WorldWideScience

Sample records for antimony 133

  1. Antimony Toxicity

    Directory of Open Access Journals (Sweden)

    Shyam Sundar

    2010-12-01

    Full Text Available Antimony toxicity occurs either due to occupational exposure or during therapy. Occupational exposure may cause respiratory irritation, pneumoconiosis, antimony spots on the skin and gastrointestinal symptoms. In addition antimony trioxide is possibly carcinogenic to humans. Improvements in working conditions have remarkably decreased the incidence of antimony toxicity in the workplace. As a therapeutic, antimony has been mostly used for the treatment of leishmaniasis and schistosomiasis. The major toxic side-effects of antimonials as a result of therapy are cardiotoxicity (~9% of patients and pancreatitis, which is seen commonly in HIV and visceral leishmaniasis co-infections. Quality control of each batch of drugs produced and regular monitoring for toxicity is required when antimonials are used therapeutically.

  2. Pentavalent Antimonials: New Perspectives for Old Drugs

    OpenAIRE

    Ribeiro, Raul R.; Cynthia Demicheli; Frédéric Frézard

    2009-01-01

    Pentavalent antimonials, including meglumine antimoniate and sodium stibogluconate, have been used for more than half a century in the therapy of the parasitic disease leishmaniasis. Even though antimonials are still the first-line drugs, they exhibit several limitations, including severe side effects, the need for daily parenteral administration and drug resistance. The molecular structure of antimonials, their metabolism and mechanism of action are still being investigated. Some recent stud...

  3. Pentavalent Antimonials: New Perspectives for Old Drugs

    Directory of Open Access Journals (Sweden)

    Raul R. Ribeiro

    2009-06-01

    Full Text Available Pentavalent antimonials, including meglumine antimoniate and sodium stibogluconate, have been used for more than half a century in the therapy of the parasitic disease leishmaniasis. Even though antimonials are still the first-line drugs, they exhibit several limitations, including severe side effects, the need for daily parenteral administration and drug resistance. The molecular structure of antimonials, their metabolism and mechanism of action are still being investigated. Some recent studies suggest that pentavalent antimony acts as a prodrug that is converted to active and more toxic trivalent antimony. Other works support the direct involvement of pentavalent antimony. Recent data suggest that the biomolecules, thiols and ribonucleosides, may mediate the actions of these drugs. This review will summarize the progress to date on the chemistry and biochemistry of pentavalent antimony. It will also present the most recent works being done to improve antimonial chemotherapy. These works include the development of simple synthetic methods for pentavalent antimonials, liposome-based formulations for targeting the Leishmania parasites responsible for visceral leishmaniasis and cyclodextrin-based formulations to promote the oral delivery of antimony.

  4. Antimony production by carbothermic reduction of stibnite in the presence of lime

    Directory of Open Access Journals (Sweden)

    Padilla R.

    2014-01-01

    Full Text Available Experimental work on the carbothermic reduction of Sb2S3 in the presence of lime was carried out in the temperature range of 973 to 1123 K to produce antimony in an environmentally friendly manner. The results demonstrated the technical feasibility of producing antimony by this method without producing SO2 gas. Complete conversion of Sb2S3 was obtained at 1023 K in about 1000 seconds and at 1123 K in less than 250 seconds using stibnite-carbon-lime mixtures with molar ratios Sb2S3:CaO:C = 1:3:3. It was found that the reduction proceeds through the formation of an intermediate oxide SbO2, which is subsequently reduced by CO(g to yield antimony metal and CaS. The kinetics of the Sb2S3 reduction was analyzed by using the equation ln(1-X = -kt. The activation energy was 233 kJ mol-1 in the temperature range of 973 to 1123 K. This value would correspond to an antimony catalyzed carbon oxidation by CO2.

  5. FIRST REPORT ON OTOTOXICITY OF MEGLUMINE ANTIMONIATE

    Directory of Open Access Journals (Sweden)

    Cláudia Maria Valete-Rosalino

    2014-09-01

    Full Text Available Introduction: Pentavalent antimonials are the first drug of choice in the treatment of tegumentary leishmaniasis. Data on ototoxicity related with such drugs is scarcely available in literature, leading us to develop a study on cochleovestibular functions. Case Report: A case of a tegumentary leishmaniasis patient, a 78-year-old man who presented a substantial increase in auditory threshold with tinnitus and severe rotatory dizziness during the treatment with meglumine antimoniate, is reported. These symptoms worsened in two weeks after treatment was interrupted. Conclusion: Dizziness and tinnitus had already been related to meglumine antimoniate. However, this is the first well documented case of cochlear-vestibular toxicity related to meglumine antimoniate.

  6. Preparation and properties of antimony thin film anode materials

    Institute of Scientific and Technical Information of China (English)

    SU Shufa; CAO Gaoshao; ZHAO Xinbing

    2004-01-01

    Metallic antimony thin films were deposited by magnetron sputtering and electrodeposition. Electrochemical properties of the thin film as anode materials for lithium-ion batteries were investigated and compared with those of antimony powder. It was found that both magnetron sputtering and electrodeposition are easily controllable processes to deposit antimony films with fiat charge/discharge potential plateaus. The electrochemical performances of antimony thin films, especially those prepared with magnetron sputtering, are better than those of antimony powder. The reversible capacities of the magnetron sputtered antimony thin film are above 400 mA h g-1 in the first 15 cycles.

  7. 21 CFR 862.3110 - Antimony test system.

    Science.gov (United States)

    2010-04-01

    ... antimony, a heavy metal, in urine, blood, vomitus, and stomach contents. Measurements obtained by this device are used in the diagnosis and treatment of antimony poisoning. (b) Classification. Class I....

  8. Anthropogenic impacts on the biogeochemistry and cycling of antimony.

    Science.gov (United States)

    Shotyk, William; Krachler, Michael; Chen, Bin

    2005-01-01

    Antimony is a potentially toxic trace element with no known biological function. Antimony is commonly enriched in coals, and fossil fuel combustion appears to be the largest single source of anthropogenic Sb to the global atmosphere. Abundant in sulfide minerals, its emission to the atmosphere from anthropogenic activities is linked to the mining and metallurgy of non-ferrous metals, especially Pb, Cu, and Zn. In particular, the geochemical and mineralogical association of Sb with Pb minerals implies that, like Pb, Sb has been emitted to the environment for thousands of years because of Pb mining, smelting, and refining. In the US alone, there are more than 400 former secondary lead smelting operations and worldwide there are 133 Pb-Zn smelters in operation today. Antimony is used in creating and improving dozens of industrial and commercial materials including various alloys, ceramics, glasses, plastics, and synthetic fabrics, making waste incineration another important source of Sb to the environment. Enrichments of Sb in atmospheric aerosols, plants, soils, sediments, as well as alpine and polar snow and ice suggest that Sb contamination is extensive, but there are very few quantitative studies of the geographic extent, intensity, and chronology of this contamination. There is an urgent need to quantify the extent of human impacts and how these have changed with time. The decreasing inventories of anthropogenic Sb with time in peat cores from Switzerland and Scotland suggest that the atmospheric Sb flux may be declining, but there have been too few studies to make any general conclusions. In fact, some studies of sediments and biomonitors in central Europe show little decline in Sb concentrations during the past decades. There is an obvious need for reliable data from well dated archives such as polar snow and ice, peat bogs, and sediments. The air concentrations, extent of enrichment, particle size distribution, and rate of deposition of Sb in urban areas is

  9. Perspectives of antimony compounds in oncology

    Institute of Scientific and Technical Information of China (English)

    Pankaj SHARMA; Diego PEREZ; Armando CABRERA; Nee ROSAS; Jose Luis ARIAS

    2008-01-01

    Antimony, a natural element that has been used as a drug for over more than 100 years, has remarkable therapeutic efficacy in patients with acute promyelocytic leukemia. This review focuses on recent advances in developing antimony anti- cancer agents with an emphasis on antimony coordination complexes, Sb (Ⅲ) and Sb (V). These complexes, which include many organometallic complexes, may provide a broader spectrum of antitumoral activity. They were compared with classical platinum anticancer drugs. The review covers the literature data pub- lished up to 2007. A number of antimonials with different antitumoral activities are known and have diverse applications, even though little research has been done on their possibilities. It might be feasible to develop more specific and effective inhibitors for phosphatase-targeted, anticancer therapeutics through the screen- ing of sodium stibogluconate (SSG) and potassium antimonyltartrate-related compounds, which are comprised of antimony conjugated to different organic moieties. For example, SSG appears to be a better inhibitor than suramin which is a compound known for its antineoplastic activity against several types of cancers.

  10. Infrared surface polaritons on antimony.

    Science.gov (United States)

    Cleary, Justin W; Medhi, Gautam; Shahzad, Monas; Rezadad, Imen; Maukonen, Doug; Peale, Robert E; Boreman, Glenn D; Wentzell, Sandy; Buchwald, Walter R

    2012-01-30

    The semimetal antimony, with a plasma frequency ~80 times less than that of gold, is potentially useful as a host for infrared surface polaritons (SPs). Relevant IR SP properties, including the frequency-dependent propagation length and penetration depths for fields into the media on either side of the interface, were determined from optical constants measured on optically-thick thermally-evaporated Sb films over the wavelength range 1 to 40 μm. Plasma and carrier relaxation frequencies were determined from Drude-model fits to these data. The real part of the permittivity is negative for wavelengths beyond 11 μm. Distinct resonant decreases in specular reflected intensity were observed for Sb lamellar gratings in the wavelength range of 6 to 11 μm, where the real part of the permittivity is positive. Both resonance angles and the angular reflectance spectral line shapes are in agreement with theory for excitation of bound surface electromagnetic waves (SPs). Finite element method (FEM) electrodynamic simulations indicate the existence of SP modes under conditions matching the experiments. FEM results also show that such waves depend on having a significant imaginary part of the permittivity, as has been noted earlier for the case of surface exciton polaritons.

  11. Synthesis and application of antimony pent(isooctyl thioglycollate)

    Institute of Scientific and Technical Information of China (English)

    LIU You-nian; LI Hong-bing; SHU Wan-gen; CHEN Qi-yuan

    2005-01-01

    A new type of thermal stabilizer, antimony pent(isooctyl thioglycollate)(Sb(SCH2COOC8H17)5), was synthesized by using antimony trioxide, isooctanol and thioglycolic acid in 2 steps. Firstly, antimony trioxide was oxidized into colloidal antimony peroxide. Then antimony peroxide and isooctyl thioglycollate reacted stoichiometrically for 2 h with the yield of 87%. This compound was used as thermal stabilizer for polyvinyl chloride(PVC). The results show that the thermal stability time is 52 min at 200 ℃ by heat-ageing oven test when adding 2.5% thermal stabilizer to PVC resin. Compared with antimony tris(isooctyl thiolycollate), the initial thermal stability of antimony pent(isooctyl thioglycollate) is better than that of antimony tris(isooctyl thioglycollate), while the long-term thermal stability time is shorter than that of antimony tris(isooctyl thioglycollate). Meanwhile, the synergism of antimony pent(isooctyl thioglycollate) with calcium stearate was studied, indicating that when the mass ratio of antimony pent(isooctyl thioglycollate) to calcium stearate is 2:1, the thermal stability time of PVC is 58 min.

  12. Vacuum Evaporation Technology for Treating Antimony-Rich Anode Slime

    Science.gov (United States)

    Qiu, Keqiang; Lin, Deqiang; Yang, Xuelin

    2012-11-01

    A vacuum evaporation technology for treating antimony-rich anode slime was developed in this work. Experiments were carried out at temperatures from 873 K to 1073 K and residual gas pressures from 50 Pa to 600 Pa. During vacuum evaporation, silver from the antimony-rich anode slime was left behind in the distilland in a silver alloy containing antimony and lead, and antimony trioxide was evaporated. The experimental results showed that 92% by weight of antimony can be removed, and the silver content in the alloy was up to 12.84%. The antimony trioxide content in the distillate was more than 99.7%, and the distillate can be used directly as zero-grade antimony trioxide (China standard).

  13. Microbial antimony biogeochemistry: Enzymes, regulation, and related metabolic pathways

    Science.gov (United States)

    Li, Jingxin; Qian Wang,; Oremland, Ronald S.; Kulp, Thomas R.; Rensing, Christopher; Wang, Gejiao

    2016-01-01

    Antimony (Sb) is a toxic metalloid that occurs widely at trace concentrations in soil, aquatic systems, and the atmosphere. Nowadays, with the development of its new industrial applications and the corresponding expansion of antimony mining activities, the phenomenon of antimony pollution has become an increasingly serious concern. In recent years, research interest in Sb has been growing and reflects a fundamental scientific concern regarding Sb in the environment. In this review, we summarize the recent research on bacterial antimony transformations, especially those regarding antimony uptake, efflux, antimonite oxidation, and antimonate reduction. We conclude that our current understanding of antimony biochemistry and biogeochemistry is roughly equivalent to where that of arsenic was some 20 years ago. This portends the possibility of future discoveries with regard to the ability of microorganisms to conserve energy for their growth from antimony redox reactions and the isolation of new species of “antimonotrophs.”

  14. Arsenic and antimony transporters in eukaryotes.

    Science.gov (United States)

    Maciaszczyk-Dziubinska, Ewa; Wawrzycka, Donata; Wysocki, Robert

    2012-01-01

    Arsenic and antimony are toxic metalloids, naturally present in the environment and all organisms have developed pathways for their detoxification. The most effective metalloid tolerance systems in eukaryotes include downregulation of metalloid uptake, efflux out of the cell, and complexation with phytochelatin or glutathione followed by sequestration into the vacuole. Understanding of arsenic and antimony transport system is of high importance due to the increasing usage of arsenic-based drugs in the treatment of certain types of cancer and diseases caused by protozoan parasites as well as for the development of bio- and phytoremediation strategies for metalloid polluted areas. However, in contrast to prokaryotes, the knowledge about specific transporters of arsenic and antimony and the mechanisms of metalloid transport in eukaryotes has been very limited for a long time. Here, we review the recent advances in understanding of arsenic and antimony transport pathways in eukaryotes, including a dual role of aquaglyceroporins in uptake and efflux of metalloids, elucidation of arsenic transport mechanism by the yeast Acr3 transporter and its role in arsenic hyperaccumulation in ferns, identification of vacuolar transporters of arsenic-phytochelatin complexes in plants and forms of arsenic substrates recognized by mammalian ABC transporters.

  15. In vitro antileishmanial properties of neutron-irradiated meglumine antimoniate

    Energy Technology Data Exchange (ETDEWEB)

    Borborema, Samanta Etel Treiger; Nascimento, Nanci do [Instituto de Pesquisas Energeticas e Nucleares (IPEN-CNEN/SP), SP (Brazil). Lab. de Biologia Molecular]. E-mail: samanta@usp.br; Osso Junior, Joao Alberto [Instituto de Pesquisas Energeticas e Nucleares (IPEN-CNEN/SP), SP (Brazil). Centro de Radiofarmacia]. E-mail: jaosso@ipen.br; Andrade Junior, Heitor Franco de [Instituto de Medicina Tropical de Sao Paulo (IMT-SP), SP (Brazil). Lab. de Protozoologia]. E-mail:hfandrad@usp.br

    2005-10-15

    Pentavalent antimony, as meglumine antimoniate (Glucantime) or sodium stibogluconate (Pentostam), is the main treatment for leishmaniasis, a complex of diseases caused by the protozoan Leishmania, and an endemic and neglected threat in Brazil. Despite over half a century of clinical use, their mechanism of action, toxicity and pharmacokinetic data remain unknown. The analytical methods for determination of antimony in biological systems remain complex and have low sensitivity. Radiotracer studies have a potential in pharmaceutical development. The aim of this study was to obtain a radiotracer for antimony, with suitable physical and biological properties. Meglumine antimoniate was neutron irradiated inside the IEA-R1 nuclear reactor, producing two radioisotopes {sup 122} Sb and {sup 124} Sb, with high radionuclidic purity and good specific activity. This compound showed the same antileishmanial activity as the native compound. The use of the radiotracers, easily created by neutron irradiation, could be an interesting tool to solve important questions in antimonial pharmacology. (author)

  16. In Vitro antileishmanial properties of neutron-irradiated meglumine antimoniate

    OpenAIRE

    Samanta Etel Treiger Borborema; Heitor Franco de Andrade Junior; João Alberto Osso Junior; Nanci do Nascimento

    2005-01-01

    Pentavalent antimony, as meglumine antimoniate (Glucantime® ) or sodium stibogluconate (Pentostam® ), is the main treatment for leishmaniasis, a complex of diseases caused by the protozoan Leishmania, and an endemic and neglected threat in Brazil. Despite over half a century of clinical use, their mechanism of action, toxicity and pharmacokinetic data remain unknown. The analytical methods for determination of antimony in biological systems remain complex and have low sensitivity. Radiotracer...

  17. Pharmacokinetic of antimony in mice with cutaneous Leishmaniasis

    Energy Technology Data Exchange (ETDEWEB)

    Borborema, Samanta E.T.; Nascimento, Nanci do [Instituto de Pesquisas Energeticas e Nucleares IPEN/CNEN-SP, Sao Paulo, SP (Brazil). Lab. de Biologia Molecular]. E-mails: samanta@usp.br; nnascime@ipen.br; Andrade Junior, Heitor F. de [Instituto de Pesquisas Energeticas e Nucleares IPEN/CNEN-SP, Sao Paulo, SP (Brazil). Lab. de Biologia Molecular; Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: hfandrad@usp.br; Osso Junior, Joao A. [Instituto de Pesquisas Energeticas e Nucleares IPEN/CNEN-SP, Sao Paulo, SP (Brazil). Centro de Radiofarmacia]. E-mail: jaosso@ipen.br

    2007-07-01

    Cutaneous Leishmaniasis (CL) remains a major world health problem, with about 1.5 million new cases each year. Caused by protozoa Leishmania, in South America, this infection can vary from a chronic skin ulcer, to an erosive mucosal disease and severe facial disfigurement. Pentavalent antimony (Sb{sup +5}) as sodium stibogluconate (Pentostam) or meglumine antimoniate (Glucantime) are main drugs for treating most forms of human leishmaniasis. For six decades, despite the recent developments, the effective therapy to cutaneous leishmaniasis has been based on long parenteral courses of such drugs, even though these are fairly costly, toxic and inconvenient to use, without adequate knowledge on their pharmacokinetics or mechanism of action. Pharmacokinetics studies could be based on bioactive traceable drugs, usually with radioactive isotopes, but antimony radioisotopes are unavailable commercially. Neutron irradiation is a powerful tool in the analysis of mineral content of samples, for antimony, there are at least two main isotopes that could be formed after neutron irradiation in nuclear reactor. The aim of the present study was to construct antimony salts with those radioisotopes to obtain tracers to compare the pharmacokinetic and the tissue distribution of neutron irradiated meglumine antimoniate in healthy and cutaneous leishmaniasis experimentally infected mice. Meglumine antimoniate, (Glucantime, Aventis, S.P, Brazil), was neutron irradiated inside the IEA-R1 nuclear reactor (IPEN/CNEN-SP), producing two radioisotopes {sup 122}Sb and {sup 124}Sb. Its biodistribution was verified in BALB/c mice experimentally infected with Leishmania (Leishmania) Amazonensis, which received a single intraperitoneal dose of the drug. At different times after injection, the tissues and blood were excised and activity measured in a NaI (Tl) scintillation counter. Compared with the healthy mice, experimentally infected mice had significantly lower maximum concentration of antimony

  18. Separation of traffic related antimony compounds

    International Nuclear Information System (INIS)

    Complete text of publication follows. It is known that most of the brake pads contain Sb2S3 as lubricant to achieve better friction stability. Due to braking the brake lining crumbles away and its Sb content gets into the air. As a result of the temperature increase accompanying the braking a part of the antimony may oxidize to oxides, as Sb2O3 or even to the more stable form, Sb2O4. Since Sb2O3 more readily soluble than the others, its absorption from the lung so its environmental impact effect is more harmful. After a systematic investigation involving solubilization of the solid compounds, citric and tartaric acid as well as 6 mol/dm3 HCl were tested for leaching of trace antimony compounds from natural matrix. To prepare reference material related to these species, soil and activated charcoal was spiked in 10 μg/g concentration with all the three material (Sb2S3, Sb2O3,Sb2O4). separately. Recovery of the different forms was checked by graphite furnace atomic absorption spectrometric (GFAAS) analysis of the leachates. The soil was confirmed to oxidize the sulfide content while the activated charcoal was established to enrich antimony from HCl solution as ion association complex. It was concluded, that Sb2S3 is leached only in slight amount in 4 hours by 0.1-0.5 mol/dm3 citric acid, while leaching of Sb2O3 is quantitative. On the other side, it was proved that Sb2O3 as well as Sb2S3 traces are soluble in 6 HCl solution in 60 min, whilst Sb2O4 is not destroyed. So, the Sb2O3 and Sb2S3 content of a flying dust can be determined. The GFAAS temperature program had to be modified in order to be capable to analyze high organic matrix as citric or tartaric acid even in 0.5 mol/dm3 concentration. Concerning their decomposition temperature an additional step was inserted into the temperature program, pyrolysis on 300 and 400 deg C, respectively. The antimony concentration of the highly acidic leachates were determined by hydride generation GFAAS. The reproducibility of

  19. Selective determination of antimony(III) and antimony(V) with ammonium pyrrolidinedithiocarbamate, sodium diethyldithiocarbamate and dithizone by atomic-absorption spectrometry with a carbon-tube atomizer.

    Science.gov (United States)

    Kamada, T; Yamamoto, Y

    1977-05-01

    The extraction behaviour of antimony(III) and antimony(V) with ammonium pyrrolidinedithiocarbamate, sodium diethyldithiocarbamate and dithizone in organic solvents has been investigated by means of frameless atomic-absorption spectrophotometry with a carbon-tube atomizer. The selective extraction of antimony(III) and differential determination of antimony(III) and antimony(V) have been developed. With ammonium pyrrolidinedithiocarbamate and methyl isobutyl ketone, when the aqueous phase/solvent volume ratio is 50 ml/10 ml and the injection volume in the carbon tube is 20 mul, the sensitivity for antimony is 0.2 ng/ml for 1% absorption. The relative standard deviations are ca. 2%. Interferences by many metal ions can be prevented by masking with EDTA. The proposed methods have been applied satisfactorily to determination of antimony(III) and antimony(V) in various types of water. PMID:18962096

  20. Structural and electrical characterization of zinc oxide doped with antimony

    Directory of Open Access Journals (Sweden)

    G. Juárez Díaz

    2014-08-01

    Full Text Available In this work we report the results of structural and electrical characterization realized on zinc oxide single crystal samples with (001 orientation, which were doped with antimony. Doping was carried out by antimony thermal diffusion at 1000 °C for periods of 1 and 2 hours under nitrogen environment from a solid source formed by antimony oxide. Electrical characterization by I-V curves and Hall effect shown an increase in acceptor concentration which demonstrates that doping is effective and create holes in zinc oxide samples.

  1. Deposition of rod-shaped antimony sulfide thin films from single-source antimony thiosemicarbazone precursors

    Energy Technology Data Exchange (ETDEWEB)

    Biswal, Jasmine B.; Sawant, Narayan V. [Department of Chemistry, University of Mumbai, Vidyanagari, Santacruz (East), Mumbai - 400 098 (India); Garje, Shivram S., E-mail: ssgarje@chem.mu.ac.i [Department of Chemistry, University of Mumbai, Vidyanagari, Santacruz (East), Mumbai - 400 098 (India)

    2010-04-02

    Antimony sulfide thin films were deposited on glass substrates by aerosol assisted chemical vapour deposition technique using single source precursors, namely, antimony(III) thiosemicarbazones, SbCl{sub 3}(L) (L = thiosemicarbazones of thiophene-2-carboxaldehyde (1) and cinnamaldehyde (2)). The deposited films were characterized by X-ray diffraction, scanning electron microscopy, energy dispersive X-ray analysis and UV-visible spectroscopy in order to identify their phases, morphologies, compositions and optical properties respectively. These characterizations revealed that the films were comprised of rod-shaped particles of orthorhombic stibnite (Sb{sub 2}S{sub 3}) with a Sb:S stoichiometry of {approx} 1:1.3. The calculated optical band gap from UV-vis absorption spectrum is found to be 3.48 eV.

  2. Tissue distribution of residual antimony in rats treated with multiple doses of meglumine antimoniate

    Directory of Open Access Journals (Sweden)

    Deise Riba Coelho

    2014-07-01

    Full Text Available Meglumine antimoniate (MA and sodium stibogluconate are pentavalent antimony (SbV drugs used since the mid-1940s. Notwithstanding the fact that they are first-choice drugs for the treatment of leishmaniases, there are gaps in our knowledge of their toxicological profile, mode of action and kinetics. Little is known about the distribution of antimony in tissues after SbV administration. In this study, we evaluated the Sb content of tissues from male rats 24 h and three weeks after a 21-day course of treatment with MA (300 mg SbV/kg body wt/d, subcutaneous. Sb concentrations in the blood and organs were determined by inductively coupled plasma-mass spectrometry. In rats, as with in humans, the Sb blood levels after MA dosing can be described by a two-compartment model with a fast (t1/2 = 0.6 h and a slow (t1/2 >> 24 h elimination phase. The spleen was the organ that accumulated the highest amount of Sb, while bone and thyroid ranked second in descending order of tissues according to Sb levels (spleen >> bone, thyroid, kidneys > liver, epididymis, lungs, adrenals > prostate > thymus, pancreas, heart, small intestines > skeletal muscle, testes, stomach > brain. The pathophysiological consequences of Sb accumulation in the thyroid and Sb speciation in the liver, thyroid, spleen and bone warrant further studies.

  3. How can we adapt to geological scarcity of antimony? Investigation of antimony's substitutability and of other measures to achieve a sustainable use

    NARCIS (Netherlands)

    Henckens, M.L.C.M.; Driessen, P.P.J.; Worrell, E.

    2016-01-01

    Abstract Antimony is an element that is applied in many useful applications for mankind. However, antimony resources are very scarce, when comparing the current extraction rates with the availability of antimony containing ores. From an inter-temporal sustainability perspective, current generations

  4. Cloud point extraction combined with electrothermal atomic absorption spectrometry for the speciation of antimony(III) and antimony(V) in food packaging materials

    International Nuclear Information System (INIS)

    A simple, sensitive method for the speciation of inorganic antimony by cloud point extraction combined with electrothermal atomic absorption spectrometry (ETAAS) is presented and evaluated. The method based on the fact that formation of a hydrophobic complex of antimony(III) with ammonium pyrrolidine dithiocarbamate (APDC) at pH 5.0 and subsequently the hydrophobic complex enter into surfactant-rich phase, whereas antimony(V) remained in aqueous solutions. Antimony(III) in surfactant-rich phase was analyzed by ETAAS after dilution by 0.2 mL nitric acid in methanol (0.1 M), and antimony(V) was calculated by subtracting antimony(III) from the total antimony after reducing antimony(V) to antimony(III) by L-cysteine. The main factors affecting the cloud point extraction, such as pH, concentration of APDC and Triton X-114, equilibrium temperature and incubation time, sample volume were investigated in detail. Under the optimum conditions, the detection limit (3σ) of the proposed method was 0.02 ng mL-1 for antimony(III), and the relative standard deviation was 7.8% (c = 1.0 ng mL-1, n = 7). The proposed method was successfully applied to speciation of inorganic antimony in the leaching solutions of different food packaging materials with satisfactory results.

  5. Cloud point extraction combined with electrothermal atomic absorption spectrometry for the speciation of antimony(III) and antimony(V) in food packaging materials.

    Science.gov (United States)

    Jiang, Xiuming; Wen, Shengping; Xiang, Guoqiang

    2010-03-15

    A simple, sensitive method for the speciation of inorganic antimony by cloud point extraction combined with electrothermal atomic absorption spectrometry (ETAAS) is presented and evaluated. The method based on the fact that formation of a hydrophobic complex of antimony(III) with ammonium pyrrolidine dithiocarbamate (APDC) at pH 5.0 and subsequently the hydrophobic complex enter into surfactant-rich phase, whereas antimony(V) remained in aqueous solutions. Antimony(III) in surfactant-rich phase was analyzed by ETAAS after dilution by 0.2 mL nitric acid in methanol (0.1M), and antimony(V) was calculated by subtracting antimony(III) from the total antimony after reducing antimony(V) to antimony(III) by l-cysteine. The main factors affecting the cloud point extraction, such as pH, concentration of APDC and Triton X-114, equilibrium temperature and incubation time, sample volume were investigated in detail. Under the optimum conditions, the detection limit (3 sigma) of the proposed method was 0.02 ng mL(-1) for antimony(III), and the relative standard deviation was 7.8% (c=1.0 ng mL(-1), n=7). The proposed method was successfully applied to speciation of inorganic antimony in the leaching solutions of different food packaging materials with satisfactory results. PMID:19853991

  6. Cloud point extraction combined with electrothermal atomic absorption spectrometry for the speciation of antimony(III) and antimony(V) in food packaging materials

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Xiuming; Wen Shengping [School of Chemistry and Chemical Engineering, Henan University of Technology, South Song Shan Road No. 140, Zhengzhou City 450001 (China); Xiang Guoqiang, E-mail: xianggq@haut.edu.cn [School of Chemistry and Chemical Engineering, Henan University of Technology, South Song Shan Road No. 140, Zhengzhou City 450001 (China)

    2010-03-15

    A simple, sensitive method for the speciation of inorganic antimony by cloud point extraction combined with electrothermal atomic absorption spectrometry (ETAAS) is presented and evaluated. The method based on the fact that formation of a hydrophobic complex of antimony(III) with ammonium pyrrolidine dithiocarbamate (APDC) at pH 5.0 and subsequently the hydrophobic complex enter into surfactant-rich phase, whereas antimony(V) remained in aqueous solutions. Antimony(III) in surfactant-rich phase was analyzed by ETAAS after dilution by 0.2 mL nitric acid in methanol (0.1 M), and antimony(V) was calculated by subtracting antimony(III) from the total antimony after reducing antimony(V) to antimony(III) by L-cysteine. The main factors affecting the cloud point extraction, such as pH, concentration of APDC and Triton X-114, equilibrium temperature and incubation time, sample volume were investigated in detail. Under the optimum conditions, the detection limit (3{sigma}) of the proposed method was 0.02 ng mL{sup -1} for antimony(III), and the relative standard deviation was 7.8% (c = 1.0 ng mL{sup -1}, n = 7). The proposed method was successfully applied to speciation of inorganic antimony in the leaching solutions of different food packaging materials with satisfactory results.

  7. Heat-treated Saccharomyces cerevisiae for antimony speciation and antimony(III) preconcentration in water samples

    International Nuclear Information System (INIS)

    An analytical method was developed for antimony speciation and antimony(III) preconcentration in water samples. The method is based on the selective retention of Sb(III) by modified Saccharomyces cerevisiae in the presence of Sb(V). Heat, caustic and solvent pretreatments of the biomass were investigated to improve the kinetics and thermodynamics of Sb(III) uptake process at room temperature. Heating for 30 min at 80 deg. C was defined as the optimal treatment. Antimony accumulation by the cells was independent of pH (5-10) and ionic strength (0.01-0.1 mol L-1). 140 mg of yeast and 2 h of contact were necessary to ensure quantitative sequestration of Sb(III) up to 750 μg L-1. In these conditions, Sb(V) was not retained. Sb(V) was quantified in sorption supernatant by inductively coupled plasma mass spectrometry (ICP-MS) or inductively coupled plasma optical emission spectrometry (ICP-OES). Sb(III) was determined after elution with 40 mmol L-1 thioglycolic acid at pH 10. A preconcentration factor close to nine was achieved for Sb(III) when 100 mL of sample was processed. After preconcentration, the detection limits for Sb(III) and Sb(V) were 2 and 5 ng L-1, respectively, using ICP-MS, 7 and 0.9 μg L-1 using ICP-OES. The proposed method was successfully applied to the determination of Sb(III) and Sb(V) in spiked river and mineral water samples. The relative standard deviations (n = 3) were in the 2-5% range at the tenth μg L-1 level and less than 10% at the lowest Sb(III) and Sb(V) tested concentration (0.1 μg L-1). Corrected recoveries were in all cases close to 100%

  8. Noninferiority of Miltefosine Versus Meglumine Antimoniate for Cutaneous Leishmaniasis in Children

    OpenAIRE

    Rubiano, Luisa Consuelo; Miranda, María Consuelo; Muvdi Arenas, Sandra; Montero, Luz Mery; Rodríguez-Barraquer, Isabel; Garcerant, Daniel; Prager, Martín; Osorio, Lyda; Rojas, Maria Ximena; Pérez, Mauricio; Nicholls, Ruben Santiago; Gore Saravia, Nancy

    2012-01-01

    Background. Children have a lower response rate to antimonial drugs and higher elimination rate of antimony (Sb) than adults. Oral miltefosine has not been evaluated for pediatric cutaneous leishmaniasis.

  9. The influence of pet containers on antimony concentration in bottled drinking water

    OpenAIRE

    Perić-Grujić Aleksandra A.; Radmanovac Aleksandar R.; Stojanov Aleksander M.; Pocajt Viktor V.; Ristić Mirjana Đ.

    2010-01-01

    Antimony trioxide (Sb2O3) is the most frequently used catalyst in the polyethylene terephthalate (PET) manufacture. As a result, antimony is incorporated into PET bottles at concentration level of 100-300 mg/kg. PET containers are used for drinking water and beverages, as well as food packaging and in the pharmaceutical industry. Thus, it is important to understand the factors that may influence the release of antimony from the catalysts into water and other products, since antimony is potent...

  10. The influence of pet containers on antimony concentration in bottled drinking water

    Directory of Open Access Journals (Sweden)

    Perić-Grujić Aleksandra A.

    2010-01-01

    Full Text Available Antimony trioxide (Sb2O3 is the most frequently used catalyst in the polyethylene terephthalate (PET manufacture. As a result, antimony is incorporated into PET bottles at concentration level of 100-300 mg/kg. PET containers are used for drinking water and beverages, as well as food packaging and in the pharmaceutical industry. Thus, it is important to understand the factors that may influence the release of antimony from the catalysts into water and other products, since antimony is potentially toxic trace element. In this paper, the antimony content in nine brands of bottled mineral and spring water from Serbia, and seven brands of bottled mineral and spring water from EU countries was analyzed. The measurements were conducted using the inductively coupled plasma-mass spectrometry (ICP-MS technique. In the all examined samples the antimony concentration was bellow the maximum contaminant level of 5 μg/L prescribed by the Serbian and EU regulations. Comparison of the content of antimony in PET bottled waters with the content of antimony in water bottled commercially in glass and the natural content of antimony in pristine groundwaters, provides explicit evidence of antimony leaching from PET containers. Since waters bottled in PET have much greater concentration ratio of Sb to Pb than corresponding pristine groundwaters, it can be assumed that bottled waters cannot be used as the relavant source for the study of the natural antimony content in groundwaters. There is a clear relation between the quality of water in bottles (composition, ion strength and antimony leaching rate. Moreover, while the rate of antimony leaching is slow at temperatures below 60 oC, at the temperature range of 60-80 oC antimony release occurs and reaches maximum contaminant level rapidly. As antimony can cause both acute and chronic health problems, factors that promote the increase of antimony concentration should be avoided.

  11. Longitudinal Wobbling in $^{133}$La

    CERN Document Server

    Biswas, S; Garg, U; Bhat, G H; Frauendorf, S; Li, W; Sheikh, J A; Sethi, J; Saha, S; Singh, Purnima; Choudhury, D; Matta, J T; Ayangeakaa, A D; Dar, W >; Singh, V; Sihotra, S

    2016-01-01

    Excited states of $^{133}$La have been investigated to search for the wobbling excitation mode in the low-spin regime. Wobbling bands with $n_\\omega$ = 0 and 1 are identified along with the interconnecting $\\Delta I$ = 1, $E2$ transitions, which are regarded as fingerprints of the wobbling motion. An increase in wobbling frequency %of the $n_\\omega$ = 1 band with spin implies longitudinal wobbling for $^{133}$La, in contrast with the case of transverse wobbling observed in $^{135}$Pr. This is the first observation of a longitudinal wobbling band in nuclei. The experimental observations are accounted for by calculations using the quasiparticle triaxial rotor with harmonic frozen approximation and the triaxial projected shell model approaches, which attribute the appearance of longitudinal wobbling to the early alignment of an h$_{11/2}$ neutron pair.

  12. 7 CFR 29.133 - Identification number.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Identification number. 29.133 Section 29.133... REGULATIONS TOBACCO INSPECTION Regulations Miscellaneous § 29.133 Identification number. The Director may require the use of official identification numbers in connection with tobacco certificated or...

  13. 14 CFR 65.133 - Seal.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Seal. 65.133 Section 65.133 Aeronautics and...: AIRMEN OTHER THAN FLIGHT CREWMEMBERS Parachute Riggers § 65.133 Seal. Each certificated parachute rigger must have a seal with an identifying mark prescribed by the Administrator, and a seal press....

  14. 33 CFR 117.133 - Ouachita River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Ouachita River. 117.133 Section 117.133 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Arkansas § 117.133 Ouachita River. The draw of the...

  15. 22 CFR 133.670 - Suspension.

    Science.gov (United States)

    2010-04-01

    ... Acquisition Regulation for procurement contracts (48 CFR part 9, subpart 9.4) and the common rule, Government... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Suspension. 133.670 Section 133.670 Foreign... ASSISTANCE) Definitions § 133.670 Suspension. Suspension means an action taken by a Federal agency...

  16. 22 CFR 133.655 - Individual.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Individual. 133.655 Section 133.655 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 133.655 Individual. Individual means a natural person....

  17. 47 CFR 24.133 - Emission limits.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Emission limits. 24.133 Section 24.133... SERVICES Narrowband PCS § 24.133 Emission limits. (a) The power of any emission shall be attenuated below... the lesser attenuation. (b) The measurements of emission power can be expressed in peak or...

  18. 14 CFR 125.133 - Fuel valves.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Fuel valves. 125.133 Section 125.133....133 Fuel valves. Each fuel valve must— (a) Comply with § 125.155; (b) Have positive stops or suitable... operation or from accelerated flight conditions are not transmitted to the lines connected to the valve....

  19. 10 CFR 71.133 - Corrective action.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Corrective action. 71.133 Section 71.133 Energy NUCLEAR....133 Corrective action. The licensee, certificate holder, and applicant for a CoC shall establish... determined and corrective action taken to preclude repetition. The identification of the...

  20. 46 CFR 133.105 - Survival craft.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Survival craft. 133.105 Section 133.105 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS LIFESAVING SYSTEMS Requirements for All OSVs § 133.105 Survival craft. (a) Each survival craft must be approved and equipped...

  1. 7 CFR 930.133 - Compensation rate.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Compensation rate. 930.133 Section 930.133 Agriculture... Regulations § 930.133 Compensation rate. A compensation rate of $250 per meeting shall be paid to the public member and to the alternate public member when attending Board meetings. Such compensation is a...

  2. 49 CFR 383.133 - Testing methods.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Testing methods. 383.133 Section 383.133... STANDARDS; REQUIREMENTS AND PENALTIES Tests § 383.133 Testing methods. (a) All tests shall be constructed in... must be at least as stringent as the Federal standards. (c) States shall determine specific methods...

  3. Antimony Doped Tin Oxide Thin Films: Co Gas Sensor

    Directory of Open Access Journals (Sweden)

    P.S. Joshi

    2011-01-01

    Full Text Available Tin dioxide (SnO2 serves as an important base material in a variety of resistive type gas sensors. The widespread applicability of this semicoducting oxide is related both to its range of conductance variability and to the fact that it responds to both oxidising and reducing gases. The antimony doped tin-oxide films were prepared by spray pyrolysis method. The as-deposited films are blackish in colour. Addition of antimony impurity showed little increase in the thickness. The X-ray diffraction pattern shows characteristic tin oxide peaks with tetragonal structure. As the doping concentration of antimony was increased, new peak corresponding to Sb was observed. The intensity of this peak found to be increased when the Sb concentration was increased from 0.01 % to the 1 % which indicates the antimony was incorporated into the tin oxide. For gas sensing studies ohmic contacts were preferred to ensure the changes in resistance of sensor is due to only adsorption of gas molecule. The graph of I-V shows a straight line in nature which indicates the ohmic contact. The sensitivity of the sensor for CO gas was tested. The sensitivity of antimony doped tin oxide found to be increased with increasing Sb concentration. The maximum sensitivity was observed for Sb = 1 % at a working temperature of 250 °C.

  4. Behavior of arsenic impurity at antimony electric precipitation

    International Nuclear Information System (INIS)

    In the paper the arsenic impurity electrochemical behavior and it purification from antimony by electric precipitation out of fluoride solutions was studied. For this the arsenic sample with mass 0.003-0.006 g has been irradiated at the WWR-SM nuclear reactor during 3-5 hour in the thermal neutron flux 1013 n/cm2 s, after 24 h keeping the sample has being dissolved in the concentrated nitric acid, and then it has been evaporated several times with distillation water addition up to wet precipitation state. It is shown, that arsenic impurity behavior character in the antimony electric precipitation out to fluoride electrolyte depends on the electrolyte content, electrolysis conditions, arsenic valency state in arsenic impurity existence in the five-valency state its joint electric reduction with antimony is practically not observing. In the case the arsenic being in three-valency state, it joint electric reduction with antimony is taking place. In this time the electrolytic antimony contents arsenic impurities less in dozen time than initial material

  5. Martensite transformation in antimony implanted stainless steel

    International Nuclear Information System (INIS)

    The authors have used Rutherford backscattering analysis (RBS) and transmission electron microscopy (TEM) and diffraction to investigate austenitic stainless steel crystals implanted at room temperature with 80 keV Sb+ ions to a fluence of 5 x 1020 ions/m2, thus providing implantation with a heavy group V element. RBS channeling spectra from implanted crystals show a damage peak which approaches the height of the random level and therefore indicates a very high degree of disorder in the implanted layers. The distribution of the disorder extends to a depth 3-5 times the depth of the primary radiation damage. The Sb peaks under channeling as well as random conditions are indistinguishable, confirming that substitutionality during implantation is negligible. To establish the nature of the disorder which cannot be assessed from the RBS analysis alone, and in particular to assess whether an amorphous alloy is formed in the implanted layer as indicated from the RBS spectra, samples implanted under similar conditions were investigated in the TEM. Significant extra spots in the patterns can be ascribed to the presence of a radiation induced b.c.c. phase of martensitic origin. The result that a significant amount of martensite can be induced by antimony implantation seems to indicate that the main driving force for the transition is due to damage induced stress concentrations. (Auth.)

  6. Antimony Resistance in Leishmania, Focusing on Experimental Research

    Directory of Open Access Journals (Sweden)

    Fakhri Jeddi

    2011-01-01

    Full Text Available Leishmaniases are parasitic diseases that spread in many countries with a prevalence of 12 million cases. There are few available treatments and antimonials are still of major importance in the therapeutic strategies used in most endemic regions. However, resistance toward these compounds has recently emerged in areas where the replacement of these drugs is mainly limited by the cost of alternative molecules. In this paper, we reviewed the studies carried out on antimonial resistance in Leishmania. Several common limitations of these works are presented before prevalent approaches to evidence antimonial resistance are related. Afterwards, phenotypic determination of resistance is described, then confronted to clinical outcome. Finally, we detail molecular mechanisms and targets involved in resistance and already identified in vitro within selected mutant strains or in clinical isolates.

  7. Lattice dynamics of femtosecond laser-excited antimony

    Science.gov (United States)

    Abdel-Fattah, Mahmoud Hanafy; Bugayev, Aleksey; Elsayed-Ali, Hani E.

    2016-07-01

    Ultrafast electron diffraction is used to probe the lattice dynamics of femtosecond laser-excited antimony thin film. The temporal hierarchies of the intensity and position of diffraction orders are monitored. The femtosecond laser excitation of antimony film was found to lead to initial compression after the laser pulse, which gives way to tension vibrating at new equilibrium displacement. A damped harmonic oscillator model, in which the hot electron-blast force contributes to the driving force of oscillations in lattice spacing, is used to interpret the data. The electron-phonon energy-exchange rate and the electronic Grüneisen parameter were obtained.

  8. Heat-treated Saccharomyces cerevisiae for antimony speciation and antimony(III) preconcentration in water samples

    Energy Technology Data Exchange (ETDEWEB)

    Marcellino, Sebastien [Universite de Lyon, Lyon1, Laboratoire des Sciences Analytiques, CNRS UMR 5180, bat CPE, 43, boulevard du 11 novembre 1918, 69622 Villeurbanne cedex (France); Attar, Hossein [Universite Louis Pasteur de Strasbourg, Laboratoire de Chimie Analytique et Sciences Separatives, CNRS UMR 7178, ECPM, 25 rue Becquerel 67087 Strasbourg (France); Lievremont, Didier; Lett, Marie-Claire [Universite Louis Pasteur de Strasbourg, Laboratoire de Genetique Moleculaire, Genetique et Microbiologie, CNRS UMR 7156, 28 rue Goethe, 67000 Strasbourg (France); Barbier, Frederique [CNRS USR 59, Service Central d' Analyse, 59 Chemin du Canal BP22 69390 Vernaison (France); Lagarde, Florence [Universite de Lyon, Lyon1, Laboratoire des Sciences Analytiques, CNRS UMR 5180, bat CPE, 43, boulevard du 11 novembre 1918, 69622 Villeurbanne cedex (France); Universite Louis Pasteur de Strasbourg, Laboratoire de Chimie Analytique et Sciences Separatives, CNRS UMR 7178, ECPM, 25 rue Becquerel 67087 Strasbourg (France)], E-mail: florence.lagarde@univ-lyon1.fr

    2008-11-23

    An analytical method was developed for antimony speciation and antimony(III) preconcentration in water samples. The method is based on the selective retention of Sb(III) by modified Saccharomyces cerevisiae in the presence of Sb(V). Heat, caustic and solvent pretreatments of the biomass were investigated to improve the kinetics and thermodynamics of Sb(III) uptake process at room temperature. Heating for 30 min at 80 deg. C was defined as the optimal treatment. Antimony accumulation by the cells was independent of pH (5-10) and ionic strength (0.01-0.1 mol L{sup -1}). 140 mg of yeast and 2 h of contact were necessary to ensure quantitative sequestration of Sb(III) up to 750 {mu}g L{sup -1}. In these conditions, Sb(V) was not retained. Sb(V) was quantified in sorption supernatant by inductively coupled plasma mass spectrometry (ICP-MS) or inductively coupled plasma optical emission spectrometry (ICP-OES). Sb(III) was determined after elution with 40 mmol L{sup -1} thioglycolic acid at pH 10. A preconcentration factor close to nine was achieved for Sb(III) when 100 mL of sample was processed. After preconcentration, the detection limits for Sb(III) and Sb(V) were 2 and 5 ng L{sup -1}, respectively, using ICP-MS, 7 and 0.9 {mu}g L{sup -1} using ICP-OES. The proposed method was successfully applied to the determination of Sb(III) and Sb(V) in spiked river and mineral water samples. The relative standard deviations (n = 3) were in the 2-5% range at the tenth {mu}g L{sup -1} level and less than 10% at the lowest Sb(III) and Sb(V) tested concentration (0.1 {mu}g L{sup -1}). Corrected recoveries were in all cases close to 100%.

  9. Antimony to Cure Visceral Leishmaniasis Unresponsive to Liposomal Amphotericin B.

    Directory of Open Access Journals (Sweden)

    Gloria Morizot

    2016-01-01

    Full Text Available We report on 4 patients (1 immunocompetent, 3 immunosuppressed in whom visceral leishmaniasis had become unresponsive to (or had relapsed after treatment with appropriate doses of liposomal amphotericin B. Under close follow-up, full courses of pentavalent antimony were administered without life-threatening adverse events and resulted in rapid and sustained clinical and parasitological cure.

  10. Antimony to Cure Visceral Leishmaniasis Unresponsive to Liposomal Amphotericin B.

    Science.gov (United States)

    Morizot, Gloria; Jouffroy, Romain; Faye, Albert; Chabert, Paul; Belhouari, Katia; Calin, Ruxandra; Charlier, Caroline; Miailhes, Patrick; Siriez, Jean-Yves; Mouri, Oussama; Yera, Hélène; Gilquin, Jacques; Tubiana, Roland; Lanternier, Fanny; Mamzer, Marie-France; Legendre, Christophe; Peyramond, Dominique; Caumes, Eric; Lortholary, Olivier; Buffet, Pierre

    2016-01-01

    We report on 4 patients (1 immunocompetent, 3 immunosuppressed) in whom visceral leishmaniasis had become unresponsive to (or had relapsed after) treatment with appropriate doses of liposomal amphotericin B. Under close follow-up, full courses of pentavalent antimony were administered without life-threatening adverse events and resulted in rapid and sustained clinical and parasitological cure.

  11. Discovery of palladium, antimony, tellurium, iodine, and xenon isotopes

    OpenAIRE

    Kathawa, J.; Fry, C; Thoennessen, M

    2012-01-01

    Currently, thirty-eight palladium, thirty-eight antimony, thirty-nine tellurium, thirty-eight iodine, and forty xenon isotopes have been observed and the discovery of these isotopes is discussed here. For each isotope a brief synopsis of the first refereed publication, including the production and identification method, is presented.

  12. Direct Band Gap Gallium Antimony Phosphide (GaSbxP(1-x)) Alloys.

    Science.gov (United States)

    Russell, H B; Andriotis, A N; Menon, M; Jasinski, J B; Martinez-Garcia, A; Sunkara, M K

    2016-01-01

    Here, we report direct band gap transition for Gallium Phosphide (GaP) when alloyed with just 1-2 at% antimony (Sb) utilizing both density functional theory based computations and experiments. First principles density functional theory calculations of GaSbxP(1-x) alloys in a 216 atom supercell configuration indicate that an indirect to direct band gap transition occurs at x = 0.0092 or higher Sb incorporation into GaSbxP(1-x). Furthermore, these calculations indicate band edge straddling of the hydrogen evolution and oxygen evolution reactions for compositions ranging from x = 0.0092 Sb up to at least x = 0.065 Sb making it a candidate for use in a Schottky type photoelectrochemical water splitting device. GaSbxP(1-x) nanowires were synthesized by reactive transport utilizing a microwave plasma discharge with average compositions ranging from x = 0.06 to x = 0.12 Sb and direct band gaps between 2.21 eV and 1.33 eV. Photoelectrochemical experiments show that the material is photoactive with p-type conductivity. This study brings attention to a relatively uninvestigated, tunable band gap semiconductor system with tremendous potential in many fields. PMID:26860470

  13. Direct Band Gap Gallium Antimony Phosphide (GaSbxP1-x) Alloys

    Science.gov (United States)

    Russell, H. B.; Andriotis, A. N.; Menon, M.; Jasinski, J. B.; Martinez-Garcia, A.; Sunkara, M. K.

    2016-02-01

    Here, we report direct band gap transition for Gallium Phosphide (GaP) when alloyed with just 1-2 at% antimony (Sb) utilizing both density functional theory based computations and experiments. First principles density functional theory calculations of GaSbxP1-x alloys in a 216 atom supercell configuration indicate that an indirect to direct band gap transition occurs at x = 0.0092 or higher Sb incorporation into GaSbxP1-x. Furthermore, these calculations indicate band edge straddling of the hydrogen evolution and oxygen evolution reactions for compositions ranging from x = 0.0092 Sb up to at least x = 0.065 Sb making it a candidate for use in a Schottky type photoelectrochemical water splitting device. GaSbxP1-x nanowires were synthesized by reactive transport utilizing a microwave plasma discharge with average compositions ranging from x = 0.06 to x = 0.12 Sb and direct band gaps between 2.21 eV and 1.33 eV. Photoelectrochemical experiments show that the material is photoactive with p-type conductivity. This study brings attention to a relatively uninvestigated, tunable band gap semiconductor system with tremendous potential in many fields.

  14. Dicty_cDB: SLA133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA133 (Link to dictyBase) - - - Contig-U16455-1 SLA133Z (Link... to Original site) - - SLA133Z 728 - - - - Show SLA133 Library SL (Link to library) Clone ID SLA133 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLA1-B/SLA133Q.Seq.d/ Representative seq. ID SLA13...3Z (Link to Original site) Representative DNA sequence >SLA133 (SLA133Q) /CSM/SL/SLA1-B/SLA133Q.Seq.d/ XXXXX...AAATAATATTTCTTAATAAATAGC ATTTTATAATAATTTTAA sequence update 1998. 4.11 Translated Amino Acid sequence ---rph

  15. The determination of the thermodynamic activity of antimony in alpha-iron

    International Nuclear Information System (INIS)

    In this paper a method is suggested for determining the thermodynamic activity of antimony dissolved in alpha-iron, based on the study of antimony distribution between the two phases: liquid lead and solid iron. By this method, it was found that solid solutions of antimony in alpha-iron can be distinguished by positive divergences from the ideal state. Over a fairly wide range of concentrations, solutions of antimony in iron obey Henry's law. Special experiments on the distribution of antimony between lead and liquid iron showed that in the liquid state also the iron-antimony system is marked by positive divergences from the ideal state when small concentrations of antimony are present. The heat required for the solution of antimony in alpha-iron, and the excess partial molar entropy, were calculated from the activity temperature. The results were used for accurately locating the line showing the solubility limit of antimony in alpha-iron. Since alloys of antimony with iron were obtained by diffusion saturation and not by cooling from the liquid state, there was no liquefaction. Thus the lattice constant of the alloys and its relation to the alloy concentration could be reliably determined. The solubility limit established from X-ray data agrees with that obtained with Sb124. (author)

  16. Expression of CD133 in acute leukemia.

    Science.gov (United States)

    Tolba, Fetnat M; Foda, Mona E; Kamal, Howyda M; Elshabrawy, Deena A

    2013-06-01

    There have been conflicting results regarding a correlation between CD133 expression and disease outcome. To assess CD133 expression in patients with acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) and to evaluate its correlation with the different clinical and laboratory data as well as its relation to disease outcome, the present study included 60 newly diagnosed acute leukemic patients; 30 ALL patients with a male to female ratio of 1.5:1 and their ages ranged from 9 months to 48 years, and 30 AML patients with a male to female ratio of 1:1 and their ages ranged from 17 to 66 years. Flow cytometric assessment of CD133 expression was performed on blast cells. In ALL, no correlations were elicited between CD133 expression and some monoclonal antibodies, but in AML group, there was a significant positive correlation between CD133 and HLA-DR, CD3, CD7 and TDT, CD13 and CD34. In ALL group, patients with negative CD133 expression achieved complete remission more than patients with positive CD133 expression. In AML group, there was no statistically significant association found between positive CD133 expression and treatment outcome. The Kaplan-Meier curve illustrated a high significant negative correlation between CD133 expression and the overall survival of the AML patients. CD133 expression is an independent prognostic factor in acute leukemia, especially ALL patients and its expression could characterize a group of acute leukemic patients with higher resistance to standard chemotherapy and relapse. CD133 expression was highly associated with poor prognosis in acute leukemic patients. PMID:23532815

  17. 21 CFR 133.118 - Colby cheese.

    Science.gov (United States)

    2010-04-01

    ...: (1) The word “milk” means cow's milk, which may be adjusted by separating part of the fat therefrom... Products § 133.118 Colby cheese. (a) Colby cheese is the food prepared from milk and other ingredients... the methods prescribed in § 133.5 (a), (b), and (d). If the milk used is not pasteurized, the...

  18. 22 CFR 133.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 133.650 Section 133.650 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL... authorized by a law of the United States, rather than to acquire property or services for the...

  19. 4 CFR 28.133 - Stay proceedings.

    Science.gov (United States)

    2010-01-01

    ... 4 Accounts 1 2010-01-01 2010-01-01 false Stay proceedings. 28.133 Section 28.133 Accounts... request shall be in writing and shall specify the nature of the action to be stayed and the basis for the... alleged prohibited personnel practice as specified by the Board's General Counsel; (2) Assess the...

  20. 21 CFR 133.141 - Gorgonzola cheese.

    Science.gov (United States)

    2010-04-01

    ... storage, the surface of the cheese may be scraped to remove surface growth of undesirable microorganisms... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Gorgonzola cheese. 133.141 Section 133.141 Food... HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese...

  1. 21 CFR 133.106 - Blue cheese.

    Science.gov (United States)

    2010-04-01

    ... undesirable microorganisms. Antimycotics may be applied to the surface of the whole cheese. One or more of the... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Blue cheese. 133.106 Section 133.106 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and...

  2. 12 CFR 13.3 - Business conduct.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Business conduct. 13.3 Section 13.3 Banks and....3 Business conduct. A bank that is a government securities broker or dealer shall observe high standards of commercial honor and just and equitable principles of trade in the conduct of its business as...

  3. 38 CFR 13.3 - State legislation.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false State legislation. 13.3... ADMINISTRATION, FIDUCIARY ACTIVITIES § 13.3 State legislation. Field facility Directors are authorized to... local and State bar associations, to the end that deficiencies of the State laws relating to...

  4. 40 CFR 133.102 - Secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Secondary treatment. 133.102 Section... TREATMENT REGULATION § 133.102 Secondary treatment. The following paragraphs describe the minimum level of effluent quality attainable by secondary treatment in terms of the parameters—BOD5, SS and pH....

  5. In Vitro antileishmanial properties of neutron-irradiated meglumine antimoniate

    Directory of Open Access Journals (Sweden)

    Samanta Etel Treiger Borborema

    2005-10-01

    Full Text Available Pentavalent antimony, as meglumine antimoniate (Glucantime® or sodium stibogluconate (Pentostam® , is the main treatment for leishmaniasis, a complex of diseases caused by the protozoan Leishmania, and an endemic and neglected threat in Brazil. Despite over half a century of clinical use, their mechanism of action, toxicity and pharmacokinetic data remain unknown. The analytical methods for determination of antimony in biological systems remain complex and have low sensitivity. Radiotracer studies have a potential in pharmaceutical development. The aim of this study was to obtain a radiotracer for antimony, with suitable physical and biological properties. Meglumine antimoniate was neutron irradiated inside the IEA-R1 nuclear reactor, producing two radioisotopes 122Sb and 124Sb, with high radionuclidic purity and good specific activity. This compound showed the same antileishmanial activity as the native compound. The use of the radiotracers, easily created by neutron irradiation, could be an interesting tool to solve important questions in antimonial pharmacology.Os antimoniais pentavalentes, como o antimoniato de meglumina (Glucantime® ou estibogluconato de sódio (Pentostam® , são o principal tratamento para a leishmaniose, um complexo de doenças causadas pelo protozoário parasita Leishmania, uma doença endêmica e negligenciada no Brasil. Apesar do seu uso clínico por mais de meio século, seu mecanismo de ação, toxicidade e dados de farmacocinética permanecem desconhecidos. Os métodos analíticos para determinação de antimônio em sistemas biológicos são complexos e apresentam baixa sensibilidade. Estudos utilizando radiotraçadores têm papel potencial no desenvolvimento farmacológico. O objetivo deste estudo foi desenvolver um radiotraçador de antimônio, com propriedades físicas e biológicas adequadas. O antimoniato de meglumina foi irradiado por nêutrons no reator nuclear IEA-R1, produzindo dois radioisótopos: 122

  6. Antimony and arsenic biogeochemistry in the western Atlantic Ocean

    Science.gov (United States)

    Cutter, Gregory A.; Cutter, Lynda S.; Featherstone, Alison M.; Lohrenz, Steven E.

    The subtropical to equatorial Atlantic Ocean provides a unique regime in which one can examine the biogeochemical cycles of antimony and arsenic. In particular, this region is strongly affected by inputs from the Amazon River and dust from North Africa at the surface, and horizontal transport at depth from high-latitude northern (e.g., North Atlantic Deep Water) and southern waters (e.g., Antarctic Bottom and Intermediate Waters). As a part of the 1996 Intergovernmental Oceanographic Commission's Contaminant Baseline Survey, data for dissolved As(III+V), As(III), mono- and dimethyl arsenic, Sb(III+V), Sb(III), and monomethyl antimony were obtained at six vertical profile stations and 44 sites along the 11,000 km transect from Montevideo, Uruguay, to Bridgetown, Barbados. The arsenic results were similar to those in other oceans, with moderate surface depletion, deep-water enrichment, a predominance of arsenate (>85% As(V)), and methylated arsenic species and As(III) in surface waters that are likely a result of phytoplankton conversions to mitigate arsenate "stress" (toxicity). Perhaps the most significant discovery in the arsenic results was the extremely low concentrations in the Amazon Plume (as low as 9.8 nmol/l) that appear to extend for considerable distances offshore in the equatorial region. The very low concentration of inorganic arsenic in the Amazon River (2.8 nmol/l; about half those in most rivers) is probably the result of intense iron oxyhydroxide scavenging. Dissolved antimony was also primarily in the pentavalent state (>95% antimonate), but Sb(III) and monomethyl antimony were only detected in surface waters and displayed no correlations with biotic tracers such as nutrients and chlorophyll a. Unlike As(III+V)'s nutrient-type vertical profiles, Sb(III+V) displayed surface maxima and decreased into the deep waters, exhibiting the behavior of a scavenged element with a strong atmospheric input. While surface water Sb had a slight correlation with

  7. BioGeochemistry of antimony, Sources, Transfers, Impacts and Assessment

    Science.gov (United States)

    Le Roux, Gael; Pinelli, Eric; Hedde, Mickael; Guiresse, Maritxu; De Vleeschouwer, François; Silvestre, Jérôme; Enrico, Maxime; Gandois, Laure; Monna, Fabrice; Gers, Charles; Probst, Anne

    2013-04-01

    BioGeoSTIB is a project funded by ADEME (French Environmental Protection Agency). Its aim is to provide a better understanding of biogeochemical cycle disturbances of antimony by man. Specifically, it is focused on the atmosphere-soil-organism interfaces. Based on a multi-scale approach, the impact of antimony on organisms and organism communities and the factors of Sb dispersion in the environment aim to better characterized. This report gives the main results of 2 and 1 -2 years of research. Using peat bogs as environmental archives, we show that Sb contamination in soils date back to the beginning of the metallurgy. Atmospheric deposition of Sb largely increased by 100 times during the Industrial Revolution compared to natural levels (~0,001-0,01 mg m-2 an-1) estimated in the deepest peat layers. This disturbance in the antimony geochemical cycle modified its concentrations in soils. One main source of present Sb contamination is automotive traffic due to Sb in braking lines. This emerging contamination was characterized close to a roundabout. This additional source of Sb does not seem to impact soil fauna but Sb concentrations in soil solutions exceed 1 μg L-1. Genotoxicity tests have been performed on the model plant Vicia faba and show that antimony is genotoxic at its lowest concentrations and that there is a synergistic effect lead, a trace metal frequently found in association with antimony in the environment. It is a main issue to determine Sb critical loads in the environment but main identified lacks are thermodynamic data, which are not available yet, to model the behavior of Sb in soil solutions and the fact the antimony is always associated with other anthropogenic trace metals like lead. Critical thresholds of Sb have been determined for the first time based on genotoxicity experiment. Simulations show that these thresholds can be exceeded in the future, whereas present limits for invertebrates (US-EPA) are and will not be reached. However

  8. States of antimony and tin atoms in lead chalcogenides

    International Nuclear Information System (INIS)

    It is shown by Mössbauer spectroscopy of the 119Sb(119mSn) isotope that impurity antimony atoms in PbS, PbSe, and PbTe lattices are distributed between cation and anion sublattices. In n-type samples, the greatest part of antimony is located in the anion sublattice; in hole ones, in the cation sublattice. The tin atoms formed as a result of radioactive decay of 119Sb (antisite state) are electrically inactive in the anion sub-lattice of PbS and PbSe, while, in the cation sublattice, they form donor U− centers. Electron exchange between the neutral and doubly ionized tin U− centers via the allowed band states is observed. The tin atoms formed after radioactive decay of 119Sb are electrically inactive in the anion and cation sublattices of PbTe.

  9. 无机锑系阻燃剂%Inorganic Antimony Series Fire Retardants

    Institute of Scientific and Technical Information of China (English)

    张亨

    2012-01-01

    无机锑系阻燃剂主要包括三氧化二锑、五氧化二锑溶胶和锑酸钠等。介绍了它们的性质、生产工艺、产品标准、阻燃用途和研发方向等。%Inorganic antimony series fire retardants include antimony trioxide, antimony pentoxide sol and sodium antimonate, etc. The properties, production process, production standard and uses of several inorganic antimony series fire retardants are introduced.

  10. Correlation of CsK{sub 2}Sb photocathode lifetime with antimony thickness

    Energy Technology Data Exchange (ETDEWEB)

    Mamun, M. A., E-mail: mmamu001@odu.edu; Elmustafa, A. A. [Department of Mechanical and Aerospace Engineering, Old Dominion University, Norfolk, Virginia 23529 (United States); The Applied Research Center, Thomas Jefferson National Accelerator Facility, Newport News, Virginia 23606 (United States); Hernandez-Garcia, C.; Poelker, M. [Thomas Jefferson National Accelerator Facility, Newport News, Virginia 23606 (United States)

    2015-06-01

    CsK{sub 2}Sb photocathodes with quantum efficiency on the order of 10% at 532 nm, and lifetime greater than 90 days at low voltage, were successfully manufactured via co-deposition of alkali species emanating from an effusion source. Photocathodes were characterized as a function of antimony layer thickness and alkali consumption, inside a vacuum chamber that was initially baked, but frequently vented without re-baking. Photocathode lifetime measured at low voltage is correlated with the antimony layer thickness. Photocathodes manufactured with comparatively thick antimony layers exhibited the best lifetime. We speculate that the antimony layer serves as a reservoir, or sponge, for the alkali.

  11. Correlation of CsK2Sb photocathode lifetime with antimony thickness

    Energy Technology Data Exchange (ETDEWEB)

    Mamun, M. A. [Department of Mechanical and Aerospace Engineering, Old Dominion University, Norfolk, Virginia 23529, USA; The Applied Research Center, Thomas Jefferson National Accelerator Facility, Newport News, Virginia 23606, USA; Hernandez-Garcia, C. [Thomas Jefferson National Accelerator Facility, Newport News, Virginia 23606, USA; Poelker, M. [Thomas Jefferson National Accelerator Facility, Newport News, Virginia 23606, USA; Elmustafa, A. A. [Department of Mechanical and Aerospace Engineering, Old Dominion University, Norfolk, Virginia 23529, USA; The Applied Research Center, Thomas Jefferson National Accelerator Facility, Newport News, Virginia 23606, USA

    2015-06-01

    CsK2Sb photocathodes with quantum efficiency on the order of 10% at 532 nm, and lifetime greater than 90 days at low voltage, were successfully manufactured via co-deposition of alkali species emanating from an effusion source. Photocathodes were characterized as a function of antimony layer thickness and alkali consumption, inside a vacuum chamber that was initially baked, but frequently vented without re-baking. Photocathode lifetime measured at low voltage is correlated with the antimony layer thickness. Photocathodes manufactured with comparatively thick antimony layers exhibited the best lifetime. We speculate that the antimony layer serves as a reservoir, or sponge, for the alkali.

  12. Correlation of CsK2Sb photocathode lifetime with antimony thickness

    Directory of Open Access Journals (Sweden)

    M. A. Mamun

    2015-06-01

    Full Text Available CsK2Sb photocathodes with quantum efficiency on the order of 10% at 532 nm, and lifetime greater than 90 days at low voltage, were successfully manufactured via co-deposition of alkali species emanating from an effusion source. Photocathodes were characterized as a function of antimony layer thickness and alkali consumption, inside a vacuum chamber that was initially baked, but frequently vented without re-baking. Photocathode lifetime measured at low voltage is correlated with the antimony layer thickness. Photocathodes manufactured with comparatively thick antimony layers exhibited the best lifetime. We speculate that the antimony layer serves as a reservoir, or sponge, for the alkali.

  13. Resistance to Arsenic- and Antimony-Based Drugs

    OpenAIRE

    Milena Salerno; Arlette Garnier-Suillerot

    2003-01-01

    Organic arsenicals were the first antimicrobial agents specifically synthesized for the treatment of infectious diseases such as syphilis and sleeping sickness. For the treatment of diseases caused by trypanosomatid parasites, organic derivatives of arsenic and the related metalloid antimony are still the drugs of choice. Arsenic trioxide, As203, has been used for a long time in traditional Chinese medicines for treatment of various diseases, and it has recently been shown to be clinically ac...

  14. Crystallization of antimony orthotantalate and its physical properties

    International Nuclear Information System (INIS)

    Physicochemical conditions of monophase synthesis of antimony orthoniobate monocrystals in the system SbO3-Ta2O5-KHF2-H2O2-H2O were investigated. In the area of monophase synthesis of SbTaO4 monocrystals kinetic studies of its growth conditions for inoculation, depending on solvent concentration, temperature, pyroelectric properties of the monocrystal grown were studied and conclusion was made on their practical use

  15. Dicty_cDB: AFM133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM133 (Link to dictyBase) - - - - AFM133P (Link to Original site) AFM133F 638 AFM...133Z 647 AFM133P 1265 - - Show AFM133 Library AF (Link to library) Clone ID AFM133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-B/AFM133Q.Seq.d/ Representative seq. ID AFM133P (Link to... Original site) Representative DNA sequence >AFM133 (AFM133Q) /CSM/AF/AFM1-B/AFM133Q.Seq.d/ AAAACATCTCTATTTT

  16. Dicty_cDB: CHS133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHS133 (Link to dictyBase) - - - - CHS133P (Link to Original site) CHS133F 704 CHS1...33Z 773 CHS133P 1457 - - Show CHS133 Library CH (Link to library) Clone ID CHS133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHS1...-B/CHS133Q.Seq.d/ Representative seq. ID CHS133P (Link to... Original site) Representative DNA sequence >CHS133 (CHS133Q) /CSM/CH/CHS1-B/CHS133Q.Seq.d/ ATTTTTAAATATATAT

  17. Single-Particle States in $^{133}$Sn

    CERN Document Server

    Huck, A

    2002-01-01

    % IS338 \\\\ \\\\ It is suggested to investigate the $\\beta^- $-decay of $^{133}$In and $^{134}$In in order to determine the single-particle states in $^{133}$Sn, which are so far unknown and needed for the shell-model description of the region close to $^{132}$Sn. Large hyper-pure Ge-detectors will be used for the $\\gamma$-ray spectroscopy. In the experiments with $^{134}$In, delayed neutrons in coincidence with $\\gamma$-rays from excited states in $^{133}$Sn provide the opportunity for a very selective detection of the states in question.

  18. Antimony leaching from polyethylene terephthalate (PET) plastic used for bottled drinking water.

    Science.gov (United States)

    Westerhoff, Paul; Prapaipong, Panjai; Shock, Everett; Hillaireau, Alice

    2008-02-01

    Antimony is a regulated contaminant that poses both acute and chronic health effects in drinking water. Previous reports suggest that polyethylene terephthalate (PET) plastics used for water bottles in Europe and Canada leach antimony, but no studies on bottled water in the United States have previously been conducted. Nine commercially available bottled waters in the southwestern US (Arizona) were purchased and tested for antimony concentrations as well as for potential antimony release by the plastics that compose the bottles. The southwestern US was chosen for the study because of its high consumption of bottled water and elevated temperatures, which could increase antimony leaching from PET plastics. Antimony concentrations in the bottled waters ranged from 0.095 to 0.521 ppb, well below the US Environmental Protection Agency (USEPA) maximum contaminant level (MCL) of 6 ppb. The average concentration was 0.195+/-0.116 ppb at the beginning of the study and 0.226+/-0.160 ppb 3 months later, with no statistical differences; samples were stored at 22 degrees C. However, storage at higher temperatures had a significant effect on the time-dependent release of antimony. The rate of antimony (Sb) release could be fit by a power function model (Sb(t)=Sb 0 x[Time, h]k; k=8.7 x 10(-6)x[Temperature ( degrees C)](2.55); Sb 0 is the initial antimony concentration). For exposure temperatures of 60, 65, 70, 75, 80, and 85 degrees C, the exposure durations necessary to exceed the 6 ppb MCL are 176, 38, 12, 4.7, 2.3, and 1.3 days, respectively. Summertime temperatures inside of cars, garages, and enclosed storage areas can exceed 65 degrees C in Arizona, and thus could promote antimony leaching from PET bottled waters. Microwave digestion revealed that the PET plastic used by one brand contained 213+/-35 mgSb/kg plastic; leaching of all the antimony from this plastic into 0.5L of water in a bottle could result in an antimony concentration of 376 ppb. Clearly, only a small

  19. Recent advances on antimony(III/V) compounds with potential activity against tumor cells.

    Science.gov (United States)

    Hadjikakou, S K; Ozturk, I I; Banti, C N; Kourkoumelis, N; Hadjiliadis, N

    2015-12-01

    Antimony one of the heavier pnictogens, has been in medical use against microbes and parasites as well. Antimony-based drugs have been prescribed against leishmaniasis since the parasitic transmission of the tropical disease was understood in the beginning of the 20th century. The activity of arsenic against visceral leishmaniasis led to the synthesis of an array of arsenic-containing parasitic agents, among them the less toxic pentavalent antimonials: Stibosan, Neostibosan, and Ureastibamine. Other antimony drugs followed: sodium stibogluconate (Pentostam) and melglumine antimoniate (Glucantim or Glucantime); both continue to be in use today despite their toxic side effects and increasing loss in potency due to the growing resistance of the parasite against antimony. Antimony compounds and their therapeutic potentials are under consideration from many research groups, while a number of early reviews recording advances of antimony biomedical applications are also available. However, there are only few reports on the screening for antitumor potential of antimony compounds. This review focuses upon results obtained on the anti-proliferative activity of antimony compounds in the past years. This survey shows that antimony(III/V) complexes containing various types of ligands such as thiones, thiosemicarbazones, dithiocarbamates, carboxylic acids, or ketones, nitrogen donor ligands, exhibit selectivity against a variety of cancer cells. The role of the ligand type of the complex is elucidated within this review. The complexes and their biological activity are already reported elsewhere. However quantitative structure-activity relationship (QSAR) modeling studies have been carried out and they are reported for the first time here. PMID:26092367

  20. Heavy weight vehicle traffic and its relationship with antimony content in human blood.

    Science.gov (United States)

    Quiroz, Waldo; De Gregori, Ida; Basilio, Paola; Bravo, Manuel; Pinto, Marcela; Lobos, Maria Gabriela

    2009-05-01

    Brake pads systems are nowadays considered as one of the most important sources of antimony in airborne particulate matter. One way that antimony can enter the body is through the lungs and specially by the interaction of antimony with -SH groups present in erythrocyte membrane cells. In spite of that, there are no studies about antimony enrichment in blood of workers exposed to high vehicle traffic. Port workers are generally exposed to heavy weight vehicle traffic. In Chile the biggest marine port is found in Valparaíso City. In this study antimony in whole blood and its fractions (erythrocytes-plasma and erythrocytes membranes-cytoplasm) of 45 volunteers were determined. The volunteers were port workers from Valparaíso city, and two control groups, one from Valparaíso and another from Quebrada Alvarado, the latter being a rural area located about 100 Km away from Valparaíso. The results demonstrate that port workers are highly impacted by antimony emissions from heavy weight vehicle traffic showing an average concentration of 27 +/- 9 ng Sb kg(-1), 5-10 times higher than the concentration of antimony in the blood of control groups. These are the highest antimony levels in blood ever reported in the literature. The highest antimony percentages (>60%) were always found in the erythrocyte fractions. However, the exposure degree to vehicle traffic is significant over antimony distribution in plasma, erythrocytes and cytoplasm. This results shows that the antimony mass in the erythrocyte membranes, was approximately constant at 1.0 +/- 0.1 ng Sb g(-1) of whole blood in all blood samples analyzed.

  1. REL 133 UOP Course Tutorial/TutorialRank

    OpenAIRE

    jhon

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 6 Times, Rating: A+   REL 133 Week 1 Individual Assignment Elements of Religious Traditions Paper (UOP Course) REL 133 Week 1 DQ 1 (UOP Course) REL 133 Week 1 DQ 2 (UOP Course) REL 133 Week 1 DQ 3 (UOP Course) REL 133 Week 1 DQ 4 (UOP Course) REL 133 Week 2 Individual Assignment Four Yogic Paths and Jainism Worksheet (UOP Course) REL 133 Week 2 DQ 1 (UOP Course) REL 133 W...

  2. 49 CFR 37.133 - Subscription service.

    Science.gov (United States)

    2010-10-01

    ... DISABILITIES (ADA) Paratransit as a Complement to Fixed Route Service § 37.133 Subscription service. (a) This... paratransit system, subject to the limitations in this section. (b) Subscription service may not absorb...

  3. 14 CFR 1264.133 - Evidence.

    Science.gov (United States)

    2010-01-01

    ... PENALTIES ACT OF 1986 § 1264.133 Evidence. (a) The presiding officer shall determine the admissibility of... outweighed by the danger of unfair prejudice, confusion of the issues, or by considerations of undue delay...

  4. Dicty_cDB: CHR133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR133 (Link to dictyBase) - - - Contig-U11110-1 | Contig-U13144-1 CHR...133P (Link to Original site) CHR133F 616 CHR133Z 142 CHR133P 738 - - Show CHR133 Library CH (Link to library) Clone ID CHR...10-1 | Contig-U13144-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR1-B/CHR...133Q.Seq.d/ Representative seq. ID CHR133P (Link to Original site) Representative DNA sequence >CHR133 (CHR...133Q) /CSM/CH/CHR1-B/CHR133Q.Seq.d/ TTTGTACCAGCATTCAAGGTAATTCCTTATTGGGGTACACAACAACAACGTACTACCATT

  5. Dicty_cDB: SSC133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSC133 (Link to dictyBase) - G02091 DDB0220658 Contig-U12246-1 SSC...133E (Link to Original site) - - - - - - SSC133E 474 Show SSC133 Library SS (Link to library) Clone ID SSC...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSC1-B/SSC133Q.Seq.d/ ...Representative seq. ID SSC133E (Link to Original site) Representative DNA sequence >SSC133 (SSC133Q) /CSM/SS/SSC1-B/SSC...30 (SSI330Q) /CSM/SS/SSI3-B/SSI330Q.Seq.d/ 620 e-177 SSC133 (SSC133Q) /CSM/SS/SSC1-B/SSC133Q.Seq.d/ 620 e-17

  6. Tin dioxide sol-gel derived films doped with platinum and antimony deposited on porous silicon

    NARCIS (Netherlands)

    Savaniu, C.; Arnautu, A.; Cobianu, C.; Craciun, G.; Flueraru, C.; Zaharescu, M.; Parlog, C.; Paszti, F.; Berg, van den A.

    1999-01-01

    SnO2 sol-gel derived thin films doped simultaneously with Pt and Sb are obtained and reported for the first time. The Sn sources were tin(IV) ethoxide or tin(II) ethylhexanoate, while hexachloroplatinic acid (H2PtCl6) and antimony chloride (SbCl3) were used as platinum and antimony sources, respecti

  7. Oxidation and mobilization of metallic antimony in aqueous systems with simulated groundwater

    Science.gov (United States)

    Ilgen, A. G.; Majs, F.; Barker, A. J.; Douglas, T. A.; Trainor, T. P.

    2014-05-01

    Antimony (Sb) is a contaminant of concern that can be present in elevated concentrations in shooting range soils due to mobilization from spent lead/antimony bullets. Antimony in shooting range soils has been observed as either metallic Sb(0) or as Sb(V) immobilized by iron (hydr)oxides. The absence of Sb(III) in soils is indicative of rapid Sb(III) oxidation to Sb(V) under surface soil conditions. However, the major controls on antimony oxidation and mobility are poorly understood. To better understand these controls we performed multiple batch experiments under oxic conditions to quantify the oxidation and dissolution of antimony in systems where Sb(0) is oxidized to Sb(III) and further to Sb(V). We also tested how variations in the aqueous matrix composition and the presence of metallic lead (Pb) affect the dissolution, solid phase speciation, and oxidation of antimony. We monitored changes in the aqueous antimony speciation using liquid chromatography inductively coupled plasma mass spectrometry (LC-ICP-MS). To test which solid phases form as a result of Sb(0) oxidation, and therefore potentially limit the mobility of antimony in our studied systems, we characterized the partially oxidized Sb(0) powders by means of extended X-ray absorption fine structure (EXAFS) spectroscopy and powder X-ray diffraction (XRD).

  8. Leishmania donovani: an in vitro study of antimony-resistant amphotericin B-sensitive isolates

    DEFF Research Database (Denmark)

    Sharief, Abdalla Hassan; Gasim Khalil, Eltahir Awad; Theander, Thor G;

    2006-01-01

    Drug sensitivity of clinically antimony-unresponsive Leishmania donovani isolates from Eastern Sudan was evaluated in an in vitro culture system against sodium stibogluconate (Pentostam) and Amphotericin B. Eight isolates, six from antimony-resistant and two from clinically responsive patients were...

  9. Research on Percolation Network and Physical Properties of Graphite/Antimony Composites

    Institute of Scientific and Technical Information of China (English)

    HU Ya-fei; HE Min; WANG Qi-li

    2006-01-01

    The microstructure, friction and wear behaviour of graphite preform and graphite/antimony composites are analysed based on the percolation theory of hydrodynamics to investigate the relationship between the percolation network and physical properties of graphite/antimony composites. The result shows that there are two important factors to enhance friction and wear behaviour of graphite/antimony composites at high temperature: 1) the formation of the pore network in the preform, which is called the first percolation and 2) the optimization of infiltration method in the process of infiltrating antimony, which is called the second percolation. By adding some pyrolysate and controlling the roasting process, perfect net pores and sub-micron percolation microstructure may be formed in the graphite preform. By controlling the infiltration process, the saturation of molten antimony infiltrating into perfect pores can be optimized.

  10. Testing of antimony selective media for treatment of liquid radwaste

    International Nuclear Information System (INIS)

    Nuclear power plants have sought radiation source term reduction and reduced discharge of radioactive constituents for many years. In the case of pressurized water reactors (PWRs), the latter efforts have been directed toward capture and immobilization of recalcitrant (ubiquitous radionuclides with long half-lives) species such as Cs-134 and Cs-137 and Co-58 and Co-60. As these plants resolved, or at least mitigated, the problems with radiocesium and radio-cobalt, antimony radionuclides (Sb-122, Sb-124, and Sb-125) have become a primary concern in liquid liquid radwaste systems Graver Technologies developed a granular composite metal oxide media with good selectivity for radio-antimony. Initial laboratory data were collected using non-radioactive salts of antimony, cesium, and cobalt to judge efficacy of selective removal of antimony. Based on success of those trials, the media, designated Gravex GX187, was tested in partnership with Energy Solutions (nee Duratek) using actual liquid liquid radwaste in two PWR plants. One of these plants performed extensive slip-stream trials comparing the GX187 with strong base anion resins. With more than 2500 bed volumes of throughput, the GX187 outperformed the other competitors by reducing both Sb-124 and Sb-125 radionuclides below minimum detectable activity (MDA) with average decontamination factors (DF's) of 170, even when subjected to high levels of borate. Based on these favorable results, Energy Solutions installed the GX187 in a layered bed in their ALPS liquid radwaste processing system at this plant in August 2005. After one year of intermittent, batchwise operation including an outage, the GX187 processed more than 2.25 million liters (>600,000 gallons) of liquid liquid radwaste while reducing the Sb-125 activity to 2.9 E-08 Bq/L (DF=111) on average. This evaluation is ongoing and will continue at least until the fall 2006 outage at this plant. Concurrently, Graver developed a second generation antimony selective

  11. 21 CFR 133.175 - Pasteurized cheese spread.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized cheese spread. 133.175 Section 133.175... Cheese and Related Products § 133.175 Pasteurized cheese spread. Pasteurized cheese spread is the food... statement of ingredients, prescribed for pasteurized process cheese spread by § 133.179, except that...

  12. Behavior of ruthenium, cesium and antimony during simulated HLLW vitrification

    International Nuclear Information System (INIS)

    The behavior of ruthenium, cesium, and antimony during the vitrification of simulated high-level radioactive liquid wastes (HLLW) in a liquid fed melter was studied on a laboratory scale and on a semi-pilot scale. In the laboratory melter of a 2.5 kg capacity, a series of tests with the simulate traced with 103Ru, 134Cs and 124Sb, has shown that the Ru and Cs losses to the melter effluent are generally higher than 10% whereas the antimony losses remain lower than 0.4%. A wet purification system comprising in series, a dust scrubber, a condenser, an ejector venturi and an NOx washing column retains most of the activity present in the off-gas so that the release fractions for Ru at the absolute filter inlet ranges between 5.10-3 to 5.10-5% of the Ru fed, for Cs the corresponding release fraction ranges between 3.10-3 to 10-4% and for Sb the release fraction ranges between 1.7 10-4 to 1.7 10-5%. The same experiments were performed at a throughput of 1 to 2 1 h-1 of simulated solution in the semi-pilot scale unit RUFUS. The RUFUS unit comprises a glass melter with a 50 kg molten glass capacity and the wet purification train comprises in series a dust scrubber, a condenser, an ejector venturi and an NOx washing column. The tracer tests were restricted to 103Ru and 134Cs since the laboratory tests had shown that the antimony losses were very low. The results of the tests are presented

  13. The Hydrothermal Chemistry of Gold, Arsenic, Antimony, Mercury and Silver

    Energy Technology Data Exchange (ETDEWEB)

    Bessinger, Brad; Apps, John A.

    2003-03-23

    A comprehensive thermodynamic database based on the Helgeson-Kirkham-Flowers (HKF) equation of state was developed for metal complexes in hydrothermal systems. Because this equation of state has been shown to accurately predict standard partial molal thermodynamic properties of aqueous species at elevated temperatures and pressures, this study provides the necessary foundation for future exploration into transport and depositional processes in polymetallic ore deposits. The HKF equation of state parameters for gold, arsenic, antimony, mercury, and silver sulfide and hydroxide complexes were derived from experimental equilibrium constants using nonlinear regression calculations. In order to ensure that the resulting parameters were internally consistent, those experiments utilizing incompatible thermodynamic data were re-speciated prior to regression. Because new experimental studies were used to revise the HKF parameters for H2S0 and HS-1, those metal complexes for which HKF parameters had been previously derived were also updated. It was found that predicted thermodynamic properties of metal complexes are consistent with linear correlations between standard partial molal thermodynamic properties. This result allowed assessment of several complexes for which experimental data necessary to perform regression calculations was limited. Oxygen fugacity-temperature diagrams were calculated to illustrate how thermodynamic data improves our understanding of depositional processes. Predicted thermodynamic properties were used to investigate metal transport in Carlin-type gold deposits. Assuming a linear relationship between temperature and pressure, metals are predicted to predominantly be transported as sulfide complexes at a total aqueous sulfur concentration of 0.05 m. Also, the presence of arsenic and antimony mineral phases in the deposits are shown to restrict mineralization within a limited range of chemical conditions. Finally, at a lesser aqueous sulfur

  14. Electrostatically defined silicon quantum dots with counted antimony donor implants

    Energy Technology Data Exchange (ETDEWEB)

    Singh, M., E-mail: msingh@sandia.gov; Luhman, D. R.; Lilly, M. P. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Center for Integrated Nanotechnologies, Sandia National Laboratories, Albuquerque, New Mexico 87175 (United States); Pacheco, J. L.; Perry, D.; Garratt, E.; Ten Eyck, G.; Bishop, N. C.; Wendt, J. R.; Manginell, R. P.; Dominguez, J.; Pluym, T.; Bielejec, E.; Carroll, M. S. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States)

    2016-02-08

    Deterministic control over the location and number of donors is crucial to donor spin quantum bits (qubits) in semiconductor based quantum computing. In this work, a focused ion beam is used to implant antimony donors in 100 nm × 150 nm windows straddling quantum dots. Ion detectors are integrated next to the quantum dots to sense the implants. The numbers of donors implanted can be counted to a precision of a single ion. In low-temperature transport measurements, regular Coulomb blockade is observed from the quantum dots. Charge offsets indicative of donor ionization are also observed in devices with counted donor implants.

  15. Antimony implanted strained Si for nMOSFET applications

    OpenAIRE

    Zamani, Atieh

    2009-01-01

    Incorporation of implanted antimony (Sb) in strained-silicon (s-Si) formed on relaxed-SiGe virtual substrates (10 and 30% Ge) has been studied. The implantation doses were 5×1013- 5×1014 cm-2 with an energy of 20 keV. The activation of dopant was performed by an rapid thermal annealing (RTA) treatment at 700 and 800 °C for 30 sec. Projected range of this implantation is about 20 nm which was also confirmed by different techniques. The layers were analyzed in terms of strain relaxation, sheet ...

  16. Solubility behaviour of antimony(III) and antimony(V) solids in basic aqueous solutions at 300{sup o}C

    Energy Technology Data Exchange (ETDEWEB)

    Lemire, R.J.; Tosello, N.B.; Halliday, J.D

    1999-12-01

    The major contributions of the isotopes {sup 122}Sb and {sup 124}Sb to activity transport in a CANDU reactor primary heat transport system (HTS), have been associated with oxygen ingress during reactor shutdown. As part of a program to minimize the release and redeposition of these isotopes, the solubilities of antimony(III) and (V) oxides and salts have been measured in basic solutions at temperatures from 25 to 300{sup o}C. The results provide information on the charge and the stability as a function of temperature of antimony solution species and, hence, a guide to the trends in the temperature dependence of the solubilities of antimony solids. In solutions in which oxidation of antimony(III) to antimony(V) is minimized, the solubility of Sb{sub 2}O{sub 3} increases by about two orders of magnitude between 25 and 200{sup o}C, and then levels out or decreases slightly. At 250{sup o}C, in oxidizing solutions, Sb{sub 2}O{sub 5}{center_dot}xH{sub 2}O and simple sodium antimonate(V) were found to be unstable in sodium hydroxide solutions with respect to the solid, Na{sub 2{alpha}}[H(H{sub 2}O)]{sub 2-2{alpha}}Sb{sub 2}O{sub 6}, which has a pyrochlore structure. The solubility of this partially protonated sodium antimonate increases from 25 to 200{sup o}C and decreases at temperatures above 250{sup o}C. These solubility changes for the antimony (V) solids reflect changes in the stability of the anionic antimony solution species (SbO{sub 3}{sup -} or Sb(OH){sub 6}{sup -}), even though the compositions of antimony-containing solids in basic oxidizing solutions are strongly dependent on the cations and their aqueous phase concentrations. All solids used in the present experiments would be expected to generate total solution antimony concentrations {>=} 0.00005 mol{center_dot}dm{sup -3} in any neutral or basic aqueous solutions (assuming no added sodium salts). Therefore, under HTS conditions, precipitation of any antimony oxides or mixed oxides is unlikely. It cannot be

  17. Antimony removal from the polyethylene terephthalate manufacture wastewater

    Directory of Open Access Journals (Sweden)

    Tomas Vengris

    2010-04-01

    Full Text Available In this study, antimony removal by coagulation from polyethylene terephthalate resin production wastewater of „Orion Global PET“ factory in Klaipėda city was investigated, with regard to the dependence of coagulant type and dosage, pH and presence of organics. FeCl3 ∙6H2O, FeSO4 ∙7H2O, AlCl3∙6H2O and TiCl4 salts were used as coagulants. Ti(IV and Fe(III revealed oneself to be the most effective coagulants. Antimony removal effectiveness is moderate and low using FeSO4 ∙7H2O and AlCl3∙6H2O coagulants, respectively. The addition of 10 mg dm-3 Ti(IV and 30 mg dm-3 Fe(III reduces by ~98% of the Sb, when the initial amount of Sb in wastewater is about 1200 mkg/l. The action of Fe(III is practically independent in the pH range 4-9, and that of Ti(IV slightly decreases in the same pH interval. The Sb amount in wastewater can be reduced to 13-20 mkg dm-3, while the initial Sb concentration is 1200 mkg dm-3. The presence of organic compounds in wastewater determines the reduction of Sb removal by coagulation.

  18. Alkali oxide-tantalum, niobium and antimony oxide ionic conductors

    Science.gov (United States)

    Roth, R. S.; Brower, W. S.; Parker, H. S.; Minor, D. B.; Waring, J. L.

    1975-01-01

    The phase equilibrium relations of four systems were investigated in detail. These consisted of sodium and potassium antimonates with antimony oxide and tantalum and niobium oxide with rubidium oxide as far as the ratio 4Rb2O:llB2O5 (B=Nb, Ta). The ternary system NaSbO3-Sb2O4-NaF was investigated extensively to determine the actual composition of the body centered cubic sodium antimonate. Various other binary and ternary oxide systems involving alkali oxides were examined in lesser detail. The phases synthesized were screened by ion exchange methods to determine mobility of the mobility of the alkali ion within the niobium, tantalum or antimony oxide (fluoride) structural framework. Five structure types warranted further investigation; these structure types are (1) hexagonal tungsten bronze (HTB), (2) pyrochlore, (3) the hybrid HTB-pyrochlore hexagonal ordered phases, (4) body centered cubic antimonates and (5) 2K2O:3Nb2O5. Although all of these phases exhibit good ion exchange properties only the pyrochlore was prepared with Na(+) ions as an equilibrium phase and as a low porosity ceramic. Sb(+3) in the channel interferes with ionic conductivity in this case, although relatively good ionic conductivity was found for the metastable Na(+) ion exchanged analogs of RbTa2O5F and KTaWO6 pyrochlore phases.

  19. Antimony contamination and its effect on Trifolium plants

    Science.gov (United States)

    Corrales, Isabel; Barceló, Juan; Bech, Jaume; Poschenrieder, Charlotte

    2014-05-01

    Antimony is not an essential element and soil Sb contents usually are low.However, soil contamination by Sb has increased in the last years due to the human activities (combustion of fossil fuels, mining, waste incineration, smelting, shooting and road traffic). The main objective of this work was to study the effect of different concentrations of antimony (KSb(OH)6) in order to evaluate the effect on growth and Sb uptake on Trifolium pratense cv. Milvus and Trifolium repens. Our results show that Sb accumulated both in roots and shoots of clover without any negative effect on root growth, cellular viability and lipid peroxidation. This absence of toxicity sympthoms in clover plants could be very dangerous because Sb can be inadvertedly incorporated into the trophic chain causing toxic effects both in animals and humans. The absence of toxic effects on plants does not seem to be due to detoxification by phytochelatins because the use of the gamma-glutamylcysteine synthetase inhibitor, L-buthionine-[S,R]-sulphoximine (BSO) did not enhance Sb toxicity to plants. (Supported by the Spanish MICINN project BFU2010-14873)

  20. Thermal decomposition kinetics of antimony oxychloride in air

    Institute of Scientific and Technical Information of China (English)

    阳卫军; 唐谟堂; 金胜明

    2002-01-01

    The DTA and XRD techniques were employed to study thermal decomposition mechanism of antimony oxychloride SbOCl in the air. The thermal decomposition reaction occurs in four steps, and the former three steps as: SbOCl(s)→Sb4O5Cl2(s)+SbCl3(g)→Sb8O11Cl2(s)+SbCl3(g)→Sb2O3(s)+SbCl3(g). The forth step is the oxidation of Sb2O3 by air, Sb2O3(s)+O2→Sb2O4(s). The activation energy and the order of the thermal decomposition reaction of antimony oxychloride in three steps presented in DTA curves were calculated according to Kinssinger methods from DTA curves. The values of activation energy and the order are respectively 91.97kJ/mol, 0.73 in the first step, 131.14kJ/mol, 0.63 in the second step and 146.94kJ/mol, 1.58 in the third step.

  1. BSA activated CdTe quantum dot nanosensor for antimony ion detection.

    Science.gov (United States)

    Ge, Shenguang; Zhang, Congcong; Zhu, Yuanna; Yu, Jinghua; Zhang, Shuangshuang

    2010-01-01

    A novel fluorescent nanosensor for Sb(3+) determination was reported based on thioglycolic acid (TGA)-capped CdTe quantum dot (QD) nanoparticles. It was the first antimony ion sensor using QD nanoparticles in a receptor-fluorophore system. The water-soluable TGA-capped CdTe QDs were prepared through a hydrothermal route, NaHTe was used as the Te precursor for CdTe QDs synthesis. Bovine serum albumin (BSA) conjugated to TGA-capped CdTe via an amide link interacting with carboxyl of the TGA-capped CdTe. When antimony ion enters the BSA, the lone pair electrons of the nitrogen and oxygen atom become involved in the coordination, switching off the QD emission and a dramatic quenching of the fluorescence intensity results, allowing the detection of low concentrations of antimony ions. Using the operating principle, the antimony ion sensor based on QD nanoparticles showed a very good linearity in the range 0.10-22.0 microg L(-1), with the detection limit lower than 2.94 x 10(-8) g L(-1) and the relative standard deviation (RSD) 2.54% (n = 6). In a study of interferences, the antimony-sensitive TGA-QD-BSA sensor showed good selectivity. Therefore, a simple, fast, sensitive, and highly selective assay for antimony has been built. The presented method has been applied successfully to the determination of antimony in real water samples (n = 6) with satisfactory results.

  2. Removal of cobalt from zinc sulphate solution using rude antimony trioxide as additive

    Institute of Scientific and Technical Information of China (English)

    戴军; 王德全; 姜澜; 金曼

    2002-01-01

    The process of cobalt removal from zinc sulphate solution using rude antimony trioxide as an additive was investigated. The rude antimony trioxide was produced in treatment of copper and lead anode mud and its main components are antimony trioxide, antimony arsenate and lead antimonate. Using the rude antimony trioxide as the additive of cobalt removal can not only decrease operation cost of purification but also find out a new way for utilization of the rude antimony trioxide. The effects of temperature, dosage of zinc dust, the rude antimony trioxide, copper ion and solution pH on removal of cobalt were studied. And experimental data using the rude Sb2O3 as additive were compared with those using Sb2O3. The results indicate that using rude Sb2O3 as additive, cobalt concentration in solution could be decreased from 24mg/L to below 1mg/L under about the same conditions as using Sb2O3.

  3. Leaching Mechanism of Complicated Antimony-Lead Concentrate and Sulfur Formation in Slurry Electrolysis

    Institute of Scientific and Technical Information of China (English)

    WangChengyan; QiuDingfan; JiangPeihai

    2004-01-01

    Anodic reaction mechanism of complicated antimony-lead concentrate in slurry electrolysis was investigated by the anodic polarization curves determined under various conditions. The main reactions on the anode are the oxidations of FeCln(2-n) . Though the oxidation of jamesonite particle on the anode can occur during the whole process, it is less. With the help of mineralogy studies and relevant tests, the leaching reaction mechanism of jameson[to and gudmundite during slurry electrolysis was ascertained. Because of the oxidation reaction of FeCl3 produced by antimony-lead concentrate itself, the non-oxidation complex acid dissolution of jameson[re, the oxidation complex acid dissolution of gudmundite, and the oxidation of air carried by stirring, the leaching ratio of antimony reaches about 35% when HCl-NH4Cl solution is used to leach antimony-lead concentrate directly. So when the theoretical electric quantity is given to oxidation of antimony in slurry electrolysis, all of antimony, lead and iron containing in antimony-lead concentrate, are leached. The formation of sulfur is through the directly redox reaction of Fe3+ and jameson[re. The S2- in jamesonite is oxidized into S0 , and forms the crystals of sulfur again on the spot. The redox reaction of Fe3+ and H2S formed by non-oxidative acid dissolution of jamesonite is less.

  4. In Vitro Antiparasitic and Apoptotic Effects of Antimony Sulfide Nanoparticles on Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Saied Soflaei

    2012-01-01

    Full Text Available Visceral leishmaniasis is one of the most important sever diseases in tropical and subtropical countries. In the present study the effects of antimony sulfide nanoparticles on Leishmania infantum in vitro were evaluated. Antimony sulfide NPs (Sb2S5 were synthesized by biological method from Serratia marcescens bacteria. Then the cytotoxicity effects of different concentrations (5, 10, 25, 50, and 100 μg/mL of this nanoparticle were assessed on promastigote and amastigote stages of L. infantum. MTT method was used for verification results of promastigote assay. Finally, the percentages of apoptotic, necrotic, and viable cells were determined by flow cytometry. The results indicated the positive effectiveness of antimony sulfide NPs on proliferation of promastigote form. The IC50 (50% inhibitory concentration of antimony sulfide NPs on promastigotes was calculated 50 μg/mL. The cytotoxicity effect was dose-dependent means by increasing the concentration of antimony sulfide NPs, the cytotoxicity curve was raised and the viability curve of the parasite dropped simultaneously. Moreover, the IC50 of antimony sulfide NPs on amastigote stage was calculated 25 μg/mL. On the other hand, however, antimony sulfide NPs have a low cytotoxicity effect on uninfected macrophages but it can induce apoptosis in promastigote stage at 3 of 4 concentrations.

  5. Segregation of antimony in InP in MOVPE

    Energy Technology Data Exchange (ETDEWEB)

    Weeke, Stefan

    2008-07-01

    In this work the segregation of antimony in indium phosphide in metal organic vapour phase epitaxy (MOVPE)was systematically investigated. Therefore phosphine stabilized InP surfaces were treated with tri-methyl-antimony (TMSb) in MOVPE. An antimony rich Sb/InP surface was established, showing a typical spectra for the antimonides observed in reflectance anisotropy spectroscopy (RAS).Adsorption and desorption of antimony are investigated, as well as the incorporation of Sb during overgrowth of the Sb/InP surface with InP. Therefore the growth parameters temperature, TMSb partial pressure and treatment time are varied and their influence investigated. The experiments are monitored in-situ with RAS, the achieved data is correlated with ex-situ characterisation such as X-ray diffraction (XRD) and secondary ion mass spectroscopy (SIMS). It is shown that under treatment with TMSb a stable Sb/InP surface is formed within seconds, which does not change under further TMSb treatment. This process is rarely influenced by the TMSb partial pressure. On the contrary, the desorption of Sb is a very slow process. Two main processes can be distinguished: The desorption of excess Sb from the surface and the formation of the MOVPE prepared InP (2 x 1) surface. The reaction velocity of adsorption and desorption increases with temperature. Above a critical value the increase of TMSb partial pressure has no influence on the time for desorption. During overgrowth of the Sb/InP surface the opposite temperature dependence is observed: with increasing growth temperature the typical spectra for antimonides is observed longer. An analysis of the grown samples with XRD and SIMS showed the formation of an InPSb double quantum well. One layer is formed at the interface, the second one 50 nm-120 nm deep in the InP. The location of the 2nd InPSb layer can be correlated with the vanishing of the Sb signature in RAS. The distance between the quantum wells increases with growth temperature, until it

  6. Control of AC133/CD133 and impact on human hematopoietic progenitor cells through nucleolin.

    Science.gov (United States)

    Bhatia, S; Reister, S; Mahotka, C; Meisel, R; Borkhardt, A; Grinstein, E

    2015-11-01

    AC133 is a prominent surface marker of CD34+ and CD34- hematopoietic stem/progenitor cell (HSPC) subsets. AC133+ HSPCs contain high progenitor cell activity and are capable of hematopoietic reconstitution. Furthermore, AC133 is used for prospective isolation of tumor-initiating cells in several hematological malignancies. Nucleolin is a multifunctional factor of growing and cancer cells, which is aberrantly active in certain hematological neoplasms, and serves as a candidate molecular target for cancer therapy. Nucleolin is involved in gene transcription and RNA metabolism and is prevalently expressed in HSPCs, as opposed to differentiated hematopoietic tissue. The present study dissects nucleolin-mediated activation of surface AC133 and its cognate gene CD133, via specific interaction of nucleolin with the tissue-dependent CD133 promoter P1, as a mechanism that crucially contributes to AC133 expression in CD34+ HSPCs. In mobilized peripheral blood (MPB)-derived HSPCs, nucleolin elevates colony-forming unit (CFU) frequencies and enriches granulocyte-macrophage CFUs. Furthermore, nucleolin amplifies long-term culture-initiating cells and also promotes long-term, cytokine-dependent maintenance of hematopoietic progenitor cells. Active β-catenin, active Akt and Bcl-2 levels in MPB-derived HSPCs are nucleolin-dependent, and effects of nucleolin on these cells partially rely on β-catenin activity. The study provides new insights into molecular network relevant to stem/progenitor cells in normal and malignant hematopoiesis. PMID:26183533

  7. Varicella zoster virus reactivation during or immediately following treatment of tegumentary leishmaniasis with antimony compounds

    Directory of Open Access Journals (Sweden)

    Andrea Barbieri Barros

    2014-07-01

    Full Text Available Antimony compounds are the cornerstone treatments for tegumentary leishmaniasis. The reactivation of herpes virus is a side effect described in few reports. We conducted an observational study to describe the incidence of herpes zoster reactivation during treatment with antimony compounds. The global incidence of herpes zoster is approximately 2.5 cases per 1,000 persons per month (or 30 cases per 1,000 persons per year. The estimated incidence of herpes zoster in patients undergoing antimony therapy is higher than previously reported.

  8. Structural and optical characterization of thermally evaporated bismuth and antimony films for photovoltaic applications

    Science.gov (United States)

    Srimathy, N.; Ruban Kumar, A.

    2016-05-01

    In this present study, the thin film of bismuth and antimony is coated by thermal evaporation system equipped with the inbuilt ultra high vacuum system. XRD analysis confirmed the rhombohedral structure of Bismuth and Antimony on the prepared film. The surface roughness and physical appearance is analyzed by Atomic force microscopy. The results of Raman Spectroscopy show the wave functions and the spectrum of electrons. The preparation technique and conditions strongly influence the crystalline structure and the phase composition of bismuth and antimony thin films. The electrical and optical properties for the prepared film are analyzed. The results show a great interest and promising applications in Photovoltaic devices.

  9. 21 CFR 133.183 - Romano cheese.

    Science.gov (United States)

    2010-04-01

    ... Products § 133.183 Romano cheese. (a) Romano cheese is the food prepared from cow's milk or sheep's milk or... purposes of this section, the word “milk” means cow's milk or goat's milk or sheep's milk or mixtures of... of cow's milk) by adding one or more of the following: Cream, skim milk, concentrated skim......

  10. 5 CFR 1201.133 - Judicial review.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Judicial review. 1201.133 Section 1201... review. An employee, former employee, or applicant for employment who is adversely affected by a final... review of the decision in the United States Court of Appeals for the Federal Circuit. 5 U.S.C....

  11. 7 CFR 1150.133 - Nominations.

    Science.gov (United States)

    2010-01-01

    ... and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order National Dairy Promotion and Research Board § 1150.133 Nominations. Nominations for members of the..., the Secretary shall announce at least 120 days in advance when a Board member's term is expiring...

  12. Cerebral blood flow tomography with xenon-133

    DEFF Research Database (Denmark)

    Lassen, N A

    1985-01-01

    Cerebral blood flow (CBF) can be measured tomographically by inhalation of Xenon-133. The calculation is based on taking a sequence of tomograms during the wash-in and wash-out phase of the tracer. Due to the dynamic nature of the process, a highly sensitive and fast moving single photon emission...

  13. 27 CFR 9.133 - Rutherford.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Rutherford. 9.133 Section... Rutherford. (a) Name. The name of the viticultural area described in this section is “Rutherford.” (b) Approved maps. The appropriate maps for determining the boundary of the Rutherford viticultural area...

  14. 40 CFR 141.133 - Compliance requirements.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Disinfectant Residuals, Disinfection Byproducts, and Disinfection Byproduct Precursors § 141.133 Compliance requirements. (a) General requirements. (1) Where... chlorine or chloramine, the system is out of compliance at the end of that quarter. (b)...

  15. Coordination- and Redox-Noninnocent Behavior of Ambiphilic Ligands Containing Antimony.

    Science.gov (United States)

    Jones, J Stuart; Gabbaï, François P

    2016-05-17

    Stimulated by applications in catalysis, the chemistry of ambiphilic ligands featuring both donor and acceptor functionalities has experienced substantial growth in the past several years. The unique opportunities in catalysis offered by ambiphilic ligands stem from the ability of their acceptor functionalities to play key roles via metal-ligand cooperation or modulation of the reactivity of the metal center. Ligands featuring group 13 centers, most notably boranes, as their acceptor functionalities have undoubtedly spearheaded these developments, with remarkable results having been achieved in catalytic hydrogenation and hydrosilylation. Motivated by these developments as well as by our fundamental interest in the chemistry of heavy group 15 elements, we became fascinated by the possibility of employing antimony centers as Lewis acids within ambiphilic ligands. The chemistry of antimony-based ligands, most often encountered as trivalent stibines, has historically been considered to mirror that of their lighter phosphorus-based congeners. There is growing evidence, however, that antimony-based ligands may display unique coordination behavior and reactivity. Additionally, despite the diverse Lewis acid and redox chemistry that antimony exhibits, there have been only limited efforts to explore this chemistry within the coordination sphere of a transition metal. By incorporation of antimony into the framework of polydentate ligands in order to enforce the main group metal-transition metal interaction, the effect of redox and coordination events at the antimony center on the structure, electronics, and reactivity of the metal complex may be investigated. This Account describes our group's continuing efforts to probe the coordination behavior, reactivity, and application of ambiphilic ligands incorporating antimony centers. Structural and theoretical studies have established that both Sb(III) and Sb(V) centers in polydentate ligands may act as Z-type ligands toward late

  16. Coordination- and Redox-Noninnocent Behavior of Ambiphilic Ligands Containing Antimony.

    Science.gov (United States)

    Jones, J Stuart; Gabbaï, François P

    2016-05-17

    Stimulated by applications in catalysis, the chemistry of ambiphilic ligands featuring both donor and acceptor functionalities has experienced substantial growth in the past several years. The unique opportunities in catalysis offered by ambiphilic ligands stem from the ability of their acceptor functionalities to play key roles via metal-ligand cooperation or modulation of the reactivity of the metal center. Ligands featuring group 13 centers, most notably boranes, as their acceptor functionalities have undoubtedly spearheaded these developments, with remarkable results having been achieved in catalytic hydrogenation and hydrosilylation. Motivated by these developments as well as by our fundamental interest in the chemistry of heavy group 15 elements, we became fascinated by the possibility of employing antimony centers as Lewis acids within ambiphilic ligands. The chemistry of antimony-based ligands, most often encountered as trivalent stibines, has historically been considered to mirror that of their lighter phosphorus-based congeners. There is growing evidence, however, that antimony-based ligands may display unique coordination behavior and reactivity. Additionally, despite the diverse Lewis acid and redox chemistry that antimony exhibits, there have been only limited efforts to explore this chemistry within the coordination sphere of a transition metal. By incorporation of antimony into the framework of polydentate ligands in order to enforce the main group metal-transition metal interaction, the effect of redox and coordination events at the antimony center on the structure, electronics, and reactivity of the metal complex may be investigated. This Account describes our group's continuing efforts to probe the coordination behavior, reactivity, and application of ambiphilic ligands incorporating antimony centers. Structural and theoretical studies have established that both Sb(III) and Sb(V) centers in polydentate ligands may act as Z-type ligands toward late

  17. Synthesis and characterisation of nano-pore antimony imprinted polymer and its use in the extraction and determination of antimony in water and fruit juice samples.

    Science.gov (United States)

    Shakerian, Farid; Dadfarnia, Shayessteh; Haji Shabani, Ali Mohammad; Nili Ahmad Abadi, Maryam

    2014-02-15

    A solid phase extraction method using antimony ion imprinted polymer (IIP) sorbent combined with electrothermal atomic absorption spectrometry (ETAAS) was developed for the extraction and speciation of antimony. The sorbent has been synthesised in the presence of Sb(III) and ammonium pyrrolidine dithiocarbamate (APDC) using styrene as the monomer and ethylene glycol dimethacrylate (EGDMA) as the cross linker. The imprinted Sb(III) ions were removed by leaching with HCl (50%v/v) and the polymer was characterised by FT-IR and scanning electron microscopy. The maximum sorption capacity of the IIP for Sb(III) ions was found to be 6.7 mg g(-1). With preconcentration of 60 mL of sample, an enhancement factor of 232 and detection limit of 3.9 ng L(-1) was obtained. Total antimony was determined after the reduction of Sb(V) to Sb(III). The method was successfully applied to the determination of antimony species in water samples and total antimony in fruit juices.

  18. Biogeochemistry of Antimony(V) in Microcosms under Sulfidogenic Conditions

    Science.gov (United States)

    O'Loughlin, E. J.; Johnson, C. R.; Antonopoulos, D. A.; Boyanov, M.; Flynn, T. M.; Koval, J. C.; Kemner, K. M.

    2015-12-01

    As the mining and use of antimony continues to increase, environmental concerns involving the element have grown. Antimony(V) and (III) are the two most environmentally-relevant oxidation states, but little is known about the redox transitions between the two in natural systems. To better understand the behavior of antimony in anoxic environments, we examined the transformations of Sb(V) under Fe(III)- and sulfate-reducing conditions in aqueous suspensions that contained 2 mM KSb(OH)6, 50 mM Fe(III) (as ferrihydrite), 10 mM sulfate, and 10 mM lactate, and were inoculated with sediment from a wetland on the campus of Argonne National Laboratory in Argonne, Illinois. Samples were collected over time to track changes in the concentrations of Sb, Fe(II), sulfate, and lactate, as well as the composition of the microbial community as determined by 16S rRNA gene inventories. We also examined the interaction of Sb(V) with pure Fe(II) mineral phases in aqueous suspensions containing 2 mM KSb(OH)6 and 50 mM Fe(II) as either magnetite, sideritre, vivianite, green rust, or mackinawite. X-ray absorption fine-structure spectroscopy was used to determine the valence state of Sb and its chemical speciation. Lactate was rapidly fermented to acetate and propionate concomittant with a bloom of Veillonellaceae. Utilization of propionate for dissimilatory sulfate reduction (DSR) was accompanied by an increase in Desulfobulbaceae. Sb K-edge X-Ray absorption near edge structure (XANES) analysis showed reduction of Sb(V) to Sb(III) within 4 weeks, concurrent with DSR and the formation of FeS. We observed variable responses in the ability of specific Fe(II) minerals to reduce Sb(V). No reduction was observed with magnetite, siderite, vivianite, or green rust. In the presence of mackinawite (FeS), however, Sb(V) was reduced to Sb(III) sulfide. These results suggest that the reduction of Sb(V) to Sb(III) is not likely under solely Fe(III)-reducing conditions, but is expected in sulfidogenic

  19. Geochemical Studies on Dachang Antimony Ore Deposit in Qinglong,Guizhou Province

    Institute of Scientific and Technical Information of China (English)

    张启厚

    1999-01-01

    The Dachang antimony deposit in Qinglong,Guizhou Province,is strictly controlled by the “Dachang Layer” which is a complex altered rock occurring at unconformity between the Permian Emeishan basalt and the Maokou limestone.Based on the studies of the hanging-and foot-wall rocks,the trace elements and REE contents of the rocks and ores and heavy placer minerals in the basalt,this paper is focused on the relations between these data and the “Dachang Layer”and its hanging- and oot-wall rocks.The author pointed out that the “Dachang Layer” and basalt are the source-beds of antimony;ilmenite and magnetite are the major mineral carriers of antimony.In the processes of halmyrosis and burial metamorphism of the “Dachang Layer” an basalt,antimony was mobilized along with the mobilization of iron and was preliminarily concentrated in the“ Dachang Layer”.

  20. Effect of filler on the self-lubrication performance of graphite antimony composites

    Institute of Scientific and Technical Information of China (English)

    WANG Qi-li; HU Ya-fei; HE Min

    2008-01-01

    Graphite antimony composites were prepared using a mechanical pressure infiltration method to force molten antimony into graphite preforms having a percolation micro-structure and a hop-pocket power filler. The micro-structural and macroscopic properties of the graphite antimony composites were analysed. Observations included metallographic analysis, physical properties and friction and wear behaviour. The results show that the wear loss is decreased by 12.24% and that the friction coefficient is re-duced by 32.61% after hop-pocket power was used. The research indicates that the hop-pocket power method gives a useful way to reduce friction coefficients and wear loss, and to increase service life and self-lubrication properties, of the graphite antimony seal-ing material as compared to carbon black.

  1. Geochemistries of arsenic, antimony, mercury, and related elements in sediments of puget sound

    Science.gov (United States)

    Crecelius, E.A.; Bothner, Michael H.; Carpenter, R.

    1975-01-01

    The natural distributions of arsenic, antimony mercury, chromium, cobalt, iron, aluminum, and carbon in the surface sediments of Puget Sound are perturbed by two major anthropogenic sources of trace metals: a copper smelter near Tacoma, Wash., that discharges large amounts of arsenic and antimony, and a chlor-alkali plant in Bellingham, Wash., which, in the recent past, discharged significant amounts of mercury. Arsenic and antimony inputs from the smelter over the past 80 years are evident in sediment cores whose accumulation rates have been determined by the lead-210 technique. An arsenic budget for Puget Sound reveals the importance of atmospheric input resulting from smokestack emissions of the smelter. Chemical extraction studies of sediments showed that more than 82% of the mercury was associated with easily oxidizable organic matter, whereas about 50% of both arsenic and antimony was associated with extractable iron and aluminum compounds.

  2. NEW THIO S2- ADDUCTS WITH ANTIMONY (III AND V HALIDE: SYNTHESIS AND INFRARED STUDY

    Directory of Open Access Journals (Sweden)

    HASSAN ALLOUCH

    2013-12-01

    Full Text Available Five new S2- adducts with SbIII and SbV halides have been synthesized and studied by infrared. Discrete structures have been suggested, the environment around the antimony being tetrahedral, trigonal bipyramidal or octahedral.

  3. Crystal structure and thermodynamic properties of potassium antimony tungsten oxide

    Energy Technology Data Exchange (ETDEWEB)

    Knyazev, Aleksandr V., E-mail: knav@uic.nnov.ru [Nizhny Novgorod State University, Gagarin Prospekt 23/2, Nizhny Novgorod, 603950 (Russian Federation); Tananaev, Ivan G. [Institute of Physical Chemistry and Electrochemistry, Russian Academy of Sciences, 31 Leninsky prospect, Moscow GSP-1, 119991 (Russian Federation); Kuznetsova, Nataliya Yu.; Smirnova, Nataliya N.; Letyanina, Irene A.; Ladenkov, Igor V. [Nizhny Novgorod State University, Gagarin Prospekt 23/2, Nizhny Novgorod, 603950 (Russian Federation)

    2010-02-20

    In the present work potassium antimony tungsten oxide with pyrochlore structure is refined by the Rietveld method (space group Fd3m, Z = 8). The temperature dependences of heat capacity have been measured for the first time in the range from 7 to 370 K for this compound. The experimental data were used to calculate standard thermodynamic functions, namely the heat capacity C{sub p}{sup o}(T), enthalpy H{sup o}(T) - H{sup o}(0), entropy S{sup o}(T) - S{sup o}(0) and Gibbs function G{sup o}(T) - H{sup o}(0), for the range from T {yields} 0 to 370 K. The differential scanning calorimetry was applied to measure the incongruent melting temperature of compound under study. The high-temperature X-ray diffraction was used for the determining thermal expansion coefficients.

  4. Coherent and Incoherent Structural Dynamics in Laser-Excited Antimony

    CERN Document Server

    Waldecker, Lutz; Bertoni, Roman; Vasileiadis, Thomas; Garcia, Martin E; Zijlstra, Eeuwe S; Ernstorfer, Ralph

    2016-01-01

    We investigate the excitation of phonons in photoexcited antimony and demonstrate that the entire electron-lattice interactions, in particular coherent and incoherent electron-phonon coupling, can be probed simultaneously. Using femtosecond electron diffraction (FED) with high temporal resolution, we observe the coherent excitation of the fully symmetric \\Ag\\ optical phonon mode via the shift of the minimum of the atomic potential energy surface. Molecular dynamics simulations are performed to quantify the change in lattice potential and the associated real-space amplitude of the coherent atomic oscillations. In addition, our experimental configuration allows observing the energy transfer from electrons to phonons via incoherent electron-lattice scattering events. Applying a modified two-temperature model, the electron-phonon coupling is determined from the data as a function of electronic temperature.

  5. Atomistic mechanisms governing structural stability change of zinc antimony thermoelectrics

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Xiaolong [Frontier Institute of Science and Technology, Xi' an Jiaotong University, Xi' an 710054 (China); Lin, Jianping, E-mail: jaredlin@163.com [School of Materials Science and Engineering, Xiamen University of Technology, Xiamen 361024 (China); Qiao, Guanjun [State Key Laboratory for Mechanical Behavior of Materials, Xi' an Jiaotong University, Xi' an 710049 (China); Wang, Zhao, E-mail: zwangzhao@gmail.com [Frontier Institute of Science and Technology, Xi' an Jiaotong University, Xi' an 710054 (China); State Key Laboratory for Mechanical Behavior of Materials, Xi' an Jiaotong University, Xi' an 710049 (China)

    2015-01-05

    The structural stability of thermoelectric materials is a subject of growing importance for their energy harvesting applications. Here, we study the microscopic mechanisms governing the structural stability change of zinc antimony at its working temperature, using molecular dynamics combined with experimental measurements of the electrical and thermal conductivity. Our results show that the temperature-dependence of the thermal and electrical transport coefficients is strongly correlated with a structural transition. This is found to be associated with a relaxation process, in which a group of Zn atoms migrates between interstitial sites. This atom migration gradually leads to a stabilizing structural transition of the entire crystal framework, and then results in a more stable crystal structure of β–Zn{sub 4}Sb{sub 3} at high temperature.

  6. Antimonial drugs entrapped into phosphatidylserine liposomes: physicochemical evaluation and antileishmanial activity

    OpenAIRE

    Samanta Etel Treiger Borborema; João Alberto Osso Junior; Heitor Franco de Andrade Junior; Nanci do Nascimento

    2016-01-01

    Abstract: INTRODUCTION: Leishmaniasis is a disease caused by the protozoan Leishmania that resides mainly in mononuclear phagocytic system tissues. Pentavalent antimonials are the main treatment option, although these drugs have toxic side effects and high resistance rates. A potentially alternative and more effective therapeutic strategy is to use liposomes as carriers of the antileishmanial agents. The aims of this study were to develop antimonial drugs entrapped into phosphatidylserine l...

  7. New low-antimony alloy for straps and cycling service in lead-acid batteries

    Science.gov (United States)

    Prengaman, R. David

    Lead-antimony alloys used for the positive grids in lead-acid batteries for cycling service have generally used antimony contents of 4.5 wt.% and above. Tubular batteries for cycling service that impart high compression of the active material to the grid surface via gauntlet use alloys with antimony contents as low as 1.5 wt.%. These batteries are generally employed in less-severe cycling service. Value-regulated lead-acid (VRLA) batteries can give good cycling service without lead-antimony in the positive grid, but require a high tin content and high compression. The change in automotive battery positive grid alloys to lead-calcium-tin and the tin contents of VRLA positive grids and straps have dramatically increased the tin content of the recycled grid and strap lead in the USA, Europe, and Australia. The higher tin contents can contaminate the lead used for lead-antimony battery grids and generally must be removed to low levels to meet the specifications. This study describes a low-antimony alloy that contains a substantial amount of tin. The high tin content reduces the rate of corrosion of low-antimony positive grid alloys, improves conductivity, increases the bond between the grid and the active material, and cycles as well as the traditional 5-6 wt.% antimony alloys employed in conventional flat-plate batteries. The alloy is also used as a corrosion-resistant cast-on strap alloy for automotive batteries for high temperature service, as well as for posts, bushings, and connectors for all wet batteries.

  8. Intercomparision of Standardized Radioactive Solution of 133Ba

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>133Ba is a very important nuclide in the field of radiation, for example applied to efficienency calibration of the γ spectromenter. To ensure the accurate and reliable of measurement results of 133Ba, to

  9. 21 CFR 133.186 - Sap sago cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  10. Deletion 22q13.3 syndrome

    OpenAIRE

    Phelan Mary C

    2008-01-01

    Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndr...

  11. 27 CFR 40.133 - Amount of individual bond.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Amount of individual bond. 40.133 Section 40.133 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU..., AND PROCESSED TOBACCO Bonds and Extensions of Coverage of Bonds § 40.133 Amount of individual...

  12. 21 CFR 133.124 - Cold-pack cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cold-pack cheese food. 133.124 Section 133.124 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD... Cheese and Related Products § 133.124 Cold-pack cheese food. (a)(1) Cold-pack cheese food is the...

  13. 46 CFR 133.130 - Stowage of survival craft.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Stowage of survival craft. 133.130 Section 133.130... SYSTEMS Requirements for All OSVs § 133.130 Stowage of survival craft. (a) General. Each survival craft must be stowed as follows: (1) Each survival craft must be as close to the accommodation and...

  14. 19 CFR 133.21 - Articles bearing counterfeit trademarks.

    Science.gov (United States)

    2010-04-01

    ...: “The sample described as and provided pursuant to 19 CFR 133.21(d) was (damaged/destroyed/lost) during... 19 Customs Duties 1 2010-04-01 2010-04-01 false Articles bearing counterfeit trademarks. 133.21... Recorded Trademarks or Recorded Trade Names § 133.21 Articles bearing counterfeit trademarks....

  15. 23 CFR 1.33 - Conflicts of interest.

    Science.gov (United States)

    2010-04-01

    ... § 1.33 Conflicts of interest. No official or employee of a State or any other governmental... 23 Highways 1 2010-04-01 2010-04-01 false Conflicts of interest. 1.33 Section 1.33 Highways... project shall have, directly or indirectly, any financial or other personal interest in any such...

  16. 22 CFR 133.635 - Drug-free workplace.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Drug-free workplace. 133.635 Section 133.635 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 133.635 Drug-free workplace. Drug-free workplace means a site for...

  17. Effect of Antimony, Phosphorous and Salinity on Growth, Root Membrane Permeability and Root Antimony, Iron and Zinc Concentration of Corn in Hydroponic Media

    OpenAIRE

    H. Barangizi; M. Afyuni; B. Rezaee

    2010-01-01

    Antimony (Sb) pollution has increased in recent years because of human activities and extensive usage of antimony compounds. To date, only a few researches have been conducted in this field in Iran. The purpose of this research is to determine fresh and dry weight, root permeability percentage and root concentration of Sb, Fe and Zn in the corn. This greenhouse research was performed in hydroponics. A factorial experiment (3 × 2 × 3) with three Sb concentrations (0, 6, 18 mgL-1), with and wit...

  18. Effects of antimony on aquatic organisms (Larva and embryo of Oryzias latipes, Moina macrocopa, Simocephalus mixtus, and Pseudokirchneriella subcapitata).

    Science.gov (United States)

    Nam, Sun-Hwa; Yang, Chang-Yong; An, Youn-Joo

    2009-05-01

    Antimony is widespread in aquatic environment. Trivalent forms of antimony are known to be more toxic than other chemical species of antimony. In the present study, antimony potassium tartrate (APT), the trivalent inorganic forms of antimony, was selected as a test antimony compound due to its high water solubility. The effects of antimony on Japanese medaka (Oryzias latipes), planktonic crustacea (Moina macrocopa and Simocephalus mixtus), and green algae (Pseudokirchneriella subcapitata) were evaluated. Larval survival and the embryonic development were measured for fish assay. APT was less toxic to larval medaka (24-h LC50, 261; 48-h LC50, 238 mg L(-1)). Simocephalus mixtus was killed by very low concentrations of APT (24-h LC50, 4.92 mg L(-1)), and antimony was also toxic to Moina macrocopa (24-h LC50, 12.83 mg L(-1)). Toxicities of APT to S. mixtus and Moina macrocopa were about 50 and 20 times more toxic to Oryzias latipes larvae, respectively, in terms of 24-h LC50 value. Growth inhibition of Pseudokirchneriella subcapitata was observed in the presence of APT (72-h EC50, 206 mg L(-1)). This study demonstrated that APT is more toxic to planktonic crustacea than fish and green algae, and planktonic crustacea appears a better indicator of antimony pollution in aquatic environment. PMID:19264343

  19. Arsenic and Antimony Content in Soil and Plants from Baia Mare Area, Romania

    Directory of Open Access Journals (Sweden)

    Gabriela Oprea

    2010-01-01

    Full Text Available Problem statement: The objective of this research was to evaluate the degree of soil contamination with arsenic and antimony in Baia Mare, a nonferrous mining and metallurgical center located in the North West region of Romania. The soil in the area is affected by the emissions of powders containing metals from metallurgical factories. Previous studies indicated the soil contamination with copper, zinc, cadmium and lead, but there is few data about the actual level of soil pollution with arsenic and antimony. Approach: The soil samples were collected from 2 districts of Baia Mare: Ferneziu, which is located in the proximity of a lead smelter and Săsar district which is located along the Sasar River in the preferential direction of the wind over a metallurgical factory producing lead. As reference was considered Dura area located in a less polluted hilly area, in the west part of the town. Samples of soil and plants from the residential area of Ferneziu, Săsar and Dura districts were collected. The arsenic determination was carried out by inductively coupled plasma atomic emission spectrometry and the antimony determination by inductively coupled plasma mass spectrometry. Results: In Ferneziu area, the concentration of arsenic in soil ranged between 0.25 and 255 mg kg-1. In Săsar district the arsenic concentration in the soil ranged between 5.5 and 295 mg kg-1. Regarding antimony, in Ferneziu area the concentration ranged between 5.3 and 40.6 mg kg-1; while in Săsar, antimony soils concentrations vary in the range: 0.9-18.4. Arsenic and antimony concentrations in plants were low for almost of the samples, both in Ferneziu and Săsar area indicating a low mobility of these elements in the studied soils. Conclusion: This study indicated the soil pollution with arsenic both in Ferneziu district and in Săsar district. The soil pollution with antimony was found especially in Ferneziu district.

  20. Antimony distribution and mobility in topsoils and plants (Cytisus striatus, Cistus ladanifer and Dittrichia viscosa) from polluted Sb-mining areas in Extremadura (Spain)

    International Nuclear Information System (INIS)

    A study about topsoil antimony distribution and mobility from the soils to the biomass has been afforded in three abandoned Sb mining areas located at Extremadura. Physico-chemical characteristics of the soils and total antimony levels were measured in soils and autochthonous plant species (Cytisus striatus, Cistus ladanifer and Dittrichia viscosa). Comparison with corresponding values in reference areas isolated from the mining activities is discussed. Antimony mobility in the soils was estimated by measuring the water extractable fraction; low results were obtained for the three soil areas, with no statistical differences. Plant ability to accumulate antimony was estimated by use of plant accumulation coefficients (PAC). Seasonal (spring vs. autumn) effects on the antimony content in the plant species. Cytisus striatus from Mari Rosa mine presented antimony excluder characteristics, whereas Dittrichia viscosa specimens growing in San Antonio mine showed a significant antimony bioaccumulation. - Bioaccumulation of antimony in vegetal species growing in mining areas

  1. Antimony distribution and mobility in topsoils and plants (Cytisus striatus, Cistus ladanifer and Dittrichia viscosa) from polluted Sb-mining areas in Extremadura (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Murciego, A. Murciego [Area de Cristalografia y Mineralogia, Universidad de Extremadura, Avda. Elvas, s/n, E-06071 Badajoz (Spain); Sanchez, A. Garcia [IRNA-CSIC, Departamento de Geoquimica Ambiental, Aptdo. 257, Salamanca (Spain); Gonzalez, M.A. Rodriguez [Area de Cristalografia y Mineralogia, Universidad de Extremadura, Avda. Elvas, s/n, E-06071 Badajoz (Spain); Gil, E. Pinilla [Departamento de Quimica Analitica y Electroquimica, Facultad de Ciencias, Universidad de Extremadura, Avda. Elvas, s/n, E-06071 Badajoz (Spain)]. E-mail: epinilla@unex.es; Gordillo, C. Toro [Departamento de Quimica Analitica y Electroquimica, Facultad de Ciencias, Universidad de Extremadura, Avda. Elvas, s/n, E-06071 Badajoz (Spain); Fernandez, J. Cabezas [Area de Ecologia, Universidad de Extremadura, Avda. Elvas, s/n, E-06071 Badajoz (Spain); Triguero, T. Buyolo [Area de Ecologia, Universidad de Extremadura, Avda. Elvas, s/n, E-06071 Badajoz (Spain)

    2007-01-15

    A study about topsoil antimony distribution and mobility from the soils to the biomass has been afforded in three abandoned Sb mining areas located at Extremadura. Physico-chemical characteristics of the soils and total antimony levels were measured in soils and autochthonous plant species (Cytisus striatus, Cistus ladanifer and Dittrichia viscosa). Comparison with corresponding values in reference areas isolated from the mining activities is discussed. Antimony mobility in the soils was estimated by measuring the water extractable fraction; low results were obtained for the three soil areas, with no statistical differences. Plant ability to accumulate antimony was estimated by use of plant accumulation coefficients (PAC). Seasonal (spring vs. autumn) effects on the antimony content in the plant species. Cytisus striatus from Mari Rosa mine presented antimony excluder characteristics, whereas Dittrichia viscosa specimens growing in San Antonio mine showed a significant antimony bioaccumulation. - Bioaccumulation of antimony in vegetal species growing in mining areas.

  2. The MRP1-mediated effluxes of arsenic and antimony do not require arsenic-glutathione and antimony-glutathione complex formation.

    Science.gov (United States)

    Salerno, Milena; Petroutsa, Maria; Garnier-Suillerot, Arlette

    2002-04-01

    Arsenic trioxide is an effective treatment for acute promyelocytic leukemia, but resistance to metalloid salts is found in humans. Using atomic absorption spectroscopy, we have measured the rate of uptake of arsenic trioxide and of antimony tartrate in GLC4 and GLC4/ADR cells overexpressing MRP1 and the rate of their MRP1-mediated effluxes as a function of the intracellular GSH concentration. In sensitive cells, after 1 h, a pseudosteady state is reached where intra- and extracellular concentrations of metalloid are the same. This precludes the formation, at short term, of complexes between arsenic or antimony with GSH. In resistant cells reduced intracellular accumulation of arsenic (or antimony), reflecting an increased rate of arsenic (or antimony) efflux from the cells, is observed. No efflux of the metalloid is observed in GSH depleted cells. The two metalloids and GSH are pumped out by MRP1 with the same efficiency. Moreover for the three compounds 50% of the efflux is inhibited by 2 microM MK571. This led us to suggest that As- and Sb-containing species could be cotransported with GSH. PMID:12018890

  3. Levels and risk factors of antimony contamination in human hair from an electronic waste recycling area, Guiyu, China.

    Science.gov (United States)

    Huang, Yue; Ni, Wenqing; Chen, Yaowen; Wang, Xiaoling; Zhang, Jingwen; Wu, Kusheng

    2015-05-01

    The primitive electronic waste (e-waste) recycling has brought a series of environmental pollutants in Guiyu, China. Antimony is one of the important metal contaminants and has aroused the global concerns recently. We aimed to investigate concentrations of antimony in human hair from Guiyu and compared them with those from a control area where no e-waste recycling exists, and assessed the potential risk factors. A total of 205 human hair samples from Guiyu and 80 samples from Jinping were collected for analysis. All volunteers were asked to complete a questionnaire including socio-demographic characteristics and other possible factors related to hair antimony exposure. The concentrations of hair antimony were analyzed using atomic absorption spectrophotometer. Our results indicated that the level of hair antimony in volunteers from Guiyu (median, 160.78; range, 6.99-4412.59 ng/g) was significantly higher than those from Jinping (median, 61.74; range, 2.98-628.43 ng/g). The residents who engaged in e-waste recycling activities in Guiyu had higher hair antimony concentrations than others (P < 0.001). There was no significant difference of hair antimony concentrations among different occupation types in e-waste recycling. Multiple stepwise regression analysis indicated that hair antimony concentrations were associated with education level (β = -0.064), the time of residence in Guiyu (β = 0.112), living house also served as e-waste workshop (β = 0.099), the work related to e-waste (β = 0.169), and smoking (β = 0.018). The elevated hair antimony concentrations implied that the residents in Guiyu might be at high risk of antimony contamination, especially the e-waste recycling workers. Work related to e-waste recycling activities and long-time residence in Guiyu contributed to the high hair antimony exposure. PMID:25501644

  4. Chemoresistance of CD133+ cancer stem cells in laryngeal carcinoma

    Institute of Scientific and Technical Information of China (English)

    YANG Jing-pu; LIU Yan; ZHONG Wei; YU Dan; WEN Lian-ji; JIN Chun-shun

    2011-01-01

    Background Mounting evidence suggests that tumors are histologically heterogeneous and are maintained by a small population of tumor cells termed cancer stem cells. CD133 has been identified as a candidate marker of cancer stem cells in laryngeal carcinoma. This study aimed to analyze the chemoresistance of CD133+ cancer stem cells.Methods The response of Hep-2 cells to different chemotherapeutic agents was investigated and the expression of CD133 was studied. Fluorescence-activated cell sorting analysis was used to identify CD133,and the CD133+ subset of cells was separated and analyzed in colony formation assays,cell invasion assays,chemotherapy resistance studies,and analyzed for the expression of the drug resistance gene ABCG2.Results About 1%-2% of Hep-2 cells were CD133+ cells,and the CD133+ proportion was enriched by chemotherapy.CD133+ cancer stem cells exhibited higher potential for clonogenicity and invasion,and were more resistant to chemotherapy. This resistance was correlated with higher expression of ABCG2.Conclusions This study suggested that CD133+ cancer stem cells are more resistant to chemotherapy. The expression of ABCG2 could be partially responsible for this. Targeting this small population of CD133+ cancer stem cells could be a strategy to develop more effective treatments for laryngeal carcinoma.

  5. Predictors of an unsatisfactory response to pentavalent antimony in the treatment of American visceral leishmaniasis

    Directory of Open Access Journals (Sweden)

    Santos Mácia A.

    2002-01-01

    Full Text Available Although treatment of visceral leishmaniasis with pentavalent antimony is usually successful, some patients require second-line drug therapy, most commonly with amphotericin B. To identify the clinical characteristics that predict an inadequate response to pentavalent antimony, a case-control study was undertaken in Teresina, Piaui, Brazil. Over a two-year period, there were 19 cases of VL in which the staff physicians of a hospital prescribed second-line therapy with amphotericin B after determining that treatment with pentavalent antimony had failed. The control group consisted of 97 patients that were successfully treated with pentavalent antimony. A chart review using univariate and multivariate analysis was performed. The cure rate was 90% with amphotericin B. The odds ratio for the prescription of amphotericin B was 10.2 for children less than one year old, compared with individuals aged over 10 years. Patients who presented coinfection had an OR of 7.1 while those on antibiotics had an OR of 2.8. These data support either undertaking a longer course of therapy with pentavalent antimony for children or using amphotericin B as a first-line agent for children and individuals with coinfections. It also suggests that chemoprophylaxis directed toward bacterial coinfection in small children with VL may be indicated.

  6. Arsenic and antimony removal from drinking water by adsorption on granular ferric oxide.

    Science.gov (United States)

    Sazakli, Eleni; Zouvelou, Stavroula V; Kalavrouziotis, Ioannis; Leotsinidis, Michalis

    2015-01-01

    Arsenic and antimony occur in drinking water due to natural weathering or anthropogenic activities. There has been growing concern about their impact on health. The aim of this study was to assess the efficiency of a granular ferric oxide adsorbent medium to remove arsenic and antimony from drinking water via rapid small-scale column tests (RSSCTs). Three different water matrices - deionized, raw water treated with a reverse osmosis domestic device and raw water - were spiked with arsenic and/or antimony to a concentration of 100 μg L⁻¹. Both elements were successfully adsorbed onto the medium. The loadings until the guideline value was exceeded in the effluent were found to be 0.35-1.63 mg g⁻¹ for arsenic and 0.12-2.11 mg g⁻¹ for antimony, depending on the water matrix. Adsorption of one element was not substantially affected by the presence of the other. Aeration did not affect significantly the adsorption capacity. Granular ferric oxide could be employed for the simultaneous removal of arsenic and antimony from drinking water, whereas full-scale systems should be assessed via laboratory tests before their implementation.

  7. Determination of traces of uranium and thorium in antimony(III) oxide by ICP-MS

    International Nuclear Information System (INIS)

    Traces of uranium and thorium in antimony(III) oxide were determined by inductively coupled plasma mass spectrometry (ICP-MS). A method of vaporization as the halide was applied to the separation of the analytes from the antimony matrix. Because the above separation method is so simple, reduced of external contamination was expected. In the case of vaporization using hydrochloric acid, however, it was found that antimony trichloride ions overlapped thorium ion of 232 (m/z). To find the most suitable conditions for matrix separation, vaporization behaviors were studied by using different acidic solutions such as HBr, HBr-HClO4 and HBr-H2SO4. Neither HBr+HClO4 nor HBr+H2SO4 was able to reduce the antimony matrix down to an unaffected level on ICP-MS measurement. On the other hand, in the case of the vaporization using hydrobromic acid, almost all the antimony matrix was removed. Determination limits obtained by this method were 0.02 and 0.03 ng g-1 for uranium and thorium, respectively. (author)

  8. Antimony bioavailability: knowledge and research perspectives for sustainable agricultures.

    Science.gov (United States)

    Pierart, Antoine; Shahid, Muhammad; Séjalon-Delmas, Nathalie; Dumat, Camille

    2015-05-30

    The increasing interest in urban agriculture highlights the crucial question of crop quality. The main objectives for environmental sustainability are a decrease in chemical inputs, a reduction in the level of pollutants, and an improvement in the soil's biological activity. Among inorganic pollutants emitted by vehicle traffic and some industrial processes in urban areas, antimony (Sb) is observed on a global scale. While this metalloid is known to be potentially toxic, it can transfer from the soil or the atmosphere to plants, and accumulate in their edible parts. Urban agriculture is developing worldwide, and could therefore increasingly expose populations to Sb. The objective of this review was in consequences to gather and interpret actual knowledge of Sb uptake and bioaccumulation by crops, to reveal investigative fields on which to focus. While there is still no legal maximal value for Sb in plants and soils, light has to be shed on its accumulation and the factors affecting it. A relative absence of data exists about the role of soil flora and fauna in the transfer, speciation and compartmentation of Sb in vegetables. Moreover, little information exists on Sb ecotoxicity for terrestrial ecosystems. A human risk assessment has finally been reviewed, with particular focus on Sb bioaccessibility.

  9. SESPE-FRAZIER, DIABLO, MATILIJA, DRY LAKES, SAWMILL-BADLANDS, CUYAMA, ANTIMONY, AND QUATAL ROADLESS AREAS, CALIFORNIA.

    Science.gov (United States)

    Frizzell, Virgil A.; Hale, William N.

    1984-01-01

    The study area, consisting of the Sespe-Frazier, Diablo, Matilija, Dry Lakes, Sawmill-Badlands, Cuyama, Antimony, and Quatal Roadless Areas, occupies about 872 sq mi in the Los Padres National Forest, California. Studies indicate that the Sespe-Frazier Roadless Area contains demonstrated resources of gold, gypsum, phosphate and bentonite; deposits in the Cuyama Roadless Area have demonstrated resources of gypsum; mines in the Antimony Roadless Area have demonstrated resources of antimony, gold, silver, and marble; and the Quatal Roadless Area has demonstrated resources of bentonite. The Sespe-Frazier Roadless Area has substantiated potential for geothermal resources suitable for direct-heat purposes, probable and substantiated potential for oil and gas resources, and probable potential for gold resources. Small areas of probable resource potential for antimony and gold were identified in Antimony Roadless Area.

  10. Mixed Antimony(V Complexes with Different Sugars to Modulate the Oral Bioavailability of Pentavalent Antimonial Drugs

    Directory of Open Access Journals (Sweden)

    Weverson A. Ferreira

    2014-04-01

    Full Text Available Previous studies have shown that the association of the drug meglumine antimoniate (MA with β-cyclodextrin can improve its bioavailability by the oral route. In this work, ribose and maltose were investigated for their ability to form mixed or association complexes with MA, release MA and modulate the serum levels of Sb after oral administration in mice. Analysis of the MA/ribose composition by high performance liquid chromatography coupled to mass spectrometry (LCMS-IT-TOF revealed the presence of mixed meglumine-Sb-ribose and Sb-ribose complexes. Analysis of the MA/maltose composition suggested the formation of MA-maltose association compounds. Circular dichroism characterization of these compositions following dilution in water at 37 °C suggested a partial and slow dissociation of the association compounds. When the MA/ribose composition was administered orally and compared to MA, the serum concentration of Sb was significantly lower after 1 h and greater after 3 h. On the other hand, the MA/maltose composition showed similar serum Sb concentration after 1 h and higher level of Sb after 3 h, when compared to MA. In conclusion, the present study has demonstrated the formation of mixed or association complexes of MA with sugars, such as maltose and ribose, which promoted sustained serum level of Sb after oral administration.

  11. Anodic stripping voltammetry of antimony using gold nanoparticle-modified carbon screen-printed electrodes

    International Nuclear Information System (INIS)

    Carbon screen-printed electrodes (CSPE) modified with gold nanoparticles present an interesting alternative in the determination of antimony using differential pulse anodic stripping voltammetry. Metallic gold nanoparticles deposits have been obtained by direct electrochemical deposition. Scanning electron microscopy measurements show that the electrochemically synthesized gold nanoparticles are deposited in aggregated form. Any undue effects caused by the presence of foreign ions in the solution were also analyzed to ensure that common interferents in the determination of antimony by ASV. The detection limit for Sb(III) obtained was 9.44 x 10-10 M. In terms of reproducibility, the precision of the above mentioned method in %R.S.D. values was calculated at 2.69% (n = 10). The method was applied to determine levels of antimony in seawater samples and pharmaceutical preparations

  12. Synthesis of barium mercaptides and application of antimony/barium mercaptides

    Institute of Scientific and Technical Information of China (English)

    瞿龙; 张露露; 舒万艮

    2001-01-01

    Mercaptoacetic acid, isooctyl thioglycolate and barium hydroxide used as start materials, barium bis (2-ethylhexyl thioglycolate) (Ba(2EHTG)2), barium thioglycolate (Ba(TG)) and barium bisthioglycolate (Ba(TG)2) were synthesized. Their optimum synthetic techniques were discussed, and some physicochemical data were reported. Infrared spectroscopy and elemental analysis methods were used to identify the structures. They were put into PVC plastic products together with antimony tris (2-ethylhexyl thioglycolate) (Sb(2EHTG)3) under the suitable compounding, and their heat stability to PVC was studied. It is shown that these barium mercaptides have remarkable synergisms with antimony mercaptides and the long-term stabilizing effect of organoantimony stabilizer can be effectively improved, reducing the amount of antimony compounds so as to avoid the decrease of its stabilizing effect.

  13. Response of cutaneous leishmaniasis (chiclero's ulcer) to treatment with meglumine antimoniate in Southeast Mexico.

    Science.gov (United States)

    Vargas-Gonzalez, A; Canto-Lara, S B; Damian-Centeno, A G; Andrade-Narvaez, F J

    1999-12-01

    Cutaneous leishmaniasis, known as chiclero's ulcer in southeastern Mexico, is characterized by a predominantly single, painless, ulcerated lesion, without lymphangitis or adenopathy. When located on the ear, it tends to become chronic, causing destruction of the pinna and disfigurement. It is caused predominantly by Leishmania (L.) mexicana. Although pentavalent antimonials (Sb5+) are the mainstay of leishmanial therapy and have been used for more than 50 years, dosage regimens have been repeatedly modified and the best one has not been fully identified. The main purpose of the present study was to investigate the response of chiclero's ulcer to treatment with meglumine antimoniate. One hundred five patients were treated with meglumine antimoniate at a daily dose of 1 ampule per day (425 mg of Sb5+) until healing. The lesions healed after a mean of 25 days (range = 5-60 days). PMID:10674678

  14. Geothermal and fluid flowing simulation of ore-forming antimony deposits in Xikuangshan

    Institute of Scientific and Technical Information of China (English)

    YANG Ruiyan; MA Dongsheng; BAO Zhengyu; PAN Jiayong; CAO Shuanglin; XIA Fei

    2006-01-01

    The Xikuangshan Antimony Deposit located in the Mid-Hunan Basin, China, is the largest antimony deposit in the world. Based on the hydrogeological and geochemical data collected from four sections, Xikuangshan-Dajienao (AO), Xikuangshan-Dashengshan (BO), Xikuangshan-Longshan (CO) and Dafengshan (DO) in the Basin, an advanced metallogenic model related to deep-cyclic meteoric water of Xikuangshan Antimony Deposit is put forward in this paper using a model of heat-gravity-driving fluid flow transportation. The simulation results show that the ore-forming fluid of the deposit mainly comes from the Dashengshan and Longshan areas where BO and CO sections are located if the overall basin keeps a constant atmospheric precipitation and infiltration rate during mineralization, and that the average transportation speed of the ore-forming fluids is about 0.2-0.4 m/a.

  15. On-line lab-in-syringe cloud point extraction for the spectrophotometric determination of antimony.

    Science.gov (United States)

    Frizzarin, Rejane M; Portugal, Lindomar A; Estela, José M; Rocha, Fábio R P; Cerdà, Victor

    2016-02-01

    Most of the procedures for antimony determination require time-consuming sample preparation (e.g. liquid-liquid extraction with organic solvents), which are harmful to the environment. Because of the high antimony toxicity, a rapid, sensitive and greener procedure for its determination becomes necessary. The goal of this work was to develop an analytical procedure exploiting for the first time the cloud point extraction on a lab-in-syringe flow system aiming at the spectrophotometric determination of antimony. The procedure was based on formation of an ion-pair between the antimony-iodide complex and H(+) followed by extraction with Triton X-114. The factorial design showed that the concentrations of ascorbic acid, H2SO4 and Triton X-114, as well as second and third order interactions were significant at the 95% confidence level. A Box-Behnken design was applied to obtain the response surfaces and to identify the critical values. System is robust at the 95% confidence level. A linear response was observed from 5 to 50 µg L(-1), described by the equation A=0.137+0.050C(Sb) (r=0.998). The detection limit (99.7% confidence level), the coefficient of variation (n=5; 15 µg L(-1)) and the sampling rate was estimated at 1.8 µg L(-1), 1.6% and 16 h(-1), respectively. The procedure allows quantification of antimony in the concentrations established by environmental legislation (6 µg L(-1)) and it was successfully applied to the determination of antimony in freshwater samples and antileishmanial drugs, yielding results in agreement with those obtained by HGFAAS at the 95% confidence level.

  16. Future trends of global atmospheric antimony emissions from anthropogenic activities until 2050

    Science.gov (United States)

    Zhou, Junrui; Tian, Hezhong; Zhu, Chuanyong; Hao, Jiming; Gao, Jiajia; Wang, Yong; Xue, Yifeng; Hua, Shenbin; Wang, Kun

    2015-11-01

    This paper presents the scenario forecast of global atmospheric antimony (Sb) emissions from anthropogenic activities till 2050. The projection scenarios are built based on the comprehensive global antimony emission inventory for the period 1995-2010 which is reported in our previous study. Three scenarios are set up to investigate the future changes of global antimony emissions as well as their source and region contribution characteristics. Trends of activity levels specified as 5 primary source categories are projected by combining the historical trend extrapolation with EIA International energy outlook 2013, while the source-specific dynamic emission factors are determined by applying transformed normal distribution functions. If no major changes in the efficiency of emission control are introduced and keep current air quality legislations (Current Legislation scenario), global antimony emissions will increase by a factor of 2 between 2010 and 2050. The largest increase in Sb emissions is projected from Asia due to large volume of nonferrous metals production and waste incineration. In case of enforcing the pollutant emission standards (Strengthened Control scenario), global antimony emissions in 2050 will stabilize with that of 2010. Moreover, we can anticipate further declines in Sb emissions for all continents with the best emission control performances (Maximum Feasible Technological Reduction scenario). Future antimony emissions from the top 10 largest emitting countries have also been calculated and source category contributions of increasing emissions of these countries present significant diversity. Furthermore, global emission projections in 2050 are distributed within a 1° × 1°latitude/longitude grid. East Asia, Western Europe and North America present remarkable differences in emission intensity under the three scenarios, which implies that source-and-country specific control measures are necessary to be implemented for abating Sb emissions from

  17. Studies on Thin Films of Antimony Vacuum Evaporated from a Knudsen-Type Source

    Directory of Open Access Journals (Sweden)

    K.L. Chaudhary

    2000-10-01

    Full Text Available A Knudsen-type evaporation source was used for the deposition of thin films of antimony to study their growth and microstructure under different rates of evaporation and substrate temperatures when vacuum evaporated onto air-cleaved KC1, mica, amorphous carbon and doped KCl substrates. The crystallisation of these films on exposure to an electron beam of moderate intensity inside the electron microscope was studied, and the orientations of the crystallised films wrt the substrate were established. It has been concluded that antimony films prepared by this source compare well with those prepared by other sources of vacuum evaporation.

  18. Co-doping with antimony to control phosphorous diffusion in germanium

    KAUST Repository

    Tahini, H. A.

    2013-02-15

    In germanium, phosphorous and antimony diffuse quickly and as such their transport must be controlled in order to design efficient n-typed doped regions. Here, density functional theory based calculations are used to predict the influence of double donor co-doping on the migration activation energies of vacancy-mediated diffusion processes. The migration energy barriers for phosphorous and antimony were found to be increased significantly when larger clusters involving two donor atoms and a vacancy were formed. These clusters are energetically stable and can lead to the formation of even larger clusters involving a number of donor atoms around a vacancy, thereby affecting the properties of devices.

  19. 21 CFR 133.147 - Grated American cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Grated American cheese food. 133.147 Section 133.147 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific...

  20. 14 CFR 133.41 - Flight characteristics requirements.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Flight characteristics requirements. 133.41... EXTERNAL-LOAD OPERATIONS Airworthiness Requirements § 133.41 Flight characteristics requirements. (a) The applicant must demonstrate to the Administrator, by performing the operational flight checks prescribed...

  1. 19 CFR 133.37 - Renewal of copyright recordation.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Renewal of copyright recordation. 133.37 Section... OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.37 Renewal of copyright recordation. (a) Term of renewal. If a recorded copyright has a term which exceeds the original...

  2. 19 CFR 133.32 - Application to record copyright.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Application to record copyright. 133.32 Section... OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.32 Application to record copyright. An application to record a copyright to secure customs protection against...

  3. 21 CFR 133.137 - Washed curd cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd cheese for manufacturing. 133.137... Standardized Cheese and Related Products § 133.137 Washed curd cheese for manufacturing. Washed curd cheese for manufacturing conforms to the definition and standard of identity prescribed for washed curd cheese by §...

  4. 21 CFR 133.189 - Skim milk cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Skim milk cheese for manufacturing. 133.189... Standardized Cheese and Related Products § 133.189 Skim milk cheese for manufacturing. (a) Skim milk cheese for manufacturing is the food prepared from skim milk and other ingredients specified in this section, by...

  5. 21 CFR 133.145 - Granular cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular cheese for manufacturing. 133.145 Section... Standardized Cheese and Related Products § 133.145 Granular cheese for manufacturing. Granular cheese for manufacturing conforms to the definition and standard of identity prescribed for granular cheese by §...

  6. 21 CFR 133.114 - Cheddar cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cheddar cheese for manufacturing. 133.114 Section... Standardized Cheese and Related Products § 133.114 Cheddar cheese for manufacturing. Cheddar cheese for manufacturing conforms to the definition and standard of identity prescribed for cheddar cheese by §...

  7. 21 CFR 133.196 - Swiss cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Swiss cheese for manufacturing. 133.196 Section... Standardized Cheese and Related Products § 133.196 Swiss cheese for manufacturing. Swiss cheese for manufacturing conforms to the definition and standard of identity prescribed for swiss cheese by §...

  8. 21 CFR 133.109 - Brick cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Brick cheese for manufacturing. 133.109 Section... Standardized Cheese and Related Products § 133.109 Brick cheese for manufacturing. Brick cheese for manufacturing conforms to the definition and standard of identity for brick cheese prescribed by §...

  9. 21 CFR 133.119 - Colby cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Colby cheese for manufacturing. 133.119 Section... Standardized Cheese and Related Products § 133.119 Colby cheese for manufacturing. Colby cheese for manufacturing conforms to the definition and standard of identity prescribed for colby cheese by §...

  10. Influence of cooling rate and antimony addition content on graphite morphology and mechanical properties of a ductile iron

    Directory of Open Access Journals (Sweden)

    Liu Zhe

    2012-05-01

    Full Text Available Cooling rate and inoculation practice can greatly affect the graphite morphology of ductile irons. In the present research, the effects of the cooling rate and antimony addition on the graphite morphology and mechanical properties of ductile irons have been studied. Three ductile iron castings were prepared through solidification under cooling conditions S (slow, M (medium and F (fast. The cooling rates around the equilibrium eutectic temperature (1,150 ℃ for these cooling conditions (S, M and F were set at 0.21 ℃·min-1, 0.32 ℃·min-1 and 0.37 ℃·min-1, respectively. In addition, four ductile iron castings were prepared by adding 0.01%, 0.02%, 0.03% and 0.04% (by weight antimony, respectively under the slow cooling condition. The results show that the nodularity index, tensile strength and hardness of the ductile iron castings without antimony addition are all improved with the increase of cooling rate, while the ductile iron casting solidified under the medium cooling rate possesses the largest number of graphite nodules. Furthermore, for the four antimony containing castings, the graphite morphology and tensile strength are also improved by the antimony additions, and the effect of antimony addition is intensified when the addition increases from 0.01% to 0.03%. Moreover, the rare earth elements (REE/antimony ratio of 2 appears to be the most effective for fine nodular graphite formation in ductile iron.

  11. Promoter hypomethylation regulates CD133 expression in human gliomas

    Institute of Scientific and Technical Information of China (English)

    Kouichi Tabu; Ken Sasai; Taichi Kimura; Lei Wang; Eiko Aoyanagi; Shinji Kohsaka; Mishie Tanino; Hiroshi Nishihara; Shinya Tanaka

    2008-01-01

    Brain tumor-initiating cells (BTICs) have been enriched using antibodies against the cell surface protein CD133;however,the biological relevance and the regulatory mechanism of CD133 expression in human gliomas are not yet understood.In this study,we initially demonstrated that CD133 was overexpressed in high-grade human glioblastomas where CD133-positive cells were focally observed as a micro-cluster.In addition,CD133 transcripts with exon 1A,1B,or 1C were predominantly expressed in glioblastomas.To elucidate the mechanism regulating this aberrant expression of CD133,three proximal promoters (P1,P2,and P3) containing a CpG island were isolated.In U251MG and T98Gglioblastoma cells,the P1 region flanking exon 1A exhibited the highest activity among the three promoters,and this activity was significantly inactivated by in vitro methylation.After treatment with the demethylating agent 5-azacytidine and/or the histone deacetylase inhibitor valproic acid,the expression level of CD133 mRNA was significantly restored in glioma cells.Importantly,hypomethylation of CpG sites within the P1,P2,and P3 regions was observed by bisulfite sequencing in human glioblastoma tissues with abundant CD133 mRNA.Taken together,our results indicate that DNA hypomethylation is an important determinant of CD133 expression in glioblastomas,and this epigenetic event may be associated with the development of BTICs expressing CD133.

  12. Commerce Ministry Announced the Export Quotas for Zinc,Antimony,Tungsten,Tin and Silver

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    <正> The Ministry of Commerce recently announcedits decision on the export quotas for zinc,anti-mony,tungsten,tin and silver in 2004.Accord-ing to the data released,all the export quotasare reduced except for silver.Relevant peoplesay that the raw materials shortage is a majorissue for the production of antimony and tin,

  13. Determination of barium and antimony in gun shot residues by neutron activation analysis

    International Nuclear Information System (INIS)

    The antimony contents on both hands of 7 persons before and after firing an automatic pistol were determined by instrumental neutron activation analysis. The gun shot residues were removed from hands by a 4% solution of cellulose acetate in acetone. The average content of antimony on both hands before firing obtained from 70 measurements (35 from each hand) was 0.040 ± 0.010 micro gram, whereas the average contents on the right and the left hands after 1 firing were 0.385 ± 0.036 and 0.144 ± 0.029 micro gram respectively. The ration of the antimony contents after 1 firing to the normal level (before firing) was 9.9 for the right and 3.6 for the left. No significant difference was observed between male and female, smoker and non-smoker. The antimony content after several firings was not much different from that of 1 firing and it reduced to the normal level within 2 days after firing. The barium contents before and after firing were studied from one person. Barium was precipitated as Ba SO4 before counting. An average contents of 0.936 ± 0.551 micro gram for both hands before firing, 4.092 ± 2.687 micro gram for the right hand and 1.363 ± 0.879 micro gram for the left hand after 1 firing were found

  14. Investigation on the thermal radiation properties of antimony doped tin oxide particles

    Institute of Scientific and Technical Information of China (English)

    Fu Cheng-Wu; Zhang Shuan-Qin; Chen Ming-Qing

    2008-01-01

    This paper reports the preparation of antimony doped tin oxide crystalline powders by chemical coprecipitation method. The influence of sintering temperature and the sintering retention time on the thermal infrared emissivity is analysed. The thermal infrared reflectivity is measured and the optimum doping concentration is proposed.

  15. Thermodynamics for arsenic and antimony in copper matte converting—computer simulation

    Science.gov (United States)

    Chaubal, P. C.; Nagamori, M.

    1988-08-01

    Thermodynamic data for arsenic and antimony and their sulfide and oxide gases have been critically reviewed and compiled. The entropy values for AsS(g), SbS(g), and BiS(g) have been recalculated based on a statistical thermodynamic method. The standard heat of formation and entropy of As2O3(g) have been newly assessed to be △H{298/0} = -81,500 cal/mole and S{298/0} = 81.5 cal/deg/mole. Copper matte converting has been mathematically described using the stepwise equilibrium simulation technique together with quadratic approximations of oxygen and magnetite solubilities in molten mattes. A differential equation for the volatilization of arsenic and antimony has been derived and solved for successive reaction microsteps, whereby the volatilization, slagging, and alloying of the minor elements in copper matte converting have been examined as functions of reaction time and other process variables. Only the first (slag-making) stage of converting is responsible for the elimination of arsenic and antimony by volatilization. Arsenic volatilizes mainly as AsS(g) and AsO(g), with As2(g) also contributing when initial mattes are unusually rich in arsenic (above 0.5 pct arsenic). Antimony volatilizes chiefly as SbS(g), and the contributions of other gases such as SbO(g) and Sb(g) always remain negligibly low. The results of the stepwise equilibrium simulation compare favorably with the industrial operating data.

  16. Synthesis of antimony tris(mercaptoethyl carboxylates) as thermal stabilizer for polyvinyl chloride

    Institute of Scientific and Technical Information of China (English)

    舒万艮; 刘又年; 陈启元

    2002-01-01

    A novel type of thermal stabilizers-antimony tris(mercaptoethyl carboxylates) (Sb(SCH2CH2OOCR) 3), was synthesized from carboxylic acid, antimony trioxide and 2-mercaptoethanol in two steps. The experimental results show that the molar ratio of carboxylic acid to antimony tris(2-hydroxyethyl mercaptide) is 1.2, when adding 0.6% tetra-n-butyl titanate as catalyst and xylene as isotropic solvent, heating and refluxing for about 2~4h. The thermal stability was measured by heat-aging oven test. The thermal stability time is about 8~40min(at 200℃) when adding 2% tetra-n-butyl titanate in polyvinyl chloride(PVC). Among these stabilizers, antimony tris(mercaptoethyl stearate) has best thermal stability. Its thermal stability is better than that of Ca-Zn complex and basic lead stabilizers, and equal to that of organotin. In addition, the stabilization mechanism of this kind of stabilizers for PVC was discussed briefly.

  17. Antimonial drugs entrapped into phosphatidylserine liposomes: physicochemical evaluation and antileishmanial activity

    Directory of Open Access Journals (Sweden)

    Samanta Etel Treiger Borborema

    2016-04-01

    Full Text Available Abstract: INTRODUCTION: Leishmaniasis is a disease caused by the protozoan Leishmania that resides mainly in mononuclear phagocytic system tissues. Pentavalent antimonials are the main treatment option, although these drugs have toxic side effects and high resistance rates. A potentially alternative and more effective therapeutic strategy is to use liposomes as carriers of the antileishmanial agents. The aims of this study were to develop antimonial drugs entrapped into phosphatidylserine liposomes and to analyze their biological and physicochemical characteristics. METHODS: Liposomes containing meglumine antimoniate (MA or pentavalent antimony salt (Sb were obtained through filter extrusion (FEL and characterized by transmission electron microscopy. Promastigotes of Leishmania infantum were incubated with the drugs and the viability was determined with a tetrazolium dye (MTT assay. The effects of these drugs against intracellular amastigotes were also evaluated by optical microscopy, and mammalian cytotoxicity was determined by an MTT assay. RESULTS: Liposomes had an average diameter of 162nm. MA-FEL showed inhibitory activity against intracellular L. infantum amastigotes, with a 50% inhibitory concentration (IC50 of 0.9μg/mL, whereas that of MA was 60μg/mL. Sb-FEL showed an IC50 value of 0.2μg/mL, whereas that of free Sb was 9μg/mL. MA-FEL and Sb-FEL had strong in vitro activity that was 63-fold and 39-fold more effective than their respective free drugs. MA-FEL tested at a ten-times higher concentration than Sb-FEL did not show cytotoxicity to mammalian cells, resulting in a higher selectivity index. CONCLUSIONS: Antimonial drug-containing liposomes are more effective against Leishmania-infected macrophages than the non-liposomal drugs.

  18. Exposure mode study to xenon-133 in a reactor building

    International Nuclear Information System (INIS)

    The work described in this thesis focuses on the external and internal dose assessment to xenon-133. During the nuclear reactor operation, fission products and radioactive inert gases, as 133Xe, are generated and might be responsible for the exposure of workers in case of clad defect. Particle Monte Carlo transport code is adapted in radioprotection to quantify dosimetric quantities. The study of exposure to xenon-133 is conducted by using Monte-Carlo simulations based on GEANT4, an anthropomorphic phantom, a realistic geometry of the reactor building, and compartmental models. The external exposure inside a reactor building is conducted with a realistic and conservative exposure scenario. The effective dose rate and the eye lens equivalent dose rate are determined by Monte-Carlo simulations. Due to the particular emission spectrum of xenon-133, the equivalent dose rate to the lens of eyes is discussed in the light of expected new eye dose limits. The internal exposure occurs while xenon-133 is inhaled. The lungs are firstly exposed by inhalation, and their equivalent dose rate is obtained by Monte-Carlo simulations. A biokinetic model is used to evaluate the internal exposure to xenon-133. This thesis gives us a better understanding to the dosimetric quantities related to external and internal exposure to xenon-133. Moreover the impacts of the dosimetric changes are studied on the current and future dosimetric limits. The dosimetric quantities are lower than the current and future dosimetric limits. (author)

  19. Examination of post operative split lung function using quantitative xenon 133 (133Xe) inhalation scan

    International Nuclear Information System (INIS)

    133Xe inhalation scan and ordinary lung function testing were performed three times in 34 patients undergoing pulmonary resection: before surgery, and one and six months postoperatively. Forced vital capacity (FVC) and forced expiratory volume in the first second (FEV1.0) were used as spirometric parameters. From the 133Xe inhalation scan, a split lung capacity (right to left, upper, middle and lower) and T1/2 (time required for half of the inhalation of 133Xe gas to be expired) were calculated by computer and used as indices of split lung capacity and ventilation, respectively. The predicted postoperative lung functions were calculated using preoperative spirometric respiratory function and 133Xe inhalation data according to the formula reported by Ali and associates. At sixth postoperative month, both predicted FVC (r=0.895, p1.0 (r=0.897, p<0.001) correlated highly with those actually observed. These results appear to be very useful for preoperative evaluation of operative indications and the choice of surgical method. The ratios of observed to predicted lung capacity in the post operative state were examined by splitting the right and left lung and the means±S.D.(%) were 80.5±9.7% on the operated side and 119.2±11.7% on the opposite side one month after surgery. Six months after surgery, the corresponding figures were 111.0±5.6% and 96.7±16.4%. The post operative T1/2 values on the operated sides were about 2.4 times the preoperative values at one month after surgery but returned to the preoperative values by the six postoperative month. From these results, it can be said that respiratory functions after pulmonary resection are maintained primarily by compensatory lung function of opposite and operated sides at one and six months, respectively. These results also provide valuable information on postoperative respiratory care for patients who have undergone lung resection. (author)

  20. Electrodes modified with bismuth, antimony and tin precursor compounds for electrochemical stripping analysis of trace metals (a short review)

    OpenAIRE

    Lezi, Nikolitsa; Economou, Anastasios; Barek, Jiří

    2014-01-01

    Over the last decade, intensive research is being carried out towards the development of “green” electrochemical sensors. Bismuth, antimony and tin electrodes have been proposed as potential substitutes of mercury electrodes in electrochemical stripping analysis of trace metals. The main advantage of these metals as electrode materials is their lower toxicity compared to mercury. Among the different configuration of bismuth, antimony and tin electrodes, one of the most attractive inv...

  1. Investigation into properties of the mixture of perfluoro-2-methyl-bicyclo(4,4,0) decane with antimony fluoride

    International Nuclear Information System (INIS)

    State diagram was constructed for a binary system formed by antimony fluoride and perfluoro-2-methyl-bicyclo-(4,4,0)decane in the temperature range of -58 deg to +56 deg C. Temperature dependence of solubility and the differential molar heat of solubility of solid Sb F5 were determined. Above the melting point of antimony fluoride these components were found to form a system of two sparingly miscible liquids with upper critical dissolution temperature

  2. Electrodeposition of SnSbCu Alloy on Copper from an Electrolyte with Varied Content of Antimony Chloride

    Science.gov (United States)

    Valeeva, A. Kh.; Valeev, I. Sh.

    2015-10-01

    The microstructure and chemical composition of electrodeposited alloys of the SnSbCu system with varied concentration of antimony chloride in the electrolyte have been investigated. It is shown that during electrodeposition mechanical-mixture alloys are not formed, but rather intermetallic compounds. It is found that increasing the concentration of antimony chloride in the electrolyte leads to a decrease in the tin content and cracking of the coating.

  3. The Ministry of Land and Resources Continued to Impose Total Exploitation Control on Tungsten, Antimony and Rare Earth

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

    <正>The General Office of the Ministry of Land and Resources distributed "Notice on Issuing Total Exploitation Control Quota of Tungsten Mine, Antimony Mine and Rare Earth Mine (First Batch) for 2013" (the "Notice") on January 5, it issued total exploitation control quota of tungsten mine, antimony mine and rare earth mine (first batch) for 2013. According to the Notice, the first batch of national

  4. Review of xenon-133 production and related problems

    International Nuclear Information System (INIS)

    A literature survey is given on the production methods of fission xenon-133 and related problems, such as purification, metrological and dosimetric aspects, preparation of isotopic solutions, recycling, etc. 127 references are included. (Author) 127 refs

  5. 19 CFR 133.42 - Infringing copies or phonorecords.

    Science.gov (United States)

    2010-04-01

    ... pursuant to 19 CFR 133.42(e) was (damaged/destroyed/lost) during examination, testing, or other use.” (f... trafficking in counterfeit labels for phonorecords or copies of motion pictures or other audiovisual works...

  6. 40 CFR 133.105 - Treatment equivalent to secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... except as provided for in § 133.103, or paragraphs (d), (e) or (f) of this section. (a) BOD 5. (1) The 30...) of this section. Where concurrent BOD effluent data are available, they must be submitted with...

  7. Treatment of antimony mine drainage: challenges and opportunities with special emphasis on mineral adsorption and sulfate reducing bacteria.

    Science.gov (United States)

    Li, Yongchao; Hu, Xiaoxian; Ren, Bozhi

    2016-01-01

    The present article summarizes antimony mine distribution, antimony mine drainage generation and environmental impacts, and critically analyses the remediation approach with special emphasis on iron oxidizing bacteria and sulfate reducing bacteria. Most recent research focuses on readily available low-cost adsorbents, such as minerals, wastes, and biosorbents. It is found that iron oxides prepared by chemical methods present superior adsorption ability for Sb(III) and Sb(V). However, this process is more costly and iron oxide activity can be inhibited by plenty of sulfate in antimony mine drainage. In the presence of sulfate reducing bacteria, sulfate can be reduced to sulfide and form Sb(2)S(3) precipitates. However, dissolved oxygen and lack of nutrient source in antimony mine drainage inhibit sulfate reducing bacteria activity. Biogenetic iron oxide minerals from iron corrosion by iron-oxidizing bacteria may prove promising for antimony adsorption, while the micro-environment generated from iron corrosion by iron oxidizing bacteria may provide better growth conditions for symbiotic sulfate reducing bacteria. Finally, based on biogenetic iron oxide adsorption and sulfate reducing bacteria followed by precipitation, the paper suggests an alternative treatment for antimony mine drainage that deserves exploration.

  8. Automated analysis of Xe-133 pulmonary ventilation (AAPV) in children

    Science.gov (United States)

    Cao, Xinhua; Treves, S. Ted

    2011-03-01

    In this study, an automated analysis of pulmonary ventilation (AAPV) was developed to visualize the ventilation in pediatric lungs using dynamic Xe-133 scintigraphy. AAPV is a software algorithm that converts a dynamic series of Xe- 133 images into four functional images: equilibrium, washout halftime, residual, and clearance rate by analyzing pixelbased activity. Compared to conventional methods of calculating global or regional ventilation parameters, AAPV provides a visual representation of pulmonary ventilation functions.

  9. A mechanical valve assembly for xenon 133 gas delivery systems

    International Nuclear Information System (INIS)

    Some gas delivery systems used in pulmonary ventilation scanning are unable to satisfactorily supply 133Xe gas to bed-ridden patients. A mechanical gas valve assembly to control the flow of gas in such systems was constructed. A commercially produced 133Xe gas delivery system when fitted with the new assembly was able to ventilate almost all patients whereas previously this could be achieved with approximately only 50% of patients

  10. Expression of CD133 in various premalignant and proliferative lesions

    Directory of Open Access Journals (Sweden)

    Rahmi Amtha

    2015-06-01

    Full Text Available Background: In Jakarta, oral squamous cell carcinoma (OSCC usually detected in late stage with very low survival rate ofabout 1.1 years. OSCC may be preceded by premalignant lesion, so that early detection of the lesion may decrease the mortality rate due to oral malignancy. CD133 is a hematopoietic stem cell that play role in tissue regeneration, inflammation and tumor. Upregulated of CD133 was reported on tumor progression. Purpose: The aim of study is to determine circulating CD133 expression on premalignant (PML and proliferative (PL lesion. Method: Observational research was carried out on patients who seek treatment of PML and PL at Oral Medicine clinic. CD133 was taken from peripheral blood serum, examined using PCR. Data was analyzed by Chi square test. Result: 15 subjects (each of five subjects for PML, PL and control consist of 40% male and 60% female. Age group of above 41 years old was most affected PML and PL (66.7%. Tongue is common site for oral lesion (40%. There is a significant different of circulating CD133 rate among all groups lesion (p=0.039. Conclusion: CD133 express differently in premalignant and proliferative lesions.

  11. Review of xenon-133 production and related problems; Estudio bibliografico de la produccion de xenon-133 y problemas afines

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Ropero, M.

    1980-07-01

    A literature survey is given on the production methods of fission xenon-133 and related problems, such as purification, metrological and dosimetric aspects, preparation of isotopic solutions, recycling, etc. 127 references are included. (Author) 127 refs.

  12. [Physico-chemical characteristics of meglumine antimoniate in different storage conditions].

    Science.gov (United States)

    Romero, G A; de Oliveira, M R; Correia, D; Marsden, P D

    1996-01-01

    During the period October 1992 to July 1995 we measured the osmolarity and pH of ampoules of meglumine antimoniate (glucantime) from lot 9206L-004 (manufactured by Rhodia Farma Ltd, of São Paulo, SP, Brazil) maintained in three temperature conditions namely 4 degrees C, 37 degrees C and ambiental. Although we observed statistically significant differences in osmolarity between samples, the limited number of measurements and the variation of this property in ampoules maintained at the same temperature were obstacles to obtain definitive conclusions. Such a variation was not found with pH. Assuming these parameters could reflect structural changes in the pentavalent antimony molecule, clearly further better controlled experiments are indicated.

  13. Antimony segregation in stressed SiGe heterostructures grown by molecular beam epitaxy

    International Nuclear Information System (INIS)

    The effects of the growth temperature, composition, and elastic strains in separate layers on the segregation of antimony are studied experimentally for stressed SiGe structures grown by molecular beam epitaxy. It is established that the growth conditions and parameters of the structures exert an interrelated influence on the segregation of Sb: the degree of the influence of the composition and elastic stresses in the SiGe layers on Sb segregation depends on the growth temperature. It is shown that usage of a method previously proposed by us for the selective doping of silicon structures with consideration for the obtained dependences of Sb segregation on the growth conditions and parameters of the SiGe layers makes it possible to form SiGe structures selectively doped with antimony

  14. Deciphering lead and cadmium stripping peaks for porous antimony deposited electrodes

    Directory of Open Access Journals (Sweden)

    Taimoor Aqeel Ahmad

    2016-06-01

    Full Text Available Cadmium and lead are generally taken as model heavy metal ions in water to scale the detection limit of various electrode sensors, using electrochemical sensing techniques. These ions interact with the electrochemically deposited antimony electrodes depending on the diffusion limitations. The phenomenon acts differently for the in-situ and ex-situ deposition as well as for porous and non-porous electrodes. A method has been adopted in this study to discourage the stripping and deposition of the working ions (antimony to understand the principle of heavy metal ion detection. X-ray photoelectron spectroscopy (XPS technique was used to establish the interaction between the working and dissolved ions. In addition to the distinct peaks for each analyte, researchers also observed a shoulder peak. A possible reason for the presence of this peak was provided. Different electrochemical tests were performed to ascertain the theory on the basis of the experimental observations.

  15. A facile and fast route to prepare antimony (Sb) nanostructures without additives

    KAUST Repository

    Shah, M.A.

    2011-12-01

    Herein, we report a safe, low cost and reproducible approach for the synthesis of antimony (Sb) nanostructures with most of them having prism like morphology and having well defined faces in the range of ∼70210 nm. The organics free approach is based on a reaction of antimony powder and pure water at ∼210 °C without using any harmful additives and amines. The XRD pattern confirmed the composition and crystallinity of the grown nanostructures. The reported method besides being organics free is economical, fast and free of pollution, which will make it suitable for large scale production. Furthermore, it is well expected that such a technique could be extended to prepare many other important metal and metal oxide nanostructures. The prospects of the process are bright and promising. © 2012 Sharif University of Technology. Production and hosting by Elsevier B.V. All rights reserved.

  16. Bi-antimony capped Keggin polyoxometalate modified with Cu-ligand fragment

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Jiao [College of Chemistry and Material Science, Hebei Normal University, No. 20 Road East of 2nd Ring South, Yuhua District, Shijiazhuang, Hebei 050024 (China); Han, Zhangang, E-mail: hanzg116@yahoo.com.cn [College of Chemistry and Material Science, Hebei Normal University, No. 20 Road East of 2nd Ring South, Yuhua District, Shijiazhuang, Hebei 050024 (China); Zhang, Heng; Yu, Haitao [College of Chemistry and Material Science, Hebei Normal University, No. 20 Road East of 2nd Ring South, Yuhua District, Shijiazhuang, Hebei 050024 (China); Zhai, Xueliang, E-mail: xlzhai253@mail.hebtu.edu.cn [College of Chemistry and Material Science, Hebei Normal University, No. 20 Road East of 2nd Ring South, Yuhua District, Shijiazhuang, Hebei 050024 (China)

    2012-10-15

    Three polyoxometalates consisting of bi-antimony capped Keggin-type clusters: [Cu(mbpy){sub 2}]{sub 2}[PMo{sub 12}O{sub 40}Sb{sub 2}]{center_dot}4H{sub 2}O (1), [Cu(mbpy){sub 2}][PMo{sub 12}O{sub 40}Sb{sub 2}] (2) and {l_brace}Cu(mbpy)[Cu(mbpy){sub 2}]{sub 2}{r_brace}[VMo{sub 8}V{sub 4}O{sub 40}Sb{sub 2}]{center_dot}2H{sub 2}O (3) (mbpy=4,4 Prime -dimethyl-2,2 Prime - dipyridyl in 1 and 2; 5,5 Prime -dimethyl-2,2 Prime -dipyridyl in 3) have been synthesized and characterized by IR, X-ray powder diffraction, TG analysis and electrochemical property. Single-crystal analysis revealed that all of three compounds are built upon bi-antimony capped Keggin-type polyoxoanions and Cu-mbpy cations. In 1-3, two Sb{sup III} centers located at the two opposite of anionic surface adopt fundamentally tetragonal pyramidal coordination geometry. Both compounds 1 and 2 consist of P-centered Keggin structure, while compound 3 presents a V-centered Keggin anion. The Keggin-type anions present different structural features: isolated cluster in 1 and Cu-ligand-supported cluster in 2 and 3. - Graphical abstract: Three hybrid compounds consisting of bi-antimony capped Keggin-type clusters modified with Cu-ligand cations have been synthesized and characterized. Highlights: Black-Right-Pointing-Pointer Three hybrid compounds consisting of bi-antimony capped Keggin-type clusters have been synthesized. Black-Right-Pointing-Pointer Two Sb{sup III} centers located at the two opposite of anionic surface adopt tetragonal pyramidal coordination geometry. Black-Right-Pointing-Pointer The anions present different structural features: isolated and Cu-ligand-supported cluster.

  17. Metal corrosion studies with the fluorosulphonic acid-antimony pentafluoride superacid system

    International Nuclear Information System (INIS)

    Because of their rapid dissolution of many actinide metals and refractory oxides, superacids such as HSO3F/SbF5 have potential applications in actinide processing. However, material compatibility must first be addressed because of the highly corrosive nature of superacids. This paper describes the qualitative rates of attack of fluorosulphonic acid-antimony pentafluoride superacid on a variety of metal substrates relevant to nuclear processing

  18. Application of Hyphenated Techniques in Speciation Analysis of Arsenic, Antimony, and Thallium

    OpenAIRE

    Rajmund Michalski; Sebastian Szopa; Magdalena Jabłońska; Aleksandra Łyko

    2012-01-01

    Due to the fact that metals and metalloids have a strong impact on the environment, the methods of their determination and speciation have received special attention in recent years. Arsenic, antimony, and thallium are important examples of such toxic elements. Their speciation is especially important in the environmental and biomedical fields because of their toxicity, bioavailability, and reactivity. Recently, speciation analytics has been playing a unique role in the studies of biogeochemi...

  19. Electrodeposition Mechanism of Trivalent Antimony%三价锑的电沉积机理

    Institute of Scientific and Technical Information of China (English)

    林艳; 谢刚; 杨大锦

    2011-01-01

    The reduction mechanism of Sb3+ in H2SO4-NH4F-SbF3 electrolyte system was studied by means of electrochemical methods, including chronopotentiometry and alternating current impedance.Analysis of potential-time transients clearly shows that antimony (Ⅲ) could be reduced to antimony metal via two-steps irreversible electron transfer process in H2SO4-NH4F-SbF3 system.The relationship between iτ1/2 and i calculated by chronopotentiometry indicates that the trivalent antimony complex undergoes chemical transformation reaction before its reduction in the cathode.The impedance results confirm the above conclusion and indicate that the adsorption states which are the middle product of trivalent antimony have different influences on two electron transfer steps.%采用恒电流阶跃法及交流阻抗法等电化学方法,研究了H2SO4-NH4F-SbF3体系中三价锑的阴极还原机理.电势~时间暂态曲线出现二步反应特征,表明Sb"还原分两步进行.由恒电流阶跃曲线中iτ1/2~i关系可知Sb3+阴极还原存在前置化学转化.Sb3+阴极还原的交流阻抗测定结果进一步验证Sb3+还原是存在化学前置转化步骤的二步反应,且电活性中间产物吸附在电极表面,吸附反应对两步电子转移步骤的影响不同.

  20. Polycrystalline thin films of antimony selenide via chemical bath deposition and post deposition treatments

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Lazcano, Y. [Department of Solar Energy Materials, Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Temixco, Morelos-62580 (Mexico); Pena, Yolanda [Department of Solar Energy Materials, Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Temixco, Morelos-62580 (Mexico); Nair, M.T.S. [Department of Solar Energy Materials, Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Temixco, Morelos-62580 (Mexico)]. E-mail: mtsn@cie.unam.mx; Nair, P.K. [Department of Solar Energy Materials, Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Temixco, Morelos-62580 (Mexico)

    2005-12-22

    We report a method for obtaining thin films of polycrystalline antimony selenide via chemical bath deposition followed by heating the thin films at 573 K in selenium vapor. The thin films deposited from chemical baths containing one or more soluble complexes of antimony, and selenosulfate initially did not show X-ray diffraction (XRD) patterns corresponding to crystalline antimony selenide. Composition of the films, studied by energy dispersive X-ray analyses indicated selenium deficiency. Heating these films in presence of selenium vapor at 573 K under nitrogen (2000 mTorr) resulted in an enrichment of Se in the films. XRD peaks of such films matched Sb{sub 2}Se{sub 3}. Evaluation of band gap from optical spectra of such films shows absorption due to indirect transition occurring in the range of 1-1.2 eV. The films are photosensitive, with dark conductivity of about 2 x 10{sup -8} ({omega} cm){sup -1} and photoconductivity, about 10{sup -6} ({omega} cm){sup -1} under tungsten halogen lamp illumination with intensity of 700 W m{sup -2}. An estimate for the mobility life time product for the film is 4 x 10{sup -9} cm{sup 2} V{sup -1}.

  1. Studies in atomic-fluorescence spectroscopy-V The fluorescence characteristics and determination of antimony.

    Science.gov (United States)

    Dagnall, R M; Thompson, K C; West, T S

    1967-10-01

    Atomic-fluorescence of antimony may be generated in an air-propane flame by nebulizing aqueous solutions of antimony salts whilst irradiating the flame by means of a microwave-excited electrode-less discharge tube operating at 30 W. The strongest fluorescence is exhibited by the (4)S(11 2 ) --> (4)P(1 3 ) 2311 A resonance line and weaker signals are observed at the 2068 and 2176 A resonance lines and at four intercombination lines, at 2598, 2671, 2770 and 2878 A. A process of thermally assisted direct-line fluorescence is postulated to account for the otherwise inexplicable intensity of the 2598 A line emission. Atomic-fluorescence spectroscopy at 2176 A permits the determination of antimony in the range 0.1-120 ppm with a detection limit of 0.05 ppm. With the same equipment and source, the range of measurement for atomic-absorption was 6-120 ppm and the detection limit was 1 ppm. No interferences were observed from 100-fold molar amounts of Cd, Co, Cu, Fe, Hg, K, Mg, Mn, Mo, Na, NH(4), Pb and Zn or from arsenate, chloride, nitrate, phosphate and sulphate. PMID:18960212

  2. Morphology and antimony segregation of spangles on batch hot-dip galvanized coatings

    International Nuclear Information System (INIS)

    Spangles produced by batch hot-dip galvanizing process have a rougher surface and a greater surface segregation of alloying element compared with those in continuous hot-dip galvanizing line (CGL), owing to the cooling rate of the former is much smaller than that of the later. Therefore, typical spangles on a batch hot-dipped Zn-0.05Al-0.2Sb alloy coating were investigated. The chemical, morphological characterization and identification of the phases on the spangles were examined by scanning electron microscopy (SEM), backscattered electron imaging (BSE), atomic force microscopy (AFM), energy dispersive spectroscopy (EDS) and X-ray diffraction analysis (XRD). The results showed that the coating surface usually exhibited three kinds of spangles: shiny, feathery and dull spangle, of which extensively antimony surface segregation was detected. The nature of precipitate on the coating surface was identified as β-Sb3Zn4, The precipitated β-Sb3Zn4 particles distributed randomly on the shiny spangle surface, both β-Sb3Zn4 particles and dentritic segregation of antimony dispersed in the dendritic secondary arm spacings of the feathery spangle and on the whole dull spangle surface. The dentritic segregation of antimony and precipitation of Sb3Zn4 compound are discussed by a proposed model.

  3. Antimony in the Contaminated Site of El Triunfo, Baja California Sur, Mexico

    Directory of Open Access Journals (Sweden)

    Marmolejo-Rodríguez A. J.

    2013-04-01

    Full Text Available Antimony has properties similar to arsenic with some of its compounds toxic to humans. Therefore it is necessary to control the wastes accumulated by anthropogenic activities, such as mining, where it is in tailings to be released to the environment. According to the Environment Protection Agency, the maximum value in sediments is 11.2 mg Sb kg–1 and the Earth’s crust average is 0.2 mg Sb kg–1. In this semiarid area, the drainage basin El Carrizal is impacted with wastes of an abandoned gold mine at the Mining District El Triunfo (MD – ET which have tailings with 17,600 mg kg–1 of antimony. In the main dry river (arroyo, the Sb content is between 0.6 and 122 mg kg–1. This element is transported from the source throughout the fluvial basin to discharge into the Pacific Ocean. In the arroyo mouth we collected one sedimentary core and the sediment from dunes (28.6 – 45.7 and 6.43 – 7.74 mg Sb kg–1. This research concluded the antimony is enriched in this semiarid system, with Normalized Enrichment Factors severely enriched mainly in arroyo sediments close to the MD-ET

  4. Parto prematuro após uso de antimonial pentavalente: relato de um caso Premature birth after the use of pentavalent antimonial: case report

    Directory of Open Access Journals (Sweden)

    Bruna Pinheiro Silveira

    2003-07-01

    Full Text Available Relata-se o caso de uma mulher de 19 anos, na 24ª semana de gravidez e com leishmaniose visceral. Tratada com antimonial pentavalente na posologia de 850mg/dia por 20 dias, ocorreu parto prematuro no quinto dia de tratamento e óbito da criança um dia após nascimento. Considerando a importância da protozoose no nosso meio e a raridade da associação com a gestação, julgamos de interesse a publicação do caso.A case is reported of a 19-year-old woman, at week 24 of gestation, with visceral leishmaniosis. She was treated with meglumine antimoniate at a dose of 850mg/day for 20 days. There occurred premature birth on day five of treatment and the neonate died one day after birth. Considering the importance of protozoiasis in our population and the rarity of the association with pregnancy, we resolved to publish the case.

  5. CD133, Selectively Targeting the Root of Cancer

    Directory of Open Access Journals (Sweden)

    Jörg U. Schmohl

    2016-05-01

    Full Text Available Cancer stem cells (CSC are capable of promoting tumor initiation and self-renewal, two important hallmarks of carcinoma formation. This population comprises a small percentage of the tumor mass and is highly resistant to chemotherapy, causing the most difficult problem in the field of cancer research, drug refractory relapse. Many CSC markers have been reported. One of the most promising and perhaps least ubiquitous is CD133, a membrane-bound pentaspan glycoprotein that is frequently expressed on CSC. There is evidence that directly targeting CD133 with biological drugs might be the most effective way to eliminate CSC. We have investigated two entirely unrelated, but highly effective approaches for selectively targeting CD133. The first involves using a special anti-CD133 single chain variable fragment (scFv to deliver a catalytic toxin. The second utilizes this same scFv to deliver components of the immune system. In this review, we discuss the development and current status of these CD133 associated biological agents. Together, they show exceptional promise by specific and efficient CSC elimination.

  6. Comparison of oral itraconazole and intramuscular meglumine antimoniate in the treatment of cutaneous leishmaniasis

    International Nuclear Information System (INIS)

    To compare the efficacy and tolerability of oral itraconazole against intramuscular meglumine antimoniate in the treatment of Cutaneous Leishmaniasis (CL). Two hundred eligible and consenting patients of Cutaneous Leishmaniasis (CL) were divided in two groups with 100 patients in each. The number and location of the lesions were documented and clinical types of cutaneous leishmaniasis were noted. The diagnosis was confirmed by skin slit smear and histopathology of the lesional skin. Culture on Nicolle Novy MacNeal (NNN) medium and Leishmanin test was done in all patients. All the patients in both groups were subjected to complete blood picture, urine examination, serum urea and creatinine levels and ECG examination. One group was given itraconazole 100 mg twice daily orally for a duration of 6-8 weeks. The other group was given meglumine antimoniate 10 cc in the form of deep intramuscular injections for 15-30 days. The efficacy of the treatment was judged by clinical and parasitological response. Side effects of the agents were also noted during treatment. Out of 200 patients studied, 185 were males and 15 were females. The mean age of presentation was 30 + 6.6 years. Single lesion was seen in 132 (66%) subjects whereas 68 (34%) subjects had multiple lesions. Slit skin smears were positive in 50 (25%) of the patients. Skin biopsy yielded the presence of LT bodies in 150 (75%) subjects. The culture was positive in 102 (51%) cases. Leishmanin test was positive in 94% subjects. Seventy-five (75%) patients on itraconazole therapy showed complete clinical and parasitological cure in 4-8 weeks duration. A rise in ALT was seen in 12% subjects. Five (5%) subjects did not show any improvement till the end of therapy. Sixty-five (65%) subjects on meglumine antimoniate showed complete healing in 15-30 days. In 35 (35%) of the patients, the treatment had to be stopped due to intolerable side-effects. Four cases of lupoid leishmaniasis and 4 cases of sporotrichoid leishmaniasis

  7. Development of an analytical method for antimony speciation in vegetables by HPLC-hydride generation-atomic fluorescence spectrometry.

    Science.gov (United States)

    Olivares, David; Bravo, Manuel; Feldmann, Jorg; Raab, Andrea; Neaman, Alexander; Quiroz, Waldo

    2012-01-01

    A new method for antimony speciation in terrestrial edible vegetables (spinach, onions, and carrots) was developed using HPLC with hydride generation-atomic fluorescence spectrometry. Mechanical agitation and ultrasound were tested as extraction techniques. Different extraction reagents were evaluated and optimal conditions were determined using experimental design methodology, where EDTA (10 mmol/L, pH 2.5) was selected because this chelate solution produced the highest extraction yield and exhibited the best compatibility with the mobile phase. The results demonstrated that EDTA prevents oxidation of Sb(III) to Sb(V) and maintains the stability of antimony species during the entire analytical process. The LOD and precision (RSD values obtained) for Sb(V), Sb(III), and trimethyl Sb(V) were 0.08, 0.07, and 0.9 microg/L and 5.0, 5.2, and 4.7%, respectively, for a 100 microL sample volume. The application of this method to real samples allowed extraction of 50% of total antimony content from spinach, while antimony extracted from carrots and onion samples ranged between 50 and 60 and 54 and 70%, respectively. Only Sb(V) was detected in three roots (onion and spinach) that represented 60-70% of the total antimony in the extracts. PMID:22970588

  8. Development of an analytical method for antimony speciation in vegetables by HPLC-hydride generation-atomic fluorescence spectrometry.

    Science.gov (United States)

    Olivares, David; Bravo, Manuel; Feldmann, Jorg; Raab, Andrea; Neaman, Alexander; Quiroz, Waldo

    2012-01-01

    A new method for antimony speciation in terrestrial edible vegetables (spinach, onions, and carrots) was developed using HPLC with hydride generation-atomic fluorescence spectrometry. Mechanical agitation and ultrasound were tested as extraction techniques. Different extraction reagents were evaluated and optimal conditions were determined using experimental design methodology, where EDTA (10 mmol/L, pH 2.5) was selected because this chelate solution produced the highest extraction yield and exhibited the best compatibility with the mobile phase. The results demonstrated that EDTA prevents oxidation of Sb(III) to Sb(V) and maintains the stability of antimony species during the entire analytical process. The LOD and precision (RSD values obtained) for Sb(V), Sb(III), and trimethyl Sb(V) were 0.08, 0.07, and 0.9 microg/L and 5.0, 5.2, and 4.7%, respectively, for a 100 microL sample volume. The application of this method to real samples allowed extraction of 50% of total antimony content from spinach, while antimony extracted from carrots and onion samples ranged between 50 and 60 and 54 and 70%, respectively. Only Sb(V) was detected in three roots (onion and spinach) that represented 60-70% of the total antimony in the extracts.

  9. Leachability of antimony from energy ashes. Total contents, leachability and remedial suggestions; Lakning av antimon fraan energiaskor. Totalhalter, lakbarhet samt foerslag till aatgaerder

    Energy Technology Data Exchange (ETDEWEB)

    Baeckstroem, Mattias [Oerebro Univ. (Sweden)

    2006-01-15

    In the current project total concentrations for antimony in 31 energy ashes have been compiled. The average concentration of antimony in boiler fly ash and grate boiler fly ash is 192 and 1,140 mg/kg, respectively. The corresponding antimony concentrations for boiler ashes and grate bottom ashes are 86,5 and 61,8 mg/kg, respectively. Multivariate calculations clearly pointed out waste as the major source for antimony in ashes. The difference between total antimony concentration in fly ash and bottom ash is greatest for grate boilers, in average 18 times higher in the fly ash. The difference for CFB/BFB-boilers is only slightly more than 2. However, based on amount, 75% of the total antimony inventory is recovered in the fly ashes for both CFB/BFB and grate boilers. Eleven (eight of which were bottom ashes) out of the 31 samples exceeded the guidelines for inert waste. It is clear that the higher ionic strength in the solutions from the fly ashes contribute to decrease the solubility for critical minerals retaining antimony. In addition, the fly ashes have considerably larger effective surface able to sorb trace elements. A clear and positive covariance was discovered between aluminium and antimony. Furthermore, it was noted that antimony showed no typical anionic behaviour despite the fact that it according to the geochemical calculations should be present as SbO{sub 3}{sup -}. At L/S 10, a maximum of 1% of the total antimony concentration is leached. This should be compared to chloride that had 94% of the total concentration leached at L/S 10. There was no correlation between the leached antimony concentrations and the total antimony concentrations. The sequential extractions also suggest a low leachability for antimony from the ashes. In average only 9,6% is released at pH 7, 7,3% at pH 5, 3,6% during reducing conditions and 3,2% during oxidising conditions. In total, only 24% of the total antimony concentrations is released during the four extraction steps. The

  10. Synthesis, characterization and single crystal X-ray analysis of chlorobis(N,N-dimethyldithiocarbamato-S,S′antimony(III

    Directory of Open Access Journals (Sweden)

    H.P.S. Chauhan

    2015-07-01

    Full Text Available The title compound chlorobis(N,N-dimethyldithiocarbamato-S,S′antimony(III has been prepared in distilled acetonitrile and characterized by physicochemical [melting point and molecular weight determination, elemental analysis (C, H, N, S & Sb], spectral [FT–IR, far IR, NMR (1H & 13C] studies. The crystal and molecular structure was further confirmed using single crystal X-ray diffraction analysis which features a five-coordinate geometry for antimony(III within a ClS4 donor set. The distortion in the co-planarity of ClSbS3 evidences the stereochemical influence exerts by the lone pair of electrons on antimony(III. Two centrosymmetrically related molecule held together via C–H···Cl secondary interaction result in molecular aggregation of the compound.

  11. Selective liquid-liquid extraction of antimony(III from hydrochloric acid media by N-n-octylaniline in xylene

    Directory of Open Access Journals (Sweden)

    M. A. ANUSE

    2004-04-01

    Full Text Available N-n-Octylaniline in xylene was used for the extraction separation of antimony(III from hydrochloric acid media. Antimony(III was extracted quantitatively with 10 mL 4 % N-n-octylaniline in xylene. It was stripped from the organic phase with 0.5 M ammonia and estimated photometrically by the iodide method. The effect of metal ion, acid, reagent concentration and various foreign ions was investigated. The method affords binary and ternary separation of antimony(III from tellurium(IV, selenium(IV, lead(II, bismuth(III, tin(IV, germanium(IV, copper(II, gold(III, iron(III and zinc(II. The method is applicable for the analysis of synthetic mixtures, alloys and semiconductor thin films. It is fast, accurate and precise.

  12. Strong expression of CD133 is associated with increased cholangiocarcinoma progression

    Institute of Scientific and Technical Information of China (English)

    Kawin Leelawat; Taweesak Thongtawee; Siriluck Narong; Somboon Subwongcharoen; Sa-ad Treepongkaruna

    2011-01-01

    AIM: To determine the role of CD133 in cholangiocar-cinoma progression.METHODS: CD133 protein expression was evaluated by immunohistochemistry in 34 cholangiocarcinoma specimens. In addition, proliferation, chemoresistance and invasive properties of CD133-enriched (CD133+) and CD133-depleted (CD133-) RMCCA1 cholangiocarci-noma cells were studied and compared.RESULTS: Strong CD133 expression was observed in 67.6% (23/34) of the cholangiocarcinoma specimens. Strong expression of CD133 was significantly associat-ed with nodal metastasis (P = 0.009) and positive sur-gical margin status (P = 0.011). In the in vitro study, both the CD133+ and CD133- cells had similar prolifera-tion abilities and resistance to chemotherapeutic drugs. However, the CD133+ cells had a higher invasive ability compared with CD133- cells.CONCLUSION: CD133+ cells play an important role in the invasiveness of cholangiocarcinoma. Targeting of the CD133+ cells may be a useful approach to improve treatment against cholangiocarcinoma.

  13. 21 CFR 133.155 - Mozzarella cheese and scamorza cheese.

    Science.gov (United States)

    2010-04-01

    ... safe and suitable ingredients may be used: (1) Dairy ingredients. Cow's milk, nonfat milk, or cream, as defined in § 133.3, or the corresponding products of water buffalo origin, except that cow's milk products... buffalo milk, the name of the food is accompanied by the phrase “made with water buffalo milk”. (d)...

  14. 40 CFR 164.133 - Emergency waiver of hearing.

    Science.gov (United States)

    2010-07-01

    ... Section 164.133 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS RULES OF PRACTICE GOVERNING HEARINGS, UNDER THE FEDERAL INSECTICIDE, FUNGICIDE, AND RODENTICIDE ACT... he determines: (1) That the application presents a situation involving need to use the pesticide...

  15. 27 CFR 31.133 - Change in management.

    Science.gov (United States)

    2010-04-01

    ... controlling the management policies or buying or selling practices of the business pertaining to alcohol... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Change in management. 31... § 31.133 Change in management. A change in management that involves no change in ownership of...

  16. Dicty_cDB: VFJ133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available fqpmvlekk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VFJ133 (VFJ1...A Score E Sequences producing significant alignments: (bits) Value N ( BJ432622 ) Dictyostelium discoideum c... significant alignments: (bits) Value AB292732_1( AB292732 |pid:none) Dictyosteli

  17. 49 CFR 237.133 - Supervision of repairs and modifications.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Supervision of repairs and modifications. 237.133... Supervision of repairs and modifications. Each repair or modification pursuant to this part shall be performed under the immediate supervision of a railroad bridge supervisor as defined in § 237.55 of this part...

  18. 21 CFR 133.171 - Pasteurized process pimento cheese.

    Science.gov (United States)

    2010-04-01

    ... process cheese with fruits, vegetables, or meats, and is subject to the requirement for label statement of..., washed curd cheese, colby cheese, and granular cheese, respectively. (d) The only fruit, vegetable, or... Section 133.171 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...

  19. 50 CFR 600.133 - Scientific and Statistical Committee (SSC).

    Science.gov (United States)

    2010-10-01

    ... Fishery Management Councils § 600.133 Scientific and Statistical Committee (SSC). (a) Each Council shall...) Each SSC shall provide its Council ongoing scientific advice for fishery management decisions... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Scientific and Statistical Committee...

  20. 41 CFR 105-53.133 - Information Security Oversight Office.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Information Security... FUNCTIONS Central Offices § 105-53.133 Information Security Oversight Office. (a) Creation and authority. The Information Security Oversight Office (ISOO), headed by the Director of ISOO, who is appointed...

  1. 16 CFR 1500.133 - Extremely flammable contact adhesives; labeling.

    Science.gov (United States)

    2010-01-01

    ... regulation (sec. 16 CFR part 1302), paragraphs (a), (b), (c) and (d) of this section are revoked as to the... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Extremely flammable contact adhesives... REGULATIONS § 1500.133 Extremely flammable contact adhesives; labeling. (a) Extremely flammable...

  2. 40 CFR 35.133 - Programs eligible for inclusion.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Programs eligible for inclusion. 35.133... Programs eligible for inclusion. (a) Eligible programs. Except as provided in paragraph (b) of this section, the environmental programs eligible, in accordance with appropriation acts, for inclusion in...

  3. {sup 133}Xenon study in various pulmonary diseases

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Q.C.; Mori, Yutaka; Uchiyama, Masayuki; Kawakami, Kenji [Jikei Univ., Tokyo (Japan). School of Medicine; Tominaga, Shigeru

    1997-08-01

    An aim of this study is to evaluate the role of {sup 133}Xe examination for patients with various pulmonary diseases (diffuse pan bronchiolitis and bronchiectasis end so on were included) whose pulmonary function was within normal limits. Subjects consist of 21 cases (9 cases of chronic bronchitis, 3 cases of lower respiratory infectious disease were contained; 5 of bronchiectasis, 1 case of lower respiratory infectious disease were contained; 3 of diffuse pan bronchiolitis; 1 case of pulmonary emphysema; 2 cases of sequestration of the lung; 1 case of bacterial pneumonia). These patients were treated by Levofloxacin (200-300 mg/day) from 2-6 months and Ofloxacin (300 mg/day) from 3-6 months. Ventilation scintigraphy was performed with {sup 133}Xe before and after therapy. Chest X-P, CT imaging, pulmonary function test and blood gas analysis were examined at the same period. All cases showed abnormal regions of ventilation before therapy, although results of pulmonary function test and blood gas analysis were within normal ranges. Abnormal areas of ventilation were improved by therapy in all cases, but most of the patients still showed abnormal retention of {sup 133}Xe. This finding suggests that it is necessary to continue the treatment. As conclusion, {sup 133}Xe is useful to evaluate an indication of treatment for various pulmonary diseases. (author)

  4. 40 CFR 180.133 - Lindane; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Lindane; tolerances for residues. 180... PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.133 Lindane; tolerances for residues. (a) General. Tolerances are established for residues of the...

  5. Development and pharmacokinetic of antimony encapsulated in liposomes of phosphatidylserine using radioisotopes in experimental leishmaniasis

    International Nuclear Information System (INIS)

    Leishmaniasis are a complex of parasitic diseases caused by intra macrophage protozoa of the genus Leishmania, and is fatal if left untreated. Pentavalent antimonials, though toxic and their mechanism of action being unclear, remain the first-line drugs for treatment. Effective therapy could be achieved by delivering antileishmanial drugs to these sites of infection. Liposomes are phospholipid vesicles that promote improvement in the efficacy and action of drugs in target cell. Liposomes are taken up by the cells of mononuclear phagocytic system (MPS). The purpose of this study was to develop a preparation of meglumine antimonate encapsulated in liposomes of phosphatidylserine and to study its pharmacokinetic in healthy mice to establish its metabolism and distribution. Quantitative analysis of antimony from liposomes demonstrated that Neutron Activation Analysis was the most sensitive technique with almost 100 % of accuracy. All liposome formulations presented a mean diameter size of 150 nm. The determination of IC50 in infected macrophage showed that liposome formulations were between 10 - 63 fold more effective than the free drug, indicating higher selectivity index. By fluorescence microscopy, an increased uptake of fluorescent-liposomes was seen in infected macrophages during short times of incubation compared with non-infected macrophages. Biodistribution studies showed that meglumine antimonate irradiated encapsulated in liposomes of phosphatidylserine promoted a targeting of antimony for MPS tissues and maintained high doses in organs for a prolonged period. In conclusion, these data suggest that meglumine antimonate encapsulated in liposomes showed higher effectiveness than the non-liposomal drug against Leishmania infection. The development of liposome formulations should be a new alternative for the chemotherapy of infection diseases, especially Leishmaniasis, as they are used to sustain and target pharmaceuticals to the local of infection. (author)

  6. Lithium-antimony-lead liquid metal battery for grid-level energy storage

    Science.gov (United States)

    Wang, Kangli; Jiang, Kai; Chung, Brice; Ouchi, Takanari; Burke, Paul J.; Boysen, Dane A.; Bradwell, David J.; Kim, Hojong; Muecke, Ulrich; Sadoway, Donald R.

    2014-10-01

    The ability to store energy on the electric grid would greatly improve its efficiency and reliability while enabling the integration of intermittent renewable energy technologies (such as wind and solar) into baseload supply. Batteries have long been considered strong candidate solutions owing to their small spatial footprint, mechanical simplicity and flexibility in siting. However, the barrier to widespread adoption of batteries is their high cost. Here we describe a lithium-antimony-lead liquid metal battery that potentially meets the performance specifications for stationary energy storage applications. This Li||Sb-Pb battery comprises a liquid lithium negative electrode, a molten salt electrolyte, and a liquid antimony-lead alloy positive electrode, which self-segregate by density into three distinct layers owing to the immiscibility of the contiguous salt and metal phases. The all-liquid construction confers the advantages of higher current density, longer cycle life and simpler manufacturing of large-scale storage systems (because no membranes or separators are involved) relative to those of conventional batteries. At charge-discharge current densities of 275 milliamperes per square centimetre, the cells cycled at 450 degrees Celsius with 98 per cent Coulombic efficiency and 73 per cent round-trip energy efficiency. To provide evidence of their high power capability, the cells were discharged and charged at current densities as high as 1,000 milliamperes per square centimetre. Measured capacity loss after operation for 1,800 hours (more than 450 charge-discharge cycles at 100 per cent depth of discharge) projects retention of over 85 per cent of initial capacity after ten years of daily cycling. Our results demonstrate that alloying a high-melting-point, high-voltage metal (antimony) with a low-melting-point, low-cost metal (lead) advantageously decreases the operating temperature while maintaining a high cell voltage. Apart from the fact that this finding

  7. The LABCG2 Transporter from the Protozoan Parasite Leishmania Is Involved in Antimony Resistance.

    Science.gov (United States)

    Perea, Ana; Manzano, José Ignacio; Castanys, Santiago; Gamarro, Francisco

    2016-06-01

    Treatment for leishmaniasis, which is caused by Leishmania protozoan parasites, currently relies on a reduced arsenal of drugs. However, the significant increase in the incidence of drug therapeutic failure and the growing resistance to first-line drugs like antimonials in some areas of Northern India and Nepal limit the control of this parasitic disease. Understanding the molecular mechanisms of resistance in Leishmania is now a matter of urgency to optimize drugs used and to identify novel drug targets to block or reverse resistant mechanisms. Some members of the family of ATP-binding cassette (ABC) transporters in Leishmania have been associated with drug resistance. In this study, we have focused our interest to characterize LABCG2's involvement in drug resistance in Leishmania. Leishmania major parasites overexpressing the ABC protein transporter LABCG2 were generated in order to assess how LABCG2 is involved in drug resistance. Assays of susceptibility to different leishmanicidal agents were carried out. Analysis of the drug resistance profile revealed that Leishmania parasites overexpressing LABCG2 were resistant to antimony, as they demonstrated a reduced accumulation of Sb(III) due to an increase in drug efflux. Additionally, LABCG2 was able to transport thiols in the presence of Sb(III) Biotinylation assays using parasites expressing LABCG2 fused with an N-terminal green fluorescent protein tag revealed that LABCG2 is partially localized in the plasma membrane; this supports data from previous studies which suggested that LABCG2 is localized in intracellular vesicles that fuse with the plasma membrane during exocytosis. In conclusion, Leishmania LABCG2 probably confers antimony resistance by sequestering metal-thiol conjugates within vesicles and through further exocytosis by means of the parasite's flagellar pocket. PMID:27021316

  8. Highly active and stable Pt electrocatalysts promoted by antimony-doped SnO2 supports for oxygen reduction reactions

    DEFF Research Database (Denmark)

    Yin, Min; Xu, Junyuan; Li, Qingfeng;

    2014-01-01

    Alternative composite supports for platinum catalysts were synthesized from antimony doped tin dioxide (ATO) nanoparticles. In the range of the antimony content from 0 to 11mol%, the highest electrical conductivity of 1.1Scm-1 at 130°C was obtained for the 5mol% Sb ATO, from which composite...... supports composed of oxides and carbon and supported platinum catalysts were prepared. Using the pure oxide support, the Pt/ATO catalyst displayed superior specific activity and stability for the oxygen reduction reactions (ORRs). Low surface area of ATO caused poor dispersion of Pt particles compared...

  9. Separation of antimony from synthetic cloth. Application in forensic science using neutron activation analysis

    International Nuclear Information System (INIS)

    A simple ion-exchange separation procedure was developed for selective removal of antimony from synthetic cloth to facilitate determination of several trace elements frequently used to identify gunshot residues by neutron activation analysis. Radiotracers of Sb, Ba, Cu, Co, As, Zn, Hg and Ag were employed to optimize the developed procedure. The method involves the quantitative retention of the above elements, except of Sb, from 0.2M ammonium carbonate solution using Chelex 100 resin and subsequent quantitative elution of the elements of interest with 2M nitric acid for gamma-ray spectrometry. The procedure was tested by simulated gunshot residues. (author)

  10. Influence of arsenic,antimony and cobalt impurities on the cathodic process in zinc electrowinning

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    By means of an electrochemical study,the influence of arsenic,antimony and cobalt on cathodic polarization in the zinc electrowinning process,the associated kinetic equations and parameters,and the polarization mechanism have been studied.The results show that the experimental values of the kinetic parameters are in accord with the theoretical values in the ZnSO4/H2SO4 solution with a single impurity is added.In contrast,the charge transfer coefficient α is smaller than the theoretical value in the ZnSO4/H2SO4 solution when the three impurities are added together.

  11. Polymorphism and properties of Bi{sub 2}WO{sub 6} doped with pentavalent antimony

    Energy Technology Data Exchange (ETDEWEB)

    Kharitonova, E.P.; Belov, D.A. [M.V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Gagor, A.B.; Pietraszko, A.P. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okólna 2, 50-950 Wrocław (Poland); Alekseeva, O.A. [Shubnikov Institute of Crystallography, Russian Academy of Sciences, Leninsky pr. 59, 119333 Moscow (Russian Federation); Voronkova, V.I., E-mail: voronk@polly.phys.msu.ru [M.V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation)

    2014-04-05

    Highlights: • The limit of Bi{sub 2}W{sub 1−x}Sb{sub x}O{sub 6−y} solid solutions is at x = 0.05. • Bi{sub 2}W{sub 1−x}Sb{sub x}O{sub 6−y} does not fully transform into high-temperature monoclinic phase. • Sb{sup 5+} has a weak effect on the temperatures of the ferroelectric transitions. • γ→γ{sup ‴} transition near 650 °C was observed as strong permittivity peak at 0.01–8 Hz. • The conductivity of Bi{sub 2}W{sub 0.96}Sb{sub 0.04}O{sub 6−y} at 800 °C reaches 0.02 S/cm. -- Abstract: Antimony-containing solid solutions isostructural with bismuth tungstate, Bi{sub 2}WO{sub 6}, have been prepared in air as polycrystalline samples by solid-state reactions and as single crystals by unseeded flux growth. The antimony in the solid solutions is in a pentavalent state and substitutes for tungsten in the structure of Bi{sub 2}WO{sub 6}. The Bi{sub 2}W{sub 1−x}Sb{sub x}O{sub 6−y} solid solutions have been shown to exist in the composition range 0 ⩽ x ⩽ 0.05. We have examined the effect of Sb{sup 5+} doping on the polymorphism and properties of Bi{sub 2}WO{sub 6}. In contrast to undoped Bi{sub 2}WO{sub 6}, antimony-substituted bismuth tungstate does not completely transform into its high-temperature, monoclinic phase at 960 °C and remains two-phase up to temperatures approaching its melting point. Antimony substitution for tungsten has a weak effect on the temperatures of the ferroelectric phase transitions. Heterovalent substitution of Sb{sup 5+} for W{sup 6+} is accompanied by the formation of extra oxygen vacancies and an increase in the electrical conductivity of the solid solutions by one to two orders of magnitude relative to undoped Bi{sub 2}WO{sub 6}.

  12. Electromagnetic absorption and shielding behavior of polyaniline-antimony oxide composites

    Science.gov (United States)

    Faisal, Muhammad; Khasim, Syed

    2013-02-01

    This work highlights the microwave absorption and electromagnetic interference (EMI) shielding properties of synthesized polyaniline (PAni)-antimony oxide (Sb2O3) composites in the 8-12 GHz (X-band) range. These composites showed absorption dominated EMI shielding effectiveness (EMI SEA) of -34 to -40 dB (> 99 % attenuation), indicating their shielding potential throughout the X-band. Our analyses reveal that the Sb2O3 particles in PAni matrix have key impact in determining the microwave absorption properties of the composites.

  13. Determination of arsenic, selenium and antimony by neutron activation analysis. Application to hair samples

    International Nuclear Information System (INIS)

    A fast rabbit system for instrumental activation analysis with reactor neutrons is described. Its use in the determination of selenium in hair is discussed. A survey is given of the correction factors which are inherent to the use of short-lived radionuclides. An alternative to INAA is NAA based on the separation of arsenic, selenium and antimony by hydride evaporation and adsorption to active carbon. Data for some Standard Reference Materials are given. This work was done under research contract 2440/RI/RB with the IAEA

  14. CD133 does not enrich for the stem cell activity in vivo in adult mouse prostates

    Directory of Open Access Journals (Sweden)

    Xing Wei

    2016-05-01

    Full Text Available CD133 is widely used as a marker for stem/progenitor cells in many organ systems. Previous studies using in vitro stem cell assays have suggested that the CD133-expressing prostate basal cells may serve as the putative prostate stem cells. However, the precise localization of the CD133-expressing cells and their contributions to adult murine prostate homeostasis in vivo remain undetermined. We show that loss of function of CD133 does not impair murine prostate morphogenesis, homeostasis and regeneration, implying a dispensable role for CD133 in prostate stem cell function. Using a CD133-CreERT2 model in conjunction with a fluorescent report line, we show that CD133 is not only expressed in a fraction of prostate basal cells, but also in some luminal cells and stromal cells. CD133+ basal cells possess higher in vitro sphere-forming activities than CD133− basal cells. However, the in vivo lineage tracing study reveals that the two cell populations possess the same regenerative capacity and contribute equally to the maintenance of the basal cell lineage. Similarly, CD133+ and CD133− luminal cells are functionally equivalent in maintaining the luminal cell lineage. Collectively, our study demonstrates that CD133 does not enrich for the stem cell activity in vivo in adult murine prostate. This study does not contradict previous reports showing CD133+ cells as prostate stem cells in vitro. Instead, it highlights a substantial impact of biological contexts on cellular behaviors.

  15. Differential number of CD34+, CD133+ and CD34+/CD133+ cells in peripheral blood of patients with congestive heart failure

    Directory of Open Access Journals (Sweden)

    Fritzenwanger M

    2009-03-01

    Full Text Available Abstract Background Endothelial progenitor cells (EPC which are characterised by the simulateous expression of CD34, CD133 and vascular endothelial growth receptor 2 (VEGF 2 are involved in the pathophysiology of congestive heart failure (CHF and their number and function is reduced in CHF. But so far our knowledge about the number of circulating hematopoietic stem/progenitor cells (CPC expressing the early hematopoietic marker CD133 and CD34 in CHF is spares and therefore we determined their number and correlated them with New York Heart Association (NYHA functional class. Methods CD34 and CD133 surface expression was quantified by flow cytometry in the peripheral venous blood of 41 healthy adults and 101 patients with various degrees of CHF. Results CD34+, CD133+ and CD34+/CD133+ cells correlated inversely with age. Both the number of CD34+ and of CD34+/CD133+ cells inversely correlated with NYHA functional class. The number of CD133+ cells was not affected by NYHA class. Furthermore the number of CD133+ cells did not differ between control and CHF patients. Conclusion In CHF the release of CD34+, CD133+ and CD34+/CD133+ cells from the bone marrow seems to be regulated differently. Modulating the releasing process in CHF may be a tool in CHF treatment.

  16. The biological difference between CD13+CD133+ and CD13¬CD133¬liver cancer cells and its clinical significance

    Directory of Open Access Journals (Sweden)

    Shi-long JIN

    2013-09-01

    Full Text Available Objective To compare the biological difference between CD13+CD133+ and CD13-CD133- hepatocellular carcinoma (HCC cells in HuH7 cell line and its clinical significance. Methods The status of proliferation, phase of the cell cycle, tumor formation in vivo, differentiation, and their chemoresistance to 5-FU and pirarubicin of CD13+CD133+ and CD13-CD133-HCC cells were studied to analyze the clinical implication of CD13+CD133+HCC cell subset. Results The proliferation rate of CD13+CD133+HCC cells was significantly higher than that of CD13-CD133-HCC cells. The cell-cycle phase study showed that 78.45% of the CD13+CD133+HCC cells were in the G0/G1 phase, 2.19% in G2/M phase, and 19.36% in S phase, while 62.18% CD13-CD133-HCC cells were in the G0/G1 phase, 11.88% in G2/M phase, and 25.95% in S phase. Limiting dilution analysis of HuH7 cells revealed that 1×103 CD13+CD133+ cells could form the tumor, while 1×105 CD13-CD133- cells did. CD13+CD133+ cells showed chemoresistance to 5-FU and pirarubicin, while other three subsets succumbed to the drugs. Conclusion CD13+CD133+ cancer cells in HuH7 showed the characteristics of cancer stem cells (CSCs, which might contribute to the relapse and metastasis of liver cancer, and they may be the main target for chemotherapy in human liver cancer.

  17. High levels of antimony in dust from e-waste recycling in southeastern China

    International Nuclear Information System (INIS)

    Environmental contamination due to uncontrolled e-waste recycling is an emerging global issue. Antimony (Sb) is a toxic element used in semiconductor components and flame retardants for circuit board within electronic equipment. When e-waste is recycled, Sb is released and contaminates the surrounding environment; however, few studies have characterized the extent of this problem. In this study, we investigated Sb and arsenic (As) distributions in indoor dust from 13 e-waste recycling villages in Guiyu, Guangdong Province, southeastern China. Results revealed significantly elevated concentrations of Sb (6.1-232 mg/kg) in dust within all villages, which were 3.9-147 times higher than those from the non e-waste sites, indicating e-waste recycling was an important source of Sb pollution. On the contrary, As concentrations (5.4-17.7 mg/kg) in e-waste dusts were similar to reference values from the control sites. Therefore, dusts emitted from e-waste recycling may be characterized by high Sb/As ratios, which may help identify the contamination due to the e-waste recycling activities. - Highlights: → Antimony and arsenic concentrations in dust from e-waste recycling were investigated. → E-waste recycling is an important emerging source of Sb pollution. → Sb/As ratios may help identify the e-waste contamination.

  18. Canine visceral leishmaniasis: comparison of in vitro leishmanicidal activity of marbofloxacin, meglumine antimoniate and sodium stibogluconate.

    Science.gov (United States)

    Vouldoukis, Ioannis; Rougier, Sandrine; Dugas, Bernard; Pino, Paco; Mazier, Dominique; Woehrlé, Frédérique

    2006-01-30

    The control of canine leishmaniasis largely depends on the success of treatment. Drugs currently available to treat this disease are toxic and partially effective. The curative effect of marbofloxacin, a third-generation fluoroquinolone developed for veterinarian individual treatment, was evaluated in vitro in the presence of Leishmania infantum promastigotes and dog-monocyte-derived macrophages; meglumine antimoniate and sodium stibogluconate were used as comparative treatments. We observed that the killing of Leishmania promastigotes and intracellular amastigotes by marbofloxacin was dose-dependent. We demonstrated that successful treatment of canine infected macrophages for 48 h was possible with 500 microg/ml of marbofloxacin. Leishmanicidal activity acted through a TNF-alpha and nitric oxide pathway and correlated with the generation of nitric oxide (NO(2)) production by monocytes derived macrophages from infected (23+/-5 microM) or healthy (21+/-6 microM) dogs, in comparison with NO(2) concentration in infected/non-treated macrophages (Marbofloxacin was shown to be non-toxic at 500 microg/ml in vitro and no cell apoptosis was observed. The molecule was able to induce a parasitic process after significant elimination of amastigotes in leishmania-infected dog macrophages. We propose that marbofloxacin, compared to standard chemotherapeutic agents (meglumine antimoniate and sodium stibogluconate), could be an effective and pragmatic oral route alternative to treat canine leishmaniasis.

  19. Evaluation of antimony microparticles supported on biochar for application in the voltammetric determination of paraquat.

    Science.gov (United States)

    Gevaerd, Ava; de Oliveira, Paulo R; Mangrich, Antonio S; Bergamini, Márcio F; Marcolino-Junior, Luiz H

    2016-05-01

    This work describes the construction and application of carbon paste electrodes modified with biochar and antimony microparticles (SbBCPE) for voltammetric determination of paraquat using a simple and sensitive procedure based on voltammetric stripping analysis. Some parameters such as amount of biochar and antimony used in the composition of the carbon paste and instrumental parameters were examined in detail. Under optimized conditions, an analytical curve was obtained for paraquat determination employing SbBCPE, which showed a linear response ranging from 0.2 to 2.9 μmol L(-1), with limit of detection and quantification of 34 nmol L(-1) and 113 nmol L(-1), respectively, after paraquat pre-concentration of 120 s. The repeatability study presented a RSD=2.0% for 10 consecutive measurements using the same electrode surface and the reproducibility study showed a RSD=2.7% for measurements with 10 different electrode surfaces. The proposed sensor was successfully applied for paraquat determination in tap water and citric fruit juice spiked samples and good recoveries were obtained without any sample pre-treatment, showing its promising analytical performance.

  20. Antimony retention and release from drained and waterlogged shooting range soil under field conditions.

    Science.gov (United States)

    Hockmann, Kerstin; Tandy, Susan; Lenz, Markus; Reiser, René; Conesa, Héctor M; Keller, Martin; Studer, Björn; Schulin, Rainer

    2015-09-01

    Many soils polluted by antimony (Sb) are subject to fluctuating waterlogging conditions; yet, little is known about how these affect the mobility of this toxic element under field conditions. Here, we compared Sb leaching from a calcareous shooting range soil under drained and waterlogged conditions using four large outdoor lysimeters. After monitoring the leachate samples taken at bi-weekly intervals for >1.5 years under drained conditions, two of the lysimeters were subjected to waterlogging with a water table fluctuating according to natural rainfall water infiltration. Antimony leachate concentrations under drained conditions showed a strong seasonal fluctuation between 110 μg L(-1) in summer and soil solution indicated that this decrease in Sb(V) concentrations was attributable to the reduction of Sb(V) to Sb(III) and the stronger sorption affinity of the latter to iron (Fe) (hydr)oxide phases. Our results demonstrate the importance of considering seasonal and waterlogging effects in the assessment of the risks from Sb-contaminated sites. PMID:25592464

  1. A Black Phosphate Conversion Coating on Steel Surface Using Antimony(III)-Tartrate as an Additive

    Science.gov (United States)

    Li, Feng; Wang, Guiping

    2016-05-01

    A novel black phosphate conversion coating was formed on steel surface through a Zn-Mn phosphating bath containing mainly ZnO, H3PO4, Mn(H2PO4)2, and Ca(NO3)2, where antimony(III)-tartrate was used as the blackening agent of phosphatization. The surface morphology and composition of the coating were characterized by scanning electron microscopy, energy dispersion spectroscopy, and x-ray photoelectron spectroscopy. Corrosion resistance of the coating was studied by potentiodynamic polarization curves and electrochemical impedance spectroscopy. The pH value of the solution had significant influence on the formation and corrosion resistance of the coating. The experimental results indicated that the Sb plays a vital role in the blackening of phosphate conversion coating. The optimal concentration of antimony(III)-tartrate in the phosphating bath used in this experiment was 1.0 g L-1, as higher values reduced the corrosion resistance of the coating. In addition, by saponification and oil seals, the corrosion duration of the black phosphate coating in a copper sulfate spot test can be as long as 20 min.

  2. Application of Hyphenated Techniques in Speciation Analysis of Arsenic, Antimony, and Thallium

    Directory of Open Access Journals (Sweden)

    Rajmund Michalski

    2012-01-01

    Full Text Available Due to the fact that metals and metalloids have a strong impact on the environment, the methods of their determination and speciation have received special attention in recent years. Arsenic, antimony, and thallium are important examples of such toxic elements. Their speciation is especially important in the environmental and biomedical fields because of their toxicity, bioavailability, and reactivity. Recently, speciation analytics has been playing a unique role in the studies of biogeochemical cycles of chemical compounds, determination of toxicity and ecotoxicity of selected elements, quality control of food products, control of medicines and pharmaceutical products, technological process control, research on the impact of technological installation on the environment, examination of occupational exposure, and clinical analysis. Conventional methods are usually labor intensive, time consuming, and susceptible to interferences. The hyphenated techniques, in which separation method is coupled with multidimensional detectors, have become useful alternatives. The main advantages of those techniques consist in extremely low detection and quantification limits, insignificant interference, influence as well as high precision and repeatability of the determinations. In view of their importance, the present work overviews and discusses different hyphenated techniques used for arsenic, antimony, and thallium species analysis, in different clinical, environmental and food matrices.

  3. Determination of Trace Antimony (III by Adsorption Voltammetry at Carbon Paste Electrode

    Directory of Open Access Journals (Sweden)

    Nongyue He

    2005-05-01

    Full Text Available This work presents a sensitive method for the determination of trace antimonybased on the antimony-pyrogallol red (PGR adsorption at a carbon paste electrode (CPE.The optimal conditions were to use an electrode containing 25% paraffin oil and 75%high purity graphite powder as working electrode, a 0.10 mol/L HCl solution containing3.0×10-5 mol/L PGR as accumulation medium and a 0.20 mol/L HCl solution aselectrolyte with an accumulation time of 150 s and a reduction time of 60 s at -0.50 Vfollowed with a sweep from -0.50 V to 0.20 V. The mechanism of the electrode reactionwas discussed. Interferences of other metal ions were studied as well. The detection limitwas 1×10-9 mol/L. The linear range was from 2.0×10-9 mol/L to 5.0×10-7 mol/L.Application of the proposed method to the determination of antimony in water andhuman hair samples gave good results.

  4. Organically complexed iron enhances bioavailability of antimony to maize (Zea mays) seedlings in organic soils.

    Science.gov (United States)

    Ptak, Corey; McBride, Murray

    2015-12-01

    Antimony (Sb) is a metalloid belonging to group 15 of the periodic table. Chemical similarities between arsenic (As) and Sb produce concerns about potential health effects of Sb and enrichment in the environment. Antimony is found in oxic environments predominately as an oxyanionic species, antimonite (Sb[OH](6-)). As a result of its net negative charge, Sb[OH](6-) was not initially predicted to have strong interactions with natural organic matter. Oxyanionic species could bind the negatively charged organic matter via a ternary complexation mechanism, in which cationic metals mediate the strong association between organic matter functional groups and oxyanions. However, these interactions are poorly understood in how they influence the bioavailability of oxyanionic contaminants to plants. Iron (Fe) additions to organic soils have been found to increase the number of organically complexed Fe sites suitable for Sb exchange, resulting in a reduced bioavailable fraction of Sb. The bioavailability of Sb to maize seedlings as a function of organically complexed Fe was examined using a greenhouse study. A significant increase in plant tissue Sb was observed as organically complexed Fe increased, which was not predicted by methods commonly used to assess bioavailable Sb. Extraction of soils with organic acids common to the maize rhizosphere suggested that organic acid exudation can readily mobilize Sb bound by organic Fe complexes. PMID:26076768

  5. Morphology-controlled growth of crystalline antimony sulfide via a refluxing polyol process

    Science.gov (United States)

    Zhang, Rui; Chen, Xiangying; Mo, Maosong; Wang, Zhenghua; Zhang, Meng; Liu, Xinyuan; Qian, Yitai

    2004-02-01

    By refluxing antimony trichloride (SbCl 3) and thiourea in various solvents at suitable reaction conditions, antimony sulfide (Sb 2S 3) crystallites with a diversity of well-defined morphologies were synthesized. Sb 2S 3 rods with the average diameter of 800 nm and the length of 7 μm, as well as microtubes with the average outer diameter of 1.2 μm, the average inner diameter of 800 nm and the length of 8 μm, were obtained in 1,2-propanediol at 180°C for 10 min. In contrast, a series of experiments under different conditions were carried out to investigate the influencing factors on the reaction. The as-synthesized products were characterized by powder X-ray diffraction, field-emission scanning electron microscopy, transmission electron microscope and X-ray photoelectron spectra. The results indicate Sb 2S 3 crystals with different morphologies, including rod-like, tube-like, bowknot-like, flower-like, straw-bundled-like, taken under different experimental conditions. It is found that the reaction temperature, time, solvent and poly(vinyl pyrrolidone) (as a polymer capping reagent) play important roles in the formation of the final Sb 2S 3 crystallites with different morphologies. Also, the possible growth mechanism is discussed.

  6. Organically complexed iron enhances bioavailability of antimony to maize (Zea mays) seedlings in organic soils.

    Science.gov (United States)

    Ptak, Corey; McBride, Murray

    2015-12-01

    Antimony (Sb) is a metalloid belonging to group 15 of the periodic table. Chemical similarities between arsenic (As) and Sb produce concerns about potential health effects of Sb and enrichment in the environment. Antimony is found in oxic environments predominately as an oxyanionic species, antimonite (Sb[OH](6-)). As a result of its net negative charge, Sb[OH](6-) was not initially predicted to have strong interactions with natural organic matter. Oxyanionic species could bind the negatively charged organic matter via a ternary complexation mechanism, in which cationic metals mediate the strong association between organic matter functional groups and oxyanions. However, these interactions are poorly understood in how they influence the bioavailability of oxyanionic contaminants to plants. Iron (Fe) additions to organic soils have been found to increase the number of organically complexed Fe sites suitable for Sb exchange, resulting in a reduced bioavailable fraction of Sb. The bioavailability of Sb to maize seedlings as a function of organically complexed Fe was examined using a greenhouse study. A significant increase in plant tissue Sb was observed as organically complexed Fe increased, which was not predicted by methods commonly used to assess bioavailable Sb. Extraction of soils with organic acids common to the maize rhizosphere suggested that organic acid exudation can readily mobilize Sb bound by organic Fe complexes.

  7. Effect of antimony incorporation on structural properties of CuInS{sub 2} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Ben Rabeh, M., E-mail: mohamedbenrabeh@yahoo.f [Laboratoire de Photovoltaique et Materiaux Semi-Conducteurs - ENIT BP 37, Le belvedere, 1002 Tunis (Tunisia); Chaglabou, N., E-mail: nadia_chaglabou@yahoo.f [Laboratoire de Photovoltaique et Materiaux Semi-Conducteurs - ENIT BP 37, Le belvedere, 1002 Tunis (Tunisia); Kanzari, M., E-mail: Mounir.Kanzari@ipeit.rnu.t [Laboratoire de Photovoltaique et Materiaux Semi-Conducteurs - ENIT BP 37, Le belvedere, 1002 Tunis (Tunisia)

    2010-02-15

    CuInS{sub 2} (CIS) single crystals doped with 1, 2, 3 and 4 atomic percent (at.%) of antimony (Sb) were grown by the horizontal Bridgman method. The effect of Sb doping on the structural properties of CIS crystal was studied by means of X-ray diffraction (XRD), energy dispersive X-ray analysis (EDAX), scanning electron microscopy (SEM) and PL measurements. X-ray diffraction data suggests that the doping of Sb in the CIS single crystals does not affect the tetragonal (chalcopyrite) crystal structure and exhibited a (1 1 2) preferred orientation. In addition, with increasing Sb concentration, the X-ray diffraction analysis show that Sb doped CIS crystals are more crystallized and the diffraction peaks of the CuInS{sub 2} phase were more pronounced in particular the (1 1 2) plane. EDAX study revealed that Sb atoms can occupy the indium site and/or occupying the sulfur site to make an acceptor. PL spectra of undoped and Sb doped CIS crystals show two emission peaks at 1.52 and 1.62 eV, respectively which decreased with increasing atomic percent antimony. Sb doped CIS crystals show p-type conductivity.

  8. Food crop accumulation and bioavailability assessment for antimony (Sb) compared with arsenic (As) in contaminated soils.

    Science.gov (United States)

    Wilson, Susan C; Tighe, Matthew; Paterson, Ewan; Ashley, Paul M

    2014-10-01

    Field samples and a 9-week glasshouse growth trial were used to investigate the accumulation of mining derived arsenic (As) and antimony (Sb) in vegetable crops growing on the Macleay River Floodplain in Northern New South Wales, Australia. The soils were also extracted using EDTA to assess the potential for this extractant to be used as a predictor of As and Sb uptake in vegetables, and a simplified bioaccessibility extraction test (SBET) to understand potential for uptake in the human gut with soil ingestion. Metalloids were not detected in any field vegetables sampled. Antimony was not detected in the growth trial vegetable crops over the 9-week greenhouse trial. Arsenic accumulation in edible vegetable parts was risk of exposure through short-term vegetable crops is low. The data also demonstrate that uptake pathways for Sb and As in the vegetables were different with uptake strongly impacted by soil properties. A fraction of soil-borne metalloid was soluble in the different soils resulting in Sb soil solution concentration (10.75 ± 0.52 μg L(-1)) that could present concern for contamination of water resources. EDTA proved a poor predictor of As and Sb phytoavailability. Oral bioaccessibility, as measured by SBET, was risk from soil borne As and Sb in the floodplain environment.

  9. Determination of antimony in nail and hair by thermal neutron activation analysis

    International Nuclear Information System (INIS)

    The concentration of antimony in nail and hair was determined by thermal neutron activation analysis. Samples were collected from the workers of an antimony refinery, inhabitants near the refinery, and residents in control area. They were irradiated by Kyoto University 5000 kW Reactor for 1 h, and cooled for 30 to 100 days. After cooling, the concentration of Sb in nail and hair was estimated by measuring the intensity of γ-ray from 124Sb of the samples, then the samples were washed by 0.1 % aqueous solution of nonionic surface active agent in an ultrasonic cleaner. The γ-ray spectrometry was done again (after washing). The concentration of Sb in nail before washing was 730 ppm for the workers, 2.46 ppm for habitants near the refinery, and 0.19 ppm for the control; after washing, it became 230 ppm for the workers, 0.63 ppm for habitants, and 0.09 ppm for the control. The concentration of Sb in hair before and after washing was 222 ppm and 196 ppm for the workers, and 0.21 ppm and 0.15 ppm for the control, respectively. (author)

  10. One-step synthesis of antimony-doped tin dioxide nanocrystallites and their property

    Institute of Scientific and Technical Information of China (English)

    ZHENG Min; WANG Bao

    2009-01-01

    Antimony-doped tin dioxide(ATO) nanoparticles with primary diameter in the range of 9-10 nm were rapidly synthesized via a novel combustion technique, starting with antimony trichloride and tin tetrachloride as metal sources and self-assembly compounds as fuels. The combustion phenomena and characteristics of products were controlled by assembling components in fuel compounds according to appropriate molar ratio. The as-synthesized products were characterized by XRD, SEM, TEM and XPS, respectively. The electrical conductivity was evaluated through measuring the antistatic property of polyester fiber treated by the as-synthesized products. The results show that a mild combustion phenomena without release of smoke can be taken on and perfect azury rutile ATO crystal with complete substitution can be formed rapidly under the appropriate synthetic conditions. The antistatic property of the polyester fiber treated by the as-synthesized ATO products is enhanced remarkably. The triboelectricity voltage below 1.0 kV, half life below 1.0 s and surface resistance below 1.0×106 Ω can be attained.

  11. Growth of antimony doped P-type zinc oxide nanowires for optoelectronics

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhong Lin; Pradel, Ken

    2016-09-27

    In a method of growing p-type nanowires, a nanowire growth solution of zinc nitrate (Zn(NO.sub.3).sub.2), hexamethylenetetramine (HMTA) and polyethylenemine (800 M.sub.w PEI) is prepared. A dopant solution to the growth solution, the dopant solution including an equal molar ration of sodium hydroxide (NaOH), glycolic acid (C.sub.2H.sub.4O.sub.3) and antimony acetate (Sb(CH.sub.3COO).sub.3) in water is prepared. The dopant solution and the growth solution combine to generate a resulting solution that includes antimony to zinc in a ratio of between 0.2% molar to 2.0% molar, the resulting solution having a top surface. An ammonia solution is added to the resulting solution. A ZnO seed layer is applied to a substrate and the substrate is placed into the top surface of the resulting solution with the ZnO seed layer facing downwardly for a predetermined time until Sb-doped ZnO nanowires having a length of at least 5 .mu.m have grown from the ZnO seed layer.

  12. CD133/prominin-1-mediated autophagy and glucose uptake beneficial for hepatoma cell survival.

    Directory of Open Access Journals (Sweden)

    Haiyang Chen

    Full Text Available CD133/Prominin-1 is a pentaspan transmembrane protein that has been frequently used as a biomarker for cancer stem cells, although its biological function is unclear. The aim of our study was to explore the intrinsic functions of CD133 membrane protein in hepatoma cells during autophagy, apoptosis, tumorigenesis and cell survival through expression or downregulation of CD133. In this study, CD133 was found to be dynamically released from plasma membrane into cytoplasm in both of complete medium(CM and low glucose medium (LGM, and LGM promoted this translocation. Expression of CD133 enhanced autophagic activity in LGM, while silencing CD133 attenuated this activity in HCC LM3 and Huh-7 cells, suggesting that CD133 is associated with autophagy. Immunofluorescence and time-lapsed confocal techniques confirmed that CD133 was associated with autophagy marker, microtubule-associated protein light chain3 (LC3 and lysosome marker during the glucose starvation. We further found that Huh-7 cells with stable expression of shCD133 (Huh-7sh133 impaired the ability of cell proliferation and formation of xenograft tumors in the NOD/SCID mice. Although loss of CD133 did not affect the rates of glucose uptake in Huh-7con and Huh-7sh133 cells under the CM, Huh-7sh133 cells obviously died fast than Huh-7con cells in the LGM and decreased the rate of glucose uptake and ATP production. Furthermore, targeting CD133 by CD133mAb resulted in cell death in HepG2 cells, especially in the LGM, via inhibition of autophagic activity and increase of apoptosis. The results demonstrated that CD133 is involved in cell survival through regulation of autophagy and glucose uptake, which may be necessary for cancer stem cells to survive in tumor microenvironment.

  13. Prognostic role of CD133 expression in colorectal cancer: a meta-analysis

    OpenAIRE

    Wang Ke; Xu Jianjun; Zhang Junshu; Huang Jian

    2012-01-01

    Abstract Background CD133 has been identified as a putative cancer stem cell marker in colorectal cancer (CRC). However, the clinical and prognostic significance of CD133 in CRC remains controversial. Methods Publications were identified which assessed the clinical or prognostic significance of CD133 in CRC up to October 2012. A meta-analysis was performed to clarify the association between CD133 expression and clinical outcomes. Results A total of 12 studies met the inclusion criteria, and c...

  14. Effect of Annealing on the Properties of Antimony Telluride Thin Films and Their Applications in CdTe Solar Cells

    Directory of Open Access Journals (Sweden)

    Zhouling Wang

    2014-01-01

    Full Text Available Antimony telluride alloy thin films were deposited at room temperature by using the vacuum coevaporation method. The films were annealed at different temperatures in N2 ambient, and then the compositional, structural, and electrical properties of antimony telluride thin films were characterized by X-ray fluorescence, X-ray diffraction, differential thermal analysis, and Hall measurements. The results indicate that single phase antimony telluride existed when the annealing temperature was higher than 488 K. All thin films exhibited p-type conductivity with high carrier concentrations. Cell performance was greatly improved when the antimony telluride thin films were used as the back contact layer for CdTe thin film solar cells. The dark current voltage and capacitance voltage measurements were performed to investigate the formation of the back contacts for the cells with or without Sb2Te3 buffer layers. CdTe solar cells with the buffer layers can reduce the series resistance and eliminate the reverse junction between CdTe and metal electrodes.

  15. Progress of Antimony-containing Wastewater Treatment%含锑废水处理技术研究进展

    Institute of Scientific and Technical Information of China (English)

    尹鑫; 周广柱; 王翠珍; 王世豪; 彭刚; 何双

    2014-01-01

    在锑矿的开采及冶炼加工过程中,排出了大量含锑废水,这种重金属废水对环境和人体健康构成严重威胁。本文总结了重金属锑元素的物理化学性质、毒性特点,归纳了含锑废水的处理方法,分析了含锑废水处理技术的优势和缺点,提出了工艺联合应用等高效处理含锑废水的相关建议。%A large amount of wastewater containing antimony discharged in the process of antimony ore mining,smelting and processing,which pose a serious threat to the environment and human health. In this paper we summarized the characteristics of physical and chemical properties, toxicity of antimony, and the antimony wastewater treatment. Advantages and disadvantages of these treatment crafts were compared in a table,the recommendations given out for more efficiently processing via crafts combination.

  16. Electrochemical, structural and surface characterization of nickel/zirconia solid oxide fuel cell anodes in coal gas containing antimony

    Science.gov (United States)

    Marina, Olga A.; Pederson, Larry R.; Coyle, Christopher A.; Thomsen, Edwin C.; Nachimuthu, Ponnusamy; Edwards, Danny J.

    The interactions of antimony with the nickel-zirconia anode in solid oxide fuel cells (SOFCs) have been investigated. Tests with both anode-supported and electrolyte-supported button cells were performed at 700 and 800 °C in synthetic coal gas containing 100 ppb to 9 ppm antimony. Minor performance loss was observed immediately after Sb introduction to coal gas resulting in ca. 5% power output drop. While no further degradation was observed during the following several hundred hours of testing, cells abruptly and irreversibly failed after 800-1600 h depending on Sb concentration and test temperature. Antimony was found to interact strongly with nickel resulting in extensive alteration phase formation, consistent with expectations based on thermodynamic properties. Nickel antimonide phases, NiSb and Ni 5Sb 2, were partially coalesced into large grains and eventually affected electronic percolation through the anode support. Initial degradation was attributed to diffusion of antimony to the active anode/electrolyte interface to form an adsorption layer, while the late stage degradation was due the Ni-Sb phase formation. Assuming an average Sb concentration in coal gas of 0.07 ppmv, a 500 μm thick Ni/zirconia anode-supported cell is not expected to fail within 7 years when operated at a power output of 0.5 W cm -2 and fuel utilization above 50%.

  17. Ambulatory oesophageal pH monitoring : a comparison between antimony, ISFET, and glass pH electrodes

    NARCIS (Netherlands)

    Hemmink, Gerrit J. M.; Weusten, Bas L. A. M.; Oors, Jac; Bredenoord, Albert J.; Timmer, Robin; Smout, Andre J. P. M.

    2010-01-01

    Background and aim Ambulatory oesophageal pH-impedance monitoring is a widely used test to evaluate patients with reflux symptoms. Several types of pH electrodes are available: antimony, ion sensitive field effect transistor (ISFET), and glass electrodes. These pH electrodes have not been compared d

  18. POLICY China’s Ministry of Commerce Set the Rules for Antimony and Tungsten Export in 2005

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    <正> China’s ministry of commerce recently re-leased the rules and application procedures forthe export of antimony and tungsten productsin 2005 by the domestic producers.Based on the rules set by the ministry,China’santimony and tungsten producers providingtheir products for export must be those enter-prises authorized by the related State authori-ties.

  19. Comparative phytotoxicity of methylated and inorganic arsenic- and antimony species to Lemna minor, Wolffia arrhiza and Selenastrum capricornutum

    NARCIS (Netherlands)

    L. Duester; H.G. van der Geest; S. Moelleken; A.V. Hirner; K. Kueppers

    2011-01-01

    The alkylation of metalloids through the transfer of methyl groups is an important factor in the biogeochemical cycling of elements like arsenic and antimony. In the environment, many different organic and inorganic forms of these elements can therefore be found in soils, sediments or organisms. Stu

  20. 27 CFR 478.133 - Records of transactions in semiautomatic assault weapons.

    Science.gov (United States)

    2010-04-01

    ... semiautomatic assault weapons. 478.133 Section 478.133 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL... AMMUNITION Records § 478.133 Records of transactions in semiautomatic assault weapons. The evidence specified in § 478.40(c), relating to transactions in semiautomatic assault weapons, shall be retained in...

  1. 41 CFR 301-10.133 - What is a U.S. flag air carrier?

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false What is a U.S. flag air carrier? 301-10.133 Section 301-10.133 Public Contracts and Property Management Federal Travel Regulation... Carrier Transportation Use of United States Flag Air Carriers § 301-10.133 What is a U.S. flag air...

  2. 46 CFR 108.133 - Hull superstructure, structural bulkheads, decks, and deckhouses.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Hull superstructure, structural bulkheads, decks, and deckhouses. 108.133 Section 108.133 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.133 Hull...

  3. American cutaneous leishmaniasis caused by Leishmania (Viannia) braziliensis resistant to meglumine antimoniate, but with good response to pentamidine: a case report.

    Science.gov (United States)

    Pimentel, Maria Inês Fernandes; Baptista, Cibele; Rubin, Evelyn Figueiredo; Vasconcellos, Erica de Camargo Ferreira e; Lyra, Marcelo Rosandiski; Salgueiro, Mariza de Matos; Saheki, Maurício Naoto; Rosalino, Cláudia Maria Valete; Madeira, Maria de Fátima; Silva, Aline Fagundes da; Confort, Eliame Mouta; Schubach, Armando de Oliveira

    2011-01-01

    This is a case report of a Brazilian soldier with cutaneous leishmaniasis. The lesion relapsed following two systemic treatments with meglumine antimoniate. The patient was treated with amphotericin B, which was interrupted due to poor tolerance. Following isolation of Leishmania sp., six intralesional infiltrations of meglumine antimoniate resulted in no response. Leishmania sp promastigotes were again isolated. The patient was submitted to intramuscular 4 mg/kg pentamidine. Parasites from the first and second biopsies were identified as Leishmania (Viannia) braziliensis; those isolated from the first biopsy were more sensitive to meglumine antimoniate in vitro than those isolated from the second biopsy. No relapse was observed. PMID:21552747

  4. American cutaneous leishmaniasis caused by Leishmania (Viannia) braziliensis resistant to meglumine antimoniate, but with good response to pentamidine: a case report.

    Science.gov (United States)

    Pimentel, Maria Inês Fernandes; Baptista, Cibele; Rubin, Evelyn Figueiredo; Vasconcellos, Erica de Camargo Ferreira e; Lyra, Marcelo Rosandiski; Salgueiro, Mariza de Matos; Saheki, Maurício Naoto; Rosalino, Cláudia Maria Valete; Madeira, Maria de Fátima; Silva, Aline Fagundes da; Confort, Eliame Mouta; Schubach, Armando de Oliveira

    2011-01-01

    This is a case report of a Brazilian soldier with cutaneous leishmaniasis. The lesion relapsed following two systemic treatments with meglumine antimoniate. The patient was treated with amphotericin B, which was interrupted due to poor tolerance. Following isolation of Leishmania sp., six intralesional infiltrations of meglumine antimoniate resulted in no response. Leishmania sp promastigotes were again isolated. The patient was submitted to intramuscular 4 mg/kg pentamidine. Parasites from the first and second biopsies were identified as Leishmania (Viannia) braziliensis; those isolated from the first biopsy were more sensitive to meglumine antimoniate in vitro than those isolated from the second biopsy. No relapse was observed.

  5. Non-invasive in vivo imaging of tumor-associated CD133/prominin.

    Directory of Open Access Journals (Sweden)

    Chizuko Tsurumi

    Full Text Available BACKGROUND: Cancer stem cells are thought to play a pivotal role in tumor maintenance, metastasis, tumor therapy resistance and relapse. Hence, the development of methods for non-invasive in vivo detection of cancer stem cells is of great importance. METHODOLOGY/PRINCIPAL FINDINGS: Here, we describe successful in vivo detection of CD133/prominin, a cancer stem cell surface marker for a variety of tumor entities. The CD133-specific monoclonal antibody AC133.1 was used for quantitative fluorescence-based optical imaging of mouse xenograft models based on isogenic pairs of CD133 positive and negative cell lines. A first set consisted of wild-type U251 glioblastoma cells, which do not express CD133, and lentivirally transduced CD133-overexpressing U251 cells. A second set made use of HCT116 colon carcinoma cells, which uniformly express CD133 at levels comparable to primary glioblastoma stem cells, and a CD133-negative HCT116 derivative. Not surprisingly, visualization and quantification of CD133 in overexpressing U251 xenografts was successful; more importantly, however, significant differences were also found in matched HCT116 xenograft pairs, despite the lower CD133 expression levels. The binding of i.v.-injected AC133.1 antibodies to CD133 positive, but not negative, tumor cells isolated from xenografts was confirmed by flow cytometry. CONCLUSIONS/SIGNIFICANCE: Taken together, our results show that non-invasive antibody-based in vivo imaging of tumor-associated CD133 is feasible and that CD133 antibody-based tumor targeting is efficient. This should facilitate developing clinically applicable cancer stem cell imaging methods and CD133 antibody-based therapeutics.

  6. Determination of natural isotopic variation in antimony using inductively coupled plasma mass spectrometry for an uncertainty estimation of the standard atomic weight of antimony

    International Nuclear Information System (INIS)

    The isotopic variation of industrially produced antimony was estimated using multiple-collector inductively coupled plasma mass spectrometry. A reproducible 123Sb/121Sb ratio of ±0.004% (2 standard deviations) was routinely obtained using a Sn doping mass discrimination correction technique. Only a small isotopic variation of about 0.05% was observed among industrially important Sb materials (five commercially available reagents and two ore minerals). The degree of Sb isotopic variation to determine the uncertainty in Sb atomic weight can be reduced by this new analytical technique to 0.00025 compared to the currently accepted IUPAC isotopic variation determined by conventional mass spectrometry of ±0.001. Heavy isotope enrichment of Sb in a drainage water sample from a stibnite mining area was found. This heavy isotope enrichment tendency in an aqueous environment may be useful in detecting anthropogenic Sb input from industrial emission by the smelting process via air because Sb of anthropogenic origin will have lighter isotope enrichment features. (author)

  7. Spin dynamics of complex oxides, bismuth-antimony alloys, and bismuth chalcogenides

    Science.gov (United States)

    Sahin, Cuneyt

    The emerging field of spintronics relies on the manipulation of electron spin in order to use it in spin-based electronics. Such a paradigm change has to tackle several challenges including finding materials with sufficiently long spin lifetimes and materials which are efficient in generating pure spin currents. This thesis predicts that two types of material families could be a solution to the aforementioned challenges: complex oxides and bismuth based materials. We derived a general approach for constructing an effective spin-orbit Hamiltonian which is applicable to all nonmagnetic materials. This formalism is useful for calculating spin-dependent properties near an arbitrary point in momentum space. We also verified this formalism through comparisons with other approaches for III-V semiconductors, and its general applicability is illustrated by deriving the spin-orbit interaction and predicting spin lifetimes for strained strontium titanate (STO) and a two-dimensional electron gas in STO (such as at the LAO/STO interface). Our results suggest robust spin coherence and spin transport properties in STO related materials even at room temperature. In the second part of the study we calculated intrinsic spin Hall conductivities for bismuth-antimony (BISb) semimetals with strong spin-orbit couplings, from the Kubo formula and using Berry curvatures evaluated throughout the Brillouin zone from a tight-binding Hamiltonian. Nearly crossing bands with strong spin-orbit interaction generate giant spin Hall conductivities in these materials, ranging from 474 ((h/e)O--1cm--1) for bismuth to 96((h/e)O--1cm --1) for antimony; the value for bismuth is more than twice that of platinum. The large spin Hall conductivities persist for alloy compositions corresponding to a three-dimensional topological insulator state, such as Bi0.83Sb0.17. The spin Hall conductivity could be changed by a factor of 5 for doped Bi, or for Bi0.83Sb0.17, by changing the chemical potential by 0.5 e

  8. First-Principles Study of Antimony Doping Effects on the Iron-Based Superconductor CaFe(SbxAs1-x)2

    Science.gov (United States)

    Nagai, Yuki; Nakamura, Hiroki; Machida, Masahiko; Kuroki, Kazuhiko

    2015-09-01

    We study antimony doping effects on the iron-based superconductor CaFe(SbxAs1-x)2 by using the first-principles calculation. The calculations reveal that the substitution of a doped antimony atom into As of the chainlike As layers is more stable than that into FeAs layers. This prediction can be checked by experiments. Our results suggest that doping homologous elements into the chainlike As layers, which only exist in the novel 112 system, is responsible for rising up the critical temperature. We discuss antimony doping effects on the electronic structure. It is found that the calculated band structures with and without the antimony doping are similar to each other within our framework.

  9. Phytoavailability of antimony and heavy metals in arid regions: the case of the Wadley Sb district (San Luis, Potosí, Mexico).

    Science.gov (United States)

    Levresse, G; Lopez, G; Tritlla, J; López, E Cardellach; Chavez, A Carrillo; Salvador, E Mascuñano; Soler, A; Corbella, M; Sandoval, L G Hernández; Corona-Esquivel, R

    2012-06-15

    This paper presents original results on the Sb and heavy metals contents in sediments and waste tailings, plants and water from the giant Wadley antimony mine district (San Luis Potosí State, Mexico). The dominant antimony phases in mining wastes are stibiconite, montroydite and minor hermimorphite. The waste tailings contain high concentrations of metals and metalloids (antimony, iron, zinc, arsenic, copper, and mercury). Manganese, copper, zinc, and antimony contents exceed the quality guidelines values for groundwater, plants and for waste tailings. Results indicate that peak accumulation is seasonal due to the concentration by high metabolism plants as Solanaceae Nicotiana. The metal phytoavailability in waste tailings is highly dependant on the metal speciation, its capability to be transported in water and, more particularly, the plant metabolism efficiency.

  10. Rac1+ cells distributed in accordance with CD 133+ cells in glioblastomas and the elevated invasiveness of CD 133+ glioma cells with higher Rac1 activity

    Institute of Scientific and Technical Information of China (English)

    ZHANG Bin; SUN Jian; YU Sheng-ping; CHEN Cong; LIU Bin; LIU Zhi-feng; REN Bing-cheng; MING Hao-lang; YANG Xue-jun

    2012-01-01

    Background Recent studies have suggested that cancer stem cells are one of the major causes for tumor recurrence due to their resistance to radiotherapy and chemotherapy.Although the highly invasive nature of glioblastoma (GBM)cells is also implicated in the failure of current therapies,it is not clear how glioma stem cells (GSCs) are involved in invasiveness.Rac1 activity is necessary for inducing reorganization of actin cytoskeleton and cell movement.In this study,we aimed to investigate the distribution characteristics of CD133+ cells and Rac1+ cells in GBM as well as Rac1 activity in CD133+ GBM cells,and analyze the migration and invasion potential of these cells.Methods A series of 21 patients with GBM were admitted consecutively and received tumor resection in Tianjin Medical University General Hospital during the first half of the year 2011.Tissue specimens were collected both from the peripheral and the central parts for each tumor under magnetic resonance imaging (MRI) navigation guidance.Immunohistochemical staining was used to detect the CD133+ cells and Rac1+ cells distribution in GBM specimens.Double-labeling immunofluorescence was further used to analyze CD133 and Rac1 co-expression and the relationship between CD133+ cells distribution and Rac1 expression.Serum-free medium culture and magnetic sorting were used to isolate CD133+ cells from U87 cell line.Rac1 activation assay was conducted to assess the activation of Rac1 in CD133+ and CD133-U87 cells.The migration and invasive ability of CD133+ and CD133-U87 cells were determined by cell migration and invasion assays in vitro.Student's t-test and one-way analysis of variance (ANOVA) test were used to determine statistical significance in this study.Results In the central parts of GBMs,CD133+ cells were found to cluster around necrosis and occasionally cluster around the vessels under the microscope by immunohistological staining.In the peripheral parts of the tumors,CD133+ cells were lined up along

  11. Chemoresistance of CD133{sup +} colon cancer may be related with increased survivin expression

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mi-Ra; Ji, Sun-Young; Mia-Jan, Khalilullah [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Cho, Mee-Yon, E-mail: meeyon@yonsei.ac.kr [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Institute of Genomic Cohort, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of)

    2015-07-31

    CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133{sup +} colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133{sup −} cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133{sup +} and siRNA-induced CD133{sup −} cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133{sup +} cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133{sup +} cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133{sup +} cells at 96 h after siRNA transfection. From this study, we conclude that CD133{sup +} cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133{sup +} colon cancer. - Highlights: • We evaluate the role of CD133 in chemoresistance of colon cancer. • We compared the chemoresistance of CD133{sup +} cells and siRNA-induced CD133{sup −} cells. • CD133 had little to no effect on MDR1, ABCG2 and AKT1 expression. • Survivin expression and chemoresistance were increased in CD133{sup +} colon cancer cells.

  12. Thermoelectric transport in surface- and antimony-doped bismuth telluride nanoplates

    Science.gov (United States)

    Pettes, Michael Thompson; Kim, Jaehyun; Wu, Wei; Bustillo, Karen C.; Shi, Li

    2016-10-01

    We report the in-plane thermoelectric properties of suspended (Bi1-xSbx)2Te3 nanoplates with x ranging from 0.07 to 0.95 and thicknesses ranging from 9 to 42 nm. The results presented here reveal a trend of increasing p-type behavior with increasing antimony concentration, and a maximum Seebeck coefficient and thermoelectric figure of merit at x ˜ 0.5. We additionally tuned extrinsic doping of the surface using a tetrafluoro-tetracyanoquinodimethane (F4-TCNQ) coating. The lattice thermal conductivity is found to be below that for undoped ultrathin Bi2Te3 nanoplates of comparable thickness and in the range of 0.2-0.7 W m-1 K-1 at room temperature.

  13. Nuclear quadrupole resonance of iodine pentafluoride and its complexes with antimony pentafluoride

    International Nuclear Information System (INIS)

    The spectra of nuclear quadrupole resonance (NQR) have been obtained at 77 deg K for I127 and Sbsup(121,128) in the IF5, IF5xSbF5, IF5x2SbF5, CsIF6, and RbIF6 compounds. An agreement between quadrupole spectra and structural data have been observed. The results of studying IF5 by NQR, gamma resonance and microwave spectroscopy have been compared. It has been established that unshared electron pair of an iodine atom is stereochemically active which leads to a considerable distortion of octahedral symmetry of coordination polyhedron of the iodine atoms. The structure of complexes of iodine pentafluoride with antimony pentafluoride is given

  14. A novel composite material based on antimony(III) oxide and amorphous silica

    Energy Technology Data Exchange (ETDEWEB)

    Zemnukhova, Ludmila A. [Institute of Chemistry, Far-Eastern Branch, Russian Academy of Sciences, 690022 Vladivostok (Russian Federation); Panasenko, Alexander E., E-mail: panasenko@ich.dvo.ru [Institute of Chemistry, Far-Eastern Branch, Russian Academy of Sciences, 690022 Vladivostok (Russian Federation)

    2013-05-01

    The composite material nSb₂O₃·mSiO₂·xH₂O was prepared by hydrolysis of SbCl₃ and Na₂SiO₃ in an aqueous medium. It has been shown that the composition of the material is influenced by the ratio of the initial components and the acidity of the reaction medium. The morphology of the material particles and its specific surface area have been determined. The thermal and optic properties were also investigated. - Graphical abstract: Novel composite material containing amorphous silica and crystal antimony(III) oxide has been synthesized by hydrolysis of SbCl₃ and Na₂SiO₃ in an aqueous medium. Highlights: • The composite material nSb₂O₃·mSiO₂·xH₂O was prepared in an aqueous medium. • The composition of the material is controllable by a synthesis conditions. • The morphology of the material and its optic properties have been determined.

  15. Preparation and characterization of conductive antimony-doped tin oxide (ATO) nanoparticles

    Institute of Scientific and Technical Information of China (English)

    LIN; Feng; DUAN; Xue-chen; REN; Xian-jing

    2005-01-01

    In this paper, conductive antimony-doped tin oxide (ATO) composite particles is prepared by hydroxylation method of metal alcoxides. This method has many advantages such as little pollution, low cost, simple sheet and equipment. The synthesis processing and the ATO nanoparticles are characterized by means of transmission electron microscope (TEM), X-ray diffraction (XRD), thermal gravimetric and differential thermal analysis, and BET. The results show that the ATO nanoparticles is tetragonal rutile crystal structure. TEM show that the particles are monodispersed with weak aggromation. The size of the particles calcinated at 700 is about 8nm. The specific areas are 153 m2 · g-1. In addition to, ATO nanop articles have good electric properties

  16. Sequential solvent extraction for forms of antimony in five selected coals

    Science.gov (United States)

    Qi, C.; Liu, Gaisheng; Kong, Y.; Chou, C.-L.; Wang, R.

    2008-01-01

    Abundance of antimony in bulk samples has been determined in five selected coals, three coals from Huaibei Coalfield, Anhui, China, and two from the Illinois Basin in the United States. The Sb abundance in these samples is in the range of 0.11-0.43 ??g/g. The forms of Sb in coals were studied by sequential solvent extraction. The six forms of Sb are water soluble, ion changeable, organic matter bound, carbonate bound, silicate bound, and sulfide bound. Results of sequential extraction show that silicate-bound Sb is the most abundant form in these coals. Silicate- plus sulfide-bound Sb accounts for more than half of the total Sb in all coals. Bituminous coals are higher in organic matterbound Sb than anthracite and natural coke, indicating that the Sb in the organic matter may be incorporated into silicate and sulfide minerals during metamorphism. ?? 2008 by The University of Chicago. All rights reserved.

  17. Reduced Graphene Oxide/Tin-Antimony Nanocomposites as Anode Materials for Advanced Sodium-Ion Batteries.

    Science.gov (United States)

    Ji, Liwen; Zhou, Weidong; Chabot, Victor; Yu, Aiping; Xiao, Xingcheng

    2015-11-11

    Reduced graphene oxides loaded with tin-antimony alloy (RGO-SnSb) nanocomposites were synthesized through a hydrothermal reaction and the subsequent thermal reduction treatments. Transmission electron microscope images confirm that SnSb nanoparticles with an average size of about 20-30 nm are uniformly dispersed on the RGO surfaces. When they were used as anodes for rechargeable sodium (Na)-ion batteries, these as-synthesized RGO-SnSb nanocomposite anodes delivered a high initial reversible capacity of 407 mAh g(-1), stable cyclic retention for more than 80 cycles and excellent cycle stability at ultra high charge/discharge rates up to 30C. The significantly improved performance of the synthesized RGO-SnSb nanocomposites as Na-ion battery anodes can be attributed to the synergetic effects of RGO-based flexible framework and the nanoscale dimension of the SnSb alloy particles (batteries.

  18. Novel antimony doped tin oxide/carbon aerogel as efficient electrocatalytic filtration membrane

    Directory of Open Access Journals (Sweden)

    Zhimeng Liu

    2016-05-01

    Full Text Available A facile method was developed to prepare antimony doped tin oxide (Sb-SnO2/carbon aerogel (CA for use as an electrocatalytic filtration membrane. The preparation process included synthesis of a precursor sol, impregnation, and thermal decomposition. The Sb-SnO2, which was tetragonal in phase with an average crystallite size of 10.8 nm, was uniformly distributed on the CA surface and firmly attached via carbon-oxygen-tin chemical bonds. Preliminary filtration tests indicated that the Sb-SnO2/CA membrane had a high rate of total organic carbon removal for aqueous tetracycline owing to its high current efficiency and electrode stability.

  19. Novel fabrication of an electrochromic antimony-doped tin oxide film using a nanoparticle deposition system

    Science.gov (United States)

    Kim, Hyungsub; Park, Yunchan; Choi, Dahyun; Ahn, Sung-Hoon; Lee, Caroline Sunyong

    2016-07-01

    Novel deposition method of Antimony-doped tin oxide (ATO) thin films was introduced using a nanoparticle deposition system (NPDS) to fabricate an electrochromic (EC) device. NPDS is a dry deposition method that simplifies the ATO deposition process by eliminating the need for solvents or binders. In this study, an ATO EC layer was deposited using NPDS. The surface morphology and electrochemical and optical transmittance properties were characterized. The optical transmittance change in the ATO EC device was ∼35% over the wavelength range of 350-800 nm, and the cyclic transmittance was stable. The ATO film deposited using NPDS, exhibited a coloration efficiency of 15.5 cm2 C-1. Therefore, our results suggest that ATO EC devices can be fabricated using a simple, cost-effective NPDS, which allows nanoparticles to be deposited directly without pre- or post-processing.

  20. Microbial diversity and community structure in an antimony-rich tailings dump.

    Science.gov (United States)

    Xiao, Enzong; Krumins, Valdis; Dong, Yiran; Xiao, Tangfu; Ning, Zengping; Xiao, Qingxiang; Sun, Weimin

    2016-09-01

    To assess the impact of antimony (Sb) on microbial community structure, 12 samples were taken from an Sb tailings pile in Guizhou Province, Southwest China. All 12 samples exhibited elevated Sb concentrations, but the mobile and bioaccessible fractions were small in comparison to total Sb concentrations. Besides the geochemical analyses, microbial communities inhabiting the tailing samples were characterized to investigate the interplay between the microorganisms and environmental factors in mine tailings. In all samples, Proteobacteria and Actinobacteria were the most dominant phyla. At the genus level, Thiobacillus, Limnobacter, Nocardioides, Lysobacter, Phormidium, and Kaistobacter demonstrated relatively high abundances. The two most abundant genera, Thiobacillus and Limnobacter, are characterized as sulfur-oxidizing bacteria and thiosulfate-oxidizing bacteria, respectively, while the genus Lysobacter contains arsenic (As)-resistant bacteria. Canonical correspondence analysis (CCA) indicates that TOC and the sulfate to sulfide ratio strongly shaped the microbial communities, suggesting the influence of the environmental factors in the indigenous microbial communities. PMID:27188777

  1. Properties of antimony doped ZnO thin films deposited by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Sadananda Kumar, N., E-mail: sadanthara@gmail.com; Bangera, Kasturi V.; Shivakumar, G. K. [National Institute of Technology Karnataka, Surathkal, Thin Films Laboratory, Department of Physics (India)

    2015-07-15

    Antimony (Sb) doped zinc oxide (ZnO) thin films were deposited on the glass substrate at 450°C using spray pyrolysis technique. Effect of Sb doping on surface morphology structural, optical and electrical properties were studied. X-ray diffraction (XRD) analysis showed that both the undoped and doped ZnO thin films are polycrystalline in nature with (101) preferred orientation. SEM analysis showed a change in surface morphology of Sb doped ZnO thin films. Doping results in a marked increase in conductivity without affecting the transmittance of the films. ZnO films prepared with 3 at % Sb shows the lowest resistivity of 0.185 Ohm cm with a Hall mobility of 54.05 cm{sup 2} V{sup –1} s{sup –1}, and a hole concentration of 6.25 × 10{sup 17} cm{sup –3}.

  2. Renal function evaluation in patients with American Cutaneous Leishmaniasis after specific treatment with pentavalent antimonial

    Directory of Open Access Journals (Sweden)

    Oliveira Rodrigo A

    2012-06-01

    Full Text Available Abstract Background Renal evaluation studies are rare in American Cutaneous Leishmaniasis (ACL. The aim of this study is to investigate whether specific treatment reverts ACL-associated renal dysfunction. Methods A prospective study was conducted with 37 patients with ACL. Urinary concentrating and acidification ability was assessed before and after treatment with pentavalent antimonial. Results The patients mean age was 35.6 ± 12 years and 19 were male. Before treatment, urinary concentrating defect (U/Posm Conclusion As previously described, urinary concentrating and acidification defects were found in an important number of patients with ACL. Present results demonstrate that only some patients recover urinary acidification capacity, while no one returned to normal urinary concentration capacity.

  3. Supermolecular template route to fabrication of well crystallized hollow antimony microspheres

    Institute of Scientific and Technical Information of China (English)

    GU Li; CHEN Shu-da; WEI Xiao-yan

    2006-01-01

    Hollow spheres of elemental antimony (Sb) with good crystallinity, high contrast and thin wall were prepared in the solutions of poly(ethylene glycol) (PEG) and oleic acid(OA) associations at the refluxed temperature. The complexes of Sb3+ with tartaric acid were used as precursors, which can avoid the hydrolysis of SbCl3 and the resulting impurity of products. The average diameter and thickness of the as-prepared hollow sphere are about 300 nm and less than 20 nm, respectively. The formation of hollow spheres depends on the template function of PEG and OA associations, which can be confirmed through the theoretical analysis and results of control experiments. The specific surface area reaches 34.669 m2/g.

  4. 锑环境健康效应的研究进展%Environmental Health Effect of Antimony: a Review of Recent Researches

    Institute of Scientific and Technical Information of China (English)

    戈兆凤; 韦朝阳

    2011-01-01

    随着锑的开采及含锑产品的广泛应用,锑所带来的污染问题已越来越严重,锑对环境与健康的危害也受到了更多的关注.该文总结了锑环境健康效应的研究进展,从医学、环境毒理学和生态毒理学的角度分别分析了锑对人、动物以及植物与土壤生物的健康效应.提示今后还需加强锑的致癌性及基因毒性研究,并需从微观与宏观尺度揭示锑的毒性效应,以期为锑的环境健康风险评估提供科学依据.%The antimony mining and widely use of antimony products have resulted in serious antimony contamination,causing hazards to both the environment and human health. The present paper summarized the research progresses on the environmental health effect of antimony. The health effects of antimony on human, animals, and plants as well as soil organisms are introduced and discussed in the view of medical science, environmental toxicology and ecological toxicology, respectively. It is suggested that more researches should be conducted on antimony earcinogenieity and genotoxicity, and the toxic effects of antimony should be explored from micro and macroscopic scales in order to provide the scientific basis for risk assessment of antimony.

  5. Successful treatment of feline leishmaniosis using a combination of allopurinol and N-methyl-glucamine antimoniate

    Directory of Open Access Journals (Sweden)

    Maria Alexandra Basso

    2016-02-01

    Full Text Available Case summary This work describes the diagnosis and successful treatment of a 2-year-old domestic cat infected with Leishmania species and presenting fever, and ulcerative and nodular skin lesions after being treated for pyodermatitis for 1 year without clinical improvement. After anamnesis the cat was submitted to a complete clinical examination. Blood was collected for determination of haematological and biochemical parameters, detection of feline leukaemia virus (FeLV, feline immunodeficiency virus (FIV, feline coronavirus (FCoV and Leishmania amastigotes. Fine-needle aspiration puncture from the skin nodules was also performed. After definitive diagnosis the animal was treated and followed up over a 2 year period. The animal tested negative for FIV-specific antibodies, FeLV antigen and feline coronavirus RNA. Leishmania amastigotes in the skin nodules were confirmed by cytology and molecular diagnosis. Treatment was initiated with allopurinol, resulting in a slight clinical improvement. Thus, N-methyl-glucamine antimoniate was added and administered for 30 days, with complete closure of the ulcerative lesions in the hindlimbs requiring a surgical approach. Close monitoring of the patient in the following 24 months indicated that combined therapy was safe and clinical cure was achieved without further relapses or side effects. Relevance and novel information Considering the increasing number of feline leishmaniosis cases and the inconsistent results of most therapeutic protocols described in the literature, the use of new approaches, especially in refractory cases, is essential. Although the use of allopurinol and N-methyl-glucamine antimoniate is off-label in cats, in this case the combination treatment was followed by an extensive analytical monitoring, supporting their safety and effectiveness.

  6. Infrared-to-red upconversion luminescence in samarium-doped antimony glasses

    International Nuclear Information System (INIS)

    A new antimony-based glass system (K2O-B2O3-Sb2O3) having low phonon energy (about 600 cm-1) doped with Sm3+ ions has been developed. Infrared reflection spectroscopic (IRRS) studies have been employed to establish its low phonon energy. Ultraviolet-Visible-near infrared (UV-Vis-NIR) absorption and photoluminescence upconversion properties with the spectrochemistry of the 15K2O-15B2O3-70Sb2O3 (mol%) glasses have been studied doping with different concentrations (0.1-1.0 wt%) of Sm2O3. UV-Vis-NIR absorption band positions have been justified with quantitative calculation of nephelauxetic parameter and covalent bonding characteristics of the host. NIR to visible upconversion has been investigated by exciting at 949 nm at room temperature. Three upconverted bands originating from the 4G5/2→6H5/2, 4G5/2→6H7/2 and 4G5/2→6H9/2 transitions are found to be centered at 566 (green, weak), 602 (orange, weak) and 636 (red, remarkably strong) nm, respectively. These bands have been explained from the evaluation of the absorption, normal (downconversion) fluorescence and excitation spectra. The upconversion processes have been explained by the excited state absorption (ESA), energy transfer (ET) and cross-relaxation (CR) mechanisms involving population of the metastable (storage) energy level (4G5/2) by multiphonon deexcitation effect. It is evident from the IRRS study that the upconversion phenomena are expedited by the low multiphonon relaxation rate in antimony glasses owing to their low phonon energy (602 cm-1, the main and highest intensity Sb-O-Sb stretching band) which is very close to that of fluoride glasses (500-600 cm-1)

  7. Optical properties of Eu3+-doped antimony-oxide-based low phonon disordered matrices

    Science.gov (United States)

    Som, Tirtha; Karmakar, Basudeb

    2010-01-01

    A new series of monolithic Eu2O3-doped high antimony oxide (40-80 mol%) content disordered matrices (glasses) of low phonon energy (about 600 cm-1) in the K2O-B2O3-Sb2O3 (KBS) system was prepared by the melt-quench technique. Infrared reflection spectroscopy was used to establish the low phonon energy of the glasses. Amorphicity and devitrification of the glasses were confirmed by x-ray diffraction analysis. UV-vis absorption spectra of Eu3+ have been measured and the band positions have been justified with quantitative calculation of the nephelauxetic parameter and covalent bonding characteristics of the host. These Eu2O3-doped glasses upon excitation at 393 nm radiation exhibit six emission bands in the range 500-750 nm due to their low phonon energy. Of these, the magnetic dipole ^{5}\\mathrm {D}_{0} \\to {}^{7} \\mathrm {F_{1}} transition shows small Stark splitting while the electric dipole ^{5}\\mathrm {D}_{0} \\to {}^{7}\\mathrm {F}_{2} transition undergoes remarkable Stark splitting into two components. They have been explained by the crystal field effect. The Judd-Ofelt parameters, Ωt = 2,4,6, were also evaluated and the change of Ωt with the glass composition was correlated with the asymmetric effect at Eu3+ ion sites and the fundamental properties like covalent character and optical basicity. We are the first to report the spectroscopic properties of the Eu3+ ion in KBS low phonon antimony glasses.

  8. Optical characterization of antimony-based bismuth-doped thin films with different annealing temperatures

    Institute of Scientific and Technical Information of China (English)

    Xinmiao Lu; Yiqun Wu; Yang Wang; Jinsong Wei

    2011-01-01

    Antimony-b ased bismuth-doped thin film,a new kind of super-resolution mask layer,is prepared by magnetron sputtering.The structures and optical constants of the thin films before and after annealing are examined in detail.The as-deposited film is mainly in an amorphous state.After annealing at 170-370℃,it is converted to the rhombohedral-type of structure.The extent of crystallization increased with the annealing temperature.When the thin film is annealed,its refractive index decreased in the most visible region,whereas the extinction coefficient and reflectivity are markedly increased.The results indicate that the optical parameters of the film strongly depend on its microstructure and the bonding of the atoms.As demand for ultrahigh-density information storage continues to grow the recording mark size in optical memory is reduced to the nanometer scale [1- 4].Exceeding the optical diffraction limit with traditional optical storage technology has become a challenge[5-6].%Antimony-based bismuth-doped thin film, a new kind of super-resolution mask layer, is prepared by magnetron sputtering. The structures and optical constants of the thin films before and after annealing are examined in detail. The as-deposited film is mainly in an amorphous state. After annealing at 170-370℃, it is converted to the rhombohedral-type of structure. The extent of crystallization increased with the annealing temperature. When the thin film is annealed, its refractive index decreased in the most visible region, whereas the extinction coefficient and reflectivity are markedly increased. The results indicate that the optical parameters of the film strongly depend on its microstructure and the bonding of the atoms.

  9. Study of regional lung function with xenon 133

    International Nuclear Information System (INIS)

    Exploration of regional lung function includes study of the closed circuit perfusion and ventilation respectively by injection and inhalation of xenon 133. The radiation is measured across the chest using 4 fixed scintillation counters, placed opposite the subject's back, 2 per lung field. Theoretical regional values using 15 normal young subjects are determined. Three cases justified the practical interest of this method. The percentage of variation for the parameters studied was about 10%. The method proved very useful for the clinician to whom it provides a numerical assessment of regional ventilation and perfusion

  10. Regional study of ventilation with inhaled xenon 133 in children

    International Nuclear Information System (INIS)

    A regional exploration of pulmonary ventilation in a population of 104 infants and children by a study of distribution and washout of xenon 133 inhaled with rebreathing is carried out. The results are expressed by photographs (gamma-camera) and time-activity curves. The indications for regional exploration were oriented by the existence on the straight X-ray film of a localised ventilation disorder (a hyperlucent area or an opacity). This study permitted physiopathological analysis and guided endobronchial examinations. The functional results obtained, complete and explain other methods of exploration of lung function by spirography, ventilatory mechanics, transthoracic electrical measurements and study of lung perfusion with technetium 99m

  11. A 15q13.3 microdeletion segregating with autism

    OpenAIRE

    Pagnamenta, Alistair T.; Wing, Kirsty; Akha, Elham Sadighi; Knight, Samantha JL; Bölte, Sven; Schmötzer, Gabriele; Duketis, Eftichia; Poustka, Fritz; Klauck, Sabine M; Poustka, Annemarie; Ragoussis, Jiannis; Bailey, Anthony J; Monaco, Anthony P

    2008-01-01

    Autism and mental retardation (MR) show high rates of comorbidity and potentially share genetic risk factors. In this study, a rare ∼2 Mb microdeletion involving chromosome band 15q13.3 was detected in a multiplex autism family. This genomic loss lies between distal break points of the Prader–Willi/Angelman syndrome locus and was first described in association with MR and epilepsy. Together with recent studies that have also implicated this genomic imbalance in schizophrenia, our data indicat...

  12. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica;

    2013-01-01

    duplications that include both the YWHAE and LIS1 genes. These patients had a relatively distinct facial phenotype and frequent structural brain abnormalities involving the corpus callosum, cerebellar vermis, and cranial base. Autism spectrum disorders were seen in a third of duplication probands, most......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...

  13. 133Xe labelling of acrylate for catheter embolisation

    International Nuclear Information System (INIS)

    A method for radio-nucleide labelling of histo-acryl/lipiodol with 133Xe gas is described. The method consists of disolving the gas in lipiodol under sterile conditions. After embolisation and angiography, the localisation of the embolising material can be determined by means of a scintillation camera. The labelling method was used in 15 patients. In all patients the position of the embolising material, as demonstrated by scintigraphy, corresponded with the radiological findings. It was not possible to demonstrate escape of the material by scintigraphy. (orig.)

  14. Decreased antimony uptake and overexpression of genes of thiol metabolism are associated with drug resistance in a canine isolate of Leishmania infantum.

    Science.gov (United States)

    Gómez Pérez, Verónica; García-Hernandez, Raquel; Corpas-López, Victoriano; Tomás, Ana M; Martín-Sanchez, Joaquina; Castanys, Santiago; Gamarro, Francisco

    2016-08-01

    Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania infantum, is one of the most important zoonotic diseases affecting dogs and humans in the Mediterranean area. The presence of infected dogs as the main reservoir host of L. infantum is regarded as the most significant risk for potential human infection. We have studied the susceptibility profile to antimony and other anti-leishmania drugs (amphotericin B, miltefosine, paromomycin) in Leishmania infantum isolates extracted from a dog before and after two therapeutic interventions with meglumine antimoniate (subcutaneous Glucantime(®), 100 mg/kg/day for 28 days). After the therapeutic intervention, these parasites were significantly less susceptible to antimony than pretreatment isolate, presenting a resistance index of 6-fold to Sb(III) for promastigotes and >3-fold to Sb(III) and 3-fold to Sb(V) for intracellular amastigotes. The susceptibility profile of this resistant L. infantum line is related to a decreased antimony uptake due to lower aquaglyceroporin-1 expression levels. Additionally, other mechanisms including an increase in thiols and overexpression of enzymes involved in thiol metabolism, such as ornithine decarboxylase, trypanothione reductase, mitochondrial tryparedoxin and mitochondrial tryparedoxin peroxidase, could contribute to the resistance as antimony detoxification mechanisms. A major contribution of this study in a canine L. infantum isolate is to find an antimony-resistant mechanism similar to that previously described in other human clinical isolates. PMID:27317865

  15. Characterization of CD133+ hepatocellular carcinoma cells as cancer stem/progenitor cells

    International Nuclear Information System (INIS)

    The CD133 antigen, identified as a hematopoietic stem cell marker, appears in various human embryonic epithelia including the neural tube, gut, and kidney. We herein investigated whether CD133+ cells isolated from human hepatocellular carcinoma cell lines possess cancer stem/progenitor cell-like properties. Among the three cell lines studied, the CD133 antigen was found to be expressed only on the surface of Huh-7 cells. CD133+ cells from Huh-7 performed a higher in vitro proliferative potential and lower mRNA expressions of mature hepatocyte markers, glutamine synthetase and cytochrome P450 3A4, than CD133- population of Huh-7 cells. When either CD133+ or CD133- cells were subcutaneously injected into SCID mice, CD133+ cells formed tumors, whereas CD133- cells induced either a very small number of tumors or none at all. Taken together, the identification of CD133+ cells could thus be a potentially powerful tool to investigate the tumorigenic process in the hepatoma system and to also develop effective therapies targeted against hepatocellular carcinoma

  16. Sodium Antimony Gluconate Induces Generation of Reactive Oxygen Species and Nitric Oxide via Phosphoinositide 3-Kinase and Mitogen-Activated Protein Kinase Activation in Leishmania donovani-Infected Macrophages

    OpenAIRE

    Mookerjee Basu, Jayati; Mookerjee, Ananda; Sen, Prosenjit; Bhaumik, Suniti; Sen, Pradip; Banerjee, Subha; Naskar, Ksudiram; Choudhuri, Soumitra K.; Saha, Bhaskar; Raha, Sanghamitra; Roy, Syamal

    2006-01-01

    Pentavalent antimony complexes, such as sodium stibogluconate and sodium antimony gluconate (SAG), are still the first choice for chemotherapy against various forms of leishmaniasis, including visceral leishmaniasis, or kala-azar. Although the requirement of a somewhat functional immune system for the antileishmanial action of antimony was reported previously, the cellular and molecular mechanism of action of SAG was not clear. Herein, we show that SAG induces extracellular signal-regulated k...

  17. Remediation of antimony-rich mine waters: Assessment of antimony removal and shifts in the microbial community of an onsite field-scale bioreactor.

    Science.gov (United States)

    Sun, Weimin; Xiao, Enzong; Kalin, Margarete; Krumins, Valdis; Dong, Yiran; Ning, Zengping; Liu, Tong; Sun, Min; Zhao, Yanlong; Wu, Shiliang; Mao, Jianzhong; Xiao, Tangfu

    2016-08-01

    An on-site field-scale bioreactor for passive treatment of antimony (Sb) contamination was installed downstream of an active Sb mine in Southwest China, and operated for one year (including a six month monitoring period). This bioreactor consisted of five treatment units, including one pre-aerobic cell, two aerobic cells, and two microaerobic cells. With the aerobic cells inoculated with indigenous mine water microflora, the bioreactor removed more than 90% of total soluble Sb and 80% of soluble antimonite (Sb(III)). An increase in pH and decrease of oxidation-reduction potential (Eh) was also observed along the flow direction. High-throughput sequencing of the small subunit ribosomal RNA (SSU rRNA) gene variable (V4) region revealed that taxonomically diverse microbial communities developed in the bioreactor. Metal (loid)-oxidizing bacteria including Ferrovum, Thiomonas, Gallionella, and Leptospirillum, were highly enriched in the bioreactor cells where the highest total Sb and Sb(III) removal occurred. Canonical correspondence analysis (CCA) indicated that a suite of in situ physicochemical parameters including pH and Eh were substantially correlated with the overall microbial communities. Based on an UPGMA (Unweighted Pair Group Method with Arithmetic Mean) tree and PCoA (Principal Coordinates Analysis), the microbial composition of each cell was distinct, indicating these in situ physicochemical parameters had an effect in shaping the indigenous microbial communities. Overall, this study was the first to employ a field-scale bioreactor to treat Sb-rich mine water onsite and, moreover, the findings suggest the feasibility of the bioreactor in removing elevated Sb from mine waters. PMID:27208755

  18. Cyanide and antimony thermodynamic database for the aqueous species and solids for the EPA-MINTEQ geochemical code

    Energy Technology Data Exchange (ETDEWEB)

    Sehmel, G.A.

    1989-05-01

    Thermodynamic data for aqueous species and solids that contain cyanide and antimony were tabulated from several commonly accepted, published sources of thermodynamic data and recent journal article. The review does not include gases or organic complexes of either antimony or cyanide, nor does the review include the sulfur compounds of cyanide. The basic thermodynamic data, ..delta..G/sub f,298//sup o/, ..delta..H/sub f,298//sup o/, and S/sub f//sup o/ values, were chosen to represent each solid phase and aqueous species for which data were available in the appropriate standard state. From these data the equilibrium constants (log K/sub r,298//sup o/) and enthalpies of reaction (..delta..H/sub r,298//sup o/) at 298 K (25/degree/C) were calculated for reactions involving the formation of these aqueous species and solids from the basic components. 34 refs., 14 tabs.

  19. Antimony incorporation in InAs quantum dots grown on GaAs substrate by molecular beam epitaxy

    Science.gov (United States)

    Rihani, J.; Sallet, V.; Christophe, H. J.; Oueslati, M.; Chtourou, R.

    2008-01-01

    We have grown InAs(Sb) quantum dots (QDs) on GaAs (0 0 1) substrates by molecular beam epitaxy (MBE) using two different antimony exposures ( ΦSb). Atomic force microscopy (AFM) and photoluminescence (PL) spectroscopy were carried out to investigate the dot size evolution as function of the incorporated antimony content in InAs/GaAs QDs material. Anomalous asymmetric-band feature was observed in room temperature photoluminescence (RTPL) spectra of the investigated QD samples grown at relatively high temperature (490 °C). From the temperature-dependent PL measurements, it was found that the asymmetric-band feature is associated with the ground-states transitions from QDs with bimodal size distribution. The analysis of the pump power dependent PL spectra allows us to suggest a type II band lineup for the InAsSb/GaAs QDs materials system.

  20. Interest of lymphoscintigraphy with 99sup(m)Tc-labelled antimony sulfide in the arms after breast carcinoma treatment

    International Nuclear Information System (INIS)

    2 mCi of antimony sulfide colloid labelled with sup(99m)Tc were injected subcutaneously between the digits in 25 patients with postoperative lymphoedema of the arm for breast carcinoma. The two arms are examined successively, the normal one being used as control. The lymphoscintigraphy is realised with a gamma camera during an hour. The information obtained is threefoled; on the peripheral block's importance, the place where the lymphatic flow is stopped, and the presence in 40% of patients of axillary lymph nodes. The diminution of the lymphatic flow is not in correlation with the lymphoedema's importance. Lymphoscintigraphy with sup(99m)Tc antimony sulfide colloid is a simple examination but some side effects may occur. In 7 patients, post-injection lymphangitis was observed, with favorable evolution under antibiotic treatment. The lymphoscintigraphy can give some interesting information on the evolution of treated lymphoedema

  1. CXCL3 contributes to CD133+ CSCs maintenance and forms a positive feedback regulation loop with CD133 in HCC via Erk1/2 phosphorylation

    Science.gov (United States)

    Zhang, Lin; Zhang, Lixing; Li, Hong; Ge, Chao; Zhao, Fangyu; Tian, Hua; Chen, Taoyang; Jiang, Guoping; Xie, Haiyang; Cui, Ying; Yao, Ming; Li, Jinjun

    2016-01-01

    Although the chemotactic cytokine CXCL3 is thought to play an important role in tumor initiation and invasion, little is known about its function in hepatocellular carcinoma (HCC). In our previous study, we found that Ikaros inhibited CD133 expression via the MAPK pathway in HCC. Here, we showed that Ikaros may indirectly down-regulate CXCL3 expression in HCC cells, which leads to better outcomes in patients with CD133+ cancer stem cell (CSC) populations. CD133 overexpression induced CXCL3 expression, and silencing of CD133 down-regulated CXCL3 in HCC cells. Knockdown of CXCL3 inhibited CD133+ HCC CSCs’ self-renewal and tumorigenesis. The serum CXCL3 level was higher in HCC patients’ samples than that in healthy individual. HCC patients with higher CXCL3 expression displayed a poor prognosis, and a high level of CXCL3 was significantly associated with vascular invasion and tumor capsule formation. Exogenous CXCL3 induced Erk1/2 and ETS1 phosphorylation and promoted CD133 expression, indicating a positive feedback loop between CXCL3 and CD133 gene expression in HCC cells via Erk1/2 activation. Together, our findings indicated that CXCL3 might be a potent therapeutic target for HCC. PMID:27255419

  2. Co-administration of glycyrrhizic acid with the antileishmanial drug sodium antimony gluconate (SAG) cures SAG-resistant visceral leishmaniasis.

    Science.gov (United States)

    Bhattacharjee, Amrita; Majumder, Saikat; Majumdar, Suchandra Bhattacharyya; Choudhuri, Soumitra Kumar; Roy, Syamal; Majumdar, Subrata

    2015-03-01

    Since there are very few affordable antileishmanial drugs available, antimonial resistance has crippled antileishmanial therapy, thereby emphasising the need for development of novel therapeutic strategies. This study aimed to evaluate the antileishmanial role of combined therapy with sodium antimony gluconate (SAG) and the triterpenoid glycyrrhizic acid (GA) against infection with SAG-resistant Leishmania (GE1F8R). Combination therapy with GA and SAG successfully limited infection with SAG-resistant Leishmania in a synergistic manner (fractional inhibitory concentration index resistant Leishmania and co-treated with GA and SAG exhibited a significant reduction in hepatic and splenic parasite burden. In probing the mechanism, it was observed that GA treatment suppressed the expression and efflux activity of P-glycoprotein (P-gp) and multidrug resistance-associated protein 1 (MRP1), two host ABC transporters responsible for antimony efflux from host cells infected with SAG-resistant parasites. This suppression correlated with greater intracellular antimony retention during SAG therapy both in vitro and in vivo, which was reflected in the reduced parasite load. Furthermore, co-administration of GA and SAG induced a shift in the cytokine balance towards a Th1 phenotype by augmenting pro-inflammatory cytokines (such as IL-12, IFNγ and TNFα) and inducing nitric oxide generation in GE1F8R-infected macrophages as well as GE1F8R-infected mice. This study aims to provide an affordable leishmanicidal alternative to expensive antileishmanial drugs such as miltefosine and amphotericin B. Furthermore, this report explores the role of GA as a resistance modulator in MRP1- and P-gp-overexpressing conditions. PMID:25600891

  3. Exploring screen printing technology on thermoelectric energy harvesting with printing copper-nickel and bismuth-antimony thermocouples

    OpenAIRE

    Cao, Zhuo; Koukharenko, Elena; Torah, R; Beeby, SP

    2013-01-01

    This paper reports the fabrication and testing of copper (Cu) - nickel (Ni) and bismuth (Bi) - antimony (Sb) based thermocouples fabricated using screen printing technology. The transport properties of the printed thermoelectric material were measured in room temperature while the Seebeck voltage and power output of the printed thermocouples were tested under a variety temperature gradient. Initial thermoelectric materials have been integrated in inks and then deposited on substrate by the si...

  4. The Potential Impact of Biofield Energy Treatment on the Atomic and Physical Properties of Antimony Tin Oxide Nanopowder

    OpenAIRE

    Trivedi, Mahendra Kumar

    2015-01-01

    Antimony tin oxide (ATO) is known for its high thermal conductivity, optical transmittance, and wide energy band gap, which makes it a promising material for the display devices, solar cells, and chemical sensor industries. The present study was undertaken to evaluate the effect of biofield energy treatment on the atomic and physical properties of ATO nanopowder. The ATO nanopowder was divided into two parts: control and treated. The treated part was subjected to Mr. Trivedi’s biofield ...

  5. The influence of remelting on the properties of AlSi6Cu4 alloy modified by antimony

    OpenAIRE

    D. Medlen; D. Bolibruchova

    2012-01-01

    The paper deals with the problem of multiple remelting influence on AlSi6Cu4 alloy modified by antimony on chosen mechanical characteristics, microstructure and gas content. This foundry alloy is used mostly in automotive industry. Foundry Aluminum-Silicon alloys are also used in number of industrial weight sensitive applications because of their low weight and very good castability and good mechanical properties. Modifiers are usually added to molten aluminum-silicon alloys to refine the eut...

  6. EFFECT OF GRAIN BOUNDARY SEGREGATION OF ANTIMONY ON RELAXATION AT GRAIN BOUNDARIES IN SILICON-IRON ALLOYS

    OpenAIRE

    Iwasaki, Y.; Fujimoto, K

    1981-01-01

    A sharp grain boundary peak appears in both 2 and 3% silicon-iron alloys due to a substitutional solute of silicon. This peak is highly sensitive to the segregation of the third element of antimony and, contrary to orthodox solute peaks in binary and ternary alloys, largely decreases in magnitude on heating after a segregation treatment. The subsequent measurement on cooling returns the peak to the ordinary magnitude. As a function of annealing time at a temperature of segregation, the height...

  7. Measurement of regional hepatic blood flow and scintigraphic imaging of portal circulation with /sup 133/Xe

    Energy Technology Data Exchange (ETDEWEB)

    Kroiss, A. (Krankenanstalt der Stadt Wien Rudolfstiftung (Austria) 1. Medizinische Abt.)

    1980-01-01

    Regional hepatic blood flow has been determined by 4 methods with the aid of /sup 133/Xe washout technique: 1. scintisplenoportography (direct application of /sup 133/Xe into the spleen by means of a thin needle); 2. arterial method (/sup 133/Xe is injected into the A. hepatica by means of a catheter); 3. retrograde-venous method (/sup 133/Xe administered by an occluding hepatic vein catheter); 4. percutaneous intrahepatic method (/sup 133/Xe administered directly into the parenchyma by means of a Chiba needle). It was possible to demonstrate that hepatic blood flow values established with the aid of /sup 133/Xe are independent of the form of application (scintisplenoportography, arterial method, retrograde-venous method).

  8. Evaluation of potential dietary toxicity of heavy metals in some common Nigerian beverages: A look at antimony, tin and mercury

    Directory of Open Access Journals (Sweden)

    I.I. Roberts

    2011-11-01

    Full Text Available There is currently little information on the composition of heavy metals in beverages imported and locally produced in Nigeria. The study quantitatively determined the composition of antimony (Sb, tin (Sn and mercury (Hg in 50 different beverage samples and evaluated the extent of violation of guideline values. Analysis of the beverage samples for the presence of Sb, Sn, and Hg was carried out using an atomic absorption spectrophotometer (AAS 929. The mean values detected for mercury, tin and antimony (±SE in fruit juices and soft drinks were 2.39±0.25, 3.66±0.22 and 0.49±0.048 μg/l; 2.93±0.34, 3.60±0.46 and 0.49±0.10 μg/l in dairy drinks and 0.94±0.02, 4.34±0.48 and 0.48±0.05 μg/l in bottled water samples respectively. While antimony detected in all products was below guideline values, mercury and tin were above the acceptable levels established by the World Health Organization, United States Environmental Protection Agency and European Union in most samples tested.

  9. Precipitation of antimony from the solution of sodium thioantimonite by air oxidation in the presence of catalytic agents

    Institute of Scientific and Technical Information of China (English)

    杨天足; 赖琼琳; 唐建军; 楚广

    2002-01-01

    The behavior of antimony oxidation in the solution of sodium thioantimonite was studied in the presence of catalytic agents. The catalytic effects of the respective addition of cupric sulfate, sodium tartrate, potassium permanganate, phenol, 1,2-dihydroxybenzene and their combination on the oxidation of sodium thioantimonite were investigated. A pilot test was carried out. The results show that the respective use of sodium tartrate, cupric sulfate, potassium permanganate, phenol and 1,2-dihydroxybenzene have little catalytic effect on the oxidation of sodium thioantimonite. However there exists obvious catalytic oxidation by the combination of 0.25 g/L 1,2-dihydroxybenzene, 0.5 g/L potassium permanganate and 1.0 g/L phenol. Moreover, high blast intensity, the increase of temperature and NaOH concentration favor the oxidation of antimony. The oxidation process of antimony has such advantages as quick reaction and low operation costs. The results of the pilot test are consistent with those of laboratory experiments.

  10. Separation of Lead from Crude Antimony by Pyro-Refining Process with NaPO3 Addition

    Science.gov (United States)

    Ye, Longgang; Hu, Yuejie; Xia, Zhimei; Chen, Yongming

    2016-06-01

    The main purpose of this study was to separate lead from crude antimony through an oxidation pyro-refining process and by using sodium metaphosphate as a lead elimination reagent. The process parameters that will affect the refining results were optimized experimentally under controlled conditions, such as the sodium metaphosphate charging dosage, the refining temperature and duration, and the air flow rate, to determine their effect on the lead content in refined antimony and the lead removal rate. A minimum lead content of 0.0522 wt.% and a 98.6% lead removal rate were obtained under the following optimal conditions: W_{{{NaPO}_{{3}} }} = 15% W Sb (where W represents weight), a refining temperature of 800°C, a refining time of 30 min, and an air flow rate of 3 L/min. X-ray diffractometry and scanning electron microscopy showed that high-purity antimony was obtained. The smelting operation is free from smoke or ammonia pollution when using monobasic sodium phosphate or ammonium dihydrogen phosphate as the lead elimination reagent. However, this refining process can also remove a certain amount of sulfur, cobalt, and silicon simultaneously, and smelting results also suggest that sodium metaphosphate can be used as a potential lead elimination reagent for bismuth and copper refining.

  11. PANCREATIC TOXICITY AS AN ADVERSE EFFECT INDUCED BY MEGLUMINE ANTIMONIATE THERAPY IN A CLINICAL TRIAL FOR CUTANEOUS LEISHMANIASIS

    Science.gov (United States)

    LYRA, Marcelo Rosandiski; PASSOS, Sonia Regina Lambert; PIMENTEL, Maria Inês Fernandes; BEDOYA-PACHECO, Sandro Javier; VALETE-ROSALINO, Cláudia Maria; VASCONCELLOS, Erica Camargo Ferreira; ANTONIO, Liliane Fatima; SAHEKI, Mauricio Naoto; SALGUEIRO, Mariza Mattos; SANTOS, Ginelza Peres Lima; RIBEIRO, Madelon Noato; CONCEIÇÃO-SILVA, Fatima; MADEIRA, Maria Fatima; SILVA, Jorge Luiz Nunes; FAGUNDES, Aline; SCHUBACH, Armando Oliveria

    2016-01-01

    SUMMARY American tegumentary leishmaniasis is an infectious disease caused by a protozoan of the genus Leishmania. Pentavalent antimonials are the first choice drugs for cutaneous leishmaniasis (CL), although doses are controversial. In a clinical trial for CL we investigated the occurrence of pancreatic toxicity with different schedules of treatment with meglumine antimoniate (MA). Seventy-two patients were allocated in two different therapeutic groups: 20 or 5 mg of pentavalent antimony (Sb5+)/kg/day for 20 or 30 days, respectively. Looking for adverse effects, patients were asked about abdominal pain, nausea, vomiting or anorexia in each medical visit. We performed physical examinations and collected blood to evaluate serum amylase and lipase in the pre-treatment period, and every 10 days during treatment and one month post-treatment. Hyperlipasemia occurred in 54.8% and hyperamylasemia in 19.4% patients. Patients treated with MA 20 mg Sb5+ presented a higher risk of hyperlipasemia (p = 0.023). Besides, higher MA doses were associated with a 2.05 higher risk ratio (p = 0.003) of developing more serious (moderate to severe) hyperlipasemia. The attributable fraction was 51% in this group. Thirty-six patients presented abdominal pain, nausea, vomiting or anorexia but only 47.2% of those had hyperlipasemia and/ or hyperamylasemia. These findings suggest the importance of the search for less toxic therapeutic regimens for the treatment of CL. PMID:27680173

  12. STAT3 is a key transcriptional regulator of cancer stem cell marker CD133 in HCC

    Science.gov (United States)

    Ghoshal, Sarani; Fuchs, Bryan C.

    2016-01-01

    Cancer stem cell (CSC) marker CD133 was found to be upregulated in many cancers including hepatocellular carcinoma (HCC). However, the molecular mechanism of CD133 regulation in the liver tumor microenvironment has remained elusive. In this study Won and colleagues report that interleukin-6 (IL-6) mediated signal transducer and activator of transcription factor 3 (STAT3) signaling and hypoxia enhance the expression of CD133 and promote the progression of HCC. PMID:27275460

  13. Molecular properties of CD133+ glioblastoma stem cells derived from treatment-refractory recurrent brain tumors

    OpenAIRE

    Liu, Qinghai; Nguyen, David H.; DONG, QINGHUA; Shitaku, Peter; Chung, Kenneth; Liu, On Ying; Jonathan L Tso; Liu, Jason Y; Konkankit, Veerauo; Cloughesy, Timothy F.; Mischel, Paul S; Lane, Timothy F.; Liau, Linda M.; Stanley F Nelson; Tso, Cho-Lea

    2009-01-01

    Glioblastoma multiforme (GBM) remains refractory to conventional therapy. CD133+ GBM cells have been recently isolated and characterized as chemo-/radio-resistant tumor-initiating cells and are hypothesized to be responsible for post-treatment recurrence. In order to explore the molecular properties of tumorigenic CD133+ GBM cells that resist treatment, we isolated CD133+ GBM cells from tumors that are recurrent and have previously received chemo-/radio-therapy. We found that the purified CD1...

  14. Clinicopathological significance of CD133 in lung cancer: A meta-analysis

    OpenAIRE

    Yaoxi TAN; Chen, Bo; Xu, Wei; Zhao, Weihong; Wu, Jianqing

    2013-01-01

    CD133 is one of the most commonly used markers of lung cancer stem cells (CSCs), which are characterized by their ability for self-renewal and tumorigenicity. However, the clinical value and significance of CD133 in lung cancer remains controversial. Due to the limited size of the individual studies, the association between CD133 and the clinicopathological characteristics of lung cancer had not been fully elucidated. A meta-analysis based on published studies was performed with the aim of ev...

  15. 29 CFR 780.133 - Farmers' cooperative as a “farmer.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Farmers' cooperative as a âfarmer.â 780.133 Section 780.133... General Scope of Agriculture Practices Performed âby A Farmerâ § 780.133 Farmers' cooperative as a “farmer.” (a) The phrase “by a farmer” covers practices performed either by the farmer himself or by the...

  16. A 133-xenon inhalation system for cerebral blood-flow measurements in ventilated premature babies

    International Nuclear Information System (INIS)

    We constructed a Xenon-133 inhalation and trapping system in order to measure cerebral blood flow of ventilated premature babies by means of the noninvasive 133Xe clearance method. The completely lead-shielded inhalation device is a closed system driven by the baby's own respirator and can thus be safely used at the patients bedside in the intensive care unit. Reproducible proximal airway concentrations of 133Xe (with or without leaks around the endotracheal tube) were obtained by in vitro simulation. (orig.)

  17. CD133 promotes gallbladder carcinoma cell migration through activating Akt phosphorylation

    Science.gov (United States)

    Zhen, Jiaojiao; Ai, Zhilong

    2016-01-01

    Gallbladder carcinoma (GBC) is the fifth most common malignancy of gastrointestinal tract. The prognosis of gallbladder carcinoma is extremely terrible partially due to metastasis. However, the mechanisms underlying gallbladder carcinoma metastasis remain largely unknown. CD133 is a widely used cancer stem cell marker including in gallbladder carcinoma. Here, we found that CD133 was highly expressed in gallbladder carcinoma as compared to normal tissues. CD133 was located in the invasive areas in gallbladder carcinoma. Down-regulation expression of CD133 inhibited migration and invasion of gallbladder carcinoma cell without obviously reducing cell proliferation. Mechanism analysis revealed that down-regulation expression of CD133 inhibited Akt phosphorylation and increased PTEN protein level. The inhibitory effect of CD133 down-regulation on gallbladder carcinoma cell migration could be rescued by Akt activation. Consistent with this, addition of Akt inhibitor Wortmannin markedly inhibited the migration ability of CD133-overexpressing cells. Thus, down-regulation of CD133 inhibits migration of gallbladder carcinoma cells through reducing Akt phosphorylation. These findings explore the fundamental biological aspect of CD133 in gallbladder carcinoma progression, providing insights into gallbladder carcinoma cell migration. PMID:26910892

  18. Clinicopathological significance of CD133 in lung cancer: A meta-analysis.

    Science.gov (United States)

    Tan, Yaoxi; Chen, Bo; Xu, Wei; Zhao, Weihong; Wu, Jianqing

    2014-01-01

    CD133 is one of the most commonly used markers of lung cancer stem cells (CSCs), which are characterized by their ability for self-renewal and tumorigenicity. However, the clinical value and significance of CD133 in lung cancer remains controversial. Due to the limited size of the individual studies, the association between CD133 and the clinicopathological characteristics of lung cancer had not been fully elucidated. A meta-analysis based on published studies was performed with the aim of evaluating the effect of CD133 on the clinicopathological characteristics of lung cancer and to investigate the role of CSCs in the prognosis of lung cancer. A total of 15 eligible studies were included in this meta-analysis and our results indicated that a positive CD133 expression was significantly associated with poor differentiation and lymph node metastasis, although it was not associated with tumor stage or histological type. Therefore, CD133 may be considered as a prognostic maker of lung cancer. Further clinical studies, with larger patient samples, unified methods and cut-off levels to detect CD133 expression, classified by tumor stage, therapeutic schedule, follow-up time and survival events, are required to determine the role of CD133 in clinical application and the association between CD133 and the prognosis of lung cancer. PMID:24649317

  19. CD133 Immunohistochemisty in Glioblastoma – Identification of Tumor Stem Cells or a Matter of Coincidence?

    DEFF Research Database (Denmark)

    Hermansen, Simon Kjær; Christensen, Karina Garnier; Jensen, Stine Skov;

    + niches in glioblastomas, often in close relation to blood vessels, using all four antibody clones. The distribution of identified niches did, however, rarely correspond among each antibody clone. Staining of glioblastoma single and niche cells was predominantly cytoplasmatic, although membranous staining...... was also observed in niches. Quantitative stereology revealed vast dissimilarities regarding fractions of CD133+ niches and single cells among the CD133 antibody clones. Generally, the fraction of CD133 positivity identified by clone W6B3C1 was significantly higher than CD133 fractions identified by...

  20. Analysis of 133 patients with severe blunt liver injury

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective: To investigate the treatment and causes of death aboutsevere blunt liver injury.Methods: The data of 133 patients with severe blunt liver injury (Grade Ⅲ to Grade Ⅴ) were analyzed retrospectively. All the patients except 2 underwent operations. Different types of surgical procedures were adopted according to the severity of liver injury.Results: Operations were the major method to treat hepatic injury. The total mortality rate was 21.0% in this study. The mortality rates of Grade Ⅲ, Grade Ⅳ and Grade Ⅴ of liver injuries were 11.3%, 24.4% and 69.2%, respectively.Conclusions: Packing treatment plays an important role in the treatment of hepatic injury. The mortality rate is related closely to the severity of hepatic injury, multiple trauma, shock and disturbance of blood coagulation.

  1. Contribution to scintigraphic study of pulmonary ventilation using 133Xe

    International Nuclear Information System (INIS)

    A technique of regional lung function study, using 133Xe, is described (instrumentation, procedure, results). A gamma-camera is used for this investigation, its main advantages are as follows. The picture is smaller than the one produced by a scanner, but is obtained more quickly. The gamma-camera equipped with a data processing unit is able to visualize areas of interest and to provide quantitative informations. Two parameters are studied. The first one is Xenon washout speed expressed in (ml/mn/cm3) which gives an exact value of pulmonary ventilation. The latter is retention. This parameter is of interest because retention is more easy to evaluate than washout speed, and is able to quantify what is suggested by scintigraphic pictures. The technique has proven to be valuable in differentiating chronic bronchitis from post-bronchitic emphysema

  2. A study on low cost-high conducting fluorine and antimony-doped tin oxide thin films

    International Nuclear Information System (INIS)

    Thin films of undoped, fluorine- and antimony-doped tin oxide on glass at 400 deg. C was prepared by spray pyrolysis technique. Tin chloride (SnCl2), ammonium fluoride (NH4F), and antimony trichloride (SbCl3) were used as source for tin (Sn), fluorine (F), and antimony (Sb), respectively. To ensure the control of solution concentration on growth rate, fluorine-doped tin oxide (SnO2:F) thin films were first prepared with different amount of tin precursor, in the range of 5-12g, which has resulted in deposition of films with different thickness values. The optimum amount of tin precursor found from this study (11g) was fixed constant for preparing SnO2 films with different doping levels of F and Sb. From the X-ray diffraction analyses, it is understood that the preferred orientation of SnO2:F films is dependent on their thickness and the solution concentration. The variation in the solution concentration and orientation of the films was reflected in their morphology as examined by scanning electron microscopy (SEM) and atomic force microscopy (AFM). SEM studies showed that the variation in the solution concentration lead to different grain shapes for different orientations. The AFM study showed that the RMS roughness of undoped films reduced considerably from 86 to 24nm due to fluorine doping (15wt.%), whereas the antimony doping (2wt.%) has no significance effect on RMS roughness (93nm). The electrical properties of the films were examined by a Hall measurements setup in van der Pauw configuration. A minimum sheet resistance of 1.75 and 2.17Ω/ were obtained for F and Sb doped films, respectively. From the optical studies, it is found that the transmittance of undoped films increased from 42% to a maximum 85% on 30wt.% fluorine doping, whereas that has been decreased to a minimum of 12% on 4wt.% antimony doping (800nm). A discussion on the effect of type of dopants and their concentration on the structural, electrical and optical properties of the SnO2 film have

  3. Preparation of antimony sulfide semiconductor nanoparticles by pulsed laser ablation in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Ren-De, E-mail: son003@sekisui.com [Research & Development Institute, High Performance Plastics Company, Sekisui Chemical Co., Ltd. 2-1 Hyakuyama, Shimamoto-Cho, Mishima-Gun, Osaka, 618-0021 (Japan); Tsuji, Takeshi [Interdisciplinary Graduate School of Science and Engineering, Shimane University, 1060 Nishikawatsu-Cho, Matsue, 690-8504 (Japan)

    2015-09-01

    Highlights: • Pulsed laser ablation in liquid (LAL) was applied to prepare antimony sulfide nanoparticles (Sb{sub 2}S{sub 3} NPs). • Sb{sub 2}S{sub 3} NPs with a stoichiometric composition were successfully prepared by LAL in water without using any surfactants or capping agents. • Thus-prepared Sb{sub 2}S{sub 3} NPs showed low-temperature crystallization and melting at a temperature low as 200 °C. • The NPs-coated Sb{sub 2}S{sub 3} thin film showed comparable semiconductor properties (carrier mobility and carrier density) to the vacuum deposited one. • Byproducts such as CS{sub 2}, CH{sub 4} and CO were detected by GC-MS analysis when LAL was performed in organic solvent. • The LAL-induced decomposition mechanism of Sb{sub 2}S{sub 3} and organic solvents was discussed based on the GC-MS results. - Abstract: In this paper, we report on the synthesis of antimony sulfide (Sb{sub 2}S{sub 3}) semiconductor nanoparticles by pulsed laser ablation in liquid without using any surfactants or capping agents. Different results were obtained in water and organic solvents. In the case of water, Sb{sub 2}S{sub 3} nanoparticles with chemical compositions of stoichiometry were successfully prepared when laser irradiation was performed under the condition with the dissolved oxygen removed by argon gas bubbling. It was shown that thus-obtained Sb{sub 2}S{sub 3} nanoparticles exhibit features of not only low-temperature crystallization but also low-temperature melting at a temperature as low as 200 °C. Nanoparticle-coated Sb{sub 2}S{sub 3} thin films were found to show good visible light absorption and satisfying semiconductor properties (i.e., carrier mobility and density), which are essential for photovoltaic application. On the other hand, in the case of organic solvents (e.g., acetone, ethanol), such unexpected byproducts as CS{sub 2}, CO and CH{sub 4} were detected from the reaction system by GC-MS analysis, which suggests that both Sb{sub 2}S{sub 3} and organic

  4. Infrared-to-red upconversion luminescence in samarium-doped antimony glasses

    Energy Technology Data Exchange (ETDEWEB)

    Som, Tirtha [Glass Technology Laboratory, Glass Division, Central Glass and Ceramic Research Institute, 196 Raja S.C. Mullick Road, Kolkata 700 032 (India); Karmakar, Basudeb [Glass Technology Laboratory, Glass Division, Central Glass and Ceramic Research Institute, 196 Raja S.C. Mullick Road, Kolkata 700 032 (India)], E-mail: basudebk@cgcri.res.in

    2008-12-15

    A new antimony-based glass system (K{sub 2}O-B{sub 2}O{sub 3}-Sb{sub 2}O{sub 3}) having low phonon energy (about 600 cm{sup -1}) doped with Sm{sup 3+} ions has been developed. Infrared reflection spectroscopic (IRRS) studies have been employed to establish its low phonon energy. Ultraviolet-Visible-near infrared (UV-Vis-NIR) absorption and photoluminescence upconversion properties with the spectrochemistry of the 15K{sub 2}O-15B{sub 2}O{sub 3}-70Sb{sub 2}O{sub 3} (mol%) glasses have been studied doping with different concentrations (0.1-1.0 wt%) of Sm{sub 2}O{sub 3}. UV-Vis-NIR absorption band positions have been justified with quantitative calculation of nephelauxetic parameter and covalent bonding characteristics of the host. NIR to visible upconversion has been investigated by exciting at 949 nm at room temperature. Three upconverted bands originating from the {sup 4}G{sub 5/2}{yields}{sup 6}H{sub 5/2}, {sup 4}G{sub 5/2}{yields}{sup 6}H{sub 7/2} and {sup 4}G{sub 5/2}{yields}{sup 6}H{sub 9/2} transitions are found to be centered at 566 (green, weak), 602 (orange, weak) and 636 (red, remarkably strong) nm, respectively. These bands have been explained from the evaluation of the absorption, normal (downconversion) fluorescence and excitation spectra. The upconversion processes have been explained by the excited state absorption (ESA), energy transfer (ET) and cross-relaxation (CR) mechanisms involving population of the metastable (storage) energy level ({sup 4}G{sub 5/2}) by multiphonon deexcitation effect. It is evident from the IRRS study that the upconversion phenomena are expedited by the low multiphonon relaxation rate in antimony glasses owing to their low phonon energy (602 cm{sup -1}, the main and highest intensity Sb-O-Sb stretching band) which is very close to that of fluoride glasses (500-600 cm{sup -1})

  5. CD133-expressing thyroid cancer cells are undifferentiated, radioresistant and survive radioiodide therapy

    Energy Technology Data Exchange (ETDEWEB)

    Ke, Chien-Chih [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); Liu, Ren-Shyan [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); NRPGM, Molecular and Genetic Imaging Core, Taipei (China); National Yang-Ming University, School of Medicine, Taipei (China); Taipei Veterans General Hospital, National PET/Cyclotron Center, Taipei (China); National Yang-Ming University, Department of Biomedical Imaging and Radiological Sciences, Taipei (China); Yang, An-Hang [Taipei Veterans General Hospital, Department of Pathology and Laboratory Medicine, Taipei (China); National Yang-Ming University, Department of Pathology, School of Medicine, Taipei (China); Liu, Ching-Sheng [National Yang-Ming University Medical School, Department of Nuclear Medicine, School of Medicine, Taipei (China); Chi, Chin-Wen [National Yang-Ming University, Institute of Pharmacology, School of Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Medical Research and Education, Taipei (China); Tseng, Ling-Ming [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Tsai, Yi-Fan [Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Ho, Jennifer H. [Taipei Medical University, Graduate Institute of Clinical Medicine, Taipei (China); Taipei Medical University-Wan Fang Medical Center, Department of Ophthalmology, Taipei (China); Taipei Medical University-Wan Fang Medical Center, Center for Stem Cell Research, Taipei (China); Lee, Chen-Hsen [NRPGM, Molecular and Genetic Imaging Core, Taipei (China); National Yang-Ming University, School of Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Lee, Oscar K. [Taipei Veterans General Hospital, Department of Orthopedics, Taipei (China); National Yang-Ming University, Stem Cell Research Center, Taipei (China); Taipei Veterans General Hospital, Department of Medical Research and Education, Taipei (China)

    2013-01-15

    {sup 131}I therapy is regularly used following surgery as a part of thyroid cancer management. Despite an overall relatively good prognosis, recurrent or metastatic thyroid cancer is not rare. CD133-expressing cells have been shown to mark thyroid cancer stem cells that possess the characteristics of stem cells and have the ability to initiate tumours. However, no studies have addressed the influence of CD133-expressing cells on radioiodide therapy of the thyroid cancer. The aim of this study was to investigate whether CD133{sup +} cells contribute to the radioresistance of thyroid cancer and thus potentiate future recurrence and metastasis. Thyroid cancer cell lines were analysed for CD133 expression, radiosensitivity and gene expression. The anaplastic thyroid cancer cell line ARO showed a higher percentage of CD133{sup +} cells and higher radioresistance. After {gamma}-irradiation of the cells, the CD133{sup +} population was enriched due to the higher apoptotic rate of CD133{sup -} cells. In vivo {sup 131}I treatment of ARO tumour resulted in an elevated expression of CD133, Oct4, Nanog, Lin28 and Glut1 genes. After isolation, CD133{sup +} cells exhibited higher radioresistance and higher expression of Oct4, Nanog, Sox2, Lin28 and Glut1 in the cell line or primarily cultured papillary thyroid cancer cells, and lower expression of various thyroid-specific genes, namely NIS, Tg, TPO, TSHR, TTF1 and Pax8. This study demonstrates the existence of CD133-expressing thyroid cancer cells which show a higher radioresistance and are in an undifferentiated status. These cells possess a greater potential to survive radiotherapy and may contribute to the recurrence of thyroid cancer. A future therapeutic approach for radioresistant thyroid cancer may focus on the selective eradication of CD133{sup +} cells. (orig.)

  6. CD133-expressing thyroid cancer cells are undifferentiated, radioresistant and survive radioiodide therapy

    International Nuclear Information System (INIS)

    131I therapy is regularly used following surgery as a part of thyroid cancer management. Despite an overall relatively good prognosis, recurrent or metastatic thyroid cancer is not rare. CD133-expressing cells have been shown to mark thyroid cancer stem cells that possess the characteristics of stem cells and have the ability to initiate tumours. However, no studies have addressed the influence of CD133-expressing cells on radioiodide therapy of the thyroid cancer. The aim of this study was to investigate whether CD133+ cells contribute to the radioresistance of thyroid cancer and thus potentiate future recurrence and metastasis. Thyroid cancer cell lines were analysed for CD133 expression, radiosensitivity and gene expression. The anaplastic thyroid cancer cell line ARO showed a higher percentage of CD133+ cells and higher radioresistance. After γ-irradiation of the cells, the CD133+ population was enriched due to the higher apoptotic rate of CD133- cells. In vivo 131I treatment of ARO tumour resulted in an elevated expression of CD133, Oct4, Nanog, Lin28 and Glut1 genes. After isolation, CD133+ cells exhibited higher radioresistance and higher expression of Oct4, Nanog, Sox2, Lin28 and Glut1 in the cell line or primarily cultured papillary thyroid cancer cells, and lower expression of various thyroid-specific genes, namely NIS, Tg, TPO, TSHR, TTF1 and Pax8. This study demonstrates the existence of CD133-expressing thyroid cancer cells which show a higher radioresistance and are in an undifferentiated status. These cells possess a greater potential to survive radiotherapy and may contribute to the recurrence of thyroid cancer. A future therapeutic approach for radioresistant thyroid cancer may focus on the selective eradication of CD133+ cells. (orig.)

  7. Inhibition of Leishmania donovani promastigote DNA topoisomerase I and human monocyte DNA topoisomerases I and II by antimonial drugs and classical antitopoisomerase agents.

    Science.gov (United States)

    Walker, John; Saravia, Nancy G

    2004-10-01

    We have compared the inhibitor sensitivities of DNA topoisomerase I (TOPI) from Leishmania donovani promastigotes and TOPs I and II of human monocytes using pentavalent and trivalent antimonials (SbV, SbIII) and classical TOP inhibitors. Bis-benzimidazoles (Hoechst-33258 and -33342) were potent inhibitors of both parasite and human TOPI, but Hoechst-33342 was markedly less cytotoxic to promastigotes than to monocytes in vitro. Leishmania donovani was also considerably less sensitive than monocytes to camptothecin, both at enzyme and cellular levels. Sodium stibogluconate (SSG) was the only antimonial to inhibit TOPI, exhibiting a significant (P donovani enzyme but showed low cytotoxicities against intact promastigotes. The SbV meglumine antimoniate failed to inhibit TOPI and showed negligible cytotoxicities, whereas SbIII drugs were lethal to parasites and monocytes yet poor inhibitors of TOPI. Monocyte TOPII was inhibited by bis-benzimidazoles and insensitive to antimonials and camptothecin. The disparity between the high leishmanicidal activity and low anti-TOPI potency of SbIII indicates that in vivo targeting of L. donovani TOPI by the reductive pathway of antimonial activation is improbable. Nevertheless, the potent direct inhibition of TOPI by SSG and the differential interactions of camptothecin with L. donovani and human TOPI support the possibility of developing parasite-specific derivatives. PMID:15562618

  8. Chronic exposure to arsenic in drinking water can lead to resistance to antimonial drugs in a mouse model of visceral leishmaniasis

    Science.gov (United States)

    Perry, Meghan R.; Wyllie, Susan; Raab, Andrea; Feldmann, Joerg; Fairlamb, Alan H.

    2013-01-01

    The Indian subcontinent is the only region where arsenic contamination of drinking water coexists with widespread resistance to antimonial drugs that are used to treat the parasitic disease visceral leishmaniasis. We have previously proposed that selection for parasite resistance within visceral leishmaniasis patients who have been exposed to trivalent arsenic results in cross-resistance to the related metalloid antimony, present in the pentavalent state as a complex in drugs such as sodium stibogluconate (Pentostam) and meglumine antimonate (Glucantime). To test this hypothesis, Leishmania donovani was serially passaged in mice exposed to arsenic in drinking water at environmentally relevant levels (10 or 100 ppm). Arsenic accumulation in organs and other tissues was proportional to the level of exposure and similar to that previously reported in human liver biopsies. After five monthly passages in mice exposed to arsenic, isolated parasites were found to be completely refractory to 500 μg⋅mL−1 Pentostam compared with the control passage group (38.5 μg⋅mL−1) cultured in vitro in mouse peritoneal macrophages. Reassessment of resistant parasites following further passage for 4 mo in mice without arsenic exposure showed that resistance was stable. Treatment of infected mice with Pentostam confirmed that resistance observed in vitro also occurred in vivo. We conclude that arsenic contamination may have played a significant role in the development of Leishmania antimonial resistance in Bihar because inadequate treatment with antimonial drugs is not exclusive to India, whereas widespread antimonial resistance is. PMID:24167266

  9. Chronic exposure to arsenic in drinking water can lead to resistance to antimonial drugs in a mouse model of visceral leishmaniasis.

    Science.gov (United States)

    Perry, Meghan R; Wyllie, Susan; Raab, Andrea; Feldmann, Joerg; Fairlamb, Alan H

    2013-12-01

    The Indian subcontinent is the only region where arsenic contamination of drinking water coexists with widespread resistance to antimonial drugs that are used to treat the parasitic disease visceral leishmaniasis. We have previously proposed that selection for parasite resistance within visceral leishmaniasis patients who have been exposed to trivalent arsenic results in cross-resistance to the related metalloid antimony, present in the pentavalent state as a complex in drugs such as sodium stibogluconate (Pentostam) and meglumine antimonate (Glucantime). To test this hypothesis, Leishmania donovani was serially passaged in mice exposed to arsenic in drinking water at environmentally relevant levels (10 or 100 ppm). Arsenic accumulation in organs and other tissues was proportional to the level of exposure and similar to that previously reported in human liver biopsies. After five monthly passages in mice exposed to arsenic, isolated parasites were found to be completely refractory to 500 μg · mL(-1) Pentostam compared with the control passage group (38.5 μg · mL(-1)) cultured in vitro in mouse peritoneal macrophages. Reassessment of resistant parasites following further passage for 4 mo in mice without arsenic exposure showed that resistance was stable. Treatment of infected mice with Pentostam confirmed that resistance observed in vitro also occurred in vivo. We conclude that arsenic contamination may have played a significant role in the development of Leishmania antimonial resistance in Bihar because inadequate treatment with antimonial drugs is not exclusive to India, whereas widespread antimonial resistance is.

  10. Leaching of Antimony (Sb)from Municipal Solid Waste Incineration (MSWI) Residues

    Energy Technology Data Exchange (ETDEWEB)

    Herrmann, Inga

    2004-07-01

    The mobility of antimony (Sb) in municipal solid waste incineration (MSWI) residues often exceeds the limit values stipulated by the European Union. As an ash treatment by washing is conceivable, this work investigated the Sb release from Swedish bottom ash and fly ash when mixed with water. The leaching experiments revealed the factors significantly (a = 0.05) affecting Sb release from the ashes. The following factors were investigated: Liquid to solid ratio (L/S), time, pH, carbonation (treatment with CO{sub 2}), ultrasonics and temperature. The data were evaluated using multiple linear regression (MLR). The impact of the factors could be quantified. The maximum Sb release calculated was 13 mg/kg DM for bottom ash and 51 mg/kg DM for fly ash. The derived models explained the observed data well. Nevertheless, the calculated values were subject to a high uncertainty. For bottom ash, a lowering of the Sb total content of approximately 22% could be achieved. If this also involves a sufficient lowering of the Sb mobility to meet EU limit values could not yet be assessed. Chemical equilibrium calculations were performed to explain the empirical results. However, no solid phases controlling Sb release from the ashes could be identified.

  11. Synthesis of Copper-Antimony-Sulfide Nanocrystals for Solution-Processed Solar Cells.

    Science.gov (United States)

    Suehiro, Satoshi; Horita, Keisuke; Yuasa, Masayoshi; Tanaka, Tooru; Fujita, Katsuhiko; Ishiwata, Yoichi; Shimanoe, Kengo; Kida, Tetsuya

    2015-08-17

    The p-type nanocrystals (NCs) of copper-based chalcogenides, such as CuInSe2 and Cu2ZnSnS4, have attracted increasing attention in photovoltaic applications due to their potential to produce cheap solution-processed solar cells. Herein, we report the synthesis of copper-antimony-sulfide (CAS) NCs with different crystal phases including CuSbS2, Cu3SbS4, and Cu12Sb4S13. In addition, their morphology, crystal phase, and optical properties were characterized using transmission electron microscopy, X-ray diffractometry, UV-vis-near-IR spectroscopy, and photoemission yield spectroscopy. The morphology, crystal phase, and electronic structure were significantly dependent on the chemical composition in the CAS system. Devices were fabricated using particulate films consisting of CAS NCs prepared by spin coating without a high-temperature treatment. The CAS NC-based devices exhibited a diode-like current-voltage characteristic when coupled with an n-type CdS layer. In particular, the CuSbS2 NC devices exhibited photovoltaic responses under simulated sunlight, demonstrating its applicability for use in solution-processed solar cells. PMID:26237216

  12. Adsorption behavior of antimony(III) oxyanions on magnetite surface in aqueous organic acid environment

    Science.gov (United States)

    Mittal, Vinit K.; Bera, Santanu; Narasimhan, S. V.; Velmurugan, S.

    2013-02-01

    Antimony(III) adsorption is observed on magnetite (Fe3O4) surface under acidic and reducing condition through surface hydroxyl (SOH) groups bonding on Fe3O4 surface. Desorption of adsorbed Sb(III) is observed from Fe3O4 surface along with iron release in organic acid at 85 °C after 5 h of experiment. Tartaric acid (TA) shows minimum Sb(III) adsorption on Fe3O4 among the organic acid studied. The reason is TA having two sets of adjacent functional groups viz. Odbnd Csbnd OH and Csbnd OH which are responsible for the formation of five-membered bidendate chelate with Sb(III). Other oxyanions, cations or complexing agents along with TA influences the Sb(III) adsorption on Fe3O4. The surface of magnetite is modified by the addition of fatty acids viz. Lauric acid, benzoic acid to bind the Ssbnd OH groups present on the surface. This results in delaying the process of adsorption without changing the quantity of saturation adsorption of Sb(III) on Fe3O4 surface.

  13. Large anharmonic effect and thermal expansion anisotropy of metal chalcogenides: The case of antimony sulfide

    Science.gov (United States)

    Gan, Chee Kwan; Soh, Jian Rui; Liu, Yun

    2015-12-01

    We derive a compact matrix expression for the linear thermal expansion coefficients (TECs) for a general orthorhombic system which relates elastic properties and integrated quantities based on deformation and mode dependent Grüneisen parameters and mode dependent heat capacities. The density of Grüneisen parameters Γ (ν ) as a function of frequency ν , weighted by the number of phonon modes, is introduced and found to be illuminating in interpreting the TEC results. Using density functional perturbation theory and Grüneisen formalism for thermal expansion, we illustrate the general usefulness of this method by calculating the linear and volumetric TECs of a low-symmetry orthorhombic compound antimony sulfide (Sb2S3 ), which belongs to a large class of technologically and fundamentally important materials. Even though negative Grüneisen parameters are found for deformations in all three crystal directions, the Γ (ν ) data rule out the occurrences of negative TECs at all temperatures. Sb2S3 exhibits a large thermal expansion anisotropy where the TEC in the b direction can reach as high as 13 ×10-6 K-1 at high temperatures, about two and seven times larger than the TECs in the c and a direction, respectively. Our work suggests a general and practical first-principles approach to calculate the thermal properties of other complicated low-symmetry systems.

  14. Controlled n-doping in chemical vapour deposition grown graphene by antimony

    International Nuclear Information System (INIS)

    We have studied the effects of antimony (Sb) doping on graphene grown by chemical vapour deposition without any significant change in its electrical properties. By increasing the metal thickness from 1 to 5 nm, we found a shift in the wave numbers of Raman G and two-dimensional (2D) peaks consistent with n-doping and a change in the Fermi level of the graphene into the conduction band. The relative intensity of the D peak to the G peak did not show a significant change and that of the 2D peak to the G peak remained at a large enough number as a function of metal thickness, implying little degradation by the metal dopants. Transport measurements also confirm the n-doping of graphene through a shift of Dirac point in the transfer characteristics and the quality preservation with little changes in mobility. We also report on the formation of a p–n junction by metal doping on selected areas of the graphene and their electrical properties with transfer characteristics and Hall measurements. (paper)

  15. Evaluation of atmospheric inputs as possible sources of antimony in pregnant women from urban areas.

    Science.gov (United States)

    Fort, Marta; Grimalt, Joan O; Querol, Xavier; Casas, Maribel; Sunyer, Jordi

    2016-02-15

    Antimony and copper are common components of brake linings. The occurrence of these two metals in urban atmospheric aerosols has been related to vehicular use. Urine samples (n=466) taken during the 32nd week of pregnancy were analyzed for Sb and Cu in pregnant women from an urban area (Sabadell, Catalonia, Spain). The geometric mean levels were 0.28 and 13 μg/g creatinine, respectively. Positive significant associations between urine concentrations of Sb and seasonality, intensity of physical exercise, working activities and traffic intensity at their home streets were observed. Cu showed the same trends but without statistical significance. In both cases, the estimated dietary ingestion of these two metals was larger than the inhalation inputs but the difference was much higher for Cu than for Sb. While Sb has no dietary role, Cu is an essential element which is also incorporated into humans through diet. The results suggest that inhalation of atmospheric particles may also constitute a source of Sb in pregnant women and general population of urban areas. PMID:26657384

  16. Partitioning geochemistry of arsenic and antimony, El Tatio Geyser Field, Chile

    Energy Technology Data Exchange (ETDEWEB)

    Landrum, J.T. [Department of Geological Sciences, The University of Texas, Austin, TX 78759 (United States); Bennett, P.C., E-mail: pbennett@mail.utexas.edu [Department of Geological Sciences, University of Texas, Austin, TX 78759 (United States); Engel, A.S. [Department of Geology and Geophysics, Louisiana State University, Baton Rouge, LA 70803 (United States); Alsina, M.A.; Pasten, P.A. [Departamento de Ingenieria Hidraulica y Ambiental, Pontificia Universidad Catolica de Chile, Santiago (Chile); Milliken, K. [Department of Geological Sciences, University of Texas, Austin, TX 78759 (United States)

    2009-04-15

    The abundance of As and Sb in aqueous, mineral and biological reservoirs was examined at El Tatio Geyser Field, a unique hydrothermal basin located in the Atacama Desert region of Chile. Here the concentration of total As and Sb in hydrothermal springs and discharge streams are the highest reported for a natural surface water, and the geyser basin represents a significant source of toxic elements for downstream users across Region II, Chile. The geyser waters are near neutral Na:Cl type with {approx}0.45 and 0.021 mmol L{sup -1} total As and Sb, respectively, primarily in the reduced (III) redox state at the discharge with progressive oxidation downstream. The ferric oxyhydroxides associated with the microbial mats and some mineral precipitates accumulate substantial As that was identified as arsenate by XAS analysis (>10 wt% in the mats). This As is easily mobilized by anion exchange or mild dissolution of the HFO, and the ubiquitous microbial mats represent a significant reservoir of As in this system. Antimony, in contrast, is not associated with the mineral ferric oxides or the biomats, but is substantially enriched in the silica matrix of the geyserite precipitates, up to 2 wt% as Sb{sub 2}O{sub 3}. Understanding the mobility and partitioning behavior of these metalloids is critical for understanding their eventual impact on regional water management.

  17. Spark Plasma Sintering and Densification Mechanisms of Antimony-Doped Tin Oxide Nanoceramics

    Directory of Open Access Journals (Sweden)

    Junyan Wu

    2013-01-01

    Full Text Available Densification of antimony-doped tin oxide (ATO ceramics without sintering aids is very difficult, due to the volatilization of SnO2, formation of deleterious phases above 1000°C, and poor sintering ability of ATO particles. In this paper, monodispersed ATO nanoparticles were synthesized via sol-gel method, and then ATO nanoceramics with high density were prepared by spark plasma sintering (SPS technology using the as-synthesized ATO nanoparticles without the addition of sintering aids. The effect of Sb doping content on the densification was investigated, and the densification mechanisms were explored. The results suggest that ATO nanoparticles derived from sol-gel method show good crystallinity with a crystal size of 5–20 nm and Sb is incorporated into the SnO2 crystal structure. When the SPS sintering temperature is 1000°C and the Sb doping content is 5 at.%, the density of ATO nanoceramics reaches a maximum value of 99.2%. Densification mechanisms are explored in detail.

  18. A new method for antimony speciation in plant biomass and nutrient media using anion exchange cartridge.

    Science.gov (United States)

    Tisarum, Rujira; Ren, Jing-Hua; Dong, Xiaoling; Chen, Hao; Lessl, Jason T; Ma, Lena Q

    2015-11-01

    A selective separation method based on anion exchange cartridge was developed to determine antimony (Sb) speciation in biological matrices by graphite furnace atomic absorption spectrophotometry (GFAAS). The selectivity of the cartridge towards antimonite [Sb(III)] and antimonate [Sb(V)] reversed in the presence of deionized (DI) water and 2mM citric acid. While Sb(V) was retained by the cartridge in DI water, Sb(III) was retained in citric acid media. At pH 6, Sb(III) and Sb(V) formed Sb(III)- and Sb(V)-citrate complexes, but the cartridge had higher affinity towards the Sb(III)-citrate complex. Separation of Sb(III) was tested at various concentrations in fresh and spent growth media and plant tissues. Our results showed that cartridge-based Sb speciation was successful in plant tissues, which was confirmed by HPLC-ICP-MS. The cartridge retained Sb(III) and showed 92-104% Sb(V) recovery from arsenic hyperaccumulator Pteris vittata roots treated with Sb(III) and Sb(V). The cartridge procedure is an effective alternative for Sb speciation, offering low cost, reproducible results, and simple Sb analysis using GFAAS.

  19. Antimony release from contaminated mine soils and its migration in four typical soils using lysimeter experiments.

    Science.gov (United States)

    Shangguan, Yu-Xian; Zhao, Long; Qin, Yusheng; Hou, Hong; Zhang, Naiming

    2016-11-01

    Antimony (Sb) can pose great risks to the environment in mining and smelting areas. The migration of Sb in contaminated mine soil was studied using lysimeter experiments. The exchangeable concentration of soil Sb decreased with artificial leaching. The concentrations of Sb retained in the subsoil layers (5-25cm deep) were the highest for Isohumosol and Ferrosol and the lowest for Sandy soil. The Sb concentrations in soil solutions decreased with soil depth, and were adequately simulated using a logarithmic function. The Sb migration pattern in Sandy soil was markedly different from the patterns in the other soils which suggested that Sb may be transported in soil colloids. Environmental factors such as water content, soil temperature, and oxidation-reduction potential of the soil had different effects on Sb migration in Sandy soil and Primosol. The high Fe and Mn contents in Ferrosol and Isohumosol significantly decreased the mobility of Sb in these soils. The Na and Sb concentrations in soils used in the experiments positively correlated with each other (Psoil solutions, the Sb chemical fraction patterns, and the Sb/Na ratios decreased in the order Sandy soil>Primosol>Isohumosol>Ferrosol, and we concluded that the Sb mobility in the soils also decreased in that order. PMID:27395817

  20. Synthesis of Copper-Antimony-Sulfide Nanocrystals for Solution-Processed Solar Cells.

    Science.gov (United States)

    Suehiro, Satoshi; Horita, Keisuke; Yuasa, Masayoshi; Tanaka, Tooru; Fujita, Katsuhiko; Ishiwata, Yoichi; Shimanoe, Kengo; Kida, Tetsuya

    2015-08-17

    The p-type nanocrystals (NCs) of copper-based chalcogenides, such as CuInSe2 and Cu2ZnSnS4, have attracted increasing attention in photovoltaic applications due to their potential to produce cheap solution-processed solar cells. Herein, we report the synthesis of copper-antimony-sulfide (CAS) NCs with different crystal phases including CuSbS2, Cu3SbS4, and Cu12Sb4S13. In addition, their morphology, crystal phase, and optical properties were characterized using transmission electron microscopy, X-ray diffractometry, UV-vis-near-IR spectroscopy, and photoemission yield spectroscopy. The morphology, crystal phase, and electronic structure were significantly dependent on the chemical composition in the CAS system. Devices were fabricated using particulate films consisting of CAS NCs prepared by spin coating without a high-temperature treatment. The CAS NC-based devices exhibited a diode-like current-voltage characteristic when coupled with an n-type CdS layer. In particular, the CuSbS2 NC devices exhibited photovoltaic responses under simulated sunlight, demonstrating its applicability for use in solution-processed solar cells.

  1. Semiconductor nanocrystals functionalized with antimony telluride zintl ions for nanostructured thermoelectrics.

    Science.gov (United States)

    Kovalenko, Maksym V; Spokoyny, Boris; Lee, Jong-Soo; Scheele, Marcus; Weber, Andrew; Perera, Susanthri; Landry, Daniel; Talapin, Dmitri V

    2010-05-19

    The energy efficiency of heat engines could be improved by the partial recovery of waste heat using thermoelectric (TE) generators. We show the possibility of designing nanostructured TE materials using colloidal inorganic nanocrystals functionalized with molecular antimony telluride complexes belonging to the family of Zintl ions. The unique advantage of using Zintl ions as the nanocrystal surface ligands is the possibility to convert them into crystalline metal chalcogenides, thus linking individual nanobuilding blocks into a macroscopic assembly of electronically coupled functional modules. This approach allows preserving the benefits of nanostructuring and quantum confinement while enabling facile charge transport through the interparticle boundaries. A developed methodology was applied for solution-based fabrication of nanostructured n- and p-type Bi(2-x)Sb(x)Te(3) alloys with tunable composition and PbTe-Sb(2)Te(3) nanocomposites with controlled grain size. Characterization of the TE properties of these materials showed that their Seebeck coefficients, electrical and thermal conductivities, and ZT values compared favorably with those of previously reported solution-processed TE materials.

  2. Assessment and distribution of antimony in soils around three coal mines, Anhui, China

    Science.gov (United States)

    Qi, C.; Liu, Gaisheng; Kang, Y.; Lam, P.K.S.; Chou, C.

    2011-01-01

    Thirty-three soil samples were collected from the Luling, Liuer, and Zhangji coal mines in the Huaibei and Huainan areas of Anhui Province, China. The samples were analyzed for antimony (Sb) by inductively coupled plasmaoptical emission spectrometry (ICP-OES) method. The average Sb content in the 33 samples was 4 mg kg-1, which is lower than in coals from this region (6.2 mg kg-1). More than 75% of the soils sampled showed a significant degree of Sb pollution (enrichment factors [EFs] 5-20). The soils collected near the gob pile and coal preparation plant were higher in Sb content than those collected from residential areas near the mines. The gob pile and tailings from the preparation plant were high in mineral matter content and high in Sb. They are the sources of Sb pollution in surface soils in the vicinity of coal mines. The spatial dispersion of Sb in surface soil in the mine region shows that Sb pollution could reach out as far as 350 m into the local environment conditions. Crops in rice paddies may adsorb some Sb and reduce the Sb content in soils from paddyfields. Vertical distribution of Sb in two soil profiles indicates that Sb is normally relatively immobile in soils. ?? 2011 Air & Waste Management Association.

  3. DFT Study on the Carrier Concentration and Temperature-Dependent Thermoelectric Properties of Antimony Selenide

    Directory of Open Access Journals (Sweden)

    Aditya Jayaraman

    2016-01-01

    Full Text Available We present the thermoelectric properties of Antimony Selenide (Sb2Se3 obtained using first principles calculations. We investigated the electronic band structure using the FP-LAPW method within the sphere of the density functional theory. Thermoelectric properties were calculated using BoltzTrap code using the constant relaxation time (τ approximation at three different temperatures 300 K, 600 K, and 800 K. Seebeck coefficient (S was found to decrease with increasing temperature, electrical conductivity (σ/τ was almost constant in the entire temperature range, and electronic thermal conductivity (κ/τ increased with increasing temperature. With increase in temperature S decreased from 1870 μV/K (at 300 K to 719 μV/K (at 800 K, electronic thermal conductivity increased from 1.56 × 1015 W/m K s (at 300 K to 3.92 × 1015 W/m K s (at 800 K, and electrical conductivity decreased from 22 × 1019/Ω m s (at 300 K to 20 × 1019/Ω m s (at 800 K. The thermoelectric properties were also calculated for different hole concentrations and the optimum concentration for a good thermoelectric performance over a large range of temperatures (from 300 K to 1000 K was found for hole concentration around 1019 cm−3.

  4. Comparison of arsenic and antimony biogeochemical behavior in water, soil and tailings from Xikuangshan, China.

    Science.gov (United States)

    Fu, Zhiyou; Wu, Fengchang; Mo, Changli; Deng, Qiujing; Meng, Wei; Giesy, John P

    2016-01-01

    Although similar geochemical behaviors of arsenic (As) and antimony (Sb) in the environment has been assumed and widely reported, growing evidence suggests the two elements cannot, under some conditions, be assumed to behave similarly. In this four-year study (samples collected in each year), comparative investigation of the biogeochemistry of As and Sb in water/fish, soil/vegetable, tailings/plant samples were carried out at the world's largest active Sb mine area (Xikuangshan, China). Depending on duration the tailings had been stacked, significant differences in spatial distributions between As and Sb were found, and these were associated with change in pH over time. Bio-accumulation factors (BAFs) of As were approximately 10-fold greater than those of Sb in fish/water, plant/tailing, and vegetable/soil systems. Sb had higher BAF in non-fatty tissues such as gills of fishes and shells of crabs. BAFs of Sb in vegetable/soil exhibited insignificantly, but different from As, positive correlation with pH in soil. PMID:26356182

  5. Validation of methodology and uncertainty assessment of antimony determination in environmental materials using Neutron Activation Analysis

    International Nuclear Information System (INIS)

    Antimony is an element found in low concentrations in the environment. However, its determination has attracted great interest because of the knowledge of its toxicity and increasing application. Neutron activation analysis (NAA) is a suitable method for the determination of several elements in different types, but in case of Sb, the analysis presents some difficulties due to spectral interferences. The objective of this research was to validate the method of NAA and uncertainty assessment for Sb determination in environmental samples. The experimental procedure consisted of irradiating twelve certified reference samples of different kind of matrices. The samples were irradiated in the nuclear research reactor IEA R1 IPEN/CNEN/SP followed by measurement of induced radioactivity, using a hyperpure germanium detector coupled to a gamma ray spectrometry. The radioisotopes 122Sb and 124Sb were measured and the Sb concentrations with their respective uncertainties were obtained by the comparative method. Relative errors and values of Z scores were calculated to evaluate the accuracy of the results for Sb determination in certified reference materials. The evaluation of the components that contribute to uncertainty measurement of the Sb concentration, showed that the major uncertainty contribution is due to statistical counting. The results also indicated that the uncertainty value of the combined standard uncertainty depends on the radioisotope measured and the decay time used for counting. (author)

  6. Antimony-Doped Tin Oxide Thin Films Grown by Home Made Spray Pyrolysis Technique

    Science.gov (United States)

    Yusuf, Gbadebo; Babatola, Babatunde Keji; Ishola, Abdulahi Dimeji; Awodugba, Ayodeji O.; Solar cell Collaboration

    2016-03-01

    Transparent conducting antimony-doped tin oxide (ATO) films have been deposited on glass substrates by home made spray pyrolysis technique. The structural, electrical and optical properties of the ATO films have been investigated as a function of Sb-doping level and annealing temperature. The optimum target composition for high conductivity and low resistivity was found to be 20 wt. % SnSb2 + 90 wt. ATO. Under optimized deposition conditions of 450oC annealing temperature, electrical resistivity of 5.2×10-4 Ω -cm, sheet resistance of 16.4 Ω/sq, average optical transmittance of 86% in the visible range, and average optical band-gap of 3.34eV were obtained. The film deposited at lower annealing temperature shows a relatively rough, loosely bound slightly porous surface morphology while the film deposited at higher annealing temperature shows uniformly distributed grains of greater size. Keywords: Annealing, Doping, Homemade spray pyrolysis, Tin oxide, Resistivity

  7. A density-functional study on the electronic and vibrational properties of layered antimony telluride

    Science.gov (United States)

    Stoffel, Ralf P.; Deringer, Volker L.; Simon, Ronnie E.; Hermann, Raphaël P.; Dronskowski, Richard

    2015-03-01

    We present a comprehensive survey of electronic and lattice-dynamical properties of crystalline antimony telluride (Sb2Te3). In a first step, the electronic structure and chemical bonding have been investigated, followed by calculations of the atomic force constants, phonon dispersion relationships and densities of states. Then, (macroscopic) physical properties of Sb2Te3 have been computed, namely, the atomic thermal displacement parameters, the Grüneisen parameter γ, the volume expansion of the lattice, and finally the bulk modulus B. We compare theoretical results from three popular and economic density-functional theory (DFT) approaches: the local density approximation (LDA), the generalized gradient approximation (GGA), and a posteriori dispersion corrections to the latter. Despite its simplicity, the LDA shows excellent performance for all properties investigated—including the Grüneisen parameter, which only the LDA is able to recover with confidence. In the absence of computationally more demanding hybrid DFT methods, the LDA seems to be a good choice for further lattice dynamical studies of Sb2Te3 and related layered telluride materials.

  8. miR-133a Enhances the Protective Capacity of Cardiac Progenitors Cells after Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Alberto Izarra

    2014-12-01

    Full Text Available miR-133a and miR-1 are known as muscle-specific microRNAs that are involved in cardiac development and pathophysiology. We have shown that both miR-1 and miR-133a are early and progressively upregulated during in vitro cardiac differentiation of adult cardiac progenitor cells (CPCs, but only miR-133a expression was enhanced under in vitro oxidative stress. miR-1 was demonstrated to favor differentiation of CPCs, whereas miR-133a overexpression protected CPCs against cell death, targeting, among others, the proapoptotic genes Bim and Bmf. miR-133a-CPCs clearly improved cardiac function in a rat myocardial infarction model by reducing fibrosis and hypertrophy and increasing vascularization and cardiomyocyte proliferation. The beneficial effects of miR-133a-CPCs seem to correlate with the upregulated expression of several relevant paracrine factors and the plausible cooperative secretion of miR-133a via exosomal transport. Finally, an in vitro heart muscle model confirmed the antiapoptotic effects of miR-133a-CPCs, favoring the structuration and contractile functionality of the artificial tissue.

  9. CD133 Expression in Normal Skin and in Epithelial Cutaneous Tumors

    Directory of Open Access Journals (Sweden)

    S. H. Nam-Cha

    2013-01-01

    Full Text Available Background. Expression of human CD133 (human prominin-1 in cancer cells has been postulated to be a marker of stemness and is considered as a putative marker of cancer stem cells (CSCs. We designed a study to describe the expression pattern of CD133 in normal skin and in epithelial cutaneous neoplasms. Methods. The CD133 immunohistochemical expression of forty-three eccrine and apocrine tumors was compared to that observed in other epithelial tumors of the skin. In addition, flow cytometry was used to detect the CD133 expression of four epithelial skin neoplasms, including one porocarcinoma. Results. CD133 immunoreactivity at the apical or at the apicolateral surface of cells forming glandular structures was observed. Cells from solid areas of benign or malignant tumors were not stained. The porocarcinoma derived culture cells showed a 22% of CD133 positive cells using flow cytometry, while squamous cell carcinoma cultures contained less than 0.1%. Conclusions. These observations indicate that CD133 is a specific marker of glandular differentiation that could be included in the diagnostic panel of cutaneous tumors with possible eccrine or apocrine differentiation. However, the use of CD133 expression as a marker of CSCs should be interpreted with caution in experiments of skin.

  10. 21 CFR 133.136 - Washed curd and soaked curd cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd and soaked curd cheese. 133.136... Standardized Cheese and Related Products § 133.136 Washed curd and soaked curd cheese. (a) Description. (1) Washed curd, soaked curd cheese is the food prepared by the procedure set forth in paragraph (a)(3)...

  11. 3-Bromopyruvate inhibits cell proliferation and induces apoptosis in CD133+ population in human glioma.

    Science.gov (United States)

    Xu, Dong-Qiang; Tan, Xiao-Yu; Zhang, Bao-Wei; Wu, Tao; Liu, Ping; Sun, Shao-Jun; Cao, Yin-Guang

    2016-03-01

    The study was aimed to investigate the role of 3-bromopyruvate in inhibition of CD133+ U87 human glioma cell population growth. The results demonstrated that 3-bromopyruvate inhibited the viability of both CD133+ and parental cells derived from U87 human glioma cell line. However, the 3-bromopyruvate-induced inhibition in viability was more prominent in CD133+ cells at 10 μM concentration after 48 h. Treatment of CD133+ cells with 3-bromopyruvate caused reduction in cell population and cell size, membrane bubbling, and degradation of cell membranes. Hoechst 33258 staining showed condensation of chromatin material and fragmentation of DNA in treated CD133+ cells after 48 h. 3-Bromopyruvate inhibited the migration rate of CD133+ cells significantly compared to the parental cells. Flow cytometry revealed that exposure of CD133+ cells to 3-bromopyruvate increased the cell population in S phase from 24.5 to 37.9 % with increase in time from 12 to 48 h. In addition, 3-bromopyruvate significantly enhanced the expression of Bax and cleaved caspase 3 in CD133+ cells compared to the parental cells. Therefore, 3-bromopyruvate is a potent chemotherapeutic agent for the treatment of glioma by targeting stem cells selectively. PMID:26453119

  12. miRNA-133a attenuates lipid accumulation via TR4-CD36 pathway in macrophages.

    Science.gov (United States)

    Peng, Xiao-Ping; Huang, Lei; Liu, Zhi-Hong

    2016-08-01

    lipid metabolism is the major causes of atherosclerosis. There is increasing evidence that miR-133a plays an important role in atherosclerosis. However, the regulatory mechanism of miR-133a in macrophages is still unclear. Several lines of evidence indicate that loss of TR4 leads to reduce lipid accumulation in liver and adipose tissues, etc, and lesional macrophages-derived TR4 can greatly increase the foam cell formation through increasing the CD36-mediated the uptake of ox-LDL. Interestingly, computational analysis suggests that TR4 may be a target gene of miR-133a. Here, we examined whether miR-133a regulates TR4 expression in ox-LDL-induced mouse RAW 264.7 macrophages, thereby affecting lipid accumulation. Using ox-LDL-treatment RAW 264.7 macrophages transfected with miR-133a mimics or inhibitors, we have showed that miR-133a can directly regulate the expression of TR4 in RAW 264.7 cells, thereby attenuates CD36-medide lipid accumulation. Furthermore, our studies suggest an additional explanation for the regulatory mechanism of miR-133a regulation to its functional target, TR4 in RAW 264.7 macrophages. Thus, our findings suggest that miR-133a may regulate lipid accumulation in ox-LDL-stimulated RAW 264.7 macrophages via TR4-CD36 pathway.

  13. Regional ventilation studies with Kr-81m and Xe-133: a comparative analysis

    International Nuclear Information System (INIS)

    Krypton-81m and Xe-133 ventilation scintigrams, and particulate perfusion scintigrams with Tc-99m, were obtained on the same day in 41 patients. Of 14 studies demonstrating pulmonary embolism, Kr-81m complemented the perfusion study better than Xe-133 in seven and was judged essential for that diagnosis in two. Xenon-133 was better in none. On the other hand, in 29 studies with obstructive or parenchymal lung disease, Kr-81m was essential for the diagnosis in only one of seven cases in which it was judged superior to Xe-133, whereas Xe-133 was essential in six of nine studies in which it was judged superior. Ventilation scintigraphy with Kr-81m offers important advantages over Xe-133 in the diagnosis of embolic lung disease due to its improved spatial resolution and capacity to provide superimposable ventilation and perfusion images in multiple projections, so that defects can be accurately matched. Obstructive pulmonary disease may be more easily diagnosed with Xe-133 ventilation images, because areas of gaseous retention, not visible with Kr-81m, can be seen on Xe-133 washout images

  14. 19 CFR 133.36 - Change in name of owner of recorded copyright.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Change in name of owner of recorded copyright. 133...; DEPARTMENT OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.36 Change in name of owner of recorded copyright. If there is a change in the name of the owner of a...

  15. 19 CFR 133.35 - Change of ownership of recorded copyright.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Change of ownership of recorded copyright. 133.35...; DEPARTMENT OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.35 Change of ownership of recorded copyright. (a) Application. If the ownership of a recorded copyright...

  16. CD133 identifies perivascular niches in grade II-IV astrocytomas

    DEFF Research Database (Denmark)

    Christensen, Karina; Schrøder, Henrik; Kristensen, Bjarne

    2008-01-01

    expression of CD133 in paraffin sections was analysed using morphometry. In all grades, CD133 was expressed on tumour and endothelial cells. Tumour cells were found in perivascular niches, as dispersed single cells and in pseudopalisade formations around necrosis. There was no correlation between the mean...

  17. 42 CFR 422.133 - Return to home skilled nursing facility.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Return to home skilled nursing facility. 422.133....133 Return to home skilled nursing facility. (a) General rule. MA plans must provide coverage of posthospital extended care services to Medicare enrollees through a home skilled nursing facility if...

  18. Compensation for geometric changes during monitoring of 133Xe washout from subcutaneous adipose tissue

    DEFF Research Database (Denmark)

    Bülow, J; Madsen, J

    1975-01-01

    A method is described for automatic compensation of changes in geometry during monitoring of 133Xe-washout curves from subcutaneous depots. A 99mTc source is placed on the skin over the 133Xe depot, and both isotopes are counted simultaneously. Variations in the 99mTc activity (corrected for radi...

  19. 21 CFR 133.170 - Pasteurized process cheese with fruits, vegetables, or meats.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese with fruits, vegetables, or meats. 133.170 Section 133.170 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH... dried vegetable; any properly prepared cooked or canned meat. (3) When the added fruits, vegetables,...

  20. 21 CFR 133.168 - Pasteurized blended cheese with fruits, vegetables, or meats.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized blended cheese with fruits, vegetables, or meats. 133.168 Section 133.168 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH... vegetable; any properly prepared cooked or canned meat. (3) When the added fruits, vegetables, or...

  1. MiR-133b ameliorates axon degeneration induced by MPP(+) via targeting RhoA.

    Science.gov (United States)

    Niu, M; Xu, R; Wang, J; Hou, B; Xie, A

    2016-06-14

    Increasing evidence suggests that microRNAs (miRs) play a significant role in the pathogenesis of Parkinson's disease (PD). MiR-133b, which is significantly decreased in the PD midbrain, has recently been shown to promote neurite outgrowth and enhance neural functional recovery. However, the role of miR-133b in PD has not been clearly established. Here, using a well-established PD model culture based on the neurotoxin 1-methyl-4-phenyl-pyridinium (MPP(+)), we demonstrated that miR-133b could promote axon outgrowth in dopaminergic neurons (DNs) and ameliorated MPP(+)-induced axon degeneration. Additional experiments suggested that the mechanisms of this miR-133b-mediated effect might rely on RhoA inhibition. We demonstrated that RhoA, an inhibitor of axonal growth, was increased in DNs under MPP(+) treatment, and this increase could be attenuated by miR-133b overexpression. Moreover, we demonstrated that the induced expression of miR-133b could inhibit α-synuclein, which is critically involved in the pathological process of PD. Furthermore, we found that overexpression of miR-133b abrogated the MPP(+)-induced decrease in the Bcl-2/Bax ratio and upregulated phosphorylated Akt (p-Akt), which is a pro-survival kinase. Together these findings reveal novel roles for miR-133b in the pathogenesis of PD and provide new therapeutic avenues for the treatment of the disease. PMID:27012608

  2. 21 CFR 133.161 - Muenster and munster cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Muenster and munster cheese for manufacturing. 133... Specific Standardized Cheese and Related Products § 133.161 Muenster and munster cheese for manufacturing. Muenster cheese for manufacturing conforms to the definition and standard of identity for muenster...

  3. Immiscibility in a Quantum Degenerate Mixture of $^{87}$Rb and $^{133}$Cs

    CERN Document Server

    McCarron, D J; Jenkin, D L; Köppinger, M P; Cornish, S L

    2011-01-01

    We report a new method for the production of Bose-Einstein condensates of $^{133}$Cs and demonstrate the formation of a quantum degenerate mixture of $^{87}$Rb and $^{133}$Cs. The approach exploits efficient sympathetic cooling of $^{133}$Cs via $^{87}$Rb in a magnetic quadrupole trap prior to further evaporative cooling in a levitated optical trap. Sacrificing all the $^{87}$Rb during the cooling, we create single species $^{133}$Cs condensates of up to $6\\times10^{4}$ atoms. Tailoring the evaporation to retain some $^{87}$Rb, we simultaneously create condensates of $^{87}$Rb and $^{133}$Cs in the same trapping potential, each containing up to $2\\times10^{4}$ atoms. We observe a striking phase separation of the two species revealing the mixture to be immiscible due to strong repulsive interspecies interactions.

  4. Implications of liver activity associated with 133Xe ventilation lung scans

    International Nuclear Information System (INIS)

    A series of 35 xenon-133 (133Xe) ventilation studies yielded nine cases demonstrating accumulation of activity in the liver. Maximum intrahepatic deposition of radioxenon occurred during the washout phase of the study. In addition to those clinical instances which make this phenomenon possible, i.e., obesity, alcoholic-induced liver steatosis and diabetes mellitus, we found that hyperlipidemia and coronary artery disease also favor xenon-133 localization into the hepatic parenchyma. It is concluded that the lipid avidity of 133Xe facilitates its liver accumulation hyperlipidemic patients and in patients with coronary artery disease, and that this action may be explored to further understand deranged metabolic pathways in the liver of these patients. Hepatic accumulation of 133Xe during ventilation studies must be considered when assessing regional ventilation/perfusion relationships

  5. Complementary single photon emission computed tomography of the brain: Xe-133 and iodoamphetamine

    International Nuclear Information System (INIS)

    Xe-133 and I-123 iodoamphetamin (IMP) emission computed tomography studies of 32 patients with neurologic (n = 7) or psychiatric (n = 25) diagnoses were used to determine whether the modalities yield complementary diagnostic information. The images, interpreted by two observers, differed in 15 (47%) cases. In schizophrenic patients, 11(61%) abnormalities were identified by Xe-133 imaging and 15(83%) by IMP. The abnormalities involved principally the frontal lobes and were identified in eight (73%) cases by Xe-133 imaging and in ten (67%) cases by IMP. In all four patients with arteriovenous malformations the imaging results were abnormal: Xe-133 showed increased flow while IMP revealed localized decreased activity in one patient. Imaging patterns for seizures, depression and psychoses also differed. Thus, Xe-133 and IMP appear complementary in their portrayal of brain function

  6. LOSS OF HETEROZYGOSITY ON CHROMOSOME 17p13.3 IN OVARIAN CANCER AND CERVICAL CANCER

    Institute of Scientific and Technical Information of China (English)

    Zhang Guoling; Yang Huijian; Xu Kaili; Zhou Jin; Qin Ruidi; Lu Minghua

    1998-01-01

    Objective:To identify the loss of heterozygosity (LOH) on chromosome 17p13.3 in ovarian cancer and cervical cancer. Methods: The frequency of LOH on chromosome 17p13.3 in DNA samples from 24 ovarian cancers, 9 cervical cancers, and 13 non-malignant gynecological diseases were determined respectively, using Southern blot method with probe PYNZ.22. Results:LOH on 17p13.3 was found in 12 of 24 (50.0%) ovarian cancers (including a borderline mucinous cystadenoma), 4of 9 (44.4%) cervical carcinomas, and 1 of 13 (7.7%) nonmalignant gynecological diseases, which was cervical intraepithelial neoplasm HI (CIN Ⅲ) (P<0.01).Conclusion: These results show that LOH on 17p13.3 is associated with ovarian cancer and cervical cancer,suggesting that detection of LOH on 17p13.3 may be helpful to understand the molecular pathogenesis of ovarian cancer and cervical cancer.

  7. Gold and Antimony Mixed Flotation on a Micrite Gold Antimony ore in Guizhou%贵州某泥晶灰岩型含锑金矿金锑混浮试验

    Institute of Scientific and Technical Information of China (English)

    石贵明; 周意超

    2015-01-01

    贵州某泥晶灰岩型含锑金矿石为块状构造,金属矿物主要为黄铁矿、针铁矿,含量小于1%,非金属矿物以方解石为主,另有少量石英、有机质等;金含量为6.04 g/t,显微镜下未见自然金粒,74.34%的金赋存在硫化矿中,游离金仅占总金的7.14%;硅酸盐、碳酸盐包裹金分别占11.96%和6.56%;锑主要以辉锑矿的形式存在。为高效、低成本回收矿石中的金、锑,对混合浮选工艺进行了试验研究。结果表明,在一段磨矿细度为-0.074 mm占71%的情况下1粗2扫混浮、尾矿再磨细度为-0.074 mm占92.7%的情况下再1粗2扫混浮、两粗精矿合并后3次精选、中矿顺序返回流程处理,最终获得了金品位为47.60 g/t、锑品位为9.81%、金回收率为76.68%、锑回收率为85.22%的金锑混合精矿,金锑混浮效果较理想。尾矿中金的回收及金锑分离工艺研究将另文介绍。%The micrite type antimony-containing gold ore in Guizhou is in blocky construction. Its metallic minerals are mainly pyrite and goethite,with content of less than 1%. Non-metallic minerals are calcite,and few of quartz,organic matter, etc. It contains gold of 6. 04 g/t,and natural gold grains were not seen in microscope,74. 34% of the gold occurred in sulfide ore,free gold accounted for only 7. 14%,wrapped gold in silicate and carbonate accounted for 11. 96% and 6. 56% respective-ly. Antimony mainly existed in the form of stibnite. Bulk flotation process was studied to make high efficient recovery of gold and antimony at low costs. The results indicated that,at the grinding fineness of 71% passing 0. 074 mm,through one roughing and two scavenging bulk flotation,one roughing and two scavenging bulk flotation after regrinding the tailings to 92. 7% passing 0. 074 mm,three cleaning flotation for the two mixed rough concentrate,and then middles back to the flow-sheet in turn,rough gold-antimony concentrate with gold grade of 47. 60 g

  8. Prognostic role of CD133 expression in colorectal cancer: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Wang Ke

    2012-12-01

    Full Text Available Abstract Background CD133 has been identified as a putative cancer stem cell marker in colorectal cancer (CRC. However, the clinical and prognostic significance of CD133 in CRC remains controversial. Methods Publications were identified which assessed the clinical or prognostic significance of CD133 in CRC up to October 2012. A meta-analysis was performed to clarify the association between CD133 expression and clinical outcomes. Results A total of 12 studies met the inclusion criteria, and comprised 3652 cases. Analysis of these data showed that CD133 was not significantly associated with the depth of CRC invasion (odds ratio [OR] = 1.44, 95% confidence interval [CI]: 0.77–2.68, Z = 1.15, P = 0.252 or tumor differentiation (OR = 0.63, 95% CI: 0.28–1.46, Z = −1.06, P = 0.286. Also, there was no statistically significant association of CD133 with lymph node metastasis (OR = 1.16, 95% CI: 0.87–1.54, Z = 1.05, P = 0.315 or lymphatic invasion (OR = 1.08, 95% CI: 0.81–1.43, Z = 0.53, P = 0.594. However, in identified studies, overexpression of CD133 was highly correlated with reduced overall survival (relative risk [RR] = 2.14, 95% CI: 1.45–3.17, Z = 3.81, P = 0.0001. Conclusions CD133 may play an important role in the progression of CRC, and overexpression of CD133 is closely related with poorer patient survival. If these findings are confirmed by well-designed prospective studies, CD133 may be a useful maker for clinical applications.

  9. Quantitative HPLC-ICP-MS analysis of antimony redox speciation in complex sample matrices: new insights into the Sb-chemistry causing poor chromatographic recoveries

    DEFF Research Database (Denmark)

    Hansen, Claus; Schmidt, Bjørn; Larsen, Erik Huusfeldt;

    2011-01-01

    In solution antimony exists either in the pentavalent or trivalent oxidation state. As Sb(III) is more toxic than Sb(V), it is important to be able to perform a quantitative speciation analysis of Sb’s oxidation state. The most commonly applied chromatographic methods used for this redox speciation...... analysis do, however, often show a low chromatographic Sb recovery when samples of environmental or biological origin are analysed. In this study we explored basal chemistry of antimony and found that formation of macromolecules, presumably oligomeric and polymeric Sb(V) species, is the primary cause...... of low chromatographic recoveries. A combination of HPLC-ICP-MS, AFFF-ICP-MS and spinfiltration was applied for analysis of model compounds and biological samples. Quantitative chromatographic Sb redox speciation analysis was possible by acidic hydrolysis of the antimony polymers prior to analysis...

  10. Specific recognition of arteriovenous malformations using xenon-133 RCBF technique

    International Nuclear Information System (INIS)

    With respect to the methodology of the atraumatic xenon-133 technique the problem whether or not the proposed and introduced arterial artifact (AA) truely represents radiation from intravascular volume and to what extent it affects regional cerebral blood flow (rCBF) calculation is unresolved. We performed rCBF measurements in 22 patients with angiomas to clarify this issue in those patients known to have pathologically enlarged intracranial vessels. P4 - the parameter suggested to represent the AA - as well as the conventional blood flow parameter for gray matter (F1) were compared to those of 50 volunteers using four criteria of abnormality: 1. Intrahemispheric distribution, 2. interhemispheric differences of homologous detector pairs, 3 differences of mean hemispheric values, 4. visual evaluation of CBF maps. 19 of the 22 patients with angioma fulfilled at least two of the four criteria of abnormality, in comparison to 1 of 50 volunteers. P 4's sensitivity for detecting angiomas proved to be higher (86%) than the perfusion parameters of gray matter. Focal increase of P4 proved to be highly specific for the presence of arteriovenous malformation (AVM, specifity 98%). A true arterial artifact exists in most instances in the presence of an AVM. Disregarding AA in the algorithm for calculation rCBF leads to an artificial overestimation of tissue flow in the region of the AVM

  11. STS-133/ET-137 Tanking Test Photogrammetry Assessment

    Science.gov (United States)

    Oliver, Stanley T.

    2012-01-01

    Following the launch scrub of Space Shuttle mission STS-133 on November 5, 2010, an anomalous condition of cracked and raised thermal protection system (TPS) foam was observed on the External Tank (ET). Subsequent dissection of the affected TPS region revealed cracks in the feet of two Intertank (IT) metallic stringers. An extensive investigation into the cause(s) and corrective action(s) for the cracked stringers was initiated, involving a wide array of material and structural tests and nondestructive evaluations, with the intent to culminate into the development of flight rational. One such structural test was the instrumented tanking test performed on December 17, 2010. The tanking test incorporated two three-dimensional optical displacement measurement systems to measure full-field outer surface displacements of the TPS surrounding the affected region that contained the stringer cracks. The results showed that the radial displacement and rotation of the liquid oxygen (LO2) tank flange changed significantly as the fluid level of the LO2 approached and passed the LO2 tank flange.

  12. Asteroid 2012 XE133, a transient companion to Venus

    CERN Document Server

    Marcos, C de la Fuente

    2013-01-01

    Apart from Mercury that has no known co-orbital companions, Venus remains as the inner planet that hosts the smallest number of known co-orbitals, 2: (322756) 2001 CK32 and 2002 VE68. Both objects have absolute magnitudes 18 < H < 21 and were identified as Venus co-orbitals in 2004. Here, we analyze the orbit of the recently discovered asteroid 2012 XE133 with H = 23.5 mag to conclude that it is a new Venus co-orbital currently following a transitional trajectory between Venus' Lagrangian points L5 and L3. The object could have been a 1:1 librator for several thousand years and it may leave the resonance with Venus within the next few hundred years, after a close encounter with the Earth. Our calculations show that its dynamical status as co-orbital, as well as that of the 2 previously known Venus co-orbitals, is controlled by the Earth-Moon system with Mercury playing a secondary role. The 3 temporary co-orbitals follow rather chaotic but similar trajectories with e-folding times of order of 100 yr. Ou...

  13. Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma

    Directory of Open Access Journals (Sweden)

    Lu Lizhi

    2006-12-01

    Full Text Available Abstract Background Recently, a small population of cancer stem cells in adult and pediatric brain tumors has been identified. Some evidence has suggested that CD133 is a marker for a subset of leukemia and glioblastoma cancer stem cells. Especially, CD133 positive cells isolated from human glioblastoma may initiate tumors and represent novel targets for therapeutics. The gene expression and the drug resistance property of CD133 positive cancer stem cells, however, are still unknown. Results In this study, by FACS analysis we determined the percentage of CD133 positive cells in three primary cultured cell lines established from glioblastoma patients 10.2%, 69.7% and 27.5%, respectively. We also determined the average mRNA levels of markers associated with neural precursors. For example, CD90, CD44, CXCR4, Nestin, Msi1 and MELK mRNA on CD133 positive cells increased to 15.6, 5.7, 337.8, 21.4, 84 and 1351 times, respectively, compared to autologous CD133 negative cells derived from cell line No. 66. Additionally, CD133 positive cells express higher levels of BCRP1 and MGMT mRNA, as well as higher mRNA levels of genes that inhibit apoptosis. Furthermore, CD133 positive cells were significantly resistant to chemotherapeutic agents including temozolomide, carboplatin, paclitaxel (Taxol and etoposide (VP16 compared to autologous CD133 negative cells. Finally, CD133 expression was significantly higher in recurrent GBM tissue obtained from five patients as compared to their respective newly diagnosed tumors. Conclusion Our study for the first time provided evidence that CD133 positive cancer stem cells display strong capability on tumor's resistance to chemotherapy. This resistance is probably contributed by the CD133 positive cell with higher expression of on BCRP1 and MGMT, as well as the anti-apoptosis protein and inhibitors of apoptosis protein families. Future treatment should target this small population of CD133 positive cancer stem cells in

  14. Minerogenetic Mechanism of the Songxi Silver—Antimony Deposit of Northeastern Guangdong—Ore—Controlling Role of Organic Matter

    Institute of Scientific and Technical Information of China (English)

    胡凯; 肖振宇; 等

    1999-01-01

    Organic geochemistry and comparisons of characteristics of the organic matter in wall rocks of the ore-controlling strata and ores of the Lower Jurassic Songling black shale formation and the related Songxi silver-antimony deposit of northeastern Guangdong have been studied in this paper.The results show that the Lower Jurassic Songling shale formation is a suite of biologic-rich and organic-rich ore-bearing marine sedimentary rocks.Micro-components of the organic matter in the Songling black shale formation consists primarily of algae,amorphous marine kerogen,solid bitument,and pyrobitument.The thermal evolution of organic matter is at the over-maturity stage.There is a general positive correlation between total organic carbon(CO)and metallogenetic elements such as Ag and Sb in the black shale formation.Organic matter in the host rocks in the Songxi ore deposit played a role in controlling the silver-antimony depositing environment during the forming process of the black shale ore-bearing formation.In the absence of vitrinite,the relative level of thermal maturity calculated by solid bitument reflectance indicates that the ore-forming temperatute of the Songxi silver-antimony deposit was about 150-170℃,which was considered as an epithermally reworked ore deposit.The roles of organic matter in the formation of the Sonxi ore deposit are a primitive accumulation of the metallogenetic elements(Ag,Sb) in the sea-water cycle system for ore source and a concentration of metals by ion exchange of chelation as well as reductionn of the oxidzed metals.

  15. Clinical and Parasitological Features of Patients with American Cutaneous Leishmaniasis that Did Not Respond to Treatment with Meglumine Antimoniate

    Science.gov (United States)

    Robayo, Marta L.; Lopez, Myriam C.; Daza, Carlos D.; Bedoya, Angela; Mariño, Maria L.; Saavedra, Carlos H.

    2016-01-01

    Background American cutaneous leishmaniasis (ACL) is a complicated disease producing about 67.000 new cases per year. The severity of the disease depends on the parasite species; however in the vast majority of cases species confirmation is not feasible. WHO suggestion for ACL produced by Leishmania braziliensis, as first line treatment, are pentavalent antimonial derivatives (Glucantime or Sodium Stibogluconate) under systemic administration. According to different authors, pentavalent antimonial derivatives as treatment for ACL show a healing rate of about 75% and reasons for treatment failure are not well known. Methods In order to characterise the clinical and parasitological features of patients with ACL that did not respond to Glucantime, a cross-sectional observational study was carried out in a cohort of 43 patients recruited in three of the Colombian Army National reference centers for complicated ACL. Clinical and paraclinical examination, and epidemiological and geographic information were recorded for each patient. Parasitological, histopathological and PCR infection confirmation were performed. Glucantime IC50 and in vitro infectivity for the isolated parasites were estimated. Results Predominant infecting Leishmania species corresponds to L. braziliensis (95.4%) and 35% of the parasites isolated showed a significant decrease in in vitro Glucanatime susceptibility associated with previous administration of the medicament. Lesion size and in vitro infectivity of the parasite are negatively correlated with decline in Glucantime susceptibility (Spearman: r = (-)0,548 and r = (-)0,726; respectively). Conclusion A negative correlation between lesion size and parasite resistance is documented. L. braziliensis was found as the main parasite species associated to lesion of patients that underwent treatment failure or relapse. The indication of a second round of treatment in therapeutic failure of ACL, produced by L. braziliensis, with pentavalent antimonial

  16. Cobalt doped antimony oxide nano-particles based chemical sensor and photo-catalyst for environmental pollutants

    Energy Technology Data Exchange (ETDEWEB)

    Jamal, Aslam [Centre for Advanced Materials and Nano-Engineering (CAMNE) and Department of Chemistry, Faculty of Sciences and Arts, Najran University, P. O. Box 1988, Najran 11001 (Saudi Arabia); Rahman, Mohammed M. [Center of Excellence for Advanced Materials Research (CEAMR), King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Chemistry Department, Faculty of Science, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Khan, Sher Bahadar, E-mail: drkhanmarwat@gmail.com [Center of Excellence for Advanced Materials Research (CEAMR), King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Chemistry Department, Faculty of Science, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Faisal, Mohd. [Centre for Advanced Materials and Nano-Engineering (CAMNE) and Department of Chemistry, Faculty of Sciences and Arts, Najran University, P. O. Box 1988, Najran 11001 (Saudi Arabia); Akhtar, Kalsoom [Division of Nano Sciences and Department of Chemistry, Ewha Womans University, Seoul 120-750 (Korea, Republic of); Rub, Malik Abdul; Asiri, Abdullah M.; Al-Youbi, Abdulrahman O. [Center of Excellence for Advanced Materials Research (CEAMR), King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Chemistry Department, Faculty of Science, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia)

    2012-11-15

    Graphical abstract: A dichloromethane chemical sensor using cobalt antimony oxides has been fabricated. This sensor showed high sensitivity and will be a useful candidate for environmental and health monitoring. Also it showed high photo-catalytic activity and can be a good candidate as a photo-catalyst for organic hazardous materials. Highlights: Black-Right-Pointing-Pointer Reusable chemical sensor. Black-Right-Pointing-Pointer Green environmental and eco-friendly chemi-sensor. Black-Right-Pointing-Pointer High sensitivity. Black-Right-Pointing-Pointer Good candidate for environmental and health monitoring. - Abstract: Cobalt doped antimony oxide nano-particles (NPs) have been synthesized by hydrothermal process and structurally characterized by utilizing X-ray diffraction (XRD), field emission scanning electron microscopy (FE-SEM) and Fourier transforms infrared spectrophotometer (FT-IR) which revealed that the synthesized cobalt antimony oxides (CoSb{sub 2}O{sub 6}) are well crystalline nano-particles with an average particles size of 26 {+-} 10 nm. UV-visible absorption spectra ({approx}286 nm) were used to investigate the optical properties of CoSb{sub 2}O{sub 6}. The chemical sensing of CoSb{sub 2}O{sub 6} NPs have been primarily investigated by I-V technique, where dichloromethane is used as a model compound. The analytical performance of dichloromethane chemical sensor exhibits high sensitivity (1.2432 {mu}A cm{sup -2} mM{sup -1}) and a large linear dynamic range (1.0 {mu}M-0.01 M) in short response time (10 s). The photo catalytic activity of the synthesized CoSb{sub 2}O{sub 6} nano-particles was evaluated by degradation of acridine orange (AO), which degraded 58.37% in 200 min. These results indicate that CoSb{sub 2}O{sub 6} nano-particles can play an excellent research impact in the environmental field.

  17. Comparative Efficacies of Two Antimony Regimens To Treat Leishmania braziliensis-Induced Cutaneous Leishmaniasis in Rhesus Macaques (Macaca mulatta)▿

    Science.gov (United States)

    Grimaldi, G.; Porrozzi, R.; Friedrich, K.; Teva, A.; Marchevsky, R. S.; Vieira, F.; Miekeley, N.; Paumgartten, F. J. R.

    2010-01-01

    This study compared the efficacies of two N-methylglucomine antimoniate (MA) dose regimens for treating macaques with Leishmania braziliensis-induced chronic skin disease. Whereas all animals treated with the full dose (20 mg MA/kg/day) were cured, 50% of the monkeys receiving a low-dose regimen (5 mg MA/kg/day) relapsed. The antimony concentrations in macaque plasma and tissue samples were greater in the full-dose group than in that receiving a subtherapeutic MA regimen. Our data also suggest the presence of drug-induced hepatic pathology. PMID:19822700

  18. Influence of antimony on the mechanical properties and gas content of alloy AlSi6Cu4

    OpenAIRE

    D. Medlen; D. Bolibruchova

    2011-01-01

    Aluminium alloys based on Al-Si are used in automotive and aerospace industries. AlSi6Cu4 alloy is used the complicated castings, whichmust comply high strength requirements. Strength characteristics can also be affected by the modifiers: Na, Sr, Sb. In the li terature ismentioned, that AlSi6Cu4 modified by sodium and strontium has negative effect - increases of the gas absorption. Modification of AlSi6Cu4 alloy by antimony, is still not mentioned in the literature. The article gives the effe...

  19. The influence of remelting on the properties of AlSi6Cu4 alloy modified by antimony

    Directory of Open Access Journals (Sweden)

    D. Medlen

    2012-01-01

    Full Text Available The paper deals with the problem of multiple remelting influence on AlSi6Cu4 alloy modified by antimony on chosen mechanical characteristics, microstructure and gas content. This foundry alloy is used mostly in automotive industry. Foundry Aluminum-Silicon alloys are also used in number of industrial weight sensitive applications because of their low weight and very good castability and good mechanical properties. Modifiers are usually added to molten aluminum-silicon alloys to refine the eutectic phase particle shape and improve the mechanical properties of the final cast products and Al-Si alloys cast properties.

  20. Flow analysis-hydride generation-gas phase derivative molecular absorption spectrophotometric determination of antimony in antileishmanial drugs

    Directory of Open Access Journals (Sweden)

    Máximo Gallignani

    2009-01-01

    Full Text Available In the present work, the development of a method based on the coupling of flow analysis (FA, hydride generation (HG, and derivative molecular absorption spectrophotometry (D-EAM in gas phase (GP, is described in order to determine total antimony in antileishmanial products. Second derivative order (D²224nm of the absorption spectrum (190 - 300 nm is utilized as measurement criterion. Each one of the parameters involved in the development of the proposed method was examined and optimized. The utilization of the EAM in GP as detection system in a continuous mode instead of atomic absorption spectrometry represents the great potential of the analytic proposal.

  1. The CD133+ cell as advanced medicinal product for myocardial and limb ischemia.

    Science.gov (United States)

    Bongiovanni, Dario; Bassetti, Beatrice; Gambini, Elisa; Gaipa, Giuseppe; Frati, Giacomo; Achilli, Felice; Scacciatella, Paolo; Carbucicchio, Corrado; Pompilio, Giulio

    2014-10-15

    Ischemic diseases are the major cause of death and morbidity in Western countries. In the last decade, cell therapy has been suggested to be a promising treatment both in acute/chronic myocardial and peripheral ischemia. Different cell lineages have been tested, including endothelial progenitor cells. A subpopulation of bone marrow-derived immature ECPs, expressing the highly conserved stem cell glycoprotein antigen prominin-1 or CD133 marker, was shown to possess pro-angiogenic and antiapoptotic effects on ischemic tissues. The mechanisms implicated in CD133+ cells ability to contribute to neovascularization processes have been attributed to their ability to directly differentiate into newly forming vessels and to indirectly activate pro-angiogenic signaling by paracrine mechanisms. A large body of in vivo experimental evidences has demonstrated the potential of CD133+ cells to reverse ischemia. Moreover, several clinical trials have reported promising beneficial effects after infusion of autologous CD133+ into ischemic heart and limbs exploiting various delivery strategies. These trials have contributed to characterize the CD133+ manufacturing process as an advanced cell product (AMP). The aim of this review is to summarize available experimental and clinical data on CD133+ cells in the context of myocardial and peripheral ischemia, and to focus on the development of the CD133+ cell as an anti-ischemic AMP.

  2. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    Directory of Open Access Journals (Sweden)

    Nikola Arsic

    2015-04-01

    Full Text Available Cancer stem cells (CSC are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform.

  3. Activating β-catenin signaling in CD133-positive dermal papilla cells increases hair inductivity.

    Science.gov (United States)

    Zhou, Linli; Yang, Kun; Xu, Mingang; Andl, Thomas; Millar, Sarah E; Boyce, Steven; Zhang, Yuhang

    2016-08-01

    Bioengineering hair follicles using cells isolated from human tissue remains a difficult task. Dermal papilla (DP) cells are known to guide the growth and cycling activities of hair follicles by interacting with keratinocytes. However, DP cells quickly lose their inductivity during in vitro passaging. Rodent DP cell cultures need external addition of growth factors, including WNT and BMP molecules, to maintain the hair inductive property. CD133 is expressed by a subpopulation of DP cells that are capable of inducing hair follicle formation in vivo. We report here that expression of a stabilized form of β-catenin promoted clonal growth of CD133-positive (CD133+) DP cells in in vitro three-dimensional hydrogel culture while maintaining expression of DP markers, including alkaline phosphatase (AP), CD133, and integrin α8. After a 2-week in vitro culture, cultured CD133+ DP cells with up-regulated β-catenin activity led to an accelerated in vivo hair growth in reconstituted skin compared to control cells. Further analysis showed that matrix cell proliferation and differentiation were significantly promoted in hair follicles when β-catenin signaling was up-regulated in CD133+ DP cells. Our data highlight an important role for β-catenin signaling in promoting the inductive capability of CD133+ DP cells for in vitro expansion and in vivo hair follicle regeneration, which could potentially be applied to cultured human DP cells. PMID:27312243

  4. Effect of external energy on atomic, crystalline and powder characteristics of antimony and bismuth powders

    Indian Academy of Sciences (India)

    Vikram V Dabhade; Rama Mohan R Tallapragada; Mahendra Kumar Trivedi

    2009-10-01

    Next to atoms and molecules the powders are the smallest state of matter available in high purities and large quantities. The effect of any external energy on the shape, morphology and structure can thus be studied with relative ease. The present investigation deals with the effect of a non-contact external energy on the powders of antimony and bismuth. The characteristics of powders treated by external energy are compared with the as received powders (control). The average particle sizes, 50 and 99, the sizes below which 99% of the particles are present showed significant increase and decrease indicating that the energy had caused deformation and fracture as if the powders have been subjected to high energy milling. To be able to understand the reasons for these changes the powders are characterized by techniques such as X-ray diffraction (XRD), surface area determination (BET), thermal analytical techniques such as DTA–DTG, DSC–TGA and SDTA and scanning electron microscopy (SEM). The treated powder samples exhibited remarkable changes in the powder characteristics at all structural levels starting from polycrystalline particles, through single crystal to atoms. The external energy had changed the lattice parameters of the unit cell which in turn changed the crystallite size and density. The lattice parameters are then used to compute the weight and effective nuclear charge of the atom which showed significant variation. It is speculated that the external energy is acting on the nucleus through some reversible weak interaction of larger cross section causing changes in the proton to neutron ratios. Thus the effect is felt by all the atoms, and hence the unit cell, single crystal grain and grain boundaries. The stresses generated in turn may have caused deformation or fracture of the weak interfaces such as the crystallite and grain boundaries.

  5. Contamination of bottled waters with antimony leaching from polyethylene terephthalate (PET) increases upon storage.

    Science.gov (United States)

    Shotyk, William; Krachler, Michael

    2007-03-01

    Antimony concentrations were determined in 132 brands of bottled water from 28 countries. Two of the brands were at or above the maximum allowable Sb concentration for drinking water in Japan (2 microg/L). Elevated concentrations of Sb in bottled waters are due mainly to the Sb2O3 used as the catalyst in the manufacture of polyethylene terephthalate (PET(E)). The leaching of Sb from PET(E) bottles shows variable reactivity. In 14 brands of bottled water from Canada, Sb concentrations increased on average 19% during 6 months storage at room temperature, but 48 brands of water from 11 European countries increased on average 90% under identical conditions. A mineral water from France in PET(E), purchased in Germany, yielded 725 ng/L when first tested, but 1510 ng/L when it was stored for 6 months at room temperature; the same brand of water, purchased in Hong Kong, yielded 1990 ng/L Sb. Pristine groundwater containing 1.7+/-0.4 ng/L Sb (n = 6) yielded 26.6+/-2.3 ng/L Sb (n = 3) after storage in PET(E) bottles from Canada for 6 months versus 281+/-38 ng/L Sb (n = 3) in PET(E) bottles from Germany. Tap water bottled commercially in PET(E) in December 2005 contained 450+/-56 ng/L Sb (n = 3) versus 70.3+/-0.3 ng/L Sb (n = 3) when sampled from a household faucet in the same village (Bammental, Germany), and 25.7+/-1.5 ng/L Sb (n = 3) from a local artesian flow. PMID:17396641

  6. Uptake, translocation and transformation of antimony in rice (Oryza sativa L.) seedlings.

    Science.gov (United States)

    Cai, Fei; Ren, Jinghua; Tao, Shu; Wang, Xilong

    2016-02-01

    Antimony (Sb), as a toxic metalloid, has been gaining increasing research concerns due mainly to its severe pollution in many places. Rice has been identified to be the dominant intake route of Sb by residents close to the Sb mining areas. A hydroponic experiment was conducted to investigate the difference in uptake, translocation and transformation of Sb in rice seedlings of four cultivars exposed to 0.2 or 1.0 mg/L of Sb(V). The results showed that mass concentration of iron plaque (mg/kg FW) formed at the root surfaces of cultivar N was the highest among all tested cultivars at both low and high exposure levels of Sb(V). The accumulated Sb concentration in iron plaque significantly increased with an increase in mass concentration of iron plaque formed at the rice root. The total amount of iron plaque (mg/pot) at rice root generally increased with increasing exposed Sb(V) concentration, which was closely associated with the increasing lipid peroxidation in roots. Concentration percentage of Sb in rice root significantly reduced as the corresponding value in the iron plaque increased, suggesting that iron plaque formation strongly suppressed uptake of Sb by rice root. Sb concentration in rice tissues followed an order: root > stem, leaf. The japonica rice (cultivars N and Z) exhibited a stronger translocation tendency of Sb from root to stem than indica hybrid rice (cultivars F and G). Translocation of Sb from root of cultivar F to its stem and leaf was sharply enhanced with increasing Sb exposure concentration. Sb(V) could be reduced to Sb(III) in rice tissues, especially in stems (10-26% of the total Sb). For the sake of food safety, the difference in uptake, translocation and transformation of Sb in rice species planted in Sb-contaminated soils should be taken into consideration.

  7. Association of drinking-water source and use characteristics with urinary antimony concentrations.

    Science.gov (United States)

    Makris, Konstantinos C; Andra, Syam S; Herrick, Lisa; Christophi, Costas A; Snyder, Shane A; Hauser, Russ

    2013-03-01

    Environmental factors, such as storage time, frequency of bottle reuse and temperature, have been shown to facilitate antimony (Sb) leaching from water- and food-packaging materials. The globally escalating consumption of water packaged in Sb-containing bottles, such as that of polyethylene terephthalate (PET), could increase human daily Sb doses. This study set out to investigate the relationship between drinking-water source, use characteristics, and urinary Sb concentrations (U-Sb) accompanied with survey responses of a healthy (n=35) Cypriot participant pool. One spot urine sample was collected during administration of questionnaire, while a second spot urine sample was collected from the same individual about 7 days later. Urinary and water Sb concentrations were measured with an inductively coupled plasma mass spectrometer. Survey responses showed that bottled water summed over various volumes and plastic types, such as polycarbonate and PET contributed to an average 61% of daily water consumption. Water sources such as tap, mobile stations (explained in a following section), and well water contributed to 24%, 14%, and 2% of an individual's daily water consumption pattern, respectively. Average daily potable water use of both bottled and tap water by individuals consisted of 65% drinking-water, while the remaining 35% was water used for preparing cold and hot beverages, such as, tea, coffee, and juices. A significant (P=0.02) association between per capita water consumption from PET bottles and urinary creatinine-unadjusted concentrations was observed, but this relationship did not remain after inclusion of covariates in a multivariate regression model. In the creatinine-adjusted regression model, only gender (female) was a significant (P<0.01) predictor of U-Sb, after adjusting for several covariates. It is proposed that consumption data collection on various water uses and sources among individuals could perhaps decrease the uncertainty associated with

  8. Effects of Residual Elements Arsenic, Antimony, and Tin on Surface Hot Shortness

    Science.gov (United States)

    Yin, Lan; Sridhar, Seetharaman

    2011-10-01

    Scrap-based electric arc furnace (EAF) steelmaking is limited by a surface cracking problem in the recycled steel products, which is known as surface hot shortness. This problem originates from the excessive amount of copper (Cu) in the steel scrap, which enriches during the oxidation of iron (Fe) and consequently melts and penetrates into the austenite grain boundaries. In this article, the effects of arsenic (As), antimony (Sb), and tin (Sn) on surface hot shortness were investigated. A series of Fe-0.3 wt pct Cu- x wt pct (As, Sb, or Sn) alloys with x content ranging from 0.06 to 0.10 wt pct was oxidized in air at 1423 K (1150 °C) for 60, 300, and 600 seconds inside the chamber of a thermogravimety analyzer (TGA) where heat is supplied through infrared radiation. Scanning electron microscopy (SEM) investigations show that (1) the presence of Sb and Sn results in severe grain boundary cracking, whereas the presence of As does not, (2) open cracks with Fe oxides were found beneath the oxide/metal interface in the Sb and Sn alloys, and (3) the oxide/metal interfaces for all As, Sb, and Sn alloys are planar. Penetration experiments of pure Cu and Cu-30 wt pct Sn liquid were also conducted in the chamber of a hot-stage confocal laser scanning microscopy (CLSM) in nonoxidizing atmosphere: (1) on the Fe-35 wt pct manganese (Mn) alloys to study the correlation between cracking and grain boundary characters, and (2) on the pure Fe substrates to exclude the bulk segregation effects of Sn on grain boundary cracking. It was found that grain boundary cracking rarely took place on low-energy grain boundaries. The results also suggest that the bulk segregation of Sn in the substrate is not necessary to promote significant grain boundary cracking, and as long as the liquid phase contains Sn, it will be highly embrittling.

  9. Green and red fluorescence upconversion in neodymium-doped low phonon antimony glasses

    International Nuclear Information System (INIS)

    A new K2O-B2O3-Sb2O3 (KBS) glass system having low phonon energy (about 600 cm-1) doped with Nd3+ ions has been developed. Infrared reflection spectroscopic (IRRS) studies have been employed to establish its low phonon energy. Ultraviolet-visible-near infrared (UV-vis-NIR) absorption and photoluminescence upconversion properties with special emphasis on the spectrochemistry of the 15K2O-15B2O3-70Sb2O3 (mol%) glass have been studied doping with different concentrations (0.1-1.0 wt%) of Nd2O3. UV-vis-NIR absorption band positions have been justified with quantitative calculation of nephelauxetic parameter and covalent bonding characteristics of the host. NIR to visible upconversion has been investigated by exciting at 805 nm at room temperature. Two upconverted bands originating from the 4G7/2 → 4I9/2 and 4G7/2 → 4I13/2 transitions are found to be centered at 540 nm (green, medium) and 650 nm (red, strong), respectively. These bands have been explained from the evaluation of the absorption and excitation spectra. The upconversion processes have been explained by the excited state absorption (ESA), energy transfer (ET), cooperative energy transfer (CET) and cross-relaxation (CR) mechanisms involving population of the metastable (storage) energy level (4G7/2) by effects of multiphonon deexcitation and thermal population. It is evident from the IRRS study that the upconversion phenomena are expedited by the low multiphonon relaxation rate in antimony glasses owing to their low phonon energy (602 cm-1, the main and highest intensity Sb-O-Sb stretching band) which is very close to that of fluoride glasses (500-600 cm-1).

  10. EPR, optical absorption and luminescence studies of Cr3+-doped antimony phosphate glasses

    Science.gov (United States)

    De Vicente, F. S.; Santos, F. A.; Simões, B. S.; Dias, S. T.; Siu Li, M.

    2014-12-01

    Antimony phosphate glasses (SbPO) doped with 3 and 6 mol% of Cr3+ were studied by Electron Paramagnetic Resonance (EPR), UV-VIS optical absorption and luminescence spectroscopy. The EPR spectra of Cr3+-doped glasses showed two principal resonance signals with effective g values at g = 5.11 and g = 1.97. UV-VIS optical absorption spectra of SbPO:Cr3+ presented four characteristics bands at 457, 641, 675, and 705 nm related to the transitions from 4A2(F) to 4T1(F), 4T2(F), 2T1(G), and 2E(G), respectively, of Cr3+ ions in octahedral symmetry. Optical absorption spectra of SbPO:Cr3+ allowed evaluating the crystalline field Dq, Racah parameters (B and C) and Dq/B. The calculated value of Dq/B = 2.48 indicates that Cr3+ ions in SbPO glasses are in strong ligand field sites. The optical band gap for SbPO and SbPO:Cr3+ were evaluated from the UV optical absorption edges. Luminescence measurements of pure and Cr3+-doped glasses excited with 350 nm revealed weak emission bands from 400 to 600 nm due to the 3P1 → 1S0 electronic transition from Sb3+ ions. Cr3+-doped glasses excited with 415 nm presented Cr3+ characteristic luminescence spectra composed by two broad bands, one band centered at 645 nm (2E → 4A2) and another intense band from 700 to 850 nm (4T2 → 4A2).

  11. Metagenomic approach reveals variation of microbes with arsenic and antimony metabolism genes from highly contaminated soil.

    Directory of Open Access Journals (Sweden)

    Jinming Luo

    Full Text Available Microbes have great potential for arsenic (As and antimony (Sb bioremediation in heavily contaminated soil because they have the ability to biotransform As and Sb to species that have less toxicity or are more easily removed. In this study, we integrated a metagenomic method with physicochemical characterization to elucidate the composition of microbial community and functional genes (related to As and Sb in a high As (range from 34.11 to 821.23 mg kg-1 and Sb (range from 226.67 to 3923.07 mg kg-1 contaminated mine field. Metagenomic analysis revealed that microbes from 18 phyla were present in the 5 samples of soil contaminated with high As and Sb. Moreover, redundancy analysis (RDA of the relationship between the 18 phyla and the concentration of As and Sb demonstrated that 5 phyla of microbes, i.e. Actinobacteria, Firmicutes, Nitrospirae, Tenericutes and Gemmatimonadetes were positively correlated with As and Sb concentration. The distribution, diversity and abundance of functional genes (including arsC, arrA, aioA, arsB and ACR3 were much higher for the samples containing higher As and Sb concentrations. Based on correlation analysis, the results showed a positive relationship between arsC-like (R2 = 0.871 and aioA-like (R2 = 0.675 gene abundance and As concentration, and indicated that intracellular As(V reduction and As(III oxidation could be the dominant As detoxification mechanism enabling the microbes to survive in the environment. This study provides a direct and reliable reference on the diversity of microbial community and functional genes in an extremely high concentration As- and Sb-contaminated environment.

  12. MicroRNA-133a Inhibits Osteosarcoma Cells Proliferation and Invasion via Targeting IGF-1R

    Directory of Open Access Journals (Sweden)

    Guangnan Chen

    2016-02-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs are a class of small noncoding RNAs that regulate gene expression by repressing translation or cleaving RNA transcripts in a sequence-specific manner. Downregulated microRNAs and their roles in cancer development have attracted much attention. A growing body of evidence showed that microRNA-133a (miR-133a has inhibitory effects on cell proliferation, migration, invasion, and metastasis of osteosarcoma. Methods: MiR-133a expression in human osteosarcoma cell lines and human normal osteoblastic cell line hFOB was investigated by real-time PCR (RT-PCR. The role of miR-133a in human osteosarcoma growth and invasion was assessed in cell lines in vitro and in vivo. Then, luciferase reporter assay validated IGF-1R as a downstream and functional target of miR-133a, and functional studies revealed that the anti-tumor effect of miR-133a was probably due to targeting and repressing of IGF-1R expression. Results: MiR-133a was lower expressed in human osteosarcoma cell lines than human normal osteoblastic cell line hFOB and its effect on inhibiting proliferation, invasion and metastasis is mediated by its direct interaction with the IGF-1R. Furthermore, the tumour-suppressive function of miR-133a probably contributed to inhibiting the activation AKT and ERK signaling pathway. Conclusion: MiR-133a suppresses osteosarcoma progression and metastasis by targeting IGF-1R in human osteosarcoma cells, providing a novel candidate prognostic factor and a potential anti-metastasis therapeutic target in osteosarcoma.

  13. The Brain Microenvironment Preferentially Enhances the Radioresistance of CD133+ Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Muhammad Jamal

    2012-02-01

    Full Text Available Brain tumor xenografts initiated from glioblastoma (GBM CD133+ tumor stem-like cells (TSCs are composed of TSC and non-TSC subpopulations, simulating the phenotypic heterogeneity of GBMs in situ. Given that the discrepancies between the radiosensitivity of GBM cells in vitro and the treatment response of patients suggest a role for the microenvironment in GBM radioresistance, we compared the response of TSCs and non-TSCs irradiated under in vitro and orthotopic conditions. As a measure of radioresponse determined at the individual cell level, γH2AX and 53BP1 foci were quantified in CD133+ cells and their differentiated (CD133- progeny. Under in vitro conditions, no difference was detected between CD133+ and CD133- cells in foci induction or dispersal after irradiation. However, irradiation of orthotopic xenografts initiated from TSCs resulted in the induction of fewer γH2AX and 53BP1 foci in CD133+ cells compared to their CD133- counterparts within the same tumor. Xenograft irradiation resulted in a tumor growth delay of approximately 7 days with a corresponding increase in the percentage of CD133+ cells at 7 days after radiation, which persisted to the onset of neurologic symptoms. These results suggest that, although the radioresponse of TSCs and non-TSCs does not differ under in vitro growth conditions, CD133+ cells are relatively radioresistant under intracerebral growth conditions. Whereas these findings are consistent with the suspected role for TSCs as a determinant of GBM radioresistance, these data also illustrate the dependence of the cellular radioresistance on the brain microenvironment.

  14. Comparison of 99mTc-Technegas SPECT with 133Xe dynamic SPECT in pulmonary emphysema

    International Nuclear Information System (INIS)

    This study was undertaken to compare axial images of 99mTc-Technegas SPECT (Technegas) with those of 133Xe gas dynamic SPECT in patients with pulmonary emphysema. There were 20 patients, 19 males and 1 female. All patients except one ex-smoker were heavy smokers with a mean age of 68.1 years. For Technegas scintigraphy, the patients inhaled 505 MBq 99mTc-Technegas in several tidal volume breaths in the supine position without breath holding. For 133Xe gas scintigraphy, the patients inhaled 370 MBq 133Xe gas. 133Xe gas dynamic SPECT was performed in the equilibrium phase for the last minute of the 3 minute inhalation in a closed circuit, and in the washout phase for 6 minutes of inhalation in a semi-closed circuit, by means of a gamma camera with dual detectors (Picker model Prism 2000). Abnormal findings included heterogeneity, defects and hot spots on Technegas images and on retention images taken 3 minutes after 133Xe gas washout. In 2 of 20 patients, the degree of abnormal findings on Technegas images depended on the area of 133Xe gas retention in the washout phase. In 3 patients, the degrees of abnormal findings on both Technegas SPECT and 133Xe gas dynamic SPECT images were equivalent. In the remaining 15 patients, more detailed findings and a greater area were shown by Technegas SPECT than 133Xe gas dynamic SPECT. We conclude that in patients with pulmonary emphysema Technegas SPECT can demonstrate ventilation impairment more easily than 133Xe gas dynamic SPECT. (author)

  15. 19 CFR 133.27 - Civil fines for those involved in the importation of merchandise bearing a counterfeit mark.

    Science.gov (United States)

    2010-04-01

    ... of merchandise bearing a counterfeit mark. 133.27 Section 133.27 Customs Duties U.S. CUSTOMS AND..., AND COPYRIGHTS Importations Bearing Registered and/or Recorded Trademarks or Recorded Trade Names § 133.27 Civil fines for those involved in the importation of merchandise bearing a counterfeit mark....

  16. Xe-133 recuperation by adsorption in active carbon impregnated with PF5

    International Nuclear Information System (INIS)

    Since the Mo-99 Fission Project has the aim to produce Xe-133 from gases generated in the alkaline dissolution of Al-U plates irradiated with thermal neutrons and, considering the importance of this radioisotope from the nuclear medicine point of view, studies to improve and optimize the Xe-133 recuperation were continued. Experiences were made on 'static' equilibrium employing high purity xenon and for the 'dynamic' case, Xe-133 mixed with a carrier and nitrogen as gas carrier; in this case, a 44% and a 34% increase in the capacity of xenon adsorption relaxed with activated carbon without being impregnated and impregnated with AgF, were respectively achieved. (Author)

  17. Dual-species Bose-Einstein condensate of Rb87 and Cs133

    Science.gov (United States)

    McCarron, D. J.; Cho, H. W.; Jenkin, D. L.; Köppinger, M. P.; Cornish, S. L.

    2011-07-01

    We report the formation of a dual-species Bose-Einstein condensate of Rb87 and Cs133 in the same trapping potential. Our method exploits the efficient sympathetic cooling of Cs133 via elastic collisions with Rb87, initially in a magnetic quadrupole trap and subsequently in a levitated optical trap. The two condensates each contain up to 2×104 atoms and exhibit a striking phase separation, revealing the mixture to be immiscible due to strong repulsive interspecies interactions. Sacrificing all the Rb87 during the cooling, we create single-species Cs133 condensates of up to 6×104 atoms.

  18. Metrological activity determination of {sup 133}Ba by sum-peak absolute method

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.L. da; Delgado, J.U.; Poledna, R.; Santos, A.; Veras, E.V. de; Rangel, J.; Trindade, O.L. [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Almeida, M.C.M. de, E-mail: marcandida@yahoo.com.br, E-mail: candida@cnen.gov.br [Comissao Nacional de Energia Nuclear (CNEN), Rio de Janeiro, RJ (Brazil)

    2015-07-01

    The National Laboratory for Metrology of Ionizing Radiation provides gamma sources of radionuclide and standardized in activity with reduced uncertainties. Relative methods require standards to determine the sample activity while the absolute methods, as sum-peak, not. The activity is obtained directly with good accuracy and low uncertainties. {sup 133}Ba is used in research laboratories and on calibration of detectors for analysis in different work areas. Classical absolute methods do not calibrate {sup 133}Ba due to its complex decay scheme. The sum-peak method using gamma spectrometry with germanium detector standardizes {sup 133}Ba samples. Uncertainties lower than 1% to activity results were obtained.

  19. Metrological activity determination of 133Ba by sum-peak absolute method

    Science.gov (United States)

    da Silva, R. L.; de Almeida, M. C. M.; Delgado, J. U.; Poledna, R.; Santos, A.; de Veras, E. V.; Rangel, J.; Trindade, O. L.

    2016-07-01

    The National Laboratory for Metrology of Ionizing Radiation provides gamma sources of radionuclide and standardized in activity with reduced uncertainties. Relative methods require standards to determine the sample activity while the absolute methods, as sum-peak, not. The activity is obtained directly with good accuracy and low uncertainties. 133Ba is used in research laboratories and on calibration of detectors for analysis in different work areas. Classical absolute methods don't calibrate 133Ba due to its complex decay scheme. The sum-peak method using gamma spectrometry with germanium detector standardizes 133Ba samples. Uncertainties lower than 1% to activity results were obtained.

  20. 15q13.3 microdeletions increase risk of idiopathic generalized epilepsy

    DEFF Research Database (Denmark)

    Helbig, Ingo; Mefford, Heather C; Sharp, Andrew J;

    2009-01-01

    We identified 15q13.3 microdeletions encompassing the CHRNA7 gene in 12 of 1,223 individuals with idiopathic generalized epilepsy (IGE), which were not detected in 3,699 controls (joint P = 5.32 x 10(-8)). Most deletion carriers showed common IGE syndromes without other features previously...... associated with 15q13.3 microdeletions, such as intellectual disability, autism or schizophrenia. Our results indicate that 15q13.3 microdeletions constitute the most prevalent risk factor for common epilepsies identified to date....

  1. Oct-4 expression maintained cancer stem-like properties in lung cancer-derived CD133-positive cells.

    Directory of Open Access Journals (Sweden)

    Yu-Chih Chen

    Full Text Available CD133 (prominin-1, a 5-transmembrane glycoprotein, has recently been considered to be an important marker that represents the subset population of cancer stem-like cells. Herein we report the isolation of CD133-positive cells (LC-CD133(+ and CD133-negative cells (LC-CD133(- from tissue samples of ten patients with non-small cell lung cancer (LC and five LC cell lines. LC-CD133(+ displayed higher Oct-4 expressions with the ability to self-renew and may represent a reservoir with proliferative potential for generating lung cancer cells. Furthermore, LC-CD133(+, unlike LC-CD133(-, highly co-expressed the multiple drug-resistant marker ABCG2 and showed significant resistance to chemotherapy agents (i.e., cisplatin, etoposide, doxorubicin, and paclitaxel and radiotherapy. The treatment of Oct-4 siRNA with lentiviral vector can specifically block the capability of LC-CD133(+ to form spheres and can further facilitate LC-CD133(+ to differentiate into LC-CD133(-. In addition, knock-down of Oct-4 expression in LC-CD133(+ can significantly inhibit the abilities of tumor invasion and colony formation, and increase apoptotic activities of caspase 3 and poly (ADP-ribose polymerase (PARP. Finally, in vitro and in vivo studies further confirm that the treatment effect of chemoradiotherapy for LC-CD133(+ can be improved by the treatment of Oct-4 siRNA. In conclusion, we demonstrated that Oct-4 expression plays a crucial role in maintaining the self-renewing, cancer stem-like, and chemoradioresistant properties of LC-CD133(+. Future research is warranted regarding the up-regulated expression of Oct-4 in LC-CD133(+ and malignant lung cancer.

  2. Nutritional status in patients with cutaneous leishmaniasis and a study of the effects of zinc supplementation together with antimony treatment

    Directory of Open Access Journals (Sweden)

    Miguel Guzman-Rivero

    2014-11-01

    Full Text Available Background: The role of micronutrient status for the incidence and clinical course of cutaneous leishmaniasis is not much studied. Still zinc supplementation in leishmaniasis has shown some effect on the clinical recovery, but the evidence in humans is limited. Objective: To compare biochemical nutritional status in cutaneous leishmaniasis patients with that in controls and to study the effects of zinc supplementation for 60 days. Design: Twenty-nine patients with cutaneous leishmaniasis were treated with antimony for 20 days. Fourteen of them got 45 mg zinc daily and 15 of them got placebo. Biomarkers of nutritional and inflammatory status and changes in size and characteristics of skin lesions were measured. Results: The level of transferrin receptor was higher in patients than in controls but otherwise no differences in nutritional status were found between patients and controls. No significant effects of zinc supplementation on the clinical recovery were observed as assessed by lesion area reduction and characteristics or on biochemical parameters. Conclusions: It is concluded that nutritional status was essentially unaffected in cutaneous leishmaniasis and that oral zinc supplementation administered together with intramuscular injection of antimony had no additional clinical benefit.

  3. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  4. Complement activation-related pseudoallergy in dogs following intravenous administration of a liposomal formulation of meglumine antimoniate

    Directory of Open Access Journals (Sweden)

    Raul R. Ribeiro

    2013-08-01

    Full Text Available The increasing use of nanotechnologies in advanced therapies has allowed the observation of specific adverse reactions related to nanostructures. The toxicity of a novel liposome formulation of meglumine antimoniate in dogs with visceral leishmaniasis after single dose has been investigated. Groups of 12 animals received by the intravenous route a single dose of liposomal meglumine antimoniate (group I [GI], 6.5 mg Sb/kg, empty liposomes (GII or isotonic saline (GIII. Evaluation of hematological and biochemical parameters showed no significant changes 4 days after administration. No undesired effects were registered in the GIII. However, adverse reactions were observed in 67.7% of dogs from both groups that received liposomal formulations. The side effects began moments after bolus administration and disappeared during the first 15 minutes after treatment. Prostation, sialorrhea and defecation were the most frequent clinical signs, registered in 33.3% and 41.6 % of animals from the groups GI and GII, respectively. Tachypnea, mydriasis, miosis, vomiting and cyanosis were also registered in both groups. The adverse reactions observed in this study were attributed to the activation of the complement system by lipid vesicles in a phenomenon known as Complement Activation-Related Pseudoallergy (CARPA. The influence of the physical-chemical characteristics of liposomal formulation in the triggering of CARPA is discussed.

  5. Determination of Antimony (III in Real Samples by Anodic Stripping Voltammetry Using a Mercury Film Screen-Printed Electrode

    Directory of Open Access Journals (Sweden)

    Olga Domínguez-Renedo

    2009-01-01

    Full Text Available This paper describes a procedure for the determination of antimony (III by differential pulse anodic stripping voltammetry using a mercury film screen-printed electrode as the working electrode. The procedure has been optimized using experimental design methodology. Under these conditions, in terms of Residual Standard Deviation (RSD, the repeatability (3.81 % and the reproducibility (5.07 % of the constructed electrodes were both analyzed. The detection limit for Sb (III was calculated at a value of 1.27×10–8 M. The linear range obtained was between 0.99 × 10–8 – 8.26 × 10–8 M. An analysis of possible effects due to the presence of foreign ions in the solution was performed and the procedure was successfully applied to the determination of antimony levels in pharmaceutical preparations and sea water samples.

  6. 22 CFR 133.515 - Are there any exceptions to those actions?

    Science.gov (United States)

    2010-04-01

    ... FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Violations of this Part and Consequences § 133.515 Are there any exceptions to those actions? The Procurement Executive may waive with respect to a...

  7. 22 CFR 133.110 - Are any of my Federal assistance awards exempt from this part?

    Science.gov (United States)

    2010-04-01

    ... GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Purpose and Coverage § 133.110 Are any... international obligations of the United States or the laws or regulations of a foreign government....

  8. Fifty year dose commitment to various organs and tissues from inhalation of 133Xe

    International Nuclear Information System (INIS)

    A metabolic model for a single inhalation of 133Xe, together with the computer code in use at this Laboratory, was employed for estimating dose commitments to various organs and tissues in the adult human body. The code uses Monte Carlo data for photons and assumes complete absorption of the energy from the emitted electrons in organs and tissues. For bone, a model was used to estimate dose to red and yellow marrow and to endosteal cells of both trabecular and cortical bone. For a single inhalation of 1 mCi of 133Xe, the 50 year dose to gonads was about 0.4 mrad. The dose to lungs from 133Xe dissolved in tissues is about the same, but the dose to the lungs from 133Xe in air spaces was about 1 mrad

  9. 21 CFR 133.178 - Pasteurized neufchatel cheese spread with other foods.

    Science.gov (United States)

    2010-04-01

    ... tested for phosphatase by the method prescribed in § 133.5(c), the phenol equivalent of 0.25 gram of such... mixture of two or more of the following: A vinegar, acetic acid, lactic acid, citric acid, phosphoric...

  10. Mucosal/submucosal blood flow in the gut wall determined by local washout of 133Xenon

    DEFF Research Database (Denmark)

    Mortensen, Peter; Olsen, J; Bülow, J;

    1991-01-01

    and the small intestine the 133Xe washout plotted in a semilogarithmic diagram showed a multiexponential configuration. Histological examination and localization studies showed shunting by diffusion of 133Xe in the intestinal mucosa explaining the multiexponential configuration of the washout curve. Therefore......A 133Xe washout technique for measuring the blood flow in the intestinal mucosa is introduced and evaluated. In 11 anaesthetized pigs a laparotomy was performed and the mucosal blood flow rate in the intestine of the pig was determined by a local epimucosal application of 133Xe. In both the colon...... the initial slope of the washout was used for measuring blood flow rate. Blood flow rate was simultaneously measured by microsphere entrapment technique. There was an excellent correlation between the blood flow rate determined by the two techniques the correlation coefficient R being 0.89 in the small...

  11. Expression of the "stem cell marker" CD133 in pancreas and pancreatic ductal adenocarcinomas

    Directory of Open Access Journals (Sweden)

    Sakariassen Per

    2008-02-01

    Full Text Available Abstract Background It has been suggested that a small population of cells with unique self-renewal properties and malignant potential exists in solid tumors. Such "cancer stem cells" have been isolated by flow cytometry, followed by xenograft studies of their tumor-initiating properties. A frequently used sorting marker in these experiments is the cell surface protein CD133 (prominin-1. The aim of this work was to examine the distribution of CD133 in pancreatic exocrine cancer. Methods Fifty-one cases of pancreatic ductal adenocarcinomas were clinically and histopathologically evaluated, and immunohistochemically investigated for expression of CD133, cytokeratin 19 and chromogranin A. The results were interpreted on the background of CD133 expression in normal pancreas and other normal and malignant human tissues. Results CD133 positivity could not be related to a specific embryonic layer of organ origin and was seen mainly at the apical/endoluminal surface of non-squamous, glandular epithelia and of malignant cells in ductal arrangement. Cytoplasmic CD133 staining was observed in some non-epithelial malignancies. In the pancreas, we found CD133 expressed on the apical membrane of ductal cells. In a small subset of ductal cells and in cells in centroacinar position, we also observed expression in the cytoplasm. Pancreatic ductal adenocarcinomas showed a varying degree of apical cell surface CD133 expression, and cytoplasmic staining in a few tumor cells was noted. There was no correlation between the level of CD133 expression and patient survival. Conclusion Neither in the pancreas nor in the other investigated organs can CD133 membrane expression alone be a criterion for "stemness". However, there was an interesting difference in subcellular localization with a minor cell population in normal and malignant pancreatic tissue showing cytoplasmic expression. Moreover, since CD133 was expressed in shed ductal cells of pancreatic tumors and was

  12. Commercial Banks and Value Relevance of Derivative Disclosures after SFAS 133: Evidence from the USA

    OpenAIRE

    Dona Siregar; Asokan Anandarajan; Iftekhar Hasan

    2013-01-01

    In the last decade there has been a significant increase in the use of derivatives as a vehicle to manage financial risk. The sudden spurt of derivatives has resulted in the Financial Accounting Standards Board (FASB) being forced to develop new standards for quantification and disclosure. The financial standard of interest to this study is Statement of Financial Accounting Standards (SFAS 133). SFAS 133 requires all derivatives, without exception and regardless of the accounting treatment fo...

  13. Selective Lentiviral Gene Delivery to CD133-Expressing Human Glioblastoma Stem Cells

    OpenAIRE

    N Sumru Bayin; Aram S Modrek; August Dietrich; Jonathan Lebowitz; Tobias Abel; Hae-Ri Song; Markus Schober; David Zagzag; Christian J Buchholz; Chao, Moses V; Placantonakis, Dimitris G.

    2014-01-01

    Glioblastoma multiforme (GBM) is a deadly primary brain malignancy. Glioblastoma stem cells (GSC), which have the ability to self-renew and differentiate into tumor lineages, are believed to cause tumor recurrence due to their resistance to current therapies. A subset of GSCs is marked by cell surface expression of CD133, a glycosylated pentaspan transmembrane protein. The study of CD133-expressing GSCs has been limited by the relative paucity of genetic tools that specifically target them. H...

  14. The Stem Cell Marker CD133 (Prominin-1) Is Expressed in Various Human Glandular Epithelia

    OpenAIRE

    Karbanová, Jana; Missol-Kolka, Ewa; Fonseca, Ana-Violeta; Lorra, Christoph; Janich, Peggy; Hollerová, Hana; Jászai, József; Ehrmann, Jiří; Kolář, Zdeněk; Liebers, Cornelia; Arl, Stefanie; Šubrtová, Danuše; Freund, Daniel; Mokrý, Jaroslav; Huttner, Wieland B

    2008-01-01

    Human prominin-1 (CD133) is expressed by various stem and progenitor cells originating from diverse sources. In addition to stem cells, its mouse ortholog is expressed in a broad range of adult epithelial cells, where it is selectively concentrated in their apical domain. The lack of detection of prominin-1 in adult human epithelia might be explained, at least in part, by the specificity of the widely used AC133 antibody, which recognizes an epitope that seems dependent on glycosylation. Here...

  15. Study of the 133Ba nucleus with the (vector d,p) reaction

    International Nuclear Information System (INIS)

    Excited states in 133Ba were studied with the 132Ba(vector d,p)133Ba reaction at 24.0 MeV, with a polarized deuteron beam using the Munich magnetic spectrograph Q3D. Many unambiguous spin-parity assignments were made up to an excitation energy of 2.2 MeV, which allow a detailed comparison with different theoretical calculations, such as the interacting boson-fermion model and the shell model. (orig.)

  16. Antimony doped tin oxides and their composites with tin pyrophosphates as catalyst supports for oxygen evolution reaction in proton exchange membrane water electrolysis

    DEFF Research Database (Denmark)

    Xu, Junyuan; Li, Qingfeng; Hansen, Martin Kalmar;

    2012-01-01

    Proton exchange membrane water electrolysers operating at typically 80 °C or at further elevated temperatures suffer from insufficient catalyst activity and durability. In this work, antimony doped tin oxide nanoparticles were synthesized and further doped with an inorganic proton conducting phase...

  17. Real-world emission factors for antimony and other brake wear related trace elements: size-segregated values for light and heavy duty vehicles.

    Science.gov (United States)

    Bukowiecki, Nicolas; Lienemann, Peter; Hill, Matthias; Figi, Renato; Richard, Agnes; Furger, Markus; Rickers, Karen; Falkenberg, Gerald; Zhao, Yongjing; Cliff, Steven S; Prevot, Andre S H; Baltensperger, Urs; Buchmann, Brigitte; Gehrig, Robert

    2009-11-01

    Hourly trace element measurements were performed in an urban street canyon and next to an interurban freeway in Switzerland during more than one month each, deploying a rotating drum impactor (RDI) and subsequent sample analysis by synchrotron radiation X-ray fluorescence spectrometry (SR-XRF). Antimony and other brake wear associated elements were detected in three particle size ranges (2.5-10, 1-2.5, and 0.1-1 microm). The hourly measurements revealed that the effect of resuspended road dust has to be taken into account for the calculation of vehicle emission factors. Individual values for light and heavy duty vehicles were obtained for stop-and-go traffic in the urban street canyon. Mass based brake wear emissions were predominantly found in the coarse particle fraction. For antimony, determined emission factors were 11 +/- 7 and 86 +/- 42 microg km(-1) vehicle(-1) for light and heavy duty vehicles, respectively. Antimony emissions along the interurban freeway with free-flowing traffic were significantly lower. Relative patterns for brake wear related elements were very similar for both considered locations. Beside vehicle type specific brake wear emissions, road dust resuspension was found to be a dominant contributor of antimony in the street canyon. PMID:19924925

  18. Mobilization of CD133+ progenitor cells in patients with acute cerebral infarction.

    Directory of Open Access Journals (Sweden)

    Dominik Sepp

    Full Text Available Progenitor cells (PCs contribute to the endogenous repair mechanism after ischemic events. Interleukin-8 (IL-8 as part of the acute inflammatory reaction may enhance PC mobilization. Also, statins are supposed to alter number and function of circulating PCs. We aimed to investigate PC mobilization after acute ischemic stroke as well as its association with inflammatory markers and statin therapy. Sixty-five patients with ischemic stroke were enrolled in the study. The number of CD133+ PCs was analyzed by flow cytometry. Blood samples were drawn within 24 hours after symptom onset and after 5 days. The number of CD133+ PCs increased significantly within 5 days (p<0.001. We found no correlation between CD133+ PCs and the serum levels of IL-8, IL-6, or C-reactive protein (CRP. Multivariate analysis revealed that preexisting statin therapy correlated independently with the increase of CD133+ PCs (p=0.001. This study showed a mobilization of CD133+ PCs in patients with acute cerebral infarction within 5 days after symptom onset. The early systemic inflammatory response did not seem to be a decisive factor in the mobilization of PCs. Preexisting statin therapy was associated with the increase in CD133+ PCs, suggesting a potentially beneficial effect of statin therapy in patients with stroke.

  19. Effect of Staurosporine on Neural Differentiation of CD133+ Umbilical Cord Blood Cells

    Directory of Open Access Journals (Sweden)

    Faezeh Faghihi

    2008-01-01

    Full Text Available Objective: CD133+ umbilical cord blood cells were identified as a hematopoieticstem cell which has the capacity for extensive self-renewal and differentiation.The aim of this study was to identify the effect of staurosporine (STS, a wellknownprotein kinase inhibitor on differentiation of CD133+ cells into neuralcells.Materials and Methods: CD133+ cells were enriched by immunomagneticbeads from human mononuclear cells of umbilical cord blood and the purityof higher than 94% was achieved by flowcytometry. Induction of differentiationwas performed by addition of STS (12.5, 25, and 50 nΜ. The differentiatedcells were evaluated by immunofluorescence and RT-PCR for neuron-specificproteins and transcripts.Results: STS-treated CD133+ cells expressed mRNA transcripts for neuronspecificneurofilament protein (NFM, and several basic helix-loop-helix(bHLH transcription factors important for early neurogenesis, including Otx2,Wnt1, and Hash1. The structural proteins characteristics of neurons includingβ-tubulinIII and Microtubule-Associated Protein-2 (MAP-2, were shown byimmunocytochemistry. STS-treated CD133+ cells also expressed the astrocytespecificmarker, glial fibrillary acidic protein (GFAP by immunofluorescence.Conclusion: The human cord blood-derived CD133+ hematopoietic stem cellscould differentiate into neural cell types of neuron-like cells and astrocytes bySTS treatment.

  20. The effect of phytohormones on the 133Cs and 88Sr accumulation in oilseed rape

    International Nuclear Information System (INIS)

    The effect of uptake and distribution of 133Cs and 88Sr in the common plant-India mustard (Brassica napus L.) by exogenous phytohormones (Gibberelin-A3 GA3, Salicylates, SA, 3-indole acetic acid, IAA) treatments were studied by using hydroponic experiment. The results shown as follows: the biomass of above-ground and that of roots of oilseed rape were obviously higher than that of contrary (non-hormone), and the accumulation of 133Cs and 88Sr increased as well, under the three phytohormones treatments. The distribution sequence of 133Cs and 88Sr in oilseed rape was roots>above-grounds, and the contents was 133Cs>88Sr. The accumulation ability of phytohormones was GA>SA>IAA, the accumulation of 133Cs or 88Sr increased with the phytohormone concentration. The treatment of mid-level of Gibberelin-A3 (500 mg/L) and Salicylates acid (500 μmol/L) increased the biomass, enrichment and the translocation factors under the low concentration of 133Cs and 88Sr stress (1 mmol/L). Therefore, the phyto-extraction efficiency was enhanced in oilseed rape by using exogenous phytohormones. (authors)

  1. Utility of 133Xe-ventilation scintigraphy in evaluating airflow limitation in diffuse panbronchiolitis

    International Nuclear Information System (INIS)

    Based on previous clinical experience, it is known that ventilation scintigraphy has the advantage of detecting obstructive changes. The author reports that 133Xe-ventilation scintigraphy can detect characteristic findings even in the very early stage of diffuse panbronchiolitis (DPB), which cannot be found by the chest X-ray. Fifteen cases of DPB were studied. Another 15 cases who have no abnormality on the pulmonary function test served as controls. 133Xe-ventilation scintigraphy and 99mTc-MAA-perfusion scintigraphy were performed on the above 30 cases. In DPB patients, remarkable delay of 133Xe washout and a decrease in blood flow are seen in the bilateral lower lung fields. A particular characteristic was that a localized image of 133Xe gas remained in bilateral lower lung fields. Ventilation-perfusion scintigraphy was performed on seven DPB patients for the second time, who had been given long-term administration of roxithromycin for three months. After long-term administration of roxithromycin, washout time of 133Xe gas from bilateral lower lung fields was remarkably shortened. Continuous administration of this compound helps to improve local lung function of DPB patients. It is concluded that a washout study by means of 133Xe-ventilation scintigraphy can not only detect obstructive lesions associated with DPB, even in an early stage, but is also very useful from the standpoint of therapeutic efficacy evaluation. (author)

  2. Utility of {sup 133}Xe-ventilation scintigraphy in evaluating airflow limitation in diffuse panbronchiolitis

    Energy Technology Data Exchange (ETDEWEB)

    Komatsuzaki, Katsumi [Jikei Univ., Tokyo (Japan). School of Medicine

    1995-01-01

    Based on previous clinical experience, it is known that ventilation scintigraphy has the advantage of detecting obstructive changes. The author reports that {sup 133}Xe-ventilation scintigraphy can detect characteristic findings even in the very early stage of diffuse panbronchiolitis (DPB), which cannot be found by the chest X-ray. Fifteen cases of DPB were studied. Another 15 cases who have no abnormality on the pulmonary function test served as controls. {sup 133}Xe-ventilation scintigraphy and {sup 99m}Tc-MAA-perfusion scintigraphy were performed on the above 30 cases. In DPB patients, remarkable delay of {sup 133}Xe washout and a decrease in blood flow are seen in the bilateral lower lung fields. A particular characteristic was that a localized image of {sup 133}Xe gas remained in bilateral lower lung fields. Ventilation-perfusion scintigraphy was performed on seven DPB patients for the second time, who had been given long-term administration of roxithromycin for three months. After long-term administration of roxithromycin, washout time of {sup 133}Xe gas from bilateral lower lung fields was remarkably shortened. Continuous administration of this compound helps to improve local lung function of DPB patients. It is concluded that a washout study by means of {sup 133}Xe-ventilation scintigraphy can not only detect obstructive lesions associated with DPB, even in an early stage, but is also very useful from the standpoint of therapeutic efficacy evaluation. (author).

  3. IM-133N modulates cytokine secretion by RAW264.7 and THP-1 cells.

    Science.gov (United States)

    Varma, R Sandeep; Guruprasad, Kanive P; Satyamoorthy, Kapaettu; Kumar, L M Sharath; Babu, U Venkanna; Patki, S Pralhad

    2016-01-01

    An indigenous herbal extract IM-133N containing extracts of Prosopis glandulosa Torr and Symplocos racemosa Roxb were evaluated for potential immunomodulatory effects using RAW264.7 and THP-1 cells. The incubation of the cells for 24 h with IM-133N over a dose range 0-125 µg/ml did not cause cytotoxicity that exceeded 10%. The results indicated that non-cytotoxic doses of IM-133N effectively up-regulated iNOS, TNFα, IL-6, IL-10, IL-8 and IFNγ gene expression in both the RAW264.7 and THP-1 cells. The results also indicated IM-133N elicited dose-related increases in nitric oxide (NO) and tumor necrosis factor (TNF)-α production by RAW264.7 or THP-1 cells. These results demonstrated that IM-133N could stimulate NO and induced pro-inflammatory cytokine expression by monocytes/macrophages. As clinical studies have shown IM-133N to be an effective immunomodulator without any adverse effects, the results of the present study provide further support for the potential use of this agent as an immunostimulant or as an immunotherapy adjuvant.

  4. Fibronectin Extra Domain A (EDA) Sustains CD133+/CD44+ Subpopulation of Colorectal Cancer Cells

    Science.gov (United States)

    Ou, Juanjuan; Deng, Jia; Wei, Xing; Xie, Ganfeng; Zhou, Rongbin; Yu, Liqing; Liang, Houjie

    2013-01-01

    Fibronectin is a major extracellular matrix glycoprotein with several alternatively spliced variants, including extra domain A (EDA), which was demonstrated to promote tumorigenesis via stimulating angiogenesis and lymphangiogenesis. Given that CD133+/CD44+ cancer cells are critical in tumorigenesis of colorectal cancer (CRC), we hypothesize that fibronectin EDA may promote tumorigenesis by sustaining the properties of CD133+/CD44+ colon cancer cells. We found that tumor tissue and serum EDA levels are substantially higher in advanced versus early stage human CRC. Additionally we showed that tumor tissue EDA levels are positively correlated with differentiation status and chemoresistance, and correlated with a poor prognosis of CRC patients. We also showed that in colon cancer cells SW480, CD133+/CD44+ versus CD133−/CD44− cells express significantly elevated EDA receptor integrin α9β1. Silencing EDA in SW480 cells reduces spheroid formation and cells positive for CD133 or CD44, which is associated with reduced expressions of embryonic stem cell markers and increased expressions of differentiation markers. Blocking integrin α9β1 function strongly reversed the effect of EDA overexpression. We also provided evidence suggesting that EDA sustains Wnt/β-catenin signaling activity via activating integrin/FAK/ERK pathway. In xenograft models, EDA-silenced SW480 cells exhibit reduced tumorigenic and metastatic capacity. In conclusions, EDA is essential for the maintenance of the properties of CD133+/CD44+ colon cancer cells. PMID:23811539

  5. Fibronectin extra domain A (EDA) sustains CD133(+)/CD44(+) subpopulation of colorectal cancer cells.

    Science.gov (United States)

    Ou, Juanjuan; Deng, Jia; Wei, Xing; Xie, Ganfeng; Zhou, Rongbin; Yu, Liqing; Liang, Houjie

    2013-09-01

    Fibronectin is a major extracellular matrix glycoprotein with several alternatively spliced variants, including extra domain A (EDA), which was demonstrated to promote tumorigenesis via stimulating angiogenesis and lymphangiogenesis. Given that CD133(+)/CD44(+) cancer cells are critical in tumorigenesis of colorectal cancer (CRC), we hypothesize that fibronectin EDA may promote tumorigenesis by sustaining the properties of CD133(+)/CD44(+) colon cancer cells. We found that tumor tissue and serum EDA levels are substantially higher in advanced versus early stage human CRC. Additionally we showed that tumor tissue EDA levels are positively correlated with differentiation status and chemoresistance, and correlated with a poor prognosis of CRC patients. We also showed that in colon cancer cells SW480, CD133(+)/CD44(+) versus CD133(-)/CD44(-) cells express significantly elevated EDA receptor integrin α9β1. Silencing EDA in SW480 cells reduces spheroid formation and cells positive for CD133 or CD44, which is associated with reduced expressions of embryonic stem cell markers and increased expressions of differentiation markers. Blocking integrin α9β1 function strongly reversed the effect of EDA overexpression. We also provided evidence suggesting that EDA sustains Wnt/β-catenin signaling activity via activating integrin/FAK/ERK pathway. In xenograft models, EDA-silenced SW480 cells exhibit reduced tumorigenic and metastatic capacity. In conclusion, EDA is essential for the maintenance of the properties of CD133(+)/CD44(+) colon cancer cells. PMID:23811539

  6. Monitoring of copper, arsenic and antimony levels in agricultural soils impacted and non-impacted by mining activities, from three regions in Chile.

    Science.gov (United States)

    De Gregori, Ida; Fuentes, Edwar; Rojas, Mariela; Pinochet, Hugo; Potin-Gautier, Martine

    2003-04-01

    This paper reports a comparative study of the concentration of three important environmental elements that are often found together in mineral deposits and then associated with mining activities; copper, arsenic and antimony. These elements were determined in 26 different agricultural soils from regions I, II and V in Chile, zones where the most important and biggest copper industries of this country are located. As background levels of these elements in soils have not been well established, in this study, both, impacted and non-impacted agricultural soils from different regions were considered. The relationships between the concentrations of these elements in soils were also examined. The concentration ranges for copper, arsenic and antimony were 11-530; 2.7-202 and 0.42-11 mg kg(-1) respectively. The copper concentrations in non-polluted soils from the north and central zone of Chile were similar. However, three sites from the north region have copper concentration as higher as 100 mg kg(-1), values that exceed the critical concentration for copper in soils. The concentration of arsenic and antimony in the north soils were higher than in non-impacted ones and, in the case of arsenic, greatly exceeded the world average concentration reported for this element in soils. The highest arsenic and antimony concentrations were found in Calama and Quillagua soils, two different sites in the Loa valley. The arsenic/antimony concentration ratio was higher in Quillagua soil. The high concentrations of three elements determined in impacted soils from region V (Puchuncaví and Catemu valleys) clearly shows the impact produced in this zone by the industrial and mining activities developed in their proximities. At Puchuncaví valley a clear decrease was observed in copper, arsenic and antimony concentrations in soils on the function of the distance from the industrial complex "Las Ventanas", and all concentrations exceeded the reported critical values for this matrix. Instead at

  7. Correlation models between environmental factors and bacterial resistance to antimony and copper.

    Directory of Open Access Journals (Sweden)

    Zunji Shi

    Full Text Available Antimony (Sb and copper (Cu are toxic heavy metals that are associated with a wide variety of minerals. Sb(III-oxidizing bacteria that convert the toxic Sb(III to the less toxic Sb(V are potentially useful for environmental Sb bioremediation. A total of 125 culturable Sb(III/Cu(II-resistant bacteria from 11 different types of mining soils were isolated. Four strains identified as Arthrobacter, Acinetobacter and Janibacter exhibited notably high minimum inhibitory concentrations (MICs for Sb(III (>10 mM,making them the most highly Sb(III-resistant bacteria to date. Thirty-six strains were able to oxidize Sb(III, including Pseudomonas-, Comamonas-, Acinetobacter-, Sphingopyxis-, Paracoccus- Aminobacter-, Arthrobacter-, Bacillus-, Janibacter- and Variovorax-like isolates. Canonical correspondence analysis (CCA revealed that the soil concentrations of Sb and Cu were the most obvious environmental factors affecting the culturable bacterial population structures. Stepwise linear regression was used to create two predictive models for the correlation between soil characteristics and the bacterial Sb(III or Cu(II resistance. The concentrations of Sb and Cu in the soil was the significant factors affecting the bacterial Sb(III resistance, whereas the concentrations of S and P in the soil greatly affected the bacterial Cu(II resistance. The two stepwise linear regression models that we derived are as follows: MIC(Sb(III=606.605+0.14533 x C(Sb+0.4128 x C(Cu and MIC((Cu(II=58.3844+0.02119 x C(S+0.00199 x CP [where the MIC(Sb(III and MIC(Cu(II represent the average bacterial MIC for the metal of each soil (μM, and the C(Sb, C(Cu, C(S and C(P represent concentrations for Sb, Cu, S and P (mg/kg in soil, respectively, p<0.01]. The stepwise linear regression models we developed suggest that metals as well as other soil physicochemical parameters can contribute to bacterial resistance to metals.

  8. Green and red fluorescence upconversion in neodymium-doped low phonon antimony glasses

    Energy Technology Data Exchange (ETDEWEB)

    Som, Tirtha [Glass Technology Laboratory, Central Glass and Ceramic Research Institute (Council of Scientific and Industrial Research), 196 Raja S.C. Mullick Road, Kolkata 700032 (India); Karmakar, Basudeb [Glass Technology Laboratory, Central Glass and Ceramic Research Institute (Council of Scientific and Industrial Research), 196 Raja S.C. Mullick Road, Kolkata 700032 (India)], E-mail: basudebk@cgcri.res.in

    2009-05-12

    A new K{sub 2}O-B{sub 2}O{sub 3}-Sb{sub 2}O{sub 3} (KBS) glass system having low phonon energy (about 600 cm{sup -1}) doped with Nd{sup 3+} ions has been developed. Infrared reflection spectroscopic (IRRS) studies have been employed to establish its low phonon energy. Ultraviolet-visible-near infrared (UV-vis-NIR) absorption and photoluminescence upconversion properties with special emphasis on the spectrochemistry of the 15K{sub 2}O-15B{sub 2}O{sub 3}-70Sb{sub 2}O{sub 3} (mol%) glass have been studied doping with different concentrations (0.1-1.0 wt%) of Nd{sub 2}O{sub 3}. UV-vis-NIR absorption band positions have been justified with quantitative calculation of nephelauxetic parameter and covalent bonding characteristics of the host. NIR to visible upconversion has been investigated by exciting at 805 nm at room temperature. Two upconverted bands originating from the {sup 4}G{sub 7/2} {yields} {sup 4}I{sub 9/2} and {sup 4}G{sub 7/2} {yields} {sup 4}I{sub 13/2} transitions are found to be centered at 540 nm (green, medium) and 650 nm (red, strong), respectively. These bands have been explained from the evaluation of the absorption and excitation spectra. The upconversion processes have been explained by the excited state absorption (ESA), energy transfer (ET), cooperative energy transfer (CET) and cross-relaxation (CR) mechanisms involving population of the metastable (storage) energy level ({sup 4}G{sub 7/2}) by effects of multiphonon deexcitation and thermal population. It is evident from the IRRS study that the upconversion phenomena are expedited by the low multiphonon relaxation rate in antimony glasses owing to their low phonon energy (602 cm{sup -1}, the main and highest intensity Sb-O-Sb stretching band) which is very close to that of fluoride glasses (500-600 cm{sup -1})

  9. Novel organo-colloidal synthesis, optical properties, and structural analysis of antimony sesquioxide nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Validzic, Ivana Lj., E-mail: validzic@vinca.rs; Abazovic, Nadica D.; Mitric, Miodrag [University of Belgrade, ' Vinca' Institute of Nuclear Sciences (Serbia); Lalic, Milan V. [Universidade Federal de Sergipe, Departamento de Fisica (Brazil); Popovic, Zoran S. [University of Belgrade, ' Vinca' Institute of Nuclear Sciences (Serbia); Vukajlovic, Filip R. [' Vinca' Institute of Nuclear Sciences (Serbia)

    2013-01-15

    We report the novel colloidal syntheses in organic media of antimony sesquioxide ( Sb{sub 2}O{sub 3} ) spherical nanoparticles (30-250 nm) and octahedron micro- and nanocrystals (100nm - 4{mu}) depending on the synthetic method conditions. It is observed that small differences in the synthetic procedure cause large differences in the very changeable morphology. The structure of Sb{sub 2}O{sub 3} powders was refined down to the R-factors of 9.57, 7.44, 9.19, 9.78, and 8.30 %. The refinement showed that Sb{sub 2}O{sub 3} powder belongs to the cubic crystal type with space group Fd 3-bar m (No. 227). The values of estimated standard deviations, as well as reliability factors, confirmed that the structure of Sb{sub 2}O{sub 3} was well refined. Ultraviolet and visible (UV-Vis) absorption spectroscopy and diffuse reflectance measurements (DRS) reveal that the optical band gap energies found for the Sb{sub 2}O{sub 3} octahedrons and nanoparticles, micro- and nanocrystals, respectively, are quite independent of the synthetic method conditions and synthesized morphology and is found to be between 4.1-4.4 eV. No peaks in both photoluminescence (PL) emission and excitation spectra have been observed for a broad spectral range, typical for this material. In order to discriminate between conflicting experimental results concerning the band gap energy of this compound, we investigated theoretically the electronic structure and optical properties of one of the cubic sesquioxide Sb{sub 2}O{sub 3} samples synthesized here. This has been done on the basis of density functional theory (DFT) with the generalized gradient approximation (GGA) and improved version of exchange potential suggested recently by Tran and Blaha (TB-mBJ). The main characteristic of the calculated TB-mBJ electronic structure is the significant improvement of the band gap value, which is in perfect agreement with our experimental measurements. The real and imaginary parts of the dielectric tensor are also

  10. The presence and leachability of antimony in different wastes and waste handling facilities in Norway.

    Science.gov (United States)

    Okkenhaug, G; Almås, Å R; Morin, N; Hale, S E; Arp, H P H

    2015-11-01

    The environmental behaviour of antimony (Sb) is gathering attention due to its increasingly extensive use in various products, particularly in plastics. Because of this it may be expected that plastic waste is an emission source for Sb in the environment. This study presents a comprehensive field investigation of Sb concentrations in diverse types of waste from waste handling facilities in Norway. The wastes included waste electrical and electronic equipment (WEEE), glass, vehicle fluff, combustibles, bottom ash, fly ash and digested sludge. The highest solid Sb concentrations were found in WEEE and vehicle plastic (from 1238 to 1715 mg kg(-1)) and vehicle fluff (from 34 to 4565 mg kg(-1)). The type of acid used to digest the diverse solid waste materials was also tested. It was found that HNO3:HCl extraction gave substantially lower, non-quantitative yields compared to HNO3:HF. The highest water-leachable concentration for wastes when mixed with water at a 1 : 10 ratio were observed for plastic (from 0.6 to 2.0 mg kg(-1)) and bottom ash (from 0.4 to 0.8 mg kg(-1)). For all of the considered waste fractions, Sb(v) was the dominant species in the leachates, even though Sb(iii) as Sb2O3 is mainly used in plastics and other products, indicating rapid oxidation in water. This study also presents for the first time a comparison of Sb concentrations in leachate at waste handling facilities using both active grab samples and DGT passive samples. Grab samples target the total suspended Sb, whereas DGT targets the sum of free- and other chemically labile species. The grab sample concentrations (from 0.5 to 50 μg L(-1)) were lower than the predicted no-effect concentration (PNEC) of 113 μg L(-1). The DGT concentrations were substantially lower (from 0.05 to 9.93 μg L(-1)) than the grab samples, indicating much of the Sb is present in a non-available colloidal form. In addition, air samples were taken from the chimney and areas within combustible waste incinerators, as

  11. Growth, photosynthesis, and defense mechanism of antimony (Sb)-contaminated Boehmeria nivea L.

    Science.gov (United States)

    Chai, Li-Yuan; Mubarak, Hussani; Yang, Zhi-Hui; Yong, Wang; Tang, Chong-Jian; Mirza, Nosheen

    2016-04-01

    Ramie (Boehmeria nivea L.) is the oldest cash fiber crop in China and is widely grown in antimony (Sb) mining areas. To evaluate the extent of Sb resistance and tolerance, the growth, tolerance index (TI), Sb content in plant parts and in Hoagland solution, bioaccumulation factor (BF), photosynthesis, and physiological changes in Sb-contaminated B. nivea (20, 40, 80, and 200 mg L(-1) Sb) grown hydroponically were investigated. The Sb tolerance and resistance of ramie were clearly revealed by growth inhibition, a TI between 13 and 99 %, non-significant changes in the maximum quantum efficiency of photosystem (F v /F m ), energy-harvesting efficiency (photosystem II (PSII)) and single-photon avalanche diode (SPAD) value, a significant increase in Sb in plant parts, BF >1, and an increase in catalase (CAT) and malondialdehyde (MDA) at 200 mg L(-1) Sb. Under increasing Sb stress, nearly the same non-significant decline in the maximum quantum efficiency of photosystem (F v /F m ), energy-harvesting efficiency (PSII), relative quantum yield of photosystem II (φPSII), and photochemical quenching (qP), except for F v /F m at 20 mg L(-1) Sb, were recorded. SPAD values for chlorophyll under Sb stress showed an increasing trend, except for a slight decrease, i.e., continuous increase in MDA, superoxide dismutase (SOD), peroxidase (POD), and CAT activities were suppressed under Sb addition up to 40 mg L(-1) Sb and the addition of Sb enhanced enzyme production at 80 and 200 mg L(-1) Sb. A continuous decrease in SOD, POD, and CAT up to 40 mg L(-1) Sb and enhancements at ≥80 mg L(-1), along with the continuous enhancement of MDA activity and inhibited biomass production, clearly reveal the roles of these enzymes in detoxifying Sb stress and the defense mechanism of ramie at 80 mg L(-1) Sb. Thus, B. nivea constitutes a promising candidate for Sb phytoremediation at mining sites. PMID:26711292

  12. Production of fusion radionuclides: Molybdenum-99/ Iodine - 131 and Xenon-133; Produccion de los radionucleidos de fision: Molibdeno-99, Yodo-131 y Xenon-133

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Carrillo, D.

    1982-07-01

    This report presents a new radiochemical method for industrial production of the radionuclides: molybdenum-99, iodine-131 and xenon-133. The above mentioned method based on the alkaline metathesis reaction of irradiated uranium (IV) fluoride, presents the best characteristics for the proposed objective. The study deals with the analysis of that reaction and the separation and purification processes. (Author) 71 refs.

  13. CD133在肺癌中的研究与进展%Research and advance of CD133 in lung cancer

    Institute of Scientific and Technical Information of China (English)

    于会娜; 莫碧文

    2011-01-01

    Lung carcinoma is one of the most common cause of cancer-related death in the world,and is also one of the most common malignant tumors in China. It is difficult to cure because of its high-grade malignancy and rapid progress. Cancer stem cells (CSC) is a small part of tumor cells with self-renewal, unlimited proliferation and multi-differentiation capacity in tumor tissue. While CSC has small proportion in the tumor tissue, it is closely related with tumor origin, development and metastasis, and thus considered as a potential target to eradicate tumors. CD133 is a transmembrane glycoprotein found in human hematopoietic stem cells, which is thought as a surface marker of several stem cells. CD133+ cells are associated with tumor metastasis and tumor microvessels formation. Tumor relapse could be detected by quantitative CD133 mRNA expression. CD133 is also the biomarker of CSC of lung cancer. So this paper reviews CD133 and the related research in lung cancer.%肺癌是世界范围内死亡率最高的恶性肿瘤之一,也是我国常见的恶性肿瘤之一,恶性程度高,发展迅速,治疗困难,总体疗效不理想。肿瘤干细胞是肿瘤组织中一小部分具有自我更新、无限增殖和多向分化能力的肿瘤细胞,它在肿瘤组织中所占比例虽然很少,却与肿瘤起源、发展与转移关系密切,因此肿瘤干细胞被看作是一个根除癌症的潜在目标。CD133是在人类造血干细胞中发现的一种跨膜糖蛋白,并认为是多种干细胞的表面标志之一,并且CD133+细胞与肿瘤的转移、肿瘤的血管生成都有关系。另外研究者报道,可通过检测CD133 mRNA水平预测肿瘤的复发,并且认为可以作为某些肿瘤的预后指标。因此,有人认为CD133可能是肺癌干细胞的肿瘤标记物。本文就CD133在肺癌中的研究加以综述。

  14. Synthesis and Properties of Light-tolerant Organic Antimony%耐光型有机锑的合成及其性能研究

    Institute of Scientific and Technical Information of China (English)

    高勇; 韩永和; 李建丰; 袁余斌; 王爱红

    2014-01-01

    硫醇锑稳定剂由于其耐紫外光性能很差,在存储、运输和使用方面受到很大的限制。为解决这一问题,试探性以三氯化锑和巯基酯为原料,引入抗紫外线活性基团TBP-1(2,4-二羟基二苯甲酮),合成了“晒不黑”的有机锑热稳定剂。用红外光谱对产品结构进行了确认,光敏性实验表明其7周内不变色;静态热稳定性实验结果表明其与硫醇锑热稳定剂相当。%Because of its poor ultraviolet resistance , the storage , transportation and use of antimony mercaptide stabilizer was greatly limited.In order to solve this problem , a kind of synthesized organic antimony thermal stabilizer was prepared, which was light -tolerant with antimony trichloride , isooctyl thioglycollat as raw materials and TBP -1(2,4-dihydroxybenzophenone ) , with an anti-ultraviolet agent added in.The light-tolerant performance and thermal stability of product tested showed that the color of organic antimony as -synthesized was unchangeable when under the impact of direct sunlight for 7 weeks by infrared spectroscopy spectrum that was confirmed for structure of product , and the static experimental results showed that the thermal stability was nearly equivalent to antimony mercaptide.

  15. Prognostic impact of MGMT promoter methylation and MGMT and CD133 expression in colorectal adenocarcinoma

    Science.gov (United States)

    2014-01-01

    Background New biomarkers are needed for the prognosis of advanced colorectal cancer, which remains incurable by conventional treatments. O6-methylguanine DNA methyltransferase (MGMT) methylation and protein expression have been related to colorectal cancer treatment failure and tumor progression. Moreover, the presence in these tumors of cancer stem cells, which are characterized by CD133 expression, has been associated with chemoresistance, radioresistance, metastasis, and local recurrence. The objective of this study was to determine the prognostic value of CD133 and MGMT and their possible interaction in colorectal cancer patients. Methods MGMT and CD133 expression was analyzed by immunohistochemistry in 123 paraffin-embedded colorectal adenocarcinoma samples, obtaining the percentage staining and intensity. MGMT promoter methylation status was obtained by using bisulfite modification and methylation-specific PCR (MSP). These values were correlated with clinical data, including overall survival (OS), disease-free survival (DFS), tumor stage, and differentiation grade. Results Low MGMT expression intensity was significantly correlated with shorter OS and was a prognostic factor independently of treatment and histopathological variables. High percentage of CD133 expression was significantly correlated with shorter DFS but was not an independent factor. Patients with low-intensity MGMT expression and ≥50% CD133 expression had the poorest DFS and OS outcomes. Conclusions Our results support the hypothesis that MGMT expression may be an OS biomarker as useful as tumor stage or differentiation grade and that CD133 expression may be a predictive biomarker of DFS. Thus, MGMT and CD133 may both be useful for determining the prognosis of colorectal cancer patients and to identify those requiring more aggressive adjuvant therapies. Future studies will be necessary to determine its clinical utility. PMID:25015560

  16. Rapid selection and proliferation of CD133+ cells from cancer cell lines: chemotherapeutic implications.

    Directory of Open Access Journals (Sweden)

    Sarah E Kelly

    Full Text Available Cancer stem cells (CSCs are considered a subset of the bulk tumor responsible for initiating and maintaining the disease. Several surface cellular markers have been recently used to identify CSCs. Among those is CD133, which is expressed by hematopoietic progenitor cells as well as embryonic stem cells and various cancers. We have recently isolated and cultured CD133 positive [CD133+] cells from various cancer cell lines using a NASA developed Hydrodynamic Focusing Bioreactor (HFB (Celdyne, Houston, TX. For comparison, another bioreactor, the rotary cell culture system (RCCS manufactured by Synthecon (Houston, TX was used. Both the HFB and the RCCS bioreactors simulate aspects of hypogravity. In our study, the HFB increased CD133+ cell growth from various cell lines compared to the RCCS vessel and to normal gravity control. We observed a +15-fold proliferation of the CD133+ cellular fraction with cancer cells that were cultured for 7-days at optimized conditions. The RCCS vessel instead yielded a (-4.8-fold decrease in the CD133+cellular fraction respect to the HFB after 7-days of culture. Interestingly, we also found that the hypogravity environment of the HFB greatly sensitized the CD133+ cancer cells, which are normally resistant to chemo treatment, to become susceptible to various chemotherapeutic agents, paving the way to less toxic and more effective chemotherapeutic treatment in patients. To be able to test the efficacy of cytotoxic agents in vitro prior to their use in clinical setting on cancer cells as well as on cancer stem cells may pave the way to more effective chemotherapeutic strategies in patients. This could be an important advancement in the therapeutic options of oncologic patients, allowing for more targeted and personalized chemotherapy regimens as well as for higher response rates.

  17. Activation of β-Catenin Signaling in CD133-Positive Dermal Papilla Cells Drives Postnatal Hair Growth

    Science.gov (United States)

    Zhou, Linli; Xu, Mingang; Yang, Yongguang; Yang, Kun; Wickett, Randall R.; Andl, Thomas; Millar, Sarah E.

    2016-01-01

    The hair follicle dermal papilla (DP) contains a unique prominin-1/CD133-positive (CD133+) cell subpopulation, which has been shown to possess hair follicle-inducing capability. By assaying for endogenous CD133 expression and performing lineage tracing using CD133-CreERT2; ZsGreen1 reporter mice, we find that CD133 is expressed in a subpopulation of DP cells during the growth phase of the murine hair cycle (anagen), but is absent at anagen onset. However, how CD133+ DP cells interact with keratinocytes to induce hair regenerative growth remains unclear. Wnt/β-catenin has long been recognized as a major signaling pathway required for hair follicle morphogenesis, development, and regeneration. Nuclear Wnt/β-catenin activity is observed in the DP during the hair growth phase. Here we show that induced expression of a stabilized form of β-catenin in CD133+ DP cells significantly accelerates spontaneous and depilation-induced hair growth. However, hair follicle regression is not affected in these mutants. Further analysis indicates that CD133+ DP-expressed β-catenin increases proliferation and differentiation of epithelial matrix keratinocytes. Upregulated Wnt/β-catenin activity in CD133+ DP cells also increases the number of proliferating DP cells in each anagen follicle. Our data demonstrate that β-catenin signaling potentiates the capability of CD133+ DP cells to promote postnatal hair growth. PMID:27472062

  18. Research advances in microbial mechanism of antimony%微生物对锑的代谢机制研究进展

    Institute of Scientific and Technical Information of China (English)

    李明顺; 李洁; 王革娇

    2013-01-01

    锑(Sb)是一种自然界普遍存在的剧毒重金属,随着工业生产的日趋发展,我国部分地区土壤、水体及农产品受到严重的锑污染.作为环境污染物,锑中毒会导致人类心肌衰竭,肝坏死等疾病.自然界中的某些生物,特别是微生物却可以在极高锑浓度下生长,甚至可以利用这种元素作为能源物质,因此,微生物在锑的地球物质循环中起着重要的作用.研究生物对锑的代谢机制,对于保护环境与人体健康具有重要的现实意义.本文对锑在环境中的分布、污染状况、微生物对锑的代谢以及生物修复等方面的研究现状进行了综述.同时建议今后应加强以下三方面的研究:(1)筛选更多抗锑微生物或氧化锑的微生物;(2)发掘更多锑抗性基因或氧化基因;(3)开发锑污染土壤及水体的微生物修复技术.%Antimony (Sb) is a highly toxic heavy metal which widespreadly exists in nature.With the increasing development of industry,the soil,water and agricultural products are severely polluted by antimony in some regions of our country.As an environmental pollutant,antimony poisoning can lead to heart failure,human diseases such as liver necrosis.Some organisms in nature,especially the microorganisms can grow in the high concentration of antimony,and can even use the element as an energy material,so the microorganisms play an important role in the cycle of earth's materials.Study on metabolic mechanism of antimony has important practical significance to protect environment and human health.This study reviewed the researches of Sb distribution in the environment,the pollution status,microbial metabolism of antimony and bioremediation.At the same time it suggests that future researches should strengthen the following three aspects:(1) isolating more antimony resistance or antimony oxidizing microorganisms; (2) identifying more antimony resistant or oxidizing genes; (3) exploring microbial techniques to remediate

  19. Enhanced Removal of Arsenic and Antimony in the Mining Site by Calcined γ-Fe2O3/Layered Double Hydroxide Nanocomposite

    Science.gov (United States)

    Lee, Sang-Ho; Choi, Heechul; Kim, Kyoung-Woong

    2016-04-01

    Arsenic (As) and Antimony (Sb) have been recognized as harmful contaminants in aquatic environment due to its high toxicity and carcinogenicity. Especially, the contamination of arsenic in the mining areas is considered as a serious emerging environmental issue in Korea. Due to the hazardous effect of arsenic, the United States Environmental Protection Agency (US EPA) regulated maximum contamination level of arsenic to 10 μg/L in drinking water. The harmful effect on human health by excessive intake of antimony was also reported by previous studies, and severe contamination level (100 - 7,000 μg/L) of antimony reported in surface and groundwater of abandoned mining area in China and Slovakia. Therefore, US EPA regulated maximum contaminants level of antimony in drinking water to 6 μg/L. In order to remove anionic contaminants in drinking water, various type of nanomaterials have been developed. Layered double hydroxide (LDH) is the artificial anionic clay that is based on the layered structure of positively charged brucite-like layers with interlayers of anions. The LDH is one of the promising nanomaterials for the removal of anionic contaminants because it has high selectivity for arsenic, phosphate, chromium and antimony. However, the biggest problem of LDH for wastewater treatment is that the particles cannot be easily separated after the removal of contaminants. In this study, magnetic nanoparticles (γ-Fe2O3) supported LDH nanocomposite (γ-Fe2O3/LDH) was investigated to enhance magnetic particle recovery and removal efficiency for arsenic and antimony. The calcined γ-Fe2O3/LDH nanocomposites synthesized by co-precipitation method, and the crystallographic properties of maghemite (γ-Fe2O3) and layered structure of LDH were confirmed by X-ray diffraction. The nano-sized γ-Fe2O3 (30 to 50 nm) was stably attached on the surface of LDH (100 to 150 nm) and O1s spectrum by X-ray photoelectron spectroscopy (XPS) explained that there are both physical and

  20. Synthesis and characterization of nanostructured Mn(II) doped antimony-tin oxide (ATO) films on glass

    International Nuclear Information System (INIS)

    Sol–gel Mn(II) doped antimony tin oxide films were developed with precursor of atomic ratio range, Sn:Sb:Mn = 68–72:23–25:9–3. The X-ray diffraction patterns depict tetragonal cassiterite phase of SnO2. Transmission electron microscopy images suggest the nanostructured form of the doped materials. The increase in crystallite size with Mn(II) concentration is reflected by the larger band gap values (4.61–4.73 eV) arising from the excitonic transitions which also respond to PL emissions. Hall effect measurements show that the carrier concentration increases but mobility decreases for Mn(II) doping. Room temperature ferromagnetism with different saturation magnetic moments (Ms) has been observed for all dopant concentrations, 3–9 at%.

  1. The chemistry and behaviour of antimony in the soil environment with comparisons to arsenic: A critical review

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Susan C., E-mail: swilso24@une.edu.a [School of Environmental and Rural Science, University of New England, Armidale, NSW 2351 (Australia); Lockwood, Peter V., E-mail: peter.lockwood@une.edu.a [School of Environmental and Rural Science, University of New England, Armidale, NSW 2351 (Australia); Ashley, Paul M., E-mail: pashley@une.edu.a [School of Environmental and Rural Science, University of New England, Armidale, NSW 2351 (Australia); Tighe, Matthew, E-mail: mtighe2@une.edu.a [School of Environmental and Rural Science, University of New England, Armidale, NSW 2351 (Australia)

    2010-05-15

    This article provides a critical review of the environmental chemistry of inorganic antimony (Sb) in soils, comparing and contrasting findings with those of arsenic (As). Characteristics of the Sb soil system are reviewed, with an emphasis on speciation, sorption and phase associations, identifying differences between Sb and As behaviour. Knowledge gaps in environmentally relevant Sb data for soils are identified and discussed in terms of the limitations this imposes on understanding the fate, behaviour and risks associated with Sb in environmental soil systems, with particular reference to mobility and bioavailability. - A critical and comparative review of Sb and As chemistry and associations in soil systems identifies research directions needed for better understanding of risks.

  2. Antimony (SbIII) reduces growth, declines photosynthesis, and modifies leaf tissue anatomy in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Vaculík, Marek; Mrázová, Anna; Lux, Alexander

    2015-12-01

    The role of antimony (Sb)--a non-essential trace metalloid--in physiological processes running in crops is still poorly understood. Present paper describes the effect of Sb tartrate (SbIII) on growth, Sb uptake, photosynthesis, photosynthetic pigments, and leaf tissue organization in young sunflower plants grown in hydroponics. We found that growth of below- and aboveground part was reduced with increasing concentration of Sb in the medium. Although Sb was mostly taken up by sunflower roots and only small part (1-2%) was translocated to the shoots, decline in photosynthesis, transpiration, and decreased content of photosynthetic pigments were observed. This indicates that despite relatively low mobility of Sb in root-shoot system, Sb in shoot noticeably modifies physiological status and reduced plant growth. Additionally, leaf anatomical changes indicated that Sb reduced the size of intercellular spaces and made leaf tissue more compact. PMID:26194244

  3. Conjugative plasmid in Corynebacterium flaccumfaciens subsp. oortii that confers resistance to arsenite, arsenate, and antimony(III)

    Energy Technology Data Exchange (ETDEWEB)

    Hendrick, C.A.; Haskins, W.P.; Vidaver, A.K.

    1984-07-01

    Gene transfer systems for phytopathogenic corynebacteria have not been reported previously. In this paper a conjugative 46-megadalton plasmid (pDG101) found in Corynebacterium flaccumfaciens subsp. oorii CO101 is described that mediates resistance to arsenite, arsenate, and antimony(III). Transfer of the plasmid from CO101 to four other strains from the C. flaccumfaciens group occurred between cells immobilized on nitrocellulose filters or on agar surfaces. Transconjugant strains expressed the same levels of metal resistance as the donor strain and were able to act as donor strains in subsequent matings. The physical presence of the plasmid was detected by agarose gel electrophoresis. Arsenite-sensitive derivatives of the donor and transconjugant strains were obtained after heat treatment; these were cured of pDG101.

  4. Construction of spongy antimony-doped tin oxide/graphene nanocomposites using commercially available products and its excellent electrochemical performance

    Science.gov (United States)

    Zhao, Xiaowei; Zhang, Jingwei; Zhang, Jiwei; Gong, Chunhong; Gu, Xiufang; Ma, Zhihua; Zhou, Jingfang; Yu, Laigui; Zhang, Zhijun

    2015-10-01

    We construct successfully a porous antimony-doped tin oxide (ATO)/nitrogen-doped graphene 3-dimensional (3D) frameworks (denoted as ATO/NG/TEPA; TEPA refers to tetraethylenepentamine) by a one-pot hydrothermal process, with which TEPA aqueous solution is adopted to easily re-disperse commercial ATO precursor forming a transparent hydrosol. The results show that TEPA plays a key role in the construction of ATO/NG/TEPA, not only acting as a peptization reagent to re-disperse ATO precursor nanoparticles, and as a linker to combine ATO with graphene sheets. The as-fabricated ATO/NG/TEPA hybrid as the negative electrode of lithium ion batteries exhibits excellent lithium storage capacity and cycling stability. With the advantage of easily re-dispersing commercial ATO, the present synthetic route may be put into use for the large-scale production of the titled nanocomposites as the anode material of lithium ion batteries.

  5. Fabrication of superhydrophobic and heat-insulating antimony doped tin oxide/polyurethane films by cast replica micromolding.

    Science.gov (United States)

    Feng, Jie; Huang, Baoyuan; Zhong, Mingqiang

    2009-08-01

    A novel process for fabricating superhydrophobic and heat-insulating polymeric nanocomposite films was developed. Briefly, antimony doped tin oxide (ATO) nanoparticles that commonly endow coats heat-insulating and transparent functions were mixed into commercial waterborne polyurethane (WPU) suspensions to obtain ATO/WPU suspensions, which were then cast onto poly(dimethylsiloxane) (PDMS) stamps replicated from fresh lotus leaves. After being dried and peeled off from stamps, ATO/PU films with superhydrophobic surface and heat-insulating property were created, while PU films without ATO only showed high hydrophobicity. Scanning electron microscopy (SEM) imaging showed the surface of ATO/PU superhydrophobic films had unique micro- and nano-structures similar with those on the lotus leaf. On the contrary, no obvious nano-structures were found on the surface of pure PU films, demonstrating mixing functional nanoparticles into polymers is a necessary and feasible step in creating superhydrophobic and functional films by replica molding method. PMID:19394955

  6. lVIICROSTRUCTURE AND EUTECTIC MORPHOLOGY OF AL-12.5°/o Si ALLOY REFINED WITH ANTIMONY

    Directory of Open Access Journals (Sweden)

    Funda Kahraman

    2007-01-01

    Full Text Available Modification of Al-Si cast alloys can be achieved in two different ways, namely by additions of certain eleınents orwith rapid cooling rate. Modifications of the Al-Si al1oys are carried out extensivcly in industry to improve themechanical properties, particularly ductility. In this study, the effects of antiınony addition.s and growth rate on theınicrostructure and eutectic morphology on the directionally solidified Al- 1 2.5°/o Si cutectic all oy has beeninvestigated. The results showed that antimony can be identified as a grain refıner. Over modification occurs in Al-12.5 °/oSi alloy when modifier is present in the amount of 1 %Sb results in AISb compound.

  7. Antimony (SbIII) reduces growth, declines photosynthesis, and modifies leaf tissue anatomy in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Vaculík, Marek; Mrázová, Anna; Lux, Alexander

    2015-12-01

    The role of antimony (Sb)--a non-essential trace metalloid--in physiological processes running in crops is still poorly understood. Present paper describes the effect of Sb tartrate (SbIII) on growth, Sb uptake, photosynthesis, photosynthetic pigments, and leaf tissue organization in young sunflower plants grown in hydroponics. We found that growth of below- and aboveground part was reduced with increasing concentration of Sb in the medium. Although Sb was mostly taken up by sunflower roots and only small part (1-2%) was translocated to the shoots, decline in photosynthesis, transpiration, and decreased content of photosynthetic pigments were observed. This indicates that despite relatively low mobility of Sb in root-shoot system, Sb in shoot noticeably modifies physiological status and reduced plant growth. Additionally, leaf anatomical changes indicated that Sb reduced the size of intercellular spaces and made leaf tissue more compact.

  8. TP53 drives invasion through expression of its Δ133p53β variant

    Science.gov (United States)

    Gadea, Gilles; Arsic, Nikola; Fernandes, Kenneth; Diot, Alexandra; Joruiz, Sébastien M; Abdallah, Samer; Meuray, Valerie; Vinot, Stéphanie; Anguille, Christelle; Remenyi, Judit; Khoury, Marie P; Quinlan, Philip R; Purdie, Colin A; Jordan, Lee B; Fuller-Pace, Frances V; de Toledo, Marion; Cren, Maïlys; Thompson, Alastair M

    2016-01-01

    TP53 is conventionally thought to prevent cancer formation and progression to metastasis, while mutant TP53 has transforming activities. However, in the clinic, TP53 mutation status does not accurately predict cancer progression. Here we report, based on clinical analysis corroborated with experimental data, that the p53 isoform Δ133p53β promotes cancer cell invasion, regardless of TP53 mutation status. Δ133p53β increases risk of cancer recurrence and death in breast cancer patients. Furthermore Δ133p53β is critical to define invasiveness in a panel of breast and colon cell lines, expressing WT or mutant TP53. Endogenous mutant Δ133p53β depletion prevents invasiveness without affecting mutant full-length p53 protein expression. Mechanistically WT and mutant Δ133p53β induces EMT. Our findings provide explanations to 2 long-lasting and important clinical conundrums: how WT TP53 can promote cancer cell invasion and reciprocally why mutant TP53 gene does not systematically induce cancer progression. DOI: http://dx.doi.org/10.7554/eLife.14734.001 PMID:27630122

  9. hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.

    Directory of Open Access Journals (Sweden)

    Shunsuke Ohnishi

    Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.

  10. Regional cerebral blood flow in stroke by 133Xenon inhalation and emission tomography

    DEFF Research Database (Denmark)

    Lassen, N A; Henriksen, L; Paulson, O

    1981-01-01

    A rapidly rotating single-photon emission tomograph was used to study regional cerebral blood flow by 133Xenon inhalation. Using a rotation speed of 180 degrees/5 sec a tomographic picture of the average Xenon concentration in 3 slices is obtained. By taking a sequence of 4 one-minute tomograms d...... cerebral blood flow measured tomographically by 133Xenon inhalation circumvents the extra-cranial contamination and the superposition of intracranial tissues that hamper 133Xenon inhalation flow studies using stationary detectors.......A rapidly rotating single-photon emission tomograph was used to study regional cerebral blood flow by 133Xenon inhalation. Using a rotation speed of 180 degrees/5 sec a tomographic picture of the average Xenon concentration in 3 slices is obtained. By taking a sequence of 4 one-minute tomograms...... during and after a one-minute 133Xenon inhalation period a flow-dependent variation in local isotope concentration is seen. This sequence is used for calculating CBF by a deconvolution procedure. The CBF maps have a spatial resolution of approximately 1.7 cm (FWHM). This preliminary study comprises...

  11. Xenon-133 hepatic retention ratio: A useful index for fatty liver quantification

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, S.H.; Wu, L.C.; Wang, S.J.; Lin, H.C.; Liu, R.S.; Lee, S.D.; Wu, J.C. (Veterans General Hospital, Taipei (Taiwan))

    1989-10-01

    Xenon-133 hepatic retention ratio was developed for quantifying fatty liver. Data were acquired in frame mode in the hepatic region and both lung bases for 5 min after rebreathing 20 mCi of gaseous {sup 133}Xe and for another 5 min during washout. Static ({sup 99m}Tc)sulfur colloid liver imaging was performed with the patient in the identical position immediately after the ventilation study and data were stored for liver localization. A hepatic time-activity curve corrected for background activity was generated. The 133Xe retention ratio was derived by dividing the activity at 3.5 min after washout by the peak activity. The data of 16 controls and 20 patients with fatty liver were analyzed. The retention ratio (mean +/- s.d.) was greatly increased in patients with fatty infiltration (0.43 +/- 0.20 vs. 0.04 +/- 0.08 in controls, p less than 0.001). There was a strong positive correlation between the {sup 133}Xe retention ratios and percentage of fat on biopsy as assessed by the amount of the liver tissue occupied by fat globules on H E stained sections. The {sup 133}Xe hepatic retention ratio is a simple, accurate and clinically useful index of detecting, quantifying and managing fatty infiltration of the liver.

  12. Excitation functions for (d,x) reactions on (133)Cs up to Ed=40MeV.

    Science.gov (United States)

    Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Baba, M; Ignatyuk, A V

    2016-04-01

    In the frame of a systematic study of excitation functions of deuteron induced reactions the excitation functions of the (133)Cs(d,x)(133m,133mg,131mg)Ba,(134,)(132)Cs and (12)(9m)Xe nuclear reactions were measured up to 40MeV deuteron energies by using the stacked foil irradiation technique and γ-ray spectroscopy of activated samples. The results were compared with calculations performed with the theoretical nuclear reaction codes ALICE-IPPE-D, EMPIRE II-D and TALYS calculation listed in the TENDL-2014 library. A moderate agreement was obtained. Based on the integral yields deduced from our measured cross sections, production of (131)Cs via the (133)Cs(d,4n)(131)Ba→(131)Cs reaction and (133)Ba via (133)Cs(d,2n) reactions is discussed in comparison with other charged particle production routes. PMID:26773822

  13. Excitation functions for(d,x)reactions on $^{133}$Cs up to $E_d = 40$ MeV

    CERN Document Server

    Tárkányi, F; Takács, S; Hermanne, A; Baba, M; Ignatyuk, A V

    2016-01-01

    In the frame of a systematic study of excitation functions of deuteron induced reactions the excitation functions of the $^{133}$Cs(d,x)$^{133m,133mg,131mg}$Ba, ${134,132}$Cs and $^{129m}$Xe nuclear reactions were measured up to 40 MeV deuteron energies by using the stacked foil irradiation technique and $\\gamma$-ray spectroscopy of activated samples. The results were compared with calculations performed with the theoretical nuclear reaction codes ALICE-IPPE-D, EMPIRE II-D and TALYS calculation listed in the TENDL-2014 library. A moderate agreement was obtained. Based on the integral yields deduced from our measured cross sections, production of $^{131}$Cs via the $^{133}$Cs(d,4n)$^{131}$Ba $\\longrightarrow$ $^{131}$Cs reaction and $^{133}$Ba via $^{133}$Cs(d,2n) reactions is discussed in comparison with other charged particle production routes.

  14. Highly tumorigenic lung cancer CD133+ cells display stem-like features and are spared by cisplatin treatment

    OpenAIRE

    Bertolini, Giulia; Roz, Luca; Perego, Paola; Tortoreto, Monica; Fontanella, Enrico; Gatti, Laura; Pratesi, Graziella; Fabbri, Alessandra; Andriani, Francesca; Tinelli, Stella; Roz, Elena; Caserini, Roberto; Lo Vullo, Salvatore; Camerini, Tiziana; Mariani, Luigi

    2009-01-01

    The identification of lung tumor-initiating cells and associated markers may be useful for optimization of therapeutic approaches and for predictive and prognostic information in lung cancer patients. CD133, a surface glycoprotein linked to organ-specific stem cells, was described as a marker of cancer-initiating cells in different tumor types. Here, we report that a CD133+, epithelial-specific antigen-positive (CD133+ESA+) population is increased in primary nonsmall cell lung cancer (NSCLC) ...

  15. 40 CFR 721.10074 - Acetic acid, 2-chloro-, 1-(3,3-dimethylcyclohexyl)ethyl ester.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Acetic acid, 2-chloro-, 1-(3,3... Specific Chemical Substances § 721.10074 Acetic acid, 2-chloro-, 1-(3,3-dimethylcyclohexyl)ethyl ester. (a... acetic acid, 2-chloro-, 1-(3,3-dimethylcyclohexyl)ethyl ester (PMN P-05-568; CAS No. 477218-59-0)...

  16. CD133/Src axis mediates tumor initiating property and epithelial-mesenchymal transition of head and neck cancer.

    Directory of Open Access Journals (Sweden)

    Yu-Syuan Chen

    Full Text Available BACKGROUND: Head and Neck squamous cell carcinoma (HNSCC is a human lethal cancer with clinical, pathological, phenotypical and biological heterogeneity. Caner initiating cells (CICs, which are responsible for tumor growth and coupled with gain of epithelial-mesenchymal transition (EMT, have been identified. Previously, we enriched a subpopulation of head and neck cancer initiating cells (HN-CICs with up-regulation of CD133 and enhancement of EMT. Others demonstrate that Src kinase interacts with and phosphorylates the cytoplasmic domain of CD133. However, the physiological function of CD133/Src signaling in HNSCCs has not been uncovered. METHODOLOGY/PRINCIPAL FINDING: Herein, we determined the critical role of CD133/Src axis modulating stemness, EMT and tumorigenicity of HNSCC and HN-CICs. Initially, down-regulation of CD133 significantly reduced the self-renewal ability and expression of stemness genes, and promoted the differentiation and apoptotic capability of HN-CICs. Additionally, knockdown of CD133 in HN-CICs also lessened both in vitro malignant properties including cell migration/cell invasiveness/anchorage independent growth, and in vivo tumor growth by nude mice xenotransplantation assay. In opposite, overexpression of CD133 enhanced the stemness properties and tumorigenic ability of HNSCCs. Lastly, up-regulation of CD133 increased phosphorylation of Src coupled with EMT transformation in HNSCCs, on the contrary, silence of CD133 or treatment of Src inhibitor inversely abrogated above phenotypic effects, which were induced by CD133 up-regulation in HNSCCs or HN-CICs. CONCLUSION/SIGNIFICANCE: Our results suggested that CD133/Src signaling is a regulatory switch to gain of EMT and of stemness properties in HNSCC. Finally, CD133/Src axis might be a potential therapeutic target for HNSCC by eliminating HN-CICs.

  17. Detection of $^{133}$Xe from the Fukushima nuclear power plant in the upper troposphere above Germany

    CERN Document Server

    Simgen, Hardy; Aufmhoff, Heinfried; Baumann, Robert; Kaether, Florian; Lindemann, Sebastian; Rauch, Ludwig; Schlager, Hans; Schlosser, Clemens; Schumann, Ulrich

    2013-01-01

    After the accident in the Japanese Fukushima Dai-ichi nuclear power plant in March 2011 large amounts of radioactivity were released and distributed in the atmosphere. Among them were also radioactive noble gas isotopes which can be used as tracers to probe global atmospheric circulation models. This work presents unique measurements of the radionuclide $^{133}$Xe from Fukushima in the upper troposphere above Germany. The measurements involve air sampling in a research jet aircraft followed by chromatographic xenon extraction and ultra-low background gas counting with miniaturized proportional counters. With this technique a detection limit of the order of 100 $^{133}$Xe atoms in liter-scale air samples (corresponding to about 100 mBq/m$^3$) is achievable. Our results proof that the $^{133}$Xe-rich ground level air layer from Fukushima was lifted up to the tropopause and distributed hemispherically. Moreover, comparisons with ground level air measurements indicate that the arrival of the radioactive plume in ...

  18. The Utilization and Limitation of CD133 Epitopes in Lung Cancer Stem Cells Research

    Directory of Open Access Journals (Sweden)

    Yin CHEN

    2011-10-01

    Full Text Available Lung cancer is one of the most common tumor, which lacks of effective clinical treatment to lead to desirable prognosis. According to cancer stem cell hypothesis, lung cancer stem cells are considered to be responsible for carcinogenesis, development, metastasis, recurrence, invasion, resistance to chemotherapy and radiotherapy of lung cancer. In recent years, more and more institutes used glycosylated CD133 epitopes to define, isolate, purify lung cancer stem cells. However, along with deeply research, the application of CD133 epitopes in lung cancer stem cell research is questioned. The utilization and limitation of CD133 epitopes in lung cancer stem cells research for the past few years is summaried in this review.

  19. Chromosome analysis in 133 children with congenital mental retardation%133例智力低下患儿细胞遗传学研究

    Institute of Scientific and Technical Information of China (English)

    马宁; 杨晓; 朱丽娜; 王春枝

    2012-01-01

    Objective: To explore the chromosome karyotypes in children with mental retardation. Methods: The peripheral blood lymphocytes from 133 children with congenital mental retardation were cultured and analysed by the G -band technique. Results; Of the 133 cases, 74cases (55. 6% ) showed chromosome abnormalities. The number of autosomal abnormalities were found in 62 cases and Autosomal structural chromosome abnormalities were found in 9 cases, the number of sex chromosome abnormalities in 2 cases and sex chromosome structural abnormalities in leases. Conclusions; Chromosome abnormalities may be important cytogenetic factors for congenital mental retardation. Cytogenetic chromosome karyotypic analysis is an important method for congenital mental retardation child.%目的 探讨智力低下患儿与染色体异常的关系.方法 常规外周血染色体核型分析.结果 133例患儿中共检出染色体异常74例,异常检出率55.6%.其中常染色体数目异常62例,结构异常9例;性染色体数目异常2例,结构异常1例,结论 染色体异常是导致儿童智力低下的重要原因,对此类患儿进行染色体核型分析很有必要.

  20. MicroRNA-133 inhibits behavioral aggregation by controlling dopamine synthesis in locusts.

    Directory of Open Access Journals (Sweden)

    Meiling Yang

    2014-02-01

    Full Text Available Phenotypic plasticity is ubiquitous and primarily controlled by interactions between environmental and genetic factors. The migratory locust, a worldwide pest, exhibits pronounced phenotypic plasticity, which is a population density-dependent transition that occurs between the gregarious and solitary phases. Genes involved in dopamine synthesis have been shown to regulate the phase transition of locusts. However, the function of microRNAs in this process remains unknown. In this study, we report the participation of miR-133 in dopamine production and the behavioral transition by negatively regulating two critical genes, henna and pale, in the dopamine pathway. miR-133 participated in the post-transcriptional regulation of henna and pale by binding to their coding region and 3' untranslated region, respectively. miR-133 displayed cellular co-localization with henna/pale in the protocerebrum, and its expression in the protocerebrum was negatively correlated with henna and pale expression. Moreover, miR-133 agomir delivery suppressed henna and pale expression, which consequently decreased dopamine production, thus resulting in the behavioral shift of the locusts from the gregarious phase to the solitary phase. Increasing the dopamine content could rescue the solitary phenotype, which was induced by miR-133 agomir delivery. Conversely, miR-133 inhibition increased the expression of henna and pale, resulting in the gregarious-like behavior of solitary locusts; this gregarious phenotype could be rescued by RNA interference of henna and pale. This study shows the novel function and modulation pattern of a miRNA in phenotypic plasticity and provides insight into the underlying molecular mechanisms of the phase transition of locusts.

  1. Inhibitive effect of IL-24 gene on CD133+laryngeal cancer cells

    Institute of Scientific and Technical Information of China (English)

    Jin-Zhang Cheng; Dan Yu; Hui Zhang; Chun-Shun Jin; Yan Liu; Xue Zhao; Xin-Meng Qi; Xueshi-Bojie Liu

    2014-01-01

    Objective:To explore the inhibitive and apoptosis inductive effect of IL-24 genes on CD133+laryngeal cancer cells in Hep-2 line. Methods: Human peripheral blood monocytes were isolated. The total RNA was extracted by using Trizol method and reverse transcripted into cDNA using RT-PCR method. Primers P1 and P2 was designed for the amplification of human IL-24 genes. After confirmation of agarose gel electrophoresis tests, TA was cloned into pMD19-T simple vector. NheⅠand XhoⅠdouble digesting human IL-24 and pIRES2-ZsGreen1 and eukaryotic expression vector were used to establish the pIRES2-ZsGreen1-hIL-24 vector, and detected by enzyme digestion and gene sequencing methods. Flow cytometry (FCM) was used to isolate CD133+cells from Hep-2 cells. CD133+cells were transfected with pIRES2-ZsGreen1-hIL-24 through liposome 2000. After detection, MTT and FCM were used to observe the effect of IL-24 gene on CD133+laryngeal cancer Hep-2 cells. Results: Lipotin mediated transfection of recombinant pIRES2-ZsGreen1-hIL-24 plasmid into CD133+Hep-2 could expressed IL-24 gene in cells stably. MTT results showed that IL-24 transfected group was significantly suppressed compared to empty vector group and control group (P<0.05); FCM results showed that the apoptosis rate of experimental group increased significantly compared to empty vector group and control group (P<0.05). Conclusions:IL-24 gene expressions can inhibit proliferation of CD133+laryngeal cells in Hep-2 line and promote their apoptosis.

  2. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juntao; Mao, Zhangfan; Huang, Jie; Xie, Songping; Liu, Tianshu; Mao, Zhifu, E-mail: 48151660@qq.com

    2014-02-21

    Highlights: • Notch signaling pathway members are expressed lower levels in CD133+ cells. • CD133+ cells are not as sensitive as CD133− cells to chemotherapy. • GSI could inhibit the growth of both CD133+ and CD133− cells. • Blockade of Notch signaling pathway enhanced the effect of chemotherapy with CDDP. • DAPT/CDDP co-therapy caused G2/M arrest and elimination in CD133+ cells. - Abstract: Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133− cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133− cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G{sub 2}/M phase, and there were half as many cells in S phase compared with the CD133− cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were

  3. Down-regulation of miR-133a as a poor prognosticator in non-small cell lung cancer.

    Science.gov (United States)

    Wang, Yuzhou; Li, Jinmei; Chen, Hongming; Mo, Yanli; Ye, Haiyin; Luo, Yiping; Guo, Kangwen; Mai, Zongjiong; Zhang, Ying; Chen, Baoying; Zhou, Yijin; Yang, Zhixiong

    2016-10-15

    miR-133a has been demonstrated to play an important role in tumor progression. The aim of present study was to analyze the correlation between miR-133a expression level and clinicopathologic features and its prognostic significance in non-small cell lung cancer (NSCLC). The expression of miR-133a in 104 pairs of human lung cancer tissues and adjacent normal lung tissues were analyzed by qRT-PCR. Here we show that miR-133a was down-regulated in NSCLC. The levels of miR-133a were negatively correlated with the status of N classification (N0-N1 vs. N2-N3, P=0.000), clinical stage (I-II vs. III-IV, P=0.010) and MMP-14 expression (High vs. Low, P=0.012). The patients with low miR-133a expression had shorter survival time than those with high miR-133a expression. Multivariate analysis indicated that the level of miR-133a expression was an independent prognostic indicator (P=0.012) for the survival of patients with NSCLC. In conclusion, decreased expression of miR-133a might be a potential unfavorable prognostic factor for patients with NSCLC, and further studies would be needed to prove our findings.

  4. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy

    International Nuclear Information System (INIS)

    Highlights: • Notch signaling pathway members are expressed lower levels in CD133+ cells. • CD133+ cells are not as sensitive as CD133− cells to chemotherapy. • GSI could inhibit the growth of both CD133+ and CD133− cells. • Blockade of Notch signaling pathway enhanced the effect of chemotherapy with CDDP. • DAPT/CDDP co-therapy caused G2/M arrest and elimination in CD133+ cells. - Abstract: Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133− cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133− cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G2/M phase, and there were half as many cells in S phase compared with the CD133− cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were enhanced

  5. 133Xe ventilation study in pulmonary infiltration with eosinophilia and hypersensitivity pneumonitis

    International Nuclear Information System (INIS)

    Ventilation study using 133Xe were performed to measure regional ventilation in four normal volunteers, four patients with pulmonary infiltration with eosinophilia (PIE) and five patients with hypersensitivity pneumonitis (HP). In both PIE and HP, regional abnormality of ventilation was seen and two indexes of ventilation T1/2, TA/H were in a tendency to be longer in PIE and HP than in normal volunteers. It was suggested that 133Xe ventilation study might be useful for PIE and HP. (author)

  6. Autologous CD34~+ and CD133~+ stem cells transplantation in patients with end stage liver disease

    Institute of Scientific and Technical Information of China (English)

    Hosny; Salama; Abdel-Rahman; N; Zekri; Abeer; A; Bahnassy; Eman; Medhat; Hanan; A; Halim; Ola; S; Ahmed; Ghada; Mohamed; Sheren; A; Al; Alim; Ghada; M; Sherif

    2010-01-01

    AIM:To assess the utility of an autologous CD34 + and CD133 + stem cells infusion as a possible therapeutic modality in patients with end-stage liver diseases.METHODS:One hundred and forty patients with endstage liver diseases were randomized into two groups.Group 1,comprising 90 patients,received granulocyte colony stimulating factor for five days followed by autologous CD34 + and CD133 + stem cell infusion in the portal vein.Group 2,comprising 50 patients,received regular liver treatment only and served a...

  7. Die konsep van eer as sleutel tot die interpretasie van Psalm 133

    Directory of Open Access Journals (Sweden)

    P. J. Botha

    1998-08-01

    Full Text Available The concept of honour as a key to the interpretation of Psalm 133 Despite the fact that its text is quite straightforward, the imagery of Psalm 133, combined with its brevity, poses some interpretational problems. In this paper it is proposed that consideration of the role played by the societal core value of honour in Israel can throw some light on the questions about the relationship between and the combined meaning of images such as that of brothers living together, oil running down from the beard of Aaron, and Yahweh�s commanding of blessing from Zion.

  8. Increased plasma levels of microparticles expressing CD39 and CD133 in acute liver injury

    DEFF Research Database (Denmark)

    Schmelzle, Moritz; Splith, Katrin; Wiuff Andersen, Lars;

    2013-01-01

    BACKGROUND: We have previously demonstrated that CD133 and CD39 are expressed by hematopoietic stem cells (HSC), which are mobilized after liver injury and target sites of injury, limit vascular inflammation, and boost hepatic regeneration. Plasma microparticles (MP) expressing CD39 can block...... endothelial activation. Here, we tested whether CD133 MP might be shed in a CD39-dependent manner in a model of liver injury and could potentially serve as biomarkers of liver failure in the clinic. METHODS: Wild-type and Cd39-null mice were subjected to acetaminophen-induced liver injury. Mice were...

  9. Modulation by cocaine of dopamine receptors through miRNA-133b in zebrafish embryos.

    Directory of Open Access Journals (Sweden)

    Katherine Barreto-Valer

    Full Text Available The use of cocaine during pregnancy can affect the mother and indirectly might alter the development of the embryo/foetus. Accordingly, in the present work our aim was to study in vivo (in zebrafish embryos the effects of cocaine on the expression of dopamine receptors and on miR-133b. These embryos were exposed to cocaine hydrochloride (HCl at 5 hours post-fertilization (hpf and were then collected at 8, 16, 24, 48 and 72 hpf to study the expression of dopamine receptors, drd1, drd2a, drd2b and drd3, by quantitative real time PCR (qPCR and in situ hybridization (ISH, only at 24 hpf. Our results indicate that cocaine alters the expression of the genes studied, depending on the stage of the developing embryo and the type of dopamine receptor. We found that cocaine reduced the expression of miR-133b at 24 and 48 hpf in the central nervous system (CNS and at the periphery by qPCR and also that the spatial distribution of miR-133b was mainly seen in somites, a finding that suggests the involvement of miR-133b in the development of the skeletal muscle. In contrast, at the level of the CNS miR-133b had a weak and moderate expression at 24 and 48 hpf. We also analysed the interaction of miR-133b with the Pitx3 and Pitx3 target genes drd2a and drd2b, tyrosine hydroxylase (th and dopamine transporter (dat by microinjection of the Pitx3-3'UTR sequence. Microinjection of Pitx3-3'UTR affected the expression of pitx3, drd2a, drd2b, th and dat. In conclusion, in the present work we describe a possible mechanism to account for cocaine activity by controlling miR-133b transcription in zebrafish. Via miR-133b cocaine would modulate the expression of pitx3 and subsequently of dopamine receptors, dat and th. These results indicate that miRNAs can play an important role during embryogenesis and in drug addiction.

  10. Super-resolution readout property of bismuth-doped antimony-based thin film as a functional mask for read-only memory

    Science.gov (United States)

    Lu, Xinmiao; Wu, Yiqun; Wang, Yang; Wei, Jingsong

    2012-09-01

    Bismuth-doped antimony-based (Sb100- x Bi x , x=2.46) thin films were presented as a functional mask for super-resolution readout of read-only memory (ROM). The pit size of the ROM was 390 nm, and super-resolution readout was realized on a dynamic tester with laser wavelength of 780 nm and the numerical aperture of the focusing objective lens of 0.45. The carrier-to-noise ratio (CNR) of 22 dB, readout threshold power of 0.8 mW and super-resolution readout cycles of 2×104 was achieved. The influence of film thickness and readout power on CNR was investigated. The reflectivity and transmittance of the film with different temperature at wavelength of 780 nm were detected, and the super-resolution mechanism of the bismuth-doped antimony-based thin films as the functional mask layer was discussed.

  11. Ultra-low carrier concentration and surface-dominant transport in antimony-doped Bi2Se3 topological insulator nanoribbons

    Science.gov (United States)

    Hong, Seung Sae; Cha, Judy J.; Kong, Desheng; Cui, Yi

    2012-03-01

    A topological insulator is the state of quantum matter possessing gapless spin-locking surface states across the bulk band gap, which has created new opportunities from novel electronics to energy conversion. However, the large concentration of bulk residual carriers has been a major challenge for revealing the property of the topological surface state by electron transport measurements. Here we report the surface-state-dominant transport in antimony-doped, zinc oxide-encapsulated Bi2Se3 nanoribbons with suppressed bulk electron concentration. In the nanoribbon with sub-10-nm thickness protected by a zinc oxide layer, we position the Fermi levels of the top and bottom surfaces near the Dirac point by electrostatic gating, achieving extremely low two-dimensional carrier concentration of 2×1011 cm-2. The zinc oxide-capped, antimony-doped Bi2Se3 nanostructures provide an attractive materials platform to study fundamental physics in topological insulators, as well as future applications.

  12. Sorting of CD133+ positive cells from nasopharyngeal carcinoma cell line%人鼻咽癌细胞株分选CD133+细胞实验研究

    Institute of Scientific and Technical Information of China (English)

    林国彪; 姚平; 张锡流

    2012-01-01

    目的 观察CD133在人鼻咽癌细胞株中的表达,探讨CD133+肿瘤细胞的体外增殖及分化能力从而确定鼻咽癌肿瘤干细胞的标志.方法 使用免疫细胞化学及流式细胞技术检测鼻咽癌CNE2Z细胞株中的表达,免疫磁珠分选技术纯化肿瘤细胞,体外培养,观察其增殖及分化能力.结果 鼻咽癌CNE2Z细胞株中有0.168%呈微量阳性表达,利用免疫磁珠分选技术纯化细胞的百分比为87.2%,免疫磁珠富集的CD133+肿瘤细胞在无血清培养基中1、3、5、7天的吸光度均高于相同条件下未分选细胞和CD133-细胞;CD133+在培养体系中的比例逐日下降,至培养的第12天,由第1天的87.2%下降至0.1%.结论 鼻咽癌CNE2Z细胞株中,CD133+癌细胞有比其他细胞亚群强的体外分化和增殖能力,具有自我更新、生成其他表型肿瘤细胞等干细胞样特性,CD133可能是肿瘤起始细胞的标志之一.%Purpose To detect the expression of CD133 in human nasopharyngeal carcinoma cell line, CNE2Z cell line and to observe the proliferation and differentiation ability of CD133 + groups in vitro. Methods Immunocytochemical staining and flow cytometry were used to detect the expression of putative tumor initiating cell marker CD133 in CNE2Z cell line, and the selective technique of inmu-nomagnetic beads was applied to purify CD133 positive cells. CD133+ tumor cells were cultured and their ability of proliferation and differentiation were observed in vitro. Results Only 0. 168% of cells in CNE2Z cell line expressed CD133. In senun-free RPMI1640, on days 1,3,5 and 7, their UV absorption was higher in CD133 cells than control CNE2Z cells. CD133 + cells demonstrated increased proliferating capacity. The proportion of CD133 + cells decreased in culture as days passed. In twelve days of culture, the percentage of CD133 + cells decreased from 87. 2% to 0. 1%. Conclusions CD133 + cells process stronger motility than CD133 - , CNE2Z cells in vitro and CD133

  13. Antimoniais empregados no tratamento da leishmaniose: estado da arte Antimonials employed in the treatment of leishmaniaisis: the state of the art

    OpenAIRE

    Susanne Rath; Luciano Augusto Trivelin; Talitha Rebecca Imbrunito; Daniela Maria Tomazela; Marcelo Nunes de Jesús; Percy Calvo Marzal; Heitor Franco de Andrade Junior; André Gustavo Tempone

    2003-01-01

    Antimony preparations are the drugs of choice for the treatment of leishmaniasis over 90 years, a disease that currently affects 12 million people worldwide. Its introduction was based on 19th century concepts of therapeutic effects of metal salts as arsenicals and other metals, most of them abandoned due to toxic effects or better drugs. In the last three decades, there was a great improvement in the knowledge of cell biology and immunology of those infections, but chemotherapy has not been ...

  14. Decreased antimony uptake and overexpression of genes of thiol metabolism are associated with drug resistance in a canine isolate of Leishmania infantum

    OpenAIRE

    Verónica Gómez Pérez; Raquel García-Hernandez; Victoriano Corpas-López; Tomás, Ana M.; Joaquina Martín-Sanchez; Santiago Castanys; Francisco Gamarro

    2016-01-01

    Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania infantum, is one of the most important zoonotic diseases affecting dogs and humans in the Mediterranean area. The presence of infected dogs as the main reservoir host of L. infantum is regarded as the most significant risk for potential human infection. We have studied the susceptibility profile to antimony and other anti-leishmania drugs (amphotericin B, miltefosine, paromomycin) in Leishmania infantum isolates extracted...

  15. Arsenic and antimony determination in refined and unrefined table salts by means of hydride generation atomic absorption spectrometry--comparison of sample decomposition and determination methods

    OpenAIRE

    AKSUNER, Nur; TİRTOM, Vedia Nüket; HENDEN, Emür

    2011-01-01

    An evaluation was made of different digestion methods for the determination of arsenic and antimony in table salt samples prior to hydride generation atomic absorption spectrometric analysis. Microwave acid digestion, classical wet digestion, dry ashing, and fusion were applied to the decomposition of salt samples and optimum conditions were investigated. Samples were decomposed by changing heating time, digestion techniques, and the amount and composition of acid, and then the concen...

  16. IM-133N - A Useful Herbal Combination for Eradicating Disease-triggering Pathogens in Mice via Immunotherapeutic Mechanisms

    Directory of Open Access Journals (Sweden)

    Syed Firashathulla

    2016-03-01

    Full Text Available Objectives: The present study was undertaken to evaluate the immunomodulatory (IM activity of IM-133N, a herbal combination in various immunotherapeutic experimental models. Methods: The IM activity of IM-133N was evaluated against three experimental models namely, effect of IM- 133N against Escherichia coli (E. coli-induced abdominal sepsis in mice, and carbon clearance test was performed in Wistar albino rats to evaluated the phagocytic potential of IM-133N, in addition IM-133N was evaluated for its immunoglobulin enhancing potential in rats, where the immunoglobulin levels were measured by zinc sulphate turbity (ZST test. Further, IM-133N was subjected for detailed liquid chromatography-mass spectrometry (LC-MS/MS analysis to identify the probable active constituents present in it. Results: The findings of the present study has demonstrated very promising IM property of IM-133N in all the experimental models. Briefly, pretreatment with IM-133N at 125, 250, 500 and 1,000 mg/kg, p.o. doses had protected the mice against E. coli-induced abdominal sepsis and mortality, further the effect of IM- 133N was found to be significant and dose-dependent. In support of this, in another study administration of IM-133N showed a significant and dose-dependent increase in serum immunoglobulin levels, estimated by ZST test. In line with the above findings, in the carbon clearance test the low doses (125 and 250 mg/ kg, p.o. of IM-133N increased the rate of carbon clearance, whereas the higher doses (500 and 1,000 mg/kg, p.o. did not sustain the response, and saturation effect was considered as one of the possible reason for futility of higher doses for IM-133N. In addition, A detailed LC-MS/MS analysis of IM-133N showed 17 bioactive phytochemical constituents: namely, apigenin, chaulmoogric acid, mesquitol, quercetin, symphoxanthone, salireposide, β-sitosterol, nonaeicosanol, β-amyrin, betulic acid, oleanolic acid, symplososide, symponoside, symploveroside

  17. Comparison of 133Xe gas dynamic SPECT and thin-section CT in patients with pulmonary emphysema

    International Nuclear Information System (INIS)

    We assessed 133Xe gas dynamic single photon emission computed tomography (SPECT) by comparing washout axial images with thin-section CT (TSCT) in patients with pulmonary emphysema. Twenty-three patients were studied. All patients were diagnosed as having pulmonary emphysema on the basis of TSCT. We compared TSCT of upper, middle and lower lung fields with 133Xe gas dynamic SPECT axial images at the corresponding levels during the 3 to 4 minutes of washout phase. If the degree of 133Xe gas retention or TSCT finding of ventral and dorsal parts was not the same, the images were divided into two parts. A total of 174 lesions in 23 cases were examined, but 3 lesions having no retention of 133Xe gas at equilibrium phase were excluded. The results showed that: there were 37 lesions (21.6%) with equivalent severity on both images; there were 42 lesions (24.5%) with more severity on 133Xe gas dynamic SPECT than on TSCT; and there were 92 lesions (53.8%) with more severity on TSCT than on 133Xe gas dynamic SPECT. The severity on 133Xe gas dynamic SPECT and TSCT was not always compatible. One of the reasons for the variable 133Xe gas retention even when the lesion had the same severity on TSCT, may be bronchial stricture which cannot be seen on TSCT. By comparison of axial images of 133Xe gas dynamic SPECT with CT images, we could recognize the areas of 133Xe gas retention in detail. Results suggest that 133Xe gas dynamic SPECT can be useful to identify ventilation impairment in pulmonary emphysema. (author)

  18. Antimony determination in seawater and pore water of marine sediments by means of coprecipitation with Mg(OH)2 and atomic absorption spectrometry

    International Nuclear Information System (INIS)

    The study of biogeochemical cycling of trace elements in inshore marine environment is of basic importance in order to understand the long-term distribution of both conventional and radioactive pollutants among the ecosystem components. Antimony is of radio- ecological interest, and its determination in some environmental matrices (seawater, pore water, biota) is always difficult from the analytical point of view. A quick method for antimony determination in seawater and interstitial water of marine sediments, by coprecipitation with Mg(OH)2 and subsequent atomic absorption measurement, is reported. Coprecipitation recovery (about 80% in optimal conditions) was evaluated using both radiotracers and the addition of known amounts of stable element, and turned out to depend on several parameters (percentage of precipitated Mg as compared to the natural content in seawater, ageing of Mg(OH)2, concomitant Fe and Mn concentrations, etc.). The total standard deviation of the proposed method is about 10%. The variance analysis showed that about 90% of total variance is due to the preconcentration procedure (sample handling and random contaminations) and only about 10% is due to the instrumental measurement. The results of antimony determinations in seawater and pore water of marine sediments collected at Montalto di Castro (Central Mediterranean Sea) are presented and discussed

  19. 原子荧光光谱法测定环境空气中锑%Antimony Determination by Atomic Fluorescence Spectrometry

    Institute of Scientific and Technical Information of China (English)

    顾志勇

    2014-01-01

    采用过氯乙烯滤膜采集环境空气中锑,盐酸-氢氟酸混酸体系微波消解滤膜,原子荧光光谱法测定锑。方法前处理操作过程简单、省时、酸用量少、环境污染小,方法的灵敏度和准确度都有很大的提高。采样体积为300L时,空气中锑的最低检出质量浓度为0.002mg/m3。%Antimony in air was sampled using perchloroethylene filter.The filter was dipped into hydrochloric acid and hydrofluoric acid system and digested by microwave.Atomic fluorescence spectrometry was used to detect anti-mony after.This process is simple and time-saving with easy pretreatment,less amount of acid,and less negative impacts on environment.In addition,the accuracy and precision of the process is better than previous methods. The detection limit of antimony in air is 0.002mg/m3 when the volume of air sample is 300 liters when this process was applied.

  20. Analysis of arsenic and antimony distribution within plants growing at an old mine site in Ouche (Cantal, France) and identification of species suitable for site revegetation.

    Science.gov (United States)

    Jana, Ulrike; Chassany, Vincent; Bertrand, Georges; Castrec-Rouelle, Maryse; Aubry, Emmanuel; Boudsocq, Simon; Laffray, Daniel; Repellin, Anne

    2012-11-15

    One of the objectives of this study was to assess the contamination levels in the tailings of an old antimony mine site located in Ouche (Cantal, France). Throughout the 1.3 ha site, homogenous concentrations of antimony and arsenic, a by-product of the operation, were found along 0-0.5 m-deep profiles. Maximum concentrations for antimony and arsenic were 5780 mg kg(-1) dry tailings and 852 mg kg(-1) dry tailings, respectively. Despite the presence of the contaminants and the low pH and organic matter contents of the tailings, several patches of vegetation were found. Botanical identification determined 12 different genera/species. The largest and most abundant plants were adult pines (Pinus sylvestris), birches (Betula pendula) and the bulrush (Juncus effusus). The distribution of the metalloids within specimens of each genera/species was analysed in order to deduce their concentration and translocation capacities. This was the second goal of this work. All plant specimens were highly contaminated with both metalloids. Most were root accumulators with root to shoot translocation factors Plantago major, and Deschampsia flexuosa. PMID:22789654

  1. High frequency of skin reactions in patients with leishmaniasis treated with meglumine antimoniate contaminated with heavy metals: a comparative approach using historical controls

    Directory of Open Access Journals (Sweden)

    Romero Gustavo Adolfo Sierra

    2003-01-01

    Full Text Available We analyzed data from historical controls treated with meglumine antimoniate to compare the frequency of adverse events observed in patients with cutaneous leishmaniasis treated with the same dose of meglumine antimoniate contaminated with heavy metals in an endemic area of the State of Bahia, Brazil. Group A patients were treated in 2000 with the drug produced by Eurofarma Laboratórios Ltda., São Paulo, Brazil (lot A and group B patients were treated in 1996 with the reference drug produced by Rhodia Farma Ltda., São Paulo, Brazil (lot B. We observed an unusual higher frequency of skin reactions in group A patients. However, all type of adverse events observed in group A were also observed in group B. The physico-chemical analysis of these lots revealed that lot A had lower pH and higher concentration of total and trivalent antimony, lead, cadmium, and arsenic. Our findings suggest that the skin reactions could be attributed to heavy metal contamination of lot A.

  2. High frequency of skin reactions in patients with leishmaniasis treated with meglumine antimoniate contaminated with heavy metals: a comparative approach using historical controls.

    Science.gov (United States)

    Romero, Gustavo Adolfo Sierra; Flores M, Rico Marlon de Moraes; Noronha, Elza Ferreira; Macêdo, Vanize de Oliveira

    2003-01-01

    We analyzed data from historical controls treated with meglumine antimoniate to compare the frequency of adverse events observed in patients with cutaneous leishmaniasis treated with the same dose of meglumine antimoniate contaminated with heavy metals in an endemic area of the State of Bahia, Brazil. Group A patients were treated in 2000 with the drug produced by Eurofarma Laborat rios Ltda., S o Paulo, Brazil (lot A) and group B patients were treated in 1996 with the reference drug produced by Rhodia Farma Ltda., S o Paulo, Brazil (lot B). We observed an unusual higher frequency of skin reactions in group A patients. However, all type of adverse events observed in group A were also observed in group B. The physico-chemical analysis of these lots revealed that lot A had lower pH and higher concentration of total and trivalent antimony, lead, cadmium, and arsenic. Our findings suggest that the skin reactions could be attributed to heavy metal contamination of lot A.

  3. A green analytical procedure for sensitive and selective determination of antimony in environmental and biological samples by ligandless cloud point extraction

    Science.gov (United States)

    Rezaei, Vida; Samadi-Maybodi, Abdolraouf

    2012-09-01

    A very simple, environmental friendly and sensitive method based on the cloud point extraction (CPE) separation and spectrophotometric detection has been developed for the determination of antimony. The method is founded on the color reaction of Sb (III) with iodide in acidic medium and subsequent micelle-mediated extraction of the product using the non-ionic surfactant, Triton X-114, in the absence of any chelating agent. The Effects of reaction and extraction parameters were studied and optimum conditions were established. The calibration graph was linear in the range of 0.80-95 ng mL-1 of antimony in the initial solution with r = 0.9994 (n = 9). Detection limit based on three times the standard deviation of the blank (3Sb) was 0.23 ng mL-1 and the relative standard deviation (R.S.D.) for 10 and 70 ng mL-1 of antimony were 3.32 and 1.85% (n = 8), respectively. The proposed method was compared with other methods and favorably applied to evaluate this metal in some real samples, including seawater, antileishmanial drug (glucantime) and human serum.

  4. A new cloud point extraction procedure for determination of inorganic antimony species in beverages and biological samples by flame atomic absorption spectrometry.

    Science.gov (United States)

    Altunay, Nail; Gürkan, Ramazan

    2015-05-15

    A new cloud-point extraction (CPE) for the determination of antimony species in biological and beverages samples has been established with flame atomic absorption spectrometry (FAAS). The method is based on the fact that formation of the competitive ion-pairing complex of Sb(III) and Sb(V) with Victoria Pure Blue BO (VPB(+)) at pH 10. The antimony species were individually detected by FAAS. Under the optimized conditions, the calibration range for Sb(V) is 1-250 μg L(-1) with a detection limit of 0.25 μg L(-1) and sensitive enhancement factor of 76.3 while the calibration range for Sb(III) is 10-400 μg L(-1) with a detection limit of 5.15 μg L(-1) and sensitive enhancement factor of 48.3. The precision as a relative standard deviation is in range of 0.24-2.35%. The method was successfully applied to the speciative determination of antimony species in the samples. The validation was verified by analysis of certified reference materials (CRMs).

  5. Flame-retardancy of a Cellulosic Fabric by the Application of Synergistic Effect between Ammonium Bromide and Antimony (Ⅲ)Oxide

    Institute of Scientific and Technical Information of China (English)

    MOSTASHARI Seyed Morteza; MOAFI Hadi Fallah

    2009-01-01

    The synergistic effect between ammonium bromide and antimony(Ⅲ) oxide as a nondurable finish on the flammability of 100% woven plain cotton fabric(with a density of 144 g/m2,the number of yarns 21 per 10 mm),has been investigated in this study. The laundered totally-dried, weighed specimens were impregnated with suitable concentration individual aqueous ammonium bromide and/or antimony (Ⅲ)oxide suspension solutions and some sets weIle impregnated with appropriate admixed solutions of the both chemicals.A vertical flame spread test Was then carried-out to characterize the flammability of the samples.An acceptable synergistic effect was then experi.enced by using an admixed bath containing 0.1 molar ammonium bromide and O.05 unit formal antimony trioxide solutions for impartation of flame.retardancy to a cotton fabric.The optimum mass of the mixture required to lm.Dart flame-retardancy was about 3.64 g of anhydrous additives per 100 g of fabric.The results obtained are in favor 0f Wall Effect Theory.Moreover synergistic eflfect indicating dehydration of the treated substrate by using this combination via thermogravimetry could be deduced.

  6. 21 CFR 133.102 - Asiago fresh and asiago soft cheese.

    Science.gov (United States)

    2010-04-01

    ... of this section, the word “milk” means cow's milk, which may be adjusted by separating part of the..., asiago soft cheese, is the food prepared from milk and other ingredients specified in this section, by... § 133.5 (a), (b), and (d). It is cured for not less than 60 days. (b) Milk which may be pasteurized...

  7. 10 CFR 60.133 - Additional design criteria for the underground facility.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Additional design criteria for the underground facility... Operations Area § 60.133 Additional design criteria for the underground facility. (a) General criteria for the underground facility. (1) The orientation, geometry, layout, and depth of the underground...

  8. Cerebral blood flow in acute and chronic ischemic stroke using xenon-133 inhalation tomography

    DEFF Research Database (Denmark)

    Vorstrup, S; Paulson, O B; Lassen, N A

    1986-01-01

    Serial measurements of cerebral blood flow (CBF) were performed in 12 patients with acute symptoms of ischemic cerebrovascular disease. CBF was measured by xenon-133 inhalation and single photon emission computer tomography. Six patients had severe strokes and large infarcts on the CT scan. They...

  9. 76 FR 19746 - Expansion of Foreign-Trade Zone 133; Quad-Cities, IL/IA

    Science.gov (United States)

    2011-04-08

    ... given in the Federal Register (75 FR 12729, 3/17/2010) and the application has been processed pursuant... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Expansion of Foreign-Trade Zone 133; Quad-Cities, IL/IA Pursuant to...

  10. Serine 133 Phosphorylation Is Not Required for Hippocampal CREB-Mediated Transcription and Behavior

    Science.gov (United States)

    Brian, Lisa A.; Lee, Bridgin G.; Lelay, John; Kaestner, Klaus H.; Blendy, Julie A.

    2015-01-01

    The cAMP response element (CRE)-binding protein, CREB, is a transcription factor whose activity in the brain is critical for long-term memory formation. Phosphorylation of Ser133 in the kinase-inducible domain (KID), that in turn leads to the recruitment of the transcriptional coactivator CREB-binding protein (CBP), is thought to mediate the…

  11. Draft Genome Sequence of Ureolytic Environmental Isolate Bacillus galactosidilyticus PL133

    Science.gov (United States)

    Gaiero, Jonathan R.; Formusa, Philip A.; Hsiang, Tom; Nicol, Rob W.

    2016-01-01

    We report here the 5.19-Mb draft genome sequence of Bacillus galactosidilyticus PL133 isolated from poultry litter. The isolate was an important member of the cultivable aerobic bacteria identified to have ureolytic activity, which is responsible for ammonia generation in poultry litter residue.

  12. Production of fusion radionuclides: Molybdenum-99/ Iodine - 131 and Xenon-133

    International Nuclear Information System (INIS)

    This report presents a new radiochemical method for industrial production of the radionuclides: molybdenum-99, iodine-131 and xenon-133. The above mentioned method based on the alkaline metathesis reaction of irradiated uranium (IV) fluoride, presents the best characteristics for the proposed objective. The study deals with the analysis of that reaction and the separation and purification processes. (Author) 71 refs

  13. Expression of CD133, PAX2, ESA, and GPR30 in invasive ductal breast carcinomas

    Institute of Scientific and Technical Information of China (English)

    LIU Qun; LI Ji-guang; ZHENG Xin-yu; JIN Feng; DONG Hui-ting

    2009-01-01

    Background Biomarkers in breast neoplasms provide invaluable information regarding prognosis and help determining the optimal treatment. We have examined the possible correlation between cancer stem cell (CSC)-Iike markers (CD133,paired box gene 2 protein (PAX2), epithelial specific antigen (ESA)), and a new membrane estrogen receptor (G-protein coupled receptor 30 (GPR30)) in invasive ductal breast carcinomas with known clinicopathological parameters, tumor recurrence, and expression of some known biomarkers.Methods In 74 invasive ductal breast carcinomas, we investigated the protein expression of these molecular markers by immunohistochemistry, and their associations with known clinicopathological parameters, tumor recurrence, and expression of some known biomarkers. We studied the interrelationship between the expressions of these proteins.Results CD133, a putative CSC marker, was positively related to tumor size, tumor stage, and lymph node metastasis.PAX2 was negatively correlated with tumor recurrence. ESA, one of the breast CSC markers, was an indicator of tumor recurrence. GPR30 was associated with hormone receptors. Despite the correlation between GPR30 and the nuclear estrogen receptor, the expression was dependent. Positive staining of GPR30 in tumors displayed a significant association with high C-erbB2 expression and a tendency for tumor recurrence. A positive relationship between GPR30 and CD133 existed.Conclusion Detecting the expression of CD133, PAX2, ESA, and GPR30 in invasive ductal breast carcinomas may be of help in more accurately predicting the aggressive properties of breast cancer and determining the optimal treatment.

  14. 46 CFR 133.153 - Survival craft launching and recovery arrangements using falls and a winch.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Survival craft launching and recovery arrangements using... (CONTINUED) OFFSHORE SUPPLY VESSELS LIFESAVING SYSTEMS Requirements for All OSVs § 133.153 Survival craft launching and recovery arrangements using falls and a winch. Survival craft launching and...

  15. 46 CFR 133.150 - Survival craft launching and recovery arrangements: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Survival craft launching and recovery arrangements...) OFFSHORE SUPPLY VESSELS LIFESAVING SYSTEMS Requirements for All OSVs § 133.150 Survival craft launching and recovery arrangements: General. (a) All survival craft required for abandonment by the total number...

  16. NATO-SCI 133 guides for planning and reporting tests of countermine equipment

    NARCIS (Netherlands)

    Schleijpen, H.M.A.; Bertrand, H.

    2007-01-01

    NATO Task group SCI-133 on “Countermine Technologies” under the NATO RTO (Systems Concepts and Integration) panel, has the goal to identify technologies for mine detection (close-in detection and remote detection) and mine neutralization (breaching, route clearing, area clearance) which provide the

  17. Color functional images of the cerebral blood flow. [/sup 133/Xe

    Energy Technology Data Exchange (ETDEWEB)

    Toyama, H.; Iio, M.; Iisaka, J.; Chiba, K.; Yamada, H.; Matsui, K.; Hoshi, Y.; Fuse, M.

    1976-11-01

    Functional gamma imaging, in color, was established for regional cerebral blood flow (rCBF) using /sup 133/Xe. During 10 min after intracarotid injection of /sup 133/Xe in saline, 60 picture frames of the /sup 133/Xe clearance curve for the entire hemisphere were obtained. After nine-point smoothing, the rCBF for each of the 4,096 picture elements was calculated by two methods: the half-time method and the height-over-area method. Both the /sup 133/Xe clearance half-times and the calculated CBF values were displayed, using 13 steps of color, as functional CBF images of the brain. Images of peak count and total count were also displayed on the same frame of the color television. Forty-six studies, performed on 37 patients with various cerebral disorders, were divided into two types: diffuse and focal. In the diffuse type, a decrease in CBF was noted in cases of normal-pressure hydrocephalus; successful ventriculoperitoneal shunt operations were followed by recovery of CBF. Occlusion of the middle cerebral artery showed up as a wedge-shaped area of decreased CBF, even when the conventional brain scan looked normal. Increased perfusion to a tumor was frequently associated with decreased CBF in the rest of the lateral hemisphere; such a decrease could be improved by surgical removal of the tumor.

  18. 22q13.3 Deletion Syndrome : Clinical and Molecular Analysis Using Array CGH

    NARCIS (Netherlands)

    Dhar, S. U.; del Gaudio, D.; German, J. R.; Peters, S. U.; Ou, Z.; Bader, P. I.; Berg, J. S.; Blazo, M.; Brown, C. W.; Graham, B. H.; Grebe, T. A.; Lalani, S.; Irons, M.; Sparagana, S.; Williams, M.; Phillips, J. A.; Beaudet, A. L.; Stankiewicz, P.; Patel, A.; Cheung, S. W.; Sahoo, T.

    2010-01-01

    The 22q13.3 deletion syndrome results from loss of terminal segments of varying sizes at 22qter. Few genotype phenotype correlations have been found but all patients have mental retardation and severe delay, or absence of, expressive speech. We carried out clinical and molecular characterization of

  19. Colorectal cancers with aneuploids show high CD133 expression and poor prognosis

    Institute of Scientific and Technical Information of China (English)

    Dongdong Yu; Yonghong Zhang; You Zou; Ming Tian; Deding Tao; Junbo Hu; Jianping Gong

    2010-01-01

    Objective:The aim of the study was to investigate the relationship of DNA ploidy status in colorectal cancers with patients' prognosis and also the relationship of DNA ploidy status with expression of the colorectal cancer stem cell marker CD133.Methods:The DNA ploidy status and CD133 expression in colorectal cancers were detected by flow cytometry.The clinicopathological characteristics and progression-free survival analysis of patients was evaluated based on the clinical data.Results:DNA ploidy pattern did not correlated with gender,age,lesion diameter,histological type,depth of tumor invasion,lymphatic invasion and Dukes stage.Only primary lesion cite showed significant correlation with DNA ploidy pattern,more aneuploids were observed in colonic cancer than rectal cancer,P < 0.05.The 2-year progression-free survival rate and total progression-free time in patients with aneuploids were lower than that with diploids,P < 0.05.Tumors contained aneuploids showed higher expression of CD133 than tumors of only diploids,P < 0.05.Conclusion:Tumor DNA ploidy status is a significant prognostic factor in patients with colorectal cancer and also associated with the existence of CD133 positive colorectal cancer stem cells.

  20. 29 CFR 500.133 - Substantive Federal and State safety and health standards defined.

    Science.gov (United States)

    2010-07-01

    ..., DEPARTMENT OF LABOR REGULATIONS MIGRANT AND SEASONAL AGRICULTURAL WORKER PROTECTION Motor Vehicle Safety and Insurance for Transportation of Migrant and Seasonal Agricultural Workers, Housing Safety and Health for Migrant Workers Housing Safety and Health § 500.133 Substantive Federal and State safety and...