Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

Science.gov (United States)

Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

2017-10-01

One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

Structural characterization of the Salmonella typhimurium LT2 umu operon

International Nuclear Information System (INIS)

Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

1990-01-01

The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

Science.gov (United States)

Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

2012-01-01

During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

Science.gov (United States)

Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

2016-01-01

Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

Dissecting the Photoprotective Mechanism Encoded by the flv4-2 Operon: a Distinct Contribution of Sll0218 in Photosystem II Stabilization.

Science.gov (United States)

Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari

2017-03-01

In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.

Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

Science.gov (United States)

Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

2016-03-18

In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

Science.gov (United States)

Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

2011-06-10

The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Science.gov (United States)

Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

2008-01-01

Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

NARCIS (Netherlands)

KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2005-11-18

Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

Directory of Open Access Journals (Sweden)

Dharmesh Harwani

2014-12-01

Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

Science.gov (United States)

Harwani, Dharmesh

2014-01-01

Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2007-03-15

Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

Science.gov (United States)

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-10-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

Science.gov (United States)

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Directory of Open Access Journals (Sweden)

Lindblad Peter

2008-04-01

Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

Science.gov (United States)

Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

2014-01-01

Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

2003-01-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

2003-09-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

NARCIS (Netherlands)

Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

2006-01-01

The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

Science.gov (United States)

Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

2015-07-07

Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

Directory of Open Access Journals (Sweden)

Gogarten J Peter

2008-01-01

Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Detecting uber-operons in prokaryotic genomes.

Science.gov (United States)

Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

2006-01-01

We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

Science.gov (United States)

Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

2014-01-01

Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

Directory of Open Access Journals (Sweden)

Juliana Teixeira de Magalhães

2005-06-01

Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

Elucidation of Operon Structures across Closely Related Bacterial Genomes

Science.gov (United States)

Li, Guojun

2014-01-01

About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

Evidence against the selfish operon theory.

Science.gov (United States)

Pál, Csaba; Hurst, Laurence D

2004-06-01

According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

REMap: Operon Map of M. tuberculosis

Science.gov (United States)

Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

2016-01-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

Science.gov (United States)

Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

2014-10-01

The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

ProOpDB: Prokaryotic Operon DataBase.

Science.gov (United States)

Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

2012-01-01

The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

The relative value of operon predictions

NARCIS (Netherlands)

Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

Science.gov (United States)

de Oliveira, Rafael R; Nicholson, Wayne L

2016-01-01

To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Transcriptome dynamics-based operon prediction in prokaryotes.

Science.gov (United States)

Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

2014-05-16

Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

International Nuclear Information System (INIS)

Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

1993-01-01

Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

Science.gov (United States)

Kim, Moonjeong; Kim, Kwang-Sun

2017-07-06

The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

Science.gov (United States)

Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

2015-11-17

rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

Science.gov (United States)

Zhu, Y; Lin, E C

1988-05-01

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Directory of Open Access Journals (Sweden)

Johanna Rintahaka

Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Science.gov (United States)

Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

2014-01-01

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

Problem-Solving Test: Tryptophan Operon Mutants

Science.gov (United States)

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

Science.gov (United States)

Narang, Atul; Oehler, Stefan

2017-05-01

The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

Directory of Open Access Journals (Sweden)

Sun Yuan

2006-02-01

Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

DEFF Research Database (Denmark)

Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

2015-01-01

encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿

OpenAIRE

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-01-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

Directory of Open Access Journals (Sweden)

Cataldi Angel A

2011-07-01

Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

Science.gov (United States)

2011-01-01

Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

DEFF Research Database (Denmark)

Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

2008-01-01

The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

Science.gov (United States)

Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

2017-11-01

Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

Stochastic simulations of the tetracycline operon

Science.gov (United States)

2011-01-01

Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

Stochastic simulations of the tetracycline operon

Directory of Open Access Journals (Sweden)

Kaznessis Yiannis N

2011-01-01

Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

Directory of Open Access Journals (Sweden)

Marasco Rosangela

2006-11-01

Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

International Nuclear Information System (INIS)

Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

1988-01-01

The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Metazoan operons accelerate recovery from growth arrested states

Science.gov (United States)

Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

2011-01-01

Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

OpenAIRE

Burbank, Lindsey P.; Van Horn, Christopher R.

2017-01-01

The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

OpenAIRE

Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

2000-01-01

In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply.

Science.gov (United States)

Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari

2012-09-28

The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.

The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply*

Science.gov (United States)

Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari

2012-01-01

The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963

Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

Science.gov (United States)

Ray, Sujay; Banerjee, Arundhati

2015-10-01

Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

Science.gov (United States)

da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

2017-07-01

One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

Teaching the Big Ideas of Biology with Operon Models

Science.gov (United States)

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

Science.gov (United States)

Chowdhury, Nilkanta; Bagchi, Angshuman

2017-07-01

Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

Science.gov (United States)

Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

2018-01-01

Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4

DEFF Research Database (Denmark)

Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian

1994-01-01

specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...

RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

Science.gov (United States)

Pérez-Oseguera, Angeles; Cevallos, Miguel A

2013-11-01

Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

2005-04-12

Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

Directory of Open Access Journals (Sweden)

Uzma Qaisar

Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum

Science.gov (United States)

2012-01-01

Background The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. Results By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. Conclusions The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation. PMID:22243621

Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum.

Science.gov (United States)

Schneider, Jens; Peters-Wendisch, Petra; Stansen, K Corinna; Götker, Susanne; Maximow, Stanislav; Krämer, Reinhard; Wendisch, Volker F

2012-01-13

The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation.

The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

Science.gov (United States)

Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

2014-01-01

Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

2015-01-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

2015-09-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

Science.gov (United States)

Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

2017-01-01

Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

DEFF Research Database (Denmark)

Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

2005-01-01

Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

Science.gov (United States)

Lawrence, J

1999-12-01

The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

Science.gov (United States)

Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

2017-01-15

The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

Evolution and Biophysics of the Escherichia coli lac Operon

Science.gov (United States)

Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

2011-03-01

To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

International Nuclear Information System (INIS)

Thomas, S.M.; Sedgwick, S.G.

1989-01-01

Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

NARCIS (Netherlands)

Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

2013-01-01

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

Science.gov (United States)

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

Science.gov (United States)

Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

2015-08-18

Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Tricistronic operon expression of the genes gcaD (tms), which encodes N-acetylglucosamine 1-phosphate uridyltransferase, prs, which encodes phosphoribosyl diphosphate synthetase, and ctc in vegetative cells of Bacillus subtilis

DEFF Research Database (Denmark)

Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne

1995-01-01

The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...

Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

Science.gov (United States)

Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

2014-11-01

The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

REMap: Operon map of M. tuberculosis based on RNA sequence data.

Science.gov (United States)

Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

2016-07-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

Science.gov (United States)

Ray, J. Christian J; Igoshin, Oleg A.

2012-01-01

Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

The Genomic Pattern of tDNA Operon Expression in E. coli.

Directory of Open Access Journals (Sweden)

2005-06-01

Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

Solving a discrete model of the lac operon using Z3

Science.gov (United States)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

An Engineered orco Mutation Produces Aberrant Social Behavior and Defective Neural Development in Ants.

Science.gov (United States)

Yan, Hua; Opachaloemphan, Comzit; Mancini, Giacomo; Yang, Huan; Gallitto, Matthew; Mlejnek, Jakub; Leibholz, Alexandra; Haight, Kevin; Ghaninia, Majid; Huo, Lucy; Perry, Michael; Slone, Jesse; Zhou, Xiaofan; Traficante, Maria; Penick, Clint A; Dolezal, Kelly; Gokhale, Kaustubh; Stevens, Kelsey; Fetter-Pruneda, Ingrid; Bonasio, Roberto; Zwiebel, Laurence J; Berger, Shelley L; Liebig, Jürgen; Reinberg, Danny; Desplan, Claude

2017-08-10

Ants exhibit cooperative behaviors and advanced forms of sociality that depend on pheromone-mediated communication. Odorant receptor neurons (ORNs) express specific odorant receptors (ORs) encoded by a dramatically expanded gene family in ants. In most eusocial insects, only the queen can transmit genetic information, restricting genetic studies. In contrast, workers in Harpegnathos saltator ants can be converted into gamergates (pseudoqueens) that can found entire colonies. This feature facilitated CRISPR-Cas9 generation of germline mutations in orco, the gene that encodes the obligate co-receptor of all ORs. orco mutations should significantly impact olfaction. We demonstrate striking functions of Orco in odorant perception, reproductive physiology, and social behavior plasticity. Surprisingly, unlike in other insects, loss of OR functionality also dramatically impairs development of the antennal lobe to which ORNs project. Therefore, the development of genetics in Harpegnathos establishes this ant species as a model organism to study the complexity of eusociality. Copyright © 2017 Elsevier Inc. All rights reserved.

Discovery of defense- and neuropeptides in social ants by genome-mining.

Directory of Open Access Journals (Sweden)

Christian W Gruber

Full Text Available Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant, Camponotus floridanus (carpenter ant and Harpegnathos saltator (basal genus. Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulatory peptide hormones, such as allatostatins and tachykinins, were identified and analyzed. Most interestingly we annotated genes that encode oxytocin/vasopressin-related peptides (inotocins and their putative receptors. This is the first piece of evidence for the existence of this nonapeptide hormone system in ants (Formicidae and supports recent findings in Tribolium castaneum (red flour beetle and Nasonia vitripennis (parasitoid wasp, and therefore its confinement to some basal holometabolous insects. By contrast, the absence of the inotocin hormone system in Apis mellifera (honeybee, another closely-related member of the eusocial Hymenoptera clade, establishes the basis for future studies on the molecular evolution and physiological function of oxytocin/vasopressin-related peptides (vasotocin nonapeptide family and their receptors in social insects. Particularly the identification of ant inotocin and defensin peptide sequences will provide a basis for future pharmacological characterization in the quest for potent and selective lead compounds of therapeutic value.

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

Science.gov (United States)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

Rapid customised operon assembly by yeast recombinational cloning.

Science.gov (United States)

Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

2017-06-01

We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

Science.gov (United States)

Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

2010-07-01

Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

Science.gov (United States)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

Science.gov (United States)

Branny, P; de la Torre, F; Garel, J R

1998-04-01

The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

Science.gov (United States)

Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

2015-02-01

Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

Science.gov (United States)

Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

2013-07-01

The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

Science.gov (United States)

Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

2017-11-01

The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

CONDOP: an R package for CONdition-Dependent Operon Predictions.

Science.gov (United States)

Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

2016-10-15

The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

Science.gov (United States)

Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

2012-01-01

Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

Science.gov (United States)

Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

2014-01-01

The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

Directory of Open Access Journals (Sweden)

Opsata Mona

2010-08-01

Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

The pyrimidine operon pyrRPB-carA from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Schallert, J.; Andersen, Birgit

2001-01-01

The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

Science.gov (United States)

Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

2017-07-01

Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system

DEFF Research Database (Denmark)

Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø

1997-01-01

A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...

Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

DEFF Research Database (Denmark)

Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

1994-01-01

Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL)

DEFF Research Database (Denmark)

Johansen, L.E.; Nygaard, P.; Lassen, C.

2003-01-01

In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt...

AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration.

Science.gov (United States)

Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A

2015-09-01

Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

Science.gov (United States)

Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

2017-07-17

Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

Science.gov (United States)

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

OpenAIRE

Yadav, Kavita; Kumar, Chanchal; Archana, G.; Naresh Kumar, G.

2014-01-01

Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) s...

Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

Science.gov (United States)

Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

2016-01-01

Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

NARCIS (Netherlands)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

The post-transcriptional operon

DEFF Research Database (Denmark)

Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

2011-01-01

model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

OpenAIRE

Stewart, V; Yanofsky, C

1986-01-01

We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

Ants recognize foes and not friends

Science.gov (United States)

Guerrieri, Fernando J.; Nehring, Volker; Jørgensen, Charlotte G.; Nielsen, John; Galizia, C. Giovanni; d'Ettorre, Patrizia

2009-01-01

Discriminating among individuals and rejecting non-group members is essential for the evolution and stability of animal societies. Ants are good models for studying recognition mechanisms, because they are typically very efficient in discriminating ‘friends’ (nest-mates) from ‘foes’ (non-nest-mates). Recognition in ants involves multicomponent cues encoded in cuticular hydrocarbon profiles. Here, we tested whether workers of the carpenter ant Camponotus herculeanus use the presence and/or absence of cuticular hydrocarbons to discriminate between nest-mates and non-nest-mates. We supplemented the cuticular profile with synthetic hydrocarbons mixed to liquid food and then assessed behavioural responses using two different bioassays. Our results show that (i) the presence, but not the absence, of an additional hydrocarbon elicited aggression and that (ii) among the three classes of hydrocarbons tested (unbranched, mono-methylated and dimethylated alkanes; for mono-methylated alkanes, we present a new synthetic pathway), only the dimethylated alkane was effective in eliciting aggression. Our results suggest that carpenter ants use a fundamentally different mechanism for nest-mate recognition than previously thought. They do not specifically recognize nest-mates, but rather recognize and reject non-nest-mates bearing odour cues that are novel to their own colony cuticular hydrocarbon profile. This begs for a reappraisal of the mechanisms underlying recognition systems in social insects. PMID:19364750

Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

Science.gov (United States)

Frías, José E; Flores, Enrique

2015-07-01

Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

Ant- and Ant-Colony-Inspired ALife Visual Art.

Science.gov (United States)

Greenfield, Gary; Machado, Penousal

2015-01-01

Ant- and ant-colony-inspired ALife art is characterized by the artistic exploration of the emerging collective behavior of computational agents, developed using ants as a metaphor. We present a chronology that documents the emergence and history of such visual art, contextualize ant- and ant-colony-inspired art within generative art practices, and consider how it relates to other ALife art. We survey many of the algorithms that artists have used in this genre, address some of their aims, and explore the relationships between ant- and ant-colony-inspired art and research on ant and ant colony behavior.

An ant-plant mutualism through the lens of cGMP-dependent kinase genes.

Science.gov (United States)

Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E

2017-09-13

In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).

Regulation of the rhaEWRBMA Operon Involved in l-Rhamnose Catabolism through Two Transcriptional Factors, RhaR and CcpA, in Bacillus subtilis.

Science.gov (United States)

Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro

2015-12-28

The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Science.gov (United States)

Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

2013-01-01

The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

ANT

DEFF Research Database (Denmark)

van der Duim, René; Ren, Carina Bregnholm; Jóhannesson, Gunnar Thór

2017-01-01

Ten years ago actor-network theory (ANT) entered this journal. To illustrate how the relational ontology and sensibilities of ANT lend themselves to particular kinds of research, we first interrogate the main controversies as a way to open up and discuss the main premises of ANT. These debates...... concern the status and agency of objects and non-humans, ANT’s denial of the explanatory power of social structures, and the political implications of ANT. Second we present ANT’s relevance for tourism studies and discuss what ANT ‘does’ in practice. After summarizing a decade of relations between ANT...... and tourism, we conclude by tracing three future trajectories of how we have ‘moved away with’ ANT into new areas of discovery....

An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

Science.gov (United States)

Varmanen, P; Rantanen, T; Palva, A

1996-12-01

A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

GenBank blastx search result: AK104780 [KOME

Lifescience Database Archive (English)

Full Text Available AK104780 001-039-C06 AY026914.1 Pseudomonas putida strain P111 czrBA operon, partial sequence; ben operon... and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene.|BCT BCT 3e-11 +2 ...

GenBank blastx search result: AK287557 [KOME

Lifescience Database Archive (English)

Full Text Available AK287557 J065021C17 AY026914.1 AY026914 Pseudomonas putida strain P111 czrBA operon..., partial sequence; ben operon and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene. BCT 0.0 0 ...

GenBank blastx search result: AK109330 [KOME

Lifescience Database Archive (English)

Full Text Available AK109330 006-201-C10 AY026914.1 Pseudomonas putida strain P111 czrBA operon, partial sequence; ben operon... and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene.|BCT BCT 3e-11 +2 ...

GenBank blastx search result: AK289020 [KOME

Lifescience Database Archive (English)

Full Text Available AK289020 J090090F09 AY026914.1 AY026914 Pseudomonas putida strain P111 czrBA operon..., partial sequence; ben operon and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene. BCT 0.0 0 ...

Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

Directory of Open Access Journals (Sweden)

Silvia Dossena

2013-12-01

Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

Science.gov (United States)

Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

2018-04-16

Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

Insight on specificity of uracil permeases of the NAT/NCS2 family from analysis of the transporter encoded in the pyrimidine utilization operon of Escherichia coli.

Science.gov (United States)

Botou, Maria; Lazou, Panayiota; Papakostas, Konstantinos; Lambrinidis, George; Evangelidis, Thomas; Mikros, Emmanuel; Frillingos, Stathis

2018-04-01

The uracil permease UraA of Escherichia coli is a structurally known prototype for the ubiquitous Nucleobase-Ascorbate Transporter (NAT) or Nucleobase-Cation Symporter-2 (NCS2) family and represents a well-defined subgroup of bacterial homologs that remain functionally unstudied. Here, we analyze four of these homologs, including RutG of E. coli which shares 35% identity with UraA and is encoded in the catabolic rut (pyrimidine utilization) operon. Using amplified expression in E. coli K-12, we show that RutG is a high-affinity permease for uracil, thymine and, at low efficiency, xanthine and recognizes also 5-fluorouracil and oxypurinol. In contrast, UraA and the homologs from Acinetobacter calcoaceticus and Aeromonas veronii are permeases specific for uracil and 5-fluorouracil. Molecular docking indicates that thymine is hindered from binding to UraA by a highly conserved Phe residue which is absent in RutG. Site-directed replacement of this Phe with Ala in the three uracil-specific homologs allows high-affinity recognition and/or transport of thymine, emulating the RutG profile. Furthermore, all RutG orthologs from enterobacteria retain an Ala at this position, implying that they can use both uracil and thymine and, possibly, xanthine as substrates and provide the bacterial cell with a range of catabolizable nucleobases. © 2018 John Wiley & Sons Ltd.

Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

Directory of Open Access Journals (Sweden)

Catherine E Dana

Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate.

Science.gov (United States)

Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D

2011-04-01

An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

Directory of Open Access Journals (Sweden)

April M Sapp

Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

The diversity of microorganisms associated with Acromyrmex leafcutter ants

Directory of Open Access Journals (Sweden)

Boomsma Jacobus J

2002-05-01

Full Text Available Abstract Background Molecular biological techniques are dramatically changing our view of microbial diversity in almost any environment that has so far been investigated. This study presents a systematic survey of the microbial diversity associated with a population of Acromyrmex leafcutter ants. In contrast to previous studies on social insects, which targeted specific groups of symbionts occurring in the gut (termites, Tetraponera ants or in specialised cells (Camponotus ants the objective of our present study was to do a total screening of all possible micro-organisms that can be found inside the bodies of these leafcutter ants. Results We amplified, cloned and sequenced SSU rRNA encoding gene fragments from 9 microbial groups known to have insect-associated representatives, and show that: (1 representatives of 5 out of 9 tested groups are present, (2 mostly several strains per group are present, adding up to a total of 33 different taxa. We present the microbial taxa associated with Acromymex ants in a phylogenetic context (using sequences from GenBank to assess and illustrate to which known microorganisms they are closely related. The observed microbial diversity is discussed in the light of present knowledge on the evolutionary history of Acromyrmex leafcutter ants and their known mutualistic and parasitic symbionts. Conclusions The major merits of the screening approach documented here is its high sensitivity and specificity, which allowed us to identify several microorganisms that are promising candidates for further study of their interactions with Acromyrmex leafcutter ants or their gardens.

Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

International Nuclear Information System (INIS)

Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

2011-01-01

Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

Science.gov (United States)

Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

2000-10-01

Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

Cloning and sequencing of wsp encoding gene fragments reveals a diversity of co-infecting Wolbachia strains in Acromyrmex leafcutter ants

DEFF Research Database (Denmark)

van Borm, S.; Wenseleers, T.; Billen, J.

2003-01-01

Acromyrmex insinuator hosted two additional infections. The multiple Wolbachia strains may influence the expression of reproductive conflicts in leafcutter ants, but the expected turnover of infections may make the cumulative effects on host ant reproduction complex. The additional Wolbachia infections......By sequencing part of the wsp gene of a series of clones, we detected an unusually high diversity of nine Wolbachia strains in queens of three species of leafcutter ants. Up to four strains co-occurred in a single ant. Most strains occurred in two clusters (InvA and InvB), but the social parasite...

UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

International Nuclear Information System (INIS)

Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

1994-01-01

UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

Science.gov (United States)

Archana, G.; Naresh Kumar, G.

2014-01-01

Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024

Pseudomonas fluorescens ATCC 13525 containing an artificial oxalate operon and Vitreoscilla hemoglobin secretes oxalic acid and solubilizes rock phosphate in acidic alfisols.

Directory of Open Access Journals (Sweden)

Kavita Yadav

Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.

Generalized antifungal activity and 454-screening of Pseudonocardia and Amycolatopsis bacteria in nests of fungus-growing ants

OpenAIRE

Sen, Ruchira; Ishak, Heather D.; Estrada, Dora; Dowd, Scot E.; Hong, Eunki; Mueller, Ulrich G.

2009-01-01

In many host-microbe mutualisms, hosts use beneficial metabolites supplied by microbial symbionts. Fungus-growing (attine) ants are thought to form such a mutualism with Pseudonocardia bacteria to derive antibiotics that specifically suppress the coevolving pathogen Escovopsis, which infects the ants' fungal gardens and reduces growth. Here we test 4 key assumptions of this Pseudonocardia-Escovopsis coevolution model. Culture-dependent and culture-independent (tag-encoded 454-pyrosequencing) ...

Bacterial Infections across the Ants: Frequency and Prevalence of Wolbachia, Spiroplasma, and Asaia

Directory of Open Access Journals (Sweden)

Stefanie Kautz

2013-01-01

Full Text Available Bacterial endosymbionts are common across insects, but we often lack a deeper knowledge of their prevalence across most organisms. Next-generation sequencing approaches can characterize bacterial diversity associated with a host and at the same time facilitate the fast and simultaneous screening of infectious bacteria. In this study, we used 16S rRNA tag encoded amplicon pyrosequencing to survey bacterial communities of 310 samples representing 221 individuals, 176 colonies and 95 species of ants. We found three distinct endosymbiont groups—Wolbachia (Alphaproteobacteria: Rickettsiales, Spiroplasma (Firmicutes: Entomoplasmatales, and relatives of Asaia (Alphaproteobacteria: Rhodospirillales—at different infection frequencies (at the ant species level: 22.1%, 28.4%, and 14.7%, resp. and relative abundances within bacterial communities (1.0%–99.9%. Spiroplasma was particularly enriched in the ant genus Polyrhachis, while Asaia relatives were most prevalent in arboreal ants of the genus Pseudomyrmex. While Wolbachia and Spiroplasma have been surveyed in ants before, Asaia, an acetic acid bacterium capable of fixing atmospheric nitrogen, has received much less attention. Due to sporadic prevalence across all ant taxa investigated, we hypothesize facultative associations for all three bacterial genera. Infection patterns are discussed in relation to potential adaptation of specific bacteria in certain ant groups.

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

Directory of Open Access Journals (Sweden)

Ziqing eDeng

2013-07-01

Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Dynamic model of gene regulation for the lac operon

International Nuclear Information System (INIS)

Angelova, Maia; Ben-Halim, Asma

2011-01-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Dynamic model of gene regulation for the lac operon

Energy Technology Data Exchange (ETDEWEB)

Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

2011-03-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

Science.gov (United States)

Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

2014-01-01

Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

High Levels of Bioplastic Are Produced in Fertile Transplastomic Tobacco Plants Engineered with a Synthetic Operon for the Production of Polyhydroxybutyrate1[C][OA

Science.gov (United States)

Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.

2011-01-01

An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565

Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

Science.gov (United States)

Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

2016-09-01

The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

Science.gov (United States)

Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

2015-03-01

The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

Science.gov (United States)

Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

Science.gov (United States)

Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

2015-01-01

Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

Science.gov (United States)

Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

2013-10-01

The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

DEFF Research Database (Denmark)

Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

2014-01-01

We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

Combined Venom Gland Transcriptomic and Venom Peptidomic Analysis of the Predatory Ant Odontomachus monticola

Directory of Open Access Journals (Sweden)

Kohei Kazuma

2017-10-01

Full Text Available Ants (hymenoptera: Formicidae have adapted to many different environments and have become some of the most prolific and successful insects. To date, 13,258 ant species have been reported. They have been classified into 333 genera and 17 subfamilies. Except for a few Formicinae, Dolichoderinae, and members of other subfamilies, most ant species have a sting with venom. The venoms are composed of formic acid, alkaloids, hydrocarbons, amines, peptides, and proteins. Unlike the venoms of other animals such as snakes and spiders, ant venoms have seldom been analyzed comprehensively, and their compositions are not yet completely known. In this study, we used both transcriptomic and peptidomic analyses to study the composition of the venom produced by the predatory ant species Odontomachus monticola. The transcriptome analysis yielded 49,639 contigs, of which 92 encoded toxin-like peptides and proteins with 18,106,338 mapped reads. We identified six pilosulin-like peptides by transcriptomic analysis in the venom gland. Further, we found intact pilosulin-like peptide 1 and truncated pilosulin-like peptides 2 and 3 by peptidomic analysis in the venom. Our findings related to ant venom peptides and proteins may lead the way towards development and application of novel pharmaceutical and biopesticidal resources.

Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

Directory of Open Access Journals (Sweden)

Bianca Schwartbeck

2016-11-01

Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

Directory of Open Access Journals (Sweden)

Jan Ewald

2015-04-01

Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

Science.gov (United States)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

2015-01-01

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

Genome evolution in an ancient bacteria-ant symbiosis: parallel gene loss among Blochmannia spanning the origin of the ant tribe Camponotini

Directory of Open Access Journals (Sweden)

Laura E. Williams

2015-04-01

Full Text Available Stable associations between bacterial endosymbionts and insect hosts provide opportunities to explore genome evolution in the context of established mutualisms and assess the roles of selection and genetic drift across host lineages and habitats. Blochmannia, obligate endosymbionts of ants of the tribe Camponotini, have coevolved with their ant hosts for ∼40 MY. To investigate early events in Blochmannia genome evolution across this ant host tribe, we sequenced Blochmannia from two divergent host lineages, Colobopsis obliquus and Polyrhachis turneri, and compared them with four published genomes from Blochmannia of Camponotus sensu stricto. Reconstructed gene content of the last common ancestor (LCA of these six Blochmannia genomes is reduced (690 protein coding genes, consistent with rapid gene loss soon after establishment of the symbiosis. Differential gene loss among Blochmannia lineages has affected cellular functions and metabolic pathways, including DNA replication and repair, vitamin biosynthesis and membrane proteins. Blochmannia of P. turneri (i.e., B. turneri encodes an intact DnaA chromosomal replication initiation protein, demonstrating that loss of dnaA was not essential for establishment of the symbiosis. Based on gene content, B. obliquus and B. turneri are unable to provision hosts with riboflavin. Of the six sequenced Blochmannia, B. obliquus is the earliest diverging lineage (i.e., the sister group of other Blochmannia sampled and encodes the fewest protein-coding genes and the most pseudogenes. We identified 55 genes involved in parallel gene loss, including glutamine synthetase, which may participate in nitrogen recycling. Pathways for biosynthesis of coenzyme A, terpenoids and riboflavin were lost in multiple lineages, suggesting relaxed selection on the pathway after inactivation of one component. Analysis of Illumina read datasets did not detect evidence of plasmids encoding missing functions, nor the presence of

Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

Directory of Open Access Journals (Sweden)

Keyhani Nemat O

2004-06-01

Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

Ant-plant mutualism: a dietary by-product of a tropical ant's macronutrient requirements.

Science.gov (United States)

Arcila Hernández, Lina M; Sanders, Jon G; Miller, Gabriel A; Ravenscraft, Alison; Frederickson, Megan E

2017-12-01

Many arboreal ants depend on myrmecophytic plants for both food and shelter; in return, these ants defend their host plants against herbivores, which are often insects. Ant-plant and other mutualisms do not necessarily involve the exchange of costly rewards or services; they may instead result from by-product benefits, or positive outcomes that do not entail a cost for one or both partners. Here, we examined whether the plant-ant Allomerus octoarticulatus pays a short-term cost to defend their host plants against herbivores, or whether plant defense is a by-product benefit of ant foraging for insect prey. Because the food offered by ant-plants is usually nitrogen-poor, arboreal ants may balance their diets by consuming insect prey or associating with microbial symbionts to acquire nitrogen, potentially shifting the costs and benefits of plant defense for the ant partner. To determine the effect of ant diet on an ant-plant mutualism, we compared the behavior, morphology, fitness, stable isotope signatures, and gaster microbiomes of A. octoarticulatus ants nesting in Cordia nodosa trees maintained for nearly a year with or without insect herbivores. At the end of the experiment, ants from herbivore exclosures preferred protein-rich baits more than ants in the control (i.e., herbivores present) treatment. Furthermore, workers in the control treatment were heavier than in the herbivore-exclusion treatment, and worker mass predicted reproductive output, suggesting that foraging for insect prey directly increased ant colony fitness. The gaster microbiome of ants was not significantly affected by the herbivore exclusion treatment. We conclude that the defensive behavior of some phytoecious ants is a by-product of their need for external protein sources; thus, the consumption of insect herbivores by ants benefits both the ant colony and the host plant. © 2017 by the Ecological Society of America.

Decreases in average bacterial community rRNA operon copy number during succession.

Science.gov (United States)

Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

2016-05-01

Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

OpenAIRE

Riyanti, Eny Ida; Rogers, Peter L

2009-01-01

Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

Ant Larval Demand Reduces Aphid Colony Growth Rates in an Ant-Aphid Interaction

Directory of Open Access Journals (Sweden)

James M. Cook

2012-02-01

Full Text Available Ants often form mutualistic interactions with aphids, soliciting honeydew in return for protective services. Under certain circumstances, however, ants will prey upon aphids. In addition, in the presence of ants aphids may increase the quantity or quality of honeydew produced, which is costly. Through these mechanisms, ant attendance can reduce aphid colony growth rates. However, it is unknown whether demand from within the ant colony can affect the ant-aphid interaction. In a factorial experiment, we tested whether the presence of larvae in Lasius niger ant colonies affected the growth rate of Aphis fabae colonies. Other explanatory variables tested were the origin of ant colonies (two separate colonies were used and previous diet (sugar only or sugar and protein. We found that the presence of larvae in the ant colony significantly reduced the growth rate of aphid colonies. Previous diet and colony origin did not affect aphid colony growth rates. Our results suggest that ant colonies balance the flow of two separate resources from aphid colonies- renewable sugars or a protein-rich meal, depending on demand from ant larvae within the nest. Aphid payoffs from the ant-aphid interaction may change on a seasonal basis, as the demand from larvae within the ant colony waxes and wanes.

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

Science.gov (United States)

Burbank, Lindsey P; Van Horn, Christopher R

2017-11-01

The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

Science.gov (United States)

Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

2015-01-01

Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

Science.gov (United States)

Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

2014-12-01

Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

Eucaryotic operon genes can define highly conserved syntenies

Czech Academy of Sciences Publication Activity Database

Trachtulec, Zdeněk

2004-01-01

Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

2015-01-01

ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

2015-08-01

In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

Science.gov (United States)

Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

2016-10-15

Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

Science.gov (United States)

Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

2013-02-01

Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

Fire Ant Bites

Science.gov (United States)

... Favorite Name: Category: Share: Yes No, Keep Private Fire Ant Bites Share | Fire ants are aggressive, venomous insects that have pinching ... across the United States, even into Puerto Rico. Fire ant stings usually occur on the feet or ...

Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Directory of Open Access Journals (Sweden)

Altenbuchner Josef

2011-10-01

Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

2015-02-01

Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

Directory of Open Access Journals (Sweden)

Qinna Cui

Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

Ant aggression and evolutionary stability in plant-ant and plant-pollinator mutualistic interactions.

Science.gov (United States)

Oña, L; Lachmann, M

2011-03-01

Mutualistic partners derive a benefit from their interaction, but this benefit can come at a cost. This is the case for plant-ant and plant-pollinator mutualistic associations. In exchange for protection from herbivores provided by the resident ants, plants supply various kinds of resources or nests to the ants. Most ant-myrmecophyte mutualisms are horizontally transmitted, and therefore, partners share an interest in growth but not in reproduction. This lack of alignment in fitness interests between plants and ants drives a conflict between them: ants can attack pollinators that cross-fertilize the host plants. Using a mathematical model, we define a threshold in ant aggressiveness determining pollinator survival or elimination on the host plant. In our model we observed that, all else being equal, facultative interactions result in pollinator extinction for lower levels of ant aggressiveness than obligatory interactions. We propose that the capacity to discriminate pollinators from herbivores should not often evolve in ants, and when it does it will be when the plants exhibit limited dispersal in an environment that is not seed saturated so that each seed produced can effectively generate a new offspring or if ants acquire an extra benefit from pollination (e.g. if ants eat fruit). We suggest specific mutualism examples where these hypotheses can be tested empirically. © 2010 The Authors. Journal of Evolutionary Biology © 2010 European Society For Evolutionary Biology.

Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

OpenAIRE

Chung, T; Resnik, E; Stueland, C; LaPorte, D C

1993-01-01

Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

Science.gov (United States)

Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

2016-01-01

The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

Science.gov (United States)

Ahn, Sang-Joon; Burne, Robert A

2006-10-01

The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

Science.gov (United States)

Römling, Ute; Galperin, Michael Y.

2015-01-01

Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

Science.gov (United States)

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

OpenAIRE

Goh, Yong Jun; Klaenhammer, Todd R

2013-01-01

Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

AntStar: Enhancing Optimization Problems by Integrating an Ant System and A⁎ Algorithm

Directory of Open Access Journals (Sweden)

Mohammed Faisal

2016-01-01

Full Text Available Recently, nature-inspired techniques have become valuable to many intelligent systems in different fields of technology and science. Among these techniques, Ant Systems (AS have become a valuable technique for intelligent systems in different fields. AS is a computational system inspired by the foraging behavior of ants and intended to solve practical optimization problems. In this paper, we introduce the AntStar algorithm, which is swarm intelligence based. AntStar enhances the optimization and performance of an AS by integrating the AS and A⁎ algorithm. Applying the AntStar algorithm to the single-source shortest-path problem has been done to ensure the efficiency of the proposed AntStar algorithm. The experimental result of the proposed algorithm illustrated the robustness and accuracy of the AntStar algorithm.

Runtime analysis of the 1-ANT ant colony optimizer

DEFF Research Database (Denmark)

Doerr, Benjamin; Neumann, Frank; Sudholt, Dirk

2011-01-01

The runtime analysis of randomized search heuristics is a growing field where, in the last two decades, many rigorous results have been obtained. First runtime analyses of ant colony optimization (ACO) have been conducted only recently. In these studies simple ACO algorithms such as the 1-ANT...... that give us a more detailed impression of the 1-ANT’s performance. Furthermore, the experiments also deal with the question whether using many ant solutions in one iteration can decrease the total runtime....

Microorganisms transported by ants induce changes in floral nectar composition of an ant-pollinated plant.

Science.gov (United States)

de Vega, Clara; Herrera, Carlos M

2013-04-01

Interactions between plants and ants abound in nature and have significant consequences for ecosystem functioning. Recently, it has been suggested that nectar-foraging ants transport microorganisms to flowers; more specifically, they transport yeasts, which can potentially consume sugars and alter nectar composition. Therefore, ants could indirectly change nectar sugar profile, an important floral feature involved in the plant-pollinator mutualism. But this novel role for ants has never been tested. We here investigate the effects of nectarivorous ants and their associated yeasts on the floral nectar sugar composition of an ant-pollinated plant. Differences in the nectar sugar composition of ant-excluded and ant-visited flowers were examined in 278 samples by using high-performance liquid-chromatography. The importance of the genetic identity and density of ant-transported basidiomycetous and ascomycetous yeasts on the variation of nectar traits was also evaluated. Ant visitation had significant effects on nectar sugar composition. The nectar of ant-visited flowers contained significantly more fructose, more glucose, and less sucrose than the nectar of ant-excluded flowers, but these effects were context dependent. Nectar changes were correlated with the density of yeast cells in nectar. The magnitude of the effects of ant-transported ascomycetes was much higher than that of basiodiomycetes. Ants and their associated yeasts induce changes in nectar sugar traits, reducing the chemical control of the plant over this important floral trait. The potential relevance of this new role for ants as indirect nectar modifiers is a rich topic for future research into the ecology of ant-flower interactions.

Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

Science.gov (United States)

Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

2003-01-01

Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616.

Science.gov (United States)

Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka

2017-08-15

Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

Surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis

OpenAIRE

Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

2014-01-01

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some u...

Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

Science.gov (United States)

Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

Science.gov (United States)

Boyd, D A; Mulvey, M R

2013-02-01

To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Elasri, Mohamed O

2014-06-11

Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Unknown

[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579.

Science.gov (United States)

Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier

2017-01-01

The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

Structural Basis for Catalysis by the Mono and Dimetalated forms of the dapE-encoded N-succinyl-L,L-Diaminopimelic Acid Desuccinylase

OpenAIRE

Nocek, Boguslaw P.; Gillner, Danuta M.; Fan, Yao; Holz, Richard C.; Joachimiak, Andrzej

2010-01-01

Biosynthesis of lysine and meso-diaminopimelic acid in bacteria provides essential components for protein synthesis and construction of the bacterial peptidoglycan cell wall. The dapE operon enzymes synthesize both meso-diaminopimelic acid and lysine and, therefore, represent a potential targets for novel antibacterials. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase functions in a late step of the pathway and converts N-succinyl-L,L-diaminopimelic acid (L,L-SDAP) to L,L-di...

Characterization of the Leptospira interrogans S10-spc-alpha operon

NARCIS (Netherlands)

Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

2000-01-01

A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

Harnessing ant defence at fruits reduces bruchid seed predation in a symbiotic ant-plant mutualism.

Science.gov (United States)

Pringle, Elizabeth G

2014-06-22

In horizontally transmitted mutualisms, mutualists disperse separately and reassemble in each generation with partners genetically unrelated to those in the previous generation. Because of this, there should be no selection on either partner to enhance the other's reproductive output directly. In symbiotic ant-plant mutualisms, myrmecophytic plants host defensive ant colonies, and ants defend the plants from herbivores. Plants and ants disperse separately, and, although ant defence can indirectly increase plant reproduction by reducing folivory, it is unclear whether ants can also directly increase plant reproduction by defending seeds. The neotropical tree Cordia alliodora hosts colonies of Azteca pittieri ants. The trees produce domatia where ants nest at stem nodes and also at the node between the peduncle and the rachides of the infloresence. Unlike the stem domatia, these reproductive domatia senesce after the tree fruits each year. In this study, I show that the tree's resident ant colony moves into these ephemeral reproductive domatia, where they tend honeydew-producing scale insects and patrol the nearby developing fruits. The presence of ants significantly reduced pre-dispersal seed predation by Amblycerus bruchid beetles, thereby directly increasing plant reproductive output.

"Ant-egg" cataract revisited

DEFF Research Database (Denmark)

Clemmensen, Kåre; Enghild, Jan J; Ivarsen, Anders

2017-01-01

-ray scans and electron microscopy. The purpose of this study was to further characterize "ant-egg" cataract using modern technology and display the history of the "ant-eggs" after cataract extraction. METHODS: "Ant-eggs" were examined using Heidelberg SPECTRALIS Optical Coherence Tomography (OCT...

OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

Directory of Open Access Journals (Sweden)

Arkin Adam P

2006-01-01

Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

How ants drop out: ant abundance on tropical mountains.

Science.gov (United States)

Longino, John T; Branstetter, Michael G; Colwell, Robert K

2014-01-01

In tropical wet forests, ants are a large proportion of the animal biomass, but the factors determining abundance are not well understood. We characterized ant abundance in the litter layer of 41 mature wet forest sites spread throughout Central America (Chiapas, Guatemala, Honduras, Nicaragua, and Costa Rica) and examined the impact of elevation (as a proxy for temperature) and community species richness. Sites were intentionally chosen to minimize variation in precipitation and seasonality. From sea level to 1500 m ant abundance very gradually declined, community richness declined more rapidly than abundance, and the local frequency of the locally most common species increased. These results suggest that within this elevational zone, density compensation is acting, maintaining high ant abundance as richness declines. In contrast, in sites above 1500 m, ant abundance dropped abruptly to much lower levels. Among these high montane sites, community richness explained much more of the variation in abundance than elevation, and there was no evidence of density compensation. The relative stability of abundance below 1500 m may be caused by opposing effects of temperature on productivity and metabolism. Lower temperatures may decrease productivity and thus the amount of food available for consumers, but slower metabolisms of consumers may allow maintenance of higher biomass at lower resource supply rates. Ant communities at these lower elevations may be highly interactive, the result of continuous habitat presence over geological time. High montane sites may be ephemeral in geological time, resulting in non-interactive communities dominated by historical and stochastic processes. Abundance in these sites may be determined by the number of species that manage to colonize and/or avoid extinction on mountaintops.

How ants drop out: ant abundance on tropical mountains.

Directory of Open Access Journals (Sweden)

John T Longino

Full Text Available In tropical wet forests, ants are a large proportion of the animal biomass, but the factors determining abundance are not well understood. We characterized ant abundance in the litter layer of 41 mature wet forest sites spread throughout Central America (Chiapas, Guatemala, Honduras, Nicaragua, and Costa Rica and examined the impact of elevation (as a proxy for temperature and community species richness. Sites were intentionally chosen to minimize variation in precipitation and seasonality. From sea level to 1500 m ant abundance very gradually declined, community richness declined more rapidly than abundance, and the local frequency of the locally most common species increased. These results suggest that within this elevational zone, density compensation is acting, maintaining high ant abundance as richness declines. In contrast, in sites above 1500 m, ant abundance dropped abruptly to much lower levels. Among these high montane sites, community richness explained much more of the variation in abundance than elevation, and there was no evidence of density compensation. The relative stability of abundance below 1500 m may be caused by opposing effects of temperature on productivity and metabolism. Lower temperatures may decrease productivity and thus the amount of food available for consumers, but slower metabolisms of consumers may allow maintenance of higher biomass at lower resource supply rates. Ant communities at these lower elevations may be highly interactive, the result of continuous habitat presence over geological time. High montane sites may be ephemeral in geological time, resulting in non-interactive communities dominated by historical and stochastic processes. Abundance in these sites may be determined by the number of species that manage to colonize and/or avoid extinction on mountaintops.

Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

Science.gov (United States)

Dixit, R; Trivedi, P K; Nath, P; Sane, P V

1999-09-01

Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

Pest repelling properties of ant pheromones

DEFF Research Database (Denmark)

Offenberg, Joachim

2014-01-01

Ants control pests via predation and physical deterrence; however, ant communication is based on chemical cues which may serve as warning signals to potential prey and other intruders. The presence of ant pheromones may, thus, be sufficient to repel pests from ant territories. This mini-review sh......-review shows that four out of five tested ant species deposit pheromones that repel herbivorous prey from their host plants.......Ants control pests via predation and physical deterrence; however, ant communication is based on chemical cues which may serve as warning signals to potential prey and other intruders. The presence of ant pheromones may, thus, be sufficient to repel pests from ant territories. This mini...

Nectar Theft and Floral Ant-Repellence: A Link between Nectar Volume and Ant-Repellent Traits?

Science.gov (United States)

Ballantyne, Gavin; Willmer, Pat

2012-01-01

As flower visitors, ants rarely benefit a plant. They are poor pollinators, and can also disrupt pollination by deterring other flower visitors, or by stealing nectar. Some plant species therefore possess floral ant-repelling traits. But why do particular species have such traits when others do not? In a dry forest in Costa Rica, of 49 plant species around a third were ant-repellent at very close proximity to a common generalist ant species, usually via repellent pollen. Repellence was positively correlated with the presence of large nectar volumes. Repellent traits affected ant species differently, some influencing the behaviour of just a few species and others producing more generalised ant-repellence. Our results suggest that ant-repellent floral traits may often not be pleiotropic, but instead could have been selected for as a defence against ant thieves in plant species that invest in large volumes of nectar. This conclusion highlights to the importance of research into the cost of nectar production in future studies into ant-flower interactions. PMID:22952793

Pest repellent properties of ant pheromones

DEFF Research Database (Denmark)

Offenberg, Joachim

2012-01-01

of ant pheromones may be sufficient to repel pest insects from ant territories. The study of ant semiochemicals is in its infancy, yet, evidence for their potential use in pest management is starting to build up. Pheromones from four of five tested ant species have been shown to deter herbivorous insect...... prey and competing ant species are also deterred by ant deposits, whereas ant symbionts may be attracted to them. Based on these promising initial findings, it seems advisable to further elucidate the signaling properties of ant pheromones and to test and develop their use in future pest management....

Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

Science.gov (United States)

Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

2016-01-01

An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

Directory of Open Access Journals (Sweden)

Løvdal Irene S

2012-03-01

Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

Science.gov (United States)

2012-01-01

Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

Science.gov (United States)

Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

2014-01-01

Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

Elucidation of the regulatory role of the fructose operon reveals a novel target for enhancing the NADPH supply in Corynebacterium glutamicum

DEFF Research Database (Denmark)

Wang, Zhihao; Chan, Siu Hung Joshua; Sudarsan, Suresh

2016-01-01

is linked to redox and to the general metabolism. We here provide new insights into the regulation of the metabolism of this important platform organism by systematically characterizing mutants carrying various lesions in the fructose operon. Initially, we found that a strain where the dedicated fructose...... uptake system had been inactivated (KO-ptsF) was hampered in growth on sucrose minimal medium, and suppressor mutants appeared readily. Comparative genomic analysis in conjunction with enzymatic assays revealed that suppression was linked to inactivation of the pfkB gene, encoding a fructose-1-phosphate...... kinase. Detailed characterization of KO-ptsF, KO-pfkB and double knock-out (DKO) derivatives revealed a strong role for sugar-phosphates, especially fructose-1-phosphate (F1P), in governing sugar as well as redox metabolism due to effects on transcriptional regulation of key genes. These findings allowed...

A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

Science.gov (United States)

Chopra, Paras; Bender, Andreas

The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

Directory of Open Access Journals (Sweden)

Wernegreen Jennifer J

2010-12-01

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

Science.gov (United States)

Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

2014-12-01

The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

Plant lock and ant key: pairwise coevolution of an exclusion filter in an ant-plant mutualism.

Science.gov (United States)

Brouat, C; Garcia, N; Andary, C; McKey, D

2001-10-22

Although observations suggest pairwise coevolution in specific ant-plant symbioses, coevolutionary processes have rarely been demonstrated. We report on, what is to the authors' knowledge, the strongest evidence yet for reciprocal adaptation of morphological characters in a species-specific ant-plant mutualism. The plant character is the prostoma, which is a small unlignified organ at the apex of the domatia in which symbiotic ants excavate an entrance hole. Each myrmecophyte in the genus Leonardoxa has evolved a prostoma with a different shape. By performing precise measurements on the prostomata of three related myrmecophytes, on their specific associated ants and on the entrance holes excavated by symbiotic ants at the prostomata, we showed that correspondence of the plant and ant traits forms a morphological and behavioural filter. We have strong evidence for coevolution between the dimensions and shape of the symbiotic ants and the prostoma in one of the three ant-Leonardoxa associations.

Beyond ANT

DEFF Research Database (Denmark)

Jansen, Till

2017-01-01

Actor-Network-Theory (ANT) offers an ‘infra-language’ of the social that allows one to trace social relations very dynamically, while at the same time dissolving human agency, thus providing a flat and de-centred way into sociology. However, ANT struggles with its theoretical design that may lead...... us to reduce agency to causation and to conceptualize actor-networks as homogeneous ontologies of force. This article proposes to regard ANT’s inability to conceptualize reflexivity and the interrelatedness of different ontologies as the fundamental problem of the theory. Drawing on Günther......, it offers an ‘infra-language’ of reflexive relations while maintaining ANT’s de-centred approach. This would enable us to conceptualize actor-networks as non-homogeneous, dynamic and connecting different societal rationales while maintaining the main strengths of ANT....

Dynamics of an ant-plant-pollinator model

Science.gov (United States)

Wang, Yuanshi; DeAngelis, Donald L.; Nathaniel Holland, J.

2015-03-01

In this paper, we consider plant-pollinator-ant systems in which plant-pollinator interaction and plant-ant interaction are both mutualistic, but there also exists interference of pollinators by ants. The plant-pollinator interaction can be described by a Beddington-DeAngelis formula, so we extend the formula to characterize plant-pollinator mutualisms, including the interference by ants, and form a plant-pollinator-ant model. Using dynamical systems theory, we show uniform persistence of the model. Moreover, we demonstrate conditions under which boundary equilibria are globally asymptotically stable. The dynamics exhibit mechanisms by which the three species could coexist when ants interfere with pollinators. We define a threshold in ant interference. When ant interference is strong, it can drive plant-pollinator mutualisms to extinction. Furthermore, if the ants depend on pollination mutualism for their persistence, then sufficiently strong ant interference could lead to their own extinction as well. Yet, when ant interference is weak, plant-ant and plant-pollinator mutualisms can promote the persistence of one another.

Dynamics and bistability in a reduced model of the lac operon

Science.gov (United States)

Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

2004-06-01

It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

Science.gov (United States)

Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

2014-09-01

Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Using Ants as bioindicators: Multiscale Issues in Ant Community Ecology

Directory of Open Access Journals (Sweden)

Alan Andersen

1997-06-01

Full Text Available Ecological patterns and processes are characteristically scale dependent, and research findings often cannot be translated easily from one scale to another. Conservation biology is challenged by a lack of congruence between the spatial scales of ecological research (typically involving small plots and land management (typically involving whole landscapes. Here, I discuss spatial scaling issues as they relate to an understanding of ant communities and, consequently, their use as bioindicators in land management. Our perceptions of fundamental patterns and processes in ant communities depend on scale: taxa that are behaviorally dominant at one scale are not necessarily so at others, functional groups recognized at one scale are often inappropriate for others, and the role of competition in community structure depends on the scale of analysis. Patterns of species richness and composition, and the ability of total richness to be estimated by surrogates, are all also scale dependent. Ant community ecology has a tradition of detailed studies in small plots, but the use of ants as bioindicators requires a predictive understanding of community structure and dynamics at a range of spatial scales. Such an appreciation of ant communities and their most effective use as bioindicators is best served by studies integrating results from plot-scale research with the broad-scale paradigms of biogeography, systematics, and evolutionary biology.

Ecosystem services delivered by weaver ants

DEFF Research Database (Denmark)

Offenberg, Joachim

Weaver ants (Oecopgylla spp.) are increasingly being utilized as efficient biocontrol agents in a number of tropical tree crops, as they prey on pest insects and increase yields. However, recent studies and a review of the literature reveal that a number of other services may derive from the pres......Weaver ants (Oecopgylla spp.) are increasingly being utilized as efficient biocontrol agents in a number of tropical tree crops, as they prey on pest insects and increase yields. However, recent studies and a review of the literature reveal that a number of other services may derive from...... the presence of these ants. First of all, the chemical footprint left by the high density of ants in managed host trees may results in additional benefits. (i) Ant deposits may lead to improved fruit quality, e.g. increased sugar content, (ii) ant deposits may deter important pests (chemical deterrence) from...... crops, and lastly, (iii) ant waste products deposited ias anal spots contain urea that may be taken up by plant leaves and in this way fertilize ant-plants. On top of chemical services, weaver ants have been shown to reduce plant disease incidence via competitive exclusion of other ant species because...

Ant-lepidopteran associations along African forest edges

Science.gov (United States)

Dejean, Alain; Azémar, Frédéric; Libert, Michel; Compin, Arthur; Hérault, Bruno; Orivel, Jérôme; Bouyer, Thierry; Corbara, Bruno

2017-02-01

Working along forest edges, we aimed to determine how some caterpillars can co-exist with territorially dominant arboreal ants (TDAAs) in tropical Africa. We recorded caterpillars from 22 lepidopteran species living in the presence of five TDAA species. Among the defoliator and/or nectarivorous caterpillars that live on tree foliage, the Pyralidae and Nymphalidae use their silk to protect themselves from ant attacks. The Notodontidae and lycaenid Polyommatinae and Theclinae live in direct contact with ants; the Theclinae even reward ants with abundant secretions from their Newcomer gland. Lichen feeders (lycaenid; Poritiinae), protected by long bristles, also live among ants. Some lycaenid Miletinae caterpillars feed on ant-attended membracids, including in the shelters where the ants attend them; Lachnocnema caterpillars use their forelegs to obtain trophallaxis from their host ants. Caterpillars from other species live inside weaver ant nests. Those of the genus Euliphyra (Miletinae) feed on ant prey and brood and can obtain trophallaxis, while those from an Eberidae species only prey on host ant eggs. Eublemma albifascia (Erebidae) caterpillars use their thoracic legs to obtain trophallaxis and trophic eggs from ants. Through transfer bioassays of last instars, we noted that herbivorous caterpillars living in contact with ants were always accepted by alien conspecific ants; this is likely due to an intrinsic appeasing odor. Yet, caterpillars living in ant shelters or ant nests probably acquire cues from their host colonies because they were considered aliens and killed. We conclude that co-evolution with ants occurred similarly in the Heterocera and Rhopalocera.

The metapleural gland of ants

DEFF Research Database (Denmark)

Yek, Sze Huei; Mueller, Ulrich G

2011-01-01

The metapleural gland (MG) is a complex glandular structure unique to ants, suggesting a critical role in their origin and ecological success. We synthesize the current understanding of the adaptive function, morphology, evolutionary history, and chemical properties of the MG. Two functions......-compressible invagination of the integument and the secretion is thought to ooze out passively through the non-closable opening of the MG or is groomed off by the legs and applied to target surfaces. MG loss has occurred repeatedly among the ants, particularly in the subfamilies Formicinae and Myrmicinae, and the MG...... is more commonly absent in males than in workers. MG chemistry has been characterized mostly in derived ant lineages with unique biologies (e.g. leafcutter ants, fire ants), currently precluding any inferences about MG chemistry at the origin of the ants. A synthetic approach integrating functional...

Foliar uptake of nitrogen from ant fecal droplets: an overlooked service to ant plants

DEFF Research Database (Denmark)

Pinkalski, Christian Alexander Stidsen; Jensen, Karl-Martin Vagn; Damgaard, Christian Frølund

2018-01-01

and subsequently deposited fecal droplets on the seedlings, coffee leaves showed increased levels of 15N and total N compared to control plants without ants. This was evident for both exposed leaves and leaves covered in plastic bags (i.e. not directly exposed to ants). Thus, N from ant excretions was absorbed...

HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

Science.gov (United States)

Roy, Ajit; Ranjan, Akash

2016-02-23

Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

International Nuclear Information System (INIS)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

2007-01-01

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

Generalized antifungal activity and 454-screening of Pseudonocardia and Amycolatopsis bacteria in nests of fungus-growing ants.

Science.gov (United States)

Sen, Ruchira; Ishak, Heather D; Estrada, Dora; Dowd, Scot E; Hong, Eunki; Mueller, Ulrich G

2009-10-20

In many host-microbe mutualisms, hosts use beneficial metabolites supplied by microbial symbionts. Fungus-growing (attine) ants are thought to form such a mutualism with Pseudonocardia bacteria to derive antibiotics that specifically suppress the coevolving pathogen Escovopsis, which infects the ants' fungal gardens and reduces growth. Here we test 4 key assumptions of this Pseudonocardia-Escovopsis coevolution model. Culture-dependent and culture-independent (tag-encoded 454-pyrosequencing) surveys reveal that several Pseudonocardia species and occasionally Amycolatopsis (a close relative of Pseudonocardia) co-occur on workers from a single nest, contradicting the assumption of a single pseudonocardiaceous strain per nest. Pseudonocardia can occur on males, suggesting that Pseudonocardia could also be horizontally transmitted during mating. Pseudonocardia and Amycolatopsis secretions kill or strongly suppress ant-cultivated fungi, contradicting the previous finding of a growth-enhancing effect of Pseudonocardia on the cultivars. Attine ants therefore may harm their own cultivar if they apply pseudonocardiaceous secretions to actively growing gardens. Pseudonocardia and Amycolatopsis isolates also show nonspecific antifungal activities against saprotrophic, endophytic, entomopathogenic, and garden-pathogenic fungi, contrary to the original report of specific antibiosis against Escovopsis alone. We conclude that attine-associated pseudonocardiaceous bacteria do not exhibit derived antibiotic properties to specifically suppress Escovopsis. We evaluate hypotheses on nonadaptive and adaptive functions of attine integumental bacteria, and develop an alternate conceptual framework to replace the prevailing Pseudonocardia-Escovopsis coevolution model. If association with Pseudonocardia is adaptive to attine ants, alternate roles of such microbes could include the protection of ants or sanitation of the nest.

Odorous house ants (Tapinoma sessile as back-seat drivers of localized ant decline in urban habitats.

Directory of Open Access Journals (Sweden)

Adam Salyer

Full Text Available Invasive species and habitat disturbance threaten biodiversity worldwide by modifying ecosystem performance and displacing native organisms. Similar homogenization impacts manifest locally when urbanization forces native species to relocate or reinvade perpetually altered habitat. This study investigated correlations between ant richness and abundance in response to urbanization and the nearby presence of invasive ant species, odorous house ants (Tapinoma sessile, within its native region. Surveying localized ant composition within natural, semi-natural, and urban habitat supported efforts to determine whether T. sessile appear to be primary (drivers threats as instigators or secondary (passengers threats as inheritors of indigenous ant decline. Sampling 180 sites, evenly split between all habitats with and without T. sessile present, yielded 45 total species. Although urbanization and T. sessile presence factors were significantly linked to ant decline, their interaction correlated to the greatest reduction of total ant richness (74% and abundance (81%. Total richness appeared to decrease from 27 species to 18 when natural habitat is urbanized and from 18 species to 7 with T. sessile present in urban plots. Odorous house ant presence minimally influenced ant communities within natural and semi-natural habitat, highlighting the importance of habitat alteration and T. sessile presence interactions. Results suggest urbanization releases T. sessile from unknown constraints by decreasing ant richness and competition. Within urban environment, T. sessile are pre-adapted to quickly exploit new resources and grow to supercolony strength wherein T. sessile drive adjacent biodiversity loss. Odorous house ants act as passengers and drivers of ecological change throughout different phases of urban 'invasion'. This progression through surviving habitat alteration, exploiting new resources, thriving, and further reducing interspecific competition supports a

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Ant Colony Optimization for Control

NARCIS (Netherlands)

Van Ast, J.M.

2010-01-01

The very basis of this thesis is the collective behavior of ants in colonies. Ants are an excellent example of how rather simple behavior on a local level can lead to complex behavior on a global level that is beneficial for the individuals. The key in the self-organization of ants is communication

The effect of stochasticity on the lac operon: an evolutionary perspective.

Directory of Open Access Journals (Sweden)

Milan van Hoek

2007-06-01

Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

Partial incompatibility between ants and symbiotic fungi in two sympatric species of Acromyrmex leaf-cutting ants.

Science.gov (United States)

Bot, A N; Rehner, S A; Boomsma, J J

2001-10-01

We investigate the nature and duration of incompatibility between certain combinations of Acromyrmex leaf-cutting ants and symbiotic fungi, taken from sympatric colonies of the same or a related species. Ant-fungus incompatibility appeared to be largely independent of the ant species involved, but could be explained partly by genetic differences among the fungus cultivars. Following current theoretical considerations, we develop a hypothesis, originally proposed by S. A. Frank, that the observed incompatibilities are ultimately due to competitive interactions between genetically different fungal lineages, and we predict that the ants should have evolved mechanisms to prevent such competition between cultivars within a single garden. This requires that the ants are able to recognize unfamiliar fungi, and we show that this is indeed the case. Amplified fragment length polymorphism genotyping further shows that the two sympatric Acromyrmex species share each other's major lineages of cultivar, confirming that horizontal transfer does occasionally take place. We argue and provide some evidence that chemical substances produced by the fungus garden may mediate recognition of alien fungi by the ants. We show that incompatibility between ants and transplanted, genetically different cultivars is indeed due to active killing of the novel cultivar by the ants. This incompatibility disappears when ants are force-fed the novel cultivar for about a week, a result that is consistent with our hypothesis of recognition induced by the resident fungus and eventual replacement of incompatibility compounds during force-feeding.

Sick ants become unsociable

DEFF Research Database (Denmark)

Bos, Nicky Peter Maria; Lefevre, T.; Jensen, A.B.

2012-01-01

Parasites represent a severe threat to social insects, which form high-density colonies of related individuals, and selection should favour host traits that reduce infection risk. Here, using a carpenter ant (Camponotus aethiops) and a generalist insect pathogenic fungus (Metarhizium brunneum), we...... show that infected ants radically change their behaviour over time to reduce the risk of colony infection. Infected individuals (i) performed less social interactions than their uninfected counterparts, (ii) did not interact with brood anymore and (iii) spent most of their time outside the nest from...... day 3 post-infection until death. Furthermore, infected ants displayed an increased aggressiveness towards non-nestmates. Finally, infected ants did not alter their cuticular chemical profile, suggesting that infected individuals do not signal their physiological status to nestmates. Our results...

Interactive effects of soil-dwelling ants, ant mounds and simulated grazing on local plant community composition

NARCIS (Netherlands)

Veen, G.F.; Olff, H.

2011-01-01

Interactions between aboveground vertebrate herbivores and subterranean yellow meadow ants (Lasius flavus) can drive plant community patterns in grassland ecosystems. Here, we study the relative importance of the presence of ants (L. flavus) and ant mounds under different simulated grazing regimes

Bacillus subtilis IolQ (DegA) is a transcriptional repressor of iolX encoding NAD+-dependent scyllo-inositol dehydrogenase.

Science.gov (United States)

Kang, Dong-Min; Michon, Christophe; Morinaga, Tetsuro; Tanaka, Kosei; Takenaka, Shinji; Ishikawa, Shu; Yoshida, Ken-Ichi

2017-07-11

Bacillus subtilis is able to utilize at least three inositol stereoisomers as carbon sources, myo-, scyllo-, and D-chiro-inositol (MI, SI, and DCI, respectively). NAD + -dependent SI dehydrogenase responsible for SI catabolism is encoded by iolX. Even in the absence of functional iolX, the presence of SI or MI in the growth medium was found to induce the transcription of iolX through an unknown mechanism. Immediately upstream of iolX, there is an operon that encodes two genes, yisR and iolQ (formerly known as degA), each of which could encode a transcriptional regulator. Here we performed an inactivation analysis of yisR and iolQ and found that iolQ encodes a repressor of the iolX transcription. The coding sequence of iolQ was expressed in Escherichia coli and the gene product was purified as a His-tagged fusion protein, which bound to two sites within the iolX promoter region in vitro. IolQ is a transcriptional repressor of iolX. Genetic evidences allowed us to speculate that SI and MI might possibly be the intracellular inducers, however they failed to antagonize DNA binding of IolQ in in vitro experiments.

Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

Science.gov (United States)

Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

2015-10-23

The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

Science.gov (United States)

Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

2017-05-01

Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Roadside Survey of Ants on Oahu, Hawaii

Science.gov (United States)

Tong, Reina L.; Grace, J. Kenneth; Krushelnycky, Paul D.

2018-01-01

Hawaii is home to over 60 ant species, including five of the six most damaging invasive ants. Although there have been many surveys of ants in Hawaii, the last island-wide hand-collection survey of ants on Oahu was conducted in 1988–1994. In 2012, a timed hand-collection of ants was made at 44 sites in a systematic, roadside survey throughout Oahu. Ants were identified and species distribution in relation to elevation, precipitation and soil type was analyzed. To assess possible convenience sampling bias, 15 additional sites were sampled further from roads to compare with the samples near roads. Twenty-four species of ants were found and mapped; Pheidole megacephala (F.), Ochetellus glaber (Mayr), and Technomyrmex difficilis Forel were the most frequently encountered ants. For six ant species, a logistic regression was performed with elevation, average annual precipitation, and soil order as explanatory variables. O. glaber was found in areas with lower precipitation around Oahu. Paratrechina longicornis (Latrielle) and Tetramorium simillimum (Smith, F.) were found more often in lower elevations and in areas with the Mollisol soil order. Elevation, precipitation, and soil type were not significant sources of variation for P. megacephala, Plagiolepis alluaudi Emery, and T. difficilis. P. megacephala was associated with fewer mean numbers of ants where it occurred. Ant assemblages near and far from roads did not significantly differ. Many species of ants remain established on Oahu, and recent invaders are spreading throughout the island. Mapping ant distributions contributes to continued documentation and understanding of these pests. PMID:29439503

Dealing with water deficit in Atta ant colonies: large ants scout for water while small ants transport it

Directory of Open Access Journals (Sweden)

Antonio Carlos Da-Silva

2012-07-01

Leafcutter ants (Atta sexdens rubropilosa (Forel 1908 have an elaborate social organization, complete with caste divisions. Activities carried out by specialist groups contribute to the overall success and survival of the colony when it is confronted with environmental challenges such as dehydration. Ants detect variations in humidity inside the nest and react by activating several types of behavior that enhance water uptake and decrease water loss, but it is not clear whether or not a single caste collects water regardless of the cost of bringing this resource back to the colony. Accordingly, we investigated water collection activities in three colonies of Atta sexdens rubropilosa experimentally exposed to water stress. Specifically, we analyzed whether or not the same ant caste foraged for water, regardless of the absolute energetic cost (distance of transporting this resource back to the colony. Our experimental design offered water sources at 0 m, 1 m and 10 m from the nest. We studied the body size of ants near the water sources from the initial offer of water (time  =  0 to 120 min, and tested for specialization. We observed a reduction in the average size and variance of ants that corroborated the specialization hypothesis. Although the temporal course of specialization changed with distance, the final outcome was similar among distances. Thus, we conclude that, for this species, a specialist (our use of the word “specialist” does not mean exclusive task force is responsible for collecting water, regardless of the cost of transporting water back to the colony.

The evolution of genome size in ants

Directory of Open Access Journals (Sweden)

Spagna Joseph C

2008-02-01

Full Text Available Abstract Background Despite the economic and ecological importance of ants, genomic tools for this family (Formicidae remain woefully scarce. Knowledge of genome size, for example, is a useful and necessary prerequisite for the development of many genomic resources, yet it has been reported for only one ant species (Solenopsis invicta, and the two published estimates for this species differ by 146.7 Mb (0.15 pg. Results Here, we report the genome size for 40 species of ants distributed across 10 of the 20 currently recognized subfamilies, thus making Formicidae the 4th most surveyed insect family and elevating the Hymenoptera to the 5th most surveyed insect order. Our analysis spans much of the ant phylogeny, from the less derived Amblyoponinae and Ponerinae to the more derived Myrmicinae, Formicinae and Dolichoderinae. We include a number of interesting and important taxa, including the invasive Argentine ant (Linepithema humile, Neotropical army ants (genera Eciton and Labidus, trapjaw ants (Odontomachus, fungus-growing ants (Apterostigma, Atta and Sericomyrmex, harvester ants (Messor, Pheidole and Pogonomyrmex, carpenter ants (Camponotus, a fire ant (Solenopsis, and a bulldog ant (Myrmecia. Our results show that ants possess small genomes relative to most other insects, yet genome size varies three-fold across this insect family. Moreover, our data suggest that two whole-genome duplications may have occurred in the ancestors of the modern Ectatomma and Apterostigma. Although some previous studies of other taxa have revealed a relationship between genome size and body size, our phylogenetically-controlled analysis of this correlation did not reveal a significant relationship. Conclusion This is the first analysis of genome size in ants (Formicidae and the first across multiple species of social insects. We show that genome size is a variable trait that can evolve gradually over long time spans, as well as rapidly, through processes that may

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

Are ant feces nutrients for plants? A metabolomics approach to elucidate the nutritional effects on plants hosting weaver ants

DEFF Research Database (Denmark)

Vidkjær, Nanna Hjort; Wollenweber, Bernd; Gislum, René

2015-01-01

Weaver ants (genus Oecophylla) are tropical carnivorous ant species living in high numbers in the canopies of trees. The ants excrete copious amounts of fecal matter on leaf surfaces, and these feces may provide nutrients to host trees. This hypothesis is supported by studies of ant......-plant interactions involving other ant species that have demonstrated the transfer of nutrients from ants to plants. In this 7-months study, a GC–MS-based metabolomics approach along with an analysis of total nitrogen and carbon levels was used to study metabolic changes in ant-hosting Coffea arabica plants compared...... with control plants. The results showed elevated levels of total nitrogen, amino acids, fatty acids, caffeine, and secondary metabolites of the phenylpropanoid pathway in leaves from ant-hosting plants. Minor effects were observed for sugars, whereas little or no effect was observed for organic acids, despite...

The interactions of ants with their biotic environment.

Science.gov (United States)

Chomicki, Guillaume; Renner, Susanne S

2017-03-15

This s pecial feature results from the symposium 'Ants 2016: ant interactions with their biotic environments' held in Munich in May 2016 and deals with the interactions between ants and other insects, plants, microbes and fungi, studied at micro- and macroevolutionary levels with a wide range of approaches, from field ecology to next-generation sequencing, chemical ecology and molecular genetics. In this paper, we review key aspects of these biotic interactions to provide background information for the papers of this s pecial feature After listing the major types of biotic interactions that ants engage in, we present a brief overview of ant/ant communication, ant/plant interactions, ant/fungus symbioses, and recent insights about ants and their endosymbionts. Using a large molecular clock-dated Formicidae phylogeny, we map the evolutionary origins of different ant clades' interactions with plants, fungi and hemiptera. Ants' biotic interactions provide ideal systems to address fundamental ecological and evolutionary questions about mutualism, coevolution, adaptation and animal communication. © 2017 The Author(s).

The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

DEFF Research Database (Denmark)

Liu, M; Kirpekar, F; Van Wezel, G P

2000-01-01

tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

Chemically armed mercenary ants protect fungus-farming societies

DEFF Research Database (Denmark)

Adams, Rachelle Martha Marie; Liberti, Joanito; Illum, Anders A.

2013-01-01

guest ants are sufficient to kill raiders that invariably exterminate host nests without a cohabiting guest ant colony. We also show that the odor of guest ants discourages raider scouts from recruiting nestmates to host colonies. Our results imply that Sericomyrmex fungus-growers obtain a net benefit......The ants are extraordinary in having evolved many lineages that exploit closely related ant societies as social parasites, but social parasitism by distantly related ants is rare. Here we document the interaction dynamics among a Sericomyrmex fungus-growing ant host, a permanently associated...... parasitic guest ant of the genus Megalomyrmex, and a raiding agro-predator of the genus Gnamptogenys. We show experimentally that the guest ants protect their host colonies against agro-predator raids using alkaloid venom that is much more potent than the biting defenses of the host ants. Relatively few...

A cellular automata model for ant trails

Indian Academy of Sciences (India)

In this study, the unidirectional ant traffic flow with U-turn in an ant trail was inves- tigated using ... the literature, it was considered in the model that (i) ant colony consists of two kinds of ants, good- ... ponents without a central controller [8].

The Transcriptional Repressor, MtrR, of the mtrCDE Efflux Pump Operon of Neisseria gonorrhoeae Can Also Serve as an Activator of “off Target” Gene (glnE Expression

Directory of Open Access Journals (Sweden)

Paul J. T. Johnson

2015-06-01

Full Text Available MtrR is a well-characterized repressor of the Neisseria gonorrhoeae mtrCDE efflux pump operon. However, results from a previous transcriptional profiling study suggested that MtrR also represses or activates expression of at least sixty genes outside of the mtr locus. Evidence that MtrR can directly repress so-called “off target” genes has previously been reported; in particular, MtrR was shown to directly repress glnA, which encodes glutamine synthetase. In contrast, evidence for the ability of MtrR to directly activate expression of gonococcal genes has been lacking; herein, we provide such evidence. We now report that MtrR has the ability to directly activate expression of glnE, which encodes the dual functional adenyltransferase/deadenylase enzyme GlnE that modifies GlnA resulting in regulation of its role in glutamine biosynthesis. With its capacity to repress expression of glnA, the results presented herein emphasize the diverse and often opposing regulatory properties of MtrR that likely contributes to the overall physiology and metabolism of N. gonorrhoeae.

A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

Science.gov (United States)

Kim, Dae Hun; Ko, Kwan Soo

2015-07-01

To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

Using pleometrosis (multiple queens) and pupae transplantation to boost weaver ant (Oecophylla smaragdina) colony growth in ant nurseries

DEFF Research Database (Denmark)

Offenberg, Hans Joachim; Nielsen, Mogens Gissel; Peng, Renkang

2011-01-01

Weaver ants (Oecophylla spp.) are increasingly being used for biocontrol and are targeted for future production of insect protein in ant farms. An efficient production of live ant colonies may facilitate the utilization of these ants but the production of mature colonies is hampered by the long...... and no transplantation. Thus, in ant nurseries the use of multiple queens during nest founding as well as transplantation of pupae from foreign colonies may be utilised to decrease the time it takes to produce a colony ready for implementation....

Ant-plants and fungi: a new threeway symbiosis.

Science.gov (United States)

Defossez, Emmanuel; Selosse, Marc-André; Dubois, Marie-Pierre; Mondolot, Laurence; Faccio, Antonella; Djieto-Lordon, Champlain; McKey, Doyle; Blatrix, Rumsaïs

2009-06-01

Symbioses between plants and fungi, fungi and ants, and ants and plants all play important roles in ecosystems. Symbioses involving all three partners appear to be rare. Here, we describe a novel tripartite symbiosis in which ants and a fungus inhabit domatia of an ant-plant, and present evidence that such interactions are widespread. We investigated 139 individuals of the African ant-plant Leonardoxa africana for occurrence of fungus. Behaviour of mutualist ants toward the fungus within domatia was observed using a video camera fitted with an endoscope. Fungi were identified by sequencing a fragment of their ribosomal DNA. Fungi were always present in domatia occupied by mutualist ants but never in domatia occupied by opportunistic or parasitic ants. Ants appear to favour the propagation, removal and maintenance of the fungus. Similar fungi were associated with other ant-plants in Cameroon. All belong to the ascomycete order Chaetothyriales; those from L. africana formed a monophyletic clade. These new plant-ant-fungus associations seem to be specific, as demonstrated within Leonardoxa and as suggested by fungal phyletic identities. Such tripartite associations are widespread in African ant-plants but have long been overlooked. Taking fungal partners into account will greatly enhance our understanding of symbiotic ant-plant mutualisms.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

Food source quality and ant dominance hierarchy influence the outcomes of ant-plant interactions in an arid environment

Science.gov (United States)

Flores-Flores, Rocío Vianey; Aguirre, Armando; Anjos, Diego V.; Neves, Frederico S.; Campos, Ricardo I.; Dáttilo, Wesley

2018-02-01

In this study, we conducted a series of experiments in a population of Vachellia constricta (Fabaceae) in the arid Tehuacan-Cuicatláan valley, Mexico, in order to evaluate if the food source quality and ant dominance hierarchy influence the outcomes of ant-plant interactions. Using an experiment with artificial nectaries, we observed that ants foraging on food sources with higher concentration of sugar are quicker in finding and attacking potential herbivorous insects. More specifically, we found that the same ant species may increase their defence effectiveness according to the quality of food available. These findings indicate that ant effectiveness in plant protection is context-dependent and may vary according to specific individual characteristics of plants. In addition, we showed that competitively superior ant species tend to dominate plants in periods with high nectar activity, emphasizing the role of the dominance hierarchy structuring ant-plant interactions. However, when high sugar food sources were experimentally available ad libitum, the nocturnal and competitively superior ant species, Camponotus atriceps, did not dominate the artificial nectaries during the day possibly due to limitation of its thermal tolerance. Therefore, temporal niche partitioning may be allowing the coexistence of two dominant ant species (Camponotus rubritorax during the day and C. atriceps at night) on V. constricta. Our findings indicate that the quality of the food source, and temporal shifts in ant dominance are key factors which structure the biotic plant defences in an arid environment.

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

Directory of Open Access Journals (Sweden)

T Sabari Sankar

2009-03-01

Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

Persistence of pollination mutualisms in the presence of ants.

Science.gov (United States)

Wang, Yuanshi; Wang, Shikun

2015-01-01

This paper considers plant-pollinator-ant systems in which the plant-pollinator interaction is mutualistic but ants have both positive and negative effects on plants. The ants also interfere with pollinators by preventing them from accessing plants. While a Beddington-DeAngelis (BD) formula can describe the plant-pollinator interaction, the formula is extended in this paper to characterize the pollination mutualism under the ant interference. Then, a plant-pollinator-ant system with the extended BD functional response is discussed, and global dynamics of the model demonstrate the mechanisms by which pollination mutualism can persist in the presence of ants. When the ant interference is strong, it can result in extinction of pollinators. Moreover, if the ants depend on pollination mutualism for survival, the strong interference could drive pollinators into extinction, which consequently lead to extinction of the ants themselves. When the ant interference is weak, a cooperation between plant-ant and plant-pollinator mutualisms could occur, which promotes survival of both ants and pollinators, especially in the case that ants (respectively, pollinators) cannot survive in the absence of pollinators (respectively, ants). Even when the level of ant interference remains invariant, varying ants' negative effect on plants can result in survival/extinction of both ants and pollinators. Therefore, our results provide an explanation for the persistence of pollination mutualism when there exist ants.

Isolation of the phe-operon from G. stearothermophilus comprising the phenol degradative meta-pathway genes and a novel transcriptional regulator

Directory of Open Access Journals (Sweden)

Reiss Monika

2008-11-01

Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate

Riding with the ants

NARCIS (Netherlands)

Duarte, A. P. M.; Attili-Angelis, D.; Baron, N. C.; Groenewald, Johannes Z.; Crous, Pedro W.; Pagnocca, F. C.

Isolates of Teratosphaeriaceae have frequently been found in the integument of attine ants, proving to be common and diverse in this microenvironment. The LSU phylogeny of the ant-isolated strains studied revealed that they cluster in two main lineages. The first was associated with the genus

The importance of ants in cave ecology, with new records and behavioral observations of ants in Arizona caves

Directory of Open Access Journals (Sweden)

Robert B. Pape

2016-09-01

Full Text Available The importance of ants as elements in cave ecology has been mostly unrecognized. A global list of ant species recorded from caves, compiled from a review of existing literature, is presented. This paper also reviews what is currently known about ants occurring in Arizona (USA caves. The diversity and distribution represented in these records suggests ants are relatively common cave visitors (trogloxenes. A general utilization of caves by ants within both temperate and tropical latitudes may be inferred from this combined evidence. Observations of ant behavior in Arizona caves demonstrate a low level and sporadic, but persistent, use of these habitats and their contained resources by individual ant colonies. Documentation of Neivamyrmex sp. preying on cave-inhabiting arthropods is reported here for the first time. Observations of hypogeic army ants in caves suggests they may not penetrate to great vertical depth in search of prey, but can be persistent occupants in relatively shallow, horizontal sections of caves where they may prey on endemic cave animals. First cave records for ten ant species are reported from Arizona caves. These include two species of Neivamyrmex (N. nigrescens Cresson and Neivamyrmex sp.; Formicidae: Dorylinae, four myrmicines (Pheidole portalensis Wilson, Pheidole cf. porcula Wheeler, Solenopsis aurea Wheeler and Stenamma sp. Westwood, one dolichoderine (Forelius keiferi Wheeler and three formicines (Lasius arizonicus Wheeler, L. sitiens Wilson, and Camponotus sp. Mayr.

Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

Science.gov (United States)

Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

2015-11-01

Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Christiansen, Gunna; Molin, S

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

Science.gov (United States)

Deaner, Matthew; Holzman, Allison; Alper, Hal S

2018-04-16

Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ant-plant-homopteran mutualism: how the third partner affects the interaction between a plant-specialist ant and its myrmecophyte host

Science.gov (United States)

Gaume, L.; McKey, D.; Terrin, S.

1998-01-01

By estimating relative costs and benefits, we explored the role of the homopteran partner in the protection mutualism between the myrmecophyte Leonardoxa africana T3, the ant Aphomomyrmex afer, and sap-sucking homopterans tended by ants in the tree's swollen hollow twigs. The ants obtain nest sites and food from their host-plant (food is obtained either directly by extrafloral nectar or indirectly via homopterans). Aphomomyrmex workers patrol the young leaves of L. africana T3 and protect them against phytophagous insects. Because ants tended, either solely or primarily, coccids in some trees and pseudococcids in others, we were able to study whether the nature of the interaction was dependent on the identity of the third partner. First, the type of homopteran affects the benefits to the tree of maintaining a large ant colony. Larger colony size (relative to tree size) confers greater protection against herbivory; this relationship is more pronounced for trees whose ants tend pseudococcids than for those in which ants tend coccids. Second, for trees (and associated ant colonies) of comparable size, homopteran biomass was much larger in trees harbouring coccids than in trees with pseudococcids. Thus, the cost to the tree of maintaining ants may be greater when ants are associated with coccids. The net benefits to the plant of maintaining ants appear to be much greater with pseudococcids as the third partner. To explore how the type of homopteran affects functioning of the system, we attempted to determine which of the resources (nest sites, extrafloral nectar, and homopterans) is likely to limit ant colony size. In trees where ants tended coccids, ant-colony biomass was strongly dependent on the number of extrafloral nectaries. In contrast, in trees whose ants tended only pseudococcids, colony biomass was not related to the number of nectaries and was most strongly determined by the volume of available nest sites. We present hypotheses to explain how the type of

Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

Czech Academy of Sciences Publication Activity Database

Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

2007-01-01

Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

The distribution of weaver ant pheromones on host trees

DEFF Research Database (Denmark)

Offenberg, Joachim

2007-01-01

The visible anal spots deposited by Oecophylla smaragdina ants have been suggested to deter ant prey, affect interspecific competition and facilitate mutualists and parasites in tracking down Oecophylla ants. I measured the density of anal spots on host trees with and without ants and tested for ...... to leaves. Also there was a positive correlation between spot density and the likelihood of being detected by ants. Anal spots may thus function as reliable cues to interacting species and be an important factor in shaping the community around Oecophylla colonies.......The visible anal spots deposited by Oecophylla smaragdina ants have been suggested to deter ant prey, affect interspecific competition and facilitate mutualists and parasites in tracking down Oecophylla ants. I measured the density of anal spots on host trees with and without ants and tested...... for correlations between spot density, ant activity and the likelihood of being detected by an ant. Spots were only found on trees with ants. On ant-trees, spots were distributed throughout the trees but with higher densities in areas with high ant activity and pheromone densities were higher on twigs compared...

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

Science.gov (United States)

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Relative effects of disturbance on red imported fire ants and native ant species in a longleaf pine ecosystem

DEFF Research Database (Denmark)

Stuble, Katharine L.; Kirkman, L. Katherine; Carroll, C. Ronald

2011-01-01

and cases in which non-native species become established in intact (lacking extensive anthropogenic soil disturbance) communities and subsequently diminish the abundance and richness of native species is challenging on the basis of observation alone. The red imported fire ant (Solenopsis invicta......), an invasive species that occurs throughout much of the southeastern United States, is such an example. Rather than competitively displacing native species, fire ants may become established only in disturbed areas in which native species richness and abundance are already reduced. We used insecticide to reduce......, the abundance of native ants increased to levels comparable to those in control plots after 1 year. Our findings suggest that factors other than large reductions in ant abundance and species density (number of species per unit area) may affect the establishment of fire ants and that the response of native ants...

The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

Science.gov (United States)

Stefanski, Katherine M.

A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

Science.gov (United States)

Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

2016-08-01

To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

Chemically armed mercenary ants protect fungus-farming societies

Science.gov (United States)

Adams, Rachelle M. M.; Liberti, Joanito; Illum, Anders A.; Jones, Tappey H.; Nash, David R.; Boomsma, Jacobus J.

2013-01-01

The ants are extraordinary in having evolved many lineages that exploit closely related ant societies as social parasites, but social parasitism by distantly related ants is rare. Here we document the interaction dynamics among a Sericomyrmex fungus-growing ant host, a permanently associated parasitic guest ant of the genus Megalomyrmex, and a raiding agro-predator of the genus Gnamptogenys. We show experimentally that the guest ants protect their host colonies against agro-predator raids using alkaloid venom that is much more potent than the biting defenses of the host ants. Relatively few guest ants are sufficient to kill raiders that invariably exterminate host nests without a cohabiting guest ant colony. We also show that the odor of guest ants discourages raider scouts from recruiting nestmates to host colonies. Our results imply that Sericomyrmex fungus-growers obtain a net benefit from their costly guest ants behaving as a functional soldier caste to meet lethal threats from agro-predator raiders. The fundamentally different life histories of the agro-predators and guest ants appear to facilitate their coexistence in a negative frequency-dependent manner. Because a guest ant colony is committed for life to a single host colony, the guests would harm their own interests by not defending the host that they continue to exploit. This conditional mutualism is analogous to chronic sickle cell anemia enhancing the resistance to malaria and to episodes in human history when mercenary city defenders offered either net benefits or imposed net costs, depending on the level of threat from invading armies. PMID:24019482

Chemically armed mercenary ants protect fungus-farming societies.

Science.gov (United States)

Adams, Rachelle M M; Liberti, Joanito; Illum, Anders A; Jones, Tappey H; Nash, David R; Boomsma, Jacobus J

2013-09-24

The ants are extraordinary in having evolved many lineages that exploit closely related ant societies as social parasites, but social parasitism by distantly related ants is rare. Here we document the interaction dynamics among a Sericomyrmex fungus-growing ant host, a permanently associated parasitic guest ant of the genus Megalomyrmex, and a raiding agro-predator of the genus Gnamptogenys. We show experimentally that the guest ants protect their host colonies against agro-predator raids using alkaloid venom that is much more potent than the biting defenses of the host ants. Relatively few guest ants are sufficient to kill raiders that invariably exterminate host nests without a cohabiting guest ant colony. We also show that the odor of guest ants discourages raider scouts from recruiting nestmates to host colonies. Our results imply that Sericomyrmex fungus-growers obtain a net benefit from their costly guest ants behaving as a functional soldier caste to meet lethal threats from agro-predator raiders. The fundamentally different life histories of the agro-predators and guest ants appear to facilitate their coexistence in a negative frequency-dependent manner. Because a guest ant colony is committed for life to a single host colony, the guests would harm their own interests by not defending the host that they continue to exploit. This conditional mutualism is analogous to chronic sickle cell anemia enhancing the resistance to malaria and to episodes in human history when mercenary city defenders offered either net benefits or imposed net costs, depending on the level of threat from invading armies.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

Monoculture of leafcutter ant gardens.

Directory of Open Access Journals (Sweden)

Ulrich G Mueller

2010-09-01

Full Text Available Leafcutter ants depend on the cultivation of symbiotic Attamyces fungi for food, which are thought to be grown by the ants in single-strain, clonal monoculture throughout the hundreds to thousands of gardens within a leafcutter nest. Monoculture eliminates cultivar-cultivar competition that would select for competitive fungal traits that are detrimental to the ants, whereas polyculture of several fungi could increase nutritional diversity and disease resistance of genetically variable gardens.Using three experimental approaches, we assessed cultivar diversity within nests of Atta leafcutter ants, which are most likely among all fungus-growing ants to cultivate distinct cultivar genotypes per nest because of the nests' enormous sizes (up to 5000 gardens and extended lifespans (10-20 years. In Atta texana and in A. cephalotes, we resampled nests over a 5-year period to test for persistence of resident cultivar genotypes within each nest, and we tested for genetic differences between fungi from different nest sectors accessed through excavation. In A. texana, we also determined the number of Attamyces cells carried as a starter inoculum by a dispersing queens (minimally several thousand Attamyces cells, and we tested for genetic differences between Attamyces carried by sister queens dispersing from the same nest. Except for mutational variation arising during clonal Attamyces propagation, DNA fingerprinting revealed no evidence for fungal polyculture and no genotype turnover during the 5-year surveys.Atta leafcutter ants can achieve stable, fungal monoculture over many years. Mutational variation emerging within an Attamyces monoculture could provide genetic diversity for symbiont choice (gardening biases of the ants favoring specific mutational variants, an analog of artificial selection.

Isolation and characterization of Solenopsis invicta virus 3, a new positive-strand RNA virus infecting the red imported fire ant, Solenopsis invicta

International Nuclear Information System (INIS)

Valles, Steven M.; Hashimoto, Yoshifumi

2009-01-01

We report the discovery of a new virus from the red imported fire ant, Solenopsis invicta. Solenopsis invicta virus 3 (SINV-3) represents the third virus discovered from this ant species using the metagenomics approach. The single (positive)-strand RNA, monopartite, bicistronic genome of SINV-3 was sequenced in entirety (GenBank accession number (FJ528584)), comprised of 10,386 nucleotides, and polyadenylated at the 3' terminus. This genome size was confirmed by Northern analysis. The genome revealed 2 large open reading frames (ORFs) in the sense orientation with an untranslated region (UTR) at each end and between the two ORFs. The 5' proximal ORF (ORF 1) encoded a predicted protein of 299.1 kDa (2580 amino acids). The 3' proximal ORF (ORF 2) encoded a predicted protein of 73.2 kDa (651 amino acids). RNA-dependent RNA polymerase (RdRp), helicase, and protease domains were recognized in ORF 1. SDS-PAGE separation of purified SINV-3 particles yielded 2 bands (ostensibly capsid proteins) with a combined molecular mass of 77.3 kDa which was similar to the mass predicted by ORF 2 (73.2 kDa). Phylogenetic analysis of the conserved amino acid sequences containing domains I to VIII of the RdRp from dicistroviruses, iflaviruses, plant small RNA viruses, picornaviruses, and 4 unassigned positive-strand RNA viruses revealed a trichotomous phenogram with SINV-3 and Kelp fly virus comprising a unique cluster. Electron microscopic examination of negatively stained samples of SINV-3 revealed isometric particles with apparent projections and a diameter of 27.3 ± 1.3 nm. SINV-3 was successfully transmitted to uninfected workers by feeding. The minus (replicative) strand of SINV-3 was detected in worker ants indicating replication of the virus. The possibility of using SINV-3 as a microbial control agent for fire ants is discussed.

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

The distribution and diversity of insular ants

DEFF Research Database (Denmark)

Roura-Pascual, Núria; Sanders, Nate; Hui, Cang

2016-01-01

Aim: To examine the relationship between island characteristics (area, distance to the nearest continent, climate and human population size) and ant species richness, as well as the factors underlying global geographical clustering of native and exotic ant composition on islands. Location: One...... hundred and two islands from 20 island groups around the world. Methods: We used spatial linear models that consider the spatial structure of islands to examine patterns of ant species richness. We also performed modularity analyses to identify clusters of islands hosting a similar suite of species...... and constructed conditional inference trees to assess the characteristics of islands that explain the formation of these island-ant groups. Results: Island area was the best predictor of ant species richness. However, distance to the nearest continent was an important predictor of native ant species richness...

Antígona y la muerte

OpenAIRE

Pérez Alcolea, Simona Micaela

2012-01-01

La ponencia analiza la muerte de Antígona en la obra de Sófocles. Se propone que su suicidio es un acto consciente de voluntad preanunciado a lo largo de toda la obra y no una medida desesperada. Con ese fin se exploran las posibles motivaciones de Antígona para poner fin a su vida. En el análisis se proponen tres respuestas (no necesariamente excluyentes): -Antígona responde a la ética homérica. Está en lucha con Creón, y su suicidio es su golpe de gracia al poder del rey. -Antígona...

From Ant Trails to Pedestrian Dynamics

Directory of Open Access Journals (Sweden)

Andreas Schadschneider

2003-01-01

Full Text Available This paper presents a model for the simulation of pedestrian dynamics inspired by the behaviour of ants in ant trails. Ants communicate by producing a pheromone that can be smelled by other ants. In this model, pedestrians produce a virtual pheromone that influences the motion of others. In this way all interactions are strictly local, and so even large crowds can be simulated very efficiently. Nevertheless, the model is able to reproduce the collective effects observed empirically, eg the formation of lanes in counterflow. As an application, we reproduce a surprising result found in experiments of evacuation from an aircraft.

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

Science.gov (United States)

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

Ants defend aphids against lethal disease

Science.gov (United States)

Nielsen, Charlotte; Agrawal, Anurag A.; Hajek, Ann E.

2010-01-01

Social insects defend their own colonies and some species also protect their mutualist partners. In mutualisms with aphids, ants typically feed on honeydew produced by aphids and, in turn guard and shelter aphid colonies from insect natural enemies. Here we report that Formica podzolica ants tending milkweed aphids, Aphis asclepiadis, protect aphid colonies from lethal fungal infections caused by an obligate aphid pathogen, Pandora neoaphidis. In field experiments, bodies of fungal-killed aphids were quickly removed from ant-tended aphid colonies. Ant workers were also able to detect infective conidia on the cuticle of living aphids and responded by either removing or grooming these aphids. Our results extend the long-standing view of ants as mutualists and protectors of aphids by demonstrating focused sanitizing and quarantining behaviour that may lead to reduced disease transmission in aphid colonies. PMID:19923138

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

Science.gov (United States)

Tadmor, Arbel

2009-03-01

In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

Science.gov (United States)

Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

2015-02-27

It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

Collective search by ants in microgravity

Directory of Open Access Journals (Sweden)

Stefanie M. Countryman

2015-03-01

Full Text Available The problem of collective search is a tradeoff between searching thoroughly and covering as much area as possible. This tradeoff depends on the density of searchers. Solutions to the problem of collective search are currently of much interest in robotics and in the study of distributed algorithms, for example to design ways that without central control robots can use local information to perform search and rescue operations. Ant colonies operate without central control. Because they can perceive only local, mostly chemical and tactile cues, they must search collectively to find resources and to monitor the colony's environment. Examining how ants in diverse environments solve the problem of collective search can elucidate how evolution has led to diverse forms of collective behavior. An experiment on the International Space Station in January 2014 examined how ants (Tetramorium caespitum perform collective search in microgravity. In the ISS experiment, the ants explored a small arena in which a barrier was lowered to increase the area and thus lower ant density. In microgravity, relative to ground controls, ants explored the area less thoroughly and took more convoluted paths. It appears that the difficulty of holding on to the surface interfered with the ants’ ability to search collectively. Ants frequently lost contact with the surface, but showed a remarkable ability to regain contact with the surface.

Pericarpial nectary-visiting ants do not provide fruit protection against pre-dispersal seed predators regardless of ant species composition and resource availability.

Directory of Open Access Journals (Sweden)

Priscila Andre Sanz-Veiga

Full Text Available Extrafloral nectaries can occur in both vegetative and reproductive plant structures. In many Rubiaceae species in the Brazilian Cerrado, after corolla abscission, the floral nectary continues to secret nectar throughout fruit development originating post-floral pericarpial nectaries which commonly attract many ant species. The occurrence of such nectar secreting structures might be strategic for fruit protection against seed predators, as plants are expected to invest higher on more valuable and vulnerable parts. Here, we performed ant exclusion experiments to investigate whether the interaction with ants mediated by the pericarpial nectaries of Tocoyena formosa affects plant reproductive success by reducing the number of pre-dispersal seed predators. We also assessed whether ant protection was dependent on ant species composition and resource availability. Although most of the plants were visited by large and aggressive ant species, such as Ectatomma tuberculatum and species of the genus Camponotus, ants did not protect fruits against seed predators. Furthermore, the result of the interaction was neither related to ant species composition nor to the availability of resources. We suggest that these results may be related to the nature and behavior of the most important seed predators, like Hemicolpus abdominalis weevil which the exoskeleton toughness prevent it from being predated by most ant species. On the other hand, not explored factors, such as reward quality, local ant abundance, ant colony characteristics and/or the presence of alternative energetic sources could also account for variations in ant frequency, composition, and finally ant protective effects, highlighting the conditionality of facultative plant-ant mutualisms.

The Biochemical Toxin Arsenal from Ant Venoms

Directory of Open Access Journals (Sweden)

Axel Touchard

2016-01-01

Full Text Available Ants (Formicidae represent a taxonomically diverse group of hymenopterans with over 13,000 extant species, the majority of which inject or spray secretions from a venom gland. The evolutionary success of ants is mostly due to their unique eusociality that has permitted them to develop complex collaborative strategies, partly involving their venom secretions, to defend their nest against predators, microbial pathogens, ant competitors, and to hunt prey. Activities of ant venom include paralytic, cytolytic, haemolytic, allergenic, pro-inflammatory, insecticidal, antimicrobial, and pain-producing pharmacologic activities, while non-toxic functions include roles in chemical communication involving trail and sex pheromones, deterrents, and aggregators. While these diverse activities in ant venoms have until now been largely understudied due to the small venom yield from ants, modern analytical and venomic techniques are beginning to reveal the diversity of toxin structure and function. As such, ant venoms are distinct from other venomous animals, not only rich in linear, dimeric and disulfide-bonded peptides and bioactive proteins, but also other volatile and non-volatile compounds such as alkaloids and hydrocarbons. The present review details the unique structures and pharmacologies of known ant venom proteinaceous and alkaloidal toxins and their potential as a source of novel bioinsecticides and therapeutic agents.

The Biochemical Toxin Arsenal from Ant Venoms

Science.gov (United States)

Touchard, Axel; Aili, Samira R.; Fox, Eduardo Gonçalves Paterson; Escoubas, Pierre; Orivel, Jérôme; Nicholson, Graham M.; Dejean, Alain

2016-01-01

Ants (Formicidae) represent a taxonomically diverse group of hymenopterans with over 13,000 extant species, the majority of which inject or spray secretions from a venom gland. The evolutionary success of ants is mostly due to their unique eusociality that has permitted them to develop complex collaborative strategies, partly involving their venom secretions, to defend their nest against predators, microbial pathogens, ant competitors, and to hunt prey. Activities of ant venom include paralytic, cytolytic, haemolytic, allergenic, pro-inflammatory, insecticidal, antimicrobial, and pain-producing pharmacologic activities, while non-toxic functions include roles in chemical communication involving trail and sex pheromones, deterrents, and aggregators. While these diverse activities in ant venoms have until now been largely understudied due to the small venom yield from ants, modern analytical and venomic techniques are beginning to reveal the diversity of toxin structure and function. As such, ant venoms are distinct from other venomous animals, not only rich in linear, dimeric and disulfide-bonded peptides and bioactive proteins, but also other volatile and non-volatile compounds such as alkaloids and hydrocarbons. The present review details the unique structures and pharmacologies of known ant venom proteinaceous and alkaloidal toxins and their potential as a source of novel bioinsecticides and therapeutic agents. PMID:26805882

Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

DEFF Research Database (Denmark)

Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold

2016-01-01

Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements...... of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...... on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...

Aphid egg protection by ants: a novel aspect of the mutualism between the tree-feeding aphid Stomaphis hirukawai and its attendant ant Lasius productus

Science.gov (United States)

Matsuura, Kenji; Yashiro, Toshihisa

2006-10-01

Aphids often form mutualistic associations with ants, in which the aphids provide the ants with honeydew and the ants defend the aphids from predators. In this paper, we report aphid egg protection by ants as a novel aspect of the deeply interdependent relationship between a tree-feeding aphid and its attendant ant. The ant Lasius productus harbours oviparous females, males, and eggs of the hinoki cypress-feeding aphid Stomaphis hirukawai in its nests in winter. We investigated the behaviour of ants kept with aphid eggs in petri dishes to examine whether the ants recognise the aphid eggs and tend them or only provide a refuge for the aphids. Workers carried almost all of the aphid eggs into the nest within 24 h. The ants indiscriminately tended aphid eggs collected from their own colonies and those from other ant colonies. The ants cleaned the eggs and piled them up in the nest, and egg tending by ants dramatically increased aphid egg survival rates. Starving the ants showed no significant effect on aphid egg survivorship. Without ants, aphid eggs were rapidly killed by fungi. These results suggested that grooming by the ants protected the aphid eggs, at least, against pathogenic fungi. This hygienic service afforded by the ants seems indispensable for egg survival of these aphids in an environment rich in potentially pathogenic microorganisms.

Fire ants perpetually rebuild sinking towers

Science.gov (United States)

Phonekeo, Sulisay; Mlot, Nathan; Monaenkova, Daria; Hu, David L.; Tovey, Craig

2017-07-01

In the aftermath of a flood, fire ants, Solenopsis invicta, cluster into temporary encampments. The encampments can contain hundreds of thousands of ants and reach over 30 ants high. How do ants build such tall structures without being crushed? In this combined experimental and theoretical study, we investigate the shape and rate of construction of ant towers around a central support. The towers are bell shaped, consistent with towers of constant strength such as the Eiffel tower, where each element bears an equal load. However, unlike the Eiffel tower, the ant tower is built through a process of trial and error, whereby failed portions avalanche until the final shape emerges. High-speed and novel X-ray videography reveal that the tower constantly sinks and is rebuilt, reminiscent of large multicellular systems such as human skin. We combine the behavioural rules that produce rafts on water with measurements of adhesion and attachment strength to model the rate of growth of the tower. The model correctly predicts that the growth rate decreases as the support diameter increases. This work may inspire the design of synthetic swarms capable of building in vertical layers.

Ants Orase kultuurisõnum

Index Scriptorium Estoniae

2007-01-01

26. jaanuaril toimub Tallinna Ülikooli Akadeemilises Raamatukogus seminar silmapaistvast Eesti teadlasest ja tõlkijast Ants Orasest. Esinevad kirjandusteadlased Tallinna Ülikoolist, Tartu Ülikoolist ja Eesti Kirjandusmuuseumist. Avaettekandeks on sõna Oklahoma Ülikooli professoril Vincent B. Leitchil, kes oli Ants Orase viimaseks juhendatavaks doktorandiks. Seminari korraldavad Tallinna Ülikool ja Eesti Kirjandusmuuseum. Vt ka Postimees, 26, jaan., lk. 18

Ant-plant symbioses: Stalking the chuyachaqui.

Science.gov (United States)

Davidson, D W; McKey, D

1993-09-01

According to Quechua-speaking peoples, orchard-like stands ('Supay Chacras') of two Amazonian ant-plant species are cultivated by the devil, or 'Chuyachaqui'. These "devil gardens" offer extreme examples of specializations that have evolved repeatedly in ant-plant associations. Numerous investigations are beginning to disclose the identity of the Chuyachaqui - the forces behind evolutionary specialization in ant-plant symbioses. These developments have important implications for our understanding of modes of coevolution in symbiotic mutualism, remarkable convergent similarities in the form of ant-plant symbioses on different continents, and pronounced intercontinental differences in the diversity and taxonomic composition of associates. Copyright © 1993. Published by Elsevier Ltd.

Recognition in ants: social origin matters.

Directory of Open Access Journals (Sweden)

Joël Meunier

Full Text Available The ability of group members to discriminate against foreigners is a keystone in the evolution of sociality. In social insects, colony social structure (number of queens is generally thought to influence abilities of resident workers to discriminate between nestmates and non-nestmates. However, whether social origin of introduced individuals has an effect on their acceptance in conspecific colonies remains poorly explored. Using egg-acceptance bioassays, we tested the influence of social origin of queen-laid eggs on their acceptance by foreign workers in the ant Formica selysi. We showed that workers from both single- and multiple-queen colonies discriminated against foreign eggs from single-queen colonies, whereas they surprisingly accepted foreign eggs from multiple-queen colonies. Chemical analyses then demonstrated that social origins of eggs and workers could be discriminated on the basis of their chemical profiles, a signal generally involved in nestmate discrimination. These findings provide the first evidence in social insects that social origins of eggs interfere with nestmate discrimination and are encoded by chemical signatures.

Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

Science.gov (United States)

Ghosh, Semanti; Bagchi, Angshuman

2015-12-01

Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Science.gov (United States)

Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

2017-01-01

Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Directory of Open Access Journals (Sweden)

Kathleen Jwanoswki

Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

Pollination and facultative ant-association in the African leopard ...

African Journals Online (AJOL)

The role of extra-floral nectar appears to be recruitment of foraging ants to tend the flowers resulting in a facultative ant-association between the orchid and gregarious ants. Four different ant species were found to forage on A. africana's inflorescences. Ant-tended inflorescences suffered significantly less damage by insects.

ANT, tourism and situated globality

DEFF Research Database (Denmark)

Jóhannesson, Gunnar Thór; Ren, Carina Bregnholm; van der Duim, René

2015-01-01

viable descriptions of the collective condition of humans and more-than-humans in the Anthropocene. Also and moving past a merely descriptive approach, it discusses it as a useful tool to engage with the situated globalities which come into being through the socio-spatial coupling of tourism......In recent years Actor-network theory (ANT) has increasingly been felt in the field of tourism studies (Van der Duim, Ren, & Jóhannesson, 2012). An important implication of the meeting between ANT and tourism studies is the notion of tourism being described as a heterogeneous assemblage of what we...... are used to define as the separate spheres of nature and culture. This paper explores and relates the central tenets of ANT in tourism with regard to the concept of the Anthropocene. It presents the ANT approach as a flat and object-oriented ontology and methodology and explores its potentials to carve out...

Recurrence analysis of ant activity patterns.

Directory of Open Access Journals (Sweden)

Felipe Marcel Neves

Full Text Available In this study, we used recurrence quantification analysis (RQA and recurrence plots (RPs to compare the movement activity of individual workers of three ant species, as well as a gregarious beetle species. RQA and RPs quantify the number and duration of recurrences of a dynamical system, including a detailed quantification of signals that could be stochastic, deterministic, or both. First, we found substantial differences between the activity dynamics of beetles and ants, with the results suggesting that the beetles have quasi-periodic dynamics and the ants do not. Second, workers from different ant species varied with respect to their dynamics, presenting degrees of predictability as well as stochastic signals. Finally, differences were found among minor and major caste of the same (dimorphic ant species. Our results underscore the potential of RQA and RPs in the analysis of complex behavioral patterns, as well as in general inferences on animal behavior and other biological phenomena.

Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

Science.gov (United States)

Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

2015-01-01

Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

Symbiotic mutualism with a community of opportunistic ants: protection, competition, and ant occupancy of the myrmecophyte Barteria nigritana (Passifloraceae)

Science.gov (United States)

Djiéto-Lordon, Champlain; Dejean, Alain; Gibernau, Marc; Hossaert-McKey, Martine; McKey, Doyle

2004-10-01

Barteria nigritana is a myrmecophyte tree of Lower Guinea coastal vegetation. Unlike the more specialised B. fistulosa, which harbours a single host-specific mutualistic ant, B. nigritana is associated with several opportunistic ants. Such symbiotic, yet opportunistic, ant-plant associations have been little studied. On 113 clumps of B. nigritana, we censused ant associates and herbivores and compared herbivory on plants occupied by different ants. In addition to these correlative data, protection conferred by different ant species was compared by herbivore-placement experiments. Identity of ant associate changed predictably over plant ontogeny. Pheidole megacephala was restricted to very small plants; saplings were occupied by either Oecophylla longinoda or Crematogaster sp., and the latter species was the sole occupant of larger trees. Damage by caterpillars of the nymphalid butterfly Acraea zetes accounted for much of the herbivory to leaves. Ant species differed in the protection provided to hosts. While P. megacephala provided no significant protection, plants occupied by O. longinoda and Crematogaster sp. suffered less damage than did unoccupied plants or those occupied by P. megacephala. Furthermore, O. longinoda provided more effective protection than did Crematogaster sp. Herbivore-placement experiments confirmed these results. Workers of O. longinoda killed or removed all larval instars of A. zetes. Crematogaster preyed on only the two first larval instars, and P. megacephala preyed mainly on eggs, only rarely attacking the two first larval instars. Opportunistic ants provided significant protection to this relatively unspecialised myrmecophyte. The usual associate of mature trees was not the species that provided most protection.

Cuticular hydrocarbons correlate with queen reproductive status in native and invasive Argentine ants (Linepithema humile, Mayr)

Science.gov (United States)

Diaz, Mireia; Lenoir, Alain; Ivon Paris, Carolina; Boulay, Raphaël; Gómez, Crisanto

2018-01-01

In insect societies, chemical communication plays an important role in colony reproduction and individual social status. Many studies have indicated that cuticular hydrocarbons (CHCs) are the main chemical compounds encoding reproductive status. However, these studies have largely focused on queenless or monogynous species whose workers are capable of egg laying and have mainly explored the mechanisms underlying queen-worker or worker-worker reproductive conflicts. Less is known about what occurs in highly polygynous ant species with permanently sterile workers. Here, we used the Argentine ant as a model to examine the role of CHCs in communicating reproductive information in such insect societies. The Argentine ant is unicolonial, highly polygynous, and polydomous. We identified several CHCs whose presence and levels were correlated with queen age, reproductive status, and fertility. Our results also provide new insights into queen executions in the Argentine ant, a distinctive feature displayed by this species in its introduced range. Each spring, just before new sexuals appear, workers eliminate up to 90% of the mated queens in their colonies. We discovered that queens that survived execution had different CHC profiles from queens present before and during execution. More specifically, levels of some CHCs were higher in the survivors, suggesting that workers could eliminate queens based on their chemical profiles. In addition, queen CHC profiles differed based on season and species range (native vs. introduced). Overall, the results of this study provide new evidence that CHCs serve as queen signals and do more than just regulate worker reproduction. PMID:29470506

Plant-ants use symbiotic fungi as a food source: new insight into the nutritional ecology of ant-plant interactions.

Science.gov (United States)

Blatrix, Rumsaïs; Djiéto-Lordon, Champlain; Mondolot, Laurence; La Fisca, Philippe; Voglmayr, Hermann; McKey, Doyle

2012-10-07

Usually studied as pairwise interactions, mutualisms often involve networks of interacting species. Numerous tropical arboreal ants are specialist inhabitants of myrmecophytes (plants bearing domatia, i.e. hollow structures specialized to host ants) and are thought to rely almost exclusively on resources derived from the host plant. Recent studies, following up on century-old reports, have shown that fungi of the ascomycete order Chaetothyriales live in symbiosis with plant-ants within domatia. We tested the hypothesis that ants use domatia-inhabiting fungi as food in three ant-plant symbioses: Petalomyrmex phylax/Leonardoxa africana, Tetraponera aethiops/Barteria fistulosa and Pseudomyrmex penetrator/Tachigali sp. Labelling domatia fungal patches in the field with either a fluorescent dye or (15)N showed that larvae ingested domatia fungi. Furthermore, when the natural fungal patch was replaced with a piece of a (15)N-labelled pure culture of either of two Chaetothyriales strains isolated from T. aethiops colonies, these fungi were also consumed. These two fungi often co-occur in the same ant colony. Interestingly, T. aethiops workers and larvae ingested preferentially one of the two strains. Our results add a new piece in the puzzle of the nutritional ecology of plant-ants.

Involvement of SPI-2-encoded SpiC in flagellum synthesis in Salmonella enterica serovar Typhimurium

Directory of Open Access Journals (Sweden)

Sugita Asami

2009-08-01

Full Text Available Abstract Background SpiC encoded within Salmonella pathogenicity island 2 on the Salmonella enterica serovar Typhimurium chromosome is required for survival within macrophages and systemic infection in mice. Additionally, SpiC contributes to Salmonella-induced activation of the signal transduction pathways in macrophages by affecting the expression of FliC, a component of flagella filaments. Here, we show the contribution of SpiC in flagellum synthesis. Results Quantitative RT-PCR shows that the expression levels of the class 3 fliD and motA genes that encode for the flagella cap and motor torque proteins, respectively, were lower for a spiC mutant strain than for the wild-type Salmonella. Further, this mutant had lower expression levels of the class 2 genes including the fliA gene encoding the flagellar-specific alternative sigma factor. We also found differences in flagella assembly between the wild-type strain and the spiC mutant. Many flagella filaments were observed on the bacterial surface of the wild-type strain, whereas the spiC mutant had only few flagella. The absence of spiC led to reduced expression of the FlhD protein, which functions as the master regulator in flagella gene expression, although no significant difference at the transcription level of the flhDC operon was observed between the wild-type strain and the spiC mutant. Conclusion The data show that SpiC is involved in flagella assembly by affecting the post-transcription expression of flhDC.

A new tessera into the interactome of the isc operon:A novel interaction between HscB and IscS

Directory of Open Access Journals (Sweden)

Annalisa Pastore

2016-09-01

Full Text Available Iron sulfur clusters are essential universal prosthetic groups which can be formed inorganically but, in biology, are bound to proteins and produced enzymatically. Most of the components of the machine that produces the clusters are conserved throughout evolution. In bacteria, they are encoded in the isc operon. Previous reports provide information on the role of specific components but a clear picture of how the whole machine works is still missing. We have carried out a study of the effects of the co-chaperone HscB from the model system E. coli. We document a previously undetected weak interaction between the chaperone HscB and the desulfurase IscS, one of the two main players of the machine. The binding site involves a region of HscB in the longer stem of the approximately L-shaped molecules, whereas the interacting surface of IscS overlaps with the surface previously involved in binding other proteins, such as ferredoxin and frataxin. Our findings provide an entirely new perspective to our comprehension of the role of HscB and propose this protein as a component of the IscS complex.

Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

NARCIS (Netherlands)

Nouwen, N; Driessen, AJM

2005-01-01

Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

Pheromone disruption of Argentine ant trail integrity

Science.gov (United States)

Suckling, D.M.; Peck, R.W.; Manning, L.M.; Stringer, L.D.; Cappadonna, J.; El-Sayed, A. M.

2008-01-01

Disruption of Argentine ant trail following and reduced ability to forage (measured by bait location success) was achieved after presentation of an oversupply of trail pheromone, (Z)-9-hexadecenal. Experiments tested single pheromone point sources and dispersion of a formulation in small field plots. Ant walking behavior was recorded and digitized by using video tracking, before and after presentation of trail pheromone. Ants showed changes in three parameters within seconds of treatment: (1) Ants on trails normally showed a unimodal frequency distribution of walking track angles, but this pattern disappeared after presentation of the trail pheromone; (2) ants showed initial high trail integrity on a range of untreated substrates from painted walls to wooden or concrete floors, but this was significantly reduced following presentation of a point source of pheromone; (3) the number of ants in the pheromone-treated area increased over time, as recruitment apparently exceeded departures. To test trail disruption in small outdoor plots, the trail pheromone was formulated with carnuba wax-coated quartz laboratory sand (1 g quartz sand/0.2 g wax/1 mg pheromone). The pheromone formulation, with a half-life of 30 h, was applied by rotary spreader at four rates (0, 2.5, 7.5, and 25 mg pheromone/m2) to 1- and 4-m2 plots in Volcanoes National Park, Hawaii. Ant counts at bait cards in treated plots were significantly reduced compared to controls on the day of treatment, and there was a significant reduction in ant foraging for 2 days. These results show that trail pheromone disruption of Argentine ants is possible, but a much more durable formulation is needed before nest-level impacts can be expected. ?? 2008 Springer Science+Business Media, LLC.

Congestion and communication in confined ant traffic

Science.gov (United States)

Gravish, Nick; Gold, Gregory; Zangwill, Andrew; Goodisman, Michael A. D.; Goldman, Daniel I.

2014-03-01

Many social animals move and communicate within confined spaces. In subterranean fire ants Solenopsis invicta, mobility within crowded nest tunnels is important for resource and information transport. Within confined tunnels, communication and traffic flow are at odds: trafficking ants communicate through tactile interactions while stopped, yet ants that stop to communicate impose physical obstacles on the traffic. We monitor the bi-directional flow of fire ant workers in laboratory tunnels of varied diameter D. The persistence time of communicating ant aggregations, τ, increases approximately linearly with the number of participating ants, n. The sensitivity of traffic flow increases as D decreases and diverges at a minimum diameter, Dc. A cellular automata model incorporating minimal traffic features--excluded volume and communication duration--reproduces features of the experiment. From the model we identify a competition between information transfer and the need to maintain jam-free traffic flow. We show that by balancing information transfer and traffic flow demands, an optimum group strategy exists which maximizes information throughput. We acknowledge funding from NSF PoLS #0957659 and #PHY-1205878.

Selenium exposure results in reduced reproduction in an invasive ant species and altered competitive behavior for a native ant species

International Nuclear Information System (INIS)

De La Riva, Deborah G.; Trumble, John T.

2016-01-01

Competitive ability and numerical dominance are important factors contributing to the ability of invasive ant species to establish and expand their ranges in new habitats. However, few studies have investigated the impact of environmental contamination on competitive behavior in ants as a potential factor influencing dynamics between invasive and native ant species. Here we investigated the widespread contaminant selenium to investigate its potential influence on invasion by the exotic Argentine ant, Linepithema humile, through effects on reproduction and competitive behavior. For the fecundity experiment, treatments were provided to Argentine ant colonies via to sugar water solutions containing one of three concentrations of selenium (0, 5 and 10 μg Se mL −1 ) that fall within the range found in soil and plants growing in contaminated areas. Competition experiments included both the Argentine ant and the native Dorymyrmex bicolor to determine the impact of selenium exposure (0 or 15 μg Se mL −1 ) on exploitation- and interference-competition between ant species. The results of the fecundity experiment revealed that selenium negatively impacted queen survival and brood production of Argentine ants. Viability of the developing brood was also affected in that offspring reached adulthood only in colonies that were not given selenium, whereas those in treated colonies died in their larval stages. Selenium exposure did not alter direct competitive behaviors for either species, but selenium exposure contributed to an increased bait discovery time for D. bicolor. Our results suggest that environmental toxins may not only pose problems for native ant species, but may also serve as a potential obstacle for establishment among exotic species. - Highlights: • Argentine ant colonies exposed to selenium had reduced fecundity compared to unexposed colonies. • Viability of offspring was negatively impacted by selenium. • Queen survival was reduced in colonies

Improved Ant Colony Clustering Algorithm and Its Performance Study

Science.gov (United States)

Gao, Wei

2016-01-01

Clustering analysis is used in many disciplines and applications; it is an important tool that descriptively identifies homogeneous groups of objects based on attribute values. The ant colony clustering algorithm is a swarm-intelligent method used for clustering problems that is inspired by the behavior of ant colonies that cluster their corpses and sort their larvae. A new abstraction ant colony clustering algorithm using a data combination mechanism is proposed to improve the computational efficiency and accuracy of the ant colony clustering algorithm. The abstraction ant colony clustering algorithm is used to cluster benchmark problems, and its performance is compared with the ant colony clustering algorithm and other methods used in existing literature. Based on similar computational difficulties and complexities, the results show that the abstraction ant colony clustering algorithm produces results that are not only more accurate but also more efficiently determined than the ant colony clustering algorithm and the other methods. Thus, the abstraction ant colony clustering algorithm can be used for efficient multivariate data clustering. PMID:26839533

Current and potential ant impacts in the Pacific region

Science.gov (United States)

Loope, Lloyd L.; Krushelnycky, Paul D.

2007-01-01

Worldwide, ants are a powerful ecological force, and they appear to be dominant components of animal communities of many tropical and temperate ecosystems in terms of biomass and numbers of individuals (Bluthgen et al. 2000). For example, ants comprise up to 94% of arthropod individuals in fogging samples taken from diverse lowland tropical rainforest canopies, and 86% of the biomass (Davidson et al. 2003). The majority of these ant species and individuals obtain carbohydrates either from extrafloral nectaries or from sap-feeding Hemiptera that pass carbohydrate-rich “honeydew” to attending ants while concentrating nitrogen (N) from N-poor plant sap (Davidson et al. 2003). Honeydew and nectar represent key resources for arboreal ant species, although most ant species are at least partly carnivorous or scavengers (Bluthgen et al. 2004). In contrast to most of the terrestrial world, the biotas of many Pacific islands evolved without ants. Whereas endemic ant species are found in New Zealand (ca. 10 spp.), Tonga (ca. 10 spp.), and Samoa (ca. 12 spp.), other islands of Polynesia and parts of Micronesia likely lack native ants (Wilson and Taylor 1967, Wetterer 2002, Wetterer and Vargo 2003). About 20 Indo-Australian and western Pacific ant species range to the east and north of Samoa, but it is unclear how many of these were transported there by humans at some time (Wilson and Taylor 1967). Most of the remainder of the ant species currently found on Pacific islands are widespread species that fall in the category of “tramp species,” dispersed by recent human commerce and generally closely tied to human activity and urban areas (Wilson and Taylor 1967, McGlynn 1999). In Pacific island situations, some of these tramp ant species are able to thrive beyond areas of human activity. Relatively few ant species have been successful invaders of native communities on continents, and these include most of the species that pose the greatest problems for Pacific islands

A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

Science.gov (United States)

Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

2015-01-01

The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

Oecophylla smaragdina food conversion efficiency: prospects for ant farming

DEFF Research Database (Denmark)

Offenberg, Hans Joachim

2011-01-01

can be combined with the use of the ants in biological control programmes in tropical plantations where pest insects are converted into ant biomass. To assess the cost-benefits of ant farming based on artificial feeding, food consumption and food conversion efficiency (ECI) of Oecophylla smaragdina......Oecophylla ants are sold at high prices on several commercial markets as a human delicacy, as pet food or as traditional medicine. Currently markets are supplied by ants collected from the wild; however, an increasing interest in ant farming exists as all harvest is easily sold and as ant farming...... selling prices these efficiencies led to rates of return from 1.52 to 4.56, respectively, if: (i) protein is supplied from commercial products; or (ii) alternatively supplied from free sources such as insects and kitchen waste. These results suggest that Oecophylla ant farming may become highly profitable...

A cellular automata model for ant trails

Indian Academy of Sciences (India)

In this study, the unidirectional ant traffic flow with U-turn in an ant trail was investigated using one-dimensional cellular automata model. It is known that ants communicate with each other by dropping a chemical, called pheromone, on the substrate. Apart from the studies in the literature, it was considered in the model that ...

Ant-Related Oviposition and Larval Performance in a Myrmecophilous Lycaenid

Directory of Open Access Journals (Sweden)

Matthew D. Trager

2013-01-01

Full Text Available We experimentally assessed ant-related oviposition and larval performance in the Miami blue butterfly (Cyclargus thomasi bethunebakeri. Ant tending had sex-dependent effects on most measures of larval growth: female larvae generally benefitted from increased tending frequency whereas male larvae were usually unaffected. The larger size of female larvae tended by ants resulted in a substantial predicted increase in lifetime egg production. Oviposition by adult females that were tended by C. floridanus ants as larvae was similar between host plants with or without ants. However, they laid relatively more eggs on plants with ants than did females raised without ants, which laid less than a third of their eggs on plants with ants present. In summary, we found conditional benefits for larvae tended by ants that were not accompanied by oviposition preference for plants with ants present, which is a reasonable result for a system in which ant presence at the time of oviposition is not a reliable indicator of future ant presence. More broadly, our results emphasize the importance of considering the consequences of variation in interspecific interactions, life history traits, and multiple measures of performance when evaluating the costs and benefits of mutualistic relationships.

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Science.gov (United States)

2012-01-01

Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

Ants as tools in sustainable agriculture

DEFF Research Database (Denmark)

Offenberg, Joachim

2015-01-01

1. With an expanding human population placing increasing pressure on the environment, agriculture needs sustainable production that can match conventional methods. Integrated pest management (IPM) is more sustainable, but not necessarily as efficient as conventional non-sustainable measures. 2...... in multiple crops. Their efficiency is comparable to chemical pesticides or higher, while at lower costs. They provide a rare example of documented efficient conservation biological control. 3. Weaver ants share beneficial traits with almost 13 000 other ant species and are unlikely to be unique...... of agricultural systems, this review emphasizes the potential of managing ants to achieve sustainable pest management solutions. The synthesis suggests future directions and may catalyse a research agenda on the utilization of ants, not only against arthropod pests, but also against weeds and plant diseases...

ADAPTIVE ANT COLONY OPTIMIZATION BASED GRADIENT FOR EDGE DETECTION

Directory of Open Access Journals (Sweden)

Febri Liantoni

2014-08-01

Full Text Available Ant Colony Optimization (ACO is a nature-inspired optimization algorithm which is motivated by ants foraging behavior. Due to its favorable advantages, ACO has been widely used to solve several NP-hard problems, including edge detection. Since ACO initially distributes ants at random, it may cause imbalance ant distribution which later affects path discovery process. In this paper an adaptive ACO is proposed to optimize edge detection by adaptively distributing ant according to gradient analysis. Ants are adaptively distributed according to gradient ratio of each image regions. Region which has bigger gradient ratio, will have bigger number of ant distribution. Experiments are conducted using images from various datasets. Precision and recall are used to quantitatively evaluate performance of the proposed algorithm. Precision and recall of adaptive ACO reaches 76.98 % and 96.8 %. Whereas highest precision and recall for standard ACO are 69.74 % and 74.85 %. Experimental results show that the adaptive ACO outperforms standard ACO which randomly distributes ants.

Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

NARCIS (Netherlands)

Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:.

Science.gov (United States)

Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M

2015-12-29

Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

Fungal Adaptations to Mutualistic Life with Ants

DEFF Research Database (Denmark)

Kooij, Pepijn Wilhelmus

Fungus-growing ants (Attini) feed off a fungus they cultivate in a mutualistic symbiosis in underground chambers by providing it substrate they collect outside the colony. The tribe of Attine ants ranges from small colonies of the paleo- and basal Attine species with a few hundred workers that fo...... that the fungus evolved some incredible adaptations to a mutualistic life with the ants....

Fast and flexible: argentine ants recruit from nearby trails.

Science.gov (United States)

Flanagan, Tatiana P; Pinter-Wollman, Noa M; Moses, Melanie E; Gordon, Deborah M

2013-01-01

Argentine ants (Linepithema humile) live in groups of nests connected by trails to each other and to stable food sources. In a field study, we investigated whether some ants recruit directly from established, persistent trails to food sources, thus accelerating food collection. Our results indicate that Argentine ants recruit nestmates to food directly from persistent trails, and that the exponential increase in the arrival rate of ants at baits is faster than would be possible if recruited ants traveled from distant nests. Once ants find a new food source, they walk back and forth between the bait and sometimes share food by trophallaxis with nestmates on the trail. Recruiting ants from nearby persistent trails creates a dynamic circuit, like those found in other distributed systems, which facilitates a quick response to changes in available resources.

Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis.

Science.gov (United States)

Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon

2016-05-18

Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

Hey! A Fire Ant Stung Me!

Science.gov (United States)

... Videos for Educators Search English Español Hey! A Fire Ant Stung Me! KidsHealth / For Kids / Hey! A ... Me picó una roja o colorada! What's a Fire Ant? There are many different types of fire ...

Messenger RNA Interferase RelE Controls relBE Transcription by Conditional Cooperativity

DEFF Research Database (Denmark)

Overgaard, Martin; Borch, Jonas; Jørgensen, Mikkel G

2008-01-01

Prokaryotic toxin-antitoxin (TA) loci consist of two genes in an operon that encodes a metabolically stable toxin and an unstable antitoxin. The antitoxin neutralises its cognate toxin by forming a tight complex with it. In all cases known, the antitoxin autoregulates TA operon transcription by b...... operator DNA. A mutational analysis of the operator-sites showed that RelE in excess counteracted cooperative binding of the RelB(2)*RelE complexes to the operator-sites. Thus, RelE controls relBE transcription by conditional cooperativity.......Prokaryotic toxin-antitoxin (TA) loci consist of two genes in an operon that encodes a metabolically stable toxin and an unstable antitoxin. The antitoxin neutralises its cognate toxin by forming a tight complex with it. In all cases known, the antitoxin autoregulates TA operon transcription...... by binding to one or more operators in the promoter region while the toxin functions as a co-repressor of transcription. Interestingly, the toxin can also stimulate TA operon transcription. Here we analyse mechanistic aspects of how RelE of Escherichia coli can function both as a co-repressor and derepressor...

Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

Science.gov (United States)

Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

2018-01-22

Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

Fast and flexible: argentine ants recruit from nearby trails.

Directory of Open Access Journals (Sweden)

Tatiana P Flanagan

Full Text Available Argentine ants (Linepithema humile live in groups of nests connected by trails to each other and to stable food sources. In a field study, we investigated whether some ants recruit directly from established, persistent trails to food sources, thus accelerating food collection. Our results indicate that Argentine ants recruit nestmates to food directly from persistent trails, and that the exponential increase in the arrival rate of ants at baits is faster than would be possible if recruited ants traveled from distant nests. Once ants find a new food source, they walk back and forth between the bait and sometimes share food by trophallaxis with nestmates on the trail. Recruiting ants from nearby persistent trails creates a dynamic circuit, like those found in other distributed systems, which facilitates a quick response to changes in available resources.

Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

NARCIS (Netherlands)

Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

2005-01-01

Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21.

Science.gov (United States)

Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng

2015-10-01

To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

Cryptococcus neoformans carried by Odontomachus bauri ants

Directory of Open Access Journals (Sweden)

Mariana Santos de Jesus

2012-06-01

Full Text Available Cryptococcus neoformans is the most common causative agent of cryptococcosis worldwide. Although this fungus has been isolated from a variety of organic substrates, several studies suggest that hollow trees constitute an important natural niche for C. neoformans. A previously surveyed hollow of a living pink shower tree (Cassia grandis positive for C. neoformans in the city of Rio de Janeiro, Brazil, was chosen for further investigation. Odontomachus bauri ants (trap-jaw ants found inside the hollow were collected for evaluation as possible carriers of Cryptococcus spp. Two out of 10 ants were found to carry phenoloxidase-positive colonies identified as C. neoformans molecular types VNI and VNII. The ants may have acted as a mechanical vector of C. neoformans and possibly contributed to the dispersal of the fungi from one substrate to another. To the best of our knowledge, this is the first report on the association of C. neoformans with ants of the genus Odontomachus.

[Ants as carriers of microorganisms in hospital environments].

Science.gov (United States)

Pereira, Rogério Dos Santos; Ueno, Mariko

2008-01-01

Concern exists regarding the real possibility of public health threats caused by pathogenic agents that are carried by urban ants. The present study had the objective of isolating and identifying the microorganisms that are associated with ants in hospital environments. One hundred and twenty-five ants of the same species were collected from different units of a university hospital. Each ant was collected using a swab soaked with physiological solution and was transferred to a tube containing brain heart infusion broth and incubated at 35 degrees C for 24 hours. From each tube, with growth, inoculations were made into specific culturing media, to isolate any microorganisms. The ants presented a high capacity for carrying microorganism groups: spore-producing Gram-positive bacilli 63.5%, Gram-negative bacilli 6.3%, Gram-positive cocci 23.1%, filamentous fungi 6.7% and yeast 0.5%. Thus, it can be inferred that ants may be one of the agents responsible for disseminating microorganisms in hospital environments.

RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

Science.gov (United States)

Lei, Mei G; Lee, Chia Y

2015-12-01

Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

Cuando dialogan dos Antígonas: La tumba de Antígona de María Zambrano y Antígona furiosa de Griselda Gambaro

Directory of Open Access Journals (Sweden)

Rose Duroux

2012-08-01

Full Text Available Antígona ha sido un tópico por más de 2.000 años, participando de una historia que siempre puede ser reconocida. Tanto la Guerra Civil española como la dictadura argentina vieron surgir Antígonas en busca de justicia. A partir de los trabajos de María Zambrano y Griselda Gambaro, este artículo busca rehabilitar discursivamente estas versiones. Por un lado, la filósofa española nunca regresó del exilio iniciado en 1939 y defendió hasta el final los valores republicanos. Cuando asumió que su expatriación era irreversible, ingresó en un exilio profundo del cual Antígona revela lo esencial, pasando de la "privación" a la "revelación" tanto en un modo filosófico como en el poético, tanto en sus ensayos como en su única pieza teatral, La Tumba de Antígona [1967], una significativa metáfora de la guerra fratricida y del exilio. Por otro, Antígona furiosa [1986] de Gambaro, reescribe la tragedia de Sófocles cuando denuncia el terrorismo de estado argentino en una furiosa Antígona. Gambaro, hermana y madre de desaparecidos de la guerra sucia eleva su grito por justicia en nombre de la fraternidad humanaAntigone has been a topical figure for more than 2,000 years. She plays a part in a story that one can always identify. Spanish Civil War and Argentine dictatorship saw the birth of many Antigones seeking justice. Starting from the M. Zambrano and G. Gambaro's creations, this work rehabilitates the speech and the incarnations of the Iberian and Ibero-american Antigone. On the one hand, Spanish philosopher María Zambrano never came out of the exodus which began in 1939, and she defended the values of the Republic all the way. Once she acknowledged that expatriation was irreversible, she entered a profound exile of which Antigone reveals the essence, going from "deprivation" to "revelation" in a philosophical as well as a poetical manner, both in her essays and in her unique play, La Tumba de Antígona [1967], a striking metaphor

A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

Directory of Open Access Journals (Sweden)

Enrico eMuhr

2016-01-01

Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

Predaceous ants, beach replenishment, and nest placement by sea turtles.

Science.gov (United States)

Wetterer, James K; Wood, Lawrence D; Johnson, Chris; Krahe, Holly; Fitchett, Stephanie

2007-10-01

Ants known for attacking and killing hatchling birds and reptiles include the red imported fire ant (Solenopsis invicta Buren), tropical fire ant [Solenopsis geminata (Fabr.)], and little fire ant [Wasmannia auropunctata (Roger)]. We tested whether sea turtle nest placement influenced exposure to predaceous ants. In 2000 and 2001, we surveyed ants along a Florida beach where green turtles (Chelonia mydas L.), leatherbacks (Dermochelys coriacea Vandelli), and loggerheads (Caretta caretta L.) nest. Part of the beach was artificially replenished between our two surveys. As a result, mean beach width experienced by nesting turtles differed greatly between the two nesting seasons. We surveyed 1,548 sea turtle nests (2000: 909 nests; 2001: 639 nests) and found 22 ant species. S. invicta was by far the most common species (on 431 nests); S. geminata and W. auropunctata were uncommon (on 3 and 16 nests, respectively). In 2000, 62.5% of nests had ants present (35.9% with S. invicta), but in 2001, only 30.5% of the nests had ants present (16.4% with S. invicta). Turtle nests closer to dune vegetation had significantly greater exposure to ants. Differences in ant presence on turtle nests between years and among turtle species were closely related to differences in nest placement relative to dune vegetation. Beach replenishment significantly lowered exposure of nests to ants because on the wider beaches turtles nested farther from the dune vegetation. Selective pressures on nesting sea turtles are altered both by the presence of predaceous ants and the practice of beach replenishment.

Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

DEFF Research Database (Denmark)

Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

2015-01-01

Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

Directory of Open Access Journals (Sweden)

Alexander William Eastman

2015-01-01

Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

Studies on the environmental implications of ants (Hymenoptera ...

African Journals Online (AJOL)

A study of ants associated wh two synanthropcenvironments in Awka was carried out in 2008 using pitfall and bait traps. The study yelded a total of 561 ants wth 409 obtaned from the hemisynanthrophic environment while 192 ants were collected from the endophilic environment. The percentage occurrence, total dstribution ...

Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

Science.gov (United States)

Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

2016-11-08

Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

Tracing the rise of ants - out of the ground.

Directory of Open Access Journals (Sweden)

Andrea Lucky

Full Text Available The evolution of ants (Hymenoptera: Formicidae is increasingly well-understood due to recent phylogenetic analyses, along with estimates of divergence times and diversification rates. Yet, leading hypotheses regarding the ancestral habitat of ants conflict with new findings that early ant lineages are cryptic and subterranean. Where the ants evolved, in respect to habitat, and how habitat shifts took place over time have not been formally tested. Here, we reconstruct the habitat transitions of crown-group ants through time, focusing on where they nest and forage (in the canopy, litter, or soil. Based on ancestral character reconstructions, we show that in contrast to the current consensus based on verbal arguments that ants evolved in tropical leaf litter, the soil is supported as the ancestral stratum of all ants. We also find subsequent movements up into the litter and, in some cases, into the canopy. Given the global importance of ants, because of their diversity, ecological influence and status as the most successful eusocial lineage on Earth, understanding the early evolution of this lineage provides insight into the factors that made this group so successful today.

Insecticide transfer efficiency and lethal load in Argentine ants

Energy Technology Data Exchange (ETDEWEB)

Hooper-Bui, L.M. [Department of Environmental Science, Louisiana State University, Baton Rouge, LA 70803 (United States); Department of Entomology, University of California, Riverside, CA 92521 (United States); Kwok, E.S.C. [Department of Cell Biology and Neuroscience, University of California, Riverside, CA 92521 (United States); Buchholz, B.A., E-mail: buchholz2@llnl.gov [Center for Accelerator Mass Spectrometry, Lawrence Livermore National Laboratory, Livermore, CA 94551 (United States); Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States); Rust, M.K. [Department of Entomology, University of California, Riverside, CA 92521 (United States); Eastmond, D.A. [Department of Cell Biology and Neuroscience, University of California, Riverside, CA 92521 (United States); Vogel, J.S. [Center for Accelerator Mass Spectrometry, Lawrence Livermore National Laboratory, Livermore, CA 94551 (United States)

2015-10-15

Trophallaxis between individual worker ants and the toxicant load in dead and live Argentine ants (Linepithema humile) in colonies exposed to fipronil and hydramethylnon experimental baits were examined using accelerator mass spectrometry (AMS). About 50% of the content of the crop containing trace levels of {sup 14}C-sucrose, {sup 14}C-hydramethylnon, and {sup 14}C-fipronil was shared between single donor and recipient ants. Dead workers and queens contained significantly more hydramethylnon (122.7 and 22.4 amol/μg ant, respectively) than did live workers and queens (96.3 and 10.4 amol/μg ant, respectively). Dead workers had significantly more fipronil (420.3 amol/μg ant) than did live workers (208.5 amol/μg ant), but dead and live queens had equal fipronil levels (59.5 and 54.3 amol/μg ant, respectively). The distribution of fipronil differed within the bodies of dead and live queens; the highest amounts of fipronil were recovered in the thorax of dead queens whereas live queens had the highest levels in the head. Resurgence of polygynous ant colonies treated with hydramethylnon baits may be explained by queen survival resulting from sublethal doses due to a slowing of trophallaxis throughout the colony. Bait strategies and dose levels for controlling insect pests need to be based on the specific toxicant properties and trophic strategies for targeting the entire colony.

Insecticide transfer efficiency and lethal load in Argentine ants

International Nuclear Information System (INIS)

Hooper-Bui, L.M.; Kwok, E.S.C.; Buchholz, B.A.; Rust, M.K.; Eastmond, D.A.; Vogel, J.S.

2015-01-01

Trophallaxis between individual worker ants and the toxicant load in dead and live Argentine ants (Linepithema humile) in colonies exposed to fipronil and hydramethylnon experimental baits were examined using accelerator mass spectrometry (AMS). About 50% of the content of the crop containing trace levels of 14 C-sucrose, 14 C-hydramethylnon, and 14 C-fipronil was shared between single donor and recipient ants. Dead workers and queens contained significantly more hydramethylnon (122.7 and 22.4 amol/μg ant, respectively) than did live workers and queens (96.3 and 10.4 amol/μg ant, respectively). Dead workers had significantly more fipronil (420.3 amol/μg ant) than did live workers (208.5 amol/μg ant), but dead and live queens had equal fipronil levels (59.5 and 54.3 amol/μg ant, respectively). The distribution of fipronil differed within the bodies of dead and live queens; the highest amounts of fipronil were recovered in the thorax of dead queens whereas live queens had the highest levels in the head. Resurgence of polygynous ant colonies treated with hydramethylnon baits may be explained by queen survival resulting from sublethal doses due to a slowing of trophallaxis throughout the colony. Bait strategies and dose levels for controlling insect pests need to be based on the specific toxicant properties and trophic strategies for targeting the entire colony.

The Pied Piper: A Parasitic Beetle's Melodies Modulate Ant Behaviours.

Directory of Open Access Journals (Sweden)

Andrea Di Giulio

Full Text Available Ants use various communication channels to regulate their social organisation. The main channel that drives almost all the ants' activities and behaviours is the chemical one, but it is long acknowledged that the acoustic channel also plays an important role. However, very little is known regarding exploitation of the acoustical channel by myrmecophile parasites to infiltrate the ant society. Among social parasites, the ant nest beetles (Paussus are obligate myrmecophiles able to move throughout the colony at will and prey on the ants, surprisingly never eliciting aggression from the colonies. It has been recently postulated that stridulatory organs in Paussus might be evolved as an acoustic mechanism to interact with ants. Here, we survey the role of acoustic signals employed in the Paussus beetle-Pheidole ant system. Ants parasitised by Paussus beetles produce caste-specific stridulations. We found that Paussus can "speak" three different "languages", each similar to sounds produced by different ant castes (workers, soldiers, queen. Playback experiments were used to test how host ants respond to the sounds emitted by Paussus. Our data suggest that, by mimicking the stridulations of the queen, Paussus is able to dupe the workers of its host and to be treated as royalty. This is the first report of acoustic mimicry in a beetle parasite of ants.

Ant species confer different partner benefits on two neotropical myrmecophytes.

Science.gov (United States)

Frederickson, Megan E

2005-04-01

The dynamics of mutualistic interactions involving more than a single pair of species depend on the relative costs and benefits of interaction among alternative partners. The neotropical myrmecophytes Cordia nodosa and Duroia hirsuta associate with several species of obligately symbiotic ants. I compared the ant partners of Cordia and Duroia with respect to two benefits known to be important in ant-myrmecophyte interactions: protection against herbivores provided by ants, and protection against encroaching vegetation provided by ants. Azteca spp., Myrmelachista schumanni, and Allomerus octoarticulatus demerarae ants all provide the leaves of Cordia and Duroia some protection against herbivores. However, Azteca and Allomerus provide more protection than does Myrmelachista to the leaves of their host plants. Although Allomerus protects the leaves of its hosts, plants occupied by Allomerus suffer more attacks by herbivores to their stems than do plants occupied by other ants. Relative to Azteca or Allomerus, Myrmelachista ants provide better protection against encroaching vegetation, increasing canopy openness over their host plants. These differences in benefits among the ant partners of Cordia and Duroia are reflected in the effect of each ant species on host plant size, growth rate, and reproduction. The results of this study show how mutualistic ant partners can differ with respect to both the magnitude and type of benefits they provide to the same species of myrmecophytic host.

Life-Histories of Sub-Arctic Ants

OpenAIRE

Heinze, Jürgen

1993-01-01

Ant species belonging to seven genera occur in habitats near the tree line in the Northern Hemisphere. An analysis of colony founding strategies suggests that in addition to physiological cold resistance, behavioral and sociometric adaptations might be important for survival and propagation of ants in subarctic biomes.

Edge detection in digital images using Ant Colony Optimization

Directory of Open Access Journals (Sweden)

Marjan Kuchaki Rafsanjani

2015-11-01

Full Text Available Ant Colony Optimization (ACO is an optimization algorithm inspired by the behavior of real ant colonies to approximate the solutions of difficult optimization problems. In this paper, ACO is introduced to tackle the image edge detection problem. The proposed approach is based on the distribution of ants on an image; ants try to find possible edges by using a state transition function. Experimental results show that the proposed method compared to standard edge detectors is less sensitive to Gaussian noise and gives finer details and thinner edges when compared to earlier ant-based approaches.

An encoding device and a method of encoding

DEFF Research Database (Denmark)

2012-01-01

The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....

Stealthy invaders: the biology of Cardiocondyla tramp ants

DEFF Research Database (Denmark)

Heinze, J.; Cremer, Sylvia; Eckl, N.

2006-01-01

Many invasive ant species, such as the Argentine ant or the red imported fire ant, have huge colonies with thousands of mass-foraging workers, which quickly monopolise resources and therefore represent a considerable threat to the native ant fauna. Cardiocondyla obscurior and several other specie...

The AINTEGUMENTA genes, MdANT1 and MdANT2, are associated with the regulation of cell production during fruit growth in apple (Malus × domestica Borkh.).

Science.gov (United States)

Dash, Madhumita; Malladi, Anish

2012-06-25

Fruit growth in apple (Malus × domestica Borkh.) is mediated by cell production and expansion. Genes involved in regulating these processes and thereby fruit growth, are not well characterized. We hypothesized that the apple homolog(s) of AINTEGUMENTA (ANT), an APETALA2-repeat containing transcription factor, regulates cell production during fruit growth in apple. Two ANT genes, MdANT1 and MdANT2, were isolated from apple and their expression was studied during multiple stages of fruit development. MdANT1 and MdANT2 expression was high during early fruit growth coincident with the period of cell production, rapidly declined during exit from cell production, and remained low during the rest of fruit development. The effects of increase in carbohydrate availability during fruit growth were characterized. Increase in carbohydrate availability enhanced fruit growth largely through an increase in cell production. Expression of MdANT1 and MdANT2 increased sharply by up to around 5-fold in response to an increase in carbohydrate availability. Expression of the ANT genes was compared across two apple genotypes, 'Gala' and 'Golden Delicious Smoothee' (GS), which differ in the extent of fruit growth, largely due to differences in cell production. In comparison to 'Gala', the larger fruit-size genotype, GS, displayed higher levels and a longer duration of MdANT1 and MdANT2 expression. Expression of the ANTs and cell cycle genes in the fruit core and cortex tissues isolated using laser capture microdissection was studied. During early fruit growth, expression of the MdANTs was higher within the cortex, the tissue that constitutes the majority of the fruit. Additionally, MdANT1 and MdANT2 expression was positively correlated with that of A- and B-type CYCLINS, B-type CYCLIN-DEPENDENT-KINASES (CDKBs) and MdDEL1. Multiple lines of evidence from this study suggest that MdANT1 and MdANT2 regulate cell production during fruit growth in apple. ANTs may coordinate the expression of

Current issues in the evolutionary ecology of ant-plant symbioses.

Science.gov (United States)

Mayer, Veronika E; Frederickson, Megan E; McKey, Doyle; Blatrix, Rumsaïs

2014-05-01

Ant-plant symbioses involve plants that provide hollow structures specialized for housing ants and often food to ants. In return, the inhabiting ants protect plants against herbivores and sometimes provide them with nutrients. Here, we review recent advances in ant-plant symbioses, focusing on three areas. First, the nutritional ecology of plant-ants, which is based not only on plant-derived food rewards, but also on inputs from other symbiotic partners, in particular fungi and possibly bacteria. Food and protection are the most important 'currencies' exchanged between partners and they drive the nature and evolution of the relationships. Secondly, studies of conflict and cooperation in ant-plant symbioses have contributed key insights into the evolution and maintenance of mutualism, particularly how partner-mediated feedbacks affect the specificity and stability of mutualisms. There is little evidence that mutualistic ants or plants are under selection to cheat, but the costs and benefits of ant-plant interactions do vary with environmental factors, making them vulnerable to natural or anthropogenic environmental change. Thus, thirdly, ant-plant symbioses should be considered good models for investigating the effects of global change on the outcome of mutualistic interactions. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

trans-Acting Virulence Functions of the Octopine Ti Plasmid from Agrobacterium tumefaciens

NARCIS (Netherlands)

Hille, Jacques; Kan, Jan van; Schilperoort, Rob

1984-01-01

All Ti plasmid-encoded virulence functions that were studied act in trans. An octopine Ti plasmid-specific vir operon, called vir-O, located on an EcoRI restriction fragment has been characterized. Sequences with promoter activity in Escherichia coli were identified for a second vir operon, called

The use of weaver ants (Oecophylla spp.) in tropical agriculture

DEFF Research Database (Denmark)

Offenberg, Hans Joachim

2011-01-01

by the consumed pest insects, can be harvested and utilised for nutrition as they are tasty and high in proteins, vitamins and minerals. Thus, plantations may function as ant farms and in addition to plant production also hosts the production of edible animal protein. In this setup harmful pest insects are turned...... farming as a way forward to solve an increasing future demand for protein. Weaver ant farming may build on natural food collected by the ants or alternatively be boosted by feeding the ant colonies actively with protein and sugar. In both cases, when ant biocontrol is combined with ant farming......, the environmental cost of protein production may fall even lower than for other insects as the ants feed on pests that would otherwise reduce the plant yield and since the farming area is simultaneously in use for plant production. In this presentation I provide data showing (i) how the harvest of ants can...

Toxic industrial deposit remediation by ant activity

Science.gov (United States)

Jilkova, Veronika; Frouz, Jan

2016-04-01

Toxic industrial deposits are often contaminated by heavy metals and the substrates have low pH values. In such systems, soil development is thus slowed down by high toxicity and acidic conditions which are unfavourable to soil fauna. Ants (Hymenoptera, Formicidae) are considered tolerant to heavy metal pollution and are known to increase organic matter content and microbial activity in their nests. Here, we focused on soil remediation caused by three ant species (Formica sanguinea, Lasius niger, and Tetramorium sp.) in an ore-washery sedimentation basin near Chvaletice (Czech Republic). Soil samples were taken from the centre of ant nests and from the nest surroundings (>3 m from nests). Samples were then analyzed for microbial activity and biomass and contents of organic matter and nutrients. As a result, ant species that most influenced soil properties was F. sanguinea as there were higher microbial activity and total nitrogen and ammonia contents in ant nests than in the surrounding soil. We expected such a result because F. sanguinea builds conspicuous large nests and is a carnivorous species that brings substantial amounts of nitrogen in insect prey to their nests. Effects of the other two ant species might be lower because of smaller nests and different feeding habits as they rely mainly on honeydew from aphids or on plant seeds that do not contain much nutrients.

Heat-induced symmetry breaking in ant (Hymenoptera: Formicidae escape behavior.

Directory of Open Access Journals (Sweden)

Yuan-Kai Chung

Full Text Available The collective egress of social insects is important in dangerous situations such as natural disasters or enemy attacks. Some studies have described the phenomenon of symmetry breaking in ants, with two exits induced by a repellent. However, whether symmetry breaking occurs under high temperature conditions, which are a common abiotic stress, remains unknown. In our study, we deposited a group of Polyrhachis dives ants on a heated platform and counted the number of escaping ants with two identical exits. We discovered that ants asymmetrically escaped through two exits when the temperature of the heated platform was >32.75°C. The degree of asymmetry increased linearly with the temperature of the platform. Furthermore, the higher the temperature of heated platform was, the more ants escaped from the heated platform. However, the number of escaping ants decreased for 3 min when the temperature was higher than the critical thermal limit (39.46°C, which is the threshold for ants to endure high temperature without a loss of performance. Moreover, the ants tended to form small groups to escape from the thermal stress. A preparatory formation of ant grouping was observed before they reached the exit, indicating that the ants actively clustered rather than accidentally gathered at the exits to escape. We suggest that a combination of individual and grouping ants may help to optimize the likelihood of survival during evacuation.

Ants Orasest ja Anne Lange monograafiast / Jüri Talvet

Index Scriptorium Estoniae

Talvet, Jüri, 1945-

2005-01-01

Arvustus: Oras, Ants. Luulekool. I, Apoloogia / koostajad Hando Runnel ja Jaak Rähesoo. Tartu : Ilmamaa, 2003 ; Oras, Ants. Luulekool II, Meistriklass. Tartu : Ilmamaa, 2004 ; Lange, Anne. Ants Oras : [kirjandusteadlane, -kriitik ja tõlkija (1900-1982)]. Tartu : Ilmamaa, 2004

Ant tending influences soldier production in a social aphid.

Science.gov (United States)

Shingleton, A W; Foster, W A

2000-09-22

The aphid Pseudoregma sundanica (Van der Goot) (Homoptera: Aphididae) has two defence strategies. It is obligatorily tended by various species of ant and also produces sterile soldiers. We investigated how they allocate their investment in these two strategies. We measured the size, number of soldiers, number and species of tending ant, and number and species of predators in P. sundanica populations. We found that the level of ant tending correlated negatively with soldier investment in P. sundanica. The species of tending ant also influenced soldier investment. We excluded ants from aphid populations and recorded changes in population size and structure over four weeks. Ant exclusion led to population decline and extinction. At the same time, surviving populations showed a significant increase in soldier investment. The data demonstrate that social aphids can adjust their investment in soldiers in direct response to environmental change.

Do herbivores eavesdrop on ant chemical communication to avoid predation?

Directory of Open Access Journals (Sweden)

David J Gonthier

Full Text Available Strong effects of predator chemical cues on prey are common in aquatic and marine ecosystems, but are thought to be rare in terrestrial systems and specifically for arthropods. For ants, herbivores are hypothesized to eavesdrop on ant chemical communication and thereby avoid predation or confrontation. Here I tested the effect of ant chemical cues on herbivore choice and herbivory. Using Margaridisa sp. flea beetles and leaves from the host tree (Conostegia xalapensis, I performed paired-leaf choice feeding experiments. Coating leaves with crushed ant liquids (Azteca instabilis, exposing leaves to ant patrolling prior to choice tests (A. instabilis and Camponotus textor and comparing leaves from trees with and without A. instabilis nests resulted in more herbivores and herbivory on control (no ant-treatment relative to ant-treatment leaves. In contrast to A. instabilis and C. textor, leaves previously patrolled by Solenopsis geminata had no difference in beetle number and damage compared to control leaves. Altering the time A. instabilis patrolled treatment leaves prior to choice tests (0-, 5-, 30-, 90-, 180-min. revealed treatment effects were only statistically significant after 90- and 180-min. of prior leaf exposure. This study suggests, for two ecologically important and taxonomically diverse genera (Azteca and Camponotus, ant chemical cues have important effects on herbivores and that these effects may be widespread across the ant family. It suggests that the effect of chemical cues on herbivores may only appear after substantial previous ant activity has occurred on plant tissues. Furthermore, it supports the hypothesis that herbivores use ant chemical communication to avoid predation or confrontation with ants.

Consuming fire ants reduces northern bobwhite survival and weight gain

Science.gov (United States)

Myers, P.E.; Allen, Craig R.; Birge, Hannah E.

2014-01-01

Northern bobwhite quail, Colinus virginianus (L.) (Galliformes: Odontophoridae), population declines are well documented, but pinpointing the reasons for these decreases has proven elusive. Bobwhite population declines are attributed primarily to loss of habitat and land use changes. This, however, does not entirely explain population declines in areas intensively managed for bobwhites. Although previous research demonstrates the negative impact of red imported fire ant (Solenopsis invicta Buren) (Hymenoptera: Formicidae) on northern bobwhites, the mechanisms underlying this effect are largely unknown. To meet the protein demands of early growth and development, bobwhite chicks predominantly consume small insects, of which ants are a substantial proportion. Fire ants alter ant community dynamics by often reducing native ant diversity and abundance while concurrently increasing the abundance of individuals. Fire ants have negative effects on chicks, but they are also a large potential protein source, making it difficult to disentangle their net effect on bobwhite chicks. To help investigate these effects, we conducted a laboratory experiment to understand (1) whether or not bobwhites consume fire ants, and (2) how the benefits of this consumption compare to the deleterious impacts of bobwhite chick exposure to fire ants. Sixty bobwhite chicks were separated into two groups of 30; one group was provided with starter feed only and the second group was provided with feed and fire ants. Bobwhite chicks were observed feeding on fire ants. Chicks that fed on fire ants had reduced survival and weight gain. Our results show that, while fire ants increase potential food sources for northern bobwhite, their net effect on bobwhite chicks is deleterious. This information will help inform land managers and commercial bobwhite rearing operations.

Extended phenotype: nematodes turn ants into bird-dispersed fruits

DEFF Research Database (Denmark)

Hughes, D P; Kronauer, D J C; Boomsma, J J

2008-01-01

A recent study has discovered a novel extended phenotype of a nematode which alters its ant host to resemble ripe fruit. The infected ants are in turn eaten by frugivorous birds that disperse the nematode's eggs.......A recent study has discovered a novel extended phenotype of a nematode which alters its ant host to resemble ripe fruit. The infected ants are in turn eaten by frugivorous birds that disperse the nematode's eggs....

Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

Directory of Open Access Journals (Sweden)

Astha Agarwal

2013-01-01

Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

Fungal enzymes in the attine ant symbiosis

DEFF Research Database (Denmark)

de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan

the more basal attine genera use substrates such as flowers, plant debris, small twigs, insect feces and insect carcasses. This diverse array of fungal substrates across the attine lineage implies that the symbiotic fungus needs different enzymes to break down the plant material that the ants provide...... or different efficiencies of enzyme function. Fungal enzymes that degrade plant cell walls may have functionally co-evolved with the ants in this scenario. We explore this hypothesis with direct measurements of enzyme activity in fungus gardens in 12 species across 8 genera spanning the entire phylogeny...... and diversity of life-styles within the attine clade. We find significant differences in enzyme activity between different genera and life-styles of the ants. How these findings relate to attine ant coevolution and crop optimization are discussed....

The invasive ant, Solenopsis invicta, reduces herpetofauna richness and abundance

Science.gov (United States)

Allen, Craig R.; Birge, Hannah E.; Slater, J.; Wiggers, E.

2017-01-01

Amphibians and reptiles are declining globally. One potential cause of this decline includes impacts resulting from co-occurrence with non-native red imported fire ant, Solenopsis invicta. Although a growing body of anecdotal and observational evidence from laboratory experiments supports this hypothesis, there remains a lack of field scale manipulations testing the effect of fire ants on reptile and amphibian communities. We addressed this gap by measuring reptile and amphibian (“herpetofauna”) community response to successful fire ant reductions over the course of 2 years following hydramethylnon application to five 100–200 ha plots in southeastern coastal South Carolina. By assessing changes in relative abundance and species richness of herpetofauna in response to fire ant reductions, we were able to assess whether some species were particularly vulnerable to fire ant presence, and whether this sensitivity manifested at the community level. We found that herpetofauna abundance and species richness responded positively to fire ant reductions. Our results document that even moderate populations of red imported fire ants decrease both the abundance and diversity of herpetofauna. Given global herpetofauna population declines and continued spread of fire ants, there is urgency to understand the impacts of fire ants beyond anecdotal and singles species studies. Our results provides the first community level investigation addressing these dynamics, by manipulating fire ant abundance to reveal a response in herpetofauna species abundance and richness.

The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence.

Science.gov (United States)

Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier

2014-01-01

The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

Red imported fire ant impacts on upland arthropods in Southern Mississippi

Science.gov (United States)

Epperson, D.M.; Allen, Craig R.

2010-01-01

Red imported fire ants (Solenopsis invicta) have negative impacts on a broad array of invertebrate species. We investigated the impacts of fire ants on the upland arthropod community on 20???40 ha study sites in southern Mississippi. Study sites were sampled from 19972000 before, during, and after fire ant bait treatments to reduce fire ant populations. Fire ant abundance was assessed with bait transects on all sites, and fire ant population indices were estimated on a subset of study sites. Species richness and diversity of other ant species was also assessed from bait transects. Insect biomass and diversity was determined from light trap samples. Following treatments, fire ant abundance and population indices were significantly reduced, and ant species diversity and richness were greater on treated sites. Arthropod biomass, species diversity and species richness estimated from light trap samples were negatively correlated with fire ant abundance, but there were no observable treatment effects. Solenopsis invicta has the potential to negatively impact native arthropod communities resulting in a potential loss of both species and function.

Host ant independent oviposition in the parasitic butterfly Maculinea alcon

DEFF Research Database (Denmark)

Fürst, Matthias A; Nash, David Richard

2010-01-01

to host-ant nests and non-host-ant nests, and the number and position of eggs attached were assessed. Our results show no evidence for host-ant-based oviposition in M. alcon, but support an oviposition strategy based on plant characteristics. This suggests that careful management of host-ant distribution......Parasitic Maculinea alcon butterflies can only develop in nests of a subset of available Myrmica ant species, so female butterflies have been hypothesized to preferentially lay eggs on plants close to colonies of the correct host ants. Previous correlational investigations of host......-ant-dependent oviposition in this and other Maculinea species have, however, shown equivocal results, leading to a long-term controversy over support for this hypothesis. We therefore conducted a controlled field experiment to study the egg-laying behaviour of M. alcon. Matched potted Gentiana plants were set out close...

Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z▿ †

OpenAIRE

Mustakhimov, Ildar I.; Reshetnikov, Alexander S.; Glukhov, Anatoly S.; Khmelenina, Valentina N.; Kalyuzhnaya, Marina G.; Trotsenko, Yuri A.

2009-01-01

Genes encoding key enzymes of the ectoine biosynthesis pathway in the halotolerant obligate methanotroph Methylomicrobium alcaliphilum 20Z have been shown to be organized into an ectABC-ask operon. Transcription of the ect operon is initiated from two promoters, ectAp1 and ectAp2 (ectAp1p2), similar to the σ70-dependent promoters of Escherichia coli. Upstream of the gene cluster, an open reading frame (ectR1) encoding a MarR-like transcriptional regulator was identified. Investigation of the ...

What do myrmecophagous geckos eat when ants are not available ...

African Journals Online (AJOL)

Like other Pristurus species, P. samhaensis on Samha and P. sokotranus on Socotra were highly myrmecophagous (76.7% and 38.6% ants, respectively). However, ants were absent from the diet of P. samhaensis on Darsa. In contrast to the rich native ant fauna of the other islands, only one ant species was reported for ...

Signals can trump rewards in attracting seed-dispersing ants.

Directory of Open Access Journals (Sweden)

Kyle M Turner

Full Text Available Both rewards and signals are important in mutualisms. In myrmecochory, or seed dispersal by ants, the benefits to plants are relatively well studied, but less is known about why ants pick up and move seeds. We examined seed dispersal by the ant Aphaenogaster rudis of four co-occurring species of plants, and tested whether morphology, chemical signaling, or the nutritional quality of fatty seed appendages called elaiosomes influenced dispersal rates. In removal trials, ants quickly collected diaspores (seeds plus elaiosomes of Asarum canadense, Trillium grandiflorum, and Sanguinaria canadensis, but largely neglected those of T. erectum. This discrepancy was not explained by differences in the bulk cost-benefit ratio, as assessed by the ratio of seed to elaiosome mass. We also provisioned colonies with diaspores from one of these four plant species or no diaspores as a control. Colonies performed best when fed S. canadensis diaspores, worst when fed T. grandiflorum, and intermediately when fed A. canadense, T. erectum, or no diaspores. Thus, the nutritional rewards in elaiosomes affected colony performance, but did not completely predict seed removal. Instead, high levels of oleic acid in T. grandiflorum elaiosomes may explain why ants disperse these diaspores even though they reduce ant colony performance. We show for the first time that different elaiosome-bearing plants provide rewards of different quality to ant colonies, but also that ants appear unable to accurately assess reward quality when encountering seeds. Instead, we suggest that signals can trump rewards as attractants of ants to seeds.

Fuzzy Rules for Ant Based Clustering Algorithm

Directory of Open Access Journals (Sweden)

Amira Hamdi

2016-01-01

Full Text Available This paper provides a new intelligent technique for semisupervised data clustering problem that combines the Ant System (AS algorithm with the fuzzy c-means (FCM clustering algorithm. Our proposed approach, called F-ASClass algorithm, is a distributed algorithm inspired by foraging behavior observed in ant colonyT. The ability of ants to find the shortest path forms the basis of our proposed approach. In the first step, several colonies of cooperating entities, called artificial ants, are used to find shortest paths in a complete graph that we called graph-data. The number of colonies used in F-ASClass is equal to the number of clusters in dataset. Hence, the partition matrix of dataset founded by artificial ants is given in the second step, to the fuzzy c-means technique in order to assign unclassified objects generated in the first step. The proposed approach is tested on artificial and real datasets, and its performance is compared with those of K-means, K-medoid, and FCM algorithms. Experimental section shows that F-ASClass performs better according to the error rate classification, accuracy, and separation index.

The direct and ecological costs of an ant-plant symbiosis.

Science.gov (United States)

Frederickson, Megan E; Ravenscraft, Alison; Miller, Gabriel A; Arcila Hernández, Lina M; Booth, Gregory; Pierce, Naomi E

2012-06-01

How strong is selection for cheating in mutualisms? The answer depends on the type and magnitude of the costs of the mutualism. Here we investigated the direct and ecological costs of plant defense by ants in the association between Cordia nodosa, a myrmecophytic plant, and Allomerus octoarticulatus, a phytoecious ant. Cordia nodosa trees produce food and housing to reward ants that protect them against herbivores. For nearly 1 year, we manipulated the presence of A. octoarticulatus ants and most insect herbivores on C. nodosa in a full-factorial experiment. Ants increased plant growth when herbivores were present but decreased plant growth when herbivores were absent, indicating that hosting ants can be costly to plants. However, we did not detect a cost to ant colonies of defending host plants against herbivores. Although this asymmetry in costs suggests that the plants may be under stronger selection than the ants to cheat by withholding investment in their partner, the costs to C. nodosa are probably at least partly ecological, arising because ants tend scale insects on their host plants. We argue that ecological costs should favor resistance or traits other than cheating and thus that neither partner may face much temptation to cheat.

Competitive assembly of South Pacific invasive ant communities

Directory of Open Access Journals (Sweden)

Sarty Megan

2009-01-01

Full Text Available Abstract Background The relative importance of chance and determinism in structuring ecological communities has been debated for nearly a century. Evidence for determinism or assembly rules is often evaluated with null models that randomize the occurrence of species in particular locales. However, analyses of the presence or absence of species ignores the potential influence of species abundances, which have long been considered of major importance on community structure. Here, we test for community assembly rules in ant communities on small islands of the Tokelau archipelago using both presence-absence and abundance data. We conducted three sets of analyses on two spatial scales using three years of sampling data from 39 plots on 11 islands. Results First, traditional null model tests showed support for negative species co-occurrence patterns among plots within islands, but not among islands. A plausible explanation for this result is that analyses at larger spatial scales merge heterogeneous habitats that have considerable effects on species occurrences. Second, analyses of ant abundances showed that samples with high ant abundances had fewer species than expected by chance, both within and among islands. One ant species, the invasive yellow crazy ant Anoplolepis gracilipes, appeared to have a particularly strong effect on community structure correlated with its abundance. Third, abundances of most ant species were inversely correlated with the abundances of all other ants at both spatial scales. This result is consistent with competition theory, which predicts species distributions are affected by diffuse competition with suites of co-occurring species. Conclusion Our results support a pluralistic explanation for ant species abundances and assembly. Both stochastic and deterministic processes interact to determine ant community assembly, though abundance patterns clearly drive the deterministic patterns in this community. These deterministic

Exploring with PAM: Prospecting ANTS Missions for Solar System Surveys

Science.gov (United States)

Clark, P. E.; Rilee, M. L.; Curtis, S. A.

2003-01-01

ANTS (Autonomous Nano-Technology Swarm), a large (1000 member) swarm of nano to picoclass (10 to 1 kg) totally autonomous spacecraft, are being developed as a NASA advanced mission concept. ANTS, based on a hierarchical insect social order, use an evolvable, self-similar, hierarchical neural system in which individual spacecraft represent the highest level nodes. ANTS uses swarm intelligence attained through collective, cooperative interactions of the nodes at all levels of the system. At the highest levels this can take the form of cooperative, collective behavior among the individual spacecraft in a very large constellation. The ANTS neural architecture is designed for totally autonomous operation of complex systems including spacecraft constellations. The ANTS (Autonomous Nano Technology Swarm) concept has a number of possible applications. A version of ANTS designed for surveying and determining the resource potential of the asteroid belt, called PAM (Prospecting ANTS Mission), is examined here.

A picorna-like virus from the red imported fire ant, Solenopsis invicta: initial discovery, genome sequence, and characterization

International Nuclear Information System (INIS)

Valles, Steven M.; Strong, Charles A.; Dang, Phat M.; Hunter, Wayne B.; Pereira, Roberto M.; Oi, David H.; Shapiro, Alexandra M.; Williams, David F.

2004-01-01

We report the first discovery and genome sequence of a virus infecting the red imported fire ant, Solenopsis invicta. The 8026 nucleotide, polyadenylated, RNA genome encoded two large open reading frames (ORF1 and ORF2), flanked and separated by 27, 223, and 171 nucleotide untranslated regions, respectively. The predicted amino acid sequence of the 5' proximal ORF1 (nucleotides 28 to 4218) exhibited significant identity and possessed consensus sequences characteristic of the helicase, cysteine protease, and RNA-dependent RNA polymerase sequence motifs from picornaviruses, picorna-like viruses, comoviruses, caliciviruses, and sequiviruses. The predicted amino acid sequence of the 3' proximal ORF2 (nucleotides 4390-7803) showed similarity to structural proteins in picorna-like viruses, especially the acute bee paralysis virus. Electron microscopic examination of negatively stained samples from virus-infected fire ants revealed isometric particles with a diameter of 31 nm, consistent with Picornaviridae. A survey for the fire ant virus from areas around Florida revealed a pattern of fairly widespread distribution. Among 168 nests surveyed, 22.9% were infected. The virus was found to infect all fire ant caste members and developmental stages, including eggs, early (1st-2nd) and late (3rd-4th) instars, worker pupae, workers, sexual pupae, alates ( male and female ), and queens. The virus, tentatively named S. invicta virus (SINV-1), appears to belong to the picorna-like viruses. We did not observe any perceptible symptoms among infected nests in the field. However, in every case where an SINV-1-infected colony was excavated from the field with an inseminated queen and held in the laboratory, all of the brood in these colonies died within 3 months

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

Science.gov (United States)

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Species diversity and distribution patterns of the ants of Amazonian Ecuador.

Directory of Open Access Journals (Sweden)

Kari T Ryder Wilkie

2010-10-01

Full Text Available Ants are among the most diverse, abundant and ecologically significant organisms on earth. Although their species richness appears to be greatest in the New World tropics, global patterns of ant diversity and distribution are not well understood. We comprehensively surveyed ant diversity in a lowland primary rainforest in Western Amazonia, Ecuador using canopy fogging, pitfall traps, baits, hand collecting, mini-Winkler devices and subterranean probes to sample ants. A total of 489 ant species comprising 64 genera in nine subfamilies were identified from samples collected in only 0.16 square kilometers. The most species-rich genera were Camponotus, Pheidole, Pseudomyrmex, Pachycondyla, Brachymyrmex, and Crematogaster. Camponotus and Pseudomyrmex were most diverse in the canopy, while Pheidole was most diverse on the ground. The three most abundant ground-dwelling ant genera were Pheidole, Solenopsis and Pyramica. Crematogaster carinata was the most abundant ant species in the canopy; Wasmannia auropunctata was most abundant on the ground, and the army ant Labidus coecus was the most abundant subterranean species. Ant species composition among strata was significantly different: 80% of species were found in only one stratum, 17% in two strata, and 3% in all three strata. Elevation and the number of logs and twigs available as nest sites were significant predictors of ground-dwelling ant species richness. Canopy species richness was not correlated with any ecological variable measured. Subterranean species richness was negatively correlated with depth in the soil. When ant species were categorized using a functional group matrix based on diet, nest-site preference and foraging ecology, the greatest diversity was found in Omnivorous Canopy Nesters. Our study indicates ant species richness is exceptionally high at Tiputini. We project 647-736 ant species in this global hotspot of biodiversity. Considering the relatively small area surveyed, this

Egg-laying butterflies distinguish predaceous ants by sight.

Science.gov (United States)

Sendoya, Sebastián F; Freitas, André V L; Oliveira, Paulo S

2009-07-01

Information about predation risks is critical for herbivorous insects, and natural selection favors their ability to detect predators before oviposition and to select enemy-free foliage when offspring mortality risk is high. Food plants are selected by ovipositing butterflies, and offspring survival frequently varies among plants because of variation in the presence of predators. Eunica bechina butterflies oviposit on Caryocar brasiliense, an ant-defended plant. Experiments with dried Camponotus and Cephalotes ants pinned to leaves revealed that butterflies use ant size and form as visual cues to avoid ovipositing on plant parts occupied by ants more likely to kill larval offspring. Presence of sap-sucking bugs did not affect butterfly oviposition. This is the first demonstration that visual recognition of predators can mediate egg-laying decisions by an insect herbivore and that an insect will discriminate among different species of potential predators. This unusual behavioral capability permits specialization on a risky, ant-defended food plant.

Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

Science.gov (United States)

Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

2016-05-01

Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Protection of Vochysia elliptica (Vochysiaceae by a nectar-thieving ant

Directory of Open Access Journals (Sweden)

G. Q. ROMERO

Full Text Available Vochysia elliptica (Vochysiaceae is a shrubby plant, which does not have EFNs. Camponotus ants thieve nectar, and can decrease plant fitness by making flowers less attractive to pollinators. However, ants remove herbivores, wich can be beneficial. Results show that plants from which ants were excluded had lower rates of termite (simulated herbivore removal than did plants visited by ants. Plants accessible to ants showed higher rates of termite removal in the base of leaves and in the inflorescence, than in the tip of leaves. This occurs because ants must pass through the principal axis to reach the inflorescence. Conclusive results of this cost/benefit analysis of the Camponotus sp. presence for V. elliptica can be obtained, with experimental manipulations.

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

NARCIS (Netherlands)

Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

Benefits conferred by "timid" ants: active anti-herbivore protection of the rainforest tree Leonardoxa africana by the minute ant Petalomyrmex phylax.

Science.gov (United States)

Gaume, Laurence; McKey, Doyle; Anstett, Marie-Charlotte

1997-10-01

In this study, we demonstrate that an important benefit provided by the small host-specific ant Petalomyrmex phylax to its host plant Leonardoxa africana is efficient protection against herbivores. We estimate that in the absence of ants, insect herbivory would reduce the leaf area by about one-third. This contributes considerably to the fitness of the plant. Our estimates take into account not only direct damage, such as removal of leaf surface by chewing insects, but also the effects of sucking insects on leaf growth and expansion. Sucking insects are numerically predominant in this system, and the hitherto cryptic effects of ant protection against the growth-reducing effects of sucking insects accounted for half of the total estimated benefit of ant protection. We propose that the small size of workers confers a distinct advantage in this system. Assuming that resource limitation implies a trade off between size and number of ants, and given the small size of phytophagous insects that attack Leonardoxa, we conclude that fine-grained patrolling by a large number of small workers maximises protection of young leaves of this plant. Since herbivores are small and must complete their development on the young leaves of Leonardoxa, and since a high patrolling density is required for a fine-grained search for these enemies, numerous small ants should provide the most effective protection of young leaves of Leonardoxa. We also discuss other factors that may have influenced worker size in this ant.

Competence of Litter Ants for Rapid Biodiversity Assessments

Directory of Open Access Journals (Sweden)

T. H. Saumya E. Silva

2017-01-01

Full Text Available Rapid Biodiversity Assessment approaches associated with focusing taxa have overcome many of the problems related to large scale surveys. This study examined the suitability of litter ants as a focusing taxon by checking whether diversity and species assemblages of litter ants reflect the overall picture of arthropod diversity and assemblages in leaf litter in two vegetation types: secondary forest and pine plantation in Upper Hanthana forest reserve, Sri Lanka. In each vegetation type, arthropods were sampled using three sampling methods (Winkler extraction, hand collection, and pitfall traps along three 100 m line transects. From the two sites, 1887 litter ants (34 species and 3488 litter arthropods (52 species were collected. Species assemblages composition of both ants and other arthropods differed significantly between the two sites (ANOSIM, p=0.001 with both groups generating distinct clusters for the two sites (SIMPROF, p=0.001. But there was no significant correlation (p>0.05 between abundance and richness of litter ants and those of other arthropods in both vegetation types. The overall finding suggests that the litter ants do not reflect the holistic picture of arthropod diversity and assemblages in leaf litter, but the quality of the habitat for the survival of all litter arthropods.

Asymmetric dispersal and colonization success of Amazonian plant-ants queens.

Directory of Open Access Journals (Sweden)

Emilio M Bruna

Full Text Available The dispersal ability of queens is central to understanding ant life-history evolution, and plays a fundamental role in ant population and community dynamics, the maintenance of genetic diversity, and the spread of invasive ants. In tropical ecosystems, species from over 40 genera of ants establish colonies in the stems, hollow thorns, or leaf pouches of specialized plants. However, little is known about the relative dispersal ability of queens competing for access to the same host plants.We used empirical data and inverse modeling--a technique developed by plant ecologists to model seed dispersal--to quantify and compare the dispersal kernels of queens from three Amazonian ant species that compete for access to host-plants. We found that the modal colonization distance of queens varied 8-fold, with the generalist ant species (Crematogaster laevis having a greater modal distance than two specialists (Pheidole minutula, Azteca sp. that use the same host-plants. However, our results also suggest that queens of Azteca sp. have maximal distances that are four-sixteen times greater than those of its competitors.We found large differences between ant species in both the modal and maximal distance ant queens disperse to find vacant seedlings used to found new colonies. These differences could result from interspecific differences in queen body size, and hence wing musculature, or because queens differ in their ability to identify potential host plants while in flight. Our results provide support for one of the necessary conditions underlying several of the hypothesized mechanisms promoting coexistence in tropical plant-ants. They also suggest that for some ant species limited dispersal capability could pose a significant barrier to the rescue of populations in isolated forest fragments. Finally, we demonstrate that inverse models parameterized with field data are an excellent means of quantifying the dispersal of ant queens.

Disease dynamics in a specialized parasite of ant societies

DEFF Research Database (Denmark)

Andersen, Sandra Breum; Ferrari, Matthew; Evans, Harry C.

2012-01-01

Coevolution between ant colonies and their rare specialized parasites are intriguing, because lethal infections of workers may correspond to tolerable chronic diseases of colonies, but the parasite adaptations that allow stable coexistence with ants are virtually unknown. We explore the trade......-offs experienced by Ophiocordyceps parasites manipulating ants into dying in nearby graveyards. We used field data from Brazil and Thailand to parameterize and fit a model for the growth rate of graveyards. We show that parasite pressure is much lower than the abundance of ant cadavers suggests...

Density-dependent benefits in ant-hemipteran mutualism? The case of the ghost ant Tapinoma melanocephalum (Hymenoptera: Formicidae and the invasive mealybug Phenacoccus solenopsis (Hemiptera: Pseudococcidae.

Directory of Open Access Journals (Sweden)

Aiming Zhou

Full Text Available Although density-dependent benefits to hemipterans from ant tending have been measured many times, few studies have focused on integrated effects such as interactions between ant tending, natural enemy density, and hemipteran density. In this study, we tested whether the invasive mealybug Phenacoccus solenopsis is affected by tending by ghost ants (Tapinoma melanocephalum, the presence of parasitoids, mealybug density, parasitoid density and interactions among these factors. Our results showed that mealybug colony growth rate and percentage parasitism were significantly affected by ant tending, parasitoid presence, and initial mealybug density separately. However, there were no interactions among the independent factors. There were also no significant interactions between ant tending and parasitoid density on either mealybug colony growth rate or percentage parasitism. Mealybug colony growth rate showed a negative linear relationship with initial mealybug density but a positive linear relationship with the level of ant tending. These results suggest that benefits to mealybugs are density-independent and are affected by ant tending level.

Ant exclusion in citrus over an 8-year period reveals a pervasive yet changing effect of ants on a Mediterranean spider assemblage.

Science.gov (United States)

Mestre, L; Piñol, J; Barrientos, J A; Espadaler, X

2013-09-01

Ants and spiders are ubiquitous generalist predators that exert top-down control on herbivore populations. Research shows that intraguild interactions between ants and spiders can negatively affect spider populations, but there is a lack of long-term research documenting the strength of such interactions and the potentially different effects of ants on the diverse array of species in a spider assemblage. Similarly, the suitability of family-level surrogates for finding patterns revealed by species-level data (taxonomic sufficiency) has almost never been tested in spider assemblages. We present a long-term study in which we tested the impact of ants on the spider assemblage of a Mediterranean citrus grove by performing sequential 1-year experimental exclusions on tree canopies for 8 years. We found that ants had a widespread influence on the spider assemblage, although the effect was only evident in the last 5 years of the study. During those years, ants negatively affected many spiders, and effects were especially strong for sedentary spiders. Analyses at the family level also detected assemblage differences between treatments, but they concealed the different responses to ant exclusion shown by some related spider species. Our findings show that the effects of experimental manipulations in ecology can vary greatly over time and highlight the need for long-term studies to document species interactions.

Just follow your nose: homing by olfactory cues in ants.

Science.gov (United States)

Steck, Kathrin

2012-04-01

How is an ant-equipped with a brain that barely exceeds the size of a pinhead-capable of achieving navigational marvels? Even though evidences suggest that navigation is a multimodal process, ants heavily depend on olfactory cues-of pheromonal and non-pheromonal nature-for foraging and orientation. Recent studies have directed their attention to the efficiency of pheromone trail networks. Advances in neurophysiological techniques make it possible to investigate trail pheromone processing in the ant's brain. In addition to relying on pheromone odours, ants also make use of volatiles emanating from the nest surroundings. Deposited in the vicinity of the nest, these home-range markings help the ants to home after a foraging run. Furthermore, olfactory landmarks associated with the nest enhance ants' homing abilities. Copyright © 2011 Elsevier Ltd. All rights reserved.

Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

International Nuclear Information System (INIS)

Valles, Steven M.; Oi, David H.; Becnel, James J.; Wetterer, James K.; LaPolla, John S.; Firth, Andrew E.

2016-01-01

We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

Energy Technology Data Exchange (ETDEWEB)

Valles, Steven M., E-mail: steven.valles@ars.usda.gov [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)

2016-09-15

We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

Czech Academy of Sciences Publication Activity Database

Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

2015-01-01

Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

Behind every great ant, there is a great gut

DEFF Research Database (Denmark)

Poulsen, Michael; Sapountzis, Panagiotis

2012-01-01

on the potential contribution of the ants’ gut symbionts. This issue of Molecular Ecology contains a study by Anderson et al. (2012), who take a comparative approach to explore the link between trophic levels and ant microbiomes, specifically, to address three main questions: (i) Do closely related herbivorous...... conserved gut microbiomes, suggesting symbiont functions that directly relate to dietary preference of the ant host. These findings suggest an ecological role of gut symbionts in ants, for example, in metabolism and/or protection, and the comparative approach taken supports a model of co-evolution between...... ant species and specific core symbiont microbiomes. This study, thereby, highlights the omnipresence and importance of gut symbioses—also in the Hymenoptera—and suggests that these hitherto overlooked microbes likely have contributed to the ecological success of the ants....

Purification and crystallization of Phd, the antitoxin of the phd/doc operon

International Nuclear Information System (INIS)

Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

2010-01-01

The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

Science.gov (United States)

Khun, H H; Deved, V; Wong, H; Lee, B C

2000-12-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

Arboreal ant colonies as 'hot-points' of cryptic diversity for myrmecophiles: the weaver ant Camponotus sp. aff. textor and its interaction network with its associates.

Science.gov (United States)

Pérez-Lachaud, Gabriela; Lachaud, Jean-Paul

2014-01-01

Systematic surveys of macrofaunal diversity within ant colonies are lacking, particularly for ants nesting in microhabitats that are difficult to sample. Species associated with ants are generally small and rarely collected organisms, which makes them more likely to be unnoticed. We assumed that this tendency is greater for arthropod communities in microhabitats with low accessibility, such as those found in the nests of arboreal ants that may constitute a source of cryptic biodiversity. We investigated the invertebrate diversity associated with an undescribed, but already threatened, Neotropical Camponotus weaver ant. As most of the common sampling methods used in studies of ant diversity are not suited for evaluating myrmecophile diversity within ant nests, we evaluated the macrofauna within ant nests through exhaustive colony sampling of three nests and examination of more than 80,000 individuals. We identified invertebrates from three classes belonging to 18 taxa, some of which were new to science, and recorded the first instance of the co-occurrence of two brood parasitoid wasp families attacking the same ant host colony. This diversity of ant associates corresponded to a highly complex interaction network. Agonistic interactions prevailed, but the prevalence of myrmecophiles was remarkably low. Our data support the hypothesis of the evolution of low virulence in a variety of symbionts associated with large insect societies. Because most myrmecophiles found in this work are rare, strictly specific, and exhibit highly specialized biology, the risk of extinction for these hitherto unknown invertebrates and their natural enemies is high. The cryptic, far unappreciated diversity within arboreal ant nests in areas at high risk of habitat loss qualifies these nests as 'hot-points' of biodiversity that urgently require special attention as a component of conservation and management programs.

Arboreal ant colonies as 'hot-points' of cryptic diversity for myrmecophiles: the weaver ant Camponotus sp. aff. textor and its interaction network with its associates.

Directory of Open Access Journals (Sweden)

Gabriela Pérez-Lachaud

Full Text Available INTRODUCTION: Systematic surveys of macrofaunal diversity within ant colonies are lacking, particularly for ants nesting in microhabitats that are difficult to sample. Species associated with ants are generally small and rarely collected organisms, which makes them more likely to be unnoticed. We assumed that this tendency is greater for arthropod communities in microhabitats with low accessibility, such as those found in the nests of arboreal ants that may constitute a source of cryptic biodiversity. MATERIALS AND METHODS: We investigated the invertebrate diversity associated with an undescribed, but already threatened, Neotropical Camponotus weaver ant. As most of the common sampling methods used in studies of ant diversity are not suited for evaluating myrmecophile diversity within ant nests, we evaluated the macrofauna within ant nests through exhaustive colony sampling of three nests and examination of more than 80,000 individuals. RESULTS: We identified invertebrates from three classes belonging to 18 taxa, some of which were new to science, and recorded the first instance of the co-occurrence of two brood parasitoid wasp families attacking the same ant host colony. This diversity of ant associates corresponded to a highly complex interaction network. Agonistic interactions prevailed, but the prevalence of myrmecophiles was remarkably low. CONCLUSIONS: Our data support the hypothesis of the evolution of low virulence in a variety of symbionts associated with large insect societies. Because most myrmecophiles found in this work are rare, strictly specific, and exhibit highly specialized biology, the risk of extinction for these hitherto unknown invertebrates and their natural enemies is high. The cryptic, far unappreciated diversity within arboreal ant nests in areas at high risk of habitat loss qualifies these nests as 'hot-points' of biodiversity that urgently require special attention as a component of conservation and management

Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

DEFF Research Database (Denmark)

Poulsen, Peter; Jensen, Kaj Frank

1992-01-01

We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

Science.gov (United States)

Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

2017-05-05

Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Histrionicotoxin alkaloids finally detected in an ant

DEFF Research Database (Denmark)

Jones, Tappey H.; Adams, Rachelle Martha Marie; Spande, Thomas F.

2012-01-01

Workers of the ant Carebarella bicolor collected in Panama were found to have two major poison-frog alkaloids, cis- and trans-fused decahydroquinolines (DHQs) of the 269AB type, four minor 269AB isomers, two minor 269B isomers, and three isomers of DHQ 271D. For the first time in an ant, however......) sp., were found to have a very similar DHQ complex but failed to show HTXs. Several new DHQ alkaloids of MW 271 (named in the frog as 271G) are reported from the above ants that have both m/z 202 and 204 as major fragment ions, unlike the spectrum seen for the poison-frog alkaloid 271D, which has...... only an m/z 204 base peak. Found also for the first time in skin extracts from the comparison frog Oophaga granulifera of Costa Rica is a trace DHQ of MW 273. It is coded as 273F in the frog; a different isomer is found in the ant....

Neuromodulation of Nestmate Recognition Decisions by Pavement Ants.

Science.gov (United States)

Bubak, Andrew N; Yaeger, Jazmine D W; Renner, Kenneth J; Swallow, John G; Greene, Michael J

2016-01-01

Ant colonies are distributed systems that are regulated in a non-hierarchical manner. Without a central authority, individuals inform their decisions by comparing information in local cues to a set of inherent behavioral rules. Individual behavioral decisions collectively change colony behavior and lead to self-organization capable of solving complex problems such as the decision to engage in aggressive societal conflicts with neighbors. Despite the relevance to colony fitness, the mechanisms that drive individual decisions leading to cooperative behavior are not well understood. Here we show how sensory information, both tactile and chemical, and social context-isolation, nestmate interaction, or fighting non-nestmates-affects brain monoamine levels in pavement ants (Tetramorium caespitum). Our results provide evidence that changes in octopamine and serotonin in the brains of individuals are sufficient to alter the decision by pavement ants to be aggressive towards non-nestmate ants whereas increased brain levels of dopamine correlate to physical fighting. We propose a model in which the changes in brain states of many workers collectively lead to the self-organization of societal aggression between neighboring colonies of pavement ants.

Antílope

Directory of Open Access Journals (Sweden)

Pedro Anderson Martinho Moçambique

2015-10-01

Full Text Available Essa espécie de antílope só é encontrada em território angolano, sendo assim um símbolo nacional. Segundo a mitologia africana é símbolo de vivacidade, velocidade e beleza - Angola.

Antílope

Directory of Open Access Journals (Sweden)

Pedro Anderson Martinho Moçambique

2011-04-01

Full Text Available Essa espécie de antílope só é encontrada em território angolano, sendo assim um símbolo nacional. Segundo a mitologia africana é símbolo de vivacidade, velocidade e beleza - Angola.

Genomes of ubiquitous marine and hypersaline Hydrogenovibrio, Thiomicrorhabdus and Thiomicrospira spp. encode a diversity of mechanisms to sustain chemolithoautotrophy in heterogeneous environments.

Science.gov (United States)

Scott, Kathleen M; Williams, John; Porter, Cody M B; Russel, Sydney; Harmer, Tara L; Paul, John H; Antonen, Kirsten M; Bridges, Megan K; Camper, Gary J; Campla, Christie K; Casella, Leila G; Chase, Eva; Conrad, James W; Cruz, Mercedez C; Dunlap, Darren S; Duran, Laura; Fahsbender, Elizabeth M; Goldsmith, Dawn B; Keeley, Ryan F; Kondoff, Matthew R; Kussy, Breanna I; Lane, Marannda K; Lawler, Stephanie; Leigh, Brittany A; Lewis, Courtney; Lostal, Lygia M; Marking, Devon; Mancera, Paola A; McClenthan, Evan C; McIntyre, Emily A; Mine, Jessica A; Modi, Swapnil; Moore, Brittney D; Morgan, William A; Nelson, Kaleigh M; Nguyen, Kimmy N; Ogburn, Nicholas; Parrino, David G; Pedapudi, Anangamanjari D; Pelham, Rebecca P; Preece, Amanda M; Rampersad, Elizabeth A; Richardson, Jason C; Rodgers, Christina M; Schaffer, Brent L; Sheridan, Nancy E; Solone, Michael R; Staley, Zachery R; Tabuchi, Maki; Waide, Ramond J; Wanjugi, Pauline W; Young, Suzanne; Clum, Alicia; Daum, Chris; Huntemann, Marcel; Ivanova, Natalia; Kyrpides, Nikos; Mikhailova, Natalia; Palaniappan, Krishnaveni; Pillay, Manoj; Reddy, T B K; Shapiro, Nicole; Stamatis, Dimitrios; Varghese, Neha; Woyke, Tanja; Boden, Rich; Freyermuth, Sharyn K; Kerfeld, Cheryl A

2018-03-09

Chemolithoautotrophic bacteria from the genera Hydrogenovibrio, Thiomicrorhabdus and Thiomicrospira are common, sometimes dominant, isolates from sulfidic habitats including hydrothermal vents, soda and salt lakes and marine sediments. Their genome sequences confirm their membership in a deeply branching clade of the Gammaproteobacteria. Several adaptations to heterogeneous habitats are apparent. Their genomes include large numbers of genes for sensing and responding to their environment (EAL- and GGDEF-domain proteins and methyl-accepting chemotaxis proteins) despite their small sizes (2.1-3.1 Mbp). An array of sulfur-oxidizing complexes are encoded, likely to facilitate these organisms' use of multiple forms of reduced sulfur as electron donors. Hydrogenase genes are present in some taxa, including group 1d and 2b hydrogenases in Hydrogenovibrio marinus and H. thermophilus MA2-6, acquired via horizontal gene transfer. In addition to high-affinity cbb 3 cytochrome c oxidase, some also encode cytochrome bd-type quinol oxidase or ba 3 -type cytochrome c oxidase, which could facilitate growth under different oxygen tensions, or maintain redox balance. Carboxysome operons are present in most, with genes downstream encoding transporters from four evolutionarily distinct families, which may act with the carboxysomes to form CO 2 concentrating mechanisms. These adaptations to habitat variability likely contribute to the cosmopolitan distribution of these organisms. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

Directory of Open Access Journals (Sweden)

Mariana Noelia Viale

2014-01-01

Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

Science.gov (United States)

Marincola, Gabriella; Wolz, Christiane

2017-06-02

In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application of an Image Tracking Algorithm in Fire Ant Motion Experiment

Directory of Open Access Journals (Sweden)

Lichuan Gui

2009-04-01

Full Text Available An image tracking algorithm, which was originally used with the particle image velocimetry (PIV to determine velocities of buoyant solid particles in water, is modified and applied in the presented work to detect motion of fire ant on a planar surface. A group of fire ant workers are put to the bottom of a tub and excited with vibration of selected frequency and intensity. The moving fire ants are captured with an image system that successively acquires image frames of high digital resolution. The background noise in the imaging recordings is extracted by averaging hundreds of frames and removed from each frame. The individual fire ant images are identified with a recursive digital filter, and then they are tracked between frames according to the size, brightness, shape, and orientation angle of the ant image. The speed of an individual ant is determined with the displacement of its images and the time interval between frames. The trail of the individual fire ant is determined with the image tracking results, and a statistical analysis is conducted for all the fire ants in the group. The purpose of the experiment is to investigate the response of fire ants to the substrate vibration. Test results indicate that the fire ants move faster after being excited, but the number of active ones are not increased even after a strong excitation.

Interactions Increase Forager Availability and Activity in Harvester Ants.

Directory of Open Access Journals (Sweden)

Evlyn Pless

Full Text Available Social insect colonies use interactions among workers to regulate collective behavior. Harvester ant foragers interact in a chamber just inside the nest entrance, here called the 'entrance chamber'. Previous studies of the activation of foragers in red harvester ants show that an outgoing forager inside the nest experiences an increase in brief antennal contacts before it leaves the nest to forage. Here we compare the interaction rate experienced by foragers that left the nest and ants that did not. We found that ants in the entrance chamber that leave the nest to forage experienced more interactions than ants that descend to the deeper nest without foraging. Additionally, we found that the availability of foragers in the entrance chamber is associated with the rate of forager return. An increase in the rate of forager return leads to an increase in the rate at which ants descend to the deeper nest, which then stimulates more ants to ascend into the entrance chamber. Thus a higher rate of forager return leads to more available foragers in the entrance chamber. The highest density of interactions occurs near the nest entrance and the entrances of the tunnels from the entrance chamber to the deeper nest. Local interactions with returning foragers regulate both the activation of waiting foragers and the number of foragers available to be activated.

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

Directory of Open Access Journals (Sweden)

Orlando Díaz-Hernández

2010-07-01

Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

Science.gov (United States)

Díaz-Hernández, Orlando; Santillán, Moisés

2010-01-01

In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Characterization of the biocontrol activity of pseudomonas fluorescens strain X reveals novel genes regulated by glucose.

Directory of Open Access Journals (Sweden)

Gerasimos F Kremmydas

Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.

Fluid intake rates in ants correlate with their feeding habits.

Science.gov (United States)

Paul, J; Roces, F

2003-04-01

This study investigates the techniques of nectar feeding in 11 different ant species, and quantitatively compares fluid intake rates over a wide range of nectar concentrations in four species that largely differ in their feeding habits. Ants were observed to employ two different techniques for liquid food intake, in which the glossa works either as a passive duct-like structure (sucking), or as an up- and downwards moving shovel (licking). The technique employed for collecting fluids at ad libitum food sources was observed to be species-specific and to correlate with the presence or absence of a well-developed crop in the species under scrutiny. Workers of ponerine ants licked fluid food during foraging and transported it as a droplet between their mandibles, whereas workers of species belonging to phylogenetically more advanced subfamilies, with a crop capable of storing liquids, sucked the fluid food, such as formicine ants of the genus Camponotus. In order to evaluate the performance of fluid collection during foraging, intake rates for sucrose solutions of different concentrations were measured in four ant species that differ in their foraging ecology. Scaling functions between fluid intake rates and ant size were first established for the polymorphic species, so as to compare ants of different size across species. Results showed that fluid intake rate depended, as expected and previously reported in the literature, on sugar concentration and the associated fluid viscosity. It also depended on both the species-specific feeding technique and the extent of specialization on foraging on liquid food. For similarly-sized ants, workers of two nectar-feeding ant species, Camponotus rufipes (Formicinae) and Pachycondyla villosa (Ponerinae), collected fluids with the highest intake rates, while workers of the leaf-cutting ant Atta sexdens (Myrmicinae) and a predatory ant from the Rhytidoponera impressa-complex (Ponerinae) did so with the lowest rate. Calculating the

The regulation of ant colony foraging activity without spatial information.

Directory of Open Access Journals (Sweden)

Balaji Prabhakar

Full Text Available Many dynamical networks, such as the ones that produce the collective behavior of social insects, operate without any central control, instead arising from local interactions among individuals. A well-studied example is the formation of recruitment trails in ant colonies, but many ant species do not use pheromone trails. We present a model of the regulation of foraging by harvester ant (Pogonomyrmex barbatus colonies. This species forages for scattered seeds that one ant can retrieve on its own, so there is no need for spatial information such as pheromone trails that lead ants to specific locations. Previous work shows that colony foraging activity, the rate at which ants go out to search individually for seeds, is regulated in response to current food availability throughout the colony's foraging area. Ants use the rate of brief antennal contacts inside the nest between foragers returning with food and outgoing foragers available to leave the nest on the next foraging trip. Here we present a feedback-based algorithm that captures the main features of data from field experiments in which the rate of returning foragers was manipulated. The algorithm draws on our finding that the distribution of intervals between successive ants returning to the nest is a Poisson process. We fitted the parameter that estimates the effect of each returning forager on the rate at which outgoing foragers leave the nest. We found that correlations between observed rates of returning foragers and simulated rates of outgoing foragers, using our model, were similar to those in the data. Our simple stochastic model shows how the regulation of ant colony foraging can operate without spatial information, describing a process at the level of individual ants that predicts the overall foraging activity of the colony.

Legionella dumoffii Tex-KL Mutated in an Operon Homologous to traC-traD is Defective in Epithelial Cell Invasion.

Science.gov (United States)

Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi

2016-06-01

To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Arboreal Ant Colonies as ‘Hot-Points’ of Cryptic Diversity for Myrmecophiles: The Weaver Ant Camponotus sp. aff. textor and Its Interaction Network with Its Associates

Science.gov (United States)

Pérez-Lachaud, Gabriela; Lachaud, Jean-Paul

2014-01-01

Introduction Systematic surveys of macrofaunal diversity within ant colonies are lacking, particularly for ants nesting in microhabitats that are difficult to sample. Species associated with ants are generally small and rarely collected organisms, which makes them more likely to be unnoticed. We assumed that this tendency is greater for arthropod communities in microhabitats with low accessibility, such as those found in the nests of arboreal ants that may constitute a source of cryptic biodiversity. Materials and Methods We investigated the invertebrate diversity associated with an undescribed, but already threatened, Neotropical Camponotus weaver ant. As most of the common sampling methods used in studies of ant diversity are not suited for evaluating myrmecophile diversity within ant nests, we evaluated the macrofauna within ant nests through exhaustive colony sampling of three nests and examination of more than 80,000 individuals. Results We identified invertebrates from three classes belonging to 18 taxa, some of which were new to science, and recorded the first instance of the co-occurrence of two brood parasitoid wasp families attacking the same ant host colony. This diversity of ant associates corresponded to a highly complex interaction network. Agonistic interactions prevailed, but the prevalence of myrmecophiles was remarkably low. Conclusions Our data support the hypothesis of the evolution of low virulence in a variety of symbionts associated with large insect societies. Because most myrmecophiles found in this work are rare, strictly specific, and exhibit highly specialized biology, the risk of extinction for these hitherto unknown invertebrates and their natural enemies is high. The cryptic, far unappreciated diversity within arboreal ant nests in areas at high risk of habitat loss qualifies these nests as ‘hot-points’ of biodiversity that urgently require special attention as a component of conservation and management programs. PMID:24941047

Endophytic fungi reduce leaf-cutting ant damage to seedlings

Science.gov (United States)

Bittleston, L. S.; Brockmann, F.; Wcislo, W.; Van Bael, S. A.

2011-01-01

Our study examines how the mutualism between Atta colombica leaf-cutting ants and their cultivated fungus is influenced by the presence of diverse foliar endophytic fungi (endophytes) at high densities in tropical leaf tissues. We conducted laboratory choice trials in which ant colonies chose between Cordia alliodora seedlings with high (Ehigh) or low (Elow) densities of endophytes. The Ehigh seedlings contained 5.5 times higher endophyte content and a greater diversity of fungal morphospecies than the Elow treatment, and endophyte content was not correlated with leaf toughness or thickness. Leaf-cutting ants cut over 2.5 times the leaf area from Elow relative to Ehigh seedlings and had a tendency to recruit more ants to Elow plants. Our findings suggest that leaf-cutting ants may incur costs from cutting and processing leaves with high endophyte loads, which could impact Neotropical forests by causing variable damage rates within plant communities. PMID:20610420

Diversity of Species and Behavior of Hymenopteran Parasitoids of Ants: A Review