WorldWideScience

Sample records for ant operon encoding

  1. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

    Science.gov (United States)

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

    2015-05-01

    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  2. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  3. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  4. THE CALVIN CYCLE ENZYME PHOSPHOGLYCERATE KINASE OF XANTHOBACTER-FLAVUS REQUIRED FOR AUTOTROPHIC CO2 FIXATION IS NOT ENCODED BY THE CBB OPERON

    NARCIS (Netherlands)

    MEIJER, WG

    1994-01-01

    During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic

  5. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  6. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  8. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  9. An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

    Science.gov (United States)

    Branny, P; de la Torre, F; Garel, J R

    1998-04-01

    The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

  10. Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum

    Science.gov (United States)

    2012-01-01

    Background The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. Results By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. Conclusions The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation. PMID:22243621

  11. Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum.

    Science.gov (United States)

    Schneider, Jens; Peters-Wendisch, Petra; Stansen, K Corinna; Götker, Susanne; Maximow, Stanislav; Krämer, Reinhard; Wendisch, Volker F

    2012-01-13

    The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation.

  12. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  13. Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

    NARCIS (Netherlands)

    Meijer, W.G; van den Bergh, E.R E; Smith, L.M

    In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

  14. Dissecting the Photoprotective Mechanism Encoded by the flv4-2 Operon: a Distinct Contribution of Sll0218 in Photosystem II Stabilization.

    Science.gov (United States)

    Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari

    2017-03-01

    In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.

  15. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  16. ANT

    DEFF Research Database (Denmark)

    van der Duim, René; Ren, Carina Bregnholm; Jóhannesson, Gunnar Thór

    2017-01-01

    Ten years ago actor-network theory (ANT) entered this journal. To illustrate how the relational ontology and sensibilities of ANT lend themselves to particular kinds of research, we first interrogate the main controversies as a way to open up and discuss the main premises of ANT. These debates...... concern the status and agency of objects and non-humans, ANT’s denial of the explanatory power of social structures, and the political implications of ANT. Second we present ANT’s relevance for tourism studies and discuss what ANT ‘does’ in practice. After summarizing a decade of relations between ANT...... and tourism, we conclude by tracing three future trajectories of how we have ‘moved away with’ ANT into new areas of discovery....

  17. Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

    Science.gov (United States)

    Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

    2016-03-18

    In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Insight on specificity of uracil permeases of the NAT/NCS2 family from analysis of the transporter encoded in the pyrimidine utilization operon of Escherichia coli.

    Science.gov (United States)

    Botou, Maria; Lazou, Panayiota; Papakostas, Konstantinos; Lambrinidis, George; Evangelidis, Thomas; Mikros, Emmanuel; Frillingos, Stathis

    2018-04-01

    The uracil permease UraA of Escherichia coli is a structurally known prototype for the ubiquitous Nucleobase-Ascorbate Transporter (NAT) or Nucleobase-Cation Symporter-2 (NCS2) family and represents a well-defined subgroup of bacterial homologs that remain functionally unstudied. Here, we analyze four of these homologs, including RutG of E. coli which shares 35% identity with UraA and is encoded in the catabolic rut (pyrimidine utilization) operon. Using amplified expression in E. coli K-12, we show that RutG is a high-affinity permease for uracil, thymine and, at low efficiency, xanthine and recognizes also 5-fluorouracil and oxypurinol. In contrast, UraA and the homologs from Acinetobacter calcoaceticus and Aeromonas veronii are permeases specific for uracil and 5-fluorouracil. Molecular docking indicates that thymine is hindered from binding to UraA by a highly conserved Phe residue which is absent in RutG. Site-directed replacement of this Phe with Ala in the three uracil-specific homologs allows high-affinity recognition and/or transport of thymine, emulating the RutG profile. Furthermore, all RutG orthologs from enterobacteria retain an Ala at this position, implying that they can use both uracil and thymine and, possibly, xanthine as substrates and provide the bacterial cell with a range of catabolizable nucleobases. © 2018 John Wiley & Sons Ltd.

  19. Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿

    OpenAIRE

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-01-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

  20. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  1. Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4

    DEFF Research Database (Denmark)

    Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian

    1994-01-01

    specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...

  2. Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

    Science.gov (United States)

    Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

    2014-11-01

    The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

  3. Tricistronic operon expression of the genes gcaD (tms), which encodes N-acetylglucosamine 1-phosphate uridyltransferase, prs, which encodes phosphoribosyl diphosphate synthetase, and ctc in vegetative cells of Bacillus subtilis

    DEFF Research Database (Denmark)

    Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne

    1995-01-01

    The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...

  4. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Science.gov (United States)

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  5. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  6. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  7. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  8. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Science.gov (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  9. Cloning and sequencing of wsp encoding gene fragments reveals a diversity of co-infecting Wolbachia strains in Acromyrmex leafcutter ants

    DEFF Research Database (Denmark)

    van Borm, S.; Wenseleers, T.; Billen, J.

    2003-01-01

    Acromyrmex insinuator hosted two additional infections. The multiple Wolbachia strains may influence the expression of reproductive conflicts in leafcutter ants, but the expected turnover of infections may make the cumulative effects on host ant reproduction complex. The additional Wolbachia infections......By sequencing part of the wsp gene of a series of clones, we detected an unusually high diversity of nine Wolbachia strains in queens of three species of leafcutter ants. Up to four strains co-occurred in a single ant. Most strains occurred in two clusters (InvA and InvB), but the social parasite...

  10. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  11. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  12. Evidence against the selfish operon theory.

    Science.gov (United States)

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  13. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  14. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Science.gov (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  16. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  17. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  18. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  19. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  20. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  1. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  2. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  3. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  4. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  5. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  6. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  7. Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum.

    Science.gov (United States)

    Busche, Tobias; Silar, Radoslav; Pičmanová, Martina; Pátek, Miroslav; Kalinowski, Jörn

    2012-09-03

    The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have

  8. Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum

    Directory of Open Access Journals (Sweden)

    Busche Tobias

    2012-09-01

    Full Text Available Abstract Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly

  9. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  10. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  11. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    OpenAIRE

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  12. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  13. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  14. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  15. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  16. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  17. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  18. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Science.gov (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  19. Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

    Science.gov (United States)

    Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

    2014-01-01

    Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

  20. Beyond ANT

    DEFF Research Database (Denmark)

    Jansen, Till

    2017-01-01

    Actor-Network-Theory (ANT) offers an ‘infra-language’ of the social that allows one to trace social relations very dynamically, while at the same time dissolving human agency, thus providing a flat and de-centred way into sociology. However, ANT struggles with its theoretical design that may lead...... us to reduce agency to causation and to conceptualize actor-networks as homogeneous ontologies of force. This article proposes to regard ANT’s inability to conceptualize reflexivity and the interrelatedness of different ontologies as the fundamental problem of the theory. Drawing on Günther......, it offers an ‘infra-language’ of reflexive relations while maintaining ANT’s de-centred approach. This would enable us to conceptualize actor-networks as non-homogeneous, dynamic and connecting different societal rationales while maintaining the main strengths of ANT....

  1. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  2. Stochastic simulations of the tetracycline operon

    Science.gov (United States)

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  3. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  4. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  5. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

    Science.gov (United States)

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

    2014-01-01

    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  6. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  7. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  8. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  9. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  10. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  11. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  12. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  13. Fire Ant Bites

    Science.gov (United States)

    ... Favorite Name: Category: Share: Yes No, Keep Private Fire Ant Bites Share | Fire ants are aggressive, venomous insects that have pinching ... across the United States, even into Puerto Rico. Fire ant stings usually occur on the feet or ...

  14. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

    Science.gov (United States)

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

    2015-07-07

    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  15. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  16. Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

    DEFF Research Database (Denmark)

    Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

    1996-01-01

    Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

  17. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    Science.gov (United States)

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  18. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  19. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  20. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  1. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  2. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  3. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  4. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Science.gov (United States)

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  6. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  7. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  8. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  9. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  10. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  11. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  12. The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

    OpenAIRE

    Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

    2000-01-01

    In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

  13. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  14. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  15. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

    Science.gov (United States)

    de Oliveira, Rafael R; Nicholson, Wayne L

    2016-01-01

    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  16. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  17. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  18. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Science.gov (United States)

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  20. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    Science.gov (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  1. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

  2. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  3. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

    Science.gov (United States)

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

    2017-11-01

    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  4. Ant- and Ant-Colony-Inspired ALife Visual Art.

    Science.gov (United States)

    Greenfield, Gary; Machado, Penousal

    2015-01-01

    Ant- and ant-colony-inspired ALife art is characterized by the artistic exploration of the emerging collective behavior of computational agents, developed using ants as a metaphor. We present a chronology that documents the emergence and history of such visual art, contextualize ant- and ant-colony-inspired art within generative art practices, and consider how it relates to other ALife art. We survey many of the algorithms that artists have used in this genre, address some of their aims, and explore the relationships between ant- and ant-colony-inspired art and research on ant and ant colony behavior.

  5. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Science.gov (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  6. An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

    Science.gov (United States)

    Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

    2014-10-01

    The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Science.gov (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  8. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

    Science.gov (United States)

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

    2000-10-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

  9. Displacement encoder

    International Nuclear Information System (INIS)

    Hesketh, T.G.

    1983-01-01

    In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

  10. Riding with the ants

    NARCIS (Netherlands)

    Duarte, A. P. M.; Attili-Angelis, D.; Baron, N. C.; Groenewald, Johannes Z.; Crous, Pedro W.; Pagnocca, F. C.

    Isolates of Teratosphaeriaceae have frequently been found in the integument of attine ants, proving to be common and diverse in this microenvironment. The LSU phylogeny of the ant-isolated strains studied revealed that they cluster in two main lineages. The first was associated with the genus

  11. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Science.gov (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

    2015-01-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  13. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

    2015-09-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  16. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  17. Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

    Science.gov (United States)

    Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

    2015-01-01

    Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

  18. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  19. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  20. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  1. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  2. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    OpenAIRE

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  3. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  4. The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

    Science.gov (United States)

    Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

    2014-01-01

    Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

  5. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  6. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  7. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  8. Sick ants become unsociable

    DEFF Research Database (Denmark)

    Bos, Nicky Peter Maria; Lefevre, T.; Jensen, A.B.

    2012-01-01

    Parasites represent a severe threat to social insects, which form high-density colonies of related individuals, and selection should favour host traits that reduce infection risk. Here, using a carpenter ant (Camponotus aethiops) and a generalist insect pathogenic fungus (Metarhizium brunneum), we...... show that infected ants radically change their behaviour over time to reduce the risk of colony infection. Infected individuals (i) performed less social interactions than their uninfected counterparts, (ii) did not interact with brood anymore and (iii) spent most of their time outside the nest from...... day 3 post-infection until death. Furthermore, infected ants displayed an increased aggressiveness towards non-nestmates. Finally, infected ants did not alter their cuticular chemical profile, suggesting that infected individuals do not signal their physiological status to nestmates. Our results...

  9. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Johanna Rintahaka

    Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

  10. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Science.gov (United States)

    Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

    2014-01-01

    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  11. Oxalic acid biosynthesis is encoded by an operon in Burkholderia glumae

    Science.gov (United States)

    Although the biosynthesis of oxalic acid is known to occur in a number of bacteria, the mechanism(s) regulating its production remains largely unknown. To date, there is no report on the identification of an oxalic acid biosynthetic pathway gene from bacteria. In an attempt to identify such a gene...

  12. Ants recognize foes and not friends

    Science.gov (United States)

    Guerrieri, Fernando J.; Nehring, Volker; Jørgensen, Charlotte G.; Nielsen, John; Galizia, C. Giovanni; d'Ettorre, Patrizia

    2009-01-01

    Discriminating among individuals and rejecting non-group members is essential for the evolution and stability of animal societies. Ants are good models for studying recognition mechanisms, because they are typically very efficient in discriminating ‘friends’ (nest-mates) from ‘foes’ (non-nest-mates). Recognition in ants involves multicomponent cues encoded in cuticular hydrocarbon profiles. Here, we tested whether workers of the carpenter ant Camponotus herculeanus use the presence and/or absence of cuticular hydrocarbons to discriminate between nest-mates and non-nest-mates. We supplemented the cuticular profile with synthetic hydrocarbons mixed to liquid food and then assessed behavioural responses using two different bioassays. Our results show that (i) the presence, but not the absence, of an additional hydrocarbon elicited aggression and that (ii) among the three classes of hydrocarbons tested (unbranched, mono-methylated and dimethylated alkanes; for mono-methylated alkanes, we present a new synthetic pathway), only the dimethylated alkane was effective in eliciting aggression. Our results suggest that carpenter ants use a fundamentally different mechanism for nest-mate recognition than previously thought. They do not specifically recognize nest-mates, but rather recognize and reject non-nest-mates bearing odour cues that are novel to their own colony cuticular hydrocarbon profile. This begs for a reappraisal of the mechanisms underlying recognition systems in social insects. PMID:19364750

  13. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  14. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Science.gov (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  15. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  16. Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

    Science.gov (United States)

    Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

    2017-07-17

    Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

  17. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    Science.gov (United States)

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  18. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    Science.gov (United States)

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  19. The diversity of microorganisms associated with Acromyrmex leafcutter ants

    Directory of Open Access Journals (Sweden)

    Boomsma Jacobus J

    2002-05-01

    Full Text Available Abstract Background Molecular biological techniques are dramatically changing our view of microbial diversity in almost any environment that has so far been investigated. This study presents a systematic survey of the microbial diversity associated with a population of Acromyrmex leafcutter ants. In contrast to previous studies on social insects, which targeted specific groups of symbionts occurring in the gut (termites, Tetraponera ants or in specialised cells (Camponotus ants the objective of our present study was to do a total screening of all possible micro-organisms that can be found inside the bodies of these leafcutter ants. Results We amplified, cloned and sequenced SSU rRNA encoding gene fragments from 9 microbial groups known to have insect-associated representatives, and show that: (1 representatives of 5 out of 9 tested groups are present, (2 mostly several strains per group are present, adding up to a total of 33 different taxa. We present the microbial taxa associated with Acromymex ants in a phylogenetic context (using sequences from GenBank to assess and illustrate to which known microorganisms they are closely related. The observed microbial diversity is discussed in the light of present knowledge on the evolutionary history of Acromyrmex leafcutter ants and their known mutualistic and parasitic symbionts. Conclusions The major merits of the screening approach documented here is its high sensitivity and specificity, which allowed us to identify several microorganisms that are promising candidates for further study of their interactions with Acromyrmex leafcutter ants or their gardens.

  20. The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply.

    Science.gov (United States)

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari

    2012-09-28

    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.

  1. The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply*

    Science.gov (United States)

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari

    2012-01-01

    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963

  2. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  3. Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

    Science.gov (United States)

    Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

    2017-07-01

    Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

  4. Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system

    DEFF Research Database (Denmark)

    Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø

    1997-01-01

    A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...

  5. Commentary: Warring ants

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 27; Issue 2. Commentary: Warring ants: Lessons from Lanchester's laws of combat? Renee M Borges. Volume 27 Issue 2 March 2002 pp 75-78. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/jbsc/027/02/0075-0078 ...

  6. Antílope

    Directory of Open Access Journals (Sweden)

    Pedro Anderson Martinho Moçambique

    2015-10-01

    Full Text Available Essa espécie de antílope só é encontrada em território angolano, sendo assim um símbolo nacional. Segundo a mitologia africana é símbolo de vivacidade, velocidade e beleza - Angola.

  7. Antílope

    Directory of Open Access Journals (Sweden)

    Pedro Anderson Martinho Moçambique

    2011-04-01

    Full Text Available Essa espécie de antílope só é encontrada em território angolano, sendo assim um símbolo nacional. Segundo a mitologia africana é símbolo de vivacidade, velocidade e beleza - Angola.

  8. Fire Ant Allergy

    Science.gov (United States)

    ... venom in a fire ant sting will kill bacteria and some of your skin cells. This results in the formation of a blister that fills with a cloudy white material in about 24 hours. While this looks like a pus-filled lesion that should be drained, ...

  9. "Ant-egg" cataract revisited

    DEFF Research Database (Denmark)

    Clemmensen, Kåre; Enghild, Jan J; Ivarsen, Anders

    2017-01-01

    -ray scans and electron microscopy. The purpose of this study was to further characterize "ant-egg" cataract using modern technology and display the history of the "ant-eggs" after cataract extraction. METHODS: "Ant-eggs" were examined using Heidelberg SPECTRALIS Optical Coherence Tomography (OCT...

  10. Ant Colony Optimization for Control

    NARCIS (Netherlands)

    Van Ast, J.M.

    2010-01-01

    The very basis of this thesis is the collective behavior of ants in colonies. Ants are an excellent example of how rather simple behavior on a local level can lead to complex behavior on a global level that is beneficial for the individuals. The key in the self-organization of ants is communication

  11. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  12. Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Bianca Schwartbeck

    2016-11-01

    Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

  13. The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

    Directory of Open Access Journals (Sweden)

    Uzma Qaisar

    Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

  14. Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

    Science.gov (United States)

    2011-01-01

    Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

  15. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  16. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  17. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  18. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

    Science.gov (United States)

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

    2017-11-01

    The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

  19. Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

    International Nuclear Information System (INIS)

    Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

    2011-01-01

    Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

  20. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  1. The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616.

    Science.gov (United States)

    Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka

    2017-08-15

    Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

  2. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  3. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  4. Runtime analysis of the 1-ANT ant colony optimizer

    DEFF Research Database (Denmark)

    Doerr, Benjamin; Neumann, Frank; Sudholt, Dirk

    2011-01-01

    The runtime analysis of randomized search heuristics is a growing field where, in the last two decades, many rigorous results have been obtained. First runtime analyses of ant colony optimization (ACO) have been conducted only recently. In these studies simple ACO algorithms such as the 1-ANT...... that give us a more detailed impression of the 1-ANT’s performance. Furthermore, the experiments also deal with the question whether using many ant solutions in one iteration can decrease the total runtime....

  5. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  6. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Science.gov (United States)

    2012-01-01

    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  7. Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

    Science.gov (United States)

    Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

    2015-01-01

    Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

  8. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Science.gov (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  10. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  11. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  12. Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

    OpenAIRE

    Yadav, Kavita; Kumar, Chanchal; Archana, G.; Naresh Kumar, G.

    2014-01-01

    Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) s...

  13. Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL)

    DEFF Research Database (Denmark)

    Johansen, L.E.; Nygaard, P.; Lassen, C.

    2003-01-01

    In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt...

  14. The metapleural gland of ants

    DEFF Research Database (Denmark)

    Yek, Sze Huei; Mueller, Ulrich G

    2011-01-01

    The metapleural gland (MG) is a complex glandular structure unique to ants, suggesting a critical role in their origin and ecological success. We synthesize the current understanding of the adaptive function, morphology, evolutionary history, and chemical properties of the MG. Two functions......-compressible invagination of the integument and the secretion is thought to ooze out passively through the non-closable opening of the MG or is groomed off by the legs and applied to target surfaces. MG loss has occurred repeatedly among the ants, particularly in the subfamilies Formicinae and Myrmicinae, and the MG...... is more commonly absent in males than in workers. MG chemistry has been characterized mostly in derived ant lineages with unique biologies (e.g. leafcutter ants, fire ants), currently precluding any inferences about MG chemistry at the origin of the ants. A synthetic approach integrating functional...

  15. Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

    Science.gov (United States)

    Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

    2015-02-01

    Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

    Directory of Open Access Journals (Sweden)

    Opsata Mona

    2010-08-01

    Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

  17. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Science.gov (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  18. X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

    Science.gov (United States)

    Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

  19. Hospitales seguros ante desastres

    OpenAIRE

    Celso Vladimir Bambaren Alatrista; María Del Socorro Alatrista Gutierrez

    2007-01-01

    Entre 1982 a 2005 se registraron daños en 1 143 establecimientos de salud en el Perú, generalmente debido a sismos, lluvias e inundaciones. Los daños en los servicios de salud producen la interrupción de la atención de la población y de los programas de salud, así como generan un gran gasto para la rehabilitación y reconstrucción. Por ello, se requiere proteger a los establecimientos de salud y desarrollar una política de hospitales seguros ante desastres que incluya medidas para prevenir o r...

  20. La vivienda ante emergencias

    Directory of Open Access Journals (Sweden)

    Arq. María Eugenia Gonzàlez Chipont

    2014-12-01

    Full Text Available Este trabajo propone analizar la evolución de la vivienda como respuesta ante emergencias desde principios del siglo XX hasta nuestros días. La secuencia de casos a analizar no sigue una cronología estricta sino que se organiza en función de un creciente grado de complejidad. Comienza con los aportes fundamentales de la vivienda mínima del movimiento moderno, con un fuerte acento en lo tecnológico, para ir profundizando, mientras avanzamos en el siglo, en los aspectos sociales de la arquitectura. Sin intentar oponer lo tecnológico y lo social, la estructura propuesta expresa un enriquecimiento de la cuestión técnica conforme se van ampliando sus objetivos sociales. Mientras los requerimientos tecnológicos como la inmediatez y la masividad de la respuesta, permanecen a lo largo del tiempo, la vivienda ante emergencias puede plantearse objetivos sociales cada vez más profundos. Los casos fueron elegidos a partir de autores renombrados de la Historia de la Arquitectura partiendo de ejemplos cercanos a la génesis del movimiento moderno para acercarnos cada vez más hacia el contexto actual de Latinoamérica. Se logra así un barrido geográfco pero principalmente cultural: desde las fuentes de la modernidad, bajo el paradigma sólido de la industrialización, hasta la inestabilidad de la ciudad posindustrial latinoamericana

  1. An Engineered orco Mutation Produces Aberrant Social Behavior and Defective Neural Development in Ants.

    Science.gov (United States)

    Yan, Hua; Opachaloemphan, Comzit; Mancini, Giacomo; Yang, Huan; Gallitto, Matthew; Mlejnek, Jakub; Leibholz, Alexandra; Haight, Kevin; Ghaninia, Majid; Huo, Lucy; Perry, Michael; Slone, Jesse; Zhou, Xiaofan; Traficante, Maria; Penick, Clint A; Dolezal, Kelly; Gokhale, Kaustubh; Stevens, Kelsey; Fetter-Pruneda, Ingrid; Bonasio, Roberto; Zwiebel, Laurence J; Berger, Shelley L; Liebig, Jürgen; Reinberg, Danny; Desplan, Claude

    2017-08-10

    Ants exhibit cooperative behaviors and advanced forms of sociality that depend on pheromone-mediated communication. Odorant receptor neurons (ORNs) express specific odorant receptors (ORs) encoded by a dramatically expanded gene family in ants. In most eusocial insects, only the queen can transmit genetic information, restricting genetic studies. In contrast, workers in Harpegnathos saltator ants can be converted into gamergates (pseudoqueens) that can found entire colonies. This feature facilitated CRISPR-Cas9 generation of germline mutations in orco, the gene that encodes the obligate co-receptor of all ORs. orco mutations should significantly impact olfaction. We demonstrate striking functions of Orco in odorant perception, reproductive physiology, and social behavior plasticity. Surprisingly, unlike in other insects, loss of OR functionality also dramatically impairs development of the antennal lobe to which ORNs project. Therefore, the development of genetics in Harpegnathos establishes this ant species as a model organism to study the complexity of eusociality. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Science.gov (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Science.gov (United States)

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  4. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  5. Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

    Science.gov (United States)

    Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

    2015-08-18

    Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Pest repellent properties of ant pheromones

    DEFF Research Database (Denmark)

    Offenberg, Joachim

    2012-01-01

    of ant pheromones may be sufficient to repel pest insects from ant territories. The study of ant semiochemicals is in its infancy, yet, evidence for their potential use in pest management is starting to build up. Pheromones from four of five tested ant species have been shown to deter herbivorous insect...... prey and competing ant species are also deterred by ant deposits, whereas ant symbionts may be attracted to them. Based on these promising initial findings, it seems advisable to further elucidate the signaling properties of ant pheromones and to test and develop their use in future pest management....

  7. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  8. Hospitales seguros ante desastres

    Directory of Open Access Journals (Sweden)

    Celso Vladimir Bambaren Alatrista

    2007-07-01

    Full Text Available Entre 1982 a 2005 se registraron daños en 1 143 establecimientos de salud en el Perú, generalmente debido a sismos, lluvias e inundaciones. Los daños en los servicios de salud producen la interrupción de la atención de la población y de los programas de salud, así como generan un gran gasto para la rehabilitación y reconstrucción. Por ello, se requiere proteger a los establecimientos de salud y desarrollar una política de hospitales seguros ante desastres que incluya medidas para prevenir o reducción de la vulnerabilidad estructural, no estructural y funcional en los nuevos establecimientos y en los existentes.(Rev Med Hered 2007;18:149-154.

  9. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

    2015-01-01

    ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

  10. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

    2015-08-01

    In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

  11. High Levels of Bioplastic Are Produced in Fertile Transplastomic Tobacco Plants Engineered with a Synthetic Operon for the Production of Polyhydroxybutyrate1[C][OA

    Science.gov (United States)

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.

    2011-01-01

    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565

  12. High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate.

    Science.gov (United States)

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D

    2011-04-01

    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

  13. AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration.

    Science.gov (United States)

    Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A

    2015-09-01

    Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

    Science.gov (United States)

    Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

    2018-04-16

    Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

  15. Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

    Science.gov (United States)

    Frías, José E; Flores, Enrique

    2015-07-01

    Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

  16. Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

    Directory of Open Access Journals (Sweden)

    Keyhani Nemat O

    2004-06-01

    Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

  17. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  18. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  19. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    Science.gov (United States)

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  1. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.

    Directory of Open Access Journals (Sweden)

    Jin Hwan Park

    2015-09-01

    Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.

  2. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    OpenAIRE

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  3. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    OpenAIRE

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  4. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  5. A cellular automata model for ant trails

    Indian Academy of Sciences (India)

    In this study, the unidirectional ant traffic flow with U-turn in an ant trail was inves- tigated using ... the literature, it was considered in the model that (i) ant colony consists of two kinds of ants, good- ... ponents without a central controller [8].

  6. ANT, tourism and situated globality

    DEFF Research Database (Denmark)

    Jóhannesson, Gunnar Thór; Ren, Carina Bregnholm; van der Duim, René

    2015-01-01

    viable descriptions of the collective condition of humans and more-than-humans in the Anthropocene. Also and moving past a merely descriptive approach, it discusses it as a useful tool to engage with the situated globalities which come into being through the socio-spatial coupling of tourism......In recent years Actor-network theory (ANT) has increasingly been felt in the field of tourism studies (Van der Duim, Ren, & Jóhannesson, 2012). An important implication of the meeting between ANT and tourism studies is the notion of tourism being described as a heterogeneous assemblage of what we...... are used to define as the separate spheres of nature and culture. This paper explores and relates the central tenets of ANT in tourism with regard to the concept of the Anthropocene. It presents the ANT approach as a flat and object-oriented ontology and methodology and explores its potentials to carve out...

  7. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  8. Ants Orase kultuurisõnum

    Index Scriptorium Estoniae

    2007-01-01

    26. jaanuaril toimub Tallinna Ülikooli Akadeemilises Raamatukogus seminar silmapaistvast Eesti teadlasest ja tõlkijast Ants Orasest. Esinevad kirjandusteadlased Tallinna Ülikoolist, Tartu Ülikoolist ja Eesti Kirjandusmuuseumist. Avaettekandeks on sõna Oklahoma Ülikooli professoril Vincent B. Leitchil, kes oli Ants Orase viimaseks juhendatavaks doktorandiks. Seminari korraldavad Tallinna Ülikool ja Eesti Kirjandusmuuseum. Vt ka Postimees, 26, jaan., lk. 18

  9. Using Ants as bioindicators: Multiscale Issues in Ant Community Ecology

    Directory of Open Access Journals (Sweden)

    Alan Andersen

    1997-06-01

    Full Text Available Ecological patterns and processes are characteristically scale dependent, and research findings often cannot be translated easily from one scale to another. Conservation biology is challenged by a lack of congruence between the spatial scales of ecological research (typically involving small plots and land management (typically involving whole landscapes. Here, I discuss spatial scaling issues as they relate to an understanding of ant communities and, consequently, their use as bioindicators in land management. Our perceptions of fundamental patterns and processes in ant communities depend on scale: taxa that are behaviorally dominant at one scale are not necessarily so at others, functional groups recognized at one scale are often inappropriate for others, and the role of competition in community structure depends on the scale of analysis. Patterns of species richness and composition, and the ability of total richness to be estimated by surrogates, are all also scale dependent. Ant community ecology has a tradition of detailed studies in small plots, but the use of ants as bioindicators requires a predictive understanding of community structure and dynamics at a range of spatial scales. Such an appreciation of ant communities and their most effective use as bioindicators is best served by studies integrating results from plot-scale research with the broad-scale paradigms of biogeography, systematics, and evolutionary biology.

  10. Monoculture of leafcutter ant gardens.

    Directory of Open Access Journals (Sweden)

    Ulrich G Mueller

    2010-09-01

    Full Text Available Leafcutter ants depend on the cultivation of symbiotic Attamyces fungi for food, which are thought to be grown by the ants in single-strain, clonal monoculture throughout the hundreds to thousands of gardens within a leafcutter nest. Monoculture eliminates cultivar-cultivar competition that would select for competitive fungal traits that are detrimental to the ants, whereas polyculture of several fungi could increase nutritional diversity and disease resistance of genetically variable gardens.Using three experimental approaches, we assessed cultivar diversity within nests of Atta leafcutter ants, which are most likely among all fungus-growing ants to cultivate distinct cultivar genotypes per nest because of the nests' enormous sizes (up to 5000 gardens and extended lifespans (10-20 years. In Atta texana and in A. cephalotes, we resampled nests over a 5-year period to test for persistence of resident cultivar genotypes within each nest, and we tested for genetic differences between fungi from different nest sectors accessed through excavation. In A. texana, we also determined the number of Attamyces cells carried as a starter inoculum by a dispersing queens (minimally several thousand Attamyces cells, and we tested for genetic differences between Attamyces carried by sister queens dispersing from the same nest. Except for mutational variation arising during clonal Attamyces propagation, DNA fingerprinting revealed no evidence for fungal polyculture and no genotype turnover during the 5-year surveys.Atta leafcutter ants can achieve stable, fungal monoculture over many years. Mutational variation emerging within an Attamyces monoculture could provide genetic diversity for symbiont choice (gardening biases of the ants favoring specific mutational variants, an analog of artificial selection.

  11. Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

    Science.gov (United States)

    Archana, G.; Naresh Kumar, G.

    2014-01-01

    Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024

  12. Pseudomonas fluorescens ATCC 13525 containing an artificial oxalate operon and Vitreoscilla hemoglobin secretes oxalic acid and solubilizes rock phosphate in acidic alfisols.

    Directory of Open Access Journals (Sweden)

    Kavita Yadav

    Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.

  13. Pest repelling properties of ant pheromones

    DEFF Research Database (Denmark)

    Offenberg, Joachim

    2014-01-01

    Ants control pests via predation and physical deterrence; however, ant communication is based on chemical cues which may serve as warning signals to potential prey and other intruders. The presence of ant pheromones may, thus, be sufficient to repel pests from ant territories. This mini-review sh......-review shows that four out of five tested ant species deposit pheromones that repel herbivorous prey from their host plants.......Ants control pests via predation and physical deterrence; however, ant communication is based on chemical cues which may serve as warning signals to potential prey and other intruders. The presence of ant pheromones may, thus, be sufficient to repel pests from ant territories. This mini...

  14. Induction of the mar operon by miscellaneous groceries.

    Science.gov (United States)

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

    2004-01-01

    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  15. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  16. How ants drop out: ant abundance on tropical mountains.

    Science.gov (United States)

    Longino, John T; Branstetter, Michael G; Colwell, Robert K

    2014-01-01

    In tropical wet forests, ants are a large proportion of the animal biomass, but the factors determining abundance are not well understood. We characterized ant abundance in the litter layer of 41 mature wet forest sites spread throughout Central America (Chiapas, Guatemala, Honduras, Nicaragua, and Costa Rica) and examined the impact of elevation (as a proxy for temperature) and community species richness. Sites were intentionally chosen to minimize variation in precipitation and seasonality. From sea level to 1500 m ant abundance very gradually declined, community richness declined more rapidly than abundance, and the local frequency of the locally most common species increased. These results suggest that within this elevational zone, density compensation is acting, maintaining high ant abundance as richness declines. In contrast, in sites above 1500 m, ant abundance dropped abruptly to much lower levels. Among these high montane sites, community richness explained much more of the variation in abundance than elevation, and there was no evidence of density compensation. The relative stability of abundance below 1500 m may be caused by opposing effects of temperature on productivity and metabolism. Lower temperatures may decrease productivity and thus the amount of food available for consumers, but slower metabolisms of consumers may allow maintenance of higher biomass at lower resource supply rates. Ant communities at these lower elevations may be highly interactive, the result of continuous habitat presence over geological time. High montane sites may be ephemeral in geological time, resulting in non-interactive communities dominated by historical and stochastic processes. Abundance in these sites may be determined by the number of species that manage to colonize and/or avoid extinction on mountaintops.

  17. How ants drop out: ant abundance on tropical mountains.

    Directory of Open Access Journals (Sweden)

    John T Longino

    Full Text Available In tropical wet forests, ants are a large proportion of the animal biomass, but the factors determining abundance are not well understood. We characterized ant abundance in the litter layer of 41 mature wet forest sites spread throughout Central America (Chiapas, Guatemala, Honduras, Nicaragua, and Costa Rica and examined the impact of elevation (as a proxy for temperature and community species richness. Sites were intentionally chosen to minimize variation in precipitation and seasonality. From sea level to 1500 m ant abundance very gradually declined, community richness declined more rapidly than abundance, and the local frequency of the locally most common species increased. These results suggest that within this elevational zone, density compensation is acting, maintaining high ant abundance as richness declines. In contrast, in sites above 1500 m, ant abundance dropped abruptly to much lower levels. Among these high montane sites, community richness explained much more of the variation in abundance than elevation, and there was no evidence of density compensation. The relative stability of abundance below 1500 m may be caused by opposing effects of temperature on productivity and metabolism. Lower temperatures may decrease productivity and thus the amount of food available for consumers, but slower metabolisms of consumers may allow maintenance of higher biomass at lower resource supply rates. Ant communities at these lower elevations may be highly interactive, the result of continuous habitat presence over geological time. High montane sites may be ephemeral in geological time, resulting in non-interactive communities dominated by historical and stochastic processes. Abundance in these sites may be determined by the number of species that manage to colonize and/or avoid extinction on mountaintops.

  18. An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

    Science.gov (United States)

    Varmanen, P; Rantanen, T; Palva, A

    1996-12-01

    A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

  19. Bacterial Infections across the Ants: Frequency and Prevalence of Wolbachia, Spiroplasma, and Asaia

    Directory of Open Access Journals (Sweden)

    Stefanie Kautz

    2013-01-01

    Full Text Available Bacterial endosymbionts are common across insects, but we often lack a deeper knowledge of their prevalence across most organisms. Next-generation sequencing approaches can characterize bacterial diversity associated with a host and at the same time facilitate the fast and simultaneous screening of infectious bacteria. In this study, we used 16S rRNA tag encoded amplicon pyrosequencing to survey bacterial communities of 310 samples representing 221 individuals, 176 colonies and 95 species of ants. We found three distinct endosymbiont groups—Wolbachia (Alphaproteobacteria: Rickettsiales, Spiroplasma (Firmicutes: Entomoplasmatales, and relatives of Asaia (Alphaproteobacteria: Rhodospirillales—at different infection frequencies (at the ant species level: 22.1%, 28.4%, and 14.7%, resp. and relative abundances within bacterial communities (1.0%–99.9%. Spiroplasma was particularly enriched in the ant genus Polyrhachis, while Asaia relatives were most prevalent in arboreal ants of the genus Pseudomyrmex. While Wolbachia and Spiroplasma have been surveyed in ants before, Asaia, an acetic acid bacterium capable of fixing atmospheric nitrogen, has received much less attention. Due to sporadic prevalence across all ant taxa investigated, we hypothesize facultative associations for all three bacterial genera. Infection patterns are discussed in relation to potential adaptation of specific bacteria in certain ant groups.

  20. An ant-plant mutualism through the lens of cGMP-dependent kinase genes.

    Science.gov (United States)

    Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E

    2017-09-13

    In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).

  1. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  2. Generalized antifungal activity and 454-screening of Pseudonocardia and Amycolatopsis bacteria in nests of fungus-growing ants

    OpenAIRE

    Sen, Ruchira; Ishak, Heather D.; Estrada, Dora; Dowd, Scot E.; Hong, Eunki; Mueller, Ulrich G.

    2009-01-01

    In many host-microbe mutualisms, hosts use beneficial metabolites supplied by microbial symbionts. Fungus-growing (attine) ants are thought to form such a mutualism with Pseudonocardia bacteria to derive antibiotics that specifically suppress the coevolving pathogen Escovopsis, which infects the ants' fungal gardens and reduces growth. Here we test 4 key assumptions of this Pseudonocardia-Escovopsis coevolution model. Culture-dependent and culture-independent (tag-encoded 454-pyrosequencing) ...

  3. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    A 2.7 kb DNA fragment encoding the 60 kDa common antigen (CA) and a 13 kDa protein of Legionella micdadei was sequenced. Two open reading frames of 57,677 and 10,456 Da were identified, corresponding to the heat shock proteins GroEL and GroES, respectively. Typical -35, -10, and Shine-Dalgarno heat...

  4. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  5. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

    Science.gov (United States)

    Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

    2013-01-01

    The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  6. Male parentage in army ants

    DEFF Research Database (Denmark)

    Kronauer, Daniel J C; Schöning, Caspar; Boomsma, Jacobus J

    2006-01-01

    of active research in insect sociobiology. Here we present microsatellite data for 176 males from eight colonies of the African army ant Dorylus (Anomma) molestus. Comparison with worker genotypes and inferred queen genotypes from the same colonies show that workers do not or at best very rarely reproduce...

  7. A cellular automata model for ant trails

    Indian Academy of Sciences (India)

    In this study, the unidirectional ant traffic flow with U-turn in an ant trail was investigated using one-dimensional cellular automata model. It is known that ants communicate with each other by dropping a chemical, called pheromone, on the substrate. Apart from the studies in the literature, it was considered in the model that ...

  8. Fungal Adaptations to Mutualistic Life with Ants

    DEFF Research Database (Denmark)

    Kooij, Pepijn Wilhelmus

    Fungus-growing ants (Attini) feed off a fungus they cultivate in a mutualistic symbiosis in underground chambers by providing it substrate they collect outside the colony. The tribe of Attine ants ranges from small colonies of the paleo- and basal Attine species with a few hundred workers that fo...... that the fungus evolved some incredible adaptations to a mutualistic life with the ants....

  9. Elucidation of the regulatory role of the fructose operon reveals a novel target for enhancing the NADPH supply in Corynebacterium glutamicum

    DEFF Research Database (Denmark)

    Wang, Zhihao; Chan, Siu Hung Joshua; Sudarsan, Suresh

    2016-01-01

    is linked to redox and to the general metabolism. We here provide new insights into the regulation of the metabolism of this important platform organism by systematically characterizing mutants carrying various lesions in the fructose operon. Initially, we found that a strain where the dedicated fructose...... uptake system had been inactivated (KO-ptsF) was hampered in growth on sucrose minimal medium, and suppressor mutants appeared readily. Comparative genomic analysis in conjunction with enzymatic assays revealed that suppression was linked to inactivation of the pfkB gene, encoding a fructose-1-phosphate...... kinase. Detailed characterization of KO-ptsF, KO-pfkB and double knock-out (DKO) derivatives revealed a strong role for sugar-phosphates, especially fructose-1-phosphate (F1P), in governing sugar as well as redox metabolism due to effects on transcriptional regulation of key genes. These findings allowed...

  10. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  11. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Science.gov (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  12. Regulation of the rhaEWRBMA Operon Involved in l-Rhamnose Catabolism through Two Transcriptional Factors, RhaR and CcpA, in Bacillus subtilis.

    Science.gov (United States)

    Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro

    2015-12-28

    The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological

  13. Discovery of defense- and neuropeptides in social ants by genome-mining.

    Directory of Open Access Journals (Sweden)

    Christian W Gruber

    Full Text Available Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant, Camponotus floridanus (carpenter ant and Harpegnathos saltator (basal genus. Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulatory peptide hormones, such as allatostatins and tachykinins, were identified and analyzed. Most interestingly we annotated genes that encode oxytocin/vasopressin-related peptides (inotocins and their putative receptors. This is the first piece of evidence for the existence of this nonapeptide hormone system in ants (Formicidae and supports recent findings in Tribolium castaneum (red flour beetle and Nasonia vitripennis (parasitoid wasp, and therefore its confinement to some basal holometabolous insects. By contrast, the absence of the inotocin hormone system in Apis mellifera (honeybee, another closely-related member of the eusocial Hymenoptera clade, establishes the basis for future studies on the molecular evolution and physiological function of oxytocin/vasopressin-related peptides (vasotocin nonapeptide family and their receptors in social insects. Particularly the identification of ant inotocin and defensin peptide sequences will provide a basis for future pharmacological characterization in the quest for potent and selective lead compounds of therapeutic value.

  14. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  15. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  16. Recognition in ants: social origin matters.

    Directory of Open Access Journals (Sweden)

    Joël Meunier

    Full Text Available The ability of group members to discriminate against foreigners is a keystone in the evolution of sociality. In social insects, colony social structure (number of queens is generally thought to influence abilities of resident workers to discriminate between nestmates and non-nestmates. However, whether social origin of introduced individuals has an effect on their acceptance in conspecific colonies remains poorly explored. Using egg-acceptance bioassays, we tested the influence of social origin of queen-laid eggs on their acceptance by foreign workers in the ant Formica selysi. We showed that workers from both single- and multiple-queen colonies discriminated against foreign eggs from single-queen colonies, whereas they surprisingly accepted foreign eggs from multiple-queen colonies. Chemical analyses then demonstrated that social origins of eggs and workers could be discriminated on the basis of their chemical profiles, a signal generally involved in nestmate discrimination. These findings provide the first evidence in social insects that social origins of eggs interfere with nestmate discrimination and are encoded by chemical signatures.

  17. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  19. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Science.gov (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  20. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Science.gov (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  2. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  3. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  4. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  5. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  6. Combined Venom Gland Transcriptomic and Venom Peptidomic Analysis of the Predatory Ant Odontomachus monticola

    Directory of Open Access Journals (Sweden)

    Kohei Kazuma

    2017-10-01

    Full Text Available Ants (hymenoptera: Formicidae have adapted to many different environments and have become some of the most prolific and successful insects. To date, 13,258 ant species have been reported. They have been classified into 333 genera and 17 subfamilies. Except for a few Formicinae, Dolichoderinae, and members of other subfamilies, most ant species have a sting with venom. The venoms are composed of formic acid, alkaloids, hydrocarbons, amines, peptides, and proteins. Unlike the venoms of other animals such as snakes and spiders, ant venoms have seldom been analyzed comprehensively, and their compositions are not yet completely known. In this study, we used both transcriptomic and peptidomic analyses to study the composition of the venom produced by the predatory ant species Odontomachus monticola. The transcriptome analysis yielded 49,639 contigs, of which 92 encoded toxin-like peptides and proteins with 18,106,338 mapped reads. We identified six pilosulin-like peptides by transcriptomic analysis in the venom gland. Further, we found intact pilosulin-like peptide 1 and truncated pilosulin-like peptides 2 and 3 by peptidomic analysis in the venom. Our findings related to ant venom peptides and proteins may lead the way towards development and application of novel pharmaceutical and biopesticidal resources.

  7. Landscape encodings enhance optimization.

    Directory of Open Access Journals (Sweden)

    Konstantin Klemm

    Full Text Available Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state.

  8. Landscape Encodings Enhance Optimization

    Science.gov (United States)

    Klemm, Konstantin; Mehta, Anita; Stadler, Peter F.

    2012-01-01

    Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states) of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state. PMID:22496860

  9. Revolutionizing Remote Exploration with ANTS

    Science.gov (United States)

    Clark, P. E.; Rilee, M. L.; Curtis, S.; Truszkowski, W.

    2002-05-01

    We are developing the Autonomous Nano-Technology Swarm (ANTS) architecture based on an insect colony analogue for the cost-effective, efficient, systematic survey of remote or inaccessible areas with multiple object targets, including planetary surface, marine, airborne, and space environments. The mission context is the exploration in the 2020s of the most compelling remaining targets in the solar system: main belt asteroids. Main belt asteroids harbor important clues to Solar System origins and evolution which are central to NASA's goals in Space Science. Asteroids are smaller than planets, but their number is far greater, and their combined surface area likely dwarfs the Earth's. An asteroid survey will dramatically increase our understanding of the local resources available for the Human Exploration and Development of Space. During the mission composition, shape, gravity, and orbit parameters could be returned to Earth for perhaps several thousand asteroids. A survey of this area will rival the great explorations that encircled this globe, opened up the New World, and laid the groundwork for the progress and challenges of the last centuries. The ANTS architecture for a main belt survey consists of a swarm of as many as a thousand or more highly specialized pico-spacecraft that form teams to survey as many as one hundred asteroids a month. Multi-level autonomy is critical for ANTS and the objective of the proposed study is to work through the implications and constraints this entails. ANTS couples biologically inspired autonomic control for basic functions to higher level artificial intelligence that together enable individual spacecraft to operate as specialized, cooperative, social agents. This revolutionary approach postulates highly advanced, but familiar, components integrated and operated in a way that uniquely transcends any evolutionary extrapolation of existing trends and enables thousand-spacecraft missions.

  10. Ant-plant mutualism: a dietary by-product of a tropical ant's macronutrient requirements.

    Science.gov (United States)

    Arcila Hernández, Lina M; Sanders, Jon G; Miller, Gabriel A; Ravenscraft, Alison; Frederickson, Megan E

    2017-12-01

    Many arboreal ants depend on myrmecophytic plants for both food and shelter; in return, these ants defend their host plants against herbivores, which are often insects. Ant-plant and other mutualisms do not necessarily involve the exchange of costly rewards or services; they may instead result from by-product benefits, or positive outcomes that do not entail a cost for one or both partners. Here, we examined whether the plant-ant Allomerus octoarticulatus pays a short-term cost to defend their host plants against herbivores, or whether plant defense is a by-product benefit of ant foraging for insect prey. Because the food offered by ant-plants is usually nitrogen-poor, arboreal ants may balance their diets by consuming insect prey or associating with microbial symbionts to acquire nitrogen, potentially shifting the costs and benefits of plant defense for the ant partner. To determine the effect of ant diet on an ant-plant mutualism, we compared the behavior, morphology, fitness, stable isotope signatures, and gaster microbiomes of A. octoarticulatus ants nesting in Cordia nodosa trees maintained for nearly a year with or without insect herbivores. At the end of the experiment, ants from herbivore exclosures preferred protein-rich baits more than ants in the control (i.e., herbivores present) treatment. Furthermore, workers in the control treatment were heavier than in the herbivore-exclusion treatment, and worker mass predicted reproductive output, suggesting that foraging for insect prey directly increased ant colony fitness. The gaster microbiome of ants was not significantly affected by the herbivore exclusion treatment. We conclude that the defensive behavior of some phytoecious ants is a by-product of their need for external protein sources; thus, the consumption of insect herbivores by ants benefits both the ant colony and the host plant. © 2017 by the Ecological Society of America.

  11. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  12. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  13. Ecosystem services delivered by weaver ants

    DEFF Research Database (Denmark)

    Offenberg, Joachim

    Weaver ants (Oecopgylla spp.) are increasingly being utilized as efficient biocontrol agents in a number of tropical tree crops, as they prey on pest insects and increase yields. However, recent studies and a review of the literature reveal that a number of other services may derive from the pres......Weaver ants (Oecopgylla spp.) are increasingly being utilized as efficient biocontrol agents in a number of tropical tree crops, as they prey on pest insects and increase yields. However, recent studies and a review of the literature reveal that a number of other services may derive from...... the presence of these ants. First of all, the chemical footprint left by the high density of ants in managed host trees may results in additional benefits. (i) Ant deposits may lead to improved fruit quality, e.g. increased sugar content, (ii) ant deposits may deter important pests (chemical deterrence) from...... crops, and lastly, (iii) ant waste products deposited ias anal spots contain urea that may be taken up by plant leaves and in this way fertilize ant-plants. On top of chemical services, weaver ants have been shown to reduce plant disease incidence via competitive exclusion of other ant species because...

  14. Roadside Survey of Ants on Oahu, Hawaii

    Science.gov (United States)

    Tong, Reina L.; Grace, J. Kenneth; Krushelnycky, Paul D.

    2018-01-01

    Hawaii is home to over 60 ant species, including five of the six most damaging invasive ants. Although there have been many surveys of ants in Hawaii, the last island-wide hand-collection survey of ants on Oahu was conducted in 1988–1994. In 2012, a timed hand-collection of ants was made at 44 sites in a systematic, roadside survey throughout Oahu. Ants were identified and species distribution in relation to elevation, precipitation and soil type was analyzed. To assess possible convenience sampling bias, 15 additional sites were sampled further from roads to compare with the samples near roads. Twenty-four species of ants were found and mapped; Pheidole megacephala (F.), Ochetellus glaber (Mayr), and Technomyrmex difficilis Forel were the most frequently encountered ants. For six ant species, a logistic regression was performed with elevation, average annual precipitation, and soil order as explanatory variables. O. glaber was found in areas with lower precipitation around Oahu. Paratrechina longicornis (Latrielle) and Tetramorium simillimum (Smith, F.) were found more often in lower elevations and in areas with the Mollisol soil order. Elevation, precipitation, and soil type were not significant sources of variation for P. megacephala, Plagiolepis alluaudi Emery, and T. difficilis. P. megacephala was associated with fewer mean numbers of ants where it occurred. Ant assemblages near and far from roads did not significantly differ. Many species of ants remain established on Oahu, and recent invaders are spreading throughout the island. Mapping ant distributions contributes to continued documentation and understanding of these pests. PMID:29439503

  15. Blind encoding into qudits

    International Nuclear Information System (INIS)

    Shaari, J.S.; Wahiddin, M.R.B.; Mancini, S.

    2008-01-01

    We consider the problem of encoding classical information into unknown qudit states belonging to any basis, of a maximal set of mutually unbiased bases, by one party and then decoding by another party who has perfect knowledge of the basis. Working with qudits of prime dimensions, we point out a no-go theorem that forbids 'shift' operations on arbitrary unknown states. We then provide the necessary conditions for reliable encoding/decoding

  16. An encoding device and a method of encoding

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....

  17. Ant Larval Demand Reduces Aphid Colony Growth Rates in an Ant-Aphid Interaction

    Directory of Open Access Journals (Sweden)

    James M. Cook

    2012-02-01

    Full Text Available Ants often form mutualistic interactions with aphids, soliciting honeydew in return for protective services. Under certain circumstances, however, ants will prey upon aphids. In addition, in the presence of ants aphids may increase the quantity or quality of honeydew produced, which is costly. Through these mechanisms, ant attendance can reduce aphid colony growth rates. However, it is unknown whether demand from within the ant colony can affect the ant-aphid interaction. In a factorial experiment, we tested whether the presence of larvae in Lasius niger ant colonies affected the growth rate of Aphis fabae colonies. Other explanatory variables tested were the origin of ant colonies (two separate colonies were used and previous diet (sugar only or sugar and protein. We found that the presence of larvae in the ant colony significantly reduced the growth rate of aphid colonies. Previous diet and colony origin did not affect aphid colony growth rates. Our results suggest that ant colonies balance the flow of two separate resources from aphid colonies- renewable sugars or a protein-rich meal, depending on demand from ant larvae within the nest. Aphid payoffs from the ant-aphid interaction may change on a seasonal basis, as the demand from larvae within the ant colony waxes and wanes.

  18. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  19. The distribution and diversity of insular ants

    DEFF Research Database (Denmark)

    Roura-Pascual, Núria; Sanders, Nate; Hui, Cang

    2016-01-01

    Aim: To examine the relationship between island characteristics (area, distance to the nearest continent, climate and human population size) and ant species richness, as well as the factors underlying global geographical clustering of native and exotic ant composition on islands. Location: One...... hundred and two islands from 20 island groups around the world. Methods: We used spatial linear models that consider the spatial structure of islands to examine patterns of ant species richness. We also performed modularity analyses to identify clusters of islands hosting a similar suite of species...... and constructed conditional inference trees to assess the characteristics of islands that explain the formation of these island-ant groups. Results: Island area was the best predictor of ant species richness. However, distance to the nearest continent was an important predictor of native ant species richness...

  20. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  1. Antígona y la muerte

    OpenAIRE

    Pérez Alcolea, Simona Micaela

    2012-01-01

    La ponencia analiza la muerte de Antígona en la obra de Sófocles. Se propone que su suicidio es un acto consciente de voluntad preanunciado a lo largo de toda la obra y no una medida desesperada. Con ese fin se exploran las posibles motivaciones de Antígona para poner fin a su vida. En el análisis se proponen tres respuestas (no necesariamente excluyentes): -Antígona responde a la ética homérica. Está en lucha con Creón, y su suicidio es su golpe de gracia al poder del rey. -Antígona...

  2. Ant-plant symbioses: Stalking the chuyachaqui.

    Science.gov (United States)

    Davidson, D W; McKey, D

    1993-09-01

    According to Quechua-speaking peoples, orchard-like stands ('Supay Chacras') of two Amazonian ant-plant species are cultivated by the devil, or 'Chuyachaqui'. These "devil gardens" offer extreme examples of specializations that have evolved repeatedly in ant-plant associations. Numerous investigations are beginning to disclose the identity of the Chuyachaqui - the forces behind evolutionary specialization in ant-plant symbioses. These developments have important implications for our understanding of modes of coevolution in symbiotic mutualism, remarkable convergent similarities in the form of ant-plant symbioses on different continents, and pronounced intercontinental differences in the diversity and taxonomic composition of associates. Copyright © 1993. Published by Elsevier Ltd.

  3. From Ant Trails to Pedestrian Dynamics

    Directory of Open Access Journals (Sweden)

    Andreas Schadschneider

    2003-01-01

    Full Text Available This paper presents a model for the simulation of pedestrian dynamics inspired by the behaviour of ants in ant trails. Ants communicate by producing a pheromone that can be smelled by other ants. In this model, pedestrians produce a virtual pheromone that influences the motion of others. In this way all interactions are strictly local, and so even large crowds can be simulated very efficiently. Nevertheless, the model is able to reproduce the collective effects observed empirically, eg the formation of lanes in counterflow. As an application, we reproduce a surprising result found in experiments of evacuation from an aircraft.

  4. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

    Directory of Open Access Journals (Sweden)

    Ziqing eDeng

    2013-07-01

    Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  5. Microorganisms transported by ants induce changes in floral nectar composition of an ant-pollinated plant.

    Science.gov (United States)

    de Vega, Clara; Herrera, Carlos M

    2013-04-01

    Interactions between plants and ants abound in nature and have significant consequences for ecosystem functioning. Recently, it has been suggested that nectar-foraging ants transport microorganisms to flowers; more specifically, they transport yeasts, which can potentially consume sugars and alter nectar composition. Therefore, ants could indirectly change nectar sugar profile, an important floral feature involved in the plant-pollinator mutualism. But this novel role for ants has never been tested. We here investigate the effects of nectarivorous ants and their associated yeasts on the floral nectar sugar composition of an ant-pollinated plant. Differences in the nectar sugar composition of ant-excluded and ant-visited flowers were examined in 278 samples by using high-performance liquid-chromatography. The importance of the genetic identity and density of ant-transported basidiomycetous and ascomycetous yeasts on the variation of nectar traits was also evaluated. Ant visitation had significant effects on nectar sugar composition. The nectar of ant-visited flowers contained significantly more fructose, more glucose, and less sucrose than the nectar of ant-excluded flowers, but these effects were context dependent. Nectar changes were correlated with the density of yeast cells in nectar. The magnitude of the effects of ant-transported ascomycetes was much higher than that of basiodiomycetes. Ants and their associated yeasts induce changes in nectar sugar traits, reducing the chemical control of the plant over this important floral trait. The potential relevance of this new role for ants as indirect nectar modifiers is a rich topic for future research into the ecology of ant-flower interactions.

  6. Pollination and facultative ant-association in the African leopard ...

    African Journals Online (AJOL)

    The role of extra-floral nectar appears to be recruitment of foraging ants to tend the flowers resulting in a facultative ant-association between the orchid and gregarious ants. Four different ant species were found to forage on A. africana's inflorescences. Ant-tended inflorescences suffered significantly less damage by insects.

  7. Michael Jackson antes del caos

    OpenAIRE

    Juan Luciano Nieves

    2015-01-01

    Michael Jackson es un buen ejemplo de cómo utilizar las relaciones públicas para realizar o manipular la imagen de un producto a través de los medios de comunicación. Este ensayo pretende analizar los eventos que tuvieron lugar antes de que el cantante fuera acusado de abuso sexual contra un menor. Dichos eventos formaron parte de un plan muy bien delineado para disminuir los efectos de la inminente crisis que se acercaba. Este trabajo combina la crítica retórica de temas de fantasía con teor...

  8. Viaje Antártico

    OpenAIRE

    Lasa, Gorka

    2017-01-01

    Ah, qué grandiosa sensación esta de poder caminar por los eternos hielos y dejar que mi vista se pierda en el horizonte crepuscular de esta desolada región! Aquellas solitarias islas, lamentos blancos en la distancia, aquellos azules glaciares llorando su neblina de frío y siglos. Al llamado lejano, mi alma se ve arrastrada por los vientos australes. Mítico ensueño que genera en mi imaginación el gran continente antártico. Belleza misteriosa e intimidante de la vastedad casi mágica que envuel...

  9. Foliar uptake of nitrogen from ant fecal droplets: an overlooked service to ant plants

    DEFF Research Database (Denmark)

    Pinkalski, Christian Alexander Stidsen; Jensen, Karl-Martin Vagn; Damgaard, Christian Frølund

    2018-01-01

    and subsequently deposited fecal droplets on the seedlings, coffee leaves showed increased levels of 15N and total N compared to control plants without ants. This was evident for both exposed leaves and leaves covered in plastic bags (i.e. not directly exposed to ants). Thus, N from ant excretions was absorbed...

  10. The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579.

    Science.gov (United States)

    Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier

    2017-01-01

    The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

  11. The evolution of genome size in ants

    Directory of Open Access Journals (Sweden)

    Spagna Joseph C

    2008-02-01

    Full Text Available Abstract Background Despite the economic and ecological importance of ants, genomic tools for this family (Formicidae remain woefully scarce. Knowledge of genome size, for example, is a useful and necessary prerequisite for the development of many genomic resources, yet it has been reported for only one ant species (Solenopsis invicta, and the two published estimates for this species differ by 146.7 Mb (0.15 pg. Results Here, we report the genome size for 40 species of ants distributed across 10 of the 20 currently recognized subfamilies, thus making Formicidae the 4th most surveyed insect family and elevating the Hymenoptera to the 5th most surveyed insect order. Our analysis spans much of the ant phylogeny, from the less derived Amblyoponinae and Ponerinae to the more derived Myrmicinae, Formicinae and Dolichoderinae. We include a number of interesting and important taxa, including the invasive Argentine ant (Linepithema humile, Neotropical army ants (genera Eciton and Labidus, trapjaw ants (Odontomachus, fungus-growing ants (Apterostigma, Atta and Sericomyrmex, harvester ants (Messor, Pheidole and Pogonomyrmex, carpenter ants (Camponotus, a fire ant (Solenopsis, and a bulldog ant (Myrmecia. Our results show that ants possess small genomes relative to most other insects, yet genome size varies three-fold across this insect family. Moreover, our data suggest that two whole-genome duplications may have occurred in the ancestors of the modern Ectatomma and Apterostigma. Although some previous studies of other taxa have revealed a relationship between genome size and body size, our phylogenetically-controlled analysis of this correlation did not reveal a significant relationship. Conclusion This is the first analysis of genome size in ants (Formicidae and the first across multiple species of social insects. We show that genome size is a variable trait that can evolve gradually over long time spans, as well as rapidly, through processes that may

  12. An L-Fucose Operon in the Probiotic Lactobacillus rhamnosus GG Is Involved in Adaptation to Gastrointestinal Conditions.

    Science.gov (United States)

    Becerra, Jimmy E; Yebra, María J; Monedero, Vicente

    2015-06-01

    L-Fucose is a sugar present in human secretions as part of human milk oligosaccharides, mucins, and other glycoconjugates in the intestinal epithelium. The genome of the probiotic Lactobacillus rhamnosus GG (LGG) carries a gene cluster encoding a putative L-fucose permease (fucP), L-fucose catabolic pathway (fucI, fucK, fucU, and fucA), and a transcriptional regulator (fucR). The metabolism of L-fucose in LGG results in 1,2-propanediol production, and their fucI and fucP mutants displayed a severe and mild growth defect on L-fucose, respectively. Transcriptional analysis revealed that the fuc genes are induced by L-fucose and subject to a strong carbon catabolite repression effect. This induction was triggered by FucR, which acted as a transcriptional activator necessary for growth on L-fucose. LGG utilized fucosyl-α1,3-N-acetylglucosamine and contrarily to other lactobacilli, the presence of fuc genes allowed this strain to use the L-fucose moiety. In fucI and fucR mutants, but not in fucP mutant, L-fucose was not metabolized and it was excreted to the medium during growth on fucosyl-α1,3-N-acetylglucosamine. The fuc genes were induced by this fucosyl-disaccharide in the wild type and the fucP mutant but not in a fucI mutant, showing that FucP does not participate in the regulation of fuc genes and that L-fucose metabolism is needed for FucR activation. The l-fucose operon characterized here constitutes a new example of the many factors found in LGG that allow this strain to adapt to the gastrointestinal conditions. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Hybrid chaotic ant swarm optimization

    International Nuclear Information System (INIS)

    Li Yuying; Wen Qiaoyan; Li Lixiang; Peng Haipeng

    2009-01-01

    Chaotic ant swarm optimization (CASO) is a powerful chaos search algorithm that is used to find the global optimum solution in search space. However, the CASO algorithm has some disadvantages, such as lower solution precision and longer computational time, when solving complex optimization problems. To resolve these problems, an improved CASO, called hybrid chaotic swarm optimization (HCASO), is proposed in this paper. The new algorithm introduces preselection operator and discrete recombination operator into the CASO; meanwhile it replaces the best position found by own and its neighbors' ants with the best position found by preselection operator and discrete recombination operator in evolution equation. Through testing five benchmark functions with large dimensionality, the experimental results show the new method enhances the solution accuracy and stability greatly, as well as reduces the computational time and computer memory significantly when compared to the CASO. In addition, we observe the results can become better with swarm size increasing from the sensitivity study to swarm size. And we gain some relations between problem dimensions and swam size according to scalability study.

  14. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  15. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  16. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Czech Academy of Sciences Publication Activity Database

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

    2015-01-01

    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  17. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  18. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  19. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  20. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  1. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  2. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Science.gov (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  4. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  5. The Biochemical Toxin Arsenal from Ant Venoms

    Directory of Open Access Journals (Sweden)

    Axel Touchard

    2016-01-01

    Full Text Available Ants (Formicidae represent a taxonomically diverse group of hymenopterans with over 13,000 extant species, the majority of which inject or spray secretions from a venom gland. The evolutionary success of ants is mostly due to their unique eusociality that has permitted them to develop complex collaborative strategies, partly involving their venom secretions, to defend their nest against predators, microbial pathogens, ant competitors, and to hunt prey. Activities of ant venom include paralytic, cytolytic, haemolytic, allergenic, pro-inflammatory, insecticidal, antimicrobial, and pain-producing pharmacologic activities, while non-toxic functions include roles in chemical communication involving trail and sex pheromones, deterrents, and aggregators. While these diverse activities in ant venoms have until now been largely understudied due to the small venom yield from ants, modern analytical and venomic techniques are beginning to reveal the diversity of toxin structure and function. As such, ant venoms are distinct from other venomous animals, not only rich in linear, dimeric and disulfide-bonded peptides and bioactive proteins, but also other volatile and non-volatile compounds such as alkaloids and hydrocarbons. The present review details the unique structures and pharmacologies of known ant venom proteinaceous and alkaloidal toxins and their potential as a source of novel bioinsecticides and therapeutic agents.

  6. Hey! A Fire Ant Stung Me!

    Science.gov (United States)

    ... Videos for Educators Search English Español Hey! A Fire Ant Stung Me! KidsHealth / For Kids / Hey! A ... Me picó una roja o colorada! What's a Fire Ant? There are many different types of fire ...

  7. The Biochemical Toxin Arsenal from Ant Venoms

    Science.gov (United States)

    Touchard, Axel; Aili, Samira R.; Fox, Eduardo Gonçalves Paterson; Escoubas, Pierre; Orivel, Jérôme; Nicholson, Graham M.; Dejean, Alain

    2016-01-01

    Ants (Formicidae) represent a taxonomically diverse group of hymenopterans with over 13,000 extant species, the majority of which inject or spray secretions from a venom gland. The evolutionary success of ants is mostly due to their unique eusociality that has permitted them to develop complex collaborative strategies, partly involving their venom secretions, to defend their nest against predators, microbial pathogens, ant competitors, and to hunt prey. Activities of ant venom include paralytic, cytolytic, haemolytic, allergenic, pro-inflammatory, insecticidal, antimicrobial, and pain-producing pharmacologic activities, while non-toxic functions include roles in chemical communication involving trail and sex pheromones, deterrents, and aggregators. While these diverse activities in ant venoms have until now been largely understudied due to the small venom yield from ants, modern analytical and venomic techniques are beginning to reveal the diversity of toxin structure and function. As such, ant venoms are distinct from other venomous animals, not only rich in linear, dimeric and disulfide-bonded peptides and bioactive proteins, but also other volatile and non-volatile compounds such as alkaloids and hydrocarbons. The present review details the unique structures and pharmacologies of known ant venom proteinaceous and alkaloidal toxins and their potential as a source of novel bioinsecticides and therapeutic agents. PMID:26805882

  8. Ant aggression and evolutionary stability in plant-ant and plant-pollinator mutualistic interactions.

    Science.gov (United States)

    Oña, L; Lachmann, M

    2011-03-01

    Mutualistic partners derive a benefit from their interaction, but this benefit can come at a cost. This is the case for plant-ant and plant-pollinator mutualistic associations. In exchange for protection from herbivores provided by the resident ants, plants supply various kinds of resources or nests to the ants. Most ant-myrmecophyte mutualisms are horizontally transmitted, and therefore, partners share an interest in growth but not in reproduction. This lack of alignment in fitness interests between plants and ants drives a conflict between them: ants can attack pollinators that cross-fertilize the host plants. Using a mathematical model, we define a threshold in ant aggressiveness determining pollinator survival or elimination on the host plant. In our model we observed that, all else being equal, facultative interactions result in pollinator extinction for lower levels of ant aggressiveness than obligatory interactions. We propose that the capacity to discriminate pollinators from herbivores should not often evolve in ants, and when it does it will be when the plants exhibit limited dispersal in an environment that is not seed saturated so that each seed produced can effectively generate a new offspring or if ants acquire an extra benefit from pollination (e.g. if ants eat fruit). We suggest specific mutualism examples where these hypotheses can be tested empirically. © 2010 The Authors. Journal of Evolutionary Biology © 2010 European Society For Evolutionary Biology.

  9. AntStar: Enhancing Optimization Problems by Integrating an Ant System and A⁎ Algorithm

    Directory of Open Access Journals (Sweden)

    Mohammed Faisal

    2016-01-01

    Full Text Available Recently, nature-inspired techniques have become valuable to many intelligent systems in different fields of technology and science. Among these techniques, Ant Systems (AS have become a valuable technique for intelligent systems in different fields. AS is a computational system inspired by the foraging behavior of ants and intended to solve practical optimization problems. In this paper, we introduce the AntStar algorithm, which is swarm intelligence based. AntStar enhances the optimization and performance of an AS by integrating the AS and A⁎ algorithm. Applying the AntStar algorithm to the single-source shortest-path problem has been done to ensure the efficiency of the proposed AntStar algorithm. The experimental result of the proposed algorithm illustrated the robustness and accuracy of the AntStar algorithm.

  10. Cryptococcus neoformans carried by Odontomachus bauri ants

    Directory of Open Access Journals (Sweden)

    Mariana Santos de Jesus

    2012-06-01

    Full Text Available Cryptococcus neoformans is the most common causative agent of cryptococcosis worldwide. Although this fungus has been isolated from a variety of organic substrates, several studies suggest that hollow trees constitute an important natural niche for C. neoformans. A previously surveyed hollow of a living pink shower tree (Cassia grandis positive for C. neoformans in the city of Rio de Janeiro, Brazil, was chosen for further investigation. Odontomachus bauri ants (trap-jaw ants found inside the hollow were collected for evaluation as possible carriers of Cryptococcus spp. Two out of 10 ants were found to carry phenoloxidase-positive colonies identified as C. neoformans molecular types VNI and VNII. The ants may have acted as a mechanical vector of C. neoformans and possibly contributed to the dispersal of the fungi from one substrate to another. To the best of our knowledge, this is the first report on the association of C. neoformans with ants of the genus Odontomachus.

  11. Recurrence analysis of ant activity patterns.

    Directory of Open Access Journals (Sweden)

    Felipe Marcel Neves

    Full Text Available In this study, we used recurrence quantification analysis (RQA and recurrence plots (RPs to compare the movement activity of individual workers of three ant species, as well as a gregarious beetle species. RQA and RPs quantify the number and duration of recurrences of a dynamical system, including a detailed quantification of signals that could be stochastic, deterministic, or both. First, we found substantial differences between the activity dynamics of beetles and ants, with the results suggesting that the beetles have quasi-periodic dynamics and the ants do not. Second, workers from different ant species varied with respect to their dynamics, presenting degrees of predictability as well as stochastic signals. Finally, differences were found among minor and major caste of the same (dimorphic ant species. Our results underscore the potential of RQA and RPs in the analysis of complex behavioral patterns, as well as in general inferences on animal behavior and other biological phenomena.

  12. Ants defend aphids against lethal disease

    Science.gov (United States)

    Nielsen, Charlotte; Agrawal, Anurag A.; Hajek, Ann E.

    2010-01-01

    Social insects defend their own colonies and some species also protect their mutualist partners. In mutualisms with aphids, ants typically feed on honeydew produced by aphids and, in turn guard and shelter aphid colonies from insect natural enemies. Here we report that Formica podzolica ants tending milkweed aphids, Aphis asclepiadis, protect aphid colonies from lethal fungal infections caused by an obligate aphid pathogen, Pandora neoaphidis. In field experiments, bodies of fungal-killed aphids were quickly removed from ant-tended aphid colonies. Ant workers were also able to detect infective conidia on the cuticle of living aphids and responded by either removing or grooming these aphids. Our results extend the long-standing view of ants as mutualists and protectors of aphids by demonstrating focused sanitizing and quarantining behaviour that may lead to reduced disease transmission in aphid colonies. PMID:19923138

  13. Persistence of pollination mutualisms in the presence of ants.

    Science.gov (United States)

    Wang, Yuanshi; Wang, Shikun

    2015-01-01

    This paper considers plant-pollinator-ant systems in which the plant-pollinator interaction is mutualistic but ants have both positive and negative effects on plants. The ants also interfere with pollinators by preventing them from accessing plants. While a Beddington-DeAngelis (BD) formula can describe the plant-pollinator interaction, the formula is extended in this paper to characterize the pollination mutualism under the ant interference. Then, a plant-pollinator-ant system with the extended BD functional response is discussed, and global dynamics of the model demonstrate the mechanisms by which pollination mutualism can persist in the presence of ants. When the ant interference is strong, it can result in extinction of pollinators. Moreover, if the ants depend on pollination mutualism for survival, the strong interference could drive pollinators into extinction, which consequently lead to extinction of the ants themselves. When the ant interference is weak, a cooperation between plant-ant and plant-pollinator mutualisms could occur, which promotes survival of both ants and pollinators, especially in the case that ants (respectively, pollinators) cannot survive in the absence of pollinators (respectively, ants). Even when the level of ant interference remains invariant, varying ants' negative effect on plants can result in survival/extinction of both ants and pollinators. Therefore, our results provide an explanation for the persistence of pollination mutualism when there exist ants.

  14. Michael Jackson antes del caos

    Directory of Open Access Journals (Sweden)

    Juan Luciano Nieves

    2015-01-01

    Full Text Available Michael Jackson es un buen ejemplo de cómo utilizar las relaciones públicas para realizar o manipular la imagen de un producto a través de los medios de comunicación. Este ensayo pretende analizar los eventos que tuvieron lugar antes de que el cantante fuera acusado de abuso sexual contra un menor. Dichos eventos formaron parte de un plan muy bien delineado para disminuir los efectos de la inminente crisis que se acercaba. Este trabajo combina la crítica retórica de temas de fantasía con teoría de comunicación.

  15. Individual Recognition in Ant Queens

    DEFF Research Database (Denmark)

    D'Ettorre, Patrizia; Heinze, Jürgen

    2005-01-01

    Personal relationships are the cornerstone of vertebrate societies, but insect societies are either too large for individual recognition, or their members were assumed to lack the necessary cognitive abilities 1 and 2 . This paradigm has been challenged by the recent discovery that paper wasps...... recognize each other's unique facial color patterns [3] . Individual recognition is advantageous when dominance hierarchies control the partitioning of work and reproduction 2 and 4 . Here, we show that unrelated founding queens of the ant Pachycondyla villosa use chemical cues to recognize each other...... individually. Aggression was significantly lower in pairs of queens that had previously interacted than in pairs with similar social history but no experience with one another. Moreover, subordinates discriminated familiar and unfamiliar dominants in choice experiments in which physical contact, but not odor...

  16. FDTD-ANT User Manual

    Science.gov (United States)

    Zimmerman, Martin L.

    1995-01-01

    This manual explains the theory and operation of the finite-difference time domain code FDTD-ANT developed by Analex Corporation at the NASA Lewis Research Center in Cleveland, Ohio. This code can be used for solving electromagnetic problems that are electrically small or medium (on the order of 1 to 50 cubic wavelengths). Calculated parameters include transmission line impedance, relative effective permittivity, antenna input impedance, and far-field patterns in both the time and frequency domains. The maximum problem size may be adjusted according to the computer used. This code has been run on the DEC VAX and 486 PC's and on workstations such as the Sun Sparc and the IBM RS/6000.

  17. Harnessing ant defence at fruits reduces bruchid seed predation in a symbiotic ant-plant mutualism.

    Science.gov (United States)

    Pringle, Elizabeth G

    2014-06-22

    In horizontally transmitted mutualisms, mutualists disperse separately and reassemble in each generation with partners genetically unrelated to those in the previous generation. Because of this, there should be no selection on either partner to enhance the other's reproductive output directly. In symbiotic ant-plant mutualisms, myrmecophytic plants host defensive ant colonies, and ants defend the plants from herbivores. Plants and ants disperse separately, and, although ant defence can indirectly increase plant reproduction by reducing folivory, it is unclear whether ants can also directly increase plant reproduction by defending seeds. The neotropical tree Cordia alliodora hosts colonies of Azteca pittieri ants. The trees produce domatia where ants nest at stem nodes and also at the node between the peduncle and the rachides of the infloresence. Unlike the stem domatia, these reproductive domatia senesce after the tree fruits each year. In this study, I show that the tree's resident ant colony moves into these ephemeral reproductive domatia, where they tend honeydew-producing scale insects and patrol the nearby developing fruits. The presence of ants significantly reduced pre-dispersal seed predation by Amblycerus bruchid beetles, thereby directly increasing plant reproductive output.

  18. Collective search by ants in microgravity

    Directory of Open Access Journals (Sweden)

    Stefanie M. Countryman

    2015-03-01

    Full Text Available The problem of collective search is a tradeoff between searching thoroughly and covering as much area as possible. This tradeoff depends on the density of searchers. Solutions to the problem of collective search are currently of much interest in robotics and in the study of distributed algorithms, for example to design ways that without central control robots can use local information to perform search and rescue operations. Ant colonies operate without central control. Because they can perceive only local, mostly chemical and tactile cues, they must search collectively to find resources and to monitor the colony's environment. Examining how ants in diverse environments solve the problem of collective search can elucidate how evolution has led to diverse forms of collective behavior. An experiment on the International Space Station in January 2014 examined how ants (Tetramorium caespitum perform collective search in microgravity. In the ISS experiment, the ants explored a small arena in which a barrier was lowered to increase the area and thus lower ant density. In microgravity, relative to ground controls, ants explored the area less thoroughly and took more convoluted paths. It appears that the difficulty of holding on to the surface interfered with the ants’ ability to search collectively. Ants frequently lost contact with the surface, but showed a remarkable ability to regain contact with the surface.

  19. a permutation encoding te algorithm solution of reso tation encoding

    African Journals Online (AJOL)

    eobe

    Keywords: Genetic algorithm, resource constrained. 1. INTRODUCTION. 1. .... Nigerian Journal of Technology. Vol. 34, No. 1, January 2015. 128 ... 4. ENCODING OF CHROMOSOME. ENCODING OF CHROMOSOME .... International Multi conference of Engineers and ... method”, Naval Research Logistics, vol 48, issue 2,.

  20. Ant-lepidopteran associations along African forest edges

    Science.gov (United States)

    Dejean, Alain; Azémar, Frédéric; Libert, Michel; Compin, Arthur; Hérault, Bruno; Orivel, Jérôme; Bouyer, Thierry; Corbara, Bruno

    2017-02-01

    Working along forest edges, we aimed to determine how some caterpillars can co-exist with territorially dominant arboreal ants (TDAAs) in tropical Africa. We recorded caterpillars from 22 lepidopteran species living in the presence of five TDAA species. Among the defoliator and/or nectarivorous caterpillars that live on tree foliage, the Pyralidae and Nymphalidae use their silk to protect themselves from ant attacks. The Notodontidae and lycaenid Polyommatinae and Theclinae live in direct contact with ants; the Theclinae even reward ants with abundant secretions from their Newcomer gland. Lichen feeders (lycaenid; Poritiinae), protected by long bristles, also live among ants. Some lycaenid Miletinae caterpillars feed on ant-attended membracids, including in the shelters where the ants attend them; Lachnocnema caterpillars use their forelegs to obtain trophallaxis from their host ants. Caterpillars from other species live inside weaver ant nests. Those of the genus Euliphyra (Miletinae) feed on ant prey and brood and can obtain trophallaxis, while those from an Eberidae species only prey on host ant eggs. Eublemma albifascia (Erebidae) caterpillars use their thoracic legs to obtain trophallaxis and trophic eggs from ants. Through transfer bioassays of last instars, we noted that herbivorous caterpillars living in contact with ants were always accepted by alien conspecific ants; this is likely due to an intrinsic appeasing odor. Yet, caterpillars living in ant shelters or ant nests probably acquire cues from their host colonies because they were considered aliens and killed. We conclude that co-evolution with ants occurred similarly in the Heterocera and Rhopalocera.

  1. Pheromone disruption of Argentine ant trail integrity

    Science.gov (United States)

    Suckling, D.M.; Peck, R.W.; Manning, L.M.; Stringer, L.D.; Cappadonna, J.; El-Sayed, A. M.

    2008-01-01

    Disruption of Argentine ant trail following and reduced ability to forage (measured by bait location success) was achieved after presentation of an oversupply of trail pheromone, (Z)-9-hexadecenal. Experiments tested single pheromone point sources and dispersion of a formulation in small field plots. Ant walking behavior was recorded and digitized by using video tracking, before and after presentation of trail pheromone. Ants showed changes in three parameters within seconds of treatment: (1) Ants on trails normally showed a unimodal frequency distribution of walking track angles, but this pattern disappeared after presentation of the trail pheromone; (2) ants showed initial high trail integrity on a range of untreated substrates from painted walls to wooden or concrete floors, but this was significantly reduced following presentation of a point source of pheromone; (3) the number of ants in the pheromone-treated area increased over time, as recruitment apparently exceeded departures. To test trail disruption in small outdoor plots, the trail pheromone was formulated with carnuba wax-coated quartz laboratory sand (1 g quartz sand/0.2 g wax/1 mg pheromone). The pheromone formulation, with a half-life of 30 h, was applied by rotary spreader at four rates (0, 2.5, 7.5, and 25 mg pheromone/m2) to 1- and 4-m2 plots in Volcanoes National Park, Hawaii. Ant counts at bait cards in treated plots were significantly reduced compared to controls on the day of treatment, and there was a significant reduction in ant foraging for 2 days. These results show that trail pheromone disruption of Argentine ants is possible, but a much more durable formulation is needed before nest-level impacts can be expected. ?? 2008 Springer Science+Business Media, LLC.

  2. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  3. Parallel encoders for pixel detectors

    International Nuclear Information System (INIS)

    Nikityuk, N.M.

    1991-01-01

    A new method of fast encoding and determining the multiplicity and coordinates of fired pixels is described. A specific example construction of parallel encodes and MCC for n=49 and t=2 is given. 16 refs.; 6 figs.; 2 tabs

  4. What do myrmecophagous geckos eat when ants are not available ...

    African Journals Online (AJOL)

    Like other Pristurus species, P. samhaensis on Samha and P. sokotranus on Socotra were highly myrmecophagous (76.7% and 38.6% ants, respectively). However, ants were absent from the diet of P. samhaensis on Darsa. In contrast to the rich native ant fauna of the other islands, only one ant species was reported for ...

  5. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Science.gov (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  6. Ants as tools in sustainable agriculture

    DEFF Research Database (Denmark)

    Offenberg, Joachim

    2015-01-01

    1. With an expanding human population placing increasing pressure on the environment, agriculture needs sustainable production that can match conventional methods. Integrated pest management (IPM) is more sustainable, but not necessarily as efficient as conventional non-sustainable measures. 2...... in multiple crops. Their efficiency is comparable to chemical pesticides or higher, while at lower costs. They provide a rare example of documented efficient conservation biological control. 3. Weaver ants share beneficial traits with almost 13 000 other ant species and are unlikely to be unique...... of agricultural systems, this review emphasizes the potential of managing ants to achieve sustainable pest management solutions. The synthesis suggests future directions and may catalyse a research agenda on the utilization of ants, not only against arthropod pests, but also against weeds and plant diseases...

  7. Kunstikriitik Ants Juske sai doktoriks / Neeme Korv

    Index Scriptorium Estoniae

    Korv, Neeme, 1974-

    2003-01-01

    Tartu Kõrgema Kunstikooli rektor Ants Juske kaitses 7. veebruaril Tallinnas Kunstiakadeemias edukalt doktoriväitekirja, juhendajaks oli professor Boris Bernštein ning oponeerisid doktor Altti Kuusamo Soomest ja professor Peeter Tulviste

  8. Fungal enzymes in the attine ant symbiosis

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan

    the more basal attine genera use substrates such as flowers, plant debris, small twigs, insect feces and insect carcasses. This diverse array of fungal substrates across the attine lineage implies that the symbiotic fungus needs different enzymes to break down the plant material that the ants provide...... or different efficiencies of enzyme function. Fungal enzymes that degrade plant cell walls may have functionally co-evolved with the ants in this scenario. We explore this hypothesis with direct measurements of enzyme activity in fungus gardens in 12 species across 8 genera spanning the entire phylogeny...... and diversity of life-styles within the attine clade. We find significant differences in enzyme activity between different genera and life-styles of the ants. How these findings relate to attine ant coevolution and crop optimization are discussed....

  9. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  10. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  11. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Science.gov (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  12. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  13. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Science.gov (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  14. Exotic ants (Hymenoptera, Formicidae) of Ohio

    OpenAIRE

    Ivanov,Kal

    2016-01-01

    The worldwide transfer of plants and animals outside their native ranges is an ever increasing problem for global biodiversity. Ants are no exception and many species have been transported to new locations often with profound negative impacts on local biota. The current study is based on data gathered since the publication of the “Ants of Ohio” in 2005. Here I expand on our knowledge of Ohio’s myrmecofauna by contributing new records, new distributional information and natural history notes. ...

  15. Improving Emergency Management by Modeling Ant Colonies

    Science.gov (United States)

    2015-03-01

    perform functions such as nursing the brood or maintaining the nest. The more mature workers will begin to travel outside the nest to perform foraging...small sized ants predominantly act in functional roles such as nurses or transport services within the nest. The larger sizes predominantly function...stages: the founding stage, the ergonomic stage, and the reproductive stage. The founding stage is marked by a queen ant successful mating and laying

  16. Extrafloral nectar fuels ant life in deserts

    OpenAIRE

    Aranda-Rickert, Adriana; Diez, Patricia; Marazzi, Brigitte

    2014-01-01

    Interactions mediated by extrafloral nectary (EFN)-bearing plants that reward ants with a sweet liquid secretion are well documented in temperate and tropical habitats. However, their distribution and abundance in deserts are poorly known. In this study, we test the predictions that biotic interactions between EFN plants and ants are abundant and common also in arid communities and that EFNs are only functional when new vegetative and reproductive structures are developing. In a seasonal dese...

  17. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Science.gov (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  18. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

    OpenAIRE

    Ahn, Sang-Joon; Burne, Robert A.

    2006-01-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  19. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  20. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    International Nuclear Information System (INIS)

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

    2010-01-01

    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  1. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  2. Chemically armed mercenary ants protect fungus-farming societies

    DEFF Research Database (Denmark)

    Adams, Rachelle Martha Marie; Liberti, Joanito; Illum, Anders A.

    2013-01-01

    guest ants are sufficient to kill raiders that invariably exterminate host nests without a cohabiting guest ant colony. We also show that the odor of guest ants discourages raider scouts from recruiting nestmates to host colonies. Our results imply that Sericomyrmex fungus-growers obtain a net benefit......The ants are extraordinary in having evolved many lineages that exploit closely related ant societies as social parasites, but social parasitism by distantly related ants is rare. Here we document the interaction dynamics among a Sericomyrmex fungus-growing ant host, a permanently associated...... parasitic guest ant of the genus Megalomyrmex, and a raiding agro-predator of the genus Gnamptogenys. We show experimentally that the guest ants protect their host colonies against agro-predator raids using alkaloid venom that is much more potent than the biting defenses of the host ants. Relatively few...

  3. Toxic industrial deposit remediation by ant activity

    Science.gov (United States)

    Jilkova, Veronika; Frouz, Jan

    2016-04-01

    Toxic industrial deposits are often contaminated by heavy metals and the substrates have low pH values. In such systems, soil development is thus slowed down by high toxicity and acidic conditions which are unfavourable to soil fauna. Ants (Hymenoptera, Formicidae) are considered tolerant to heavy metal pollution and are known to increase organic matter content and microbial activity in their nests. Here, we focused on soil remediation caused by three ant species (Formica sanguinea, Lasius niger, and Tetramorium sp.) in an ore-washery sedimentation basin near Chvaletice (Czech Republic). Soil samples were taken from the centre of ant nests and from the nest surroundings (>3 m from nests). Samples were then analyzed for microbial activity and biomass and contents of organic matter and nutrients. As a result, ant species that most influenced soil properties was F. sanguinea as there were higher microbial activity and total nitrogen and ammonia contents in ant nests than in the surrounding soil. We expected such a result because F. sanguinea builds conspicuous large nests and is a carnivorous species that brings substantial amounts of nitrogen in insect prey to their nests. Effects of the other two ant species might be lower because of smaller nests and different feeding habits as they rely mainly on honeydew from aphids or on plant seeds that do not contain much nutrients.

  4. Congestion and communication in confined ant traffic

    Science.gov (United States)

    Gravish, Nick; Gold, Gregory; Zangwill, Andrew; Goodisman, Michael A. D.; Goldman, Daniel I.

    2014-03-01

    Many social animals move and communicate within confined spaces. In subterranean fire ants Solenopsis invicta, mobility within crowded nest tunnels is important for resource and information transport. Within confined tunnels, communication and traffic flow are at odds: trafficking ants communicate through tactile interactions while stopped, yet ants that stop to communicate impose physical obstacles on the traffic. We monitor the bi-directional flow of fire ant workers in laboratory tunnels of varied diameter D. The persistence time of communicating ant aggregations, τ, increases approximately linearly with the number of participating ants, n. The sensitivity of traffic flow increases as D decreases and diverges at a minimum diameter, Dc. A cellular automata model incorporating minimal traffic features--excluded volume and communication duration--reproduces features of the experiment. From the model we identify a competition between information transfer and the need to maintain jam-free traffic flow. We show that by balancing information transfer and traffic flow demands, an optimum group strategy exists which maximizes information throughput. We acknowledge funding from NSF PoLS #0957659 and #PHY-1205878.

  5. Fire ants perpetually rebuild sinking towers

    Science.gov (United States)

    Phonekeo, Sulisay; Mlot, Nathan; Monaenkova, Daria; Hu, David L.; Tovey, Craig

    2017-07-01

    In the aftermath of a flood, fire ants, Solenopsis invicta, cluster into temporary encampments. The encampments can contain hundreds of thousands of ants and reach over 30 ants high. How do ants build such tall structures without being crushed? In this combined experimental and theoretical study, we investigate the shape and rate of construction of ant towers around a central support. The towers are bell shaped, consistent with towers of constant strength such as the Eiffel tower, where each element bears an equal load. However, unlike the Eiffel tower, the ant tower is built through a process of trial and error, whereby failed portions avalanche until the final shape emerges. High-speed and novel X-ray videography reveal that the tower constantly sinks and is rebuilt, reminiscent of large multicellular systems such as human skin. We combine the behavioural rules that produce rafts on water with measurements of adhesion and attachment strength to model the rate of growth of the tower. The model correctly predicts that the growth rate decreases as the support diameter increases. This work may inspire the design of synthetic swarms capable of building in vertical layers.

  6. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  7. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Science.gov (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  8. Cuticular hydrocarbons correlate with queen reproductive status in native and invasive Argentine ants (Linepithema humile, Mayr)

    Science.gov (United States)

    Diaz, Mireia; Lenoir, Alain; Ivon Paris, Carolina; Boulay, Raphaël; Gómez, Crisanto

    2018-01-01

    In insect societies, chemical communication plays an important role in colony reproduction and individual social status. Many studies have indicated that cuticular hydrocarbons (CHCs) are the main chemical compounds encoding reproductive status. However, these studies have largely focused on queenless or monogynous species whose workers are capable of egg laying and have mainly explored the mechanisms underlying queen-worker or worker-worker reproductive conflicts. Less is known about what occurs in highly polygynous ant species with permanently sterile workers. Here, we used the Argentine ant as a model to examine the role of CHCs in communicating reproductive information in such insect societies. The Argentine ant is unicolonial, highly polygynous, and polydomous. We identified several CHCs whose presence and levels were correlated with queen age, reproductive status, and fertility. Our results also provide new insights into queen executions in the Argentine ant, a distinctive feature displayed by this species in its introduced range. Each spring, just before new sexuals appear, workers eliminate up to 90% of the mated queens in their colonies. We discovered that queens that survived execution had different CHC profiles from queens present before and during execution. More specifically, levels of some CHCs were higher in the survivors, suggesting that workers could eliminate queens based on their chemical profiles. In addition, queen CHC profiles differed based on season and species range (native vs. introduced). Overall, the results of this study provide new evidence that CHCs serve as queen signals and do more than just regulate worker reproduction. PMID:29470506

  9. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Science.gov (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  10. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  11. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  12. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  13. Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis.

    Science.gov (United States)

    Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha

    2014-11-01

    Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

  14. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  15. Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

    Science.gov (United States)

    Marincola, Gabriella; Wolz, Christiane

    2017-06-02

    In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    Science.gov (United States)

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-01-22

    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  17. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  18. A new tessera into the interactome of the isc operon:A novel interaction between HscB and IscS

    Directory of Open Access Journals (Sweden)

    Annalisa Pastore

    2016-09-01

    Full Text Available Iron sulfur clusters are essential universal prosthetic groups which can be formed inorganically but, in biology, are bound to proteins and produced enzymatically. Most of the components of the machine that produces the clusters are conserved throughout evolution. In bacteria, they are encoded in the isc operon. Previous reports provide information on the role of specific components but a clear picture of how the whole machine works is still missing. We have carried out a study of the effects of the co-chaperone HscB from the model system E. coli. We document a previously undetected weak interaction between the chaperone HscB and the desulfurase IscS, one of the two main players of the machine. The binding site involves a region of HscB in the longer stem of the approximately L-shaped molecules, whereas the interacting surface of IscS overlaps with the surface previously involved in binding other proteins, such as ferredoxin and frataxin. Our findings provide an entirely new perspective to our comprehension of the role of HscB and propose this protein as a component of the IscS complex.

  19. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  20. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  1. The distribution of weaver ant pheromones on host trees

    DEFF Research Database (Denmark)

    Offenberg, Joachim

    2007-01-01

    The visible anal spots deposited by Oecophylla smaragdina ants have been suggested to deter ant prey, affect interspecific competition and facilitate mutualists and parasites in tracking down Oecophylla ants. I measured the density of anal spots on host trees with and without ants and tested for ...... to leaves. Also there was a positive correlation between spot density and the likelihood of being detected by ants. Anal spots may thus function as reliable cues to interacting species and be an important factor in shaping the community around Oecophylla colonies.......The visible anal spots deposited by Oecophylla smaragdina ants have been suggested to deter ant prey, affect interspecific competition and facilitate mutualists and parasites in tracking down Oecophylla ants. I measured the density of anal spots on host trees with and without ants and tested...... for correlations between spot density, ant activity and the likelihood of being detected by an ant. Spots were only found on trees with ants. On ant-trees, spots were distributed throughout the trees but with higher densities in areas with high ant activity and pheromone densities were higher on twigs compared...

  2. Selecting Operations for Assembler Encoding

    Directory of Open Access Journals (Sweden)

    Tomasz Praczyk

    2010-04-01

    Full Text Available Assembler Encoding is a neuro-evolutionary method in which a neural network is represented in the form of a simple program called Assembler Encoding Program. The task of the program is to create the so-called Network Definition Matrix which maintains all the information necessary to construct the network. To generate Assembler Encoding Programs and the subsequent neural networks evolutionary techniques are used.
    The performance of Assembler Encoding strongly depends on operations used in Assembler Encoding Programs. To select the most effective operations, experiments in the optimization and the predator-prey problem were carried out. In the experiments, Assembler Encoding Programs equipped with different types of operations were tested. The results of the tests are presented at the end of the paper.

  3. Fuzzy Rules for Ant Based Clustering Algorithm

    Directory of Open Access Journals (Sweden)

    Amira Hamdi

    2016-01-01

    Full Text Available This paper provides a new intelligent technique for semisupervised data clustering problem that combines the Ant System (AS algorithm with the fuzzy c-means (FCM clustering algorithm. Our proposed approach, called F-ASClass algorithm, is a distributed algorithm inspired by foraging behavior observed in ant colonyT. The ability of ants to find the shortest path forms the basis of our proposed approach. In the first step, several colonies of cooperating entities, called artificial ants, are used to find shortest paths in a complete graph that we called graph-data. The number of colonies used in F-ASClass is equal to the number of clusters in dataset. Hence, the partition matrix of dataset founded by artificial ants is given in the second step, to the fuzzy c-means technique in order to assign unclassified objects generated in the first step. The proposed approach is tested on artificial and real datasets, and its performance is compared with those of K-means, K-medoid, and FCM algorithms. Experimental section shows that F-ASClass performs better according to the error rate classification, accuracy, and separation index.

  4. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  5. Isolation of the phe-operon from G. stearothermophilus comprising the phenol degradative meta-pathway genes and a novel transcriptional regulator

    Directory of Open Access Journals (Sweden)

    Reiss Monika

    2008-11-01

    Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate

  6. Kin-informative recognition cues in ants

    DEFF Research Database (Denmark)

    Nehring, Volker; Evison, Sophie E F; Santorelli, Lorenzo A

    2011-01-01

    behaviour is thought to be rare in one of the classic examples of cooperation--social insect colonies--because the colony-level costs of individual selfishness select against cues that would allow workers to recognize their closest relatives. In accord with this, previous studies of wasps and ants have...... found little or no kin information in recognition cues. Here, we test the hypothesis that social insects do not have kin-informative recognition cues by investigating the recognition cues and relatedness of workers from four colonies of the ant Acromyrmex octospinosus. Contrary to the theoretical...... prediction, we show that the cuticular hydrocarbons of ant workers in all four colonies are informative enough to allow full-sisters to be distinguished from half-sisters with a high accuracy. These results contradict the hypothesis of non-heritable recognition cues and suggest that there is more potential...

  7. Ant parasite queens revert to mating singly

    DEFF Research Database (Denmark)

    Sumner, Seirian; Hughes, William Owen Hamar; Pedersen, Jes Søe

    2004-01-01

    quantified and they tend to be similar in related species. Here we compare the mating strategies of the leaf-cutting ant Acromyrmex echinatior and its recently derived social parasite Acromyrmex insinuator, which is also its closest relative 2 (see Fig. 1 ). We find that although the host queens mate with up......A parasitic ant has abandoned the multiple mating habit of the queens of its related host. Multiple mating (polyandry) is widespread among animal groups, particularly insects 1 . But the factors that maintain it and underlie its evolution are hard to verify because benefits and costs are not easily...... to a dozen different males, the social parasite mates only singly. This rapid and surprising reversion to single mating in a socially parasitic ant indicates that the costs of polyandry are probably specific to a free-living lifestyle....

  8. The worldwide expansion of the Argentine ant

    DEFF Research Database (Denmark)

    Vogel, Valerie; Pedersen, Jes Søe; Giraud, Tatiana

    2010-01-01

    Aim The aim of this study was to determine the number of successful establishments of the invasive Argentine ant outside native range and to see whether introduced supercolonies have resulted from single or multiple introductions. We also compared the genetic diversity of native versus introduced...... supercolonies to assess the size of the propagules (i.e. the number of founding individuals) at the origin of the introduced supercolonies. Location Global. Methods We used mitochondrial DNA (mtDNA) markers and microsatellite loci to study 39 supercolonies of the Argentine ant Linepithema humile covering both......) and secondary introductions (from sites with established invasive supercolonies) were important in the global expansion of the Argentine ant. In combination with the similar social organization of colonies in the native and introduced range, this indicates that invasiveness did not evolve recently as a unique...

  9. Desert ants learn vibration and magnetic landmarks.

    Directory of Open Access Journals (Sweden)

    Cornelia Buehlmann

    Full Text Available The desert ants Cataglyphis navigate not only by path integration but also by using visual and olfactory landmarks to pinpoint the nest entrance. Here we show that Cataglyphis noda can additionally use magnetic and vibrational landmarks as nest-defining cues. The magnetic field may typically provide directional rather than positional information, and vibrational signals so far have been shown to be involved in social behavior. Thus it remains questionable if magnetic and vibration landmarks are usually provided by the ants' habitat as nest-defining cues. However, our results point to the flexibility of the ants' navigational system, which even makes use of cues that are probably most often sensed in a different context.

  10. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    Science.gov (United States)

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  11. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

    Science.gov (United States)

    Lei, Mei G; Lee, Chia Y

    2015-12-01

    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  12. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Science.gov (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  13. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  14. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  15. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  16. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    NARCIS (Netherlands)

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  17. Ant-plants and fungi: a new threeway symbiosis.

    Science.gov (United States)

    Defossez, Emmanuel; Selosse, Marc-André; Dubois, Marie-Pierre; Mondolot, Laurence; Faccio, Antonella; Djieto-Lordon, Champlain; McKey, Doyle; Blatrix, Rumsaïs

    2009-06-01

    Symbioses between plants and fungi, fungi and ants, and ants and plants all play important roles in ecosystems. Symbioses involving all three partners appear to be rare. Here, we describe a novel tripartite symbiosis in which ants and a fungus inhabit domatia of an ant-plant, and present evidence that such interactions are widespread. We investigated 139 individuals of the African ant-plant Leonardoxa africana for occurrence of fungus. Behaviour of mutualist ants toward the fungus within domatia was observed using a video camera fitted with an endoscope. Fungi were identified by sequencing a fragment of their ribosomal DNA. Fungi were always present in domatia occupied by mutualist ants but never in domatia occupied by opportunistic or parasitic ants. Ants appear to favour the propagation, removal and maintenance of the fungus. Similar fungi were associated with other ant-plants in Cameroon. All belong to the ascomycete order Chaetothyriales; those from L. africana formed a monophyletic clade. These new plant-ant-fungus associations seem to be specific, as demonstrated within Leonardoxa and as suggested by fungal phyletic identities. Such tripartite associations are widespread in African ant-plants but have long been overlooked. Taking fungal partners into account will greatly enhance our understanding of symbiotic ant-plant mutualisms.

  18. Ants of the Peloponnese, Greece (Hymenoptera: Formicidae

    Directory of Open Access Journals (Sweden)

    Borowiec Lech

    2017-09-01

    Full Text Available This paper relates to material obtained during two field trips to the Peloponnese in 2013 and 2016. With the inclusion of some hitherto unpublished ant material, it gives new records from a total of 92 sampling localities. 129 species (including morphospecies not attributed to any known taxon of ants have been recorded from the Peloponnese (southern Greece, 27 of which have been recorded from this region for the first time. Lasius reginae and 5 other morphospecies attributed only to species complexes are new to Greece.

  19. Image Edge Tracking via Ant Colony Optimization

    Science.gov (United States)

    Li, Ruowei; Wu, Hongkun; Liu, Shilong; Rahman, M. A.; Liu, Sanchi; Kwok, Ngai Ming

    2018-04-01

    A good edge plot should use continuous thin lines to describe the complete contour of the captured object. However, the detection of weak edges is a challenging task because of the associated low pixel intensities. Ant Colony Optimization (ACO) has been employed by many researchers to address this problem. The algorithm is a meta-heuristic method developed by mimicking the natural behaviour of ants. It uses iterative searches to find the optimal solution that cannot be found via traditional optimization approaches. In this work, ACO is employed to track and repair broken edges obtained via conventional Sobel edge detector to produced a result with more connected edges.

  20. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

    2005-01-01

    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  1. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    Science.gov (United States)

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  2. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  3. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  4. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

    Science.gov (United States)

    Ghosh, Semanti; Bagchi, Angshuman

    2015-12-01

    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  5. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

    Science.gov (United States)

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

    2014-09-01

    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    International Nuclear Information System (INIS)

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

    1986-01-01

    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

  7. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

    Science.gov (United States)

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

    2016-01-01

    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Oecophylla smaragdina food conversion efficiency: prospects for ant farming

    DEFF Research Database (Denmark)

    Offenberg, Hans Joachim

    2011-01-01

    can be combined with the use of the ants in biological control programmes in tropical plantations where pest insects are converted into ant biomass. To assess the cost-benefits of ant farming based on artificial feeding, food consumption and food conversion efficiency (ECI) of Oecophylla smaragdina......Oecophylla ants are sold at high prices on several commercial markets as a human delicacy, as pet food or as traditional medicine. Currently markets are supplied by ants collected from the wild; however, an increasing interest in ant farming exists as all harvest is easily sold and as ant farming...... selling prices these efficiencies led to rates of return from 1.52 to 4.56, respectively, if: (i) protein is supplied from commercial products; or (ii) alternatively supplied from free sources such as insects and kitchen waste. These results suggest that Oecophylla ant farming may become highly profitable...

  9. Hybrid Bee Ant Colony Algorithm for Effective Load Balancing And ...

    African Journals Online (AJOL)

    PROF. OLIVER OSUAGWA

    Ant Colony algorithm is used in this hybrid Bee Ant Colony algorithm to solve load balancing issues ... Genetic Algorithm (MO-GA) for dynamic job scheduling that .... Information Networking and Applications Workshops. [7]. M. Dorigo & T.

  10. The use of weaver ants (Oecophylla spp.) in tropical agriculture

    DEFF Research Database (Denmark)

    Offenberg, Hans Joachim

    2011-01-01

    by the consumed pest insects, can be harvested and utilised for nutrition as they are tasty and high in proteins, vitamins and minerals. Thus, plantations may function as ant farms and in addition to plant production also hosts the production of edible animal protein. In this setup harmful pest insects are turned...... farming as a way forward to solve an increasing future demand for protein. Weaver ant farming may build on natural food collected by the ants or alternatively be boosted by feeding the ant colonies actively with protein and sugar. In both cases, when ant biocontrol is combined with ant farming......, the environmental cost of protein production may fall even lower than for other insects as the ants feed on pests that would otherwise reduce the plant yield and since the farming area is simultaneously in use for plant production. In this presentation I provide data showing (i) how the harvest of ants can...

  11. Dealing with water deficit in Atta ant colonies: large ants scout for water while small ants transport it

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Da-Silva

    2012-07-01

    Leafcutter ants (Atta sexdens rubropilosa (Forel 1908 have an elaborate social organization, complete with caste divisions. Activities carried out by specialist groups contribute to the overall success and survival of the colony when it is confronted with environmental challenges such as dehydration. Ants detect variations in humidity inside the nest and react by activating several types of behavior that enhance water uptake and decrease water loss, but it is not clear whether or not a single caste collects water regardless of the cost of bringing this resource back to the colony. Accordingly, we investigated water collection activities in three colonies of Atta sexdens rubropilosa experimentally exposed to water stress. Specifically, we analyzed whether or not the same ant caste foraged for water, regardless of the absolute energetic cost (distance of transporting this resource back to the colony. Our experimental design offered water sources at 0 m, 1 m and 10 m from the nest. We studied the body size of ants near the water sources from the initial offer of water (time  =  0 to 120 min, and tested for specialization. We observed a reduction in the average size and variance of ants that corroborated the specialization hypothesis. Although the temporal course of specialization changed with distance, the final outcome was similar among distances. Thus, we conclude that, for this species, a specialist (our use of the word “specialist” does not mean exclusive task force is responsible for collecting water, regardless of the cost of transporting water back to the colony.

  12. Extended phenotype: nematodes turn ants into bird-dispersed fruits

    DEFF Research Database (Denmark)

    Hughes, D P; Kronauer, D J C; Boomsma, J J

    2008-01-01

    A recent study has discovered a novel extended phenotype of a nematode which alters its ant host to resemble ripe fruit. The infected ants are in turn eaten by frugivorous birds that disperse the nematode's eggs.......A recent study has discovered a novel extended phenotype of a nematode which alters its ant host to resemble ripe fruit. The infected ants are in turn eaten by frugivorous birds that disperse the nematode's eggs....

  13. Histrionicotoxin alkaloids finally detected in an ant

    DEFF Research Database (Denmark)

    Jones, Tappey H.; Adams, Rachelle Martha Marie; Spande, Thomas F.

    2012-01-01

    Workers of the ant Carebarella bicolor collected in Panama were found to have two major poison-frog alkaloids, cis- and trans-fused decahydroquinolines (DHQs) of the 269AB type, four minor 269AB isomers, two minor 269B isomers, and three isomers of DHQ 271D. For the first time in an ant, however......) sp., were found to have a very similar DHQ complex but failed to show HTXs. Several new DHQ alkaloids of MW 271 (named in the frog as 271G) are reported from the above ants that have both m/z 202 and 204 as major fragment ions, unlike the spectrum seen for the poison-frog alkaloid 271D, which has...... only an m/z 204 base peak. Found also for the first time in skin extracts from the comparison frog Oophaga granulifera of Costa Rica is a trace DHQ of MW 273. It is coded as 273F in the frog; a different isomer is found in the ant....

  14. Ants, rodents and seed predation in Proteaceae

    African Journals Online (AJOL)

    ... their nests extremely rapidly. One benefit of the ant-plant interaction may be seed escape ... (odourless to humans when dry) household glue or, b) placing seed in a Petri dish ... the layout of exclosures was completed. Response was not as.

  15. The evolution of invasiveness in garden ants

    DEFF Research Database (Denmark)

    Cremer, Sylvia; Ugelvig, Line Vej; Drijfhout, Falko P

    2008-01-01

    It is unclear why some species become successful invaders whilst others fail, and whether invasive success depends on pre-adaptations already present in the native range or on characters evolving de-novo after introduction. Ants are among the worst invasive pests, with Lasius neglectus and its ra...

  16. The ejaculatory biology of leafcutter ants

    DEFF Research Database (Denmark)

    den Boer, Susanne; Stürup, Marlene; Boomsma, Jacobus Jan

    2015-01-01

    understanding of the fundamental biology of ejaculate production, transfer and physiological function remains extremely limited. We studied the ejaculation process in the leafcutter ant Atta colombica and found that it starts with the appearance of a clear pre-ejaculatory fluid (PEF) at the tip...

  17. Mating, hybridisation and introgression in Lasius ants

    NARCIS (Netherlands)

    Have, van der T.M.; Pedersen, J.S.; Boomsma, J.J.

    2011-01-01

    Recent reviews have shown that hybridisation among ant species is likely to be more common than previously appreciated. but that documented cases of introgression remain rare. After molecular phylogenetic work had shown that European Lasius niger (LINNAEUS, 1758) and L. psammophilus SEIFERT, 1992

  18. Recognition of social identity in ants

    DEFF Research Database (Denmark)

    Bos, Nick; d'Ettorre, Patrizia

    2012-01-01

    Recognizing the identity of others, from the individual to the group level, is a hallmark of society. Ants, and other social insects, have evolved advanced societies characterized by efficient social recognition systems. Colony identity is mediated by colony specific signature mixtures, a blend...

  19. Plasmodium parasitaemia among pregnant women attending ante ...

    African Journals Online (AJOL)

    ... Ante-Natal Clinic at Military Hospital Port Harcourt, Rivers State, Nigeria using the Standard parasitological technique. Venous blood was collected from 200 pregnant women, both thick and thin blood films were made on clean greese-free glass slide and stained with 10% Giemsa stains diluted with 7.2 buffered water for ...

  20. Operant conditioning in the ant Myrmica sabuleti.

    Science.gov (United States)

    Cammaerts, M C

    2004-11-30

    Operant conditioning could be obtained in the ant Myrmica sabuleti by presenting to the workers, during a six-day period, an apparatus containing either sugared water or meat as a reward. The conditioning obtained using sugared water as a reward was short lasting. A reconditioning was more persistent and lasted four hours. The ants' response was very precise, since they exhibited it only in front of an apparatus identical to that used during the training phase. Operant conditioning obtained using meat as a reward was more pronounced than that obtained by using sugared water, probably because meat is more valuable as a reward than sugar for the species studied, which is essentially a carnivorous one. Such a conditioning was rather persistent. Indeed, a first operant conditioning obtained by using meat as a reward could still be detected after seven hours, and a reconditioning was still significant after eight hours. One day after this eight-hour period without rewarding the ants, the response was higher again and a further day later, it was still significant. Since the operant conditioning is easy to perform and quantify and since the ants' response is very precise, such a conditioning can be used for further studying M. sabuleti workers' visual perception.

  1. A global database of ant species abundances

    Science.gov (United States)

    Gibb, Heloise; Dunn, Rob R.; Sanders, Nathan J.; Grossman, Blair F.; Photakis, Manoli; Abril, Silvia; Agosti, Donat; Andersen, Alan N.; Angulo, Elena; Armbrecht, Ingre; Arnan, Xavier; Baccaro, Fabricio B.; Bishop, Tom R.; Boulay, Raphael; Bruhl, Carsten; Castracani, Cristina; Cerda, Xim; Del Toro, Israel; Delsinne, Thibaut; Diaz, Mireia; Donoso, David A.; Ellison, Aaron M.; Enriquez, Martha L.; Fayle, Tom M.; Feener Jr., Donald H.; Fisher, Brian L.; Fisher, Robert N.; Fitpatrick, Matthew C.; Gomez, Cristanto; Gotelli, Nicholas J.; Gove, Aaron; Grasso, Donato A.; Groc, Sarah; Guenard, Benoit; Gunawardene, Nihara; Heterick, Brian; Hoffmann, Benjamin; Janda, Milan; Jenkins, Clinton; Kaspari, Michael; Klimes, Petr; Lach, Lori; Laeger, Thomas; Lattke, John; Leponce, Maurice; Lessard, Jean-Philippe; Longino, John; Lucky, Andrea; Luke, Sarah H.; Majer, Jonathan; McGlynn, Terrence P.; Menke, Sean; Mezger, Dirk; Mori, Alessandra; Moses, Jimmy; Munyai, Thinandavha Caswell; Pacheco, Renata; Paknia, Omid; Pearce-Duvet, Jessica; Pfeiffer, Martin; Philpott, Stacy M.; Resasco, Julian; Retana, Javier; Silva, Rogerio R.; Sorger, Magdalena D.; Souza, Jorge; Suarez, Andrew V.; Tista, Melanie; Vasconcelos, Heraldo L.; Vonshak, Merav; Weiser, Michael D.; Yates, Michelle; Parr, Catherine L.

    2017-01-01

    What forces structure ecological assemblages? A key limitation to general insights about assemblage structure is the availability of data that are collected at a small spatial grain (local assemblages) and a large spatial extent (global coverage). Here, we present published and unpublished data from 51,388 ant abundance and occurrence records of more than 2693 species and 7953 morphospecies from local assemblages collected at 4212 locations around the world. Ants were selected because they are diverse and abundant globally, comprise a large fraction of animal biomass in most terrestrial communities, and are key contributors to a range of ecosystem functions. Data were collected between 1949 and 2014, and include, for each geo-referenced sampling site, both the identity of the ants collected and details of sampling design, habitat type and degree of disturbance. The aim of compiling this dataset was to provide comprehensive species abundance data in order to test relationships between assemblage structure and environmental and biogeographic factors. Data were collected using a variety of standardised methods, such as pitfall and Winkler traps, and will be valuable for studies investigating large-scale forces structuring local assemblages. Understanding such relationships is particularly critical under current rates of global change. We encourage authors holding additional data on systematically collected ant assemblages, especially those in dry and cold, and remote areas, to contact us and contribute their data to this growing dataset.

  2. Transcriptional activation of the glycolytic las operon and catabolite repression of the gal operon in Lactococcus lactis are mediated by the catabolite control protein CcpA

    NARCIS (Netherlands)

    Luesink, Evert J.; Herpen, René E.M.A. van; Grossiord, Benoît P.; Kuipers, Oscar P.; Vos, Willem M. de

    1998-01-01

    The Lactococcus lactis ccpA gene, encoding the global regulatory protein CcpA, was identified and characterized. Northern blot and primer extension analyses showed that the L. lactis ccpA gene is constitutively transcribed from a promoter that does not contain a cre sequence. Inactivation of the

  3. Studies on the environmental implications of ants (Hymenoptera ...

    African Journals Online (AJOL)

    A study of ants associated wh two synanthropcenvironments in Awka was carried out in 2008 using pitfall and bait traps. The study yelded a total of 561 ants wth 409 obtaned from the hemisynanthrophic environment while 192 ants were collected from the endophilic environment. The percentage occurrence, total dstribution ...

  4. Dynamics of an ant-plant-pollinator model

    Science.gov (United States)

    Wang, Yuanshi; DeAngelis, Donald L.; Nathaniel Holland, J.

    2015-03-01

    In this paper, we consider plant-pollinator-ant systems in which plant-pollinator interaction and plant-ant interaction are both mutualistic, but there also exists interference of pollinators by ants. The plant-pollinator interaction can be described by a Beddington-DeAngelis formula, so we extend the formula to characterize plant-pollinator mutualisms, including the interference by ants, and form a plant-pollinator-ant model. Using dynamical systems theory, we show uniform persistence of the model. Moreover, we demonstrate conditions under which boundary equilibria are globally asymptotically stable. The dynamics exhibit mechanisms by which the three species could coexist when ants interfere with pollinators. We define a threshold in ant interference. When ant interference is strong, it can drive plant-pollinator mutualisms to extinction. Furthermore, if the ants depend on pollination mutualism for their persistence, then sufficiently strong ant interference could lead to their own extinction as well. Yet, when ant interference is weak, plant-ant and plant-pollinator mutualisms can promote the persistence of one another.

  5. Ants Orasest ja Anne Lange monograafiast / Jüri Talvet

    Index Scriptorium Estoniae

    Talvet, Jüri, 1945-

    2005-01-01

    Arvustus: Oras, Ants. Luulekool. I, Apoloogia / koostajad Hando Runnel ja Jaak Rähesoo. Tartu : Ilmamaa, 2003 ; Oras, Ants. Luulekool II, Meistriklass. Tartu : Ilmamaa, 2004 ; Lange, Anne. Ants Oras : [kirjandusteadlane, -kriitik ja tõlkija (1900-1982)]. Tartu : Ilmamaa, 2004

  6. Are ant feces nutrients for plants? A metabolomics approach to elucidate the nutritional effects on plants hosting weaver ants

    DEFF Research Database (Denmark)

    Vidkjær, Nanna Hjort; Wollenweber, Bernd; Gislum, René

    2015-01-01

    Weaver ants (genus Oecophylla) are tropical carnivorous ant species living in high numbers in the canopies of trees. The ants excrete copious amounts of fecal matter on leaf surfaces, and these feces may provide nutrients to host trees. This hypothesis is supported by studies of ant......-plant interactions involving other ant species that have demonstrated the transfer of nutrients from ants to plants. In this 7-months study, a GC–MS-based metabolomics approach along with an analysis of total nitrogen and carbon levels was used to study metabolic changes in ant-hosting Coffea arabica plants compared...... with control plants. The results showed elevated levels of total nitrogen, amino acids, fatty acids, caffeine, and secondary metabolites of the phenylpropanoid pathway in leaves from ant-hosting plants. Minor effects were observed for sugars, whereas little or no effect was observed for organic acids, despite...

  7. Plant lock and ant key: pairwise coevolution of an exclusion filter in an ant-plant mutualism.

    Science.gov (United States)

    Brouat, C; Garcia, N; Andary, C; McKey, D

    2001-10-22

    Although observations suggest pairwise coevolution in specific ant-plant symbioses, coevolutionary processes have rarely been demonstrated. We report on, what is to the authors' knowledge, the strongest evidence yet for reciprocal adaptation of morphological characters in a species-specific ant-plant mutualism. The plant character is the prostoma, which is a small unlignified organ at the apex of the domatia in which symbiotic ants excavate an entrance hole. Each myrmecophyte in the genus Leonardoxa has evolved a prostoma with a different shape. By performing precise measurements on the prostomata of three related myrmecophytes, on their specific associated ants and on the entrance holes excavated by symbiotic ants at the prostomata, we showed that correspondence of the plant and ant traits forms a morphological and behavioural filter. We have strong evidence for coevolution between the dimensions and shape of the symbiotic ants and the prostoma in one of the three ant-Leonardoxa associations.

  8. Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

    Science.gov (United States)

    Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

    2002-08-06

    The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

  9. Interactive effects of soil-dwelling ants, ant mounds and simulated grazing on local plant community composition

    NARCIS (Netherlands)

    Veen, G.F.; Olff, H.

    2011-01-01

    Interactions between aboveground vertebrate herbivores and subterranean yellow meadow ants (Lasius flavus) can drive plant community patterns in grassland ecosystems. Here, we study the relative importance of the presence of ants (L. flavus) and ant mounds under different simulated grazing regimes

  10. Edge detection in digital images using Ant Colony Optimization

    Directory of Open Access Journals (Sweden)

    Marjan Kuchaki Rafsanjani

    2015-11-01

    Full Text Available Ant Colony Optimization (ACO is an optimization algorithm inspired by the behavior of real ant colonies to approximate the solutions of difficult optimization problems. In this paper, ACO is introduced to tackle the image edge detection problem. The proposed approach is based on the distribution of ants on an image; ants try to find possible edges by using a state transition function. Experimental results show that the proposed method compared to standard edge detectors is less sensitive to Gaussian noise and gives finer details and thinner edges when compared to earlier ant-based approaches.

  11. Analysing and Comparing Encodability Criteria

    Directory of Open Access Journals (Sweden)

    Kirstin Peters

    2015-08-01

    Full Text Available Encodings or the proof of their absence are the main way to compare process calculi. To analyse the quality of encodings and to rule out trivial or meaningless encodings, they are augmented with quality criteria. There exists a bunch of different criteria and different variants of criteria in order to reason in different settings. This leads to incomparable results. Moreover it is not always clear whether the criteria used to obtain a result in a particular setting do indeed fit to this setting. We show how to formally reason about and compare encodability criteria by mapping them on requirements on a relation between source and target terms that is induced by the encoding function. In particular we analyse the common criteria full abstraction, operational correspondence, divergence reflection, success sensitiveness, and respect of barbs; e.g. we analyse the exact nature of the simulation relation (coupled simulation versus bisimulation that is induced by different variants of operational correspondence. This way we reduce the problem of analysing or comparing encodability criteria to the better understood problem of comparing relations on processes.

  12. The Pied Piper: A Parasitic Beetle's Melodies Modulate Ant Behaviours.

    Directory of Open Access Journals (Sweden)

    Andrea Di Giulio

    Full Text Available Ants use various communication channels to regulate their social organisation. The main channel that drives almost all the ants' activities and behaviours is the chemical one, but it is long acknowledged that the acoustic channel also plays an important role. However, very little is known regarding exploitation of the acoustical channel by myrmecophile parasites to infiltrate the ant society. Among social parasites, the ant nest beetles (Paussus are obligate myrmecophiles able to move throughout the colony at will and prey on the ants, surprisingly never eliciting aggression from the colonies. It has been recently postulated that stridulatory organs in Paussus might be evolved as an acoustic mechanism to interact with ants. Here, we survey the role of acoustic signals employed in the Paussus beetle-Pheidole ant system. Ants parasitised by Paussus beetles produce caste-specific stridulations. We found that Paussus can "speak" three different "languages", each similar to sounds produced by different ant castes (workers, soldiers, queen. Playback experiments were used to test how host ants respond to the sounds emitted by Paussus. Our data suggest that, by mimicking the stridulations of the queen, Paussus is able to dupe the workers of its host and to be treated as royalty. This is the first report of acoustic mimicry in a beetle parasite of ants.

  13. The interactions of ants with their biotic environment.

    Science.gov (United States)

    Chomicki, Guillaume; Renner, Susanne S

    2017-03-15

    This s pecial feature results from the symposium 'Ants 2016: ant interactions with their biotic environments' held in Munich in May 2016 and deals with the interactions between ants and other insects, plants, microbes and fungi, studied at micro- and macroevolutionary levels with a wide range of approaches, from field ecology to next-generation sequencing, chemical ecology and molecular genetics. In this paper, we review key aspects of these biotic interactions to provide background information for the papers of this s pecial feature After listing the major types of biotic interactions that ants engage in, we present a brief overview of ant/ant communication, ant/plant interactions, ant/fungus symbioses, and recent insights about ants and their endosymbionts. Using a large molecular clock-dated Formicidae phylogeny, we map the evolutionary origins of different ant clades' interactions with plants, fungi and hemiptera. Ants' biotic interactions provide ideal systems to address fundamental ecological and evolutionary questions about mutualism, coevolution, adaptation and animal communication. © 2017 The Author(s).

  14. Ant species confer different partner benefits on two neotropical myrmecophytes.

    Science.gov (United States)

    Frederickson, Megan E

    2005-04-01

    The dynamics of mutualistic interactions involving more than a single pair of species depend on the relative costs and benefits of interaction among alternative partners. The neotropical myrmecophytes Cordia nodosa and Duroia hirsuta associate with several species of obligately symbiotic ants. I compared the ant partners of Cordia and Duroia with respect to two benefits known to be important in ant-myrmecophyte interactions: protection against herbivores provided by ants, and protection against encroaching vegetation provided by ants. Azteca spp., Myrmelachista schumanni, and Allomerus octoarticulatus demerarae ants all provide the leaves of Cordia and Duroia some protection against herbivores. However, Azteca and Allomerus provide more protection than does Myrmelachista to the leaves of their host plants. Although Allomerus protects the leaves of its hosts, plants occupied by Allomerus suffer more attacks by herbivores to their stems than do plants occupied by other ants. Relative to Azteca or Allomerus, Myrmelachista ants provide better protection against encroaching vegetation, increasing canopy openness over their host plants. These differences in benefits among the ant partners of Cordia and Duroia are reflected in the effect of each ant species on host plant size, growth rate, and reproduction. The results of this study show how mutualistic ant partners can differ with respect to both the magnitude and type of benefits they provide to the same species of myrmecophytic host.

  15. Fast and flexible: argentine ants recruit from nearby trails.

    Directory of Open Access Journals (Sweden)

    Tatiana P Flanagan

    Full Text Available Argentine ants (Linepithema humile live in groups of nests connected by trails to each other and to stable food sources. In a field study, we investigated whether some ants recruit directly from established, persistent trails to food sources, thus accelerating food collection. Our results indicate that Argentine ants recruit nestmates to food directly from persistent trails, and that the exponential increase in the arrival rate of ants at baits is faster than would be possible if recruited ants traveled from distant nests. Once ants find a new food source, they walk back and forth between the bait and sometimes share food by trophallaxis with nestmates on the trail. Recruiting ants from nearby persistent trails creates a dynamic circuit, like those found in other distributed systems, which facilitates a quick response to changes in available resources.

  16. Host ant independent oviposition in the parasitic butterfly Maculinea alcon

    DEFF Research Database (Denmark)

    Fürst, Matthias A; Nash, David Richard

    2010-01-01

    to host-ant nests and non-host-ant nests, and the number and position of eggs attached were assessed. Our results show no evidence for host-ant-based oviposition in M. alcon, but support an oviposition strategy based on plant characteristics. This suggests that careful management of host-ant distribution......Parasitic Maculinea alcon butterflies can only develop in nests of a subset of available Myrmica ant species, so female butterflies have been hypothesized to preferentially lay eggs on plants close to colonies of the correct host ants. Previous correlational investigations of host......-ant-dependent oviposition in this and other Maculinea species have, however, shown equivocal results, leading to a long-term controversy over support for this hypothesis. We therefore conducted a controlled field experiment to study the egg-laying behaviour of M. alcon. Matched potted Gentiana plants were set out close...

  17. Exploring with PAM: Prospecting ANTS Missions for Solar System Surveys

    Science.gov (United States)

    Clark, P. E.; Rilee, M. L.; Curtis, S. A.

    2003-01-01

    ANTS (Autonomous Nano-Technology Swarm), a large (1000 member) swarm of nano to picoclass (10 to 1 kg) totally autonomous spacecraft, are being developed as a NASA advanced mission concept. ANTS, based on a hierarchical insect social order, use an evolvable, self-similar, hierarchical neural system in which individual spacecraft represent the highest level nodes. ANTS uses swarm intelligence attained through collective, cooperative interactions of the nodes at all levels of the system. At the highest levels this can take the form of cooperative, collective behavior among the individual spacecraft in a very large constellation. The ANTS neural architecture is designed for totally autonomous operation of complex systems including spacecraft constellations. The ANTS (Autonomous Nano Technology Swarm) concept has a number of possible applications. A version of ANTS designed for surveying and determining the resource potential of the asteroid belt, called PAM (Prospecting ANTS Mission), is examined here.

  18. Fast and flexible: argentine ants recruit from nearby trails.

    Science.gov (United States)

    Flanagan, Tatiana P; Pinter-Wollman, Noa M; Moses, Melanie E; Gordon, Deborah M

    2013-01-01

    Argentine ants (Linepithema humile) live in groups of nests connected by trails to each other and to stable food sources. In a field study, we investigated whether some ants recruit directly from established, persistent trails to food sources, thus accelerating food collection. Our results indicate that Argentine ants recruit nestmates to food directly from persistent trails, and that the exponential increase in the arrival rate of ants at baits is faster than would be possible if recruited ants traveled from distant nests. Once ants find a new food source, they walk back and forth between the bait and sometimes share food by trophallaxis with nestmates on the trail. Recruiting ants from nearby persistent trails creates a dynamic circuit, like those found in other distributed systems, which facilitates a quick response to changes in available resources.

  19. Using pleometrosis (multiple queens) and pupae transplantation to boost weaver ant (Oecophylla smaragdina) colony growth in ant nurseries

    DEFF Research Database (Denmark)

    Offenberg, Hans Joachim; Nielsen, Mogens Gissel; Peng, Renkang

    2011-01-01

    Weaver ants (Oecophylla spp.) are increasingly being used for biocontrol and are targeted for future production of insect protein in ant farms. An efficient production of live ant colonies may facilitate the utilization of these ants but the production of mature colonies is hampered by the long...... and no transplantation. Thus, in ant nurseries the use of multiple queens during nest founding as well as transplantation of pupae from foreign colonies may be utilised to decrease the time it takes to produce a colony ready for implementation....

  20. Identification of Structural and Immunity Genes of a Class IIb Bacteriocin Encoded in the Enterocin A Operon of Enterococcus faecium Strain MXVK29.

    Science.gov (United States)

    Escamilla-Martínez, E E; Cisneros, Y M Álvarez; Fernández, F J; Quirasco-Baruch, M; Ponce-Alquicira, E

    2017-10-09

    The Enterococcus faecium strain MXVK29, isolated from fermented sausages, produces a bacteriocin with a molecular mass of 3.5 kDa that belongs to the class of enterocins II.1, according to the terminal amino acid sequence, and has been identified as enterocin A. This bacteriocin is active against selected strains of Listeria, Staphylococcus, Pediococcus, and Enterococcus. In this study, we identified the genes adjacent to the structural gene for this bacteriocin, such as the immunity gene (entI) and the inducer gene (entF). Accessory genes for this bacteriocin, such as entK, entR, and entT, were identified as well, in addition to the orf2 and orf3, showing a high identity with class IIb peptides bacteriocins. The orf2 shows the consensus motif GxxxG, similar to those shown by bacteriocins such as PlnNC8α, EntCα, and Ent1071A, whereas orf3 shows a consensus motif SxxxS similar to that present in PlnNC8β (AxxxA). PlnNC8 is expressed only in bacterial cocultures, so there is the possibility that the expression of this two-peptide bacteriocin can be induced by a similar mechanism. So far, only the expression of enterocin A has been found in this strain; however, the presence of the genes ent29α and ent29β opens the possibility for further research on its induction, functionality, and origin. Although there are reports on this type of bacteriocin (EntX, EntC, and Ent1071) in other strains of E. faecium, no report exists yet on an Enterococcus strain producing two different classes of bacteriocin.

  1. Elucidation of the regulatory role of the fructose operon reveals a novel target for enhancing the NADPH supply in Corynebacterium glutamicum.

    Science.gov (United States)

    Wang, Zhihao; Chan, Siu Hung Joshua; Sudarsan, Suresh; Blank, Lars M; Jensen, Peter Ruhdal; Solem, Christian

    2016-11-01

    The performance of Corynebacterium glutamicum cell factories producing compounds which rely heavily on NADPH has been reported to depend on the sugar being metabolized. While some aspects of this phenomenon have been elucidated, there are still many unresolved questions as to how sugar metabolism is linked to redox and to the general metabolism. We here provide new insights into the regulation of the metabolism of this important platform organism by systematically characterizing mutants carrying various lesions in the fructose operon. Initially, we found that a strain where the dedicated fructose uptake system had been inactivated (KO-ptsF) was hampered in growth on sucrose minimal medium, and suppressor mutants appeared readily. Comparative genomic analysis in conjunction with enzymatic assays revealed that suppression was linked to inactivation of the pfkB gene, encoding a fructose-1-phosphate kinase. Detailed characterization of KO-ptsF, KO-pfkB and double knock-out (DKO) derivatives revealed a strong role for sugar-phosphates, especially fructose-1-phosphate (F1P), in governing sugar as well as redox metabolism due to effects on transcriptional regulation of key genes. These findings allowed us to propose a simple model explaining the correlation between sugar phosphate concentration, gene expression and ultimately the observed phenotype. To guide us in our analysis and help us identify bottlenecks in metabolism we debugged an existing genome-scale model onto which we overlaid the transcriptome data. Based on the results obtained we managed to enhance the NADPH supply and transform the wild-type strain into delivering the highest yield of lysine ever obtained on sucrose and fructose, thus providing a good example of how regulatory mechanisms can be harnessed for bioproduction. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  2. Optic disc detection using ant colony optimization

    Science.gov (United States)

    Dias, Marcy A.; Monteiro, Fernando C.

    2012-09-01

    The retinal fundus images are used in the treatment and diagnosis of several eye diseases, such as diabetic retinopathy and glaucoma. This paper proposes a new method to detect the optic disc (OD) automatically, due to the fact that the knowledge of the OD location is essential to the automatic analysis of retinal images. Ant Colony Optimization (ACO) is an optimization algorithm inspired by the foraging behaviour of some ant species that has been applied in image processing for edge detection. Recently, the ACO was used in fundus images to detect edges, and therefore, to segment the OD and other anatomical retinal structures. We present an algorithm for the detection of OD in the retina which takes advantage of the Gabor wavelet transform, entropy and ACO algorithm. Forty images of the retina from DRIVE database were used to evaluate the performance of our method.

  3. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Directory of Open Access Journals (Sweden)

    Orlando Díaz-Hernández

    2010-07-01

    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  4. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

    Science.gov (United States)

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  5. A global database of ant species abundances

    Czech Academy of Sciences Publication Activity Database

    Gibb, H.; Dunn, R. R.; Sanders, N. J.; Grossman, B. F.; Photakis, M.; Abril, S.; Agosti, D.; Andersen, A. N.; Angulo, E.; Armbrecht, I.; Arnan, X.; Baccaro, F. B.; Bishop, T. R.; Boulay, R.; Brühl, C.; Castracani, C.; Cerdá, X.; Del Toro, I.; Delsinne, T.; Diaz, M.; Donoso, D. A.; Ellison, A. M.; Enríquez, M. L.; Fayle, Tom Maurice; Feener, D. H.; Fisher, B. L.; Fisher, R. N.; Fitzpatrick, M. C.; Gómez, C.; Gotelli, N. J.; Gove, A.; Grasso, D. A.; Groc, S.; Guenard, B.; Gunawardene, N.; Heterick, B.; Hoffmann, B.; Janda, Milan; Jenkins, C.; Kaspari, M.; Klimeš, Petr; Lach, L.; Laeger, T.; Lattke, J.; Leponce, M.; Lessard, J.-P.; Longino, J.; Lucky, A.; Luke, S. H.; Majer, J.; McGlynn, T. P.; Menke, S.; Mezger, D.; Mori, A.; Moses, Jimmy; Munyai, T. C.; Pacheco, R.; Paknia, O.; Pearce-Duvet, J.; Pfeiffer, M.; Philpott, S. M.; Resasco, J.; Retana, J.; Silva, R. R.; Sorger, M. D.; Souza, J.; Suarez, A.; Tista, M.; Vasconcelos, H. L.; Vonshak, M.; Weisser, M. D.; Yates, M.; Parr, C. L.

    2017-01-01

    Roč. 98, č. 3 (2017), s. 883-884 ISSN 0012-9658 R&D Projects: GA ČR GB14-36098G; GA ČR GAP505/12/2467; GA ČR GPP505/12/P875 Institutional support: RVO:60077344 Keywords : abundance * ants * database Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 4.809, year: 2016 http://onlinelibrary.wiley.com/doi/10.1002/ecy.1682/abstract

  6. Public goods dilemma in asexual ant societies

    OpenAIRE

    Dobata, Shigeto; Tsuji, Kazuki

    2013-01-01

    This study reports experimental evidence for the “public goods dilemma” between cooperators and cheaters in an asexual ant society, in which cheating is always more rewarding for individuals but cooperation at the cost of individual fitness leads to better performance of groups. Although this dilemma provides the basic principle of social evolution, its experimental demonstration with underlying genetics and fitness evaluation for both cooperators and cheaters still lacks in societies other t...

  7. Ant colony optimization and constraint programming

    CERN Document Server

    Solnon, Christine

    2013-01-01

    Ant colony optimization is a metaheuristic which has been successfully applied to a wide range of combinatorial optimization problems. The author describes this metaheuristic and studies its efficiency for solving some hard combinatorial problems, with a specific focus on constraint programming. The text is organized into three parts. The first part introduces constraint programming, which provides high level features to declaratively model problems by means of constraints. It describes the main existing approaches for solving constraint satisfaction problems, including complete tree search

  8. The Transcriptional Repressor, MtrR, of the mtrCDE Efflux Pump Operon of Neisseria gonorrhoeae Can Also Serve as an Activator of “off Target” Gene (glnE Expression

    Directory of Open Access Journals (Sweden)

    Paul J. T. Johnson

    2015-06-01

    Full Text Available MtrR is a well-characterized repressor of the Neisseria gonorrhoeae mtrCDE efflux pump operon. However, results from a previous transcriptional profiling study suggested that MtrR also represses or activates expression of at least sixty genes outside of the mtr locus. Evidence that MtrR can directly repress so-called “off target” genes has previously been reported; in particular, MtrR was shown to directly repress glnA, which encodes glutamine synthetase. In contrast, evidence for the ability of MtrR to directly activate expression of gonococcal genes has been lacking; herein, we provide such evidence. We now report that MtrR has the ability to directly activate expression of glnE, which encodes the dual functional adenyltransferase/deadenylase enzyme GlnE that modifies GlnA resulting in regulation of its role in glutamine biosynthesis. With its capacity to repress expression of glnA, the results presented herein emphasize the diverse and often opposing regulatory properties of MtrR that likely contributes to the overall physiology and metabolism of N. gonorrhoeae.

  9. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

    Science.gov (United States)

    2012-01-01

    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  10. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  11. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    Science.gov (United States)

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  12. Generalized antifungal activity and 454-screening of Pseudonocardia and Amycolatopsis bacteria in nests of fungus-growing ants.

    Science.gov (United States)

    Sen, Ruchira; Ishak, Heather D; Estrada, Dora; Dowd, Scot E; Hong, Eunki; Mueller, Ulrich G

    2009-10-20

    In many host-microbe mutualisms, hosts use beneficial metabolites supplied by microbial symbionts. Fungus-growing (attine) ants are thought to form such a mutualism with Pseudonocardia bacteria to derive antibiotics that specifically suppress the coevolving pathogen Escovopsis, which infects the ants' fungal gardens and reduces growth. Here we test 4 key assumptions of this Pseudonocardia-Escovopsis coevolution model. Culture-dependent and culture-independent (tag-encoded 454-pyrosequencing) surveys reveal that several Pseudonocardia species and occasionally Amycolatopsis (a close relative of Pseudonocardia) co-occur on workers from a single nest, contradicting the assumption of a single pseudonocardiaceous strain per nest. Pseudonocardia can occur on males, suggesting that Pseudonocardia could also be horizontally transmitted during mating. Pseudonocardia and Amycolatopsis secretions kill or strongly suppress ant-cultivated fungi, contradicting the previous finding of a growth-enhancing effect of Pseudonocardia on the cultivars. Attine ants therefore may harm their own cultivar if they apply pseudonocardiaceous secretions to actively growing gardens. Pseudonocardia and Amycolatopsis isolates also show nonspecific antifungal activities against saprotrophic, endophytic, entomopathogenic, and garden-pathogenic fungi, contrary to the original report of specific antibiosis against Escovopsis alone. We conclude that attine-associated pseudonocardiaceous bacteria do not exhibit derived antibiotic properties to specifically suppress Escovopsis. We evaluate hypotheses on nonadaptive and adaptive functions of attine integumental bacteria, and develop an alternate conceptual framework to replace the prevailing Pseudonocardia-Escovopsis coevolution model. If association with Pseudonocardia is adaptive to attine ants, alternate roles of such microbes could include the protection of ants or sanitation of the nest.

  13. Precision Rescue Behavior in North American Ants

    Directory of Open Access Journals (Sweden)

    Katherine Taylor

    2013-07-01

    Full Text Available Altruistic behavior, in which one individual provides aid to another at some cost to itself, is well documented. However, some species engage in a form of altruism, called rescue, that places the altruist in immediate danger. Here we investigate one such example, namely rescuing victims captured by predators. In a field experiment with two North American ant species, Tetramorium sp. E and Prenolepis imparis, individuals were held in artificial snares simulating capture. T. sp. E, but not P. imparis, exhibited digging, pulling, and snare biting, the latter precisely targeted to the object binding the victim. These results are the first to document precision rescue in a North American ant species; moreover, unlike rescue in other ants, T. sp. E rescues conspecifics from different colonies, mirroring their atypical social behavior, namely the lack of aggression between non-nestmate (heterocolonial conspecifics. In a second, observational study designed to demonstrate rescue from an actual predator, T. sp. E victims were dropped into an antlion's pit and the behavior of a single rescuer was observed. Results showed that T. sp. E not only attempted to release the victim, but also risked attacking the predator, suggesting that precision rescue may play an important role in this species' antipredator behavior.

  14. El periodista, ante la espiral de silencio

    Directory of Open Access Journals (Sweden)

    Dr. Fermín Galindo Arranz

    1998-01-01

    Full Text Available La percepción de la profesión periodística y de su influencia cambia mucho a lo largo del tiempo, de las coyunturas históricas y de los diferentes países y sociedades en los que desempeñan su labor. En un contexto mundial, la gravedad de las situaciones de riesgo periodístico se encuadran en situaciones políticas, económicas o sociales también conflictivas; es entonces cuando se suele reproducir con facilidad en la opinión pública el fenómeno de la espiral del silencio, ante el que inevitablemente se sitúa el periodista. Por definición, el trabajo del periodista consiste en ser portavoz de las novedades que se producen, en dar informaciones y emitir opiniones en la esfera pública, se tiene que situar, por tanto, de forma individual y notoriamente pública ante los fenómenos de espiral de silencio que puedan producirse en la opinión pública. Antonio Tabucchi nos presenta en su novela "Sostiene Pereira" un ejemplo magnífico del dilema del periodista ante este tipo de situaciones.

  15. Recognition of social identity in ants

    Directory of Open Access Journals (Sweden)

    Nick eBos

    2012-03-01

    Full Text Available Recognizing the identity of others, from the individual to the group level, is a hallmark of society. Ants, and other social insects, have evolved advanced societies characterized by efficient social recognition systems. Colony identity is mediated by colony specific signature mixtures, a blend of hydrocarbons present on the cuticle of every individual (the label. Recognition occurs when an ant encounters another individual, and compares the label it perceives to an internal representation of its own colony odor (the template. A mismatch between label and template leads to rejection of the encountered individual. Although advances have been made in our understanding of how the label is produced and acquired, contradictory evidence exists about information processing of recognition cues. Here, we review the literature on template acquisition in ants and address how and when the template is formed, where in the nervous system it is localized, and the possible role of learning. We combine seemingly contradictory evidence in to a novel, parsimonious theory for the information processing of nestmate recognition cues.

  16. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    Science.gov (United States)

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

    Science.gov (United States)

    Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

    2016-05-01

    Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Genome evolution in an ancient bacteria-ant symbiosis: parallel gene loss among Blochmannia spanning the origin of the ant tribe Camponotini

    Directory of Open Access Journals (Sweden)

    Laura E. Williams

    2015-04-01

    Full Text Available Stable associations between bacterial endosymbionts and insect hosts provide opportunities to explore genome evolution in the context of established mutualisms and assess the roles of selection and genetic drift across host lineages and habitats. Blochmannia, obligate endosymbionts of ants of the tribe Camponotini, have coevolved with their ant hosts for ∼40 MY. To investigate early events in Blochmannia genome evolution across this ant host tribe, we sequenced Blochmannia from two divergent host lineages, Colobopsis obliquus and Polyrhachis turneri, and compared them with four published genomes from Blochmannia of Camponotus sensu stricto. Reconstructed gene content of the last common ancestor (LCA of these six Blochmannia genomes is reduced (690 protein coding genes, consistent with rapid gene loss soon after establishment of the symbiosis. Differential gene loss among Blochmannia lineages has affected cellular functions and metabolic pathways, including DNA replication and repair, vitamin biosynthesis and membrane proteins. Blochmannia of P. turneri (i.e., B. turneri encodes an intact DnaA chromosomal replication initiation protein, demonstrating that loss of dnaA was not essential for establishment of the symbiosis. Based on gene content, B. obliquus and B. turneri are unable to provision hosts with riboflavin. Of the six sequenced Blochmannia, B. obliquus is the earliest diverging lineage (i.e., the sister group of other Blochmannia sampled and encodes the fewest protein-coding genes and the most pseudogenes. We identified 55 genes involved in parallel gene loss, including glutamine synthetase, which may participate in nitrogen recycling. Pathways for biosynthesis of coenzyme A, terpenoids and riboflavin were lost in multiple lineages, suggesting relaxed selection on the pathway after inactivation of one component. Analysis of Illumina read datasets did not detect evidence of plasmids encoding missing functions, nor the presence of

  19. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Science.gov (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  20. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  1. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Science.gov (United States)

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  2. Structural Basis for Catalysis by the Mono and Dimetalated forms of the dapE-encoded N-succinyl-L,L-Diaminopimelic Acid Desuccinylase

    OpenAIRE

    Nocek, Boguslaw P.; Gillner, Danuta M.; Fan, Yao; Holz, Richard C.; Joachimiak, Andrzej

    2010-01-01

    Biosynthesis of lysine and meso-diaminopimelic acid in bacteria provides essential components for protein synthesis and construction of the bacterial peptidoglycan cell wall. The dapE operon enzymes synthesize both meso-diaminopimelic acid and lysine and, therefore, represent a potential targets for novel antibacterials. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase functions in a late step of the pathway and converts N-succinyl-L,L-diaminopimelic acid (L,L-SDAP) to L,L-di...

  3. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

  4. Multidimensionally encoded magnetic resonance imaging.

    Science.gov (United States)

    Lin, Fa-Hsuan

    2013-07-01

    Magnetic resonance imaging (MRI) typically achieves spatial encoding by measuring the projection of a q-dimensional object over q-dimensional spatial bases created by linear spatial encoding magnetic fields (SEMs). Recently, imaging strategies using nonlinear SEMs have demonstrated potential advantages for reconstructing images with higher spatiotemporal resolution and reducing peripheral nerve stimulation. In practice, nonlinear SEMs and linear SEMs can be used jointly to further improve the image reconstruction performance. Here, we propose the multidimensionally encoded (MDE) MRI to map a q-dimensional object onto a p-dimensional encoding space where p > q. MDE MRI is a theoretical framework linking imaging strategies using linear and nonlinear SEMs. Using a system of eight surface SEM coils with an eight-channel radiofrequency coil array, we demonstrate the five-dimensional MDE MRI for a two-dimensional object as a further generalization of PatLoc imaging and O-space imaging. We also present a method of optimizing spatial bases in MDE MRI. Results show that MDE MRI with a higher dimensional encoding space can reconstruct images more efficiently and with a smaller reconstruction error when the k-space sampling distribution and the number of samples are controlled. Copyright © 2012 Wiley Periodicals, Inc.

  5. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

    Science.gov (United States)

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

    2016-09-12

    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  6. Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

    Science.gov (United States)

    Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

    2002-01-01

    Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

  7. The invasive ant, Solenopsis invicta, reduces herpetofauna richness and abundance

    Science.gov (United States)

    Allen, Craig R.; Birge, Hannah E.; Slater, J.; Wiggers, E.

    2017-01-01

    Amphibians and reptiles are declining globally. One potential cause of this decline includes impacts resulting from co-occurrence with non-native red imported fire ant, Solenopsis invicta. Although a growing body of anecdotal and observational evidence from laboratory experiments supports this hypothesis, there remains a lack of field scale manipulations testing the effect of fire ants on reptile and amphibian communities. We addressed this gap by measuring reptile and amphibian (“herpetofauna”) community response to successful fire ant reductions over the course of 2 years following hydramethylnon application to five 100–200 ha plots in southeastern coastal South Carolina. By assessing changes in relative abundance and species richness of herpetofauna in response to fire ant reductions, we were able to assess whether some species were particularly vulnerable to fire ant presence, and whether this sensitivity manifested at the community level. We found that herpetofauna abundance and species richness responded positively to fire ant reductions. Our results document that even moderate populations of red imported fire ants decrease both the abundance and diversity of herpetofauna. Given global herpetofauna population declines and continued spread of fire ants, there is urgency to understand the impacts of fire ants beyond anecdotal and singles species studies. Our results provides the first community level investigation addressing these dynamics, by manipulating fire ant abundance to reveal a response in herpetofauna species abundance and richness.

  8. Predaceous ants, beach replenishment, and nest placement by sea turtles.

    Science.gov (United States)

    Wetterer, James K; Wood, Lawrence D; Johnson, Chris; Krahe, Holly; Fitchett, Stephanie

    2007-10-01

    Ants known for attacking and killing hatchling birds and reptiles include the red imported fire ant (Solenopsis invicta Buren), tropical fire ant [Solenopsis geminata (Fabr.)], and little fire ant [Wasmannia auropunctata (Roger)]. We tested whether sea turtle nest placement influenced exposure to predaceous ants. In 2000 and 2001, we surveyed ants along a Florida beach where green turtles (Chelonia mydas L.), leatherbacks (Dermochelys coriacea Vandelli), and loggerheads (Caretta caretta L.) nest. Part of the beach was artificially replenished between our two surveys. As a result, mean beach width experienced by nesting turtles differed greatly between the two nesting seasons. We surveyed 1,548 sea turtle nests (2000: 909 nests; 2001: 639 nests) and found 22 ant species. S. invicta was by far the most common species (on 431 nests); S. geminata and W. auropunctata were uncommon (on 3 and 16 nests, respectively). In 2000, 62.5% of nests had ants present (35.9% with S. invicta), but in 2001, only 30.5% of the nests had ants present (16.4% with S. invicta). Turtle nests closer to dune vegetation had significantly greater exposure to ants. Differences in ant presence on turtle nests between years and among turtle species were closely related to differences in nest placement relative to dune vegetation. Beach replenishment significantly lowered exposure of nests to ants because on the wider beaches turtles nested farther from the dune vegetation. Selective pressures on nesting sea turtles are altered both by the presence of predaceous ants and the practice of beach replenishment.

  9. Chemically armed mercenary ants protect fungus-farming societies

    Science.gov (United States)

    Adams, Rachelle M. M.; Liberti, Joanito; Illum, Anders A.; Jones, Tappey H.; Nash, David R.; Boomsma, Jacobus J.

    2013-01-01

    The ants are extraordinary in having evolved many lineages that exploit closely related ant societies as social parasites, but social parasitism by distantly related ants is rare. Here we document the interaction dynamics among a Sericomyrmex fungus-growing ant host, a permanently associated parasitic guest ant of the genus Megalomyrmex, and a raiding agro-predator of the genus Gnamptogenys. We show experimentally that the guest ants protect their host colonies against agro-predator raids using alkaloid venom that is much more potent than the biting defenses of the host ants. Relatively few guest ants are sufficient to kill raiders that invariably exterminate host nests without a cohabiting guest ant colony. We also show that the odor of guest ants discourages raider scouts from recruiting nestmates to host colonies. Our results imply that Sericomyrmex fungus-growers obtain a net benefit from their costly guest ants behaving as a functional soldier caste to meet lethal threats from agro-predator raiders. The fundamentally different life histories of the agro-predators and guest ants appear to facilitate their coexistence in a negative frequency-dependent manner. Because a guest ant colony is committed for life to a single host colony, the guests would harm their own interests by not defending the host that they continue to exploit. This conditional mutualism is analogous to chronic sickle cell anemia enhancing the resistance to malaria and to episodes in human history when mercenary city defenders offered either net benefits or imposed net costs, depending on the level of threat from invading armies. PMID:24019482

  10. Chemically armed mercenary ants protect fungus-farming societies.

    Science.gov (United States)

    Adams, Rachelle M M; Liberti, Joanito; Illum, Anders A; Jones, Tappey H; Nash, David R; Boomsma, Jacobus J

    2013-09-24

    The ants are extraordinary in having evolved many lineages that exploit closely related ant societies as social parasites, but social parasitism by distantly related ants is rare. Here we document the interaction dynamics among a Sericomyrmex fungus-growing ant host, a permanently associated parasitic guest ant of the genus Megalomyrmex, and a raiding agro-predator of the genus Gnamptogenys. We show experimentally that the guest ants protect their host colonies against agro-predator raids using alkaloid venom that is much more potent than the biting defenses of the host ants. Relatively few guest ants are sufficient to kill raiders that invariably exterminate host nests without a cohabiting guest ant colony. We also show that the odor of guest ants discourages raider scouts from recruiting nestmates to host colonies. Our results imply that Sericomyrmex fungus-growers obtain a net benefit from their costly guest ants behaving as a functional soldier caste to meet lethal threats from agro-predator raiders. The fundamentally different life histories of the agro-predators and guest ants appear to facilitate their coexistence in a negative frequency-dependent manner. Because a guest ant colony is committed for life to a single host colony, the guests would harm their own interests by not defending the host that they continue to exploit. This conditional mutualism is analogous to chronic sickle cell anemia enhancing the resistance to malaria and to episodes in human history when mercenary city defenders offered either net benefits or imposed net costs, depending on the level of threat from invading armies.

  11. When invasive ants meet: effects of outbreeding on queen performance in the tramp ant Cardiocondyla itsukii.

    Science.gov (United States)

    Heinze, Jürgen; Frohschammer, Sabine; Bernadou, Abel

    2017-08-18

    Most disturbed habitats in the tropics and subtropics harbor numerous species of invasive ants, and occasionally the same species has been introduced repeatedly from multiple geographical sources. We examined how experimental crossbreeding between sexuals from different populations affects the fitness of queens of the tramp ant Cardiocondyla itsukii, which is widely distributed in Asia and the Pacific Islands. Eggs laid by queens that mated with nestmate males had a higher hatching rate than eggs laid by queens mated to males from neighboring (Hawaii × Kauai) or distant introduced populations (Hawaii/Kauai × Okinawa). Furthermore, inbreeding queens had a longer lifespan and produced a less female-biased offspring sex ratio than queens from allopatric mating. This suggests that the genetic divergence between different source populations may already be so large that in case of multiple invasions eventual crossbreeding might negatively affect the fitness of tramp ants. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  12. Virally encoded 7TM receptors

    DEFF Research Database (Denmark)

    Rosenkilde, M M; Waldhoer, M; Lüttichau, H R

    2001-01-01

    expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...

  13. Food source quality and ant dominance hierarchy influence the outcomes of ant-plant interactions in an arid environment

    Science.gov (United States)

    Flores-Flores, Rocío Vianey; Aguirre, Armando; Anjos, Diego V.; Neves, Frederico S.; Campos, Ricardo I.; Dáttilo, Wesley

    2018-02-01

    In this study, we conducted a series of experiments in a population of Vachellia constricta (Fabaceae) in the arid Tehuacan-Cuicatláan valley, Mexico, in order to evaluate if the food source quality and ant dominance hierarchy influence the outcomes of ant-plant interactions. Using an experiment with artificial nectaries, we observed that ants foraging on food sources with higher concentration of sugar are quicker in finding and attacking potential herbivorous insects. More specifically, we found that the same ant species may increase their defence effectiveness according to the quality of food available. These findings indicate that ant effectiveness in plant protection is context-dependent and may vary according to specific individual characteristics of plants. In addition, we showed that competitively superior ant species tend to dominate plants in periods with high nectar activity, emphasizing the role of the dominance hierarchy structuring ant-plant interactions. However, when high sugar food sources were experimentally available ad libitum, the nocturnal and competitively superior ant species, Camponotus atriceps, did not dominate the artificial nectaries during the day possibly due to limitation of its thermal tolerance. Therefore, temporal niche partitioning may be allowing the coexistence of two dominant ant species (Camponotus rubritorax during the day and C. atriceps at night) on V. constricta. Our findings indicate that the quality of the food source, and temporal shifts in ant dominance are key factors which structure the biotic plant defences in an arid environment.

  14. Just follow your nose: homing by olfactory cues in ants.

    Science.gov (United States)

    Steck, Kathrin

    2012-04-01

    How is an ant-equipped with a brain that barely exceeds the size of a pinhead-capable of achieving navigational marvels? Even though evidences suggest that navigation is a multimodal process, ants heavily depend on olfactory cues-of pheromonal and non-pheromonal nature-for foraging and orientation. Recent studies have directed their attention to the efficiency of pheromone trail networks. Advances in neurophysiological techniques make it possible to investigate trail pheromone processing in the ant's brain. In addition to relying on pheromone odours, ants also make use of volatiles emanating from the nest surroundings. Deposited in the vicinity of the nest, these home-range markings help the ants to home after a foraging run. Furthermore, olfactory landmarks associated with the nest enhance ants' homing abilities. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Ant tending influences soldier production in a social aphid.

    Science.gov (United States)

    Shingleton, A W; Foster, W A

    2000-09-22

    The aphid Pseudoregma sundanica (Van der Goot) (Homoptera: Aphididae) has two defence strategies. It is obligatorily tended by various species of ant and also produces sterile soldiers. We investigated how they allocate their investment in these two strategies. We measured the size, number of soldiers, number and species of tending ant, and number and species of predators in P. sundanica populations. We found that the level of ant tending correlated negatively with soldier investment in P. sundanica. The species of tending ant also influenced soldier investment. We excluded ants from aphid populations and recorded changes in population size and structure over four weeks. Ant exclusion led to population decline and extinction. At the same time, surviving populations showed a significant increase in soldier investment. The data demonstrate that social aphids can adjust their investment in soldiers in direct response to environmental change.

  16. Consuming fire ants reduces northern bobwhite survival and weight gain

    Science.gov (United States)

    Myers, P.E.; Allen, Craig R.; Birge, Hannah E.

    2014-01-01

    Northern bobwhite quail, Colinus virginianus (L.) (Galliformes: Odontophoridae), population declines are well documented, but pinpointing the reasons for these decreases has proven elusive. Bobwhite population declines are attributed primarily to loss of habitat and land use changes. This, however, does not entirely explain population declines in areas intensively managed for bobwhites. Although previous research demonstrates the negative impact of red imported fire ant (Solenopsis invicta Buren) (Hymenoptera: Formicidae) on northern bobwhites, the mechanisms underlying this effect are largely unknown. To meet the protein demands of early growth and development, bobwhite chicks predominantly consume small insects, of which ants are a substantial proportion. Fire ants alter ant community dynamics by often reducing native ant diversity and abundance while concurrently increasing the abundance of individuals. Fire ants have negative effects on chicks, but they are also a large potential protein source, making it difficult to disentangle their net effect on bobwhite chicks. To help investigate these effects, we conducted a laboratory experiment to understand (1) whether or not bobwhites consume fire ants, and (2) how the benefits of this consumption compare to the deleterious impacts of bobwhite chick exposure to fire ants. Sixty bobwhite chicks were separated into two groups of 30; one group was provided with starter feed only and the second group was provided with feed and fire ants. Bobwhite chicks were observed feeding on fire ants. Chicks that fed on fire ants had reduced survival and weight gain. Our results show that, while fire ants increase potential food sources for northern bobwhite, their net effect on bobwhite chicks is deleterious. This information will help inform land managers and commercial bobwhite rearing operations.

  17. Cercomacra and related antbirds (Aves, Formicariidae as army ant followers

    Directory of Open Access Journals (Sweden)

    Edwin O. Willis

    1984-01-01

    Full Text Available Cercomacra and Schistocichla antbirds (Formicariidae favor dense foliage and seldom follow army ants for flushed prey, since the ants move through open forest understory as well as through dense zones. Two other lineages, the Drymophila-Hypocnemis lineage (of dense woodland understory and the Formicivora lineage (of dense bushes in dry or semiopen zones, also cannot follow ants regularly through open forest understory.

  18. Do herbivores eavesdrop on ant chemical communication to avoid predation?

    Directory of Open Access Journals (Sweden)

    David J Gonthier

    Full Text Available Strong effects of predator chemical cues on prey are common in aquatic and marine ecosystems, but are thought to be rare in terrestrial systems and specifically for arthropods. For ants, herbivores are hypothesized to eavesdrop on ant chemical communication and thereby avoid predation or confrontation. Here I tested the effect of ant chemical cues on herbivore choice and herbivory. Using Margaridisa sp. flea beetles and leaves from the host tree (Conostegia xalapensis, I performed paired-leaf choice feeding experiments. Coating leaves with crushed ant liquids (Azteca instabilis, exposing leaves to ant patrolling prior to choice tests (A. instabilis and Camponotus textor and comparing leaves from trees with and without A. instabilis nests resulted in more herbivores and herbivory on control (no ant-treatment relative to ant-treatment leaves. In contrast to A. instabilis and C. textor, leaves previously patrolled by Solenopsis geminata had no difference in beetle number and damage compared to control leaves. Altering the time A. instabilis patrolled treatment leaves prior to choice tests (0-, 5-, 30-, 90-, 180-min. revealed treatment effects were only statistically significant after 90- and 180-min. of prior leaf exposure. This study suggests, for two ecologically important and taxonomically diverse genera (Azteca and Camponotus, ant chemical cues have important effects on herbivores and that these effects may be widespread across the ant family. It suggests that the effect of chemical cues on herbivores may only appear after substantial previous ant activity has occurred on plant tissues. Furthermore, it supports the hypothesis that herbivores use ant chemical communication to avoid predation or confrontation with ants.

  19. A Theoretic Basis for IS? The Contribution of ANT

    Directory of Open Access Journals (Sweden)

    Jim Underwood

    2002-11-01

    Full Text Available Representation is a key issue of IS design and operation that is often ignored. Actor-network theory (ANT, a semiotic theory of stakeholders, provides a way of dealing with representation. Combining aspects of ANT and Foucault's discourse theory allows us to include concepts as actors and promises a flexible and durable foundation for IS practice, but ANT itself indicates that the search for a purely theoretical foundation for IS is misguided.

  20. Insecticide transfer efficiency and lethal load in Argentine ants

    Energy Technology Data Exchange (ETDEWEB)

    Hooper-Bui, L.M. [Department of Environmental Science, Louisiana State University, Baton Rouge, LA 70803 (United States); Department of Entomology, University of California, Riverside, CA 92521 (United States); Kwok, E.S.C. [Department of Cell Biology and Neuroscience, University of California, Riverside, CA 92521 (United States); Buchholz, B.A., E-mail: buchholz2@llnl.gov [Center for Accelerator Mass Spectrometry, Lawrence Livermore National Laboratory, Livermore, CA 94551 (United States); Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States); Rust, M.K. [Department of Entomology, University of California, Riverside, CA 92521 (United States); Eastmond, D.A. [Department of Cell Biology and Neuroscience, University of California, Riverside, CA 92521 (United States); Vogel, J.S. [Center for Accelerator Mass Spectrometry, Lawrence Livermore National Laboratory, Livermore, CA 94551 (United States)

    2015-10-15

    Trophallaxis between individual worker ants and the toxicant load in dead and live Argentine ants (Linepithema humile) in colonies exposed to fipronil and hydramethylnon experimental baits were examined using accelerator mass spectrometry (AMS). About 50% of the content of the crop containing trace levels of {sup 14}C-sucrose, {sup 14}C-hydramethylnon, and {sup 14}C-fipronil was shared between single donor and recipient ants. Dead workers and queens contained significantly more hydramethylnon (122.7 and 22.4 amol/μg ant, respectively) than did live workers and queens (96.3 and 10.4 amol/μg ant, respectively). Dead workers had significantly more fipronil (420.3 amol/μg ant) than did live workers (208.5 amol/μg ant), but dead and live queens had equal fipronil levels (59.5 and 54.3 amol/μg ant, respectively). The distribution of fipronil differed within the bodies of dead and live queens; the highest amounts of fipronil were recovered in the thorax of dead queens whereas live queens had the highest levels in the head. Resurgence of polygynous ant colonies treated with hydramethylnon baits may be explained by queen survival resulting from sublethal doses due to a slowing of trophallaxis throughout the colony. Bait strategies and dose levels for controlling insect pests need to be based on the specific toxicant properties and trophic strategies for targeting the entire colony.

  1. Improved Ant Colony Clustering Algorithm and Its Performance Study

    Science.gov (United States)

    Gao, Wei

    2016-01-01

    Clustering analysis is used in many disciplines and applications; it is an important tool that descriptively identifies homogeneous groups of objects based on attribute values. The ant colony clustering algorithm is a swarm-intelligent method used for clustering problems that is inspired by the behavior of ant colonies that cluster their corpses and sort their larvae. A new abstraction ant colony clustering algorithm using a data combination mechanism is proposed to improve the computational efficiency and accuracy of the ant colony clustering algorithm. The abstraction ant colony clustering algorithm is used to cluster benchmark problems, and its performance is compared with the ant colony clustering algorithm and other methods used in existing literature. Based on similar computational difficulties and complexities, the results show that the abstraction ant colony clustering algorithm produces results that are not only more accurate but also more efficiently determined than the ant colony clustering algorithm and the other methods. Thus, the abstraction ant colony clustering algorithm can be used for efficient multivariate data clustering. PMID:26839533

  2. Insecticide transfer efficiency and lethal load in Argentine ants

    International Nuclear Information System (INIS)

    Hooper-Bui, L.M.; Kwok, E.S.C.; Buchholz, B.A.; Rust, M.K.; Eastmond, D.A.; Vogel, J.S.

    2015-01-01

    Trophallaxis between individual worker ants and the toxicant load in dead and live Argentine ants (Linepithema humile) in colonies exposed to fipronil and hydramethylnon experimental baits were examined using accelerator mass spectrometry (AMS). About 50% of the content of the crop containing trace levels of 14 C-sucrose, 14 C-hydramethylnon, and 14 C-fipronil was shared between single donor and recipient ants. Dead workers and queens contained significantly more hydramethylnon (122.7 and 22.4 amol/μg ant, respectively) than did live workers and queens (96.3 and 10.4 amol/μg ant, respectively). Dead workers had significantly more fipronil (420.3 amol/μg ant) than did live workers (208.5 amol/μg ant), but dead and live queens had equal fipronil levels (59.5 and 54.3 amol/μg ant, respectively). The distribution of fipronil differed within the bodies of dead and live queens; the highest amounts of fipronil were recovered in the thorax of dead queens whereas live queens had the highest levels in the head. Resurgence of polygynous ant colonies treated with hydramethylnon baits may be explained by queen survival resulting from sublethal doses due to a slowing of trophallaxis throughout the colony. Bait strategies and dose levels for controlling insect pests need to be based on the specific toxicant properties and trophic strategies for targeting the entire colony.

  3. Disease dynamics in a specialized parasite of ant societies

    DEFF Research Database (Denmark)

    Andersen, Sandra Breum; Ferrari, Matthew; Evans, Harry C.

    2012-01-01

    Coevolution between ant colonies and their rare specialized parasites are intriguing, because lethal infections of workers may correspond to tolerable chronic diseases of colonies, but the parasite adaptations that allow stable coexistence with ants are virtually unknown. We explore the trade......-offs experienced by Ophiocordyceps parasites manipulating ants into dying in nearby graveyards. We used field data from Brazil and Thailand to parameterize and fit a model for the growth rate of graveyards. We show that parasite pressure is much lower than the abundance of ant cadavers suggests...

  4. Signals can trump rewards in attracting seed-dispersing ants.

    Directory of Open Access Journals (Sweden)

    Kyle M Turner

    Full Text Available Both rewards and signals are important in mutualisms. In myrmecochory, or seed dispersal by ants, the benefits to plants are relatively well studied, but less is known about why ants pick up and move seeds. We examined seed dispersal by the ant Aphaenogaster rudis of four co-occurring species of plants, and tested whether morphology, chemical signaling, or the nutritional quality of fatty seed appendages called elaiosomes influenced dispersal rates. In removal trials, ants quickly collected diaspores (seeds plus elaiosomes of Asarum canadense, Trillium grandiflorum, and Sanguinaria canadensis, but largely neglected those of T. erectum. This discrepancy was not explained by differences in the bulk cost-benefit ratio, as assessed by the ratio of seed to elaiosome mass. We also provisioned colonies with diaspores from one of these four plant species or no diaspores as a control. Colonies performed best when fed S. canadensis diaspores, worst when fed T. grandiflorum, and intermediately when fed A. canadense, T. erectum, or no diaspores. Thus, the nutritional rewards in elaiosomes affected colony performance, but did not completely predict seed removal. Instead, high levels of oleic acid in T. grandiflorum elaiosomes may explain why ants disperse these diaspores even though they reduce ant colony performance. We show for the first time that different elaiosome-bearing plants provide rewards of different quality to ant colonies, but also that ants appear unable to accurately assess reward quality when encountering seeds. Instead, we suggest that signals can trump rewards as attractants of ants to seeds.

  5. The evolution of invasiveness in garden ants.

    Directory of Open Access Journals (Sweden)

    Sylvia Cremer

    Full Text Available It is unclear why some species become successful invaders whilst others fail, and whether invasive success depends on pre-adaptations already present in the native range or on characters evolving de-novo after introduction. Ants are among the worst invasive pests, with Lasius neglectus and its rapid spread through Europe and Asia as the most recent example of a pest ant that may become a global problem. Here, we present the first integrated study on behavior, morphology, population genetics, chemical recognition and parasite load of L. neglectus and its non-invasive sister species L. turcicus. We find that L. neglectus expresses the same supercolonial syndrome as other invasive ants, a social system that is characterized by mating without dispersal and large networks of cooperating nests rather than smaller mutually hostile colonies. We conclude that the invasive success of L. neglectus relies on a combination of parasite-release following introduction and pre-adaptations in mating system, body-size, queen number and recognition efficiency that evolved long before introduction. Our results challenge the notion that supercolonial organization is an inevitable consequence of low genetic variation for chemical recognition cues in small invasive founder populations. We infer that low variation and limited volatility in cuticular hydrocarbon profiles already existed in the native range in combination with low dispersal and a highly viscous population structure. Human transport to relatively disturbed urban areas thus became the decisive factor to induce parasite release, a well established general promoter of invasiveness in non-social animals and plants, but understudied in invasive social insects.

  6. The Evolution of Invasiveness in Garden Ants

    Science.gov (United States)

    Cremer, Sylvia; Ugelvig, Line V.; Drijfhout, Falko P.; Schlick-Steiner, Birgit C.; Steiner, Florian M.; Seifert, Bernhard; Hughes, David P.; Schulz, Andreas; Petersen, Klaus S.; Konrad, Heino; Stauffer, Christian; Kiran, Kadri; Espadaler, Xavier; d'Ettorre, Patrizia; Aktaç, Nihat; Eilenberg, Jørgen; Jones, Graeme R.; Nash, David R.; Pedersen, Jes S.; Boomsma, Jacobus J.

    2008-01-01

    It is unclear why some species become successful invaders whilst others fail, and whether invasive success depends on pre-adaptations already present in the native range or on characters evolving de-novo after introduction. Ants are among the worst invasive pests, with Lasius neglectus and its rapid spread through Europe and Asia as the most recent example of a pest ant that may become a global problem. Here, we present the first integrated study on behavior, morphology, population genetics, chemical recognition and parasite load of L. neglectus and its non-invasive sister species L. turcicus. We find that L. neglectus expresses the same supercolonial syndrome as other invasive ants, a social system that is characterized by mating without dispersal and large networks of cooperating nests rather than smaller mutually hostile colonies. We conclude that the invasive success of L. neglectus relies on a combination of parasite-release following introduction and pre-adaptations in mating system, body-size, queen number and recognition efficiency that evolved long before introduction. Our results challenge the notion that supercolonial organization is an inevitable consequence of low genetic variation for chemical recognition cues in small invasive founder populations. We infer that low variation and limited volatility in cuticular hydrocarbon profiles already existed in the native range in combination with low dispersal and a highly viscous population structure. Human transport to relatively disturbed urban areas thus became the decisive factor to induce parasite release, a well established general promoter of invasiveness in non-social animals and plants, but understudied in invasive social insects. PMID:19050762

  7. [Syagrus romanzoffiana (Arecaceae) seed utilization by ants in a secondary forest in South Brazil].

    Science.gov (United States)

    Silva, Fernanda R; Begnini, Romualdo M; Klier, Vinícius A; Scherer, Karla Z; Lopes, Benedito C; Castellani, Tânia T

    2009-01-01

    Ants can nest in a wide variety of substracts. This paper shows Syagrus romanzoffiana seed utilization by ants in an Atlantic secondary forest. We report 29 seeds occupied by small-bodied ants, with 27 of them showing at least two ant development stages. Although a large number of seeds were sampled, a low level of ant occupation was observed.

  8. Relative effects of disturbance on red imported fire ants and native ant species in a longleaf pine ecosystem

    DEFF Research Database (Denmark)

    Stuble, Katharine L.; Kirkman, L. Katherine; Carroll, C. Ronald

    2011-01-01

    and cases in which non-native species become established in intact (lacking extensive anthropogenic soil disturbance) communities and subsequently diminish the abundance and richness of native species is challenging on the basis of observation alone. The red imported fire ant (Solenopsis invicta......), an invasive species that occurs throughout much of the southeastern United States, is such an example. Rather than competitively displacing native species, fire ants may become established only in disturbed areas in which native species richness and abundance are already reduced. We used insecticide to reduce......, the abundance of native ants increased to levels comparable to those in control plots after 1 year. Our findings suggest that factors other than large reductions in ant abundance and species density (number of species per unit area) may affect the establishment of fire ants and that the response of native ants...

  9. La escritura como espada ante el machismo

    OpenAIRE

    Rottoli, Sofía

    2016-01-01

    Cuando se trata de expresar una postura que abarque una temática demasiado amplia o controversial, recurrir a la escritura puede ser una buena opción de abordaje. Sobre todo cuando son discusiones que llevan años de vigencia. Las luchas feministas ante la violencia de género no son una excepción. Sus discusiones siempre tuvieron presencia en diversos campos, uno de ellos es la ya mencionada escritura. Centro de Investigación en Lectura y Escritura (CILE)

  10. Ecology: 'Devil's gardens' bedevilled by ants.

    Science.gov (United States)

    Frederickson, Megan E; Greene, Michael J; Gordon, Deborah M

    2005-09-22

    'Devil's gardens' are large stands of trees in the Amazonian rainforest that consist almost entirely of a single species, Duroia hirsuta, and, according to local legend, are cultivated by an evil forest spirit. Here we show that the ant Myrmelachista schumanni, which nests in D. hirsuta stems, creates devil's gardens by poisoning all plants except its host plants with formic acid. By killing these other plants, M. schumanni provides its colonies with abundant nest sites--a long-lasting benefit as colonies can live for 800 years.

  11. Ante-natal ionising radiation and cancer

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    This editorial comments on the latest reports of the Oxford Survey of Childhood Cancer (now based on Birmingham). With 14759 pairs, the latest survey is over 10-fold larger than the 1958 report and the calculation of fatal childhood cancer rate at one case in 990 ante-natal radiographic examinations is rather larger than the early estimates, in spite of the fetal radiation dose having been halved and the cure rate for childhood leukemia being much improved. Comments are made on the comparisons with bomb survivors, and on the much increased fatal cancer incidence after first trimester radiography. (UK)

  12. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Directory of Open Access Journals (Sweden)

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  13. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Science.gov (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  14. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Science.gov (United States)

    Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

    2013-01-01

    The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  15. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  16. Ant Systems for a Dynamic TSP - Ants Caught in a Traffic Jam

    NARCIS (Netherlands)

    Eyckelhof, C.J.; Dorigo, M.; Caro Di, G.; Snoek, M.; Sampels, M.

    2002-01-01

    In this paper we present a new Ants System approach to a dynamic Travelling Salesman Problem. Here the travel times between the cities are subject to change. To handle this dynamism several ways of adapting the pheromone matrix both locally and globally are considered. We show that the strategy of

  17. Nectar Theft and Floral Ant-Repellence: A Link between Nectar Volume and Ant-Repellent Traits?

    Science.gov (United States)

    Ballantyne, Gavin; Willmer, Pat

    2012-01-01

    As flower visitors, ants rarely benefit a plant. They are poor pollinators, and can also disrupt pollination by deterring other flower visitors, or by stealing nectar. Some plant species therefore possess floral ant-repelling traits. But why do particular species have such traits when others do not? In a dry forest in Costa Rica, of 49 plant species around a third were ant-repellent at very close proximity to a common generalist ant species, usually via repellent pollen. Repellence was positively correlated with the presence of large nectar volumes. Repellent traits affected ant species differently, some influencing the behaviour of just a few species and others producing more generalised ant-repellence. Our results suggest that ant-repellent floral traits may often not be pleiotropic, but instead could have been selected for as a defence against ant thieves in plant species that invest in large volumes of nectar. This conclusion highlights to the importance of research into the cost of nectar production in future studies into ant-flower interactions. PMID:22952793

  18. Partial incompatibility between ants and symbiotic fungi in two sympatric species of Acromyrmex leaf-cutting ants.

    Science.gov (United States)

    Bot, A N; Rehner, S A; Boomsma, J J

    2001-10-01

    We investigate the nature and duration of incompatibility between certain combinations of Acromyrmex leaf-cutting ants and symbiotic fungi, taken from sympatric colonies of the same or a related species. Ant-fungus incompatibility appeared to be largely independent of the ant species involved, but could be explained partly by genetic differences among the fungus cultivars. Following current theoretical considerations, we develop a hypothesis, originally proposed by S. A. Frank, that the observed incompatibilities are ultimately due to competitive interactions between genetically different fungal lineages, and we predict that the ants should have evolved mechanisms to prevent such competition between cultivars within a single garden. This requires that the ants are able to recognize unfamiliar fungi, and we show that this is indeed the case. Amplified fragment length polymorphism genotyping further shows that the two sympatric Acromyrmex species share each other's major lineages of cultivar, confirming that horizontal transfer does occasionally take place. We argue and provide some evidence that chemical substances produced by the fungus garden may mediate recognition of alien fungi by the ants. We show that incompatibility between ants and transplanted, genetically different cultivars is indeed due to active killing of the novel cultivar by the ants. This incompatibility disappears when ants are force-fed the novel cultivar for about a week, a result that is consistent with our hypothesis of recognition induced by the resident fungus and eventual replacement of incompatibility compounds during force-feeding.

  19. The importance of ants in cave ecology, with new records and behavioral observations of ants in Arizona caves

    Directory of Open Access Journals (Sweden)

    Robert B. Pape

    2016-09-01

    Full Text Available The importance of ants as elements in cave ecology has been mostly unrecognized. A global list of ant species recorded from caves, compiled from a review of existing literature, is presented. This paper also reviews what is currently known about ants occurring in Arizona (USA caves. The diversity and distribution represented in these records suggests ants are relatively common cave visitors (trogloxenes. A general utilization of caves by ants within both temperate and tropical latitudes may be inferred from this combined evidence. Observations of ant behavior in Arizona caves demonstrate a low level and sporadic, but persistent, use of these habitats and their contained resources by individual ant colonies. Documentation of Neivamyrmex sp. preying on cave-inhabiting arthropods is reported here for the first time. Observations of hypogeic army ants in caves suggests they may not penetrate to great vertical depth in search of prey, but can be persistent occupants in relatively shallow, horizontal sections of caves where they may prey on endemic cave animals. First cave records for ten ant species are reported from Arizona caves. These include two species of Neivamyrmex (N. nigrescens Cresson and Neivamyrmex sp.; Formicidae: Dorylinae, four myrmicines (Pheidole portalensis Wilson, Pheidole cf. porcula Wheeler, Solenopsis aurea Wheeler and Stenamma sp. Westwood, one dolichoderine (Forelius keiferi Wheeler and three formicines (Lasius arizonicus Wheeler, L. sitiens Wilson, and Camponotus sp. Mayr.

  20. ANT tuner retrofit for LEB cavity

    International Nuclear Information System (INIS)

    Walling, L.; Goren, Y.; Kwiatkowski, S.

    1994-03-01

    This report describes a ferrite tuner design for the LEB cavity that utilizes techniques for bonding ferrite to metallic cooling plates that is utilized in the high-power rf and microwave industry. A test tuner was designed to fit into the existing LEB-built magnet and onto the Grimm LEB Cavity. It will require a new vacuum window in order to attain maximal tuning range and high voltage capability and a new center conductor of longer length and a different vacuum window connection than the Grimm center conductor. However, the new center conductor will be essentially identical to the Grimm center conductor in its basic construction and in the way it connects to the stand for support. The tuner is mechanically very similar to high-power stacked circulators built by ANT of Germany and was designed according to ANT's established engineering and design criteria and SSC LEB tuning and power requirements. The tuner design incorporates thin tiles of ferrite glued using a high-radiation-resistance epoxy to copper-plated stainless steel cooling plates of thickness 6.5 mm with water cooling channels inside the plates. The cooling plates constitute 16 pie-shaped segments arranged in a disk. They are electrically isolated from each other to suppress eddy currents. Five of these disks are arranged in parallel with high-pressure rf contacts between the plates at the outer radius. The end walls are slotted copper-plated stainless steel of thickness 3 mm

  1. Loading pattern optimization using ant colony algorithm

    International Nuclear Information System (INIS)

    Hoareau, Fabrice

    2008-01-01

    Electricite de France (EDF) operates 58 nuclear power plants (NPP), of the Pressurized Water Reactor type. The loading pattern optimization of these NPP is currently done by EDF expert engineers. Within this framework, EDF R and D has developed automatic optimization tools that assist the experts. LOOP is an industrial tool, developed by EDF R and D and based on a simulated annealing algorithm. In order to improve the results of such automatic tools, new optimization methods have to be tested. Ant Colony Optimization (ACO) algorithms are recent methods that have given very good results on combinatorial optimization problems. In order to evaluate the performance of such methods on loading pattern optimization, direct comparisons between LOOP and a mock-up based on the Max-Min Ant System algorithm (a particular variant of ACO algorithms) were made on realistic test-cases. It is shown that the results obtained by the ACO mock-up are very similar to those of LOOP. Future research will consist in improving these encouraging results by using parallelization and by hybridizing the ACO algorithm with local search procedures. (author)

  2. Ant Foraging Behavior for Job Shop Problem

    Directory of Open Access Journals (Sweden)

    Mahad Diyana Abdul

    2016-01-01

    Full Text Available Ant Colony Optimization (ACO is a new algorithm approach, inspired by the foraging behavior of real ants. It has frequently been applied to many optimization problems and one such problem is in solving the job shop problem (JSP. The JSP is a finite set of jobs processed on a finite set of machine where once a job initiates processing on a given machine, it must complete processing and uninterrupted. In solving the Job Shop Scheduling problem, the process is measure by the amount of time required in completing a job known as a makespan and minimizing the makespan is the main objective of this study. In this paper, we developed an ACO algorithm to minimize the makespan. A real set of problems from a metal company in Johor bahru, producing 20 parts with jobs involving the process of clinching, tapping and power press respectively. The result from this study shows that the proposed ACO heuristics managed to produce a god result in a short time.

  3. The effect of diet and opponent size on aggressive interactions involving caribbean crazy ants (Nylanderia fulva.

    Directory of Open Access Journals (Sweden)

    Katherine C Horn

    Full Text Available Biotic interactions are often important in the establishment and spread of invasive species. In particular, competition between introduced and native species can strongly influence the distribution and spread of exotic species and in some cases competition among introduced species can be important. The Caribbean crazy ant, Nylanderia fulva, was recently introduced to the Gulf Coast of Texas, and appears to be spreading inland. It has been hypothesized that competition with the red imported fire ant, Solenopsis invicta, may be an important factor in the spread of crazy ants. We investigated the potential of interspecific competition among these two introduced ants by measuring interspecific aggression between Caribbean crazy ant workers and workers of Solenopsis invicta. Specifically, we examined the effect of body size and diet on individual-level aggressive interactions among crazy ant workers and fire ants. We found that differences in diet did not alter interactions between crazy ant workers from different nests, but carbohydrate level did play an important role in antagonistic interactions with fire ants: crazy ants on low sugar diets were more aggressive and less likely to be killed in aggressive encounters with fire ants. We found that large fire ants engaged in fewer fights with crazy ants than small fire ants, but fire ant size affected neither fire ant nor crazy ant mortality. Overall, crazy ants experienced higher mortality than fire ants after aggressive encounters. Our findings suggest that fire ant workers might outcompete crazy ant workers on an individual level, providing some biotic resistance to crazy ant range expansion. However, this resistance may be overcome by crazy ants that have a restricted sugar intake, which may occur when crazy ants are excluded from resources by fire ants.

  4. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

    Science.gov (United States)

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

    2016-01-01

    The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

  5. Aphid egg protection by ants: a novel aspect of the mutualism between the tree-feeding aphid Stomaphis hirukawai and its attendant ant Lasius productus

    Science.gov (United States)

    Matsuura, Kenji; Yashiro, Toshihisa

    2006-10-01

    Aphids often form mutualistic associations with ants, in which the aphids provide the ants with honeydew and the ants defend the aphids from predators. In this paper, we report aphid egg protection by ants as a novel aspect of the deeply interdependent relationship between a tree-feeding aphid and its attendant ant. The ant Lasius productus harbours oviparous females, males, and eggs of the hinoki cypress-feeding aphid Stomaphis hirukawai in its nests in winter. We investigated the behaviour of ants kept with aphid eggs in petri dishes to examine whether the ants recognise the aphid eggs and tend them or only provide a refuge for the aphids. Workers carried almost all of the aphid eggs into the nest within 24 h. The ants indiscriminately tended aphid eggs collected from their own colonies and those from other ant colonies. The ants cleaned the eggs and piled them up in the nest, and egg tending by ants dramatically increased aphid egg survival rates. Starving the ants showed no significant effect on aphid egg survivorship. Without ants, aphid eggs were rapidly killed by fungi. These results suggested that grooming by the ants protected the aphid eggs, at least, against pathogenic fungi. This hygienic service afforded by the ants seems indispensable for egg survival of these aphids in an environment rich in potentially pathogenic microorganisms.

  6. Encoding information into precipitation structures

    International Nuclear Information System (INIS)

    Martens, Kirsten; Bena, Ioana; Droz, Michel; Rácz, Zoltan

    2008-01-01

    Material design at submicron scales would be profoundly affected if the formation of precipitation patterns could be easily controlled. It would allow the direct building of bulk structures, in contrast to traditional techniques which consist of removing material in order to create patterns. Here, we discuss an extension of our recent proposal of using electrical currents to control precipitation bands which emerge in the wake of reaction fronts in A + + B – → C reaction–diffusion processes. Our main result, based on simulating the reaction–diffusion–precipitation equations, is that the dynamics of the charged agents can be guided by an appropriately designed time-dependent electric current so that, in addition to the control of the band spacing, the width of the precipitation bands can also be tuned. This makes straightforward the encoding of information into precipitation patterns and, as an amusing example, we demonstrate the feasibility by showing how to encode a musical rhythm

  7. Current and potential ant impacts in the Pacific region

    Science.gov (United States)

    Loope, Lloyd L.; Krushelnycky, Paul D.

    2007-01-01

    Worldwide, ants are a powerful ecological force, and they appear to be dominant components of animal communities of many tropical and temperate ecosystems in terms of biomass and numbers of individuals (Bluthgen et al. 2000). For example, ants comprise up to 94% of arthropod individuals in fogging samples taken from diverse lowland tropical rainforest canopies, and 86% of the biomass (Davidson et al. 2003). The majority of these ant species and individuals obtain carbohydrates either from extrafloral nectaries or from sap-feeding Hemiptera that pass carbohydrate-rich “honeydew” to attending ants while concentrating nitrogen (N) from N-poor plant sap (Davidson et al. 2003). Honeydew and nectar represent key resources for arboreal ant species, although most ant species are at least partly carnivorous or scavengers (Bluthgen et al. 2004). In contrast to most of the terrestrial world, the biotas of many Pacific islands evolved without ants. Whereas endemic ant species are found in New Zealand (ca. 10 spp.), Tonga (ca. 10 spp.), and Samoa (ca. 12 spp.), other islands of Polynesia and parts of Micronesia likely lack native ants (Wilson and Taylor 1967, Wetterer 2002, Wetterer and Vargo 2003). About 20 Indo-Australian and western Pacific ant species range to the east and north of Samoa, but it is unclear how many of these were transported there by humans at some time (Wilson and Taylor 1967). Most of the remainder of the ant species currently found on Pacific islands are widespread species that fall in the category of “tramp species,” dispersed by recent human commerce and generally closely tied to human activity and urban areas (Wilson and Taylor 1967, McGlynn 1999). In Pacific island situations, some of these tramp ant species are able to thrive beyond areas of human activity. Relatively few ant species have been successful invaders of native communities on continents, and these include most of the species that pose the greatest problems for Pacific islands

  8. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  9. HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

    Science.gov (United States)

    Roy, Ajit; Ranjan, Akash

    2016-02-23

    Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

  10. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    Science.gov (United States)

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  11. Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters.

    Science.gov (United States)

    Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn

    2016-10-01

    Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

  12. Ultrastructure of antennal sensillae of the samsum ant ...

    African Journals Online (AJOL)

    Black ant (Samsum), Pachycodyla sennarrensis, stings and injects venom and inflicts allergy (a rare clinical problem) due to its local and systemic reaction, which is considered as a health hazard amongst Saudi society. Thus, black ant is a source of serious concern for the government and experts as well.

  13. Development of a Bait System for the Pharaoh's Ant, Monomorium ...

    African Journals Online (AJOL)

    The infestation of the Pharaoh's ant, Monomorium pharaonis L. is widespread and, sometimes, very serious in homes, hospitals, restaurants, factories, etc. People are helpless because effective baited traps are not available locally, and little has been done locally to develop effective control strategies for these ants.

  14. A preliminary checklist of the ants (Hymenoptera: Formicidae) of ...

    African Journals Online (AJOL)

    A preliminary species checklist of the ants (Hymenoptera: Formicidae) of. Kakamega Forest, Western Kenya, is presented. The species list is based on specimens sampled from 1999 until 2009, which are deposited in the ant collection of the Zoological Research Museum Koenig, Bonn, Germany, and the Natural History ...

  15. Ant species richness of fynbos and forest ecosystems in the ...

    African Journals Online (AJOL)

    The ant fauna in fynbos and forest habitats in the southern Cape are compared. There is no significant difference in ant species richness between the two undisturbed habitat types, and the only two species common to both are Acantholepis capensis and Camponotus maculatus. The degree of Hakea sericea infestation in ...

  16. Volatile chemicals in glands of the carpenter ant, Camponotus ...

    African Journals Online (AJOL)

    Volatile chemicals in glands of the carpenter ant, Camponotus arminius. J.M. Brand, L.V. Mabinya, E.D. Morgan. Abstract. Camponotus arminius is a large black carpenter ant that occurs in tropical and sub-tropical Africa and has extensive foraging trails both in trees and on the ground. Analysis of excised mandibular glands ...

  17. Novel Phialophora species from leaf-cutting ants (tribe Attini)

    NARCIS (Netherlands)

    Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.

    2014-01-01

    Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

  18. Why do house-hunting ants recruit in both directions?

    NARCIS (Netherlands)

    Planqué, R.; Dechaume-Moncharmont, F.-X.; Franks, N.R.; Kovacs, T.; Marshall, J.A.R.

    2007-01-01

    To perform tasks, organisms often use multiple procedures. Explaining the breadth of such behavioural repertoires is not always straightforward. During house hunting, colonies of Temnothorax albipennis ants use a range of behaviours to organise their emigrations. In particular, the ants use tandem

  19. Tracing the rise of ants - out of the ground.

    Directory of Open Access Journals (Sweden)

    Andrea Lucky

    Full Text Available The evolution of ants (Hymenoptera: Formicidae is increasingly well-understood due to recent phylogenetic analyses, along with estimates of divergence times and diversification rates. Yet, leading hypotheses regarding the ancestral habitat of ants conflict with new findings that early ant lineages are cryptic and subterranean. Where the ants evolved, in respect to habitat, and how habitat shifts took place over time have not been formally tested. Here, we reconstruct the habitat transitions of crown-group ants through time, focusing on where they nest and forage (in the canopy, litter, or soil. Based on ancestral character reconstructions, we show that in contrast to the current consensus based on verbal arguments that ants evolved in tropical leaf litter, the soil is supported as the ancestral stratum of all ants. We also find subsequent movements up into the litter and, in some cases, into the canopy. Given the global importance of ants, because of their diversity, ecological influence and status as the most successful eusocial lineage on Earth, understanding the early evolution of this lineage provides insight into the factors that made this group so successful today.

  20. In vitro studies of ante-mortem proliferation kinetics

    International Nuclear Information System (INIS)

    McBride, W.H.; Withers, H.R.

    1986-01-01

    Using K562 human erythroblastoid cells, it was concluded that dose fractionation has no discrepant effect on the ante-mortem proliferation kinetics of doomed cells as opposed to clonogenic cell survival and that effects on ante-mortem proliferation kinetics cannot be solely responsible for the differences in fractionation response between early and late responding tissues. (UK)

  1. Reciprocal genomic evolution in the ant-fungus agricultural symbiosis

    DEFF Research Database (Denmark)

    Nygaard, Sanne; Hu, Haofu; Li, Cai

    2016-01-01

    The attine ant-fungus agricultural symbiosis evolved over tens of millions of years, producing complex societies with industrial-scale farming analogous to that of humans. Here we document reciprocal shifts in the genomes and transcriptomes of seven fungus-farming ant species and their fungal...

  2. Life-Histories of Sub-Arctic Ants

    OpenAIRE

    Heinze, Jürgen

    1993-01-01

    Ant species belonging to seven genera occur in habitats near the tree line in the Northern Hemisphere. An analysis of colony founding strategies suggests that in addition to physiological cold resistance, behavioral and sociometric adaptations might be important for survival and propagation of ants in subarctic biomes.

  3. Studies of laboulbeniales (Fungi, Ascomycota) on myrmica ants (II)

    NARCIS (Netherlands)

    Haelewaters, Danny; Boer, Peter; Gort, Gerrit; Noordijk, Jinze

    2015-01-01

    One group of important insect parasites are the Laboulbeniales (Ascomycota), microscopic fungi that live attached to the exterior of their hosts, mainly beetles, but also mites, millipedes, earwigs, and ants. Rickia wasmannii is a common fungus in Europe and is limited to the ant genus Myrmica

  4. ADAPTIVE ANT COLONY OPTIMIZATION BASED GRADIENT FOR EDGE DETECTION

    Directory of Open Access Journals (Sweden)

    Febri Liantoni

    2014-08-01

    Full Text Available Ant Colony Optimization (ACO is a nature-inspired optimization algorithm which is motivated by ants foraging behavior. Due to its favorable advantages, ACO has been widely used to solve several NP-hard problems, including edge detection. Since ACO initially distributes ants at random, it may cause imbalance ant distribution which later affects path discovery process. In this paper an adaptive ACO is proposed to optimize edge detection by adaptively distributing ant according to gradient analysis. Ants are adaptively distributed according to gradient ratio of each image regions. Region which has bigger gradient ratio, will have bigger number of ant distribution. Experiments are conducted using images from various datasets. Precision and recall are used to quantitatively evaluate performance of the proposed algorithm. Precision and recall of adaptive ACO reaches 76.98 % and 96.8 %. Whereas highest precision and recall for standard ACO are 69.74 % and 74.85 %. Experimental results show that the adaptive ACO outperforms standard ACO which randomly distributes ants.

  5. Patterns of male parentage in the fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Boomsma, JJ

    2003-01-01

    Ant queens from eight species, covering three genera of lower and two genera of higher attine ants, have exclusively or predominantly single mating. The ensuing full-sib colonies thus have a strong potential reproductive conflict between the queen and the workers over male production...

  6. Odorous house ants (Tapinoma sessile as back-seat drivers of localized ant decline in urban habitats.

    Directory of Open Access Journals (Sweden)

    Adam Salyer

    Full Text Available Invasive species and habitat disturbance threaten biodiversity worldwide by modifying ecosystem performance and displacing native organisms. Similar homogenization impacts manifest locally when urbanization forces native species to relocate or reinvade perpetually altered habitat. This study investigated correlations between ant richness and abundance in response to urbanization and the nearby presence of invasive ant species, odorous house ants (Tapinoma sessile, within its native region. Surveying localized ant composition within natural, semi-natural, and urban habitat supported efforts to determine whether T. sessile appear to be primary (drivers threats as instigators or secondary (passengers threats as inheritors of indigenous ant decline. Sampling 180 sites, evenly split between all habitats with and without T. sessile present, yielded 45 total species. Although urbanization and T. sessile presence factors were significantly linked to ant decline, their interaction correlated to the greatest reduction of total ant richness (74% and abundance (81%. Total richness appeared to decrease from 27 species to 18 when natural habitat is urbanized and from 18 species to 7 with T. sessile present in urban plots. Odorous house ant presence minimally influenced ant communities within natural and semi-natural habitat, highlighting the importance of habitat alteration and T. sessile presence interactions. Results suggest urbanization releases T. sessile from unknown constraints by decreasing ant richness and competition. Within urban environment, T. sessile are pre-adapted to quickly exploit new resources and grow to supercolony strength wherein T. sessile drive adjacent biodiversity loss. Odorous house ants act as passengers and drivers of ecological change throughout different phases of urban 'invasion'. This progression through surviving habitat alteration, exploiting new resources, thriving, and further reducing interspecific competition supports a

  7. Weaver Ants to Control Fruit Fly Damage to Tanzanian Mangoes

    DEFF Research Database (Denmark)

    Kirkegaard, Nina

    in Australia and West Africa. In this study, small scale farmers did not think weaver ants protected their mangoes from fruit flies. Observational studies confirmed the farmers’ views. No volatile compounds, likely to be responsible for the weaver ants’ deterrent effect, were identified. This study focused...... mangoes varied a lot with zero infestation in some fruits and more than 100 pupae emerging from other fruits, indicating that other factors than the presence of weaver ants affect the fruit flies’ decision on where to oviposit. It was not uncommon for farmers to place newly harvested mangoes below mango...... not shown to be effectively deterring fruit flies, there is no great motivation for farmers to adopt weaver ants. Assuming the weaver ants could be managed in a way that made weaver ants deter fruit flies effectively there are still some economic aspects which should be studied further. It is necessary...

  8. Behind every great ant, there is a great gut

    DEFF Research Database (Denmark)

    Poulsen, Michael; Sapountzis, Panagiotis

    2012-01-01

    on the potential contribution of the ants’ gut symbionts. This issue of Molecular Ecology contains a study by Anderson et al. (2012), who take a comparative approach to explore the link between trophic levels and ant microbiomes, specifically, to address three main questions: (i) Do closely related herbivorous...... conserved gut microbiomes, suggesting symbiont functions that directly relate to dietary preference of the ant host. These findings suggest an ecological role of gut symbionts in ants, for example, in metabolism and/or protection, and the comparative approach taken supports a model of co-evolution between...... ant species and specific core symbiont microbiomes. This study, thereby, highlights the omnipresence and importance of gut symbioses—also in the Hymenoptera—and suggests that these hitherto overlooked microbes likely have contributed to the ecological success of the ants....

  9. Endophytic fungi reduce leaf-cutting ant damage to seedlings

    Science.gov (United States)

    Bittleston, L. S.; Brockmann, F.; Wcislo, W.; Van Bael, S. A.

    2011-01-01

    Our study examines how the mutualism between Atta colombica leaf-cutting ants and their cultivated fungus is influenced by the presence of diverse foliar endophytic fungi (endophytes) at high densities in tropical leaf tissues. We conducted laboratory choice trials in which ant colonies chose between Cordia alliodora seedlings with high (Ehigh) or low (Elow) densities of endophytes. The Ehigh seedlings contained 5.5 times higher endophyte content and a greater diversity of fungal morphospecies than the Elow treatment, and endophyte content was not correlated with leaf toughness or thickness. Leaf-cutting ants cut over 2.5 times the leaf area from Elow relative to Ehigh seedlings and had a tendency to recruit more ants to Elow plants. Our findings suggest that leaf-cutting ants may incur costs from cutting and processing leaves with high endophyte loads, which could impact Neotropical forests by causing variable damage rates within plant communities. PMID:20610420

  10. Egg-laying butterflies distinguish predaceous ants by sight.

    Science.gov (United States)

    Sendoya, Sebastián F; Freitas, André V L; Oliveira, Paulo S

    2009-07-01

    Information about predation risks is critical for herbivorous insects, and natural selection favors their ability to detect predators before oviposition and to select enemy-free foliage when offspring mortality risk is high. Food plants are selected by ovipositing butterflies, and offspring survival frequently varies among plants because of variation in the presence of predators. Eunica bechina butterflies oviposit on Caryocar brasiliense, an ant-defended plant. Experiments with dried Camponotus and Cephalotes ants pinned to leaves revealed that butterflies use ant size and form as visual cues to avoid ovipositing on plant parts occupied by ants more likely to kill larval offspring. Presence of sap-sucking bugs did not affect butterfly oviposition. This is the first demonstration that visual recognition of predators can mediate egg-laying decisions by an insect herbivore and that an insect will discriminate among different species of potential predators. This unusual behavioral capability permits specialization on a risky, ant-defended food plant.

  11. ANT International chemistry update and best practices

    International Nuclear Information System (INIS)

    Nordmann, F.; Odar, S.; Venz, H.; Kysela, J.; Ruehle, W.; Riess, R.

    2010-01-01

    There is an increasing number of Nuclear Power Plants (NPP) in various countries. Their chemistry practices are different due to the variety of designs and experiences while in the past the view was more monolithic. This is allowing a very rich experience that is extremely difficult to fully be aware of. ANT International is now collecting and evaluating these data as well as related R and D Information. This allows interested parties to have an easier access to the various sources of information. The chemistry experts associated to ANT International have been gathering a comprehensive detailed view of: The numerous laboratory data gained all over the world during the past decades; The extensive plant operating experiences with various types of chemistry strategies, crosschecked for various types of reactors designs and materials; An experienced international knowledge able to give the comprehensive overview that young engineers now in charge of many other activities are unable to fully cover. This paper gives the core conclusions of the detailed ANT International reports and results that have recently been gathered in the area of chemistry. It particularly covers: The primary water chemistry and its relation with radionuclides, dose rates and fuel behaviour; The secondary water chemistry focusing on its rationale selection depending on materials, design and other constraints; The start up and shutdown chemistry with it large variety of practices hardly understandable even for some experts; and, The maintenance remedies such as decontamination, steam generator cleaning and its alternate options. Various types of Reactor designs (PWR, VVER, BWR, CANDU®) are considered. The different materials, for example the impact of steam generator tubing and its evolution on the secondary water chemistry rationale or on the radioactivity built-up in the primary coolant, are described. The ways to improve the plant operation with a long term reliability as well as the most

  12. The regulation of ant colony foraging activity without spatial information.

    Directory of Open Access Journals (Sweden)

    Balaji Prabhakar

    Full Text Available Many dynamical networks, such as the ones that produce the collective behavior of social insects, operate without any central control, instead arising from local interactions among individuals. A well-studied example is the formation of recruitment trails in ant colonies, but many ant species do not use pheromone trails. We present a model of the regulation of foraging by harvester ant (Pogonomyrmex barbatus colonies. This species forages for scattered seeds that one ant can retrieve on its own, so there is no need for spatial information such as pheromone trails that lead ants to specific locations. Previous work shows that colony foraging activity, the rate at which ants go out to search individually for seeds, is regulated in response to current food availability throughout the colony's foraging area. Ants use the rate of brief antennal contacts inside the nest between foragers returning with food and outgoing foragers available to leave the nest on the next foraging trip. Here we present a feedback-based algorithm that captures the main features of data from field experiments in which the rate of returning foragers was manipulated. The algorithm draws on our finding that the distribution of intervals between successive ants returning to the nest is a Poisson process. We fitted the parameter that estimates the effect of each returning forager on the rate at which outgoing foragers leave the nest. We found that correlations between observed rates of returning foragers and simulated rates of outgoing foragers, using our model, were similar to those in the data. Our simple stochastic model shows how the regulation of ant colony foraging can operate without spatial information, describing a process at the level of individual ants that predicts the overall foraging activity of the colony.

  13. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold

    2016-01-01

    Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements...... of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...... on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...

  14. Hall effect encoding of brushless dc motors

    Science.gov (United States)

    Berard, C. A.; Furia, T. J.; Goldberg, E. A.; Greene, R. C.

    1970-01-01

    Encoding mechanism integral to the motor and using the permanent magnets embedded in the rotor eliminates the need for external devices to encode information relating the position and velocity of the rotating member.

  15. Immune defense in leaf-cutting ants

    DEFF Research Database (Denmark)

    Armitage, Sophie A O; Broch, Jens F; Marín, Hermogenes Fernández

    2011-01-01

    To ameliorate the impact of disease, social insects combine individual innate immune defenses with collective social defenses. This implies that there are different levels of selection acting on investment in immunity, each with their own trade-offs. We present the results of a cross......-fostering experiment designed to address the influences of genotype and social rearing environment upon individual and social immune defenses. We used a multiply mating leaf-cutting ant, enabling us to test for patriline effects within a colony, as well as cross-colony matriline effects. The worker's father influenced...... both individual innate immunity (constitutive antibacterial activity) and the size of the metapleural gland, which secretes antimicrobial compounds and functions in individual and social defense, indicating multiple mating could have important consequences for both defense types. However, the primarily...

  16. Ex-ante Evaluation von Investitionsalternativen

    Directory of Open Access Journals (Sweden)

    Matthias Müller

    2017-12-01

    Full Text Available Der Beitrag zeigt, wie mit Hilfe der Methode der agentenbasierten Modellierung und Simulation (ABMS ein Beitrag zur ex-ante Policy-Beratung geleistet werden kann. Anhand eines exemplarischen Anwendungsfalls, der VISIBLE Simulationsumgebung („Virtual Simulation Lab for the Analysis of Investments in Learning and Education“, diskutieren wir die Konsequenzen unterschiedlicher Kooperationsförderinstrumente für Wissensdiffusionsprozesse in Netzwerken am Beispiel der Region Heilbronn-Franken. Die Simulationsergebnisse zeigen, dass die strukturelle Konfiguration eines regionalen Innovationssystems eine zentrale Bedeutung für die Gestaltung von Kooperationsfördermaßnahmen hat und dass Interventionen, die darauf abzielen, Wissenstransfer zwischen den Akteuren anzuregen, genau die entgegengesetzten Wirkungen entfalten können.

  17. Swarm controlled emergence for ant clustering

    DEFF Research Database (Denmark)

    Scheidler, Alexander; Merkle, Daniel; Middendorf, Martin

    2013-01-01

    .g. moving robots, and clustering algorithms. Design/methodology/approach: Different types of control agents for that ant clustering model are designed by introducing slight changes to the behavioural rules of the normal agents. The clustering behaviour of the resulting swarms is investigated by extensive...... for future research to investigate the application of the method in other swarm systems. Swarm controlled emergence might be applied to control emergent effects in computing systems that consist of many autonomous components which make decentralized decisions based on local information. Practical...... simulation studies. Findings: It is shown that complex behavior can emerge in systems with two types of agents (normal agents and control agents). For a particular behavior of the control agents, an interesting swarm size dependent effect was found. The behaviour prevents clustering when the number...

  18. Discrimination Behavior in the Supercolonial Pharaoh Ant

    DEFF Research Database (Denmark)

    Pontieri, Luigi

    The majority of eusocial insect species live in small, kin structured colonies that are mutually aggressive and rarely interact. By contrast, a restricted group of ant species show a peculiar social organization called unicoloniality, where colonies can grow to vast networks of geographically...... and genetic distance between colony pairs, further confirming the important role of endogenous cues in the nestmate recognition of this species. The third chapter presents a methodological study on the best procedures for identifying chemical compounds used for nestmate recognition in social insects. We first...... evaluated the power of different combinations of data transformation and chemical distance calculation in differentiating between true nestmate recognition (NMR) cues and other compounds. We found that particular combinations of statistical procedures are more effective in differentiating NMR cues from...

  19. Flipped-Adversarial AutoEncoders

    OpenAIRE

    Zhang, Jiyi; Dang, Hung; Lee, Hwee Kuan; Chang, Ee-Chien

    2018-01-01

    We propose a flipped-Adversarial AutoEncoder (FAAE) that simultaneously trains a generative model G that maps an arbitrary latent code distribution to a data distribution and an encoder E that embodies an "inverse mapping" that encodes a data sample into a latent code vector. Unlike previous hybrid approaches that leverage adversarial training criterion in constructing autoencoders, FAAE minimizes re-encoding errors in the latent space and exploits adversarial criterion in the data space. Exp...

  20. UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

    International Nuclear Information System (INIS)

    Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

    1988-01-01

    Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs