we reported that root nodulation was inhibited by blue light irradiation of Lotus japonicus. Because some legumes do not establish nodules exclusively on underground roots, we investigated whether nodule formation in Sesbania rostrata, which forms both root and "stem" nodules following inoculation with Azorhizobium caulinodans, is inhibited by blue light as are L. japonicus nodules. We found that neither S. rostrata nodulation nor nitrogen fixation was inhibited by blue light exposure. Moreover, although A. caulinodans proliferation was not affected by blue light irradiation, bacterial survival was decreased. Therefore, blue light appears to impose different responses depending on the legume-rhizobial symbiosis.

  9. FROM CIRCULAR ECONOMY TO BLUE ECONOMY

    Directory of Open Access Journals (Sweden)

    Iustin-Emanuel, ALEXANDRU

    2014-11-01

    Full Text Available Addressing the subject of this essay is based on the background ideas generated by a new branch of science - Biomimicry. According to European Commissioner for the Environment, "Nature is the perfect model of circular economy". Therefore, by imitating nature, we are witnessing a process of cycle redesign: production-consumption-recycling. The authors present some reflections on the European Commission's decision to adopt after July 1, 2014 new measures concerning the development of more circular economies. Starting from the principles of Ecolonomy, which is based on the whole living paradigm, this paper argues for the development within each economy of entrepreneurial policies related to the Blue economy. In its turn, Blue economy is based on scientific analyses that identify the best solutions in a business. Thus, formation of social capital will lead to healthier and cheaper products, which will stimulate entrepreneurship. Blue economy is another way of thinking economic practice and is a new model of business design. It is a healthy, sustainable business, designed for people. In fact, it is the core of the whole living paradigm through which, towards 2020, circular economy will grow more and more.

  10. 'Blue Whale Challenge': A Game or Crime?

    Science.gov (United States)

    Mukhra, Richa; Baryah, Neha; Krishan, Kewal; Kanchan, Tanuj

    2017-11-11

    A bewildering range of games are emerging every other day with newer elements of fun and entertainment to woo youngsters. Games are meant to reduce stress and enhance the cognitive development of children as well as adults. Teenagers are always curious to indulge in newer games; and e-gaming is one such platform providing an easy access and quicker means of entertainment. The particular game challenge which has taken the world by storm is the dangerous "Blue Whale Challenge" often involving vulnerable teenagers. The Blue Whale Challenge is neither an application nor internet based game but the users get a link through social media chat groups to enter this "deadly" challenge game. This probably is the only game where the participant has to end his/her life to complete the game. The innocent teenagers are being targeted based on their depressed psychology and are coercively isolated from their social milieux on the pretext of keeping the challenges confidential. To add to the woes, no option is offered to quit the challenge even if the contender is unable to complete the challenge. Blue Whale Challenge in its sheer form could be seen as an illegal, unethical and inhumane endeavor in our present society. The present communication discusses the severe effects of the game on teenagers, the ethical concerns involved and the preventive measures necessary to curb it.

  11. Synchrotron powder diffraction on Aztec blue pigments

    International Nuclear Information System (INIS)

    Sanchez del Rio, M.; Gutierrez-Leon, A.; Castro, G.R.; Rubio-Zuazo, J.; Solis, C.; Sanchez-Hernandez, R.; Robles-Camacho, J.; Rojas-Gaytan, J.

    2008-01-01

    Some samples of raw blue pigments coming from an archaeological rescue mission in downtown Mexico City have been characterized using different techniques. The samples, some recovered as a part of a ritual offering, could be assigned to the late Aztec period (XVth century). The striking characteristic of these samples is that they seem to be raw pigments prior to any use in artworks, and it was possible to collect a few μg of pigment after manual grain selection under a microscopy monitoring. All pigments are made of indigo, an organic colorant locally known as anil or xiuhquilitl. The colorant is always found in combination with an inorganic matrix, studied by powder diffraction. In one case the mineral base is palygorskite, a rare clay mineral featuring micro-channels in its structure, well known as the main ingredient of the Maya blue pigment. However, other samples present the minerals sepiolite (a clay mineral of the palygorskite family) and calcite. Another sample contains barite, a mineral never reported in prehispanic paints. We present the results of characterization using high resolution powder diffraction recorded at the European Synchrotron Radiation Facility (BM25A, SpLine beamline) complemented with other techniques. All of them gave consistent results on the composition. A chemical test on resistance to acids was done, showing a high resistance for the palygorskite and eventually sepiolite compounds, in good agreement with the excellent resistance of the Maya blue. (orig.)

  12. Blue Light Protects Against Temporal Frequency Sensitive Refractive Changes.

    Science.gov (United States)

    Rucker, Frances; Britton, Stephanie; Spatcher, Molly; Hanowsky, Stephan

    2015-09-01

    Time spent outdoors is protective against myopia. The outdoors allows exposure to short-wavelength (blue light) rich sunlight, while indoor illuminants can be deficient at short-wavelengths. In the current experiment, we investigate the role of blue light, and temporal sensitivity, in the emmetropization response. Five-day-old chicks were exposed to sinusoidal luminance modulation of white light (with blue; N = 82) or yellow light (without blue; N = 83) at 80% contrast, at one of six temporal frequencies: 0, 0.2, 1, 2, 5, 10 Hz daily for 3 days. Mean illumination was 680 lux. Changes in ocular components and corneal curvature were measured. Refraction, eye length, and choroidal changes were dependent on the presence of blue light (P blue light, refraction did not change across frequencies (mean change -0.24 [diopters] D), while in the absence of blue light, we observed a hyperopic shift (>1 D) at high frequencies, and a myopic shift (>-0.6 D) at low frequencies. With blue light there was little difference in eye growth across frequencies (77 μm), while in the absence of blue light, eyes grew more at low temporal frequencies and less at high temporal frequencies (10 vs. 0.2 Hz: 145 μm; P blue light. Illuminants rich in blue light can protect against myopic eye growth when the eye is exposed to slow changes in luminance contrast as might occur with near work.

  13. Blue Light Protects Against Temporal Frequency Sensitive Refractive Changes

    Science.gov (United States)

    Rucker, Frances; Britton, Stephanie; Spatcher, Molly; Hanowsky, Stephan

    2015-01-01

    Purpose Time spent outdoors is protective against myopia. The outdoors allows exposure to short-wavelength (blue light) rich sunlight, while indoor illuminants can be deficient at short-wavelengths. In the current experiment, we investigate the role of blue light, and temporal sensitivity, in the emmetropization response. Methods Five-day-old chicks were exposed to sinusoidal luminance modulation of white light (with blue; N = 82) or yellow light (without blue; N = 83) at 80% contrast, at one of six temporal frequencies: 0, 0.2, 1, 2, 5, 10 Hz daily for 3 days. Mean illumination was 680 lux. Changes in ocular components and corneal curvature were measured. Results Refraction, eye length, and choroidal changes were dependent on the presence of blue light (P blue light, refraction did not change across frequencies (mean change −0.24 [diopters] D), while in the absence of blue light, we observed a hyperopic shift (>1 D) at high frequencies, and a myopic shift (>−0.6 D) at low frequencies. With blue light there was little difference in eye growth across frequencies (77 μm), while in the absence of blue light, eyes grew more at low temporal frequencies and less at high temporal frequencies (10 vs. 0.2 Hz: 145 μm; P blue light. Conclusions Illuminants rich in blue light can protect against myopic eye growth when the eye is exposed to slow changes in luminance contrast as might occur with near work. PMID:26393671

  14. Blue-Green Solutions in Urban Development

    Science.gov (United States)

    Karlsson, Caroline; Kalantari, Zahra

    2017-04-01

    With the ongoing urbanisation and increasing pressure for new housing and infrastructure, the nexus of developing compact, energy-efficient and yet liveable and sustainable cities is urgent to address. In this context, blue-green spaces and related ecosystem services (ES) are critical resources that need to be integrated in policy and planning of urban. Among the ES provided by blue-green spaces, regulating ES such as water retention and purification are particularly important in urban areas, affecting water supply and quality, related cultural ES and biodiversity, as well as cities potential to adapt to climate change. Blue-green infrastructure management is considered a sustainable way to reducing negative effects of urbanisation, such as decreasing flood risks, as well as adapting to climate change for example by controlling increasing flood and drought risks. Blue-green infrastructure management can for example create multifunctional surfaces with valuable environmental and social functions and generally handle greenways and ecological networks as important ecosystem service components, for example for stormwater regulation in a sustainable urban drainage system. The Norrström drainage basin (22,000 km2) is a large demonstrator for Blue-green infrastructure management. Both urbanisation and agriculture are extensive within this basin, which includes the Swedish capital Stockholm and is part of the fertile Swedish belt. Together, the relatively high population density combined with agricultural and industrial activities in this region imply large eutrophication and pollution pressures, not least transferred through storm runoff to both inland surface waters and the coastal waters of the Baltic Sea. The ecosystems of this basin provide highly valued but also threatened services. For example, Lake Mälaren is the single main freshwater supply for the Swedish capital Stockholm, as well as a key nutrient retention system that strongly mitigates waterborne nutrient

  15. Raman analysis of cobalt blue pigment in blue and white porcelain: A reassessment

    Science.gov (United States)

    Jiang, Xiaochenyang; Ma, Yanying; Chen, Yue; Li, Yuanqiu; Ma, Qinglin; Zhang, Zhaoxia; Wang, Changsui; Yang, Yimin

    2018-02-01

    Cobalt blue is a famous pigment in human history. In the past decade it is widely reported that the cobalt aluminate has been detected in ancient ceramics as blue colorant in glaze, yet the acquired Raman spectra are incredibly different from that of synthesised references, necessitating a reassessment of such contradictory scenario with more accurate analytic strategies. In this study, micro-Raman spectroscopy (MRS) and scanning electron microscopy (SEM) in association with energy dispersive spectrometry (EDS) were performed on under-glaze cobalt pigments from one submerged blue and white porcelain shard dated from Wanli reign (1573-1620 CE) of Ming dynasty (1365-1644 CE) excavated at Nan'ao I shipwreck off the southern coast of China. The micro-structural inspection reveals that the pigment particles have characteristics of small account, tiny size, heterogeneously distribution, and more importantly, been completely enwrapped by well-developed anorthite crystals in the glaze, indicating that the signals recorded in previous publications are probably not from cobalt pigments themselves but from outside thickset anorthite shell. The further spectromicroscopic analyses confirm this presumption when the accurate spectra of cobalt aluminate pigment and surrounding anorthite were obtained separately with precise optical positioning. Accordingly, we reassess and clarify the previous Raman studies dedicated to cobalt blue pigment in ancient ceramics, e.g. cobalt blue in celadon glaze, and in turn demonstrate the superiority and necessity of coupling spectroscopic analysis with corresponding structure observation, especially in the characterization of pigments from complicated physico-chemical environment like antiquities. Thus, this study promotes a better understanding of Raman spectroscopy study of cobalt blue pigments in art and archaeology field.

  16. Plasma volume methodology: Evans blue, hemoglobin-hematocrit, and mass density transformations

    Science.gov (United States)

    Greenleaf, J. E.; Hinghofer-Szalkay, H.

    1985-01-01

    Methods for measuring absolute levels and changes in plasma volume are presented along with derivations of pertinent equations. Reduction in variability of the Evans blue dye dilution technique using chromatographic column purification suggests that the day-to-day variability in the plasma volume in humans is less than + or - 20 m1. Mass density determination using the mechanical-oscillator technique provides a method for measuring vascular fluid shifts continuously for assessing the density of the filtrate, and for quantifying movements of protein across microvascular walls. Equations for the calculation of volume and density of shifted fluid are presented.

  17. Taxonomy Icon Data: blue whale [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available blue whale Balaenoptera musculus Chordata/Vertebrata/Mammalia/Theria/Eutheria/Cetacea Balaenoptera..._musculus_L.png Balaenoptera_musculus_NL.png Balaenoptera_musculus_S.png Balaenoptera_musculu...s_NS.png http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Balaenoptera+musculus&t=L http://biosciencedbc.jp/...taxonomy_icon/icon.cgi?i=Balaenoptera+musculus&t=NL http://biosciencedbc.jp/taxon...omy_icon/icon.cgi?i=Balaenoptera+musculus&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Balaenoptera+musculus&t=NS ...

  18. Complex variables

    CERN Document Server

    Fisher, Stephen D

    1999-01-01

    The most important topics in the theory and application of complex variables receive a thorough, coherent treatment in this introductory text. Intended for undergraduates or graduate students in science, mathematics, and engineering, this volume features hundreds of solved examples, exercises, and applications designed to foster a complete understanding of complex variables as well as an appreciation of their mathematical beauty and elegance. Prerequisites are minimal; a three-semester course in calculus will suffice to prepare students for discussions of these topics: the complex plane, basic

  19. An anion channel in Arabidopsis hypocotyls activated by blue light

    Science.gov (United States)

    Cho, M. H.; Spalding, E. P.; Evans, M. L. (Principal Investigator)

    1996-01-01

    A rapid, transient depolarization of the plasma membrane in seedling stems is one of the earliest effects of blue light detected in plants. It appears to play a role in transducing blue light into inhibition of hypocotyl (stem) elongation, and perhaps other responses. The possibility that activation of a Cl- conductance is part of the depolarization mechanism was raised previously and addressed here. By patch clamping hypocotyl cells isolated from dark-grown (etiolated) Arabidopsis seedlings, blue light was found to activate an anion channel residing at the plasma membrane. An anion-channel blocker commonly known as NPPB 15-nitro-2-(3-phenylpropylamino)-benzoic acid] potently and reversibly blocked this anion channel. NPPB also blocked the blue-light-induced depolarization in vivo and decreased the inhibitory effect of blue light on hypocotyl elongation. These results indicate that activation of this anion channel plays a role in transducing blue light into growth inhibition.

  20. Fuzzy logic color detection: Blue areas in melanoma dermoscopy images.

    Science.gov (United States)

    Lingala, Mounika; Stanley, R Joe; Rader, Ryan K; Hagerty, Jason; Rabinovitz, Harold S; Oliviero, Margaret; Choudhry, Iqra; Stoecker, William V

    2014-07-01

    Fuzzy logic image analysis techniques were used to analyze three shades of blue (lavender blue, light blue, and dark blue) in dermoscopic images for melanoma detection. A logistic regression model provided up to 82.7% accuracy for melanoma discrimination for 866 images. With a support vector machines (SVM) classifier, lower accuracy was obtained for individual shades (79.9-80.1%) compared with up to 81.4% accuracy with multiple shades. All fuzzy blue logic alpha cuts scored higher than the crisp case. Fuzzy logic techniques applied to multiple shades of blue can assist in melanoma detection. These vector-based fuzzy logic techniques can be extended to other image analysis problems involving multiple colors or color shades. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Optimization of banana trunk-activated carbon production for methylene blue-contaminated water treatment

    Science.gov (United States)

    Danish, Mohammed; Ahmad, Tanweer; Nadhari, W. N. A. W.; Ahmad, Mehraj; Khanday, Waheed Ahmad; Ziyang, Lou; Pin, Zhou

    2018-03-01

    This experiment was run to characterize the banana trunk-activated carbon through methylene blue dye adsorption property. The H3PO4 chemical activating agent was used to produce activated carbons from the banana trunk. A small rotatable central composite design of response surface methodology was adopted to prepare chemically (H3PO4) activated carbon from banana trunk. Three operating variables such as activation time (50-120 min), activation temperature (450-850 °C), and activating agent concentration (1.5-7.0 mol/L) play a significant role in the adsorption capacities ( q) of activated carbons against methylene blue dye. The results implied that the maximum adsorption capacity of fixed dosage (4.0 g/L) banana trunk-activated carbon was achieved at the activation time of 51 min, the activation temperature of 774 °C, and H3PO4 concentration of 5.09 mol/L. At optimum conditions of preparation, the obtained banana trunk-activated carbon has adsorption capacity 64.66 mg/g against methylene blue. Among the prepared activated carbons run number 3 (prepared with central values of the operating variables) was characterized through Fourier transform infrared spectroscopy, field emission scanning microscopy, and powder X-ray diffraction.

  2. Strategic blue-green communication filters

    Science.gov (United States)

    Rosenberg, W. J.

    1984-04-01

    The project began as an effort to construct narrowband, wide-field-of-view, large-aperture, plastic, birefringent filters suitable for blue-green communications. During the course of the study we investigated the use of crystalline materials in addition to plastic films, and we studied filter design theory in order to find designs more suitable to the blue-green system requirements. In addition, we constructed a quartz, 2A filter for the 1981 SLCAIR experiment. In this report we have included an introduction to the principles of narrowband, wide-field-of-view, birefringent filters. This section is included since the subject matter is not readily available except piecemeal in technical journals. Section 3 is a discussion of the materials which were considered during this study. It contains subsections devoted to crystals, plastics and analog element, respectively. A class of new lossless filter designs is described in Section 4. These designs are expected to provide a basis for high-transmission filters in the future. The operational SLCAIR-81 filter is described in Section 5. It was part of the successful experiment which demonstrated communication to the USN Dolphin, a research submarine. Finally, in Section 6 we describe the non-vignetting filter design which was discovered during this study. It represents a significant throughput advantage for crystal filters used in non-imaging applications.

  3. Grassy Silica Nanoribbons and Strong Blue Luminescence

    Science.gov (United States)

    Wang, Shengping; Xie, Shuang; Huang, Guowei; Guo, Hongxuan; Cho, Yujin; Chen, Jun; Fujita, Daisuke; Xu, Mingsheng

    2016-09-01

    Silicon dioxide (SiO2) is one of the key materials in many modern technological applications such as in metal oxide semiconductor transistors, photovoltaic solar cells, pollution removal, and biomedicine. We report the accidental discovery of free-standing grassy silica nanoribbons directly grown on SiO2/Si platform which is commonly used for field-effect transistors fabrication without other precursor. We investigate the formation mechanism of this novel silica nanostructure that has not been previously documented. The silica nanoribbons are flexible and can be manipulated by electron-beam. The silica nanoribbons exhibit strong blue emission at about 467 nm, together with UV and red emissions as investigated by cathodoluminescence technique. The origins of the luminescence are attributed to various defects in the silica nanoribbons; and the intensity change of the blue emission and green emission at about 550 nm is discussed in the frame of the defect density. Our study may lead to rational design of the new silica-based materials for a wide range of applications.

  4. Manajemen Strategi Pengembangan Pariwisata dengan Pendekatan Blue Ocean Strategy

    OpenAIRE

    Muzha, Vianda Kushardianti

    2015-01-01

    Persaingan industri pariwisata di Indonesia saat ini sangatlah ketat, setiap daerah berlomba untuk menonjolkan keunikannya tersendiri. Dengan adanya persaingan yang sangat ketat tersebut, Kota Batu berusaha keluar dari persaingan (red ocean) dengan menciptkan inovasi baru melalui konsep Blue Ocean Strategy. Blue Ocean Strategy adalah istilah dalam ilmu manajemen strategi yang merujuk pada siasat untuk menciptakan pasar baru yang belum dipenuhi persaingan yang ketat. Blue Ocean Strategy pada d...

  5. A Survey of Blue-Noise Sampling and Its Applications

    KAUST Repository

    Yan, Dongming

    2015-05-05

    In this paper, we survey recent approaches to blue-noise sampling and discuss their beneficial applications. We discuss the sampling algorithms that use points as sampling primitives and classify the sampling algorithms based on various aspects, e.g., the sampling domain and the type of algorithm. We demonstrate several well-known applications that can be improved by recent blue-noise sampling techniques, as well as some new applications such as dynamic sampling and blue-noise remeshing.

  6. Large Scale Density Estimation of Blue and Fin Whales (LSD)

    Science.gov (United States)

    2015-09-30

    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Large Scale Density Estimation of Blue and Fin Whales ...sensors, or both. The goal of this research is to develop and implement a new method for estimating blue and fin whale density that is effective over...develop and implement a density estimation methodology for quantifying blue and fin whale abundance from passive acoustic data recorded on sparse

  7. The Return of the Blue Butterfly

    Science.gov (United States)

    Santos, Anabela

    2014-05-01

    The Return of the Blue Butterfly The English writer Charles Dickens once wrote: "I only ask to be free. The butterflies are free". But are they really? The work that I performed with a group of students from 8th grade, had a starting point of climate change and the implications it has on ecosystems. Joining the passion I have for butterflies, I realized that they are also in danger of extinction due to these climatic effects. Thus, it was easy to seduce my students wanting to know more. Luckily I found Dr. Paula Seixas Arnaldo, a researcher at the University of Trás-os-Montes and Alto Douro, who has worked on butterflies and precisely investigated this issue. Portugal is the southern limit of butterfly-blue (Phengaris alcon), and has been many years in the red book of endangered species. Butterfly-blue is very demanding of their habitat, and disappears very easily if ideal conditions are not satisfied. Increased fragmentation of landscapes and degradation of suitable habitats, are considered the greatest challenges of the conservation of Phengaris butterfly in Portugal. In recent decades, climate change has also changed butterfly-blue spatial distribution with a movement of the species northward to colder locations, and dispersion in latitude. Butterflies of Europe must escape to the North because of the heat. Dr. Paula Seixas Arnaldo and her research team began a project, completed in December 2013, wanted to preserve and restore priority habitats recognized by the European Union to help species in danger of disappearing with increasing temperature. The blue butterfly is extremely important because it is a key indicator of the quality of these habitats. In the field, the butterflies are monitored to collect all possible data in order to identify the key species. Butterflies start flying in early July and cease in late August. Mating takes about an hour and occurs in the first days of life. The gentian-peat (Gentiana pneumonanthe) serves as the host plant for

  8. Phototherapy with blue and green mixed-light is as effective against unconjugated jaundice as blue light and reduces oxidative stress in the Gunn rat model.

    Science.gov (United States)

    Uchida, Yumiko; Morimoto, Yukihiro; Uchiike, Takao; Kamamoto, Tomoyuki; Hayashi, Tamaki; Arai, Ikuyo; Nishikubo, Toshiya; Takahashi, Yukihiro

    2015-07-01

    Phototherapy using blue light-emitting diodes (LED) is effective against neonatal jaundice. However, green light phototherapy also reduces unconjugated jaundice. We aimed to determine whether mixed blue and green light can relieve jaundice with minimal oxidative stress as effectively as either blue or green light alone in a rat model. Gunn rats were exposed to phototherapy with blue (420-520 nm), filtered blue (FB; 440-520 nm without 1.00), respectively. Blue plus green phototherapy is as effective as blue phototherapy and it attenuates irradiation-induced oxidative stress. Combined blue and green spectra might be effective against neonatal hyperbilirubinemia. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Primary orbital melanoma in association with cellular blue nevus.

    Science.gov (United States)

    El-Sawy, Tarek; Bakhoum, Mathieu F; Tetzlaff, Michael; Nasser, Qasiem J; Prieto, Victor G; Ivan, Doina; Sniegowski, Matthew C; Yin, Vivian T; Pan, Caroline; Durairaj, Vikram; Esmaeli, Bita

    2014-01-01

    To describe 3 cases of primary orbital melanoma associated with either known or subsequently discovered cellular blue nevus. The clinical records and surgical specimens of 3 patients who underwent orbital exenteration for primary orbital melanoma and who had a cellular blue nevus diagnosed before or after detection of the melanoma were retrospectively reviewed. All 3 patients presented with signs and symptoms of an orbital mass. Subsequent biopsy revealed invasive melanoma. One patient had a known history of congenital cellular blue nevus of the eyelid from which the orbital melanoma originated. The other 2 patients had no known history of cutaneous pigmentation or blue nevus. In these 2 patients, the cellular blue nevus was detected on pathologic review of the orbital exenteration specimen (1 patient) or surgical biopsy specimen (1 patient). All 3 patients underwent total body positron emission tomography/computed tomography, and in all 3 results were negative for other sites of disease involvement. In the 2 patients without a previously known nevus a total body skin check was negative for other primary melanoma lesions. All 3 patients underwent orbital exenteration followed by postoperative radiation therapy. Thorough evaluation of biopsy specimens of "primary" orbital melanoma is warranted to ensure identification of any associated blue nevus because blue nevi are precursor lesions for orbital melanoma, and the presence of a blue nevus would support a primary orbital melanoma rather than a metastatic lesion. Patients with a known blue nevus of the periocular skin and ocular adnexa should be monitored closely for signs of malignant transformation.

  10. Tooth whitening evaluation of blue covarine containing toothpastes.

    Science.gov (United States)

    Tao, Danying; Smith, Richard N; Zhang, Qiong; Sun, Jianing N; Philpotts, Carole J; Ricketts, Stephen R; Naeeni, Mojgan; Joiner, Andrew

    2017-12-01

    To measure the tooth whitening effects delivered immediately after brushing with silica-based toothpastes containing blue covarine in vitro and in vivo. Salivary pellicle coated human extracted teeth were brushed with either a slurry of a toothpaste containing blue covarine (BC), a formulation containing an increased level of blue covarine (BC+) or a negative control toothpaste containing no blue covarine. The colour of the specimens were measured in vitro using either a Minolta chromameter or a VITA Easyshade spectrophotometer, before and after brushing and changes in CIELAB values and tooth Whiteness Index (WIO) values calculated. In a double-blind cross-over clinical study, subjects brushed with either BC or BC+ toothpaste and tooth colour changes were measured with a digital image analysis system. The in vitro studies demonstrated that toothpastes containing blue covarine gave a significantly (pbrushing with the BC+ toothpaste than with the BC toothpaste (WIO p=0.006; b* p=0.013). Toothpastes containing blue covarine gave a statistically significant reduction in tooth yellowness and improvement in tooth whiteness immediately after brushing in both in vitro and clinical studies. In addition, the higher concentration blue covarine toothpaste gave statistically significant greater tooth whitening benefits than the lower concentration blue covarine toothpaste. The silica-based toothpastes containing blue covarine evaluated in the current study gave tooth whitening benefits immediately after one brush. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. High genetic diversity in a small population: the case of Chilean blue whales

    Science.gov (United States)

    Torres-Florez, Juan P; Hucke-Gaete, Rodrigo; Rosenbaum, Howard; Figueroa, Christian C

    2014-01-01

    It is generally assumed that species with low population sizes have lower genetic diversities than larger populations and vice versa. However, this would not be the case for long-lived species with long generation times, and which populations have declined due to anthropogenic effects, such as the blue whale (Balaenoptera musculus). This species was intensively decimated globally to near extinction during the 20th century. Along the Chilean coast, it is estimated that at least 4288 blue whales were hunted from an apparently pre-exploitation population size (k) of a maximum of 6200 individuals (Southeastern Pacific). Thus, here, we describe the mtDNA (control region) and nDNA (microsatellites) diversities of the Chilean blue whale aggregation site in order to verify the expectation of low genetic diversity in small populations. We then compare our findings with other blue whale aggregations in the Southern Hemisphere. Interestingly, although the estimated population size is small compared with the pre-whaling era, there is still considerable genetic diversity, even after the population crash, both in mitochondrial (N = 46) and nuclear (N = 52) markers (Hd = 0.890 and Ho = 0.692, respectively). Our results suggest that this diversity could be a consequence of the long generation times and the relatively short period of time elapsed since the end of whaling, which has been observed in other heavily-exploited whale populations. The genetic variability of blue whales on their southern Chile feeding grounds was similar to that found in other Southern Hemisphere blue whale feeding grounds. Our phylogenetic analysis of mtDNA haplotypes does not show extensive differentiation of populations among Southern Hemisphere blue whale feeding grounds. The present study suggests that although levels of genetic diversity are frequently used as estimators of population health, these parameters depend on the biology of the species and should be taken into account in a

  12. Flickering of the symbiotic variable CH Cygni during outburst

    International Nuclear Information System (INIS)

    Slovak, M.H.; Africano, J.

    1978-01-01

    High-speed and conventional BVRI photometry are reported for the bright symbiotic variable CH Cygni (M6 IIIe), obtained during the course of a recent outburst. Unlike the quiescent symbiotic stars, the presence of flickering similar in nature to that seen in the cataclysmic variables has been confirmed during this active phase. The BVRI photometry for a sample of stars in the field is used to derive the reddening and the distance to CH Cyg. A composite energy distribution is derived from 0.35 to 11.0 μm which clearly establishes the existence of a variable, blue continuum. The lack of variability in the near infrared suggests that the blue continuum arises from a hot companion. A binary model including a subluminous hot companion accreting material from the stellar wind of an SRa variable is discussed to account for the observed photometric properties. (author)

  13. Circadian and Sex Differences After Acute High-Altitude Exposure: Are Early Acclimation Responses Improved by Blue Light?

    Science.gov (United States)

    Silva-Urra, Juan A; Núñez-Espinosa, Cristian A; Niño-Mendez, Oscar A; Gaitán-Peñas, Héctor; Altavilla, Cesare; Toro-Salinas, Andrés; Torrella, Joan R; Pagès, Teresa; Javierre, Casimiro F; Behn, Claus; Viscor, Ginés

    2015-12-01

    The possible effects of blue light during acute hypoxia and the circadian rhythm on several physiological and cognitive parameters were studied. Fifty-seven volunteers were randomly assigned to 2 groups: nocturnal (2200-0230 hours) or diurnal (0900-1330 hours) and exposed to acute hypoxia (4000 m simulated altitude) in a hypobaric chamber. The participants were illuminated by blue LEDs or common artificial light on 2 different days. During each session, arterial oxygen saturation (Spo2), blood pressure, heart rate variability, and cognitive parameters were measured at sea level, after reaching the simulated altitude of 4000 m, and after 3 hours at this altitude. The circadian rhythm caused significant differences in blood pressure and heart rate variability. A 4% to 9% decrease in waking nocturnal Spo2 under acute hypoxia was observed. Acute hypoxia also induced a significant reduction (4%-8%) in systolic pressure, slightly more marked (up to 13%) under blue lighting. Women had significantly increased systolic (4%) and diastolic (12%) pressures under acute hypoxia at night compared with daytime pressure; this was not observed in men. Some tendencies toward better cognitive performance (d2 attention test) were seen under blue illumination, although when considered together with physiological parameters and reaction time, there was no conclusive favorable effect of blue light on cognitive fatigue suppression after 3 hours of acute hypobaric hypoxia. It remains to be seen whether longer exposure to blue light under hypobaric hypoxic conditions would induce favorable effects against fatigue. Copyright © 2015 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  14. Human impact on sediment fluxes within the Blue Nile and Atbara River basins

    Science.gov (United States)

    Balthazar, Vincent; Vanacker, Veerle; Girma, Atkilt; Poesen, Jean; Golla, Semunesh

    2013-01-01

    A regional assessment of the spatial variability in sediment yields allows filling the gap between detailed, process-based understanding of erosion at field scale and empirical sediment flux models at global scale. In this paper, we focus on the intrabasin variability in sediment yield within the Blue Nile and Atbara basins as biophysical and anthropogenic factors are presumably acting together to accelerate soil erosion. The Blue Nile and Atbara River systems are characterized by an important spatial variability in sediment fluxes, with area-specific sediment yield (SSY) values ranging between 4 and 4935 t/km2/y. Statistical analyses show that 41% of the observed variation in SSY can be explained by remote sensing proxy data of surface vegetation cover, rainfall intensity, mean annual temperature, and human impact. The comparison of a locally adapted regression model with global predictive sediment flux models indicates that global flux models such as the ART and BQART models are less suited to capture the spatial variability in area-specific sediment yields (SSY), but they are very efficient to predict absolute sediment yields (SY). We developed a modified version of the BQART model that estimates the human influence on sediment yield based on a high resolution composite measure of local human impact (human footprint index) instead of countrywide estimates of GNP/capita. Our modified version of the BQART is able to explain 80% of the observed variation in SY for the Blue Nile and Atbara basins and thereby performs only slightly less than locally adapted regression models.

  15. Cataclysmic variables, Hubble-Sandage variables and eta Carinae

    International Nuclear Information System (INIS)

    Bath, G.T.

    1980-01-01

    The Hubble-Sandage variables are the most luminous stars in external galaxies. They were first investigated by Hubble and Sandage (1953) for use as distance indicators. Their main characteristics are high luminosity, blue colour indices, and irregular variability. Spectroscopically they show hydrogen and helium in emission with occasionally weaker FeII and [FeII], and no Balmer jump (Humphreys 1975, 1978). In this respect they closely resemble cataclysmic variables, particularly dwarf novae. In the quiescent state dwarf novae show broad H and HeI, together with a strong UV continuum. In contrast to the spectroscopic similarities, the luminosities could hardly differ more. Rather than being the brightest stars known, quiescent dwarf novae are as faint or fainter than the sun. It is suggested that the close correspondence between the spectral appearance of the two classes combined with the difference in luminosity is well accounted for by a model of Hubble-Sandage variables in which the same physical processes are occurring, but on a larger scale. (Auth.)

  16. Identification of Young Stellar Variables with KELT for K2 . I. Taurus Dippers and Rotators

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, Joseph E.; Cargile, Phillip A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Ansdell, Megan [Institute for Astronomy, University of Hawaií at Manoa, Honolulu, HI 96822 (United States); Oelkers, Ryan J.; Somers, Garrett; Lund, Michael B.; Stassun, Keivan G. [Department of Physics and Astronomy, Vanderbilt University, 6301 Stevenson Center, Nashville, TN 37235 (United States); Gaidos, Eric [Department of Geology and Geophysics, University of Hawaií at Manoa, Honolulu, HI 96822 (United States); Cody, Ann Marie [NASA Ames Research Center, Mountain View, CA 94035 (United States); Stevens, Daniel J.; Gaudi, B. Scott [Department of Astronomy, The Ohio State University, Columbus, OH 43210 (United States); James, David [Astronomy Department, University of Washington, Box 351580, Seattle, WA 98195 (United States); Beatty, Thomas G. [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Siverd, Robert J. [Las Cumbres Observatory Global Telescope Network, 6740 Cortona Drive, Suite 102, Santa Barbara, CA 93117 (United States); Kuhn, Rudolf B. [South African Astronomical Observatory, PO Box 9, Observatory 7935 (South Africa); Pepper, Joshua [Department of Physics, Lehigh University, 16 Memorial Drive East, Bethlehem, PA 18015 (United States)

    2017-10-20

    One of the most well-studied young stellar associations, Taurus–Auriga, was observed by the extended Kepler mission, K2 , in the spring of 2017. K2 Campaign 13 (C13) is a unique opportunity to study many stars in this young association at high photometric precision and cadence. Using observations from the Kilodegree Extremely Little Telescope (KELT) survey, we identify “dippers,” aperiodic and periodic variables among K2 C13 target stars. This release of the KELT data (light curve data in e-tables) provides the community with long-time baseline observations to assist in the understanding of the more exotic variables in the association. Transient-like phenomena on timescales of months to years are known characteristics in the light curves of young stellar objects, making contextual pre- and post- K2 observations critical to understanding their underlying processes. We are providing a comprehensive set of the KELT light curves for known Taurus–Auriga stars in K2 C13. The combined data sets from K2 and KELT should permit a broad array of investigations related to star formation, stellar variability, and protoplanetary environments.

  17. EXTraS: Exploring the X-ray Transient and variable Sky

    Science.gov (United States)

    De Luca, A.; Salvaterra, R.; Tiengo, A.; D'Agostino, D.; Watson, M.; Haberl, F.; Wilms, J.

    2017-10-01

    The EXTraS project extracted all temporal domain information buried in the whole database collected by the EPIC cameras onboard the XMM-Newton mission. This included a search and characterisation of variability, both periodic and aperiodic, in hundreds of thousands of sources spanning more than eight orders of magnitude in time scale and six orders of magnitude in flux, as well as a search for fast transients, missed by standard image analysis. Phenomenological classification of variable sources, based on X-ray and multiwavelength information, has also been performed. All results and products of EXTraS are made available to the scientific community through a web public data archive. A dedicated science gateway will allow scientists to apply EXTraS pipelines on new observations. EXTraS is the most comprehensive analysis of variability, on the largest ever sample of soft X-ray sources. The resulting archive and tools disclose an enormous scientific discovery space to the community, with applications ranging from the search for rare events to population studies, with impact on the study of virtually all astrophysical source classes. EXTraS, funded within the EU/FP7 framework, is carried out by a collaboration including INAF (Italy), IUSS (Italy), CNR/IMATI (Italy), University of Leicester (UK), MPE (Germany) and ECAP (Germany).

  18. A clock reaction based on molybdenum blue.

    Science.gov (United States)

    Neuenschwander, Ulrich; Negron, Arnaldo; Jensen, Klavs F

    2013-05-30

    Clock reactions are rare kinetic phenomena, so far limited mostly to systems with ionic oxoacids and oxoanions in water. We report a new clock reaction in cyclohexanol that forms molybdenum blue from a noncharged, yellow molybdenum complex as precursor, in the presence of hydrogen peroxide. Interestingly, the concomitant color change is reversible, enabling multiple clock cycles to be executed consecutively. The kinetics of the clock reaction were experimentally characterized, and by adding insights from quantum chemical calculations, a plausible reaction mechanism was postulated. Key elementary reaction steps comprise sigmatropic rearrangements with five-membered or bicyclo[3.1.0] transition states. Importantly, numerical kinetic modeling demonstrated the mechanism's ability to reproduce the experimental findings. It also revealed that clock behavior is intimately connected to the sudden exhaustion of hydrogen peroxide. Due to the stoichiometric coproduction of ketone, the reaction bears potential for application in alcohol oxidation catalysis.

  19. Blue Marble: Remote Characterization of Habitable Planets

    Science.gov (United States)

    Woolf, Neville; Lewis, Brian; Chartres, James; Genova, Anthony

    2009-01-01

    The study of the nature and distribution of habitable environments beyond the Solar System is a key area for Astrobiology research. At the present time, our Earth is the only habitable planet that can be characterized in the same way that we might characterize planets beyond the Solar System. Due to limitations in our current and near-future technology, it is likely that extra-solar planets will be observed as single-pixel objects. To understand this data, we must develop skills in analyzing and interpreting the radiation obtained from a single pixel. These skills must include the study of the time variation of the radiation, and the range of its photometric, spectroscopic and polarimetric properties. In addition, to understand whether we are properly analyzing the single pixel data, we need to compare it with a ground truth of modest resolution images in key spectral bands. This paper discusses the concept for a mission called Blue Marble that would obtain data of the Earth using a combination of spectropolarimetry, spectrophotometry, and selected band imaging. To obtain imagery of the proper resolution, it is desirable to place the Blue Marble spacecraft no closer than the outer region of cis-lunar space. This paper explores a conceptual mission design that takes advantage of low-cost launchers, bus designs and mission elements to provide a cost effective observing platform located at one of the stable Earth-moon Lagrangian points (L4, L5). The mission design allows for the development and use of novel technologies, such as a spinning moon sensor for attitude control, and leverages lessons-learned from previous low-cost spacecraft such as Lunar Prospector to yield a low-risk mission concept.

  20. French contribution to develop Prussian blue.

    Science.gov (United States)

    Besse Bardot, Isabelle; Bardot, Sebastien; Menetrier, Florence; Leiterer, Alexandra; Pech, Annick

    2014-11-01

    Prussian blue is an antidote indicated for the treatment of internal cesium radioisotope contamination. The French armed forces develop and manufacture some antidotal drugs meeting regulatory, analytical and pharmaceutical requirements in order to submit marketing authorization documentation. Prior to an initial meeting with the French National Agency for Medicines and Health Products Safety (ANSM) in 2011, the authors were following regulatory developments in free cyanide release, active pharmaceutical ingredient (API) synthesis, API specifications, ability of cesium/Prussian blue binding products and collection of pre-clinical data. Free cyanide release was assessed by ultraviolet-visible (UV-Vis) spectrometry at 615 nm. The kinetics of cesium were evaluated in vitro by flame atomic absorption. Good laboratory practice (GLP) and mutagenic assays were examined in rat studies to assess 'no absorption'. A validated method makes it possible to assess the free cyanide in API according to the published tolerability in humans. The French synthesizer meets good manufacturing practice (GMP) to give a drug that is compliant with all specifications, ensuring its high quality. Two standard mutagenic assays showed mutagenic potential, leading to further tests to obtain more information on any induced chromosomal aberrations. Absorption could be an important factor in determining the risk posed by the drug. The French health service provides the country with several antidotal drugs reducing Chemical, Biological, Radiological and Nuclear (CBRN) risks. Using their GMP manufacturing facilities and pharmaceutical expertise, the French armed forces have contributed to developing drugs with marketing authorization, such as pentetate calcium trisodium (Ca-DTPA) for infusion, or under development with the French Alternative Energies and Atomic Energy Commission (CEA), such as Ca-DTPA by inhalation.

  1. Complex variables

    CERN Document Server

    Flanigan, Francis J

    2010-01-01

    A caution to mathematics professors: Complex Variables does not follow conventional outlines of course material. One reviewer noting its originality wrote: ""A standard text is often preferred [to a superior text like this] because the professor knows the order of topics and the problems, and doesn't really have to pay attention to the text. He can go to class without preparation."" Not so here-Dr. Flanigan treats this most important field of contemporary mathematics in a most unusual way. While all the material for an advanced undergraduate or first-year graduate course is covered, discussion

  2. Towards a Numerical Simulation of the Blue Whirl

    Science.gov (United States)

    Zhang, Xiao; Chung, Joseph; Houim, Ryan; Kaplan, Carolyn; Oran, Elaine

    2017-11-01

    The blue whirl is a newly observed flame structure shown to evolve from a fire whirl. A new computational model is being developed to simulate this phenomenon and help explain the transition and structure. A three-dimensional numerical model was constructed to solve the partially compressible, reactive Navier-Stokes equations. The fourth-order Flux- Corrected Transport (FCT) algorithm is used for convection and the Barely Implicit Correction (BIC) is applied to remove the time step restriction imposed by the sound speed. A simplified chemical-diffusive (CD) model accounts for the chemical-energy release. The diffusion process models the mass diffusion, heat conduction, and viscous diffusion. The CD chemical model implemented here allows for variable equivalence ratios, allowing for computations of both premixed and non-premixed systems without the additional numerical cost of solving a multi-step chemical model and tracking many intermediate species. The implementation of these methods and models along with various test problems are presented.

  3. A model for aperiodicity in earthquakes

    Directory of Open Access Journals (Sweden)

    B. Erickson

    2008-01-01

    Full Text Available Conditions under which a single oscillator model coupled with Dieterich-Ruina's rate and state dependent friction exhibits chaotic dynamics is studied. Properties of spring-block models are discussed. The parameter values of the system are explored and the corresponding numerical solutions presented. Bifurcation analysis is performed to determine the bifurcations and stability of stationary solutions and we find that the system undergoes a Hopf bifurcation to a periodic orbit. This periodic orbit then undergoes a period doubling cascade into a strange attractor, recognized as broadband noise in the power spectrum. The implications for earthquakes are discussed.

  4. Renormalization transformation of periodic and aperiodic lattices

    International Nuclear Information System (INIS)

    Macia, Enrique; Rodriguez-Oliveros, Rogelio

    2006-01-01

    In this work we introduce a similarity transformation acting on transfer matrices describing the propagation of elementary excitations through either periodic or Fibonacci lattices. The proposed transformation can act at two different scale lengths. At the atomic scale the transformation allows one to express the systems' global transfer matrix in terms of an equivalent on-site model one. Correlation effects among different hopping terms are described by a series of local phase factors in that case. When acting on larger scale lengths, corresponding to short segments of the original lattice, the similarity transformation can be properly regarded as describing an effective renormalization of the chain. The nature of the resulting renormalized lattice significantly depends on the kind of order (i.e., periodic or quasiperiodic) of the original lattice, expressing a delicate balance between chemical complexity and topological order as a consequence of the renormalization process

  5. No effect of blue on winning contests in judo

    NARCIS (Netherlands)

    Dijkstra, Peter D.; Preenen, Paul T. Y.

    2008-01-01

    A study by Rowe et al. reported a winning bias for judo athletes wearing a blue outfit relative to those wearing a white one during the 2004 Olympics. It was suggested that blue is associated with a higher likelihood of winning through differential effects of colour on opponent visibility and/or an

  6. Isolation and Characterization of Blue Green Algae from Egyptian ...

    African Journals Online (AJOL)

    meldemellawy

    2014-02-20

    Feb 20, 2014 ... aminotransferase (AMT) domains of the mycE and ndaF genes (Jungblut et al., 2006) allowing detection of microcystin and nodularin-producing cyanobacteria. MATERIALS AND METHODS. Isolation and cultivation of blue green algae. Blue green algae had been isolated from soil of Rice field in river.

  7. Designing green and blue infrastructure to support healthy urban living

    NARCIS (Netherlands)

    Gehrels, H.; Meulen, van der Suzanne; Schasfoort, F.; Bosch, Peter; Brolsma, R.; Dinther, van D.; Geerling, G.J.; Goossens, M.; Jacobs, C.M.J.; jong, de Merijn; Kok, Sien; Massop, H.T.L.

    2016-01-01

    This report focuses on developing concepts and design principles for blue and green infrastructure that not only support climate resilience but also contribute to a healthy and liveable urban environment. We will first assess the effectiveness of blue and green infrastructure on the basis of

  8. Effects of fire and browsing on regeneration of blue oak

    Science.gov (United States)

    James W. Bartolome; Mitchel P. McClaran; Barbara H. Allen-Diaz; Jim Dunne; Lawrence D. Ford; Richard B. Standiford; Neil K. McDougald; Larry C. Forero

    2002-01-01

    Blue oaks (Quercus douglasii) are not regenerating well over much of California. The roles of fire and browsing in regeneration are probably significant, but poorly understood. We burned two foothill blue oak woodland sites which contained significant numbers of small trees between 40 and 70 cm tall, then compared height growth over 14 years among 48...

  9. QCD on the BlueGene/L Supercomputer

    Science.gov (United States)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-03-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented.

  10. QCD on the BlueGene/L Supercomputer

    International Nuclear Information System (INIS)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-01-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented

  11. Blue superradiance from neat semiconducting alternating copolymer films

    NARCIS (Netherlands)

    Brouwer, H.J; Krasnikov, V.V.; Hilberer, A; Hadziioannou, G

    1996-01-01

    Blue superradiant emission in thin polymer films with a low energy threshold, as reported here, offers hope for the possible development of solid-state electrically pumped polymer lasers The absorbance, emission, and fluorescence spectra of the blue-light emitting copolymer

  12. Trypan Blue Dye In Extra-Capsular Cataract Surgery: Initial ...

    African Journals Online (AJOL)

    The two groups had incidence of striate keratitis, anterior capsule remnants, unplanned anterior chamber (A/C) lens implants and average increase in surgery time compared. The trypan blue group had better results than the non-trypan group. The trypan blue group had an incidence of 40.7% striate keratitis as against ...

  13. POSTPARTUM BLUES PADA PERSALINAN DIBAWAH USIA DUA PULUH TAHUN

    Directory of Open Access Journals (Sweden)

    Kurniasari Pratiwi

    2017-05-01

    Full Text Available Postpartum blues or baby blues is a feeling of sadness experienced by mothers after childbirth related to the baby. Postpartum blues is like an iceberg that is difficult to detect because there are still many people who do not understand about the event. Nevertheless, postpartum blues not being handled properly is one of the factors precipitating the occurrence of postpartum depression,  can be fatal for mother and baby. Postpartum blues more common in women who marry in their early age. Indonesia has high percentage of early age marriage in the world (ranked 37 and is the second highest in ASEAN after Cambodia. Based on data, there was increasing number of woman cases delivering labor and having children in the village Panggungharjo Sewon Bantul from year 2013 to 2015. Research objectives are to determine the postpartum blues in labor under the age of 20 years. This study is a descriptive study with retrospective design. The study population consists of women who gave birth  under the age of 20 years in the village of Panggungharjo, Sewon, Bantul using total sampling (33 subjects. The result showed that 45.5% of respondents who experienced postpartum blues and 54.5% did not experience postpartum blues.

  14. nonlinear kinetics and mechanism of nile blue reaction

    African Journals Online (AJOL)

    Prof. S.B. Jonnalagadda

    A 11-step mechanism, consistent with the overall reaction dynamics and supported by simulations, is ... been designed based on the chemistry of BZ reactions, the role of bromide ion under various concentration ... dynamics of nile blue - acidic bromate reaction arises from the extremely slow depletion rate of nile blue in the ...

  15. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  16. Blue Genes : Sharing and Conserving the World's Aquatic Biodiversity

    International Development Research Centre (IDRC) Digital Library (Canada)

    Blue Genes : Sharing and Conserving the World's Aquatic Biodiversity. Couverture du livre Blue Genes: Sharing and Conserving the World's Aquatic Biodiversity. Auteur(s) : David Greer et Brian Harvey. Maison(s) d'édition : Earthscan, CRDI. 31 août 2004. ISBN : 1844071065. 246 pages. e-ISBN : 1552501574.

  17. Soluble or insoluble prussian blue for radiocesium and thallium poisoning?

    Science.gov (United States)

    Thompson, Dennis F; Callen, Erin D

    2004-09-01

    To review the available English-language literature concerning the efficacy of soluble and insoluble Prussian blue used as a therapeutic agent in radiocesium and thallium poisoning. A thorough search of MEDLINE, Toxline, and EMBASE databases (1960s-August 2003) was performed. Search terms included Prussian blue, thallium, and radiocesium poisoning. Bibliographies of relevant papers were reviewed for additional citations. study selection AND DATA EXTRACTION: Reports and studies of human trials and cases, along with animal and relevant in vitro data, were sought. Data were categorized as insoluble and soluble Prussian blue and by thallium and radiocesium poisoning. The majority of evidence describing the efficacy of Prussian blue for radiocesium poisoning is based on the use of the insoluble form. In contrast, the majority of data supporting the efficacy of Prussian blue in thallium poisoning involves the use of the soluble form. Insoluble Prussian blue has recently been approved in the US for treatment of both thallium and radiocesium poisoning. While there is sufficient evidence that the insoluble form of Prussian blue is effective in radiocesium poisoning, there is a paucity of analogous data supporting its use in thallium poisoning. Whether the physicochemical differences between soluble and insoluble Prussian blue have any effect on outcomes in human poisoning is not known.

  18. Fluctuating and Directional Asymmetry of the Blue Mussel (

    NARCIS (Netherlands)

    Lajus, D.; Katolikova, M.; Strelkov, P.; Hummel, H.

    2015-01-01

    In this work we examined morphological variation at different levels to study performance and population structuring of the blue mussel Mytilus edulis. Our objectives were: (i) to develop an integrated technique for analyzing morphological variation in blue mussels and, based on this technique; (ii)

  19. Blue whales Balaenoptera musculus off Angola: recent sightings ...

    African Journals Online (AJOL)

    The population of blue whales Balaenoptera musculus inhabiting the South-East Atlantic (Gabon to South Africa) was heavily depleted by commercial whaling. We report four photographically-verified sightings, and one probable sighting, of blue whales in deep waters (>1 000 m) off central Angola (11° S to 12°30′S) ...

  20. Protonation of Patented Blue V in aqueous solutions: theoretical and ...

    Indian Academy of Sciences (India)

    The acid-base properties of the Patented Blue V dye were studied by spectrophotometry and tristimulus colourimetry. The mechanism of protonation of Patented Blue V has been investigated with semiempirical and DFT methods.The quantum chemical calculations of total energy defined the most stable isomer foreach ...

  1. Current distribution and population size of the Blue Swallow Hirundo ...

    African Journals Online (AJOL)

    Two surveys of Blue Swallows were conducted in the southern Tanzanian highland grasslands in order to determine the habitat preferences and estimate the size of this subpopulation. During the 2008/09 and 2012 surveys, a total distance of 3 635 km was travelled in search of Blue Swallows (at an altitude of above 1 400 ...

  2. OBSTACLES TO BLUE-COLLAR PARTICIPATION IN ADULT EDUCATION.

    Science.gov (United States)

    LONDON, JACK; WENKERT, ROBERT

    WITH THE INCREASING LEISURE TIME OF BLUE-COLLAR WORKERS, CONCERN IS GROWING OVER THEIR LOW PARTICIPATION IN ADULT EDUCATION PROGRAMS. MYTHS ABOUT BLUE-COLLAR WORKERS WHICH STAND IN THEIR WAY INCLUDE--LOWER CLASS APATHY, INCAPABILITY OF SUSTAINED INTELLECTUAL EFFORT, AND LACK OF APPRECIATION OF THE VALUE OF EDUCATION. OBSTACLES INHERING IN SOCIAL…

  3. Conservation priorities for the Blue Crane (Anthropoides paradiseus ...

    African Journals Online (AJOL)

    Detailed knowledge on population numbers, habitat preferences and threats is lacking for the Blue Crane (Anthropoides paradiseus), which is endemic to southern Africa and is South Africa's national bird. Using the South African Bird Atlas Project Blue Crane distribution as the accepted distribution of the species, this ...

  4. Blue whales Balaenoptera musculus in offshore waters of Kenya ...

    African Journals Online (AJOL)

    Observations of blue whales were made in Kenyan offshore waters during a seismic survey from September 2014 to January 2015. These represent the first live at-sea sightings of blue whales reported from Kenyan waters. All 30 sightings occurred between September and October in waters ranging from 2 990 to 4 705 m ...

  5. Blue Oak Canopy Effect on Seasonal Forage Production and Quality

    Science.gov (United States)

    William E. Frost; Neil K. McDougald; Montague W. Demment

    1991-01-01

    Forage production and forage quality were measured seasonally beneath the canopy of blue oak (Quercus douglasii) and in open grassland at the San Joaquin Experimental Range. At the March and peak standing crop sampling dates forage production was significantly greater (p=.05) beneath blue oak compared to open grassland. At most sampling dates, the...

  6. BLUE OCEAN STRATEGY (BOS SEBAGAI PARADIGMA BARU MANAJEMEN PENDIDIKAN ISLAM

    Directory of Open Access Journals (Sweden)

    Ikhwan Fuad

    2016-08-01

    Full Text Available The focus of this article is to describe the Blue Ocean Strategy as a new paradigm of Islamic education management. the author seeks to elaborate on how the adoption of the Blue Ocean strategy of the business world to the world of education and answered the principles of what is accepted and rejected away from the theory. Adoption of blue ocean strategy is done by applying the universal principles are : among others reconstruct market boundaries, focus on the big picture rather than numbers, reach beyond existing demand, perform a series of strategies with appropriate, efforts to overcome organizational constraints and integrate execution into strategy. The principles of Blue Ocean Strategy Indicators that can be absorbed is an indicator that focuses gave excellent service and were not absorbed is a strong indicator of economic motivation. Generally, Blue Ocean Strategy quite well applied as a management paradigm of Islamic education.

  7. A Rare Case of Multifocal Prostatic Blue Nevus

    Directory of Open Access Journals (Sweden)

    Elias J. Farran

    2018-01-01

    Full Text Available Prostatic blue nevus is a rare benign pathologic diagnosis most commonly diagnosed incidentally on many different types of prostate specimens. Blue nevus is the deposition of stromal melanin characterized by spindle cells within the fibromuscular stroma which stains positive for melanin-specific stains Fontana-Masson and S100 and stains negative for CD68, HMB45, and iron stains. We report the case of a multifocal and bilateral blue nevus in a 52-year-old Hispanic male who presented with an elevated prostate-specific antigen of 4.3 and mild obstructive lower urinary tract symptoms, found by transrectal ultrasound-guided prostate needle biopsy. The biopsy also revealed benign prostatic tissue with postatrophic hyperplasia and chronic inflammation. This is the 35th reported case of prostatic blue nevus and the third to show multifocal blue nevus.

  8. Methylene blue promotes quiescence of rat neural progenitor cells

    Directory of Open Access Journals (Sweden)

    LUOKUN eXIE

    2014-10-01

    Full Text Available Neural stem cell-based treatment holds a new therapeutic opportunity for neurodegenerative disorders. Here, we investigated the effect of methylene blue on proliferation and differentiation of rat neural progenitor cells (NPCs both in vitro and in vivo. We found that methylene blue inhibited proliferation and promoted quiescence of NPCs in vitro without affecting committed neuronal differentiation. Consistently, intracerebroventricular infusion of methylene blue significantly inhibited neural progenitor cell proliferation at the subventricular zone (SVZ. Methylene blue inhibited mTOR signaling along with down-regulation of cyclins in NPCs in vitro and in vivo. In summary, our study indicates that methylene blue may delay NPC senescence through enhancing NPCs quiescence.

  9. Growth stimulation produced by methylene blue treatment in sweet potato

    International Nuclear Information System (INIS)

    Lage, C.L.S.; Esquibel, M.A.

    1997-01-01

    Methylene blue as an alternative treatment to gamma rays to stimulate growth in sweet potato tissue cultures, was applied in two different ways: – pre-incubation of nodal explants with methylene blue for 1 h using urea as a permeabilizer; – methylene blue directly incorporated into the culture medium. Both treatments stimulated growth, but the better performance being obtained with the second treatment, which had no toxic effect. The activity and electrophoresis pattern of peroxidase after treatment of Ipomoea batatas plantlets with methylene blue or gamma rays did not show similar results for the two treatments. Peroxidase activity was greater in leaves of gamma ray treated plants compared to the non-treated control. The results obtained with the Methylene blue treatment did not significantly change the peroxidase activity relative to the control. (author)

  10. PRECISION PHOTOMETRIC MONITORING OF VERY LOW MASS σ ORIONIS CLUSTER MEMBERS: VARIABILITY AND ROTATION AT A FEW Myr

    International Nuclear Information System (INIS)

    Cody, Ann Marie; Hillenbrand, Lynne A.

    2010-01-01

    We present high-precision photometry on 107 variable low-mass stars and brown dwarfs in the ∼3 Myr σ Orionis open cluster. We have carried out I-band photometric monitoring within two fields, encompassing 153 confirmed or candidate members of the low-mass cluster population, from 0.02 to 0.5 M sun . We are sensitive to brightness changes on timescales from 10 minutes to two weeks with amplitudes as low as 0.004 mag, and find variability on these timescales in nearly 70% of cluster members. We identify both periodic and aperiodic modes of variability, as well as semi-periodic rapid fading events that are not accounted for by the standard explanations of rotational modulation of surface features or accretion. We have incorporated both optical and infrared color data to uncover trends in variability with mass and circumstellar disks. While the data confirm that the lowest-mass objects (M sun ) rotate more rapidly than the 0.2-0.5 M sun members, they do not support a direct connection between rotation rate and the presence of a disk. Finally, we speculate on the origin of irregular variability in cluster members with no evidence for disks or accretion.

  11. Genetic variability in three Amazon parrot species

    Directory of Open Access Journals (Sweden)

    IF. Lopes

    Full Text Available Parrots of the genus Amazona are among the most threatened species of the Order Pscittaciformes. This work describes allozyme polymorphisms in three Amazon parrot species - the Blue-fronted Amazon (Amazona aestiva, the Orange-winged Amazon (Amazona amazonica, and the Festive Amazon (Amazona festiva -, and provides useful data for the evaluation of their genetic variability. We electrophoretically analyzed blood samples from 68 wild-caught individuals, maintained in captivity in three Brazilian zoos. Eight of the ten studied enzyme loci exhibited polymorphism. Glucosephosphate isomerase (Gpi proved to be a diagnostic locus for the identification of these Amazon species. The expected average heterozygosity of the Blue-fronted Amazon (0.060 differed significantly from the expected heterozygosities of the Orange-winged Amazon and the Festive Amazon (0.040 and 0.039, respectively. This result was discussed as a consequence of hybridization between two geographic A. aestiva subspecies, and alternatively as a particular trait of this species. Genetic variability of the Blue-fronted Amazon compared to birds in general is not low on a species-wide level, despite the fact that this parrot is one of the most illegally traded species. Allozyme analysis proved to be an useful tool in monitoring the genetic variation within the genus Amazona and can be applied in the management program of other threatened species of this genus.

  12. Genetic variability in three Amazon parrot species.

    Science.gov (United States)

    Lopes, I F; Del Lama, M A; Del Lama, S N

    2007-12-01

    Parrots of the genus Amazona are among the most threatened species of the Order Pscittaciformes. This work describes allozyme polymorphisms in three Amazon parrot species--the Blue-fronted Amazon (Amazona aestiva), the Orange-winged Amazon (Amazona amazonica), and the Festive Amazon (Amazona festiva) -, and provides useful data for the evaluation of their genetic variability. We electrophoretically analyzed blood samples from 68 wild-caught individuals, maintained in captivity in three Brazilian zoos. Eight of the ten studied enzyme loci exhibited polymorphism. Glucosephosphate isomerase (Gpi) proved to be a diagnostic locus for the identification of these Amazon species. The expected average heterozygosity of the Blue-fronted Amazon (0.060) differed significantly from the expected heterozygosities of the Orange-winged Amazon and the Festive Amazon (0.040 and 0.039, respectively). This result was discussed as a consequence of hybridization between two geographic A. aestiva subspecies, and alternatively as a particular trait of this species. Genetic variability of the Blue-fronted Amazon compared to birds in general is not low on a species-wide level, despite the fact that this parrot is one of the most illegally traded species. Allozyme analysis proved to be an useful tool in monitoring the genetic variation within the genus Amazona and can be applied in the management program of other threatened species of this genus.

  13. "Blue-Collar Blues" : kõigi maade töötud, ühinege! / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016

    2009-01-01

    Rahvusvaheline näitus "Blue-Collar Blues" Tallinna Kunstihoones ja Kunstihoone galeriis 31. jaanuarini 2010. Kuraator Anders Härm. Näituse ajendiks on 1. juulist 2009 Eestis kehtima hakanud töölepinguseadus, näituse fookus on töösuhetel

  14. 76 FR 19466 - Wellpoint, Inc. D/B/A/Anthem Blue Cross & Blue Shield, et al.; Amended Certification Regarding...

    Science.gov (United States)

    2011-04-07

    ... Employment and Training Administration Wellpoint, Inc. D/B/A/Anthem Blue Cross & Blue Shield, et al.; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance TA-W-74,895 Wellpoint, Inc. D/B/A... from Kelly Services and Jacobsen Group Indianapolis, Indiana TA-W-74,895A Wellpoint, Inc. D/B/A/Anthem...

  15. EMODnet MedSea Checkpoint for sustainable Blue Growth

    Science.gov (United States)

    Moussat, Eric; Pinardi, Nadia; Manzella, Giuseppe; Blanc, Frederique

    2016-04-01

    The EMODNET checkpoint is a wide monitoring system assessment activity aiming to support the sustainable Blue Growth at the scale of the European Sea Basins by: 1) Clarifying the observation landscape of all compartments of the marine environment including Air, Water, Seabed, Biota and Human activities, pointing out to the existing programs, national, European and international 2) Evaluating fitness for use indicators that will show the accessibility and usability of observation and modeling data sets and their roles and synergies based upon selected applications by the European Marine Environment Strategy 3) Prioritizing the needs to optimize the overall monitoring Infrastructure (in situ and satellite data collection and assembling, data management and networking, modeling and forecasting, geo-infrastructure) and release recommendations for evolutions to better meet the application requirements in view of sustainable Blue Growth The assessment is designed for : - Institutional stakeholders for decision making on observation and monitoring systems - Data providers and producers to know how their data collected once for a given purpose could fit other user needs - End-users interested in a regional status and possible uses of existing monitoring data Selected end-user applications are of paramount importance for: (i) the blue economy sector (offshore industries, fisheries); (ii) marine environment variability and change (eutrophication, river inputs and ocean climate change impacts); (iii) emergency management (oil spills); and (iv) preservation of natural resources and biodiversity (Marine Protected Areas). End-user applications generate innovative products based on the existing observation landscape. The fitness for use assessment is made thanks to the comparison of the expected product specifications with the quality of the product derived from the selected data. This involves the development of checkpoint information and indicators based on Data quality and

  16. Space-time modelling of lightning-caused ignitions in the Blue Mountains, Oregon

    Science.gov (United States)

    Diaz-Avalos, Carlos; Peterson, D.L.; Alvarado, Ernesto; Ferguson, Sue A.; Besag, Julian E.

    2001-01-01

    Generalized linear mixed models (GLMM) were used to study the effect of vegetation cover, elevation, slope, and precipitation on the probability of ignition in the Blue Mountains, Oregon, and to estimate the probability of ignition occurrence at different locations in space and in time. Data on starting location of lightning-caused ignitions in the Blue Mountains between April 1986 and September 1993 constituted the base for the analysis. The study area was divided into a pixela??time array. For each pixela??time location we associated a value of 1 if at least one ignition occurred and 0 otherwise. Covariate information for each pixel was obtained using a geographic information system. The GLMMs were fitted in a Bayesian framework. Higher ignition probabilities were associated with the following cover types: subalpine herbaceous, alpine tundra, lodgepole pine (Pinus contorta Dougl. ex Loud.), whitebark pine (Pinus albicaulis Engelm.), Engelmann spruce (Picea engelmannii Parry ex Engelm.), subalpine fir (Abies lasiocarpa (Hook.) Nutt.), and grand fir (Abies grandis (Dougl.) Lindl.). Within each vegetation type, higher ignition probabilities occurred at lower elevations. Additionally, ignition probabilities are lower in the northern and southern extremes of the Blue Mountains. The GLMM procedure used here is suitable for analysing ignition occurrence in other forested regions where probabilities of ignition are highly variable because of a spatially complex biophysical environment.

  17. Phototherapy with blue and green mixed-light is as effective against unconjugated jaundice as blue light and reduces oxidative stress in the Gunn rat model.

    OpenAIRE

    Uchida, Yumiko; Morimoto, Yukihiro; Uchiike, Takao; Kamamoto, Tomoyuki :4/0000339; Hayashi, Tamaki; Arai, Ikuyo; Nishikubo, Toshiya; Takahashi, Yukihiro

    2015-01-01

    OBJECTIVE:Phototherapy using blue light-emitting diodes (LED) is effective against neonatal jaundice. However, green light phototherapy also reduces unconjugated jaundice. We aimed to determine whether mixed blue and green light can relieve jaundice with minimal oxidative stress as effectively as either blue or green light alone in a rat model.METHODS:Gunn rats were exposed to phototherapy with blue (420-520 nm), filtered blue (FB; 440-520 nm without

  18. Serotonin syndrome following methylene blue administration during cardiothoracic surgery.

    Science.gov (United States)

    Smith, Christina J; Wang, Dorothy; Sgambelluri, Anna; Kramer, Robert S; Gagnon, David J

    2015-04-01

    Despite its favorable safety profile, there have been reports of methylene blue-induced encephalopathy and serotonin syndrome in patients undergoing parathyroidectomy. We report a case of serotonin syndrome following methylene blue administration in a cardiothoracic surgery patient. A 59-year-old woman taking preoperative venlafaxine and trazodone was given a single dose of 2 mg/kg methylene blue (167 mg) during a planned coronary artery bypass and mitral valve repair. Postoperatively, she was febrile to 38.7°C and developed full-body tremors, rhythmic twitching of the perioral muscles, slow conjugate roving eye movements, and spontaneous movements of the upper extremities. Electroencephalography revealed generalized diffuse slowing consistent with toxic encephalopathy, and a computed tomography scan showed no acute process. The patient's symptoms were most consistent with a methylene blue-induced serotonin syndrome. Her motor symptoms resolved within 48 hours and she was eventually discharged home. Only 2 cases of methylene blue-induced serotonin syndrome during cardiothoracic surgery have been described in the literature, with this report representing the third case. Methylene blue and its metabolite, azure B, are potent, reversible inhibitors of monoamine oxidase A which is responsible for serotonin metabolism. Concomitant administration of methylene blue with serotonin-modulating agents may precipitate serotonin syndrome. © The Author(s) 2015.

  19. Methylene Blue Inhibits Caspases by Oxidation of the Catalytic Cysteine.

    Science.gov (United States)

    Pakavathkumar, Prateep; Sharma, Gyanesh; Kaushal, Vikas; Foveau, Bénédicte; LeBlanc, Andrea C

    2015-09-24

    Methylene blue, currently in phase 3 clinical trials against Alzheimer Disease, disaggregates the Tau protein of neurofibrillary tangles by oxidizing specific cysteine residues. Here, we investigated if methylene blue can inhibit caspases via the oxidation of their active site cysteine. Methylene blue, and derivatives, azure A and azure B competitively inhibited recombinant Caspase-6 (Casp6), and inhibited Casp6 activity in transfected human colon carcinoma cells and in serum-deprived primary human neuron cultures. Methylene blue also inhibited recombinant Casp1 and Casp3. Furthermore, methylene blue inhibited Casp3 activity in an acute mouse model of liver toxicity. Mass spectrometry confirmed methylene blue and azure B oxidation of the catalytic Cys163 cysteine of Casp6. Together, these results show a novel inhibitory mechanism of caspases via sulfenation of the active site cysteine. These results indicate that methylene blue or its derivatives could (1) have an additional effect against Alzheimer Disease by inhibiting brain caspase activity, (2) be used as a drug to prevent caspase activation in other conditions, and (3) predispose chronically treated individuals to cancer via the inhibition of caspases.

  20. Blue light-induced oxidative stress in live skin.

    Science.gov (United States)

    Nakashima, Yuya; Ohta, Shigeo; Wolf, Alexander M

    2017-07-01

    Skin damage from exposure to sunlight induces aging-like changes in appearance and is attributed to the ultraviolet (UV) component of light. Photosensitized production of reactive oxygen species (ROS) by UVA light is widely accepted to contribute to skin damage and carcinogenesis, but visible light is thought not to do so. Using mice expressing redox-sensitive GFP to detect ROS, blue light could produce oxidative stress in live skin. Blue light induced oxidative stress preferentially in mitochondria, but green, red, far red or infrared light did not. Blue light-induced oxidative stress was also detected in cultured human keratinocytes, but the per photon efficacy was only 25% of UVA in human keratinocyte mitochondria, compared to 68% of UVA in mouse skin. Skin autofluorescence was reduced by blue light, suggesting flavins are the photosensitizer. Exposing human skin to the blue light contained in sunlight depressed flavin autofluorescence, demonstrating that the visible component of sunlight has a physiologically significant effect on human skin. The ROS produced by blue light is probably superoxide, but not singlet oxygen. These results suggest that blue light contributes to skin aging similar to UVA. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Effects of blue light and caffeine on mood.

    Science.gov (United States)

    Ekström, Johan G; Beaven, C Martyn

    2014-09-01

    Both short wavelength (blue) light and caffeine have been studied for their mood enhancing effects on humans. The ability of blue light to increase alertness, mood and cognitive function via non-image forming neuropathways has been suggested as a non-pharmacological countermeasure for depression across a range of occupational settings. This experimental study compared blue light and caffeine and aimed to test the effects of blue light/placebo (BLU), white light/240-mg caffeine (CAF), blue light/240-mg caffeine (BCAF) and white light/placebo (PLA), on mood. A randomised, controlled, crossover design study was used, in a convenience population of 20 healthy volunteers. The participants rated their mood on the Swedish Core Affect Scales (SCAS) prior to and after each experimental condition to assess the dimensions of valence and activation. There was a significant main effect of light (p = 0.009), and the combination of blue light and caffeine had clear positive effects on core effects (ES, ranging from 0.41 to 1.20) and global mood (ES, 0.61 ± 0.53). The benefits of the combination of blue light and caffeine should be further investigated across a range of applications due to the observed effects on the dimensions of arousal, valence and pleasant activation.

  2. DisBlue+: A distributed annotation-based C# compiler

    Directory of Open Access Journals (Sweden)

    Samir E. AbdelRahman

    2010-06-01

    Full Text Available Many programming languages utilize annotations to add useful information to the program but they still result in more tokens to be compiled and hence slower compilation time. Any current distributed compiler breaks the program into scattered disjoint pieces to speed up the compilation. However, these pieces cooperate synchronously and depend highly on each other. This causes massive overhead since messages, symbols, or codes must be roamed throughout the network. This paper presents two promising compilers named annotation-based C# (Blue+ and distributed annotation-based C# (DisBlue+. The proposed Blue+ annotation is based on axiomatic semantics to replace the if/loop constructs. As the developer tends to use many (complex conditions and repeat them in the program, such annotations reduce the compilation scanning time and increases the whole code readability. Built on the top of Blue+, DisBlue+ presents its proposed distributed concept which is to divide each program class to its prototype and definition, as disjoint distributed pieces, such that each class definition is compiled with only its related compiled prototypes (interfaces. Such concept reduces the amount of code transferred over the network, minimizes the dependencies among the disjoint pieces, and removes any possible synchronization between them. To test their efficiencies, Blue+ and DisBlue+ were verified with large-size codes against some existing compilers namely Javac, DJavac, and CDjava.

  3. Rapid assessment of different oxygenic phototrophs and single-cell photosynthesis with multicolour variable chlorophyll fluorescence imaging

    DEFF Research Database (Denmark)

    Trampe, Erik Christian Løvbjerg; Kolbowski, J.; Schreiber, U.

    2011-01-01

    We present a new system for microscopic multicolour variable chlorophyll fluorescence imaging of aquatic phototrophs. The system is compact and portable and enables microscopic imaging of photosynthetic performance of individual cells and chloroplasts using different combinations of blue, green, ...

  4. The discrimination of (non-denim) blue cotton.

    Science.gov (United States)

    Palmer, Ray; Hutchinson, William; Fryer, Verity

    2009-03-01

    This study was conducted to determine the degree of discrimination obtained between non-denim blue cotton fibres using visible-UV range microspectrophotometry alone. To this end, samples of fibres were taken from 100, nondenim, blue cotton, outer garments, including t-shirts, trousers and jumpers and subjected to analysis by both visible and UV range microspectrophotometry. The results obtained from the samples of each garment were compared to determine if they 'matched' or not. From an initial visual comparison of the garments it was possible to subdivide the samples into two populations consisting of 73 'dark blue' garments and 27 'mid-blue' garments. It was found that of the 73 'dark blue' garments, 22 distinct sub-populations could be distinguished using visible range MSP, this figure being increased to 43 when the analysis was extended into the UVW range. In the case of the 27 'mid-blue' garments, 9 distinct sub-populations were discriminated using visible range MSP, this figure being increased to 17 when the analysis was extended into the UV range. The discriminating power (i.e., the number of discriminated pairs divided by the number of possible pairs) of visible range microspectrophotometry was calculated as 0.89 for 'mid-blue' garments and 0.87 for 'dark blue' garments. Extending microspectrophotometry into the UV range increased discrimination by 7%, giving a discriminating power of 0.96 for both mid and dark blue cotton fibres which was similar to that reported by a previous study where this method was combined with light and fluorescence microscopy. Intra-garment variation was found to be negligible. The implications of this study for casework are discussed and a revised analytical pathway for the comparison of this fibre type/colour combination using microspectrophotometry as a primary screening tool, is proposed.

  5. Screening of oral premalignant lesions in smokers using toluidine blue

    Directory of Open Access Journals (Sweden)

    Yanti Leosari

    2009-06-01

    Full Text Available Background: A smoker is associated with the risk of developing oral premalignant lesions due to the cacinogenic contents in cigarette. Toluidine blue is a basic chromatic dye used in screening the presence of premalignant lesions due to its ability to detect acidic components in cells and tissues. Purpose: This study was purposed to observe the outcomes of toluidine blue staining on oral mucosa of smokers and non smokers and to find out whether quantity and duration of smoking affect the final results of toluidine blue staining. Methods: Forty male subjects, aged 20-60 years old were involved in this study, consisted of 10 heavy smokers, 10 moderate smokers, 10 light smokers and 10 non smokers. Subjects were instructed to rinse their mouths with mineral water for 20 seconds followed by acetic acid 1% for another 20 seconds. Toluidine blue stain was applied in excess and left on site for 1 minute. Subjects were instructed to rinse with acetic acid 1% and sufficient water consecutively for 20 seconds each. The areas of oral mucosa that stained blue were captured with intraoral camera and transferred to the computer unit. The staining procedure was repeated after 14 days. Results: Chi-square test showed that toluidine blue positive staining dominates the smokers group. Regression and correlation test indicate that Toluidine blue staining is more obvious in subjects who consume more cigarettes. Conclusion: It was concluded that oral mucosa of smokers absorbed more toluidine blue than that of non smokers and retention of toluidine blue is affected by quantity and duration of smoking.

  6. Removal of direct blue-86 from aqueous solution by new activated carbon developed from orange peel.

    Science.gov (United States)

    Nemr, Ahmed El; Abdelwahab, Ola; El-Sikaily, Amany; Khaled, Azza

    2009-01-15

    The use of low-cost, easy obtained, high efficiency and eco-friendly adsorbents has been investigated as an ideal alternative to the current expensive methods of removing dyes from wastewater. This study investigates the potential use of activated carbon prepared from orange peel for the removal of direct blue-86 (DB-86) (Direct Fast Turquoise Blue GL) dye from simulated wastewater. The effects of different system variables, adsorbent dosage, initial dye concentration, pH and contact time were studied. The results showed that as the amount of the adsorbent increased, the percentage of dye removal increased accordingly. Optimum pH value for dye adsorption was determined as approximately 2.0. Maximum dye was sequestered within 30min after the beginning for every experiment. The adsorption of direct blue-86 followed a pseudo-second-order rate equation and fit well Langmuir, Tempkin and Dubinin-Radushkevich (D-R) equations better than Freundlich and Redlich-Peterson equations. The maximum removal of direct blue-86 was obtained at pH 2 as 92% for adsorbent dose of 6gL(-1) and 100mgL(-1) initial dye concentration at room temperature. The maximum adsorption capacity obtained from Langmuir equation was 33.78mgg(-1). Furthermore, adsorption kinetics of DB-86 was studied and the rate of adsorption was found to conform to pseudo-second-order kinetics with a good correlation (R2>0.99) with intraparticle diffusion as one of the rate determining steps. Activated carbon developed from orange peel can be attractive options for dye removal from diluted industrial effluents since test reaction made on simulated dyeing wastewater show better removal percentage of DB-86.

  7. Analyzing runoff processes through conceptual hydrological modeling in the Upper Blue Nile Basin, Ethiopia

    Science.gov (United States)

    Dessie, M.; Verhoest, N. E. C.; Pauwels, V. R. N.; Admasu, T.; Poesen, J.; Adgo, E.; Deckers, J.; Nyssen, J.

    2014-12-01

    Understanding runoff processes in a basin is of paramount importance for the effective planning and management of water resources, in particular in data-scarce regions such as the Upper Blue Nile. Hydrological models representing the underlying hydrological processes can predict river discharges from ungauged catchments and allow for an understanding of the rainfall-runoff processes in those catchments. In this paper, such a conceptual process-based hydrological model is developed and applied to the upper Gumara and Gilgel Abay catchments (both located within the Upper Blue Nile Basin, the Lake Tana sub-basin) to study the runoff mechanisms and rainfall-runoff processes in the basin. Topography is considered as a proxy for the variability of most of the catchment characteristics. We divided the catchments into different runoff production areas using topographic criteria. Impermeable surfaces (rock outcrops and hard soil pans, common in the Upper Blue Nile Basin) were considered separately in the conceptual model. Based on model results, it can be inferred that about 65% of the runoff appears in the form of interflow in the Gumara study catchment, and baseflow constitutes the larger proportion of runoff (44-48%) in the Gilgel Abay catchment. Direct runoff represents a smaller fraction of the runoff in both catchments (18-19% for the Gumara, and 20% for the Gilgel Abay) and most of this direct runoff is generated through infiltration excess runoff mechanism from the impermeable rocks or hard soil pans. The study reveals that the hillslopes are recharge areas (sources of interflow and deep percolation) and direct runoff as saturated excess flow prevails from the flat slope areas. Overall, the model study suggests that identifying the catchments into different runoff production areas based on topography and including the impermeable rocky areas separately in the modeling process mimics the rainfall-runoff process in the Upper Blue Nile Basin well and yields a useful

  8. Analyzing runoff processes through conceptual hydrological modelling in the Upper Blue Nile basin, Ethiopia

    Science.gov (United States)

    Dessie, M.; Verhoest, N. E. C.; Pauwels, V. R. N.; Admasu, T.; Poesen, J.; Adgo, E.; Deckers, J.; Nyssen, J.

    2014-05-01

    Understanding runoff processes in a basin is of paramount importance for the effective planning and management of water resources, in particular in data scarce regions of the Upper Blue Nile. Hydrological models representing the underlying hydrological processes can predict river discharges from ungauged catchments and allow for an understanding of the rainfall-runoff processes in those catchments. In this paper, such a conceptual process-based hydrological model is developed and applied to the upper Gumara and Gilgel Abay catchments (both located within the Upper Blue Nile basin, the Lake Tana sub-basin) to study the runoff mechanisms and rainfall-runoff processes in the basin. Topography is considered as a proxy for the variability of most of the catchment characteristics. We divided the catchments into different runoff production areas using topographic criteria. Impermeable surfaces (rock outcrops and hard soil pans, common in the Upper Blue Nile basin) were considered separately in the conceptual model. Based on model results, it can be inferred that about 65% of the runoff appears in the form of interflow in the Gumara study catchment, and baseflow constitutes the larger proportion of runoff (44-48%) in the Gilgel Abay catchment. Direct runoff represents a smaller fraction of the runoff in both catchments (18-19% for the Gumara, and 20% for the Gilgel Abay) and most of this direct runoff is generated through infiltration excess runoff mechanism from the impermeable rocks or hard soil pans. The study reveals that the hillslopes are recharge areas (sources of interflow and deep percolation) and direct runoff as saturated excess flow prevails from the flat slope areas. Overall, the model study suggests that identifying the catchments into different runoff production areas based on topography and including the impermeable rocky areas separately in the modeling process mimics well the rainfall-runoff process in the Upper Blue Nile basin and brings a useful result

  9. Prussian Blue Mg-Li Hybrid Batteries.

    Science.gov (United States)

    Sun, Xiaoqi; Duffort, Victor; Nazar, Linda F

    2016-08-01

    The major advantage of Mg batteries relies on their promise of employing an Mg metal negative electrode, which offers much higher energy density compared to graphitic carbon. However, the strong coulombic interaction of Mg 2+ ions with anions leads to their sluggish diffusion in the solid state, which along with a high desolvation energy, hinders the development of positive electrode materials. To circumvent this limitation, Mg metal negative electrodes can be used in hybrid systems by coupling an Li + insertion cathode through a dual salt electrolyte. Two "high voltage" Prussian blue analogues (average 2.3 V vs Mg/Mg 2+ ; 3.0 V vs Li/Li + ) are investigated as cathode materials and the influence of structural water is shown. Their electrochemical profiles, presenting two voltage plateaus, are explained based on the two unique Fe bonding environments. Structural water has a beneficial impact on the cell voltage. Capacities of 125 mAh g -1 are obtained at a current density of 10 mA g -1 (≈C/10), while stable performance up to 300 cycles is demonstrated at 200 mA g -1 (≈2C). The hybrid cell design is a step toward building a safe and high density energy storage system.

  10. Blue Sky Birds Come to the World

    Directory of Open Access Journals (Sweden)

    Bura Sabiha Kelek

    2015-06-01

    Full Text Available The New Supply System comes to all fields for logistics.Drone is an unmanned vehicle for loading and unloading packages.Perhaps we can imagine it as a ‘’blue sky bird’’. This new trend has three important impacts that are determined by technoligical capabilities, ,regularity pressure, and public acceptance so that it will be dealed within current powers and circumstances. This kind of vehicles are used in different capacities, such as multicopter,drone or robot.Logistics’ issues are interested in short-term delivery systems for customer satisfaction but all developments go through GPS so it is based on 21st century technological developments, which have been tested on a short-term basis and will be expected to be of use in 2 years. The purpose of this research is to give lead to researchers information about risk and the advantages of using the technology in this manner.Some advantages and disadvantages ,schedules’ problems in the system will be identifed.

  11. Peculiar Type II supernovae from blue supergiants

    Science.gov (United States)

    Kleiser, Io K. W.; Poznanski, Dovi; Kasen, Daniel; Young, Timothy R.; Chornock, Ryan; Filippenko, Alexei V.; Challis, Peter; Ganeshalingam, Mohan; Kirshner, Robert P.; Li, Weidong; Matheson, Thomas; Nugent, Peter E.; Silverman, Jeffrey M.

    2011-07-01

    The vast majority of Type II supernovae (SNeII) are produced by red supergiants, but SN 1987A revealed that blue supergiants (BSGs) can produce members of this class as well, albeit with some peculiar properties. This best-studied event revolutionized our understanding of SNe and linking it to the bulk of Type II events is essential. We present here the optical photometry and spectroscopy gathered for SN 2000cb, which is clearly not a standard SNII and yet is not a SN 1987A analogue. The light curve of SN 2000cb is reminiscent of that of SN 1987A in shape, with a slow rise to a late optical peak, but on substantially different time-scales. Spectroscopically, SN 2000cb resembles a normal SNII, but with ejecta velocities that far exceed those measured for SN 1987A or normal SNeII, above 18 000 km s-1 for Hα at early times. The red colours, high velocities, late photometric peak and our modelling of this object all point towards a scenario involving the high-energy explosion of a small-radius star, most likely a BSG, producing 0.1 M⊙ of 56Ni. Adding a similar object to the sample, SN 2005ci, we derive a rate of ˜2 per cent of the core-collapse rate for this loosely defined class of BSG explosions.

  12. Quantum mechanical model for Maya Blue

    Science.gov (United States)

    Fuentes, María E.; Peña, Brisa; Contreras, César; Montero, Ana L.; Chianelli, Russell; Alvarado, Manuel; Olivas, Ramón; Rodríguez, Luz M.; Camacho, Héctor; Montero-Cabrera, Luis A.

    This work is about Maya Blue (MB), a pigment developed by Mesoamerican civilizations between the 5th and 16th centuries from an aluminosilicate mineral (palygorskite) and an organic dye (indigo). Two different supramolecular quantum-mechanical models afford explanations for the unusual stability of MB based on the oxidation of the indigo molecule during the heating process and its interaction with palygorskite. A model considering indigo derivatives attached to several aluminates shows the principal features of the experimental visible spectrum of MB within the TD-DFT methodology. Another model of an indigo oxidized species confined within an inorganic supramolecular cavity system, that involves about 170 atoms, was calculated after a large configuration interaction of single excited determinants within the NDOL approximation (Montero-Cabrera et al., J Chem Phys, 2007, 127, 145102). It allows a correct reproduction and interpretation of the corresponding spectrum. This second methodology provides the most satisfactory results, being able to manage very big molecular systems at a QM level. Structural explanation for the unusual stability of MB is also provided.

  13. The EXTraS project: Exploring the X-ray Transient and variable Sky

    Science.gov (United States)

    Kreikenbohm, A.; Oertel, M.; Wilms, J.; DeLuca, A.; Haberl, F.; Greiner, J.; Delvaux, C.; Carpano, S.; Law-Green, D.; Rosen, S.

    2015-07-01

    Modern X-ray observatories can yield unique insights into time domain astrophysics. Indeed, a huge amount of information is already stored - and largely unexploited - in data archives. The EXTraS project harvests the hitherto unexplored temporal domain information buried in the serendipitous data collected by the European Photon Imaging Camera (EPIC) instrument onboard the ESA XMM-Newton mission since its launch. This includes a search for fast transients, missed by standard image analysis, and a search and characterization of variability (both periodic and aperiodic) in hundreds of thousands of sources spanning more than nine orders of magnitude in time scale (from less than 1 s to 10 yr) and six orders of magnitude in flux (from 10(-9) to more than 10(-15) erg cm(-2) s(-1) in 0.2-12 keV). X-ray results are to be complemented by multiwavelength characterization of new discoveries. Phenomenological classification of variable sources will also be performed. Our final catalogue and results will be made available to the community, together with new analysis tools, at the end of the project (late 2016). EXTraS is funded within the EU/FP7-Cooperation Space framework and is carried out by a collaboration including INAF (Italy), IUSS (Italy), CNR/IMATI (Italy), University of Leicester (UK), MPE (Germany) and ECAP (Germany).

  14. Spatial dynamics and expanded vertical niche of blue sharks in oceanographic fronts reveal habitat targets for conservation.

    Directory of Open Access Journals (Sweden)

    Nuno Queiroz

    Full Text Available Dramatic population declines among species of pelagic shark as a result of overfishing have been reported, with some species now at a fraction of their historical biomass. Advanced telemetry techniques enable tracking of spatial dynamics and behaviour, providing fundamental information on habitat preferences of threatened species to aid conservation. We tracked movements of the highest pelagic fisheries by-catch species, the blue shark Prionace glauca, in the North-east Atlantic using pop-off satellite-linked archival tags to determine the degree of space use linked to habitat and to examine vertical niche. Overall, blue sharks moved south-west of tagging sites (English Channel; southern Portugal, exhibiting pronounced site fidelity correlated with localized productive frontal areas, with estimated space-use patterns being significantly different from that of random walks. Tracked female sharks displayed behavioural variability in diel depth preferences, both within and between individuals. Diel depth use ranged from normal DVM (nDVM; dawn descent, dusk ascent, to reverse DVM (rDVM; dawn ascent, dusk descent, to behavioural patterns where no diel differences were apparent. Results showed that blue sharks occupy some of the most productive marine zones for extended periods and structure diel activity patterns across multiple spatio-temporal scales in response to particular habitat types. In so doing, sharks occupied an extraordinarily broad vertical depth range for their size (1.0-2.0 m fork length, from the surface into the bathypelagic realm (max. dive depth, 1160 m. The space-use patterns of blue sharks indicated they spend much of the time in areas where pelagic longlining activities are often highest, and in depth zones where these fisheries particularly target other species, which could account for the rapid declines recently reported for blue sharks in many parts of the world's oceans. Our results provide habitat targets for blue shark

  15. Methylene blue-related corneal edema and iris discoloration.

    Science.gov (United States)

    Timucin, Ozgur Bulent; Karadag, Mehmet Fatih; Aslanci, Mehmet Emin; Baykara, Mehmet

    2016-04-01

    We report the case of a 70-year-old female patient who developed corneal edema and iris discoloration following the inadvertent use of 1% methylene blue instead of 0.025% trypan blue to stain the anterior capsule during cataract phacoemulsification surgery. Copious irrigation was performed upon realization of incorrect dye use. Corneal edema and iris discoloration developed during the early postoperative period and persisted at 24-months follow-up. However, keratoplasty was not required. The intracameral use of 1% methylene blue has a cytotoxic effect on the corneal endothelium and iris epithelium. Copious irrigation for at least 30 min using an anterior chamber maintainer may improve outcomes.

  16. Blue-light emitting triazolopyridinium and triazoloquinolinium salts

    KAUST Repository

    Carboni, Valentina

    2017-01-27

    Compounds that emit blue light are of interest for applications that include optoelectronic devices and chemo/biosensing and imaging. The design and synthesis of small organic molecules that can act as high-efficiency deep-blue-light emitters in the solid state and can be easily processed from solutions represents a significant challenge. Herein we present the preparation and photophysical, photochemical and electrochemical properties of a series of triazolopyridinium and triazoloquinolinium compounds. The compounds are soluble in water or polar organic solvents and exhibit photoluminescence in the blue region of the spectrum in fluid solution, in the solid state and in a frozen matrix.

  17. The biotechnological ways of blue-green algae complex processing

    OpenAIRE

    Nykyforov, Volodymyr; Malovanyy, Myroslav; Kozlovskaya, Tatyana; Novokhatko, Olha; Digtiar, Sergii

    2016-01-01

    The results of long­term research of various ways and methods of collection and processing of blue­green algae that cause “bloom” of the Dnieper reservoirs were presented. The possibility and feasibility of the blue­green algae biomass processing to biogas by methanogenesis were substantiated. It was found experimentally that preliminary mechanical cavitation of the blue­green algae biomass increases the biogas yield by 21.5 %. It was determined that the biogas produced contains up to 72 % of...

  18. [Seven cases of parathyroidectomy for secondary hyperparathyroidism using methylene blue: suggestion for the method of methylene blue infusion].

    Science.gov (United States)

    Kadoya, Tatsuo; Kinoshita, Yuki; Shiraishi, Munehiro; Uehara, Hirofumi; Yamamoto, Toshinori; Suetsugu, Keiko

    2014-08-01

    Intraoperative staining of the parathyroid glands with intravenously administered methylene blue is well described and has been demonstrated as an effective and safe method to facilitate parathyroidectomy. However, there have been several literatures of the development of postoperative neurological toxicity in patients who received methylene blue infusion during parathyroidectomy. We report the method of methylene blue infusion during parathyroidectomy at our institution. Seven adult patients who had undergone parathyroidectomy for secondary hyperparathyroidism associated with chronic renal failure were included in this study. Methylene blue was administered at a constant rate of 4 mg x kg(-1) x hr(-1) with a 1% solution just before the start of operation. The infusion was stopped after the first parathyroid gland was identified. The mean dose of methylene blue used was 2.2 +/- 0.8 mg x kg(-1). Consequently, the dose of methylene blue by this method could be decreased to less than half of the previously administered dose (6 mg x kg(-1)) at our institution. The dose of methylene blue used should be kept to the minimum required to identify the parathyroid glands in each case.

  19. Blue Carbon Sequestration in Florida Coastal Wetlands - Response to Recent Climate Change and Holocene Climate Variability

    Science.gov (United States)

    Vaughn, D.; Bianchi, T. S.; Osborne, T.; Shields, M. R.; Kenney, W.

    2017-12-01

    Intertidal forests and salt marshes represent a major component of Florida's coasts and are essential to the health and integrity of coastal Florida's ecological and economic systems. In addition, coastal wetlands have been recognized as highly efficient carbon sinks with their ability to store carbon on time scales from centuries to millennia. Although losses of salt marshes, mangroves, and seagrass beds through both natural and anthropogenic forces are threatening their ability to act as carbon sinks globally, the poleward encroachment of mangroves into higher latitude salt marshes may lead to regional increases in carbon sequestration as mangroves store more carbon than salt marshes. For Florida, this encroachment of mangroves into salt marshes is prominent along the northern coasts where fewer freeze events have coincided with an increase in mangrove extent over the past several decades. Soil cores collected from a northeastern Florida wetland will allow us to determine whether the recent poleward encroachment of mangroves into northern Florida salt marshes has led to an increase in belowground carbon storage. The soil cores, which are approximately two to three meters in length, will also provide the first known record of carbon storage in a northern Florida wetland during the Holocene. Initial results from the top 40 cm, which represents 100 years based on dating of other northern Florida wetland cores, suggest more carbon is currently being stored within the transition between marsh and mangrove than in areas currently covered by salt marsh vegetation or mangroves. The transitional zone also has a much larger loss of carbon within the top 40 cm compared to the mangrove and marsh cores. Lignin-based degradation indices along with other biomarker data and 210Pb/137Cs ages will be presented to demonstrate how much of this loss of carbon may be related to degradation and how much may be related to changes in carbon sources.

  20. VizieR Online Data Catalog: Luminous blue variables NACO and VISIR images (Martayan+, 2016)

    Science.gov (United States)

    Martayan, C.; Lobel, A.; Baade, D.; Mehner, A.; Rivinius, T.; Boffin, H. M. J.; Girard, J.; Mawet, D.; Montagnier, G.; Blomme, R.; Kervella, P.; Sana, H.; Stefl, S.; Zorec, J.; Lacour, S.; Le Bouquin, J.-B.; Martins, F.; Merand, A.; Patru, F.; Selman, F.; Fremat, Y.

    2016-03-01

    The stars in our sample were selected for their properties to investigate the binary nature of LBVs and to study the envelope structure. To study the binarity and the environment of the objects, two cameras with good spatial resolution were used. The first one is NACO with its adaptive optics facility and the second is VISIR. Both cameras allow near- to mid-IR observations. Our observations are summarized in Table 2. (4 data files).

  1. Understanding Motherhood and Mood - Baby Blues and Beyond

    Science.gov (United States)

    ... Low thyroid levels can cause depressed or irritated moods, problems with sleep and concentration, and weight gain. ... you have the baby blues, you may: Have mood swings Feel sad, anxious, or overwhelmed Have crying ...

  2. THE PITFALLS OF THE BLUE OCEAN STRATEGY CANVAS

    DEFF Research Database (Denmark)

    Lindgren, Peter; Saghaug, Kristin Margrethe; Clemmensen, Suberia

    2009-01-01

    Numerous authors have developed a list of tactics and analyticaltechniques to discover new business or new business models (Markides2008)(Johnson 2008). The Blue Ocean strategy (Kim & Mauborgne 2005)have been one of these - probably one of the most important analyticaltechniques related to the area...... of innovation and new business model (BM)innovation since 2005. Today many consultancies and managersresponsible for innovation use the Blue Ocean framework as one of theirtop 5 innovation tools.Wanting to accentuate the importance of analyzing the strategy canvascarefully, when generating new business models...... - it is important tounderstand the very foundation and construction of the strategy canvas -namely value.This paper addresses the question on How is value defined, measured andfrom which viewed in the Blue Ocean theory and framework. How is valuedefined and used by companies using the Blue Ocean strategy...

  3. Blue nevus with a starburst pattern on dermoscopy.

    Science.gov (United States)

    Shiga, Takeo; Nakajima, Kimiko; Tarutani, Masahito; Izumi, Miki; Tanaka, Masaru; Sano, Shigetoshi

    2012-10-01

    An 11-year-old girl presented to our department with a blue-gray papule approximately 4 mm in diameter. We suspected that it was a blue nevus or a pigmented Reed/Spitz nevus. On dermoscopic observation, the lesion showed homogeneous black-bluish pigmentation. This dermoscopic feature was suggestive of a blue nevus. However, near-circumferential streaks and a global feature of a "starburst pattern" were also observed, as is often found in a Reed/Spitz nevus. The lesion was excised and histological examination revealed spindle cells with melanin pigments diffusely present in the upper dermis and around hair follicles in the mid-dermis, but not in the epidermis. The melanocytic cells were arranged in a symmetrical wedge-shaped configuration. In addition, there was a diffuse fibrosis. Finally, we made a diagnosis of a blue nevus based on these findings.

  4. Blue-green and green phosphors for lighting applications

    Science.gov (United States)

    Setlur, Anant Achyut; Chandran, Ramachandran Gopi; Henderson, Claire Susan; Nammalwar, Pransanth Kumar; Radkov, Emil

    2012-12-11

    Embodiments of the present techniques provide a related family of phosphors that may be used in lighting systems to generate blue or blue-green light. The phosphors include systems having a general formula of: ((Sr.sub.1-zM.sub.z).sub.1-(x+w)A.sub.wCe.sub.x).sub.3(Al.sub.1-ySi.s- ub.y)O.sub.4+y+3(x-w)F.sub.1-y-3(x-w) (I), wherein 0lighting systems, such as LEDs and fluorescent tubes, among others, to produce blue and blue/green light. Further, the phosphors may be used in blends with other phosphors, or in combined lighting systems, to produce white light suitable for illumination.

  5. Tudo Pela Patria: The Brazilian Navy's Drive to Blue Water

    National Research Council Canada - National Science Library

    Conners, Michael E

    2005-01-01

    The Brazilian Navy is unique among most world navies today. Since the end of the Cold War, most nations have reduced their naval power, yet Brazil has maintained a determination to possess a blue-water fleet...

  6. Blue Light for Enhancing Alertness in Space Missions

    Data.gov (United States)

    National Aeronautics and Space Administration — This is the final year of a directed research project that had reduced aims due to an unexpected funding reduction. The goal is to study the efficacy of blue or...

  7. Valuing the European 'coastal blue carbon' storage benefit.

    Science.gov (United States)

    Luisetti, T; Jackson, E L; Turner, R K

    2013-06-15

    'Blue' carbon ecosystems are important carbon storage providers that are currently not protected by any international mechanism, such as REDD. This study aims to contribute to raising awareness in the political domain about the 'blue' carbon issue. This analysis also provides guidance in terms of how to value stock and flows of ecosystem services adding to the debate begun by the Costanza et al. (1997) paper in Nature. Through scenario analysis we assess how human welfare benefits will be affected by changes in the European coastal blue carbon stock provision. The current extent of European coastal blue carbon has an accounting stock value of about US$180 million. If EU Environmental Protection Directives continue to be implemented and effectively enforced, society will gain an appreciating asset over time. However, a future policy reversal resulting in extensive ecosystem loss could mean economic value losses as high as US$1 billion by 2060. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  8. Unconventional Laser Guide Stars and Wavefront Correction of Blue Starlight

    National Research Council Canada - National Science Library

    Hellwarth, Robert

    2002-01-01

    ...) a return signal to the transmitting telescope that would appear, for 20 ns, to have a brightness temperature of millions of degrees, and thus serve as a guide star for high-order corrections of blue starlight, (2...

  9. SPECIATION AND STABILITY OF METHYLENE BLUE-METAL ...

    African Journals Online (AJOL)

    a

    SCN)4] and turns methylene blue to violet. The stoichiometry and stability constants of the ion-association complexes were determined using Benesi-. Hildebrand method and the stoichiometry was confirmed by Job's continuous variation method.

  10. Photodynamic action of the methylene blue: mutagenesis and sinergism

    International Nuclear Information System (INIS)

    Capella, M.A.M.

    1988-01-01

    Two aspects of photodynamic therapy were studied: the associated mutagenesis and the interactions with physical agents, in order to increase its biological effects. The photodynamic action with methylene blue in the mutagenesis and sinergism is studied. (L.M.J.)

  11. White Arctic vs. Blue Arctic: Making Choices

    Science.gov (United States)

    Pfirman, S. L.; Newton, R.; Schlosser, P.; Pomerance, R.; Tremblay, B.; Murray, M. S.; Gerrard, M.

    2015-12-01

    As the Arctic warms and shifts from icy white to watery blue and resource-rich, tension is arising between the desire to restore and sustain an ice-covered Arctic and stakeholder communities that hope to benefit from an open Arctic Ocean. If emissions of greenhouse gases to the atmosphere continue on their present trend, most of the summer sea ice cover is projected to be gone by mid-century, i.e., by the time that few if any interventions could be in place to restore it. There are many local as well as global reasons for ice restoration, including for example, preserving the Arctic's reflectivity, sustaining critical habitat, and maintaining cultural traditions. However, due to challenges in implementing interventions, it may take decades before summer sea ice would begin to return. This means that future generations would be faced with bringing sea ice back into regions where they have not experienced it before. While there is likely to be interest in taking action to restore ice for the local, regional, and global services it provides, there is also interest in the economic advancement that open access brings. Dealing with these emerging issues and new combinations of stakeholders needs new approaches - yet environmental change in the Arctic is proceeding quickly and will force the issues sooner rather than later. In this contribution we examine challenges, opportunities, and responsibilities related to exploring options for restoring Arctic sea ice and potential pathways for their implementation. Negotiating responses involves international strategic considerations including security and governance, meaning that along with local communities, state decision-makers, and commercial interests, national governments will have to play central roles. While these issues are currently playing out in the Arctic, similar tensions are also emerging in other regions.

  12. Blue Light and Ultraviolet Radiation Exposure from Infant Phototherapy Equipment.

    Science.gov (United States)

    Pinto, Iole; Bogi, Andrea; Picciolo, Francesco; Stacchini, Nicola; Buonocore, Giuseppe; Bellieni, Carlo V

    2015-01-01

    Phototherapy is the use of light for reducing the concentration of bilirubin in the body of infants. Although it has become a mainstay since its introduction in 1958, a better understanding of the efficacy and safety of phototherapy applications seems to be necessary for improved clinical practices and outcomes. This study was initiated to evaluate workers' exposure to Optical Radiation from different types of phototherapy devices in clinical use in Italy. During infant phototherapy the staff monitors babies periodically for around 10 min every hour, and fixation of the phototherapy beam light frequently occurs: almost all operators work within 30 cm of the phototherapy source during monitoring procedures, with most of them commonly working at ≤25 cm from the direct or reflected radiation beam. The results of this study suggest that there is a great variability in the spectral emission of equipments investigated, depending on the types of lamps used and some phototherapy equipment exposes operators to blue light photochemical retinal hazard. Some of the equipment investigated presents relevant spectral emission also in the UVA region. Taking into account that the exposure to UV in childhood has been established as an important contributing factor for melanoma risk in adults and considering the high susceptibility to UV-induced skin damage of the newborn, related to his pigmentary traits, the UV exposure of the infant during phototherapy should be "as low as reasonably achievable," considering that it is unnecessary to the therapy. It is recommended that special safety training be provided for the affected employees: in particular, protective eyewear can be necessary during newborn assistance activities carried out in proximity of some sources. The engineering design of phototherapy equipment can be optimized. Specific requirements for photobiological safety of lamps used in the phototherapy equipment should be defined in the safety product standard for such

  13. How bees distinguish patterns by green and blue modulation

    Directory of Open Access Journals (Sweden)

    Horridge A

    2015-10-01

    Full Text Available Adrian Horridge Biological Sciences, Australian National University, Canberra, ACT, Australia Abstract: In the 1920s, Mathilde Hertz found that trained bees discriminated between shapes or patterns of similar size by something related to total length of contrasting contours. This input is now interpreted as modulation in green and blue receptor channels as flying bees scan in the horizontal plane. Modulation is defined as total contrast irrespective of sign multiplied by length of edge displaying that contrast, projected to vertical, therefore, combining structure and contrast in a single input. Contrast is outside the eye; modulation is a phasic response in receptor pathways inside. In recent experiments, bees trained to distinguish color detected, located, and measured three independent inputs and the angles between them. They are the tonic response of the blue receptor pathway and modulation of small-field green or (less preferred blue receptor pathways. Green and blue channels interacted intimately at a peripheral level. This study explores in more detail how various patterns are discriminated by these cues. The direction of contrast at a boundary was not detected. Instead, bees located and measured total modulation generated by horizontal scanning of contrasts, irrespective of pattern. They also located the positions of isolated vertical edges relative to other landmarks and distinguished the angular widths between vertical edges by green or blue modulation alone. The preferred inputs were the strongest green modulation signal and angular width between outside edges, irrespective of color. In the absence of green modulation, the remaining cue was a measure and location of blue modulation at edges. In the presence of green modulation, blue modulation was inhibited. Black/white patterns were distinguished by the same inputs in blue and green receptor channels. Left–right polarity and mirror images could be discriminated by retinotopic green

  14. How bees distinguish patterns by green and blue modulation.

    Science.gov (United States)

    Horridge, Adrian

    2015-01-01

    In the 1920s, Mathilde Hertz found that trained bees discriminated between shapes or patterns of similar size by something related to total length of contrasting contours. This input is now interpreted as modulation in green and blue receptor channels as flying bees scan in the horizontal plane. Modulation is defined as total contrast irrespective of sign multiplied by length of edge displaying that contrast, projected to vertical, therefore, combining structure and contrast in a single input. Contrast is outside the eye; modulation is a phasic response in receptor pathways inside. In recent experiments, bees trained to distinguish color detected, located, and measured three independent inputs and the angles between them. They are the tonic response of the blue receptor pathway and modulation of small-field green or (less preferred) blue receptor pathways. Green and blue channels interacted intimately at a peripheral level. This study explores in more detail how various patterns are discriminated by these cues. The direction of contrast at a boundary was not detected. Instead, bees located and measured total modulation generated by horizontal scanning of contrasts, irrespective of pattern. They also located the positions of isolated vertical edges relative to other landmarks and distinguished the angular widths between vertical edges by green or blue modulation alone. The preferred inputs were the strongest green modulation signal and angular width between outside edges, irrespective of color. In the absence of green modulation, the remaining cue was a measure and location of blue modulation at edges. In the presence of green modulation, blue modulation was inhibited. Black/white patterns were distinguished by the same inputs in blue and green receptor channels. Left-right polarity and mirror images could be discriminated by retinotopic green modulation alone. Colors in areas bounded by strong green contrast were distinguished as more or less blue than the

  15. Prussian Blue Modified Graphene Enable Multifunctional Electrochemical Application

    DEFF Research Database (Denmark)

    Zhang, Minwei; Halder, Arnab; Hou, Chengyi

    to energytechnologies. In this presentation, we have explored the combination of redox active Prussian Blue (PB)nanostructures (e.g., core-shell Gold@Prussian Blue (Au@PB) nanoparticles (NPs) and interlocked PBnanocubes) with chemically exfoliated graphene to prepare multifunctional composites......Graphene based nanomaterials have been a hot topic since 2004. These materials have shownsome notable advantages, including large surface areas, high flexibility and reasonably good conductivityand mechanical strength, suitable for a wide range of electrochemical applications from sensors...

  16. Nonlinear Kinetics and Mechanism of Nile Blue Reaction with Acidic ...

    African Journals Online (AJOL)

    After an induction period, a swift reaction occurs. The overall reaction is NB+ + BrO3- react to P + CH3COOH + H+ + Br-, where P is the de-ethylated N-oxide derivative of nile blue. The rapid kinetics of the reaction of bromine direct with nile blue were also reported. A 11-step mechanism, consistent with the overall reaction ...

  17. The Online Big Blue Test for Promoting Exercise: Health, Self-Efficacy, and Social Support.

    Science.gov (United States)

    Gómez-Zúñiga, Beni; Pousada, Modesta; Hernandez, Manny M; Colberg, Sheri; Gabarrón, Elia; Armayones, Manuel

    2015-10-01

    Recent articles have documented the influence of self-efficacy and social support on exercising. Simultaneously, insulin use is also related to the perception of self-efficacy and social support in patients with diabetes. We combine these two ideas through the Big Blue Test experience in a social networking site and propose to analyze whether a change in blood sugar levels after completion of the Big Blue Test and insulin use are related to the perception of self-efficacy and social support in patients with diabetes. To undergo the Big Blue Test, 3,926 participants voluntarily joined the Diabetes Hands Foundation. Responses were analyzed using descriptive analysis. The participants who reduced their blood glucose after exercise the least were those with lower self-efficacy and also with lower perceived social support. There seems to have been no relationship between changes in blood sugar level and the explicit intention of doing exercise in the future. Insulin-dependent participants demonstrated a lower perception of self-efficacy and social support than non-insulin-dependent participants. Change in blood glucose level or being insulin-dependent or not do not explain completely a health behavior such as exercise. Hence, self-efficacy and social support have an impact on behavioral change such as exercise to become a habit in people with diabetes, and this experience through a social networking site is an important tool for this behavioral change. For exercise to become a habit in people with diabetes, it is necessary to consider not only the crucial physiological variables, but also those psychological variables that clearly have an impact on behavioral change.

  18. Methylene blue inhibits lumefantrine-resistant Plasmodium berghei.

    Science.gov (United States)

    Mwangi, Victor Irungu; Mumo, Ruth Mwende; Kiboi, Daniel Muthui; Omar, Sabah Ahmed; Ng'ang'a, Zipporah Waithera; Ozwara, Hastings Suba

    2016-06-30

    Chemotherapy still is the most effective way to control malaria, a major public health problem in sub-Saharan Africa. The large-scale use of the combination therapy artemether-lumefantrine for malaria treatment in Africa predisposes lumefantrine to emergence of resistance. There is need to identify drugs that can be used as substitutes to lumefantrine for use in combination therapy. Methylene blue, a synthetic anti-methemoglobinemia drug, has been shown to contain antimalarial properties, making it a candidate for drug repurposing. The present study sought to determine antiplasmodial effects of methylene blue against lumefantrine- and pyrimethamine-resistant strains of P. berghei. Activity of methylene blue was assessed using the classical four-day test on mice infected with lumefantrine-resistant and pyrimethamine-resistant P. berghei. A dose of 45 mg/kg/day was effective for testing ED90. Parasitemia and mice survival was determined. At 45 mg/kg/day, methylene blue sustained significant parasite inhibition, over 99%, for at least 6 days post-treatment against lumefantrine-resistant and pyrimethamine-resistant P. berghei (p = 0.0086 and p = 0.0191, respectively). No serious adverse effects were observed. Our results indicate that methylene blue at a concentration of 45 mg/kg/day confers over 99% inhibition against lumefantrine- and pyrimethamine-resistant P. berghei for six days. This shows the potential use methylene blue in the development of antimalarials against lumefantrine- and pyrimethamine-resistant parasites.

  19. International, prospective haemovigilance study on methylene blue-treated plasma.

    Science.gov (United States)

    Noens, L; Vilariño, Ma D; Megalou, A; Qureshi, H

    2017-05-01

    Methylene blue is a phenothiazine dye, which in combination with visible light has virucidal and bactericidal properties, disrupting the replication of a broad range of enveloped viruses and some non-enveloped viruses. The study objective was to collect data on adverse reactions occurring with methylene blue plasma administered in a routine clinical practice environment and document their characteristics and severity. This was an open label, multicentre, non-controlled, non-randomized, non-interventional study. Patients who receive a methylene blue plasma transfusion were observed for any signs and symptoms (adverse reactions) within 24 h safter the start of the transfusion, in different hospitals for a study duration of at least 1 year. A total of 19 315 methylene blue plasma units were transfused. There were eight patients with adverse reactions recorded during the study, one of them serious. Two had more than one reaction (two and four, respectively). Three patients had previous transfusions with methylene blue plasma only. Methylene blue plasma has a very acceptable safety profile with a rate of serious adverse reactions of 0·5/10 000 units. © 2017 International Society of Blood Transfusion.

  20. Blue light-mediated inactivation of Enterococcus faecalis in vitro.

    Science.gov (United States)

    Pileggi, Giorgio; Wataha, John C; Girard, Myriam; Grad, Iwona; Schrenzel, Jacques; Lange, Norbert; Bouillaguet, Serge

    2013-05-01

    In dentistry, residual infection remains a major cause of failure after endodontic treatment; many of these infections involve Enterococcus faecalis. In the current study, we explored the possibility that blue light activated photosensitizers could be used, in principle, to inactivate this microbe as an adjunct disinfection strategy for endodontic therapy. Three blue light absorbing photosensitizers, eosin-Y, rose bengal, and curcumin, were tested on E. faecalis grown in planktonic suspensions or biofilms. Photosensitizers were incubated for 30 min with bacteria then exposed to blue light (450-500 nm) for 240 s. Sodium hypochlorite (3%) was used as a control. After 48 h, the viability of E. faecalis was estimated by measuring colony-forming units post-exposure vs. untreated controls (CFU/mL). Blue light irradiation alone did not alter E. faecalis viability. For planktonic cultures, blue light activated eosin-Y (5 μM), rose bengal (1 μM), or curcumin (5 μM) significantly (pcurcumin of 100, 10, and 10 μM respectively, completely suppressed E. faecalis viability (p<0.05). Although the current results are limited to an in vitro model, they support further exploration of blue light activated antimicrobials as an adjunct therapy in endodontic treatment. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Hypnosis-associated blue-tinted vision: a case report

    Directory of Open Access Journals (Sweden)

    Savedoff Aaron D

    2005-12-01

    Full Text Available Abstract Background Self-hypnosis has been taught routinely at the SUNY Upstate Medical University for treatment of pulmonary symptoms thought to be amenable to psychological therapy. While using hypnosis for relaxation, four individuals, including a patient with cystic fibrosis, reported development of blue-tinted vision. Based on a search of the literature, we believe this is the first published report of hypnosis-associated blue-tinted vision. Case presentation The patient reported blue-tinted vision when he used hypnosis on an almost daily basis for seven years. The visual change typically occurred when he was relaxed. Moreover, a concurrent erection in the absence of sexual thoughts usually was present. The other three individuals reported blue-tinted vision after learning how to use hypnosis for relaxation as part of a group hypnosis instruction. Conclusion The blue-tinted vision experienced by the individuals in this report may be the result of an hypnosis-induced primary change in cognitive processing. Additionally, as the relaxing effect of hypnosis can be associated with a reduction in blood pressure and increased blood flow, hypnosis-associated blue-tinted vision also may be related to retinal vasodilation.

  2. Determinants of Colour Constancy and the Blue Bias

    Science.gov (United States)

    Gegenfurtner, Karl

    2017-01-01

    We investigated several sensory and cognitive determinants of colour constancy across 40 illumination hues. In the first experiment, we measured colour naming for the illumination and for the colour induced by the illumination on the colorimetric grey. Results confirmed that the induced colours are approximately complementary to the colour of the illumination. In the second experiment, we measured colour constancy using achromatic adjustments. Average colour constancy was perfect under the blue daylight illumination and decreased in colour directions away from the blue daylight illumination due to undershooting and a strong blue bias. Apart from this blue bias, colour constancy was not related to illumination discrimination and to chromatic detection measured previously with the same setup and stimuli. We also observed a strong negative relationship between the degree of colour constancy and the consensus of naming the illumination colour. Constancy coincided with a low naming consensus, in particular because bluish illumination colours were sometimes seen as achromatic. Blue bias and category consensus alone explained >68%, and all determinants together explained >94% of the variance of achromatic adjustments. These findings suggest that colour constancy is optimised for blue daylight. PMID:29348910

  3. The fading of irradiated blue-colored pearls

    International Nuclear Information System (INIS)

    Okamoto, Shinichi

    1982-01-01

    The fading of irradiated and natural blue-colored pearls was investigated in this experiment. Thirty natural blue-colored pearls and sixty irradiated blue-colored pearls were used. Some of them were placed at a light position of RT. Another pearls were placed at a dark position of 50 0 C. The irradiated pearls placed at a light position of RT didn't show remarkable fading in their color in 294 days. But the natural blue-colored pearls showed a little recovery from 4% to 8% in reflection factors in 223 days at RT. The irradiated pearls placed at a dark position of 50 0 C showed the recovery from 9% to 14% in 264 days independently of irradiation times. The natural blue-colored pearls also showed the bleaching from 5% to 10% in reflection factor in 86 days at 50 0 C. Both irradiated and natural blue-colored pearls hardly showed their remarkable changes in their chromaticities independently of temperatures. (author)

  4. VARIABLES IN GLOBULAR CLUSTER NGC 5024

    Energy Technology Data Exchange (ETDEWEB)

    Safonova, M.; Stalin, C. S., E-mail: rita@iiap.res.in, E-mail: stalin@iiap.res.in [Indian Institute of Astrophysics, Koramangala, Bangalore 560 034 (India)

    2011-12-15

    We present the results of a commissioning campaign to observe Galactic globular clusters for the search of microlensing events. The central 10' Multiplication-Sign 10' region of the globular cluster NGC 5024 was monitored using the 2 m Himalayan Chandra Telescope in R-band for a period of about 8 hr on 2010 March 24. Light curves were obtained for nearly 10,000 stars using a modified Differential Image Analysis technique. We identified all known variables within our field of view and revised the periods and status of some previously reported short-period variables. We report about 70 new variable sources and present their equatorial coordinates, periods, light curves, and possible types. Out of these, 15 are SX Phe stars, 10 are W UMa-type stars, and 14 are probable RR Lyrae stars. Nine of the newly discovered SX Phe stars and one eclipsing binary belong to the blue straggler star population.

  5. Crop damage of Eriotheca gracilipes (Bombacaceae by the Blue-Fronted Amazon (Amazona aestiva, Psittacidae, in the Brazilian Cerrado

    Directory of Open Access Journals (Sweden)

    J Ragusa-Netto

    Full Text Available Seed predation has major effects on the reproductive success of individuals, spatial patterns of populations, genetic variability, interspecific interactions and ultimately in the diversity of tree communities. At a Brazilian savanna, I evaluated the proportional crop loss of Eriotheca gracilipes due the Blue-Fronted Amazon (Amazona aestiva during a fruiting period. Also, I analyzed the relationship between proportional crop loss to Amazons and both fruit crop size and the distance from the nearest damaged conspecific. Trees produced from 1 to 109 fruits, so that Amazons foraged more often on trees bearing larger fruit crop size, while seldom visited less productive trees. Moreover, the relationship between fruit crop sizes and the number of depredated fruits was significant. However, when only damaged trees were assessed, I found a negative and significant relation between fruit crop size and proportional crop loss to Blue-Fronted Amazons. Taking into account this as a measure more directly related to the probability of seed survival, a negative density dependent effect emerged. Also, Amazons similarly damaged the fruit crops of either close or distant neighboring damaged trees. Hence, in spite of Blue-Fronted Amazons searched for E. gracilipes bearing large fruit crops, they were swamped due to the presence of more fruits than they could eat. Moderate seed predation by Blue-Fronted Amazons either at trees with large fruit crops or in areas where fruiting trees were aggregated implies in an enhanced probability of E. gracilipes seed survival and consequent regeneration success.

  6. Crop damage of Eriotheca gracilipes (Bombacaceae) by the Blue-Fronted Amazon (Amazona aestiva, Psittacidae), in the Brazilian Cerrado.

    Science.gov (United States)

    Ragusa-Netto, J

    2014-11-01

    Seed predation has major effects on the reproductive success of individuals, spatial patterns of populations, genetic variability, interspecific interactions and ultimately in the diversity of tree communities. At a Brazilian savanna, I evaluated the proportional crop loss of Eriotheca gracilipes due the Blue-Fronted Amazon (Amazona aestiva) during a fruiting period. Also, I analyzed the relationship between proportional crop loss to Amazons and both fruit crop size and the distance from the nearest damaged conspecific. Trees produced from 1 to 109 fruits, so that Amazons foraged more often on trees bearing larger fruit crop size, while seldom visited less productive trees. Moreover, the relationship between fruit crop sizes and the number of depredated fruits was significant. However, when only damaged trees were assessed, I found a negative and significant relation between fruit crop size and proportional crop loss to Blue-Fronted Amazons. Taking into account this as a measure more directly related to the probability of seed survival, a negative density dependent effect emerged. Also, Amazons similarly damaged the fruit crops of either close or distant neighboring damaged trees. Hence, in spite of Blue-Fronted Amazons searched for E. gracilipes bearing large fruit crops, they were swamped due to the presence of more fruits than they could eat. Moderate seed predation by Blue-Fronted Amazons either at trees with large fruit crops or in areas where fruiting trees were aggregated implies in an enhanced probability of E. gracilipes seed survival and consequent regeneration success.

  7. EVOLUTION {sup registered} BLUE. Designed for the needs of tomorrow; EVOLUTION {sup registered} BLUE. Entwickelt fuer die Anforderungen von morgen

    Energy Technology Data Exchange (ETDEWEB)

    Blessing, Carsten [ThyssenKrupp Aufzugswerke GmbH, Neuhausen (Germany). Product Service; Dangerfield, Nicola [ThyssenKrupp Aufzuege GmbH, Stuttgart (Germany). Sales Support/Marketing Communication

    2013-11-01

    The future needs innovation. The new elevator design concept EVOLUTION {sup registered} BLUE sets new standards for flexibility, shaft efficiency, energy saving and design. It uses materials of the highest quality. (orig.)

  8. Fast Blue RR—Siloxane Derivatized Materials Indicate Wound Infection Due to a Deep Blue Color Development

    Directory of Open Access Journals (Sweden)

    Doris Schiffer

    2015-09-01

    Full Text Available There is a strong need for simple and fast methods for wound infection determination. Myeloperoxidase, an immune system-derived enzyme was found to be a suitable biomarker for wound infection. Hence, alkoxysilane-derivatized Fast Blue RR was immobilized via simple hydrolytic polymerization. The resulting enzyme-responsive siloxane layers were incubated with myeloperoxidase, wound fluid or hemoglobin. The reaction was monitored via HPLC measurements and the color development quantified spectrophotometrically. Myeloperoxidase was indeed able to oxidize immobilized Fast Blue RR leading to a blue colored product. No conversion was detected in non-infected wound fluids. The visible color changes of these novel materials towards blue enable an easy distinction between infected and non-infected wound fluids.

  9. PENGARUH BRAND IMAGE DAN KUALITAS PELAYANAN TERHADAP KEPUASAN WISATAWAN DALAM MEMILIH TAKSI BLUE BIRD DI BALI

    Directory of Open Access Journals (Sweden)

    Dewa Ayu Putu Mega Puriani

    2017-07-01

    Full Text Available In Bali, many types of taxi can be encountered starting from the airport until city and tourist destination, one of them is Blue Bird Taxi. Blue Bird taxi has a brand image and good service quality which can be seen from many awards, some of them are Mark Plus Wow Service Excellence Award 2015 and Indonesian Leading Taxi/Limousine Company. Along with the technology development, giving significant impact to competition among land transportation for instance online based taxi. The technique of determining the respondents is purposive sampling technique with the number of respondents were 170 respondents. Furthermore, in analysing the data, this study using multiple regression analysis techniques. Results of this study mention that variable dimension dominate on brand image is strength. In partially brand image give positive and significant impact on tourist satisfaction with tcount of 2,465 and significant value of 0,015. And variable dimension dominate on service quality is tangible. Service quality give positive and significant impact on tourist satisfaction with tcount of 9,219 and significant value of 0,000. Simultaneously, it can be concluded that brand image and service quality give positive and significant impact on tourist satisfaction with Fcount of 105,731 and significant value of 0,000.

  10. Red, White, and the Blues Part 3 of 4: The New Beat of the Blues: R&B

    Science.gov (United States)

    Cassinos-Carr, Cathy

    2004-01-01

    When rhythm & blues--or, as it is more commonly called, R&B, was first born, it did not even have a name. Prior to 1949, all black popular music, including jazz, blues, and gospel, was known as "race music." But by the end of the 1940s, the music had become so successful that it gained a new-found respect--and Billboard magazine, realizing that…

  11. kinetics and mechanism of reaction of acidic chlorite with phenoxazine dyes, Nile blue and Meldola’s blue

    Directory of Open Access Journals (Sweden)

    L.Q. Qwabe

    2005-06-01

    Full Text Available The kinetics and mechanism of the oxidation of two phenoxazine dyes namely Nile blue (7-amino-3-diethylamino-8,9-benzo phenoxazine chloride, NB+ and Meldola’s blue (3- dimethylamino-8,9-benzo phenoxazine chloride, MB+ with acidic chlorite and hypochlorous acid have been investigated using a UV-visible and a stopped flow equipment. For both Nile blue and Meldola’s blue reactions the rates have first-order dependence on each substrate, chlorite and acid. Both reactions showed negative salt effect indicating the reaction is between the oppositely charged species, likely the substrate cation and chlorite anion. The acidic chlorite reaction with MB+ was very slow compared with NB+ and was studied at higher temperature of 40 oC. The overall third order rate constants for the reaction of acidic chlorite with Nile blue and Meldola’s blue were (0.363 plus or minus 0.005 M-2 s-1 at 25 oC and (3.09 plus or minus 0.08 x 10-3 M-2 s-1 at 40 oC, respectively. The energy parameters for NB+ reaction were Ea = 47.8 kJ mol-1, H = 40.4 kJ mol-1 and S = -233 J K-1 mol-1, while the corresponding values for MB+ reaction were 62.4 kJ mol-1, 54.6 kJ mol-1 and -248 J K-1 mol-1, respectively. The second-order rate coefficients for HOCl reaction with Nile blue and Meldola’s blue at 25 oC were (5.14 plus or minus 0.01 x 103 M-1 s-1 and (1.25 plus or minus 0.03 x 102 M-1 s-1, respectively.

  12. Magnetic Properties of selected Prussian Blue Analogs

    Science.gov (United States)

    Shrestha, Manjita

    Prussian Blue Analogs (PBAs) of composition M[M(C,N)6 ] 2.xH2O are bimetallic cyanide complexes, where M and M are bivalent or trivalent transition metals and x is number of water molecule per unit cell. The PBAs form cubic framework structures, which consist mostly of alternating MIIIN6 and MIIC 6 octahedrals. However, occupancies of the octrahedrals are not perfect: they may be empty and the charges are balanced by the guest water molecules at the lattice site (C or N site) or the interstitial site (between the octahedrals) of the unit cell. Most (but not all) PBAs exhibit negative thermal expansion behavior, i.e. volume decrease with increasing temperature. Another area of interest in PBA research is the occurrence of unusual magnetic properties. Similar to other molecular magnets, large crystal-field splitting due to the octrahedral environment may result in a combination of low- or high-spin configurations of the localized magnetic moments, i.e. spin crossover effects may be found. My dissertation focuses on the magnetic properties of the selected 3d transition-metal PBAs, namely metal hexacyanochromates M3[Cr(C,N)6 ]2.xH2O, metal hexcyanoferrates M3[Fe(C,N)6]2.xH2O and metal hexcyanocobaltates M3[Co(C,N)6]2 .xH2O where M = Mn, Co, Ni and Cu. In particular, I analyzed the temperature and field dependencies of the bulk magnetic response of those PBAs. My results show that the magnetic susceptibility of all studied PBAs follows the Curie-Weiss behavior in the paramagnetic region up to room temperature; however, some of the compounds exhibit long-range magnetic order at lower temperatures (ferromagnetic or antiferromagnetic). In particular, the data provide evidence for magnetic ground states for most of the metal hexacyanochromates and all of the metal hexacyanoferrates but none of the hexacyanocobaltates that were studied. For each of the compounds, my analysis provides a measure of the effective magnetic moment, which is then compared with the predicted

  13. Periods of ZZ Ceti variables

    International Nuclear Information System (INIS)

    Cox, A.N.; Hodson, S.W.; Starrfield, S.G.

    1979-01-01

    White dwarf pulsators (ZZ Ceti variables) osub solar acccur in the extension of the radial pulsation envelope ionization instability strip to the observed luminosities of 3 x 10 -3 L sub solar according to van Horn. Investigations were underway to see if the driving mechanisms of hydrogen and helium ionization can cause radial pulsations as they do for the Cepheids, the RR Lyrae variables, and the delta Scuti variables. Masses used in this study are 0.60 and 0.75 M sub solar for T/sub e/ between 10,000 K and 14,000 K, the observed range in T/sub e/. Helium rich surface compositions like Y = 0.78,, Z = 0.02 as well as Y = 0.28, Z = 0.02 were used in spite of observations showing only hydrogen lines in the spectrum. The deep layers are pure carbon, and several transition compositions are included. The models show radial pulsation instabilities for many overtone modes at periods between about 0.3 and 3 seconds. The driving mechanism is mostly helium ionization at 40,000 and 150,000 K. The blue edge at about 14,000 K is probably due to the driving region becoming too shallow, and the red edge at 10,000 K is due to so much convection in the pulsation deriving region that no radiative luminosity is available for modulation by the γ and kappa effects. It is speculated that the very long observed periods (100 to 1000 sec) of ZZ Ceti variables are not due to nonradial pulsations, but are possibly aliases due to data undersampling. 4 references

  14. Study of Methylene Blue Ototoxicity in the Guinea Pig.

    Science.gov (United States)

    Belhassen, Sarah; Alzahrani, Musaed; Nader, Marc-Elie; Gaboury, Louis; Saliba, Issam

    2017-11-01

    Methylene blue is widely used in the medical field, especially as a blue dye for staining. It is also used as a photosensitizing agent in antimicrobial photodynamic therapy, which once photoactivated is effective for the eradication of several multi-resistant bacteria. The objective of this study was to investigate the ototoxic potential of methylene blue and precise its use in otology. It was a prospective animal study performed on guinea pigs in our tertiary medical center. We divided the animals into two groups: an experimental group and a control group, who underwent a series of three intratympanic (IT) injections. In the control group (n = 10), they received injections of gentamicin in one ear (positive control) and normal saline in the contralateral ear (negative control). The experimental group (n = 10) received injections of methylene blue in one ear, compared to injections of normal saline in the contralateral ear. We conducted auditory-evoked brainstem response (ABR) before and 1 week after the injection series. Once this is completed, the cochlea was dissected and caspase-3 was analyzed by immunohistochemistry. The mean difference of hearing loss in the methylene blue group compared to normal saline was 1.50 dB, and it was not shown to be statistically significant (P = 0.688). For the positive control group, which received IT injections of gentamicin, the mean threshold of hearing loss difference for all the frequencies combined was 66.25 dB (P methylene blue. In light of our results, IT injections of methylene blue did not demonstrate an ototoxic potential. We recommend further studies to precise its use in the otologic field.

  15. Neurometabolic mechanisms for memory enhancement and neuroprotection of methylene blue

    Science.gov (United States)

    Rojas, Julio C.; Bruchey, Aleksandra K.; Gonzalez-Lima, F.

    2011-01-01

    This paper provides the first review of the memory-enhancing and neuroprotective metabolic mechanisms of action of methylene blue in vivo. These mechanisms have important implications as a new neurobiological approach to improve normal memory and to treat memory impairment and neurodegeneration associated with mitochondrial dysfunction. Methylene blue’s action is unique because its neurobiological effects are not determined by regular drug-receptor interactions or drug-response paradigms. Methylene blue shows a hormetic dose-response, with opposite effects at low and high doses. At low doses, methylene blue is an electron cycler in the mitochondrial electron transport chain, with unparalleled antioxidant and cell respiration-enhancing properties that affect the function of the nervous system in a versatile manner. A major role of the respiratory enzyme cytochrome oxidase on the memory-enhancing effects of methylene blue is supported by available data. The memory-enhancing effects have been associated with improvement of memory consolidation in a network-specific and use-dependent fashion. In addition, low doses of methylene blue have also been used for neuroprotection against mitochondrial dysfunction in humans and experimental models of disease. The unique auto-oxidizing property of methylene blue and its pleiotropic effects on a number of tissue oxidases explain its potent neuroprotective effects at low doses. The evidence reviewed supports a mechanistic role of low-dose methylene blue as a promising and safe intervention for improving memory and for the treatment of acute and chronic conditions characterized by increased oxidative stress, neurodegeneration and memory impairment. PMID:22067440

  16. Blue and grey water footprint of textile industry in China.

    Science.gov (United States)

    Wang, Laili; Ding, Xuemei; Wu, Xiongying

    2013-01-01

    Water footprint (WF) is a newly developed idea that indicates impacts of freshwater appropriation and wastewater discharge. The textile industry is one of the oldest, longest and most complicated industrial chains in the world's manufacturing industries. However, the textile industry is also water intensive. In this paper, we applied a bottom-up approach to estimate the direct blue water footprint (WFdir,blue) and direct grey water footprint (WFdir,grey) of China's textile industry at sector level based on WF methodology. The results showed that WFdir,blue of China's textile industry had an increasing trend from 2001 to 2010. The annual WFdir,blue surpassed 0.92 Gm(3)/yr (giga cubic meter a year) since 2004 and rose to peak value of 1.09 Gm(3)/yr in 2007. The original and residuary WFdir,grey (both were calculated based on the concentration of chemical oxygen demand (CODCr)) of China's textile industry had a similar variation trend with that of WFdir,blue. Among the three sub-sectors of China's textile industry, the manufacture of textiles sector's annual WFdir,blue and WFdir,grey were much larger than those of the manufacture of textile wearing apparel, footware and caps sector and the manufacture of chemical fibers sector. The intensities of WFdir,blue and WF(res)dir,grey of China's textile industry were year by year decreasing through the efforts of issuing restriction policies on freshwater use and wastewater generation and discharge, and popularization of water saving and wastewater treatment technologies.

  17. Blue Guardian: open architecture intelligence, surveillance, and reconnaissance (ISR) demonstrations

    Science.gov (United States)

    Shirey, Russell G.; Borntrager, Luke A.; Soine, Andrew T.; Green, David M.

    2017-04-01

    The Air Force Research Laboratory (AFRL) - Sensors Directorate has developed the Blue Guardian program to demonstrate advanced sensing technology utilizing open architectures in operationally relevant environments. Blue Guardian has adopted the core concepts and principles of the Air Force Rapid Capabilities Office (AFRCO) Open Mission Systems (OMS) initiative to implement an open Intelligence, Surveillance and Reconnaissance (ISR) platform architecture. Using this new OMS standard provides a business case to reduce cost and program schedules for industry and the Department of Defense (DoD). Blue Guardian is an early adopting program of OMS and provides much needed science and technology improvements, development, testing, and implementation of OMS for ISR purposes. This paper presents results and lessons learned under the Blue Guardian Project Shepherd program which conducted Multi-INT operational demonstrations in the Joint Interagency Task Force - South (JIATF-S) and USSOUTHCOM area of operations in early 2016. Further, on-going research is discussed to enhance Blue Guardian Multi-INT ISR capabilities to support additional mission sets and platforms, including unmanned operations over line of sight (LOS) and beyond line of sight (BLOS) datalinks. An implementation of additional OMS message sets and services to support off-platform sensor command and control using OMS/UCI data structures and dissemination of sensor product data/metadata is explored. Lastly, the Blue Guardian team is working with the AgilePod program to use OMS in a full Government Data Rights Pod to rapidly swap these sensors to different aircraft. The union of the AgilePod (which uses SOSA compliant standards) and OMS technologies under Blue Guardian programs is discussed.

  18. Global Monthly Water Scarcity: Blue Water Footprints versus Blue Water Availability

    Science.gov (United States)

    Hoekstra, Arjen Y.; Mekonnen, Mesfin M.; Chapagain, Ashok K.; Mathews, Ruth E.; Richter, Brian D.

    2012-01-01

    Freshwater scarcity is a growing concern, placing considerable importance on the accuracy of indicators used to characterize and map water scarcity worldwide. We improve upon past efforts by using estimates of blue water footprints (consumptive use of ground- and surface water flows) rather than water withdrawals, accounting for the flows needed to sustain critical ecological functions and by considering monthly rather than annual values. We analyzed 405 river basins for the period 1996–2005. In 201 basins with 2.67 billion inhabitants there was severe water scarcity during at least one month of the year. The ecological and economic consequences of increasing degrees of water scarcity – as evidenced by the Rio Grande (Rio Bravo), Indus, and Murray-Darling River Basins – can include complete desiccation during dry seasons, decimation of aquatic biodiversity, and substantial economic disruption. PMID:22393438

  19. THE MASSIVE STAR POPULATION IN M101. III. SPECTRA AND PHOTOMETRY OF THE LUMINOUS AND VARIABLE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Grammer, Skyler H.; Humphreys, Roberta M. [Minnesota Institute for Astrophysics, 116 Church Street SE, University of Minnesota , Minneapolis, MN 55455 (United States); Gerke, Jill, E-mail: grammer@astro.umn.edu, E-mail: roberta@umn.edu [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States)

    2015-05-15

    We discuss moderate-resolution spectra, multicolor photometry, and light curves of 31 of the most luminous stars and variables in the giant spiral M101. The majority are intermediate A- to F-type supergiants. We present new photometry and light curves for three known “irregular blue variables,” V2, V4, and V9, and identify a new candidate. Their spectra and variability confirm that they are luminous blue variable (LBV) candidates and V9 may be in an LBV-like maximum light state or eruption.

  20. Blue-Light Filtering Spectacle Lenses: Optical and Clinical Performances.

    Science.gov (United States)

    Leung, Tsz Wing; Li, Roger Wing-Hong; Kee, Chea-Su

    2017-01-01

    To evaluate the optical performance of blue-light filtering spectacle lenses and investigate whether a reduction in blue light transmission affects visual performance and sleep quality. Experiment 1: The relative changes in phototoxicity, scotopic sensitivity, and melatonin suppression of five blue-light filtering plano spectacle lenses were calculated based on their spectral transmittances measured by a spectrophotometer. Experiment 2: A pseudo-randomized controlled study was conducted to evaluate the clinical performance of two blue-light filtering spectacle lenses (BF: blue-filtering anti-reflection coating; BT: brown-tinted) with a regular clear lens (AR) serving as a control. A total of eighty computer users were recruited from two age cohorts (young adults: 18-30 yrs, middle-aged adults: 40-55 yrs). Contrast sensitivity under standard and glare conditions, and colour discrimination were measured using standard clinical tests. After one month of lens wear, subjective ratings of lens performance were collected by questionnaire. All tested blue-light filtering spectacle lenses theoretically reduced the calculated phototoxicity by 10.6% to 23.6%. Although use of the blue-light filters also decreased scotopic sensitivity by 2.4% to 9.6%, and melatonin suppression by 5.8% to 15.0%, over 70% of the participants could not detect these optical changes. Our clinical tests revealed no significant decrease in contrast sensitivity either with (95% confidence intervals [CI]: AR-BT [-0.05, 0.05]; AR-BF [-0.05, 0.06]; BT-BF [-0.06, 0.06]) or without glare (95% CI: AR-BT [-0.01, 0.03]; AR-BF [-0.01, 0.03]; BT-BF [-0.02, 0.02]) and colour discrimination (95% CI: AR-BT [-9.07, 1.02]; AR-BF [-7.06, 4.46]; BT-BF [-3.12, 8.57]). Blue-light filtering spectacle lenses can partially filter high-energy short-wavelength light without substantially degrading visual performance and sleep quality. These lenses may serve as a supplementary option for protecting the retina from potential

  1. Blue-Light Filtering Spectacle Lenses: Optical and Clinical Performances

    Science.gov (United States)

    2017-01-01

    Purposes To evaluate the optical performance of blue-light filtering spectacle lenses and investigate whether a reduction in blue light transmission affects visual performance and sleep quality. Methods Experiment 1: The relative changes in phototoxicity, scotopic sensitivity, and melatonin suppression of five blue-light filtering plano spectacle lenses were calculated based on their spectral transmittances measured by a spectrophotometer. Experiment 2: A pseudo-randomized controlled study was conducted to evaluate the clinical performance of two blue-light filtering spectacle lenses (BF: blue-filtering anti-reflection coating; BT: brown-tinted) with a regular clear lens (AR) serving as a control. A total of eighty computer users were recruited from two age cohorts (young adults: 18–30 yrs, middle-aged adults: 40–55 yrs). Contrast sensitivity under standard and glare conditions, and colour discrimination were measured using standard clinical tests. After one month of lens wear, subjective ratings of lens performance were collected by questionnaire. Results All tested blue-light filtering spectacle lenses theoretically reduced the calculated phototoxicity by 10.6% to 23.6%. Although use of the blue-light filters also decreased scotopic sensitivity by 2.4% to 9.6%, and melatonin suppression by 5.8% to 15.0%, over 70% of the participants could not detect these optical changes. Our clinical tests revealed no significant decrease in contrast sensitivity either with (95% confidence intervals [CI]: AR–BT [–0.05, 0.05]; AR–BF [–0.05, 0.06]; BT–BF [–0.06, 0.06]) or without glare (95% CI: AR–BT [–0.01, 0.03]; AR–BF [–0.01, 0.03]; BT–BF [–0.02, 0.02]) and colour discrimination (95% CI: AR–BT [–9.07, 1.02]; AR–BF [–7.06, 4.46]; BT–BF [–3.12, 8.57]). Conclusion Blue-light filtering spectacle lenses can partially filter high-energy short-wavelength light without substantially degrading visual performance and sleep quality. These lenses may

  2. Sustainable Life on the Blue Frontier

    Science.gov (United States)

    Helvarg, D.

    2002-05-01

    the 1950s suggest we now have the technological capacity for a new energy transition to non-carbon systems including photovoltaics, wind-turbines, biofuels and hydrogen fuel-cells. A (largely) hydrogen based economy could also lead to a decentralized power grid less vulnerable to terrorism and the increased natural disasters we can expect in the coming greenhouse century. Sustainable development of limited resources and the shift to renewable forms of agriculture, water-planning, energy and other technologies will ultimately depend not simply on earth science, but on a highly political process which will (hopefully) combine the best-available science, and society's values to determine public policy that benefits the long-term interests of our blue planet's varied residents, recognizing that our economy is a fully owned subsidiary of our environment.

  3. Proteomics meets blue biotechnology: a wealth of novelties and opportunities.

    Science.gov (United States)

    Hartmann, Erica M; Durighello, Emie; Pible, Olivier; Nogales, Balbina; Beltrametti, Fabrizio; Bosch, Rafael; Christie-Oleza, Joseph A; Armengaud, Jean

    2014-10-01

    Blue biotechnology, in which aquatic environments provide the inspiration for various products such as food additives, aquaculture, biosensors, green chemistry, bioenergy, and pharmaceuticals, holds enormous promise. Large-scale efforts to sequence aquatic genomes and metagenomes, as well as campaigns to isolate new organisms and culture-based screenings, are helping to push the boundaries of known organisms. Mass spectrometry-based proteomics can complement 16S gene sequencing in the effort to discover new organisms of potential relevance to blue biotechnology by facilitating the rapid screening of microbial isolates and by providing in depth profiles of the proteomes and metaproteomes of marine organisms, both model cultivable isolates and, more recently, exotic non-cultivable species and communities. Proteomics has already contributed to blue biotechnology by identifying aquatic proteins with potential applications to food fermentation, the textile industry, and biomedical drug development. In this review, we discuss historical developments in blue biotechnology, the current limitations to the known marine biosphere, and the ways in which mass spectrometry can expand that knowledge. We further speculate about directions that research in blue biotechnology will take given current and near-future technological advancements in mass spectrometry. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Compete or Leapfrog: Creating Blue Ocean through Entrepreneurial Orientation

    Directory of Open Access Journals (Sweden)

    Arslan Ayub

    2013-10-01

    Full Text Available The study analyzes the role of entrepreneurial orientation with mediating effect of knowledge creation process to creating Blue Ocean in corporate sector in Pakistan There is an increasing competition among companies due to globalization and technological advancements. Thus, it requires a study to measure the multifaceted influence of entrepreneurial orientation on knowledge creation process and Blue Ocean besides the actual paradigm of this terminology. This concept has been well discussed in this research arena since its inception in 2005. Numerous such initiatives have already been taken, however this concept invites a lot more addition, related companies are still in pursuit to materialize the research concepts. We highlight the contingencies in the shift from a red ocean to Blue Ocean. The study uses exploratory approach; primary data is collected from 391 professionals working in different sectors of Pakistan. The study uses structural equation model (SEM technique to test the hypotheses. The study found a positive relationship between entrepreneurial orientation and Blue Ocean, entrepreneurial orientation, knowledge creation process, and Blue Ocean. The study throws light on the importance of entrepreneurial orientation and knowledge creation process to head on this fast-paced competition.

  5. Borax methylene blue: a spectroscopic and staining study.

    Science.gov (United States)

    Donaldson, P T; Russo, A; Reynolds, C; Lillie, R D

    1978-07-01

    Borax methylene blue is quite stable at room temperatures of 22-25 C. At 30 C polychroming is slow; during 50 days in a water bath at this temperature the absorption peak moves from 665 to 656 nm. At 35 C, the absorption peak reaches 660 nm in 7 days, 654 nm in 14. At 60 C polychroming is rapid, the absorption peak reaching 640-620 nm in 3 days. When the pH of the borax methylene blue solutions, normally about 9.0, is adjusted to pH 6.5, the absorption peak remains at 665 nm even when incubated at 60 C for extended periods. When used as a blood stain 0.4 ml borax methylene blue (1% methylene blue in 1% borax), 4 ml acetone, 2 ml borax-acid phosphate buffer to bring the solution to pH 6.5, and distilled water to make 40 ml, with 0.2 ml 1% eosin added just before using, an excellent Nocht-Giemsa type stain is achieved after 30 minutes staining. The material plasmodia P. falciparum, P. vivax, and P. berghei stain moderate blue with dark red chromatin and green to black pigment granules. The study confirms Malachowski's 1891 results and explains Gautier's 1896-98 failure to duplicate it.

  6. Blue light dosage affects carotenoids and tocopherols in microgreens.

    Science.gov (United States)

    Samuolienė, Giedrė; Viršilė, Akvilė; Brazaitytė, Aušra; Jankauskienė, Julė; Sakalauskienė, Sandra; Vaštakaitė, Viktorija; Novičkovas, Algirdas; Viškelienė, Alina; Sasnauskas, Audrius; Duchovskis, Pavelas

    2017-08-01

    Mustard, beet and parsley were grown to harvest time under selected LEDs: 638+660+731+0% 445nm; 638+660+731+8% 445nm; 638+660+731+16% 445nm; 638+660+731+25% 445nm; 638+660+731+33% 445nm. From 1.2 to 4.3 times higher concentrations of chlorophylls a and b, carotenoids, α- and β-carotenes, lutein, violaxanthin and zeaxanthin was found under blue 33% treatment in comparison to lower blue light dosages. Meanwhile, the accumulation of metabolites, which were not directly connected with light reactions, such as tocopherols, was more influenced by lower (16%) blue light dosage, increasing about 1.3 times. Thus, microgreen enrichment of carotenoid and xanthophyll pigments may be achieved using higher (16-33%) blue light intensities. Changes in metabolite quantities were not the result of changes of other carotenoid concentration, but were more influenced by light treatment and depended on the species. Significant quantitative changes in response to blue light percentage were obtained for both directly and not directly light-dependent metabolite groups. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Effects of blue light on pigment biosynthesis of Monascus.

    Science.gov (United States)

    Chen, Di; Xue, Chunmao; Chen, Mianhua; Wu, Shufen; Li, Zhenjing; Wang, Changlu

    2016-04-01

    The influence of different illumination levels of blue light on the growth and intracellular pigment yields of Monascus strain M9 was investigated. Compared with darkness, constant exposure to blue light of 100 lux reduced the yields of six pigments, namely, rubropunctatamine (RUM), monascorubramine (MOM), rubropunctatin (RUN), monascorubrin (MON), monascin (MS), and ankaflavin (AK). However, exposure to varying levels of blue light had different effects on pigment production. Exposure to 100 lux of blue light once for 30 min/day and to 100 lux of blue light once and twice for 15 min/day could enhance RUM, MOM, MS, and AK production and reduce RUN and MON compared with non-exposure. Exposure to 100 lux twice for 30 min/day and to 200 lux once for 45 min/day decreased the RUM, MOM, MS, and AK yields and increased the RUN and MON. Meanwhile, the expression levels of pigment biosynthetic genes were analyzed by real-time quantitative PCR. Results indicated that gene MpPKS5, mppR1, mppA, mppB, mmpC, mppD, MpFasA, MpFasB, and mppF were positively correlated with the yields of RUN and MON, whereas mppE and mppR2 were associated with RUM, MOM, MS, and AK production.

  8. Fe K-edge XANES of Maya blue pigment

    International Nuclear Information System (INIS)

    Rio, M. Sanchez del; Sodo, A.; Eeckhout, S.G.; Neisius, T.; Martinetto, P.; Dooryhee, E.; Reyes-Valerio, C.

    2005-01-01

    The utilization of techniques used in Materials Science for the characterization of artefacts of interest for cultural heritage is getting more and more attention nowadays. One of the products of the ancient Maya chemistry is the 'Maya blue' pigment, made with natural indigo and palygorskite. This pigment is different from any other pigment used in other parts of the world. It is durable and acid-resistant, and still keeps many secrets to scientists even though it has been studied for more than 50 years. Although the pigment is basically made of palygorskite Si 8 (Mg 2 Al 2 )O 20 (OH) 2 (OH 2 ) 4 .4H 2 O and an organic colourant (indigo: C 16 H 10 N 2 O 2 ), a number of other compounds have been found in previous studies on archaeological samples, like other clays and minerals, iron nanoparticles, iron oxides, impurities of transition metals (Cr, Mn, Ti, V), etc. We measured at the ESRF ID26 beamline the Fe K-edge XANES spectra of the blue pigment in ancient samples. They are compared to XANES spectra of Maya blue samples synthesized under controlled conditions, and iron oxides usually employed as pigments (hematite and goethite). Our results show that the iron found in ancient Maya blue pigment is related to the Fe exchanged in the palygorskite clay. We did not find iron in metallic form or goethite in archaeological Maya blue

  9. Development of a Blue Emitting Calcium-Aluminate Phosphor.

    Directory of Open Access Journals (Sweden)

    Doory Kim

    Full Text Available We report methodological advances that enhance the phosphorescence efficiency of a blue-emitting calcium aluminate phosphor (CaAl2O4: Eu2+, Nd3+. The investigation of long-persistence blue-emitting phosphors is highly desirable due to their promising applications, such as white LEDs; however, the development of highly efficient blue-emitting phosphors is still challenging. Here, we have quantitatively characterized the phosphorescence properties of the blue-emitting phosphor CaAl2O4:Eu2+, Nd3+ with various compositions and directly related these properties to the quality of its luminescence. We optimized the composition of the activator Eu2+ and the co-activator Nd3+, the doping conditions with alkaline earth metals, alkali metals, and Si to create crystallographic distortions and, finally, the flux conditions to find the best parameters for bright and persistent blue-emitting phosphors. Our research has identified several doping compositions with good to excellent performance, with which we have demonstrated bright and persistent phosphors with afterglow characteristics superior to those of conventional phosphors.

  10. Blue light emitting diesel soot for photonic applications

    Science.gov (United States)

    Swapna, M. S.; Sankararaman, S.

    2018-01-01

    The present work is the first report of producing blue light emission from phosphor free and low-cost material—the diesel soot from the internal combustion engines (ICEs). The structural morphology is analyzed by field emission scanning electron microscopy and high-resolution transmission electron microscopy. The optical characterization is done by recording UV–visible spectrum and photoluminescent Spectrum. The CIE plot and the power spectrum for the sample show blue emission. This is further verified by collecting diesel soot from the ICE of different year of make. A visual confirmation of blue emission is obtained by exciting the sample with UV laser. The presence of various allotropic forms of carbon in the sample is identified by x-ray diffraction, Fourier transform infrared and Raman spectroscopic analysis.

  11. Microanalysis study of archaeological mural samples containing Maya blue pigment

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez del Rio, M. [ESRF, BP220, F-38043 Grenoble (France)]. E-mail: srio@esrf.fr; Martinetto, P. [Laboratoire de Cristallographie, CNRS, BP166 F-30842 Grenoble (France); Somogyi, A. [ESRF, BP220, F-38043 Grenoble (France); Reyes-Valerio, C. [INAH, Mexico DF (Mexico); Dooryhee, E. [Laboratoire de Cristallographie, CNRS, BP166 F-30842 Grenoble (France); Peltier, N. [Laboratoire de Cristallographie, CNRS, BP166 F-30842 Grenoble (France); Alianelli, L. [INFM-OGG c/o ESRF, BP220, F-38043 Grenoble Cedex (France); Moignard, B. [C2RMF, 6 Rue des Pyramides, F-75041 Paris Cedex 01 (France); Pichon, L. [C2RMF, 6 Rue des Pyramides, F-75041 Paris Cedex 01 (France); Calligaro, T. [C2RMF, 6 Rue des Pyramides, F-75041 Paris Cedex 01 (France); Dran, J.-C. [C2RMF, 6 Rue des Pyramides, F-75041 Paris Cedex 01 (France)

    2004-10-08

    Elemental analysis by X-ray fluorescence and particle induced X-ray emission is applied to the study of several Mesoamerican mural samples containing blue pigments. The most characteristic blue pigment is Maya blue, a very stable organo-clay complex original from Maya culture and widely used in murals, pottery and sculptures in a vast region of Mesoamerica during the pre-hispanic time (from VIII century) and during the colonization until 1580. The mural samples come from six different archaeological sites (four pre-hispanic and two from XVI century colonial convents). The correlation between the presence of some elements and the pigment colour is discussed. From the comparative study of the elemental concentration, some conclusions are drawn on the nature of the pigments and the technology used.

  12. Microanalysis study of archaeological mural samples containing Maya blue pigment

    International Nuclear Information System (INIS)

    Sanchez del Rio, M.; Martinetto, P.; Somogyi, A.; Reyes-Valerio, C.; Dooryhee, E.; Peltier, N.; Alianelli, L.; Moignard, B.; Pichon, L.; Calligaro, T.; Dran, J.-C.

    2004-01-01

    Elemental analysis by X-ray fluorescence and particle induced X-ray emission is applied to the study of several Mesoamerican mural samples containing blue pigments. The most characteristic blue pigment is Maya blue, a very stable organo-clay complex original from Maya culture and widely used in murals, pottery and sculptures in a vast region of Mesoamerica during the pre-hispanic time (from VIII century) and during the colonization until 1580. The mural samples come from six different archaeological sites (four pre-hispanic and two from XVI century colonial convents). The correlation between the presence of some elements and the pigment colour is discussed. From the comparative study of the elemental concentration, some conclusions are drawn on the nature of the pigments and the technology used

  13. Blue-green photoluminescence in MCM-41 mesoporous nanotubes

    International Nuclear Information System (INIS)

    Shen, J L; Lee, Y C; Lui, Y L; Cheng, P W; Cheng, C F

    2003-01-01

    Different photoluminescence (PL) techniques have been used to study the blue-green emission from siliceous MCM-41 nanotubes. It was found that the intensity of the blue-green PL is enhanced by rapid thermal annealing (RTA). This enhancement is explained by the generation of twofold-coordinated Si centres and non-bridging oxygen hole centres, in line with the surface properties of MCM-41. On the basis of the analysis of the PL following RTA, polarized PL, and PL excitation, we suggest that the triplet-to-singlet transition of twofold-coordinated silicon centres is responsible for the blue-green PL in MCM-41 nanotubes. (letter to the editor)

  14. A resolution to the blue whiting (Micromesistius poutassou) population paradox?

    DEFF Research Database (Denmark)

    Pointin, Fabien; Payne, Mark R.

    2014-01-01

    We provide the strongest evidence to date supporting the existence of two independent blue whiting (Micromesistius poutassou (Risso, 1827)) populations in the North Atlantic. In spite of extensive data collected in conjunction with the fishery, the population structure of blue whiting is poorly...... understood. On one hand, genetic, morphometric, otolith and drift modelling studies point towards the existence of two populations, but, on the other hand, observations of adult distributions point towards a single population. A paradox therefore arises in attempting to reconcile these two sets...... of information. Here we analyse 1100 observations of blue whiting larvae from the Continuous Plankton Recorder (CPR) from 1948-2005 using modern statistical techniques. We show a clear spatial separation between a northern spawning area, in the Rockall Trough, and a southern one, off the Porcupine Seabight. We...

  15. Early pre-Hispanic use of indigo blue in Peru.

    Science.gov (United States)

    Splitstoser, Jeffrey C; Dillehay, Tom D; Wouters, Jan; Claro, Ana

    2016-09-01

    Archaeological research has identified the use of cultivated cotton (Gossypium barbadense) in the ancient Andes dating back to at least 7800 years ago. Because of unusual circumstances of preservation, 6000-year-old cotton fabrics from the Preceramic site of Huaca Prieta on the north coast of Peru retained traces of a blue pigment that was analyzed and positively identified as an indigoid dye (indigotin), making it the earliest known use of indigo in the world, derived most likely from Indigofera spp. native to South America. This predates by ~1500 years the earliest reported use of indigo in the Old World, from Fifth Dynasty Egypt [ca. 4400 BP (before present)]. Indigo is one of the most valued and most globally widespread dyes of antiquity and of the present era (it being the blue of blue jeans).

  16. Better to be red than blue in virtual competition

    DEFF Research Database (Denmark)

    Ilie, Andrei; Ioan, Silvia; Zagrean, Leon

    2008-01-01

    In the 2004 Olympic Games, opponents wearing red athletic uniforms were more likely to win against opponents wearing blue uniforms. To investigate whether this color bias extends to the world of virtual competition, we compared the performance of red and blue teams in a popular multiplayer first-person......-shooter (FPS) computer game. For 3 consecutive months, we collected data from a publicly available global statistics server. Outcomes from 1,347 matches played by the top 10 players on the same virtual arena were included. Red teams won 54.9% of matches, and this effect was highly significant. Our data suggest...... that joining the red team may offer a slight advantage over the blue team in virtual competition, and this should be accounted for when designing FPS games. It is likely that "seeing red" may trigger a powerful psychological distractor signal in human aggressive competition that can affect the outcome...

  17. Blue-noise remeshing with farthest point optimization

    KAUST Repository

    Yan, Dongming

    2014-08-01

    In this paper, we present a novel method for surface sampling and remeshing with good blue-noise properties. Our approach is based on the farthest point optimization (FPO), a relaxation technique that generates high quality blue-noise point sets in 2D. We propose two important generalizations of the original FPO framework: adaptive sampling and sampling on surfaces. A simple and efficient algorithm for accelerating the FPO framework is also proposed. Experimental results show that the generalized FPO generates point sets with excellent blue-noise properties for adaptive and surface sampling. Furthermore, we demonstrate that our remeshing quality is superior to the current state-of-the art approaches. © 2014 The Eurographics Association and John Wiley & Sons Ltd.

  18. Valuing blue carbon: carbon sequestration benefits provided by the marine protected areas in Colombia.

    Science.gov (United States)

    Zarate-Barrera, Tatiana G; Maldonado, Jorge H

    2015-01-01

    Marine protected areas are aimed to protect and conserve key ecosystems for the provision of a number of ecosystem services that are the basis for numerous economic activities. Among the several services that these areas provide, the capacity of sequestering (capturing and storing) organic carbon is a regulating service, provided mainly by mangroves and seagrasses, that gains importance as alternatives for mitigating global warming become a priority in the international agenda. The objective of this study is to value the services associated with the capture and storage of oceanic carbon, known as Blue Carbon, provided by a new network of marine protected areas in Colombia. We approach the monetary value associated to these services through the simulation of a hypothetical market for oceanic carbon. To do that, we construct a benefit function that considers the capacity of mangroves and seagrasses for capturing and storing blue carbon, and simulate scenarios for the variation of key variables such as the market carbon price, the discount rate, the natural rate of loss of the ecosystems, and the expectations about the post-Kyoto negotiations. The results indicate that the expected benefits associated to carbon capture and storage provided by these ecosystems are substantial but highly dependent on the expectations in terms of the negotiations surrounding the extension of the Kyoto Protocol and the dynamics of the carbon credit's demand and supply. We also find that the natural loss rate of these ecosystems does not seem to have a significant effect on the annual value of the benefits. This approach constitutes one of the first attempts to value blue carbon as one of the services provided by conservation.

  19. Valuing blue carbon: carbon sequestration benefits provided by the marine protected areas in Colombia.

    Directory of Open Access Journals (Sweden)

    Tatiana G Zarate-Barrera

    Full Text Available Marine protected areas are aimed to protect and conserve key ecosystems for the provision of a number of ecosystem services that are the basis for numerous economic activities. Among the several services that these areas provide, the capacity of sequestering (capturing and storing organic carbon is a regulating service, provided mainly by mangroves and seagrasses, that gains importance as alternatives for mitigating global warming become a priority in the international agenda. The objective of this study is to value the services associated with the capture and storage of oceanic carbon, known as Blue Carbon, provided by a new network of marine protected areas in Colombia. We approach the monetary value associated to these services through the simulation of a hypothetical market for oceanic carbon. To do that, we construct a benefit function that considers the capacity of mangroves and seagrasses for capturing and storing blue carbon, and simulate scenarios for the variation of key variables such as the market carbon price, the discount rate, the natural rate of loss of the ecosystems, and the expectations about the post-Kyoto negotiations. The results indicate that the expected benefits associated to carbon capture and storage provided by these ecosystems are substantial but highly dependent on the expectations in terms of the negotiations surrounding the extension of the Kyoto Protocol and the dynamics of the carbon credit's demand and supply. We also find that the natural loss rate of these ecosystems does not seem to have a significant effect on the annual value of the benefits. This approach constitutes one of the first attempts to value blue carbon as one of the services provided by conservation.

  20. Complex housing environment for farmed blue foxes (Vulpes lagopus): use of various resources.

    Science.gov (United States)

    Koistinen, T; Korhonen, H T

    2013-08-01

    The present study was designed to measure the use of various, simultaneously available resources in a complex housing environment in juvenile blue foxes. Twelve blue fox sibling (male-female) pairs were housed in two-section experimental cages from the age of 8 weeks until the age of 7 months (from June to December). Each experimental cage was furnished with two platforms, a nest box, a sand box and a wooden block. This housing set-up provided the foxes with social contact, and an opportunity for oral manipulation, scratching and nesting, as well as the choice of staying on a solid floor material or on an elevated location. The foxes' behaviour was recorded at three time points during autumn (September, November and December). The foxes used all available resources. The most utilised resource was the nest box, possibly because it could be utilised in several ways (as a shelter, an elevated location, an object for scratching and for oral manipulation). The foxes also stayed more in the cage section containing the nest box than in the cage section containing a sand box. The foxes rested much on the cage floor, but they also used the interior of the nest box and elevated locations for resting. Social contact often occurred during resting. Thus, the nest box and elevated location, in conjunction with social contact seem to be valuable while resting. While active, the foxes utilised the cage floor and roof of the nest box instead of the platforms. Scratching, digging and an interaction with the wooden block were seldom observed. Activity occurred mainly on the 'empty' cage area. In conclusion, all studied resources provided blue foxes with a distinct value, as they all were used in the complex housing environment. The nest box is used most and for most variable behaviours.

  1. Equilibrium, kinetics, mechanism, and process design for the sorption of methylene blue onto rice husk.

    Science.gov (United States)

    Vadivelan, V; Kumar, K Vasanth

    2005-06-01

    Batch experiments were carried out for the sorption of methylene blue onto rice husk particles. The operating variables studied were initial solution pH, initial dye concentration, adsorbent concentration, and contact time. Equilibrium data were fitted to the Freundlich and Langmuir isotherm equations and the equilibrium data were found to be well represented by the Langmuir isotherm equation. The monolayer sorption capacity of rice husks for methylene blue sorption was found to be 40.5833 mg/g at room temperature (32 degrees C). The sorption was analyzed using pseudo-first-order and pseudo-second-order kinetic models and the sorption kinetics was found to follow a pseudo-second-order kinetic model. Also the applicability of pseudo second order in modeling the kinetic data was also discussed. The sorption process was found to be controlled by both surface and pore diffusion with surface diffusion at the earlier stages followed by pore diffusion at the later stages. The average external mass transfer coefficient and intraparticle diffusion coefficient was found to be 0.01133 min(-1) and 0.695358 mg/g min0.5. Analysis of sorption data using a Boyd plot confirms that external mass transfer is the rate limiting step in the sorption process. The effective diffusion coefficient, Di was calculated using the Boyd constant and was found to be 5.05 x 10(-04) cm2/s for an initial dye concentration of 50 mg/L. A single-stage batch-adsorber design of the adsorption of methylene blue onto rice husk has been studied based on the Langmuir isotherm equation.

  2. Staring at the cold sun: blue light regulation is distributed within the genus Acinetobacter.

    Directory of Open Access Journals (Sweden)

    Adrián Golic

    Full Text Available We previously showed that the opportunistic nosocomial pathogen Acinetobacter baumannii is able to sense and respond to light via BlsA, a BLUF (Blue-Light-sensing Using FAD-domain photoreceptor protein. Here, we extend our previous studies showing that light regulation is not restricted to A. baumannii, but rather widespread within the genus Acinetobacter. First, we found that blue light modulates motility and biofilm formation in many species of the genus, including members of the Acinetobacter calcoaceticus-A. baumannii complex. In many of these species blue light acts as a key factor guiding the decision between motility or sessility at 24°C, whereas in A. baumannii, light inhibits both motility and biofilm formation. We also show that light regulation of motility occurred not only at 24°C but also at 37°C in non-A. baumannii species, contrasting the situation of A. baumannii which only shows photoregulation at 24°C. Second, we show that Acinetobacter baylyi (strain ADP1 BLUF-photoreceptors can functionally replace in vivo the A. baumannii 17978 BlsA protein and that the pathways leading to biofilm formation are inversely regulated at 24°C between these two microorganisms. Finally, we found the presence of predicted genes coding BLUF-containing proteins in all Acinetobacter sequenced genomes, even though the copy number is variable among them. Phylogenetic analysis suggests a common origin for all BLUF domains present in members of this genus, and could distinguish well-differentiated clusters that group together BLUF homologs from different species, a situation particularly clear for members of the ACB complex. Despite a role played by these BLUF domain-containing proteins in the photoregulation observed in the members of the genus Acinetobacter is a likely scenario given our findings in A. baumannii and A. baylyi, further research will contribute to confirm this possibility.

  3. Staring at the Cold Sun: Blue Light Regulation Is Distributed within the Genus Acinetobacter

    Science.gov (United States)

    Golic, Adrián; Vaneechoutte, Mario; Nemec, Alexandr; Viale, Alejandro M.; Actis, Luis A.; Mussi, María Alejandra

    2013-01-01

    We previously showed that the opportunistic nosocomial pathogen Acinetobacter baumannii is able to sense and respond to light via BlsA, a BLUF (Blue-Light-sensing Using FAD)-domain photoreceptor protein. Here, we extend our previous studies showing that light regulation is not restricted to A. baumannii, but rather widespread within the genus Acinetobacter. First, we found that blue light modulates motility and biofilm formation in many species of the genus, including members of the Acinetobacter calcoaceticus-A. baumannii complex. In many of these species blue light acts as a key factor guiding the decision between motility or sessility at 24°C, whereas in A. baumannii, light inhibits both motility and biofilm formation. We also show that light regulation of motility occurred not only at 24°C but also at 37°C in non-A. baumannii species, contrasting the situation of A. baumannii which only shows photoregulation at 24°C. Second, we show that Acinetobacter baylyi (strain ADP1) BLUF-photoreceptors can functionally replace in vivo the A. baumannii 17978 BlsA protein and that the pathways leading to biofilm formation are inversely regulated at 24°C between these two microorganisms. Finally, we found the presence of predicted genes coding BLUF-containing proteins in all Acinetobacter sequenced genomes, even though the copy number is variable among them. Phylogenetic analysis suggests a common origin for all BLUF domains present in members of this genus, and could distinguish well-differentiated clusters that group together BLUF homologs from different species, a situation particularly clear for members of the ACB complex. Despite a role played by these BLUF domain-containing proteins in the photoregulation observed in the members of the genus Acinetobacter is a likely scenario given our findings in A. baumannii and A. baylyi, further research will contribute to confirm this possibility. PMID:23358859

  4. Modification Of Cesium Toxicity By Prussian Blue In Adult Male Albino Rats

    International Nuclear Information System (INIS)

    MANGOOD, S.A.; HAGGAG, A.M.

    2009-01-01

    The purposes of this study were to asses the toxicological effects of stable cesium chloride, and investigate the possible therapeutic role of Prussian blue (PB) in adult male albino rats.Thirty two adult male albino rats were used in this study and classified to 4 groups (8 rats/group) as follows:1- Group one (G1): rats were considered as controls and kept on the commercial diet without any treatments.2-Group two (G2): treated with daily oral cesium chloride (50 mg/300 g body weight).3-Group three (G3): treated with daily oral Prussian blue (250 mg/rats).4-Group four (G4): treated with cesium chloride at a daily oral dose of 50 mg/300 g body weight + Prussian blue at a daily oral dose of 250 mg/rats.All animals were administered the CsCl and/or PB via intubation tube and the duration of this study was 35 consecutive days. Hemoglobin (Hb), hematocrit (Ht%), red blood cells (RBC), white blood cells (WBC), folic acid, vitamin B12, total protein, albumin, globulin, A/G ratio, ALT, AST, total bilirubin, alkaline phosphatase, blood glucose, urea, creatinine, creatine phosphokinase (CPK), lactate dehydrogenase (LDH), sodium, potassium, calcium and inorganic phosphorous and body weight were determined in all groups.The data obtained revealed that the intake of stable cesium chloride in adult male rats caused significant decreases in the Hb, hematocrit, folic acid, vitamin B12 and potassium contents, with significant increases in WBC count, urea and creatinine levels and no effect on the other parameters. On the other hand, PB as a therapeutic agent caused significant amelioration in the changes produced by CsCl with variable degrees leading to the conclusion that the therapeutic agents might provide a protection against the toxicological effects of CsCl.

  5. pH influences the biocompatibility of methylene blue solutions.

    Science.gov (United States)

    Gusman, David Jonathan Rodrigues; Cintra, Luciano Tavares Angelo; Novaes, Vivian Cristina Noronha; Matheus, Henrique Rinaldi; de Araujo, Nathália Januario; de Almeida, Juliano Milanezi

    2018-01-01

    The aim of this study was to investigate the biocompatibility of methylene blue at different pH levels through the method of implantation in subcutaneous tissue. Eighty-four sterilized polyethylene tubes were allocated in the subcutaneous tissue of 28 rats, each one receiving four tubes, set into four groups: group tube (G-T)-empty tube, fibrin group (G-F)-tube filled with fibrin sponge, group methylene blue pH 7 (G-MB/pH 7)-tube filled with fibrin sponge soaked by methylene blue (100 μg/ml) at pH 7.0, and group methylene blue pH 1 (G-MB/pH 1)-tube filled with fibrin sponge and soaked by methylene blue (100 μg/ml) at pH 1.0. After 7, 15, and 30 days, seven animals from each group were euthanized, and the tubes involved by the surrounding tissue were removed and fixed with 4% buffered formaldehyde solution. The collected pieces were processed and histological sections (4 μm) were stained with hematoxylin and eosin and analyzed by light microscopy. Scores were assigned to analysis of histopathologic parameters. The results were statistically analyzed by the Kruskal-Wallis test (p ≤ 0.05). At 7 and 30 days, the G-MB/pH 1 group showed no significant difference in the G-T control group, while G-MB/pH 7 had a significant increase on tissue reaction, also when compared to G-T. At 15 days, there was no statistical difference between the groups. Within the limits of this study, it is concluded that methylene blue at pH 1.0 provides better biocompatibility than at pH 7.0.

  6. Code Blue Emergencies: A Team Task Analysis and Educational Initiative

    Directory of Open Access Journals (Sweden)

    James W. Price

    2012-04-01

    Full Text Available Introduction: The objective of this study was to identify factors that have a positive or negative influence on resuscitation team performance during emergencies in the operating room (OR and post-operative recovery unit (PAR at a major Canadian teaching hospital. This information was then used to implement a team training program for code blue emergencies. Methods: In 2009/10, all OR and PAR nurses and 19 anesthesiologists at Vancouver General Hospital (VGH were invited to complete an anonymous, 10 minute written questionnaire regarding their code blue experience. Survey questions were devised by 10 recovery room and operation room nurses as well as 5 anesthesiologists representing 4 different hospitals in British Columbia. Three iterations of the survey were reviewed by a pilot group of nurses and anesthesiologists and their feedback was integrated into the final version of the survey. Results: Both nursing staff (n = 49 and anesthesiologists (n = 19 supported code blue training and believed that team training would improve patient outcome. Nurses noted that it was often difficult to identify the leader of the resuscitation team. Both nursing staff and anesthesiologists strongly agreed that too many people attending the code blue with no assigned role hindered team performance. Conclusion: Identifiable leadership and clear communication of roles were identified as keys to resuscitation team functioning. Decreasing the number of people attending code blue emergencies with no specific role, increased access to mock code blue training, and debriefing after crises were all identified as areas requiring improvement. Initial team training exercises have been well received by staff.

  7. Biological behaviour of buccal cells exposed to blue light

    International Nuclear Information System (INIS)

    Gritsch, Kerstin; Ponsonnet, Laurence; Schembri, Catherine; Farge, Pierre; Pourreyron, Laurence; Grosgogeat, Brigitte

    2008-01-01

    Blue light is used in dental practise to cure resin-based materials, but the path of the light often includes oral tissues such as gingival tissues. While adverse effects of blue light exposure on cells - such as retina cells - are well known, few studies have investigated the impact of blue light exposure on oral cells. The aim of the present in vitro study was to assess the biological effects of blue light emitted by two dental curing devices (a plasma-arc and a light-emitting diode curing unit) on human gingival fibroblasts. Light intensities and light-induced temperature rise were respectively measured with a radiometer and a thermocouple. Cellular response to blue light exposure was assessed by the observation of cell morphology (scanning electron microscopy) and the estimation of cell mitochondrial activity (MTT assay). Light intensities measured at the clinical distance were 488 ± 42 mW/cm 2 for the plasma-arc unit and ranged from 61 ± 5 to 140 ± 16 mW/cm 2 for the light-emitting diodes unit, according to the curing program used. The highest temperature rise was 0.5 and 3.5 deg. C for exposure to the plasma-arc light and to the light-emitting diodes light, respectively. Results showed no differences between exposed- and non-exposed cells in regards to cell morphology. However, cells exposed to blue light presented an increased mitochondrial activity compared to control cells (non-exposed), and mostly those exposed to plasma-arc light

  8. Temporal dynamics of blue and green virtual water trade networks

    Science.gov (United States)

    Konar, M.; Dalin, C.; Hanasaki, N.; Rinaldo, A.; Rodriguez-Iturbe, I.

    2012-12-01

    Global food security increasingly relies on the trade of food commodities. Freshwater resources are essential to agricultural production and are thus embodied in the trade of food commodities, referred to as "virtual water trade." Agricultural production predominantly relies on rainwater (i.e., "green water"), though irrigation (i.e., "blue water") does play an important role. These different sources of water have distinctly different opportunity costs, which may be reflected in the way these resources are traded. Thus, the temporal dynamics of the virtual water trade networks from these distinct water sources require characterization. We find that 42 × 109 m3 blue and 310 × 109 m3 green water was traded in 1986, growing to 78 × 109 m3 blue and 594 × 109 m3 green water traded in 2008. Three nations dominate the export of green water resources: the USA, Argentina, and Brazil. As a country increases its export trade partners it tends to export relatively more blue water. However, as a country increases its import trade partners it does not preferentially import water from a specific source. The amount of virtual water that a country imports by increasing its import trade partners has been decreasing over time, with the exception of the soy trade. Both blue and green virtual water networks are efficient: 119 × 109 m3 blue and 105 × 109 m3 green water were saved in 2008. Importantly, trade has been increasingly saving water over time, due to the intensification of crop trade on more water-efficient links.

  9. Spectrophotometric Determination of Lamotrigine in Pharmaceutical Preparations and Urine Samples Using Bromothymol Blue and Bromophenol Blue

    International Nuclear Information System (INIS)

    Najib, F.M.; Aziz, K.H.H.

    2013-01-01

    Two simple and sensitive spectrophotometric methods have been developed for the determination of the antiepileptic drug lamotrigine (LMT) in pharmaceutical preparations and urine samples. The methods are based on the interaction of LMT with two sulphonphthalein dyes, namely, bromothymol blue (BTB) and bromophenol blue (BPB) in dichloromethane (DCM) medium to form stable and yellow-colored ion-pairs with λ max 410 and 413 nm respectively. The ion-pair LMT-BPB has been extracted from aqueous solutions at pH 3.25±0.25 using DCM; while LMT-BTB ion-pair was directly prepared in DCM. Interferences from the compounds of the urine samples, in case of LMT-BPB were removed using a suppressing solution (S.S.) prepared from the salts of the interfering ions. In LMT-BTB method, the urine of normal person not taking LMT, was used as a blank to remove the effect of interferences. Under optimum conditions, the calibration curve of LMT-BTB was linear over the range of 1-12 μg.ml -1 , ε=1.97x10 4 L.mole -1 .cm -1 , r 2 = 0.9983, and D.L of 0.13 μg.ml -1 . The corresponding values for (LMT-BPB) ion-pair were 0.5-12 μg.ml -1 linear range, ε=1.92x10 4 , r 2 = 0.9980, and D.L= 0.24 μg.ml -1 . The stoichiometry of the ion-pairs were found to be 1:1, based on Jobs, mole ratio and slope ratio methods. The recoveries (%R) for both methods were in the range of 97-101.8 % and 95-97.1 % with RSD≤1.68 and 3.1 % respectively. For LMT- spiked urine samples, the recoveries were 98.5-106.6 % with RSD≤1.66 %. Interferences from phenobarbital and carbamazepine were in the range of 25-40 folds. Statistical comparison of the results with a published method using F and t-tests showed no significant differences between each of the two methods and the reported one at 95 % confidence level. A standard addition method, gave high accuracy with LMT-BPB method. The proposed methods were successfully applied for the determination of LMT in pharmaceutical preparation and urine samples. (author)

  10. The Blue Hook Populations of Massive Globular Clusters

    Science.gov (United States)

    Brown, Thomas

    2006-07-01

    Blue hook stars are a class of hot { 35,000 K} subluminous horizontal branch stars that have been recently discovered using HST ultraviolet images of the globular clusters omega Cen and NGC 2808. These stars occupy a region of the HR diagram that is unexplained by canonical stellar evolution theory. Using new theoretical evolutionary and atmospheric models, we have shown that the blue hook stars are very likely the progeny of stars that undergo extensive internal mixing during a late helium core flash on the white dwarf cooling curve. This "flash mixing" produces an enormous enhancement of the surface helium and carbon abundances, which suppresses the flux in the far ultraviolet. Although flash mixing is more likely to occur in stars that are born with high helium abundances, a high helium abundance, by itself, does not explain the presence of a blue hook population - flash mixing of the envelope is required. We propose ACS ultraviolet {SBC/F150LP and HRC/F250W} observations of the five additional globular clusters for which the presence of blue hook stars is suspected from longer wavelength observations. Like omega Cen and NGC 2808, these five targets are also among the most massive globular clusters, because less massive clusters show no evidence for blue hook stars. Because our targets span 1.5 dex in metallicity, we will be able to test our prediction that flash-mixing should be less drastic in metal-rich blue hook stars. In addition, our observations will test the hypothesis that blue hook stars only form in globular clusters massive enough to retain the helium-enriched ejecta from the first stellar generation. If this hypothesis is correct, then our observations will yield important constraints on the chemical evolution and early formation history in globular clusters, as well as the role of helium self-enrichment in producing blue horizontal branch morphologies and multiple main sequence turnoffs. Finally, our observations will provide new insight into the

  11. Dinitrogen fixation by blue-green algae from paddy fields

    International Nuclear Information System (INIS)

    Thomas, Joseph

    1977-01-01

    Recent work using radioactive nitrogen on the blue-green algae of paddy fields has been reviewed. These algae fix dinitrogen and photoassimilate carbon evolving oxygen, thereby augmenting nitrogen and carbon status of the soil and also providing oxygen to the water-logged rice paddies. Further studies using radioactive isotopes 13 N, 24 Na and 22 Na on their nitrogen fixation, nitrogen assimilation pathways; regulation of nitrogenase, heterocysts production and sporulation and sodium transport and metabolism have been carried out and reported. The field application of blue green algae for N 2 fixation was found to increase the status of soil nitrogen and yield of paddy. (M.G.B.)

  12. The role of a blue ocean strategy on performance evaluation

    Directory of Open Access Journals (Sweden)

    Mojtaba Tabari

    2014-08-01

    Full Text Available This paper develops a balanced scorecard (BSC in order to prepare a comprehensive tool for performance evaluation. In this way, an experimental test is conducted in the Resorts of Ramsar Green City located in the north of Iran, in which the factors of a blue ocean strategy influence on the dimensions of the BSC. The sample number of this study consists of 90 managers and experts of the employees who work for Resorts of Ramsar Green City. The acquired data are analyzed with using the t-test. The obtained results show that the blue ocean strategy changes in the objects and the scales of the BSC.

  13. Quirks of dye nomenclature. 8. Methylene blue, azure and violet.

    Science.gov (United States)

    Cooksey, C J

    2017-01-01

    Methylene blue was synthesized in 1877 and soon found application in medicine, staining for microscopy and as an industrial dye and pigment. An enormous literature has accumulated since its introduction. Early on, it was known that methylene blue could be degraded easily by demethylation; consequently, the purity of commercial samples often was low. Therefore, demethylation products, such as azures and methylene violet, also are considered here. The names and identity of the components, their varying modes of manufacture, analytical methods and their contribution to biological staining are discussed.

  14. Galaxy And Mass Assembly (GAMA): blue spheroids within 87 Mpc

    Science.gov (United States)

    Mahajan, Smriti; Drinkwater, Michael J.; Driver, S.; Hopkins, A. M.; Graham, Alister W.; Brough, S.; Brown, Michael J. I.; Holwerda, B. W.; Owers, Matt S.; Pimbblet, Kevin A.

    2018-03-01

    In this paper, we test if nearby blue spheroid (BSph) galaxies may become the progenitors of star-forming spiral galaxies or passively evolving elliptical galaxies. Our sample comprises 428 galaxies of various morphologies in the redshift range 0.002 well as spirals in the multidimensional space mapped by luminosity-weighted age, metallicity, dust mass, and specific star formation rate. We use H I data to reveal that some of the BSphs are (further) developing their discs, hence their blue colours. They may eventually become spiral galaxies - if sufficient gas accretion occurs - or more likely fade into low-mass red galaxies.

  15. How the ``Blues'' reveals the intimacy of music and physics

    Science.gov (United States)

    Gibson, J. Murray

    2013-03-01

    Little do most people know when they hear blues piano - and you'll hear some live in this talk - that physics permeates the style, as it does all of music. Why should you care? By deconstructing blues piano the intimacy of physics, mathematics and music will be revealed in its glory.[1] The exercise says something about how the brains of the music composer and of the listener must be intimately linked to the physical principles of acoustics. And it provides a great vehicle to explain physical phenomena to non-scientists - everything from quantum mechanics to protein structure.

  16. Osteoma in a blue-fronted Amazon parrot (Amazona aestiva).

    Science.gov (United States)

    Cardoso, João Felipe Rito; Levy, Marcelo Guilherme Bezerra; Liparisi, Flavia; Romão, Mario Antonio Pinto

    2013-09-01

    Osteoma is an uncommon bone formation documented in avian species and other animals. A blue-fronted Amazon parrot (Amazona aestiva) with clinical respiratory symptoms was examined because of a hard mass present on the left nostril. Radiographs suggested a bone tumor, and the mass was surgically excised. Histopathologic examination revealed features of an osteoma. To our knowledge, this is the first description of an osteoma in a blue-fronted Amazon parrot. Osteoma should be considered as a differential diagnosis in birds with respiratory distress and swelling of the nostril.

  17. Occupational contact dermatitis in blue-collar workers

    DEFF Research Database (Denmark)

    Schwensen, Jakob F; Menné, Torkil; Veien, Niels K

    2014-01-01

    observed among blue-collar workers (19.6%) than among controls (23.9%) (p = 0.005). Allergens with a statistically significant association with the occupational group of blue-collar workers were epoxy resins, methyldibromo glutaronitrile, 2-bromo-2-nitro-1,3-propanediol, potassium dichromate......, and methylchloroisothiazolinone (MCI)/methylisothiazolinone (MI). The following occupations were additionally identified as risk factors for contact sensitization to MCI/MI and MI, epoxy resins, and potassium dichromate, respectively: painting, construction work, and tile setting/terrazzo work. CONCLUSION: Contact allergy...

  18. Blue and green egg-color intensity is associated with parental effort and mating system in passerines: support for the sexual selection hypothesis.

    Science.gov (United States)

    Soler, Juan J; Moreno, Juan; Avilés, Jesús M; Møller, Anders P

    2005-03-01

    Among several adaptive explanations proposed to account for variation in avian egg color, that related to sexual selection is of particular interest because of its possible generality. Briefly, it proposes that because biliverdin (the pigment responsible for blue-green eggshell coloration) is an antioxidant, deposition in the eggshell by laying females may signal the capacity of females to control free radicals, despite the handicap of removing this antioxidant from their body. If males adjust parental effort in response to the intensity of the blue coloration of eggs, thereby investing more in the offspring of high-quality mates, blue eggs may represent a postmating sexually selected signal in females. Here, by image and spectrophotometric analyses of the eggs of European passerines, we tested two different predictions of the hypothesis. First, variables related to intraspecific variation in parental effort (i.e., the duration of the nestling period controlled for body mass) should be positively related to the intensity of blue-green color of the eggshell across species. Second, there should be a positive relationship between intensity of blue-green color of eggs and degree of polygyny. These predictions were supported: intensity of blue-green coloration (i.e., chroma) was significantly related to the duration of the nestling period and to degree of polygyny after controlling for possible confounding variables (i.e., body mass, incubation period, and nest type) and similarity due to common descent. Nest type (hole or nonhole) also explained a significant proportion of variation in egg chroma, perhaps reflecting different selection pressures (i.e., light conditions, risk of parasitism) affecting species with the two types of nests.

  19. How Long Will I Be Blue? Prolonged Skin Staining Following Sentinel Lymph Node Biopsy Using Intradermal Patent Blue Dye

    Science.gov (United States)

    Gumus, Metehan; Gumus, Hatice; Jones, Sue E; Jones, Peter A; Sever, Ali R; Weeks, Jennifer

    2013-01-01

    Summary Background Blue dye used for sentinel lymph node biopsy (SLNB) in breast cancer patients may cause prolonged skin discoloration at the site of injection. The aim of this study was to assess the duration of such skin discoloration. Patients and Methods 236 consecutive patients who had undergone breast conserving surgery and SLNB for breast cancer were reviewed prospectively from January 2007 to December 2009. Results Of the 236 patients, 2 had undergone bilateral surgery, and 41 had been examined in consecutive yearly reviews. Blue discoloration remained visible at the injection site after 12, 24, and > 36 months in 36.5, 23.6, and 8.6% of the patients, respectively. Conclusion The use of patent blue for identification of the sentinel lymph node in patients undergoing breast cancer surgery may result in prolonged discoloration of the skin at the injection site. PMID:24415970

  20. Isolation, identification and determination of a magenta subsidiary colour in food blue no. 1 (brilliant blue FCF).

    Science.gov (United States)

    Kusaka, T; Matsufuji, H; Chino, M; Kato, Y; Nakamura, M; Goda, Y; Toyoda, M; Takeda, M

    1999-12-01

    A magenta subsidiary colour was isolated from commercial Food Blue No. 1 (B-1; Brilliant Blue FCF). The absorption maximum for this subsidiary colour at 580 nm is outside of the range of 614-628 nm found for other subsidiary colours and m,m-B-1. On the basis of MS and NMR analyses, the structure of the subsidiary colour was elucidated as the disodium salt of 2-[[4-[N-ethyl-N-(3-sulphophenylmethyl)amino]phenyl][4-oxo- 2,5-cyclohexadienylidene]methyl]benzenesulphonic acid. HPLC analyses revealed that 24 batches of commercial Food Blue No. 1 (three manufacturers) contain 0.1-0.8% (average: 0.5%) of the magenta subsidiary colour.

  1. Assessing the impact of vulnerability on perceptions of social cohesion in the context of community resilience to disaster in the Blue Mountains.

    Science.gov (United States)

    Redshaw, Sarah; Ingham, Valerie; McCutcheon, Marion; Hicks, John; Burmeister, Oliver

    2018-02-01

    To assess the impact of network communications, community participation and elements of vulnerability on the perception of social cohesiveness in the Blue Mountains local government area (Blue Mountains LGA). A questionnaire was administered to residents of the Blue Mountains LGA. Econometric analysis of the resulting data was undertaken. Blue Mountains LGA, Australia. One thousand one hundred and three residents of the Blue Mountains LGA responded to the questionnaire. The responses enabled the construction of variables measuring individual perceptions of community cohesiveness, their network communications and community participation. Demographic data and data on the vulnerabilities of individuals were also collected. The data were used in an econometric model which identified that network communications and community participation impacted positively on perceptions of social cohesiveness while vulnerability factors had a negative impact. Remedial action to build community cohesiveness and network communications can be expected to have a positive impact on social cohesiveness. In developing strategies to build community cohesiveness and network communication, particular care needs to be taken to ensure the inclusion of those members of society who are regarded as the most vulnerable. © 2017 National Rural Health Alliance Inc.

  2. Non-destructive characterization of oriental porcelain glazes and blue underglaze pigments using μ-EDXRF, μ-Raman and VP-SEM

    International Nuclear Information System (INIS)

    Coutinho, M.L.; Muralha, V.S.F.; Mirao, J.; Veiga, J.P.

    2014-01-01

    The study of ancient materials with recognized cultural and economic value is a challenge to scientists and conservators, since it is usually necessary an approach through non-destructive techniques. Difficulties in establishing a correct analytical strategy are often significantly increased by the lack of knowledge on manufacture technologies and raw materials employed combined with the diversity of decay processes that may have acted during the lifetime of the cultural artefacts. A non-destructive characterization was performed on the glaze and underglaze pigments from a group of Chinese porcelain shards dated from the late Ming Dynasty (1368-1644) excavated at the Monastery of Santa Clara-a-Velha in Coimbra (Portugal). Chemical analysis was performed using micro-energy dispersive X-ray fluorescence spectrometry (μ-EDXRF). Mineralogical characterization was achieved by Raman microscopy (μ-Raman) and observation of small-surface crystallization dark spots with a metallic lustre in areas with high pigment concentration was done by variable pressure scanning electron microscopy (VP-SEM). Cobalt aluminate was identified as the blue underglaze pigment and a comparison of blue and dark blue pigments was performed by the ratio of Co, Mn, and Fe oxides, indicating a compositional difference between the two blue tonalities. Manganese oxide compounds were also identified as colouring agents in dark blue areas and surface migration of manganese compounds was verified. (orig.)

  3. Non-destructive characterization of oriental porcelain glazes and blue underglaze pigments using μ-EDXRF, μ-Raman and VP-SEM

    Science.gov (United States)

    Coutinho, M. L.; Muralha, V. S. F.; Mirão, J.; Veiga, J. P.

    2014-03-01

    The study of ancient materials with recognized cultural and economic value is a challenge to scientists and conservators, since it is usually necessary an approach through non-destructive techniques. Difficulties in establishing a correct analytical strategy are often significantly increased by the lack of knowledge on manufacture technologies and raw materials employed combined with the diversity of decay processes that may have acted during the lifetime of the cultural artefacts. A non-destructive characterization was performed on the glaze and underglaze pigments from a group of Chinese porcelain shards dated from the late Ming Dynasty (1368-1644) excavated at the Monastery of Santa Clara- a- Velha in Coimbra (Portugal). Chemical analysis was performed using micro-energy dispersive X-ray fluorescence spectrometry (μ-EDXRF). Mineralogical characterization was achieved by Raman microscopy (μ-Raman) and observation of small-surface crystallization dark spots with a metallic lustre in areas with high pigment concentration was done by variable pressure scanning electron microscopy (VP-SEM). Cobalt aluminate was identified as the blue underglaze pigment and a comparison of blue and dark blue pigments was performed by the ratio of Co, Mn, and Fe oxides, indicating a compositional difference between the two blue tonalities. Manganese oxide compounds were also identified as colouring agents in dark blue areas and surface migration of manganese compounds was verified.

  4. Non-destructive characterization of oriental porcelain glazes and blue underglaze pigments using μ-EDXRF, μ-Raman and VP-SEM

    Energy Technology Data Exchange (ETDEWEB)

    Coutinho, M.L. [Universidade Nova de Lisboa, REQUIMTE-CQFB, Faculdade de Ciencias e Tecnologia, Caparica (Portugal); Universidade Nova de Lisboa, Departamento de Conservacao e Restauro, Faculdade de Ciencias e Tecnologia, Caparica (Portugal); Muralha, V.S.F. [Universidade Nova de Lisboa, Research Unit VICARTE, Vidro e Ceramica para as Artes, Faculdade de Ciencias e Tecnologia, Caparica (Portugal); Mirao, J. [Universidade de Evora, Laboratorio HERCULES, Evora (Portugal); Veiga, J.P. [Universidade Nova de Lisboa, CENIMAT/I3N, Departamento de Ciencia dos Materiais, Faculdade de Ciencias e Tecnologia, Caparica (Portugal)

    2014-03-15

    The study of ancient materials with recognized cultural and economic value is a challenge to scientists and conservators, since it is usually necessary an approach through non-destructive techniques. Difficulties in establishing a correct analytical strategy are often significantly increased by the lack of knowledge on manufacture technologies and raw materials employed combined with the diversity of decay processes that may have acted during the lifetime of the cultural artefacts. A non-destructive characterization was performed on the glaze and underglaze pigments from a group of Chinese porcelain shards dated from the late Ming Dynasty (1368-1644) excavated at the Monastery of Santa Clara-a-Velha in Coimbra (Portugal). Chemical analysis was performed using micro-energy dispersive X-ray fluorescence spectrometry (μ-EDXRF). Mineralogical characterization was achieved by Raman microscopy (μ-Raman) and observation of small-surface crystallization dark spots with a metallic lustre in areas with high pigment concentration was done by variable pressure scanning electron microscopy (VP-SEM). Cobalt aluminate was identified as the blue underglaze pigment and a comparison of blue and dark blue pigments was performed by the ratio of Co, Mn, and Fe oxides, indicating a compositional difference between the two blue tonalities. Manganese oxide compounds were also identified as colouring agents in dark blue areas and surface migration of manganese compounds was verified. (orig.)

  5. Beyond blue pico laser: development of high power blue and low power direct green

    Science.gov (United States)

    Vierheilig, Clemens; Eichler, Christoph; Tautz, Sönke; Lell, Alfred; Müller, Jens; Kopp, Fabian; Stojetz, Bernhard; Hager, Thomas; Brüderl, Georg; Avramescu, Adrian; Lermer, Teresa; Ristic, Jelena; Strauss, Uwe

    2012-03-01

    There is a big need on R&D concerning visible lasers for projection applications. The pico-size mobile projection on the one hand awaits the direct green lasers with sufficiently long lifetimes at optical powers above 50mW. In this paper we demonstrate R&D-samples emitting at 519nm with lifetimes up to 10.000 hours. The business projection on the other hand requires high power operation and already uses blue lasers and phosphor conversion, but there is a strong demand for higher power levels. We investigate the power limits of R&D laser structures. In continuous wave operation, the power is limited by thermal roll-over. With an excellent power conversion efficiency of up to 29% the thermal roll-over is as high as 2.5W for a single emitter in TO56 can. We do not observe significant leakage at high currents. Driven in short pulse operation to prevent the laser from self heating, linear laser characteristics of optical power versus electrical current are observed up to almost 8W of optical power.

  6. X-ray structure of a blue complex pigment from the blue flowers of Centaurea cyanus

    International Nuclear Information System (INIS)

    Shiono, M.; Matsugaki, N.; Takeda, K.

    2005-01-01

    Full text: The blue pigment of the cornflower, named protocyanin, has long been investigated, but its precise structure has remained unclear. Our recent research demonstrated the components of protocyanin to be anthocyanin (AN), flavone glycoside (FL), Fe 3+ , Mg 2+ and Ca 2+ ions and we succeeded in the reconstruction of protocyanin. In this study, we revealed the X-ray structure of protocyanin. The crystal structure of the reconstructed protocyanin was determined at a resolution of 1.05 A. The refined molecule has pseudo threefold symmetry and four metal ions, Fe 3+ , Mg 2+ and two Ca 2+ , align along the pseudo three-fold axis. The four metals are coordinated to six AN molecules and six FL molecules. The inner Fe 3+ and Mg 2+ ions are each coordinated to three AN molecules respectively, while the outer two Ca 2+ ions are each coordinated to three FL molecules . Both AN and FL molecules are self-associated with each other as AN-AN and FL-FL in pair and this hydrophobic association also exists between AN and FL molecules. Protocyanin is a tetra-metal (Fe 3+ , Mg 2+ , 2Ca 2+ ) nuclear complex of twelve molecules of anthocyanin and flavone glycoside, a new type of supramolecular pigment. (author)

  7. Spinning like a blue straggler: the population of fast rotating blue straggler stars in ω Centauri

    Energy Technology Data Exchange (ETDEWEB)

    Mucciarelli, A.; Lovisi, L.; Ferraro, F. R.; Dalessandro, E.; Lanzoni, B. [Dipartimento di Fisica and Astronomia, Università degli Studi di Bologna, Viale Berti Pichat 6/2, I-40127 Bologna (Italy); Monaco, L. [European Southern Observatory, Casilla 19001, Santiago (Chile)

    2014-12-10

    By using high-resolution spectra acquired with FLAMES-GIRAFFE at the ESO/VLT, we measured the radial and rotational velocities for 110 blue straggler stars (BSSs) in ω Centauri, the globular cluster-like stellar system harboring the largest known BSS population. According to their radial velocities, 109 BSSs are members of the system. The rotational velocity distribution is very broad, with the bulk of BSSs spinning at less than ∼40 km s{sup –1} (in agreement with the majority of such stars observed in other globular clusters) and a long tail reaching ∼200 km s{sup –1}. About 40% of the sample has v{sub e} sin i > 40 km s{sup –1} and about 20% has v{sub e} sin i > 70 km s{sup –1}. Such a large fraction is very similar to the percentage of fast rotating BSSs observed in M4. Thus, ω Centauri is the second stellar cluster, beyond M4, with a surprisingly high population of fast spinning BSSs. We found a hint of radial behavior for a fraction of fast rotating BSSs, with a mild peak within one core radius, and a possible rise in the external regions (beyond four core radii). This may suggest that recent formation episodes of mass transfer BSSs occurred preferentially in the outskirts of ω Centauri, or that braking mechanisms able to slow down these stars are least efficient in the lowest density environments.

  8. OPTIMIZATION OF REACTIVE BLUE 19 DECOLORIZATION BY GANODERMA SP. USING RESPONSE SURFACE METHODOLOGY

    Directory of Open Access Journals (Sweden)

    1M. Mohammadian Fazli, *1A. R. Mesdaghinia, 1K. Naddafi, 1S. Nasseri , 1M. Yunesian, 2M. Mazaheri Assadi, 3S. Rezaie, 4H. Hamzehei

    2010-01-01

    Full Text Available Synthetic dyes are extensively used in different industries. Dyes have adverse impacts such as visual effects, chemical oxygen demand, toxicity, mutagenicity and carcinogenicity characteristics. White rot fungi, due to extracellular enzyme system, are capable to degrade dyes and various xenobiotics. The aim of this study was to optimize decolorization of reactive blue 19 (RB19 dye using Ganoderma sp. fungus. Response Surface Methodology (RSM was used to study the effect of independent variables, namely glycerol concentration (15, 20 and 25 g/L, temperature (27, 30 and 33 oC and pH (5.5, 6.0 and 6.5 on color removal efficiency in aqueous solution. From RSM-generated model, the optimum conditions for RB19 decolorization were identified to be at temperature of 27oC, glycerol concentration of 19.14 mg/L and pH=6.3. At the optimum conditions, predicted decolorization was 95.3 percent. The confirmatory experiments were conducted and confirmed the results by 94.89% color removal. Thus, this statistical approach enabled to improve reactive blue 19 decolorization process by Ganoderma sp. up to 1.27 times higher than non-optimized conditions.

  9. Dental fluorosis in the Blue Mountains and Hawkesbury, New South Wales, Australia: policy implications.

    Science.gov (United States)

    Bal, Ikreet S; Dennison, Peter J; Evans, R Wendell

    2015-02-01

    The aim of the present study was to determine whether the adjustment of the fluoride concentration to 1 ppm in the drinking water supplied to the Blue Mountains, New South Wales, Australia in 1993 was associated with fluorosis incidence. In 2003, children attending schools in the Blue Mountains and a control region (fluoridated in 1967) that had been randomly selected at baseline in 1992 were examined for dental fluorosis (maxillary central incisors only) using Dean's index. A fluoride history for each child was obtained by questionnaire. Associations between fluorosis and 58 potential explanatory variables were explored. The response rate was 63%. A total of 1138 children aged from 7 to 11 years with erupted permanent central incisors were examined for dental fluorosis. Fluorosis prevalence was the same in both regions. The Community Index of Dental Fluorosis values were slightly different, but were both above 0.6, indicative of public health concern. For the group as a whole, we concluded that: (a) fluorosis prevalence (0.39) in both regions was similar; and (b) the higher-than-expected prevalence and severity of fluorosis was due mainly to two factors: (a) the higher-than-optimal fluoride level in drinking water; and (b) swallowing of fluoride toothpaste in early childhood. © 2014 Wiley Publishing Asia Pty Ltd.

  10. Sand Floor for Farmed Blue Foxes: Effects on Claws, Adrenal Cortex Function, Growth and Fur Properties

    Directory of Open Access Journals (Sweden)

    Leena Ahola

    2009-01-01

    Full Text Available Farmed blue foxes (Vulpes lagopus are traditionally housed on mesh floors where they are unable to perform certain species-specific behaviours, such as digging, which may compromise the animals' welfare. This study describes how a possibility to use in-cage sand floor affects welfare-related variables like growth of the claws, adrenal cortex function, and fur properties in juvenile blue foxes. The foxes (N=32 were housed in male-female sibling pairs in an outdoor fur animal shed in cage systems consisting of two traditional fox cages. For the eight male-female sibling pairs of the Control group, there was a mesh floor in both cages of each cage system, whereas for the eight pairs of the Sand group there was a mesh floor in one cage and a 30–40 cm deep earth floor in the other cage. The results show that sand floor is beneficial for the wearing of the claws of foxes. Furthermore, an early experience of sand floor may have positive effects on the foxes' fur development. The results, however, also suggest that there might appear welfare problems observed as disturbed claw growth and increased adrenal cortex activation if foxes that are once provided with clean and unfrozen sand floor are not allowed to enjoy this floor all the time.

  11. Generalized instrumental variable models

    OpenAIRE

    Andrew Chesher; Adam Rosen

    2014-01-01

    This paper develops characterizations of identified sets of structures and structural features for complete and incomplete models involving continuous or discrete variables. Multiple values of unobserved variables can be associated with particular combinations of observed variables. This can arise when there are multiple sources of heterogeneity, censored or discrete endogenous variables, or inequality restrictions on functions of observed and unobserved variables. The models g...

  12. High efficiency blue phosphorescent organic light-emitting diodes without electron transport layer

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Soon Ok [Department of Polymer Science and Engineering, Dankook University, Jukjeon-dong, Suji-gu, Yongin-si, Gyeonggi-do 448-701 (Korea, Republic of); Lee, Jun Yeob, E-mail: leej17@dankook.ac.kr [Department of Polymer Science and Engineering, Dankook University, Jukjeon-dong, Suji-gu, Yongin-si, Gyeonggi-do 448-701 (Korea, Republic of)

    2011-08-15

    High efficiency blue phosphorescent organic light-emitting diodes were fabricated without an electron transport layer using a spirobifluorene based blue triplet host material. The simple blue PHOLEDs without the electron transport layer showed a high external quantum efficiency and current efficiency of 16.1% and 30.2 cd/A, respectively. The high device performances of the electron transport layer free blue PHOLEDs were comparable to those of blue PHOLEDs with the electron transport layer. - Highlights: > Simple device structure without electron transport layer. > High efficiency blue phosphorescent organic light-emitting diode. > Spirobifluorene based high triplet energy host material.

  13. Treatment of attention deficit hyperactivity disorder insomnia with blue wavelength light-blocking glasses

    Directory of Open Access Journals (Sweden)

    Fargason RE

    2013-01-01

    Full Text Available Rachel E Fargason, Taylor Preston, Emily Hammond, Roberta May, Karen L GambleDepartment of Psychiatry and Behavioral Neurobiology, University of Alabama at Birmingham School of Medicine, Birmingham, AL, USABackground: The aim of this study was to examine a nonmedical treatment alternative to medication in attention deficit hyperactivity disorder (ADHD insomnia, in which blue wavelength light-blocking glasses are worn during the evening hours to counteract the phase-delaying effect of light. Outcome measures included sleep quality and midsleep time. The capacity of ADHD subjects to comply with treatment using the glasses was assessed.Methods: Daily bedtime, wake-up time, and compliance diaries were used to assess sleep quality and timing during a baseline observation week and a 2-week intervention period. The Pittsburgh Sleep Quality Index (PSQI was administered following baseline and intervention. The intervention protocol consisted of use of blue wavelength-blocking glasses and a moderate lighting environment during evening hours.Results: Partial and variable compliance were noted, with only 14 of 22 subjects completing the study due to nonadherence with wearing the glasses and diary completion. Despite the minimum 3-hour recommendation, glasses were worn, on average, for 2.4 hours daily. Lighting was reduced for only 58.7% of the evening. Compared with baseline, the intervention resulted in significant improvement in global PSQI scores, PSQI subcomponent scores, and sleep diary measures of morning refreshment after sleep (P = 0.037 and night-time awakenings (P = 0.015. Global PSQI scores fell from 11.15 to 4.54, dropping below the cut-off score of 5 for clinical insomnia. The more phase-delayed subjects, ie, those with an initial midsleep time after 4:15 am, trended towards an earlier midsleep time by 43.2 minutes following the intervention (P = 0.073. Participants reported less anxiety following the intervention (P = 0.048.Conclusions

  14. Immigration and emigration in the Sinai Baton Blue butterfly ...

    African Journals Online (AJOL)

    Thus, many estimates of rates of movement are indirect and incomplete, and there is little empirical knowledge of the factors affecting immigration and emigration. I studied intensively a local population of Sinai Baton Blue butterflies in a discrete habitat patch. The study lasted the entire adult flight period, and involved almost ...

  15. Monitoring of the endemic Sinai Baton Blue butterfly Pseudophilotes ...

    African Journals Online (AJOL)

    Results of the monitoring of the Sinai Baton Blue butterfly in its stronghold of Farsh Shoeib on Gebel Safsafa in the St Katherine Protectorate between 2004-9 is analysed to compare them with the detailed study of Mike James in 2002-3. The butterfly appears to have a three-year population cycle, with its population crashing ...

  16. Greater food availability reduces tarsus assymmetry in nestling Blue Tits

    NARCIS (Netherlands)

    Grieco, F.

    2003-01-01

    Previous work has shown that the quantity or quality of food affects the degree of asymmetry in bilateral body traits in adult birds, but so far there is no evidence that this is the case in early phases of growth too. I studied asymmetry of tarsus length of nestling Blue Tits (Parus caeruleus) in

  17. Chromophore Deprotonation State Alters the Optical Properties of Blue Chromoprotein.

    Directory of Open Access Journals (Sweden)

    Cheng-Yi Chiang

    Full Text Available Chromoproteins (CPs have unique colors and can be used in biological applications. In this work, a novel blue CP with a maximum absorption peak (λmax at 608 nm was identified from the carpet anemone Stichodactyla gigantea (sgBP. In vivo expression of sgBP in zebrafish would change the appearance of the fishes to have a blue color, indicating the potential biomarker function. To enhance the color properties, the crystal structure of sgBP at 2.25 Å resolution was determined to allow structure-based protein engineering. Among the mutations conducted in the Gln-Tyr-Gly chromophore and chromophore environment, a S157C mutation shifted the λmax to 604 nm with an extinction coefficient (ε of 58,029 M-1·cm-1 and darkened the blue color expression. The S157C mutation in the sgBP chromophore environment could affect the color expression by altering the deprotonation state of the phenolic group in the chromophore. Our results provide a structural basis for the blue color enhancement of the biomarker development.

  18. Viability of the Fricke dosemeter doped with methylene blue

    International Nuclear Information System (INIS)

    Souza, V.L.B.; Santos, C.D.A.; Rodrigues, K.R.G.; Cunha, M.S.; Figueiredo, M.D.C.; Melo, R.T.

    2009-01-01

    This work aims to find the possible utilization of the Fricke dosemeter doped with methylene blue (FMB) for the dosimetry of photodynamic therapy. The FMB was irradiated wit X rays and light emitted diodes demonstrating positive answers to the stimulus, being probably to be used for dosimetric objectives

  19. Blue Bottle Experiment: Learning Chemistry without Knowing the Chemicals

    Science.gov (United States)

    Limpanuparb, Taweetham; Areekul, Cherprang; Montriwat, Punchalee; Rajchakit, Urawadee

    2017-01-01

    The blue bottle experiment is a popular chemical demonstration because of its simplicity and visual appeal. Most papers on the topic focus on a new formulation or a new presentation, but only a few discuss pedagogical application for a full lab session. This article describes the use of this experiment in the first session of undergraduate…

  20. Designing green and blue infrastructure to support healthy urban living

    NARCIS (Netherlands)

    Gehrels, H.; Meulen, S. vsn der; Schasfoort, F.; Bosch, P.R.; Brolsma, R.; Dinter, D. van; Geerling, G.J.; Goossen, M.; Jacobs, C.; Jong, M. de; Kok, S.; Massop, H.; Oste, L.; Perez-Soba, M.; Rovers, V.; Smit, A.; Verweij, P.; Vries, B. de; Weijers, E.

    2016-01-01

    There is a growing awareness in cities throughout the world that green and blue infrastructure can offer a wide range of ecosystem services to support a healthy urban environment. For example, landscape architects explore possibilities in their design of the urban landscape to use the potential of

  1. Decolourization of Direct Blue 2 by peroxidases obtained from an ...

    African Journals Online (AJOL)

    Also, an increase in toxicity, determined by Vibrio fisheri, was observed after the enzymatic oxidation of the dye. Results suggest that the oxidation of DB2 with peroxidases can be recommended as a pretreatment step before a conventional treatment process. Keywords: decolourization, Direct Blue 2, industrial waste, ...

  2. The Effects of Blue Light on Ocular Health.

    Science.gov (United States)

    Kitchel, Elaine

    2000-01-01

    This review of the literature examines the effects of blue light (or near UV - ultraviolet), especially that given off by black-light tubes, often used with children with visual impairments. It finds a long-term danger of retinal and lens damage and offers six practical suggestions which emphasize using proper filters and limiting exposure to…

  3. Spatial interaction of methylene blue stained soil pores

    NARCIS (Netherlands)

    Stein, A.; Lieshout, van M.N.M.; Booltink, H.W.G.

    2001-01-01

    In this paper, we compare different types of patterns that emerge when applying methylene blue dye as a tracer on soils to detect preferential flow paths as a result of large cracks. Patterns on channels, vughs and cracks are analyzed with the J-function and with indicator variograms. By means of a

  4. Methylene Blue-Ascorbic Acid: An Undergraduate Experiment in Kinetics.

    Science.gov (United States)

    Snehalatha, K. C.; And Others

    1997-01-01

    Describes a laboratory exercise involving methylene blue and L-ascorbic acid in a simple clock reaction technique to illustrate the basic concepts of chemical kinetics. If stock solutions are supplied and each type of experiment takes no more than half an hour, the entire investigation can be completed in three practical sessions of three hours…

  5. The interaction between methylene blue and the cholinergic system

    NARCIS (Netherlands)

    Pfaffendorf, M.; Bruning, T. A.; Batnik, H. D.; van Zwieten, P. A.

    1997-01-01

    1. The inhibitory effects of methylene blue (MB) on different types of cholinesterases and [3H]-N-methylscopolamine ([3H]-NMS) binding to muscarinic receptors were studied. 2. Human plasma from young healthy male volunteers, purified human pseudocholinesterase and purified bovine true

  6. Intraoperatively Testing the Anastomotic Integrity of Esophagojejunostomy Using Methylene Blue.

    Science.gov (United States)

    Celik, S; Almalı, N; Aras, A; Yılmaz, Ö; Kızıltan, R

    2017-03-01

    Intraoperative testing of gastrointestinal anastomosis effectively ensures anastomotic integrity. This study investigated whether the routine use of methylene blue intraoperatively identified leaks to reduce the postoperative proportion of clinical leaks. This study retrospectively analyzed consecutive total gastrectomies performed from January 2007 to December 2014 in a university hospital setting by a general surgical group that exclusively used the methylene blue test. All surgeries were performed for gastric or junctional cancers (n = 198). All reconstructions (Roux-en Y esophagojejunostomy) were performed using a stapler. The methylene blue test was used in 108 cases (group 1) via a nasojejunal tube. No test was performed for the other 90 cases (group 2). Intraoperative leakage rate, postoperative clinical leakage rate, length of hospitalization, and mortality rate were the outcome measures. The intraoperative leakage rate was 7.4% in group 1. The postoperative clinical leakage rate was 8.6%. The postoperative clinical leakage rate was 3.7% in group 1 and 14.4% in group 2 (p = 0.007). There were no postoperative clinical leaks when an intraoperative leak led to concomitant intraoperative repair. The median length of hospital stay was 6 days in group 1 and 8 days in group 2 (p methylene blue test for esophagojejunostomy is a safe and reliable method for the assessment of anastomosis integrity, especially in cases with difficult esophagojejunostomic construction.

  7. Detection of tissue expander leakage by methylene blue instillation ...

    African Journals Online (AJOL)

    Background: Tissue expansion is an important and widely used technique of soft tissue reconstruction. Leakage of the expanders is one of the complications and it might at times be difficult to detect. Method and Conclusion: We used methylene blue stained saline for inflation of tissue expanders in 42 cases and found it to ...

  8. Extinction Memory Improvement by the Metabolic Enhancer Methylene Blue

    Science.gov (United States)

    Gonzalez-Lima, F.; Bruchey, Aleksandra K.

    2004-01-01

    We investigated whether postextinction administration of methylene blue (MB) could enhance retention of an extinguished conditioned response. MB is a redox compound that at low doses elevates cytochrome oxidase activity, thereby improving brain energy production. Saline or MB (4 mg/kg intraperitoneally) were administered to rats for 5 d following…

  9. (SSR) markers for screening blue disease resistance in cotton ...

    African Journals Online (AJOL)

    Blue disease of cotton is an economically important disease of the crop first described from the Central African Republic and spread to other countries. Brazil and other South American countries record crop losses of up to 80% from infection but no cases of the disease have been reported in Tanzania. Resistance to the ...

  10. Wild edible mushrooms in the Blue Mountains: resource and issues.

    Science.gov (United States)

    Catherine G. Parks; Craig L. Schmitt

    1997-01-01

    This paper reviews the wild mushroom resource of the Blue Mountains of northeastern Oregon and southeastern Washington and summarizes issues and concerns for regulation, monitoring, and management. Existing biological information on the major available commercial mushrooms in the area, with emphasis on morels, is presented. Brief descriptions of the most commonly...

  11. Removal of basic dye methylene blue by using bioabsorbents Ulva ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... dye was obtained by using biosorbents. Key words: Methylene blue, adsorption, Ulva, Sargassum, alumina, biosorbents. INTRODUCTION. Dyes are widely use in textile, paper, plastic, food and cosmetic industries. The wastes coming from these in- dustries can effect on our atmosphere causing pollution.

  12. Development of blue rose; Aoi bara wa sakuka

    Energy Technology Data Exchange (ETDEWEB)

    Kondo, T. [Nagoya University, Nagoya (Japan); Yoshida, K.

    1998-06-01

    Precise crystalline structures of pigments in petals have been elucidated by structural analysis of the blue pigment in Commelinaceae petals using X-ray analysis. It is found that the Mg ion is coordinated with the oxygen atom on the B-nucleus in the base nucleus of delphinidin (belonging to anthocyanidine, a pigment obtained by separating sugar from anthocyanin by hydrolysis) to develop a blue color, and that the complex is a stable supermolecule in which 6 pigment molecules are associated regularly with 6 flavone molecules. The similar mechanisms are responsible for development of blue color for flowers, and widely occurring in nature. Biosynthesis of anthocyanin, beginning with phenylalanine, undergoes virtually common processes; cyclization of the flavonoide skeleton, reduction to the anthocyanidine nucleus, hydroxylation of the B-nucleus in the base nucleus and glycoside formation at the 3-site. It will be possible to shift rose color to blue, if anthocyanin belonging to anthocyanidine could be bio-synthesized by introducing the gene of enzyme for 3`, 5`-hydroxylation on the base nucleus, which the rose lacks. 4 refs., 4 figs.

  13. Vegetation Change in Blue Oak Woodlands in California

    Science.gov (United States)

    Barbara A. Holzman; Barbara H. Allen-Diaz

    1991-01-01

    A preliminary report of a statewide project investigating vegetation change in blue oak (Quercus douglasii) woodlands in California is presented. Vegetation plots taken in the 1930s, as part of a statewide vegetation mapping project, were relocated and surveyed. Species composition, cover and tree stand structure data from the earlier study were...

  14. Compact collimators for high brightness blue LEDs using dielectric multilayers

    NARCIS (Netherlands)

    Cornelissen, H.J.; Ma, H.; Ho, C.; Li, M.; Mu, C.

    2011-01-01

    A novel method is presented to inject the light of millimeter-sized high-brightness blue LEDs into light guides of submillimeter thickness. Use is made of an interference filter that is designed to pass only those modes that will propagate in the light guide by total internal reflection. Other modes

  15. Blue Ice Tephra II - Brimstone Peak, Version 1

    Data.gov (United States)

    National Aeronautics and Space Administration — This data set is the result of a study of volcanic ash and rock fragment (tephra) layers in exposed blue ice areas on Brimstone Peak (75.888S 158.55E) in East...

  16. Blue Light Delays Commitment to Cell Division in Chlamydomonas Reinhardtii

    Czech Academy of Sciences Publication Activity Database

    Oldenhof, H.; Zachleder, Vilém; van den Ende, H.

    2004-01-01

    Roč. 6, - (2004), s. 689-695 ISSN 1435-8603 Institutional research plan: CEZ:AV0Z5020903 Keywords : Blue light * Cell cycle * Cell volume Subject RIV: EE - Microbiology, Virology Impact factor: 1.582, year: 2004

  17. Decolourisation and degradation of reactive blue 2 by sulphate ...

    African Journals Online (AJOL)

    This work was performed to determine the influence of heat treatment on sewage sludge and addition of zero valent iron (ZVI) on the degradation and decolourisation of an anthraquinone dye, reactive blue 2 (RB 2). A consortium of sulphate reducing bacteria (SRB) in a biosulphidogenic batch reactor with biodigester ...

  18. Organic/Inorganic Complex Pigments: Ancient Colors Maya Blue

    Energy Technology Data Exchange (ETDEWEB)

    Polette-Niewold, L.A.; Manciu, F.S.; Torres, B.; Alvarado, M.; Jr.; Chianelli, R.R.

    2009-06-04

    Maya Blue is an ancient blue pigment composed of palygorskite clay and indigo. It was used by the ancient Maya and provides a dramatic background for some of the most impressive murals throughout Mesoamerica. Despite exposure to acids, alkalis, and chemical solvents, the color of the Maya Blue pigment remains unaltered. The chemical interaction between palygorskite and indigo form an organic/inorganic complex with the carbonyl oxygen of the indigo bound to a surface Al{sup 3+} in the Si-O lattice. In addition indigo will undergo an oxidation to dehydroindigo during preparation. The dehydro-indigo molecule forms a similar but stronger complex with the Al{sup 3+}. Thus, Maya Blue varies in color due to the mixed indigo/dehydroindigo complex. The above conclusions are the result of application of multiple techniques (X-ray diffraction, differential thermal analysis/thermal gravimetric analysis, high resolution transmission electron microscopy, scanning electron microscopy, infrared and Raman spectroscopy) to the characterization of the organic/inorganic complex. A picture of the bonding of the organic molecule to the palygorskite surface forming a surface complex is developed and supported by the results of density functional theory calculations. We also report that other organic molecules such as thioindigo form similar organic/inorganic complexes thus, opening an entirely new class of complex materials for future applications.

  19. INTERACTION MODE BETWEEN METHYLENE BLUE-Sm(III ...

    African Journals Online (AJOL)

    Preferred Customer

    ABSTRACT. Spectroscopic and viscosity methods were applied to investigate the interaction between methylene blue (MB)-Sm(III) complex and herring sperm DNA by using acridine orange as a spectral probe in Tris-HCl buffer (pH 7.40). By means of molar ratio method, the binding ratios between MB-Sm(III) and DNA ...

  20. Age, growth and reproductive biology of the blue shark Prionace ...

    African Journals Online (AJOL)

    The age, growth and reproductive biology of the blue shark Prionace glauca from South African waters were assessed using 205 specimens, ranging in total length (TL) from 72 to 313 cm. Greater number of males (120) than females (85) were examined as they were more frequently caught. Age and growth parameters ...

  1. Current conservation status of the Blue Swallow Hirundo ...

    African Journals Online (AJOL)

    The overall probability of extinction of the species in the wild is 3%. Minimum viable population size analysis suggests that a goal for the long-term conservation of the Blue Swallow should be to mitigate current threats that are driving declines such that the population increases to a minimum of 3 600 individuals. This should ...

  2. The adsorption of methylene blue on montmorillonite from acid solutions

    Czech Academy of Sciences Publication Activity Database

    Klika, Z.; Pustková, P.; Dudová, M.; Čapková, P.; Kliková, Ch.; Matys Grygar, Tomáš

    2011-01-01

    Roč. 46, č. 3 (2011), s. 461-471 ISSN 0009-8558 Institutional research plan: CEZ:AV0Z40320502 Keywords : montmorillonite * dissolution * acid solutions * methylene blue * adsorption Subject RIV: DD - Geochemistry Impact factor: 1.053, year: 2011

  3. Kinetics and Mechanism of the Oxidation of Coomassie Brilliant Blue ...

    African Journals Online (AJOL)

    NICOLAAS

    Kinetics and Mechanism of the Oxidation of Coomassie Brilliant Blue-R dye by Hypochlorite and Role of Acid there in. Srinivasu Nadupalli, Venkata D.B.C. Dasireddy, Neil A. Koorbanally and Sreekantha B. Jonnalagadda*. School of Chemistry and Physics, University of KwaZulu-Natal, Westville Campus, Private.

  4. Is this Red Spot the Blue Spot (locus ceruleum)?

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Won Sick; Lee, Yu Kyung; Lee, Min Kyung; Hwang, Kyung Hoon [Gachon University Gil Hospital, Incheon (Korea, Republic of)

    2010-06-15

    The authors report brain images of 18F-FDG-PET in a case of schizophrenia. The images showed strikingly increased bilateral uptake in the locus ceruleum. The locus ceruleum is called the blue spot and known to be a center of the norepinephrinergic system.

  5. Frustration and curvature - Glasses and the cholesteric blue phase

    Science.gov (United States)

    Sethna, J. P.

    1983-01-01

    An analogy is drawn between continuum elastic theories of the blue phase of cholesteric liquid crystals and recent theories of frustration in configurational glasses. Both involve the introduction of a lattice of disclination lines to relieve frustration; the frustration is due to an intrinsic curvature in the natural form of parallel transport. A continuum theory of configurational glasses is proposed.

  6. Integrated mangrove-shrimp cultivation: Potential for blue carbon sequestration.

    Science.gov (United States)

    Ahmed, Nesar; Thompson, Shirley; Glaser, Marion

    2018-05-01

    Globally, shrimp farming has had devastating effects on mangrove forests. However, mangroves are the most carbon-rich forests, with blue carbon (i.e., carbon in coastal and marine ecosystems) emissions seriously augmented due to devastating effects on mangrove forests. Nevertheless, integrated mangrove-shrimp cultivation has emerged as a part of the potential solution to blue carbon emissions. Integrated mangrove-shrimp farming is also known as organic aquaculture if deforested mangrove area does not exceed 50% of the total farm area. Mangrove destruction is not permitted in organic aquaculture and the former mangrove area in parts of the shrimp farm shall be reforested to at least 50% during a period of maximum 5 years according to Naturland organic aquaculture standards. This article reviews integrated mangrove-shrimp cultivation that can help to sequester blue carbon through mangrove restoration, which can be an option for climate change mitigation. However, the adoption of integrated mangrove-shrimp cultivation could face several challenges that need to be addressed in order to realize substantial benefits from blue carbon sequestration.

  7. Removal of indigo blue using clinoptilolite-Fe

    International Nuclear Information System (INIS)

    Gutierrez S, E. E.; Colin C, A.; Solache R, M. J.

    2008-01-01

    The removal of indigo blue from aqueous solutions was evaluated using modified clinoptilolite with Fe (Z-Fe) which was characterized by SEM, EDS analysis and specific area (BET). The process followed the kinetics of pseudo-second order and Langmuir isotherm. Sorption capacity obtained was 18 mg g -1 and a solid-liquid ratio 10 g L -1 . (Author)

  8. Blue Ocean versus Competitive Strategy: Theory and Evidence

    NARCIS (Netherlands)

    A.E. Burke (Andrew); A.J. van Stel (André); A.R. Thurik (Roy)

    2009-01-01

    textabstractBlue ocean strategy seeks to turn strategic management on its head by replacing ‘competitive advantage’ with ‘value innovation’ as the primary goal where firms must create consumer demand and exploit untapped markets. Empirical analysis has been focused on case study evidence and so

  9. MANAJEMEN PENDIDIKAN TINGGI ISLAM DALAM SPEKTRUM BLUE OCEAN STRATEGY

    Directory of Open Access Journals (Sweden)

    Mardia Mardia

    2011-06-01

    Full Text Available Abstract: The Islamic higher educations are undergoing important changes involving the development of missions and reorganization of management, with implications for their quality education in the midst of complexity. The main study of this article highlights the importance of governance quality in Islamic higher education in the face of complexity from the perspective of Blue Ocean Strategy. It can be concluded that to win in the future, Islamic higher educations must stop competing each other. The only way to beat the competition is to stop trying to beat the competition. Blue Ocean Strategy to be one of the alternatives in the management of educational institutions to create distinctive adavantage and competitiveness based graduates. Abstrak:  Pendidikan tinggi Islam mengalami perubahan signifikan pada pengembangan misi dan reorganisasi manajemen yang mempengaruhi kualitas pendidikan di era kompleksitas. Kompleksitas tersebut tidak dapat diprediksi dan mempengaruhi munculnya gejala disorientasi nilai, disharmoni sosial, dan peran disfungsional. Pokok kajian tulisan ini menyorot pentingnya tatakelola pendidikan tinggi Islam bermutu dalam perspektif Blue Ocean Strategy dalam menghadapi kompleksitas. Pendekatan yang digunakan adalah analisis deskriptif teoritis dan praktis. Temuan penelitian adalah untuk berdaya saing di masa depan, pendidikan tinggi Islam harus berhenti bersaing satu sama lain. Satu-satunya cara untuk mengalahkan kompetisi adalah berhenti berusaha memenangi kompetisi. Blue Ocean Strategy menjadi salah satu alternatif dalam pengelolaan lembaga pendidikan dalam mencetak lulusan yang kompetitif dan unggul.

  10. Cloning and expression analysis of a blue copper- binding protein ...

    African Journals Online (AJOL)

    Jane

    2011-07-20

    Jul 20, 2011 ... Full Length Research Paper. Cloning and expression analysis of a blue copper- binding protein gene from Dasypyrum Villosum. Huagang He1*, Shanying Zhu1, Wenbing Wang1, Tongde Bie2 and Peidu Chen3. 1Jiangsu University. Zhenjiang 212013, P. R. China. 2Yangzhou Academy of Agricultural ...

  11. A House Divided? The Psychology of Red and Blue America

    Science.gov (United States)

    Seyle, D. Conor; Newman, Matthew L.

    2006-01-01

    Recently it has become commonplace in America for commentators and the public to use the terms "red" and "blue" to refer to perceived cultural differences in America and American politics. Although a political divide may exist in America today, these particular terms are inaccurate and reductive. This article presents research from social…

  12. Interaction mode between methylene blue-Sm(III) complex and ...

    African Journals Online (AJOL)

    Spectroscopic and viscosity methods were applied to investigate the interaction between methylene blue (MB)-Sm(III) complex and herring sperm DNA by using acridine orange as a spectral probe in Tris-HCl buffer (pH 7.40). By means of molar ratio method, the binding ratios between MB-Sm(III)and DNA were determined ...

  13. Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties

    Directory of Open Access Journals (Sweden)

    Guang Zhang

    2016-10-01

    Full Text Available Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer (D1 manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one (D2 displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1, in a three-layer organic light emitting diode (OLED by solution processing gave a pure blue emission with Commission Internationale de l’Éclairage 1931 CIE xy = (0.16, 0.12, a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m2. This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

  14. Growth comparison of Nile tilapia (Oreochromis niloticus) and Blue ...

    African Journals Online (AJOL)

    Administrator

    2011-09-26

    Sep 26, 2011 ... This study was conducted to compare and evaluate the productive performance characteristics of the base generation (F0) of Nile tilapia, Oreochromis niloticus and Blue tilapia, Oreochromis aureus under the effect of interspecific hybridization and genetically modified breeding by introducing a fragmented.

  15. Attempted kleptoparasitism of osprey by great blue herons

    Science.gov (United States)

    John R. Squires

    1998-01-01

    Two attempts of kleptoparisitism of Ospreys (Pandion haliaetus) by Great Blue Herons (Ardea herodias) were observed in Grand Teton National Park, Wyoming. Two herons vocalized and bill thrusted at Ospreys as they emerged from the water following dives for fish. Although both attempts were unsuccessful (the Ospreys failed to capture a fish), the intensity of...

  16. Does Blue Uniform Color Enhance Winning Probability in Judo Contests?

    NARCIS (Netherlands)

    Dijkstra, P.D.; Preenen, P.T.Y.; Essen, H. van

    2018-01-01

    The color of an athlete's uniform may have an effect on psychological functioning and consequently bias the chances of winning contests in sport competition. Several studies reported a winning bias for judo athletes wearing a blue outfit relative to those wearing a white outfit. However, we argue

  17. Blue laser diode (LD) and light emitting diode (LED) applications

    International Nuclear Information System (INIS)

    Bergh, Arpad A.

    2004-01-01

    The family of blue LEDs, edge emitting and surface emitting lasers, enable a number of applications. Blue lasers are used in digital applications such as optical storage in high density DVDs. The resolution of the spot size and hence the storage density is diffraction limited and is inversely proportional to the square of the wavelength of the laser. Other applications include printing, optical scanners, and high-resolution photo-lithography. As light emitters, blue LEDs are used for signaling and in direct view large area emissive displays. They are also making inroads into signage and LCD back-lighting, mobile platforms, and decorative accent lighting in curtains, furniture, etc. Blue LEDs produce white light either with phosphor wavelength converters or in combination with red and green LEDs. The full potential of LED light sources will require three devices to enable complete control over color and intensity. Sensing and medical/bio applications have a major impact on home security, on monitoring the environment, and on health care. New emerging diagnostic and therapeutic applications will improve the quality and reduce the cost of health care. (copyright 2004 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  18. Sorption characteristics of methylene blue onto Nypa fruiticans lignin ...

    African Journals Online (AJOL)

    The sorption characteristics of soda lignin extracted from Nypa fruiticans for the removal of methylene blue dye from aqueous solution was investigated in this study, as an ethically sound way of utilizing this unexploited abundant natural resource. Equilibrium data were fitted to the Langmuir and Freundlich isotherm ...

  19. Symbiotic Blue Green Algae (Azolla): A Potential Bio fertilizer for ...

    African Journals Online (AJOL)

    Symbiotic Blue Green Algae (Azolla): A Potential Bio fertilizer for Paddy Rice Production in Fogera Plain, Northwestern Ethiopia. ... They were maintained and multiplied in plastic containers at Adet in a greenhouse and then inoculated into concrete tanks for testing their adaptability. Both strains were well adapted to Adet ...

  20. Underwater Wireless Optical Communication System Using Blue LEDs

    Science.gov (United States)

    Lin, Aobo; Tong, Zheng; Song, Yuhang; Kong, Meiwei; Xu, Jing

    2016-02-01

    We demonstrate a self-designed underwater wireless optical communication system using blue LEDs. The performance of the transmitter and receiver was experimentally investigated. Four different square wave signals (10 KHz, 100 KHz, 500 KHz and 1 MHz) were successfully transmitted via a short water channel at the first phase.

  1. Use of Aspergillus wentii for biosorption of methylene blue from ...

    African Journals Online (AJOL)

    In this study, Aspergillus wentii was used as a biosorbent for the adsorption of methylene blue from aqueous solution. The effects of contact time, initial dye concentration, solution pH and temperature on biosorption were investigated. The contact time required (that is, the equilibrium time) for maximum dye biosorption was ...

  2. Blue light (470 nm) effectively inhibits bacterial and fungal growth

    Science.gov (United States)

    The activity of blue light (470nm) alone on (1) bacterial viability, and (2) with a food grade photosensitizer on filamentous fungal viability, was studied. Suspensions of the bacteria Leuconostoc mesenteroides (LM), Bacillus atrophaeus (BA), and Pseudomonas aeruginosa (PA) were prepared and aliquo...

  3. Blue light does not impair wound healing in vitro.

    Science.gov (United States)

    Masson-Meyers, Daniela Santos; Bumah, Violet Vakunseh; Enwemeka, Chukuka Samuel

    2016-07-01

    Irradiation with red or near infrared light promotes tissue repair, while treatment with blue light is known to be antimicrobial. Consequently, it is thought that infected wounds could benefit more from combined blue and red/infrared light therapy; but there is a concern that blue light may slow healing. We investigated the effect of blue 470nm light on wound healing, in terms of wound closure, total protein and collagen synthesis, growth factor and cytokines expression, in an in vitro scratch wound model. Human dermal fibroblasts were cultured for 48h until confluent. Then a linear scratch wound was created and irradiated with 3, 5, 10 or 55J/cm(2). Control plates were not irradiated. Following 24h of incubation, cells were fixed and stained for migration and fluorescence analyses and the supernatant collected for quantification of total protein, hydroxyproline, bFGF, IL-6 and IL-10. The results showed that wound closure was similar for groups treated with 3, 5 and 10J/cm(2), with a slight improvement with the 5J/cm(2) dose, and slower closure with 55J/cm(2) pblue light at low fluence does not impair in vitro wound healing. The significant decrease in IL-6 suggests that 470nm light is anti-inflammatory. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Blue Ice Tephra II - Mt. DeWitt, Version 1

    Data.gov (United States)

    National Aeronautics and Space Administration — This data set is the result of a study of volcanic ash and rock fragment (tephra) layers in exposed blue ice areas on Mt. DeWitt, Antarctica (77.12 deg S, 159.51 deg...

  5. Power-Scalable Blue-Green Bessel Beams

    Science.gov (United States)

    2016-02-23

    building system to achieve emission at the desired blue colours , was, however, abandoned due to lack of funds relative to the original anticipated award...Chen, P. Steinvurzel, K. Rottwitt, S. Ramachandran, “High-energy Fiber Lasers at Non-traditional Colours , via Intermodal Nonlinearities,” CTu3M.6

  6. Sequential serotonin and noradrenalin associated processes involved in postpartum blues

    NARCIS (Netherlands)

    Doornbos, B.; Fekkes, D.; Tanke, M.A.; de Jonge, P.; Korf, J.

    2008-01-01

    Objective: We investigated whether postpartum blues was related to changes in parameters of noradrenergic and serotonergic functioning. Methods: From 26 healthy pregnant women blood was collected at the End of pregnancy and 5 days and 6 weeks postpartum. Serotonergic parameters were: platelet

  7. Using methylene blue for perioperative localization of the hydrocele ...

    African Journals Online (AJOL)

    Postoperatively, the child was observed for any bluish discoloration of the buccal and oral mucosa. Results. All the patients were boys with a median age of 5. Figure 1: Methylene blue is visible within the hydrocele sac. Figure 2: Easy identification and dissection of the hydrocele track. Figure 3: Almost complete dissection of ...

  8. ASPECTS OF THE BREEDING BIOLOGY OF BLUE BILLED ...

    African Journals Online (AJOL)

    Blue-billed Weaver dis- played a seven~month breeding season from March to September with a peak lying between April and July. The long breeding period showed the efficiency with which the species may have utilized different food resources and hence occupy broad feeding niches. The clutch size was between 1 to.

  9. Experiencing Cultural Geography in the Birthplace of the Blues

    Science.gov (United States)

    Strait, John

    2014-01-01

    Over time, fewer and fewer geography scholars have the opportunity to actually engage in fieldwork. This article summarizes a field experience shared by a group of geography faculty and students who traveled through the Mississippi Delta endeavoring to study the dynamic nature of the region's blues music and culture. This endeavor entailed the…

  10. Blue rubber bleb nevus syndrome coexisted with intestinal ...

    African Journals Online (AJOL)

    Blue Rubber Bleb Nevus Syndrome (BRBNS) is an uncommon congenital disorder characterized by sporadic venous malformation which mainly occurs in skin and alimentary canal. Here, we report a BRBNS patient with concomitant intestinal intussusception who diagnosed by intraoperative endoscopy and ultimately ...

  11. Blue reflectance in tarantulas is evolutionarily conserved despite nanostructural diversity

    Science.gov (United States)

    Hsiung, Bor-Kai; Deheyn, Dimitri D.; Shawkey, Matthew D.; Blackledge, Todd A.

    2015-01-01

    Slight shifts in arrangement within biological photonic nanostructures can produce large color differences, and sexual selection often leads to high color diversity in clades with structural colors. We use phylogenetic reconstruction, electron microscopy, spectrophotometry, and optical modeling to show an opposing pattern of nanostructural diversification accompanied by unusual conservation of blue color in tarantulas (Araneae: Theraphosidae). In contrast to other clades, blue coloration in phylogenetically distant tarantulas peaks within a narrow 20-nm region around 450 nm. Both quasi-ordered and multilayer nanostructures found in different tarantulas produce this blue color. Thus, even within monophyletic lineages, tarantulas have evolved strikingly similar blue coloration through divergent mechanisms. The poor color perception and lack of conspicuous display during courtship of tarantulas argue that these colors are not sexually selected. Therefore, our data contrast with sexual selection that typically produces a diverse array of colors with a single structural mechanism by showing that natural selection on structural color in tarantulas resulted in convergence on similar color through diverse structural mechanisms. PMID:26702433

  12. Movement patterns and survival estimates of Blue Cranes in the ...

    African Journals Online (AJOL)

    The Western Cape population of Blue Cranes Anthropoides paradiseus is the species' largest and most stable population. How this population utilises the agricultural landscape of the Western Cape, how far individuals disperse and the connectivity between subpopulations is unknown. Basic demographic parameters such ...

  13. Live weight and reproduction performance of Zimbabwean Blue and ...

    African Journals Online (AJOL)

    Data obtained from a pair-mated ostrich flock located at Oudtshoorn in South Africa were used to derive line differences for live weight and reproduction performance in sexually mature ostriches of the Zimbabwean Blue (ZB) and South African Black (SAB) strains during 2003 to 2006. At the commencement of breeding ZB ...

  14. 75 FR 67958 - Blue Ribbon Commission on America's Nuclear Future

    Science.gov (United States)

    2010-11-04

    ... DEPARTMENT OF ENERGY Blue Ribbon Commission on America's Nuclear Future AGENCY: Office of Nuclear...-4243 or facsimile (202) 586- 0544; e-mail [email protected]nuclear.energy.gov . Additional information... including alternatives for the storage, processing, and disposal of civilian and defense spent nuclear fuel...

  15. 76 FR 71334 - Blue Ribbon Commission on America's Nuclear Future

    Science.gov (United States)

    2011-11-17

    ... DEPARTMENT OF ENERGY Blue Ribbon Commission on America's Nuclear Future AGENCY: Office of Nuclear...: [email protected]nuclear.energy.gov . Additional information will be available at: http://www.brc.gov... disposal of civilian and defense spent nuclear fuel and nuclear waste. The Commission submitted its draft...

  16. 75 FR 36647 - Blue Ribbon Commission on America's Nuclear Future

    Science.gov (United States)

    2010-06-28

    ... DEPARTMENT OF ENERGY Blue Ribbon Commission on America's Nuclear Future AGENCY: Office of Nuclear...; telephone (202) 586-4243 or facsimile (202) 586- 0544; e-mail [email protected]nuclear.energy.gov . Additional..., processing, and disposal of civilian and defense spent nuclear fuel and nuclear waste. The Commission held...

  17. 76 FR 4646 - Blue Ribbon Commission on America's Nuclear Future

    Science.gov (United States)

    2011-01-26

    ... DEPARTMENT OF ENERGY Blue Ribbon Commission on America's Nuclear Future AGENCY: Department of Energy, Office of Nuclear Energy. ACTION: Notice of Closed Meeting. SUMMARY: This notice announces a... all alternatives for the storage, processing, and disposal of civilian and defense used nuclear fuel...

  18. Color dilution alopecia in a blue Doberman pinscher crossbreed

    OpenAIRE

    Perego, Roberta; Proverbio, Daniela; Roccabianca, Paola; Spada, Eva

    2009-01-01

    A 6-year-old male, blue Doberman pinscher crossbreed was presented with coat abnormalities; in particular, flank alopecia and pruritus. Based on medical the history, clinical evidence, and histopathological examination, color dilution alopecia was diagnosed. The dog was with oral melatonin treated for 3 months without success.

  19. Color dilution alopecia in a blue Doberman pinscher crossbreed.

    Science.gov (United States)

    Perego, Roberta; Proverbio, Daniela; Roccabianca, Paola; Spada, Eva

    2009-05-01

    A 6-year-old male, blue Doberman pinscher crossbreed was presented with coat abnormalities; in particular, flank alopecia and pruritus. Based on medical the history, clinical evidence, and histopathological examination, color dilution alopecia was diagnosed. The dog was with oral melatonin treated for 3 months without success.

  20. Reflection mode holographic recording in methylene blue-sensitized ...

    Indian Academy of Sciences (India)

    2014-02-13

    Feb 13, 2014 ... Abstract. Photopolymer systems can produce good image quality holograms that does not require any post-processing and are environmentally stable with good diffraction efficiency. The present work reports the development of a methylene blue-sensitized polyvinyl alcohol acrylamide. (MBPVA/AA) ...