WorldWideScience

Sample records for annex xx hawt

  1. Annexes

    OpenAIRE

    2014-01-01

    ANNEXE 1. LES SEXENNATS PRÉSIDENTIELS AU MEXIQUE Luis Echeverria 1970-1976 José Luis Portillo 1976-1982 Miguel de La Madrid 1982-1988 Carlos Salinas de Gortari 1988-1994 ANNEXE 2. SIGLES ET TERMES SPÉCIFIQUES ALENA Accord de libre échange nord-américain ANAGSA Assurance nationale pour l’agriculture (société anonyme) CCI Confédération paysanne indépendante CEPAL Commission économique pour l’Amérique latine CETES Équivalent des bons du Trésor CFE Compagnie fédérale d’électricité Charros (leader...

  2. Annex 3

    OpenAIRE

    Mitchell, Claire

    2011-01-01

    States’ Implementing Legislation Sources for this annex include the Amnesty International Report on Universal Jurisdiction, supra note 31; Universal Jurisdiction in Europe: Criminal Prosecutions in Europe since 1990 for war crimes, crimes against humanity, torture and genocide, Redress, 30 June 1999, available at http://www.redress.org/Universal_jurisdiction.html (accessed 5 August 2007); Universal Jurisdiction in Europe: State of the Art, Human Rights Watch, June 2006, available at ht...

  3. Effects of geometry and tip speed ratio on the HAWT blade's root flow

    NARCIS (Netherlands)

    Akay, B.; Micallef, D.; Simao Ferreira, C.J.; Van Bussel, G.J.W.

    2014-01-01

    In this study, the effect of the parameters playing a role in the root flow behavior of HAWT are only partly understood. To better reveal the root flow properties, this study presents the progression of HAWT blade root flow at two different blade geometries and at two different tip speed ratios. The

  4. Design, analysis and testing of small, affordable HAWT rotors

    Science.gov (United States)

    Pricop, Mihai V.; Niculescu, Mihai L.; Cojocaru, Marius G.; Barsan, Dorin

    2012-09-01

    The paper presents affordable technologies dedicated to design, CAD modelling and manufacturing of the small-medium HAWT rotors. Three numerical tools are developed: blade/rotor design, blade modelling for industry CATIA(CATScript) and blade modelling for small scale developers. Numerical analysis of the rotors is accomplished for both performance and noise level estimation using XFLOW (LES) and an in-house code (URANS). Results are presented for a 5KW rotor at the design point only, since computations are expensive. Developement examples are included as two rotors are designed, manufactured and tested for 1.5 and 5KW. A third one, rated for 20KW is under developement. Basic testing results are also included.

  5. Annex 35: Hybvent

    DEFF Research Database (Denmark)

    Heiselberg, Per

    The Annex 35 research project is aiming at a better knowledge of hybrid systems and focusing on development of control strategies and performance prediction methods for hybrid ventilation in new and retrofitted office buildings. Its main objectives are: • to develop control strategies for hybrid ...... and cost effective hybrid ventilation systems in office and educational buildings......The Annex 35 research project is aiming at a better knowledge of hybrid systems and focusing on development of control strategies and performance prediction methods for hybrid ventilation in new and retrofitted office buildings. Its main objectives are: • to develop control strategies for hybrid...... ventilation systems in new and retrofitted office and educational buildings • to develop methods to predict ventilation performance in hybrid ventilated buildings • . to select suitable measurement techniques for diagnostic purposes to be used in . buildings with hybrid ventilation systems • to promote energy...

  6. Annex II technical documentation assessed.

    Science.gov (United States)

    van Drongelen, A W; Roszek, B; van Tienhoven, E A E; Geertsma, R E; Boumans, R T; Kraus, J J A M

    2005-12-01

    Annex II of the Medical Device Directive (MDD) is used frequently by manufacturers to obtain CE-marking. This procedure relies on a full quality assurance system and does not require an assessment of the individual medical device by a Notified Body. An investigation into the availability and the quality of technical documentation for Annex II devices revealed severe shortcomings, which are reported here.

  7. Vibration Characteristics of Roundabout Swing of HAWT Wind Wheel

    Directory of Open Access Journals (Sweden)

    Jian-long Ma

    2016-01-01

    Full Text Available Modal testing was used to show that the roundabout swing was a natural vibration mode of the wind wheel of a horizontal-axis wind turbine (HAWT. During the vibration, the blade root was simultaneously subjected to bending and rotary shear stresses. A method for indirect testing and determination of the dynamic frequencies of the typical vibrations of the wind wheel was developed, based on the frequency-holding characteristic of each subsignal during the transmission of the multiple mixed-vibration signals. The developed method enabled simple and accurate acquisition of the dynamic frequencies without destruction of the flow and structural fields. The dynamic vibration stress of the roundabout swing was found to be significantly stronger than those of the first- and second-order flexural vibrations of the blades. By a combination of numerical simulations and tests, it was determined that the pneumatic circumferential force was the primary determinant of the roundabout swing vibration frequencies, the relationship being quadratic. The roundabout swing vibration potentially offers new explanations and analytical pathways regarding the behavior of horizontal-axis wind turbines, which have been found to be frequently involved in fatigue-damage accidents within periods shorter than their design lives.

  8. Mister XX

    Directory of Open Access Journals (Sweden)

    Miletić Marija

    2016-01-01

    Full Text Available Female pseudohermaphroditism represents discrepancy between karyotype and gonadal features on one side and a psychogenic phenotype on the other. Congenital adrenal hyperplasia is the part of the spectrum of female pseudohaermaofroditism and is due to an enzyme deficiency in steroidogenesis. More than 95% of patients have 21 hydroxylase deficiency which leads to a lack of cortisol and ACTH hypersecretion of pituitary, overproduction of 17 hydroxy progesterone (17OHP and androgens and adrenal cortex hyperplasia. The clinical phenotype is classified as classical and nonclassical (aka. 'Late onset' form. The classic form is represented as salt-waisting and simply virilizing, depending on the degree of lack of aldosterone. Pathophysiology of CAH due to the lack of 21α hydroxylase is closely associated with the degree of enzyme deficiency. Overproduction of androgens is leading to accelerated virilisation. Classical form is manifested in childhood and is characterized by the overproduction of cortisol precursors and adrenal androgens. In the most severe form, co-aldosterone deficiency leads to loss of salt with all the complications. Girls with the classical form of CAH typically have am ambiguous genitals at birth due to high concentrations of androgens in utero. CAH due to 21OH deficiency is the most common cause of ambiguous genitals in 46XX newborns. Characteristically, the clitoris is enlarged, partially fused labia maiora and a common urogenital sinus at the site of the urethra and vagina. The uterus, Fallopian tubes and ovaries are present and normal, a structures of Wolfian duct are absent. When diagnosed in childhood 46XX CAH patients has been assigned female gender so far, even in fully expressed in virilised external genitalia. This dogmatic approach is based on preserving fertility, and if there was at least uterus, opting for female sex was considered justified. Only about 5% of 46 patients with XX KAH has a psychogenic male gender, as

  9. ARINC653 AADL Annex Update

    Science.gov (United States)

    2015-02-15

    of the IMA philosophy • Time & space partitioning Rationale of ARINC653 annex for AADLv2 • Standardize modeling patterns • Better modeling & analysis...Ocarina Third-party support for implementation production Generic annex that can be reused ARINC653 and MILS architectures Tailoring for other...partitioned architectures Exercised and demonstrated Architecture consistency checks and validation (i.e. latency) Code Generation of partitions and kernel 7

  10. A fully unsteady prescribed wake model for HAWT performance prediction in yawed flow

    Energy Technology Data Exchange (ETDEWEB)

    Coton, F.N.; Tongguang, Wang; Galbraith, R.A.M.; Lee, D. [Univ. of Glasgow (United Kingdom)

    1997-12-31

    This paper describes the development of a fast, accurate, aerodynamic prediction scheme for yawed flow on horizontal axis wind turbines (HAWTs). The method is a fully unsteady three-dimensional model which has been developed over several years and is still being enhanced in a number of key areas. The paper illustrates the current ability of the method by comparison with field data from the NREL combined experiment and also describes the developmental work in progress. In particular, an experimental test programme designed to yield quantitative wake convection information is summarised together with modifications to the numerical model which are necessary for meaningful comparison with the experiments. Finally, current and future work on aspects such as tower-shadow and improved unsteady aerodynamic modelling are discussed.

  11. 46,XX Male Syndrome

    Directory of Open Access Journals (Sweden)

    Bekir Uçan

    2013-06-01

    Full Text Available 46, XX male syndrome – testicular disorder of sexual differentiation (DSD is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. These cases are diagnosed more easily in childhood. In adults, the diagnosis can be difficult due to the current normal gender development. Here, we report hormonal, molecular and cytogenetic results in an adult male patient with primary hypogonadism who was diagnosed with 46, XX male syndrome in our clinic. Turk Jem 2013; 17: 46-8

  12. Numerical study of effect of pitch angle on performance characteristics of a HAWT

    Directory of Open Access Journals (Sweden)

    Sudhamshu A.R.

    2016-03-01

    Full Text Available Wind energy is one of the clean renewable forms of energy that can handle the existing global fossil fuel crisis. Although it contributes to 2.5% of the global electricity demand, with diminishing fossil fuel sources, it is important that wind energy is harnessed to a greater extent to meet the energy crisis and problem of pollution. The present work involves study of effect of pitch angle on the performance of a horizontal axis wind turbine (HAWT, NREL Phase VI. The wind velocities considered for the study are 7, 15.1 and 25.1 m/s. The simulations are performed using a commercial CFD code Fluent. A frozen rotor model is used for simulation, wherein the governing equations are solved in the moving frame of reference rotating with the rotor speed. The SST k-ω turbulence model has been used. It is seen that the thrust increases with increase in wind velocity, and decreases with increase in pitch angle. For a given wind velocity, there is an optimum pitch angle where the power generated by the turbine is maximum. The observed effect of pitch angle on the power produced has been correlated to the stall characteristics of the airfoil blade.

  13. Environmental Assessment: Disposition of Maxwell Heights Annex

    Science.gov (United States)

    2005-07-01

    Maxwell Support Division May 4, 2005 Mr. David Rabon Tribal Historic Preservation Officer Cherokee Nation of Oklahoma P.O. Box 948 Tahlequah...Oklahoma 74465 RE: Disposal of the Existing Property and Facilities of the Maxwell Heights Annex Maxwell Air Force Base, Alabama Dear Mr. Rabon , The

  14. ocaso del siglo XX

    Directory of Open Access Journals (Sweden)

    Héctor Velázquez Trujillo

    2006-01-01

    Full Text Available En el artículo se abordan los rumbos que están tomando tres sistemas políticos latinoamericanos: Colombia (Departamento de Cundinamarca, México (Estado de México y Venezuela (Estado Miranda, a través del estudio de las elecciones municipales de la última década del siglo XX. El estudio comparativo se hace a partir de tres ejes de análisis: el voto, la elección y los resultados.

  15. RECUERDOS DEL SIGLO XX

    Directory of Open Access Journals (Sweden)

    ASUNCIÓN LAVRIN

    2011-10-01

    Full Text Available Este ensayo hace una revisión de conceptos clave en la educación de la mujer en Hispanoamérica, en la primera mitad del siglo XX, y el debate sobre la educación superior de la mujer. También analiza las ideas de Gabriela Mistral para la educación femenina en su Lectura para mujeres, y las compara con las de la escritora mexicana Rosario Castellanos. Finalmente, hace un llamado por nuevos modelos educativos para la mujer de siglo XXI.Este ensayo hace una revisión de conceptos clave en la educación de la mujeren Hispanoamérica, en la primera mitad del siglo XX, y el debate sobre laeducación superior de la mujer. También analiza las ideas de Gabriela Mistralpara la educación femenina en su Lectura para mujeres, y las comparacon las de la escritora mexicana Rosario Castellanos. Finalmente, hace unllamado por nuevos modelos educativos para la mujer de siglo XXI.

  16. Analytical study on different blade-shape design of HAWT for wasted kinetic energy recovery system (WKERS)

    Science.gov (United States)

    Goh, J. B.; Jamaludin, Z.; Jafar, F. A.; Mat Ali, M.; Mokhtar, M. N. Ali; Tan, C. H.

    2017-06-01

    Wasted kinetic energy recovery system (WKERS) is a wind renewable gadget installed above a cooling tower outlet to harvest the discharged wind for electrical regeneration purpose. The previous WKERS is operated by a horizontal axis wind turbine (HAWT) with delta blade design but the performance is still not at the optimum level. Perhaps, a better blade-shape design should be determined to obtain the optimal performance, as it is believed that the blade-shape design plays a critical role in HAWT. Hence, to determine a better blade-shape design for a new generation of WKERS, elliptical blade, swept blade and NREL Phase IV blade are selected for this benchmarking process. NREL Phase IV blade is a modern HAWT’s blade design by National Renewable Energy Laboratory (NREL) research lab. During the process of benchmarking, Computational Fluid Dynamics (CFD) analysis was ran by using SolidWorks design software, where all the designs are simulated with linear flow simulation. The wind speed in the simulation is set at 10.0 m/s, which is compatible with the average wind speed produced by a standard size cooling tower. The result is obtained by flow trajectories of air motion, surface plot and cut plot of the applied blade-shape. Besides, the aspect ratio of each blade is calculated and included as one of the reference in the comparison. Hence, the final selection of the best blade-shape design will bring to the new generation of WKERS.

  17. cuarto del siglo XX

    Directory of Open Access Journals (Sweden)

    José Antonio Nieto Calmaestra

    2005-01-01

    Full Text Available Los últimos 25 años del siglo XX han supuesto un sustancial cambio en el modelo de crecimiento de la población andaluza. Así, mientras la caída de la fecundidad y la estabilización de las tasas de mortalidad han contribuido a un progresivo retroceso de la vitalidad natural, la masiva emigración de antaño ha dado paso al papel de Andalucía como incipiente foco de inmigración y al creciente protagonismo de movimientos internos de relocalización de la población. Desde el punto de vista territorial estas afirmaciones quedan matizadas por los notables contrastes que se producen entre los distintos ámbitos que conforman la región y que contraponen al medio rural con el urbano, al litoral con el interior o a las grandes ciudades con sus periferias.

  18. A New Method for Horizontal Axis Wind Turbine (HAWT Blade Optimization

    Directory of Open Access Journals (Sweden)

    Mohammadreza Mohammadi

    2016-02-01

    Full Text Available Iran has a great potential for wind energy. This paper introduces optimization of 7 wind turbine blades for small and medium scales in a determined wind condition of Zabol site, Iran, where the average wind speed is considered 7 m /s. Considered wind turbines are 3 bladed and radius of 7 case study turbine blades are 4.5 m, 6.5 m, 8 m, 9 m, 10 m, 15.5 m and 20 m. As the first step, an initial design is performed using one airfoil (NACA 63-215 across the blade. In the next step, every blade is divided into three sections, while the 20 % of first part of the blade is considered as root, the 5% of last the part is considered as tip and the rest of the blade as mid part. Providing necessary input data, suitable airfoils for wind turbines including 43 airfoils are extracted and their experimental data are entered in optimization process. Three variables in this optimization problem would be airfoil type, attack angle and chord, where the objective function is maximum output torque. A MATLAB code was written for design and optimization of the blade, which was validated with a previous experimental work. In addition, a comparison was made to show the effect of optimization with two variables (airfoil type and attack angle versus optimization with three variables (airfoil type, attack angle and chord on output torque increase. Results of this research shows a dramatic increase in comparison to initial designed blade with one airfoil where two variable optimization causes 7.7% to 22.27 % enhancement and three variable optimization causes 17.91% up to 24.48% rise in output torque .Article History: Received Oct 15, 2015; Received in revised form January 2, 2016; Accepted January 14, 2016; Available online How to Cite This Article: Mohammadi, M., Mohammadi, A. and Farahat, S. (2016 A New Method for Horizontal Axis Wind Turbine (HAWT Blade Optimization. Int. Journal of Renewable Energy Development, 5(1,1-8. http://dx.doi.org/10.14710/ijred.5.1.1-8

  19. Comparison between OpenFOAM CFD & BEM theory for variable speed – variable pitch HAWT

    Directory of Open Access Journals (Sweden)

    ElQatary Islam

    2014-01-01

    Full Text Available OpenFoam is used to compare computational fluid dynamics (CFD with blade element momentum theory (BEM for a variable speed - variable pitch HAWT (Horizontal Axis Wind Turbine. The wind turbine is first designed using the BEM to determine the blade chord, twist and operating conditions. The wind turbine blade has an outer diameter of 14 m, uses a NACA 63–415 profile for the entire blade and root to tip twist distribution of 15deg (Figure 3. The RPM varies from 20–75 for freestream velocities varying between 3–10.5 m/s (variable speed and a constant RPM of 78.78 for velocities ranging between 11–25 m/s (variable pitch. OpenFOAM is used to investigate the wind turbine performance at several operating points including cut-in wind speed (3 m/s, rated wind speed (10.5 m/s and in the variable pitch zone. Simulation results show that in the variable-speed operating range, both CFD and BEM compare reasonably well. This agreement can be attributed to the fact that the complex three-dimensional flow around the turbine blades can be split into two radial segments. For radii less than the mid-span, the flow is three-dimensional, whereas for radii greater than the mid-span, the flow is approximately two-dimensional. Since the majority of the power is produced from sections beyond the mid-span, the agreement between CFD and BEM is reasonable. For the variable-pitch operating range the CFD results and BEM deviate considerably. In this case the majority of the power is produced from the inner sections in which the flow is three-dimensional and can no longer be predicted by the BEM. The results show that differences in pitch angles up to 10deg can result to regulate the power for high wind speeds in the variable-pitch operation zone.

  20. Whole-Building Hygrothermal Modeling in IEA Annex 41

    DEFF Research Database (Denmark)

    Rode, Carsten; Woloszyn, Monika

    2007-01-01

    . The IEA Annex 41 project runs from 2004–2007, coming to conclusion just before the Thermal Performance of the Exterior Envelopes of Whole Buildings X conference. The Annex 41 project and its Subtask 1 do not aim to produce one state-of-the-art hygrothermal simulation model for whole buildings, but rather...

  1. Experimental study of improved HAWT performance in simulated natural wind by an active controlled multi-fan wind tunnel

    Science.gov (United States)

    Toshimitsu, Kazuhiko; Narihara, Takahiko; Kikugawa, Hironori; Akiyoshi, Arata; Kawazu, Yuuya

    2017-04-01

    The effects of turbulent intensity and vortex scale of simulated natural wind on performance of a horizontal axis wind turbine (HAWT) are mainly investigated in this paper. In particular, the unsteadiness and turbulence of wind in Japan are stronger than ones in Europe and North America in general. Hence, Japanese engineers should take account of the velocity unsteadiness of natural wind at installed open-air location to design a higher performance wind turbine. Using the originally designed five wind turbines on the basis of NACA and MEL blades, the dependencies of the wind frequency and vortex scale of the simulated natural wind are presented. As the results, the power coefficient of the newly designed MEL3-type rotor in the simulated natural wind is 130% larger than one in steady wind.

  2. Most Recent Sampling Results for Annex III Building

    Science.gov (United States)

    Contains email from Scott Miller, US EPA to Scott Kramer. Subject: Most Recent Sampling Results for Annex III Building. (2:52 PM) and Gore(TM) Surveys Analytical Results U.S. Geological Survey, Montgomery, AL.

  3. 3-D Time-Accurate CFD Simulations of a Multi-Megawatt Slender Bladed HAWT under Yawed Inflow Conditions

    Science.gov (United States)

    Sayed, M.; Lutz, Th.; Krämer, E.

    2016-09-01

    In the present study numerical investigations of a generic Multi-Megawatt slender bladed Horizontal-Axis Wind Turbine (HAWT) under yawed inflow conditions were conducted. A three-dimensional URANS flow solver based on structured overlapping meshes was used. The simulations were conducted at wind speeds of 7m/sec, 11 m/sec and 15 m/sec for different yaw angles ranging from +60° to -60°. It was concluded that, for below rated wind speeds, under small yaw angles (below ±15°) the magnitudes of the blade forces are slightly increased, while under high yaw angles (above ±15°) there is a significant decrease. Moreover, the load fluctuations, for the different yaw angles, have the same frequency but different amplitude and oscillation shape. It was concluded that at the above rated wind speed of 15 m/sec, the blade aerodynamic loads are significantly affected by the yaw inflow conditions and the magnitude values of the loads are decreased with increasing yaw angle. It can be concluded that the angle of attack and the tower interference are the utmost variables affecting the yawed turbines.

  4. ATI SAA Annex 3 Button Tensile Test Report I

    Science.gov (United States)

    Tang, Henry H.

    2013-01-01

    This report documents the results of a study carried out under Splace Act Agreement SAA-EA-10-004 between the National Aeronautics and Space Administration (NASA) and Astro Technology Incorpporated (ATI). NASA and ATI have entered into this agreement to collaborate on the development of technologies that can benefit both the US government space programs and the oil and gas industry. The report documents the results of a test done on an adnesive system for attaching new monitoring sensor devices to pipelines under Annex III of SAA-EA-10-004: "Proof-of-Concept Design and Testing of a Post Installed Sensing Device on Subsea Risers and Pipelines". The tasks of Annex III are to design and test a proof-of-concept sensing device for in-situ installation on pipelines, risers, or other structures deployed in deep water. The function of the sensor device is to measure various signals such as strain, stress and temperature. This study complements the work done, in Annex I of the SAA, on attaching a fiber optic sensing device to pipe via adhesive bonding. Both Annex I and Annex III studies were conducted in the Crew and Thermal System Division (CTSD) at the Johnson Space Center (JSC) in collaboration with ATI.

  5. 49 CFR 1242.30 - Dismantling retired road property and depreciation (accounts XX-17-39, XX-18-39, XX-19-39, 62-17...

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Dismantling retired road property and depreciation (accounts XX-17-39, XX-18-39, XX-19-39, 62-17-00, 62-18-00, and 62-19-00). 1242.30 Section 1242.30....30 Dismantling retired road property and depreciation (accounts XX-17-39, XX-18-39, XX-19-39,...

  6. Tethys and Annex IV Progress Report for FY 2012

    Energy Technology Data Exchange (ETDEWEB)

    Hanna, Luke A.; Butner, R. Scott; Whiting, Jonathan M.; Copping, Andrea E.

    2013-09-01

    The marine and hydrokinetic (MHK) environmental Impacts Knowledge Management System, dubbed “Tethys” after the mythical Greek titaness of the seas, is being developed by the Pacific Northwest National Laboratory (PNNL) to support the U.S. Department of Energy’s Wind and Water Power Program (WWPP). Functioning as a smart database, Tethys enables its users to identify key words or terms to help gather, organize and make available information and data pertaining to the environmental effects of MHK and offshore wind (OSW) energy development. By providing and categorizing relevant publications within a simple and searchable database, Tethys acts as a dissemination channel for information and data which can be utilized by regulators, project developers and researchers to minimize the environmental risks associated with offshore renewable energy developments and attempt to streamline the permitting process. Tethys also houses a separate content-related Annex IV data base with identical functionality to the Tethys knowledge base. Annex IV is a collaborative project among member nations of the International Energy Agency (IEA) Ocean Energy Systems – Implementing Agreement (OES-IA) that examines the environmental effects of ocean energy devices and projects. The U.S. Department of Energy leads the Annex IV working with federal partners such as the Federal Energy Regulatory Commission (FERC), the Bureau of Ocean Energy Management (BOEM), and the National Oceanic Atmospheric Administration (NOAA). While the Annex IV database contains technical reports and journal articles, it is primarily focused on the collection of project site and research study metadata forms (completed by MHK researchers and developers around the world, and collected by PNNL) which provide information on environmental studies and the current progress of the various international MHK developments in the Annex IV member nations. The purpose of this report is to provide a summary of the content

  7. Annex A1: cornerstone of the five-yearly review

    CERN Multimedia

    Staff Association

    2016-01-01

    As a reminder; the purpose of the five-yearly review is to review the financial and social conditions of all CERN personnel whether employed (MPE) or associated (MPA)! In December 2015, the CERN Council approved the package proposed by the Management. Early this year, and as final act of the 2015 five-yearly review, the CERN Council may decide, if necessary and appropriate, to review the procedures defined in Annex A1 and applicable to future five-yearly reviews. At the meeting of TREF (TRipartite Employment Forum)  in early March 2016 discussions will take place between all stakeholders (representatives of Member States, Management and the Staff Association) and Council will take a decision in June 2016, on the basis of the Management's recommendations. What does Annex A1 say and where can I find it? Annex A1 (Article S V 1.02) is a part of the Staff Rules and Regulations. This annex defines: The five-yearly review of the financial and social conditions of the staff, fellows and MPA; The a...

  8. A Description of Charles Dickens Annex, 1971-72.

    Science.gov (United States)

    Reid, Marilyn J.

    A primary annex, built to relieve overcrowding, is attended by children registered in kindergarten through grade 3. The building consists of an open area organized into a number of learning centers plus three closed classrooms. The school's program is based on two concepts adapted from the British Infant School system: (1) family or vertical…

  9. IEA SHC Task 42/ECES Annex 29 WG A1

    DEFF Research Database (Denmark)

    Ristić, Alenka; Furbo, Simon; Moser, Christoph

    2016-01-01

    An overview on the recent results on the engineering and characterization of sorption materials, PCMs and TCMs investigated in the working group WG A1 “Engineering and processing of TES materials” of IEA SHC Task 42 / ECES Annex 29 (Task 4229) entitled “Compact Thermal Energy Storage” is presented....

  10. México. Siglo XX

    Directory of Open Access Journals (Sweden)

    Zaira Navarrete-Cazales

    2015-01-01

    Full Text Available En México, la Escuela Normal ha sido la principal institución encargada de la formación de profesores para el nivel escolar básico (preescolar, primaria, secundaria; los enfoques de formación que circulan en esta institución han ido en paralelo con las políticas educativas nacionales, en tanto que el Gobierno Federal, por medio de la Secretaría de Educación Pública, es el “encargado” de dictar las políticas para la formación de los futuros docentes en dichas escuelas, por lo que su estudio (tanto de los enfoques como de las políticas resulta indispensable para comprender el trayecto de las Escuelas Normales durante el siglo XX. El objetivo de este escrito, es presentar un panorama histórico sobre las Escuelas Normales en México y dar cuenta de sus principales momentos: creación, cambios nominales, corrientes teóricas prevalecientes, momentos políticos que la definen, inter alia. Estos elementos permiten ver a grandes rasgos los procesos sociales y educativos que fueron marcandola educación normal. Concluimos que con las Escuelas Normales en México, se inicia la formación de profesores y si bien en 1982, estas Escuelas Normales adquirieron el status de instituciones de educación superior, su destino sigue estando atado a la educación básica: “por el peso de la historia y por el peso de la ley”.

  11. Ideaalnaistest XX sajandi alguse Eestis : XX sajandi alguse naised / Mirjam Hinrikus

    Index Scriptorium Estoniae

    Hinrikus, Mirjam, 1972-

    2005-01-01

    Naiskujutistest Noor-Eesti albumite illustratsioonides (Nikolai Triik, Erik Obermann). XX sajandi alguse eesti kunstis ja kirjanduses kõige levinumatest naisstereotüüpidest, feminiseerumisest. Näitus ja seminar "Ideaalne ja reaalne. Naised XX sajandi alguse Eestis" Kastellaanimajas

  12. 49 CFR 1242.84 - Marketing, sales, and public relations and advertising (accounts XX-63-88, XX-63-89 and XX-63-93).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Marketing, sales, and public relations and advertising (accounts XX-63-88, XX-63-89 and XX-63-93). 1242.84 Section 1242.84 Transportation Other... PASSENGER SERVICE FOR RAILROADS 1 Operating Expenses § 1242.84 Marketing, sales, and public relations...

  13. Prenatal diagnosis of 45,X/46,XX

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, L.Y.F. [New York Univ. School of Medicine, New York, NY (United States)

    1996-03-01

    I read with great interest the paper on {open_quotes}Prenatal Diagnosis of 45,X/46,XX mosaicism and 45,X: Implications for Postnatal Outcome{close_quotes} by Koeberl et al. They reported their experience with 12 prenatally diagnosed cases of 45,X/46,XX mosaicism and made a clinical comparison between those 12 cases and their own 41 postnatally diagnosed cases of 45,X/46,XX mosaicism. As expected, they found an overall milder phenotypic manifestation in the prenatal cases than in the postnatal ones. These authors report a lack of previous prognostic information on this type of prenatally diagnosis of mosaicism and offer their findings to fill this need. However, considerable information on this topic has been published. There have been >200 prenatally diagnosed cases of 45,X/46,XX. According to my data on 189 cases with a prenatal diagnosis of 45,X/46,XX mosaicism (Hsu 1992), there are 114 cases with available information on phenotypic outcome. Of these, 12 (10.5%) were reported to have some features of Turner syndrome, 4 had other anomalies probably not related to Turner syndrome, and 2 resulted in stillbirth. The overall rate for an abnormal phenotype in this category was thus 16/114 (14.03%). However, we must realize that, even in patients with a nonmosaic 45,X complement, the major features of Turner syndrome, such as short stature and sexual infantilism, are manifested only later in childhood or in adolescence. 3 refs.

  14. Rupture loop annex ion exchange RLAIX vault deactivation

    Energy Technology Data Exchange (ETDEWEB)

    Ham, J.E.; Harris, D.L., Westinghouse Hanford

    1996-08-01

    This engineering report documents the deactivation, stabilization and final conditions of the Rupture Loop Annex Ion Exchange (RLAIX) Vault located northwest of the 309 Building`s Plutonium Recycle Test Reactor (PRTR). Twelve ion exchange columns, piping debris, and column liquid were removed from the vault, packaged and shipped for disposal. The vault walls and floor were decontaminated, and portions of the vault were painted to fix loose contamination. Process piping and drains were plugged, and the cover blocks and rain cover were installed. Upon closure,the vault was empty, stabilized, isolated.

  15. IEA Annex 26: Advanced Supermarket Refrigeration/Heat Recovery Systems

    Energy Technology Data Exchange (ETDEWEB)

    Baxter, VAN

    2003-05-19

    With increased concern about the impact of refrigerant leakage on global warming, a number of new supermarket refrigeration system configurations requiring significantly less refrigerant charge are being considered. In order to help promote the development of advanced systems and expand the knowledge base for energy-efficient supermarket technology, the International Energy Agency (IEA) established IEA Annex 26 (Advanced Supermarket Refrigeration/Heat Recovery Systems) under the ''IEA Implementing Agreement on Heat Pumping Technologies''. Annex 26 focuses on demonstrating and documenting the energy saving and environmental benefits of advanced systems design for food refrigeration and space heating and cooling for supermarkets. Advanced in this context means systems that use less energy, require less refrigerant and produce lower refrigerant emissions. Stated another way, the goal is to identify supermarket refrigeration and HVAC technology options that reduce the total equivalent warming impact (TEWI) of supermarkets by reducing both system energy use (increasing efficiency) and reducing total refrigerant charge. The Annex has five participating countries: Canada, Denmark, Sweden, the United Kingdom, and the United States. The working program of the Annex has involved analytical and experimental investigation of several candidate system design approaches to determine their potential to reduce refrigerant usage and energy consumption. Advanced refrigeration system types investigated include the following: distributed compressor systems--small parallel compressor racks are located in close proximity to the food display cases they serve thus significantly shortening the connecting refrigerant line lengths; secondary loop systems--one or more central chillers are used to refrigerate a secondary coolant (e.g. brine, ice slurry, or CO2) that is pumped to the food display cases on the sales floor; self-contained display cases--each food display case

  16. Shining examples analysed within the EBC Annex 56 project

    DEFF Research Database (Denmark)

    Christen Mørck, Ove; Almeida, Manuela; Ferreira, Marco;

    2016-01-01

    The International Energy Agency established an Implementing Agreement within the Energy in Buildings and Communities Program to undertake research and provide an international focus on “Cost Effective Energy and Carbon Emissions Optimization in Building Renovation” (EBC Annex 56). The project aim...... to promote efficient and cost effective renovations. This paper presents the results of the analyses made on these Shining Examples....... at developing a new methodology to enable cost effective renovation of existing buildings while optimizing energy consumption and carbon emissions reduction. Several case studies were gathered to develop and validate the methodology, and a selection of “Shining Examples” was made to encourage decision makers...

  17. Rule based system for in situ identification of annex I habitats

    NARCIS (Netherlands)

    Bunce, R.G.H.; Bogers, M.M.B.; Evans, D.; Jongman, R.H.G.

    2012-01-01

    In the EBONE project the recognition of Annex I habitats in the field has been considered as an important issue. A hierarchical structure is created in this report within which the Annex I habitats can be identified. The current concept of an expert system emerged during an ECOLAND forum meeting in

  18. Koopia XX sajandil : Kuno Veeber / Anne Lõugas

    Index Scriptorium Estoniae

    Lõugas, Anne, 1951-

    2005-01-01

    Näitus "Meistriteoste lummus. Koopia Eestis XIX sajandil" Kadrioru kunstimuuseumis. XX sajandi maalilisest kopeerimisviisist. Kuno Veeberi koopiast "Mercurius kolme graatsiaga" (1927, tehtud Jacopo Tintoretto 1576. a. seinamaali järgi Veneetsia Doodzhide palees). Sama seinamaali järgi tehtud Agostino Carracci (1557-1602) vasegravüürist. Arnold Kalmuse, Elsbeth Rudolffi ja Paul Raua tehtud koopiatest

  19. Raimo Pullati XX "Vana Tallinn" / Tõnis Liibek

    Index Scriptorium Estoniae

    Liibek, Tõnis

    2009-01-01

    Ilmus professor Raimo Pullati poolt välja antava linnaajalugu ja -kultuuri tutvustava sarja "Vana Tallinn" XX köide. Tšehhi Teaduste Akadeemia raamatukogus toimus Raimo Pullati poolt välja antud entsüklopeedilise suurteose "Johann Christoph Brotze. Estonica" esitlus

  20. Raimo Pullati XX "Vana Tallinn" / Tõnis Liibek

    Index Scriptorium Estoniae

    Liibek, Tõnis

    2009-01-01

    Ilmus professor Raimo Pullati poolt välja antava linnaajalugu ja -kultuuri tutvustava sarja "Vana Tallinn" XX köide. Tšehhi Teaduste Akadeemia raamatukogus toimus Raimo Pullati poolt välja antud entsüklopeedilise suurteose "Johann Christoph Brotze. Estonica" esitlus

  1. The Annex to the Annual Financial Statements in the Context of the European Directives

    Directory of Open Access Journals (Sweden)

    Ovidia Doinea

    2009-06-01

    Full Text Available The annex is a constitutive part of the annual accounts, being a conceptual product mentioned inthe art.2 of the CEE 4th Directive. This synthetic accounting document has the role to explain or to completethe element given by the balance sheet and the profit and loss account. The annex represents a valuableinstrument of informing and analysis for all the users of accounting information. The informative dimensionof the annex is not limited, but the information presentation must respect the principle of true and fair viewand that of the significant importance.

  2. Russia and Its International Image: From Sochi Olympic Games to Annexing Crimea

    Directory of Open Access Journals (Sweden)

    Kobierecki Michał

    2016-12-01

    Full Text Available The aim of the article is to analyze the change of the Russian Federation’s international image in the light of two significant events: the Olympic Winter Games in 2014 in Sochi and the annexation of Crimea. According to the first hypothesis, one of the main aims for hosting the Olympic Games was to improve the international prestige of Russia. Shortly after the Olympics Russia increased its activity in Eastern Ukraine, which resulted in the annexation of the Crimean Peninsula. Therefore the article is also aimed to investigate whether by annexing Crimea Russia squandered the possible positive effects of hosting the Olympics in terms of its international image.

  3. Offshore Code Comparison Collaboration within IEA Wind Annex XXIII: Phase II Results Regarding Monopile Foundation Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Jonkman, J.; Butterfield, S.; Passon, P.; Larsen, T.; Camp, T.; Nichols, J.; Azcona, J.; Martinez, A.

    2008-01-01

    This paper presents an overview and describes the latest findings of the code-to-code verification activities of the Offshore Code Comparison Collaboration, which operates under Subtask 2 of the International Energy Agency Wind Annex XXIII.

  4. Global Mitigation of Non-CO2 Greenhouse Gases - Data Annexes

    Data.gov (United States)

    U.S. Environmental Protection Agency — Marginal abatement curves (MAC) can be downloaded as data annexes to the Global Mitigation of Non-CO2 Greenhouse Gases report. This data allows for improved...

  5. 33 CFR 151.53 - Special areas for Annex V of MARPOL 73/78.

    Science.gov (United States)

    2010-07-01

    ....53 Special areas for Annex V of MARPOL 73/78. (a) For the purposes of §§ 151.51 through 151.77, the special areas are the Mediterranean Sea area, the Baltic Sea area, the Black Sea area, the Red Sea area... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Special areas for Annex V...

  6. [XX 'pure' gonadal dysgenesis and XYY syndrome].

    Science.gov (United States)

    Itoh, Naoki; Tsukamoto, Taiji

    2004-02-01

    XX 'pure' gonadal dysgenesis is a disease related to Turner's syndrome. Patients of this disease are characterized by normal female external genitalia, bilateral streak gonads, amenorrhea and sexual infantilism. Recently, it has been reported that point mutations of the FSH receptor gene may be one of cause of this disease. The relationship between criminal behavior and XYY syndrome is still controversial. Increased incidence of disomic sperm in 47,XYY males has been reported by fluorescent in situ hybridization(FISH). Genetic counseling should be done when they undergo intracytoplasmic sperm injection.

  7. Prenatal Diagnosis and Genetic Analysis of a Fetus with 47,XX, +21/46,XX Mosaicism and XX/XY Chimerism

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2006-01-01

    Full Text Available Prenatal diagnosis of simultaneous occurrence of chimerism and autosomal mosaicism is extremely rare. We report the prenatal diagnosis and genetic analysis of a fetus in a twin pregnancy with mosaic 47,XX,+21/46,XX with chimeric XX/XY. A 36-year-old, para 1, woman was referred for genetic counseling at 20 weeks' gestation because of abnormal karyotype (47,XX,+21/46,XX in one fetus in a twin pregnancy. Cordocentesis revealed 47,XX,+21[3]/46,XX[35]/46,XY[7] in this fetus. Postnatal cytogenetic analysis of cord blood confirmed three cell lines in this twin (A and 46,XY in the co-twin (B. Postmortem pathologic findings of both fetuses were normal. Fluorescence in situ hybridization identified three cell lines in the cord blood of twin A. Molecular genetic analysis using polymorphic DNA markers revealed parental origin of fetal tissue, and confirmed the chimeric status. Molecular genetic analysis with polymorphic DNA markers help to differentiate chimerism from mosaicism and define the origin of cell lines, which may have importance in genetic counseling.

  8. Guanacaste Geothermal Project. Technical prefeasibility report. Annex C. Electric resistivity

    Energy Technology Data Exchange (ETDEWEB)

    1976-12-01

    This report is the third of six annexes to the Summary Report on the First Phase of the Guanacaste Geothermal Project. The studies covered an area of 500 km/sup 2/ on the SW flanks of the Rincon de la Vieja and Miravalles volcanoes of the Guanacaste Volcanic Range in NW Costa Rica, and were aimed at locating zones of high geothermal gradient, and reconstruction of the stratigraphic column. The formations in the area under study can be grouped into six resistivity ranges, varying from less than 5 to more than 200 ohm-meters. Values from 200 to as high as 30,000 ohm-meters generally correspond to fractured and porous lavas, their fracturing and porosity, as well as their drainability, increasing with resistivity. The values above 100 ohm-meters were recorded in zones of recent lava flows, in spurs of the volcanoes Rincon de la Vieja and Santa Maria, and in the slopes of the Miravalles volcano, and correspond to shallow formations (maximum depths of 150 meters) which may constitute recharge zones for the underground aquifiers. The values in the 100 to 200 ohm-meter range were generally recorded directly under layers constituted by drained, porous lavas, or under shallow layers where no recent lavas are present. The third group comprises materials with resistivities in the 25 to 100 ohm-meter range, occurring at two different depth levels: a deep one (more than 1000 meters) and a shallow one (less than 400 meters). Resistivities less than 25 ohm-meters were recorded at depths of 250 meters and more, and may correspond to material typical of the Aguacate formation, which probably constitutes the reservoir rock of the geothermal fluids. In order to locate the zones of most geothermal interest, this range was classified into the three remaining of the six groups, viz 10 to 25, 5 to 10, and less than 5 ohm-meters, the last group appearing to be that of greatest geothermal potential.

  9. 49 CFR 1242.36 - Machinery repair and equipment damaged (accounts XX-26-40 and XX-26-48).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Machinery repair and equipment damaged (accounts XX-26-40 and XX-26-48). 1242.36 Section 1242.36 Transportation Other Regulations Relating to... FOR RAILROADS 1 Operating Expenses-Equipment § 1242.36 Machinery repair and equipment...

  10. Clinical Observation on Abdominal Cluster-Needling for Treatment of Chronic Annexitis

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@Chronic annexitis is a frequently encountered disease at clinic. According to clinical experience in acupuncture treatment of annexitis, the author has developed an effective acupuncture method called abdominal cluster-needling, with quite good therapeutic results as reported in the following. Clinical Data There were altogether 66 cases of chronic annexitis in this series, which were divided randomly into the treatment group and control group. The treatment group consisted of 36 cases, ranging in age from 20-40 years, and duration of illness from 0.5-9 years. The control group consisted of 30 cases, ranging in age from 21-38 years, and duration of illness from 1-8 years.

  11. décadas del siglo XX

    Directory of Open Access Journals (Sweden)

    Luis Antonio Cruz Soto

    2003-01-01

    Full Text Available En este trabajo haremos referencia a los principales cambios que experimentó el sector siderúrgico mundial a partir de los años setenta, principalmente en al ámbito económico, tecnológico y comercial. El incremento de la sobreoferta de productos siderúrgicos, la reducción en su demanda, los adelantos tecnológicos en la producción de acero, la incorporación de nuevos competidores en el mercado mundial —sobre todo de pequeños productores y de los países del exbloque socialista— y el significativo aumento del intercambio comercial entre los países representan los principales elementos de análisis para definir el desarrollo de la industria siderúrgica en las últimas décadas del siglo xx

  12. 78 FR 57323 - York River and the Naval Weapons Station Yorktown-Cheatham Annex, Yorktown, Virginia; Danger Zone

    Science.gov (United States)

    2013-09-18

    ...-Cheatham Annex, Yorktown, Virginia; Danger Zone AGENCY: U.S. Army Corps of Engineers, DoD. ACTION: Notice... establish a danger zone in the waters of the York River off Cheatham Annex, in York County, Virginia. The... Marine Corps units. The proposed danger zone is necessary to protect the public from hazards...

  13. 75 FR 20364 - Public Buildings Service; Key Largo Beacon Annex Site; Key Largo, FL; Transfer of Property

    Science.gov (United States)

    2010-04-19

    ... From the Federal Register Online via the Government Publishing Office GENERAL SERVICES ADMINISTRATION Public Buildings Service; Key Largo Beacon Annex Site; Key Largo, FL; Transfer of Property..., identified as Key Largo Beacon Annex Site, Key Largo, FL to the U.S. Fish and Wildlife Service, Department...

  14. Annex 2: Simulation of the whole system - Calibration using measured data; Annexe 2: simulation du systeme complet et calibrage sur les mesures

    Energy Technology Data Exchange (ETDEWEB)

    Pahud, D.

    2006-12-15

    This is the Annex 2 of the annual report 2006 of the Serso project. The basic idea of the Serso project is to defrost a road bridge in winter with heat produced by the bridge in summer by solar radiation absorption and stored in a diffusive underground store. Pipes are imbedded in the bridge surface material and connected to a set of underground borehole heat exchangers ('geothermal probes'). A heat transfer fluid is circulated by a pump. The store is loaded in summer and discharged in winter. In the present Annex the mathematical model developed to simulate the whole system is described. It includes the validated simulation model of the underground heat store (see Annex 1). The parameters of the model are tuned on the basis of a two-years series of field measurements. Although the measured quantities do not include essential variables like the sky temperature and the bridge model is one-dimensional, the model satisfactorily describes the energy balance of the bridge.

  15. Sry-negative XX sex reversal in a French Bulldog.

    Science.gov (United States)

    Campos, M; Moreno-Manzano, V; García-Roselló, M; García-Roselló, E

    2011-02-01

    Here, we describe a 3-month-old XX male French Bulldog. The diagnosis was based on the clinical signs, gonadal histology and cytogenetic analysis. Additionally, the dog was confirmed to be Sry negative by semi-quantitative reverse transcription polymerase chain reaction (sqRT-PCR). Canine Sry-negative XX sex reversal is a disorder of gonadal development where individuals who have a female karyotype develop testes or ovotestes. To our knowledge, this case is the first XX male sex reversion described in a French Bulldog.

  16. Paul Scherrer Institut annual report 1994. Annex IIIA: PSI condensed matter research and material sciences

    Energy Technology Data Exchange (ETDEWEB)

    Baltensperger, U. [ed.] [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1995-10-01

    This annex reports on the PSI division IIIA`s progress achieved during 1994 in the Laboratory of Ionbeam-Physics, the Laboratory of Radiochemistry; the Laboratory for Neutron Scattering and the Laboratory for Astrophysics. Progress of the spallation neutron source project (SINQ) is documented by a set of pictures. A bibliography of the department`s publications is included. figs., tabs., refs.

  17. IEA SHC Task 42/ECES Annex 29–Working Group B

    DEFF Research Database (Denmark)

    van Helden, Wim; Yamaha, Motoi; Rathgeber, Christoph

    2016-01-01

    The IEA joint Task 42 / Annex 29 is aimed at developing compact thermal energy storage materials and systems. In Working Group B, experts are working on the development of compact thermal energy storage applications, in the areas cooling, domestic heating and hot water and industry. The majority ...

  18. HAM-Tools – a whole building simulation tool in Annex 41

    DEFF Research Database (Denmark)

    Kalagasidis, Angela Sasic; Rode, Carsten; Woloszyn, Monika

    2008-01-01

    HAM-Tools is a building simulation software. The main task of this tool is to simulate transfer processes related to building physics, i.e. heat, air and moisture transport in buildings and building components in operating conditions. The scope of the ECBCS Annex 41 “Whole Building Heat, Air and ...

  19. Advanced Supermarket Refrigeration - Heat Recovery Systems. Annex 26. Final report. Volume 2. Country reports

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-04-01

    Annex 26 has produced three deliverables: (1) Workshop (October 2000) proceedings Stockholm, Sweden, on CD-ROM (HPP-AN26-1); (2) Final report, Volume 1, Executive Summary, as report (HPP-AN26-2); and (3) Final report, Volume 2, Country reports (described in this record). Each of these reports, available from the HPC, provide valuable information for practitioners (designers, installers) and manufacturers of supermarket refrigeration systems. Annex 26 is the first international project under the IEA Heat Pump Programme that links refrigeration and heat pump technology. Recovering heat from advanced supermarket refrigeration systems for space and water heating purposes seems obvious and is beneficial for owners and operators. Because there are world-wide a great number of supermarkets that offer frozen and chilled food and further growth of this sector may be expected, the amount of energy used for refrigeration is enormous and will likely increase substantially in the near future. Annex 26 analysed several advanced supermarket refrigeration systems and came to remarkable conclusions as far as energy conservation and TEWI reduction is concerned. The conclusions justify that advanced supermarket systems with heat recovery should receive great attention and support. And there is still further research needed in several areas. The Annex also included a thorough system cost analyses and proposals for cost reductions are given.

  20. Advanced Supermarket Refrigeration - Heat Recovery Systems. Annex 26. Final report. Volume 1. Executive summary

    Energy Technology Data Exchange (ETDEWEB)

    Baxter, Van D. (ed.) [Oak Ridge National Laboratory ORNL, Oak Ridge, TN (United States)

    2003-04-01

    Annex 26 has produced three deliverables: (1) Workshop (October 2000) proceedings Stockholm, Sweden, on CD-ROM (HPP-AN26-1); (2) Final report, described in this record; and (3) Final report, Volume 2, Country reports, on CD-ROM (HPP-AN26-3). Each of these reports, available from the HPC, provide valuable information for practitioners (designers, installers) and manufacturers of supermarket refrigeration systems. Annex 26 is the first international project under the IEA Heat Pump Programme that links refrigeration and heat pump technology. Recovering heat from advanced supermarket refrigeration systems for space and water heating purposes seems obvious and is beneficial for owners and operators. Because there are world-wide a great number of supermarkets that offer frozen and chilled food and further growth of this sector may be expected, the amount of energy used for refrigeration is enormous and will likely increase substantially in the near future. Annex 26 analysed several advanced supermarket refrigeration systems and came to remarkable conclusions as far as energy conservation and TEWI reduction is concerned. The conclusions justify that advanced supermarket systems with heat recovery should receive great attention and support. And there is still further research needed in several areas. The Annex also included a thorough system cost analyses and proposals for cost reductions are given.

  1. Environmental Effects of Marine Energy Development Around the World. Annex IV Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Copping, Andrea [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Hanna, L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Whiting, J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Geerlofs, S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Grear, M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Blake, K. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Coffey, A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Massaua, M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Brown-Saracino, J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Battey, H. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2013-01-01

    This Annex IV report contains three case studies of specific interactions of marine energy devices with the marine environment addressing the physical interactions between animals and tidal turbines, the acoustic impact of marine energy devices on marine animals, and the effects of energy removal on physical systems.

  2. Implementation of Energy Strategies in Communities – Results within the Context of IEA Annex 63

    DEFF Research Database (Denmark)

    Schiefelbein, Jan; Slotterback, Carissa S.; Petersen, Jens-Phillip

    . However, findings of the International Energy Agency (IEA) Annex 51 – Case Studies & Guidelines for Energy Efficient Communities – showed that the primary challenges result from inefficient organizational processes and unsupportive framework for implementation. Thus, solutions have to be found how...

  3. 33 CFR 151.32 - Special areas for the purpose of Annex II.

    Science.gov (United States)

    2010-07-01

    ... Protection to the Antarctic Treaty as it Pertains to Pollution from Ships Noxious Liquid Substance Pollution..., the special areas are the Baltic Sea area, the Black Sea area, and the Antarctic area which are... in the Antarctic area. (b) In accordance with paragraph (13)(a) of Regulation 5 of Annex II of...

  4. Comparison of turbulence models for numerical calculation of airflow in an annex 20 room

    DEFF Research Database (Denmark)

    Voigt, Lars P. K.

    2000-01-01

    The report deals with 2-D numerical calculation of room airflow in an isothermal annex 20 room. The report documents the ability of the flow solver EllipSys2D to give results in good agreement with measurements for the specified test case. The flow solver is a finite volume code solving...

  5. 49 CFR 1242.19 - Electric power systems (account XX-19-21).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Electric power systems (account XX-19-21). 1242.19... Structures § 1242.19 Electric power systems (account XX-19-21). Separate common expenses on basis of common expenses of electric power purchased or produced for motive power (accounts XX-51-68 and XX-52-68)....

  6. Kirberg: Testigo y Actor del Siglo XX

    Directory of Open Access Journals (Sweden)

    Francisco Rivera Tobar

    2011-05-01

    Full Text Available La existencia de ideologías que encarnaron proyectos de transformación global de las sociedades, y el carácter excluyente de las mismas, constituyeron una de las principales características del siglo XX. La sociedad chilena estuvo inserta en esta tendencia, forjándose en ella diversos cuestionamientos a la realidad local. Por ejemplo, a los grandes problemas derivados de la post Primera Guerra Mundial y a la crisis del capitalismo en la década de 1930, por señalar dos acontecimientos que impactaron fuertemente en la economía y sociedad chilena, sucedió un afán industrializador destinado a equilibrar el carácter primario exportador y precariamente tecnificado de las economías tercermundistas, condiciones que las situaban en una relación de dependencia respecto de los centros del capitalismo mundial. Así, el debate teórico de los años 40 giró en torno a la necesidad de impulsar proyectos de desarrollo de la industria local para satisfacer el consumo del mercado interno...

  7. En tres etapas del siglo XX

    Directory of Open Access Journals (Sweden)

    Ana Josefina Cuevas Hernández

    2007-01-01

    Full Text Available El ensayo hace un análisis del impacto del turismo en la producción artesanal de Tlaquepaque, Jalisco, México, en tres etapas del siglo XX a través de las memorias de dos linajes de artesanos originarios de Tlaquepaque de cuatro generaciones cada uno y de literatura de otras disciplinas. El propósito es hacer una crítica del papel del Estado mexicano y del turismo en la actividad artesanal, así como en la desaparición y nacimiento de nuevos ofi cios y artesanías. Este texto contribuye a la discusión del papel de la producción artesanal y el turismo en la construcción de la identidad mexicana a través del análisis de la memoria y de la narrativa oral usando enfoques metodológicos cualitativos. Por medio de éstos la autora muestra el potencial de la historia oral y de las historias de familia en la reconstrucción de escenarios más complejos en donde los factores económicos, culturales, sociales y políticos del país encuentran sentido.

  8. las poetas mexicanas del siglo XX

    Directory of Open Access Journals (Sweden)

    Gloria Vergara

    2005-01-01

    Full Text Available Hablar de las poetas mexicanas de nuestros días implica, desde luego, preguntarse por lo que significa “ser mujer” desde la poesía misma, pero, ¿qué tanto ha cambiado en la crítica literaria, esta definición? Los estudios de género nos muestran un péndulo que va de lo radicalmente diferente, en donde se habla incluso de una pretendida “invasión” de roles, hasta el sentido fragmentario, en el que la identidad es sólo un asomo del cuerpo, del gesto, de la mirada en el múltiple escenario de la cultura. El presente ensayo aborda esta problemática desde la obra de las principales poetas mexicanas del siglo XX; se trata de un ejercicio hermenéutico, basado en las ideas de Roman Ingarden sobre el mundo representado en La obra de arte literaria y en la noción de identidad de Néstor García Canclini publicados en Identidades en movimiento y Palabra en movimiento.

  9. Environmental effects of marine energy development around the world. Annex IV Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Copping, Andrea; Hanna, Luke; Whiting, Johnathan; Geerlofs, Simon; Grear, Molly; Blake, Kara (Pacific Northwest National Laboratory, Richland, WA (United States)); Coffey, Anna; Massaua, Meghan; Brown-Saracino, Jocelyn; Battey, Hoyt (US Dept. of Energy, Washington, DC (United States))

    2013-01-15

    Annex IV is an international collaborative project to examine the environmental effects of marine energy devices among countries through the International Energy Agency’s Ocean Energy Systems Initiative (OES). The U.S. Department of Energy (DOE) serves as the Operating Agent for the Annex, in partnership with the Bureau of Ocean Energy Management (BOEM; formerly the Minerals Management Service), the Federal Energy Regulatory Commission (FERC), and National Oceanographic and Atmospheric Administration (NOAA). Numerous ocean energy technologies and devices are being developed around the world, and the few data that exist about the environmental effects of these technologies are dispersed among countries and developers. The purpose of Annex IV is to facilitate efficient government oversight of the development of ocean energy systems by compiling and disseminating information about the potential environmental effects of marine energy technologies and to identify methods of monitoring for these effects. Beginning in 2010, this three-year effort produced a publicly available searchable online database of environmental effects information (Tethys). It houses scientific literature pertaining to the environmental effects of marine energy systems, as well as metadata on international ocean energy projects and research studies. Two experts’ workshops were held in Dublin, Ireland (September 2010 and October 2012) to engage with international researchers, developers, and regulators on the scope and outcomes of the Annex IV project. Metadata and information stored in the Tethys database and feedback obtained from the two experts’ workshops were used as resources in the development of this report. This Annex IV final report contains three case studies of specific interactions of marine energy devices with the marine environment that survey, compile, and analyze the best available information in one coherent location. These case studies address 1) the physical interactions

  10. Estimating the cost of accidents and ill-health at work : a review of methodologies technical annex

    NARCIS (Netherlands)

    Weerd, M. de; Tierney, R.; Duuren-Stuurman, B. van; Bertranou, E.

    2014-01-01

    This technical annex complements the report 'Estimating the cost of accidents and ill-health at work - a review of methodologies' by providing further details on each of the studies reviewed, including their results.

  11. APPLICATION OF THE ANNEXATION PRINCIPLE TO THE STUDYOF THERMODYNAMIC PROPERTIES OF TERNARY METALLICMELTS Cd-Pb-Sb

    Institute of Scientific and Technical Information of China (English)

    J. Zhang

    2001-01-01

    Based on the phase diagrams, measured activities and the annexation principle, the calculating models of mass action concentrations for Cd-Pb, Pb-Sb and Cd-Sb binary as well as Cd-Pb-Sb ternary metallic melts have been formulated. The results of calculation both agree with practice and obey the mass action law. This in turn testifies that the models formulated can reflect the structural reality of corresponding melts and the annexation principle is applicable to these melts.``

  12. Application of Annexation Principle in Investigation of Thermodynamic Property of Ternary Metallic Melt Fe-Cr-Ni

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Based on the phase diagrams,the measured activities and the principle of annexation, a calculation model for mass action concentrations of Fe-Cr-Ni melts, has been formulated. The calculated results not only agree well with measured values, but also obey the law of mass action. It showed that the model can reflect the structural reality of given melts and the principle of annexation is applicable to the ternary metallic melts.

  13. IEA-ECBCS Annex 51: energy efficient communities. Experience from Denmark

    DEFF Research Database (Denmark)

    Dalla Rosa, Alessandro; Svendsen, Svend

    2011-01-01

    The paper describes the Danish contribution to the IEA-ECBCS Annex 51: “energy efficient communities”. We present three case studies, two from Annex subtask A (state-of-the-art review) and one from subtask B (ongoing projects). The first case study is “Samsoe: a renewable energy island......”. The community achieved a net 100% share of renewable energy in its total energy use, relying on available technical solutions, but finding new ways of organizing, financing and ownerships. The second project is “Concerto class I: Stenloese Syd”. The buildings in the settlement are low-energy buildings class I...... neighbourhood in Lystrup, Denmark”. The project integrates sustainable solutions both for the building sector and the energy supply side, which in the case consists on a low-temperature district heating network. The analysis of the successful/unsuccessful factors in the projects contributes to develop...

  14. CNEN's standards - Annex A; Normas da CNEN - Anexo A

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-11-15

    This annex presents the list of the CNEN's standards as well as the CNEN's address site, where the standards can be read and downloaded. They area related to Nuclear Facilities; Control of Nuclear Materials, Physical Protection and Against Fire; Radiation Protection; Nuclear materials, ores and minerals; Transport of Radioactive Materials; Radioactive Facilities; Certification and Personal Register; Radioactive Wastes and Decommissioning.

  15. The Situation of National Minorities in Crimea Following its Annexation by Russia

    OpenAIRE

    2016-01-01

    National minorities in Crimea have been subject to systematic violations of their rights since the illegal annexation of Crimea by Russia on 18 March 2014. Documented violations have occurred in the areas of freedom of expression, conscience, and religion; the right to peaceful assembly and association; freedom of the media and access to information; the right to a fair trial and effective remedy; the right to education in one’s native language; and linguistic and cultural rights. The de fact...

  16. Hidden in Plain Sight: La Jolla / UTC Annex, An-Edge City

    OpenAIRE

    Miller, Charles G.

    2010-01-01

    Hidden In Plain Sight: La Jolla / UTC Annex, An Edge-City is an inter-textual project (combining theoretical and historical inquiry with performative intervention and documentary filmmaking) that critically investigates the developmental landscape adjacent to the UCSD campus. Via a self-implicating and performative research methodology, the project endeavors to develop a reflexive counter-genealogy and counter-ontology of what Joel Garreau might identify and gleefully laud as "Edge City" in h...

  17. Germany’s Anschluss with Austria and Russia’s Annexation of Crimea: An Analytical Comparison

    Science.gov (United States)

    2016-06-01

    ANNEXATION OF CRIMEA: AN ANALYTICAL COMPARISON Peter D. Church Lieutenant, United States Navy B.A., University of Colorado, Boulder, 2008...references and comparisons to Hitler in the media are effective in portraying authoritarian leaders as aggressive due to the near- universal recognition...political figures and the anti-Semitic, xenophobic, Pan-German doctrine they espoused.46 A young, impressionable painter in the men’s hostels , Hitler

  18. Simulation with Different Turbulence Models in an Annex 20 Benchmark Test using Star-CCM+

    DEFF Research Database (Denmark)

    Le Dreau, Jerome; Heiselberg, Per; Nielsen, Peter V.

    The purpose of this investigation is to compare the different flow patterns obtained for the 2D isothermal test case defined in Annex 20 (1990) using different turbulence models. The different results are compared with the existing experimental data. Similar study has already been performed by Ro...... et al. (2008) using Ansys CFX 11.0. In this report, the software Star-CCM+ has been used....

  19. Auditorium: una tipología del siglo XX

    OpenAIRE

    García Pedrosa, Ignacio

    2016-01-01

    Se recoge en esta tesis doctoral la definición y clasificación de los edificios cuya finalidad es proporcionar espacios para escuchar y producir música. Se centra en aquellos construidos a lo largo del siglo XX, en el área geográfica y cultural que forman Europa occidental y Estados Unidos. Se analizan edificios construidos en el pasado, en una serie que se origina a mediados del siglo XIX y que se culmina terciado el propio siglo XX. Son edificios que contienen espacios pensados para músicas...

  20. La maquinaria agrícola en el siglo XX

    OpenAIRE

    Ruiz-Altisent, Margarita; Gil Sierra, Jacinto

    2000-01-01

    La evolución de la maquinaria agrícola en el siglo XX ha sido tan espectacular que, de los tres grandes avances habidos a lo largo de la historia de la maquinaria agrícola, dos de ellos podemos considerar que marcan el comienzo y el fin del siglo XX. El primer avance fundamental se dio el día en que el hombre que removía la tierra golpeándola con una herramienta tipo azada decidió avanzar con ella introducida en el suelo venciendo la fuerza de tiro. Nació así el arado en un tiempo indetermina...

  1. Entanglement in the XX Spin Chain with Energy Current

    CERN Document Server

    Eisler, V

    2004-01-01

    We consider the ground state of the XX chain which is constrained to carry a current of energy. The von Neumann entropy of a block of $L$ neighboring spins, describing entanglement of the block with the rest of the chain, is computed. Recent calculations have revealed that the entropy in the XX model diverges logarithmically with the size of the subsystem. We show that the presence of the energy current increases the prefactor of the logarithmic growth. This result indicates that the emergence of the energy current gives rise to an increase of entanglement.

  2. A Comprehensive Child Development Program; Title XX, Final Report.

    Science.gov (United States)

    Whatley, Juanita T.

    This booklet describes the Comprehensive Child Day Care Program for the Atlanta Public School System, a Title XX Program. This program provided day care services for children of clients in various categories. The program goals for 1975-76 were geared toward providing comprehensive day care to encompass social services to the family and…

  3. Tokyo XX videofestival ja kohtumine Suure Hiirega / Raivo Kelomees

    Index Scriptorium Estoniae

    Kelomees, Raivo, 1960-

    1998-01-01

    JVC Tokyo XX videofestivalist. Peapreemia Jon Alpertile dokumentaalse videoga "Life of Crime : Deleris's Sad Story". R. Kelomehe videost "Maja". Interaktiivse kunsti muuseumist ICC (Inter Communication Center) Tokyo Opera Citys. Ilmunud ka kogumikus "Ekraan kui membraan". Tartu, 2007, lk. 72-75

  4. A healthy, female chimera with 46,XX/46,XY karyotype.

    NARCIS (Netherlands)

    Binkhorst, M.; Leeuw, N. de; Otten, B.J.

    2009-01-01

    We report a healthy and unambiguously female newborn, whose phenotypic sex contradicted the expected male sex based on previously performed prenatal cytogenetic analysis. Both 46,XX and 46,XY cells were detected in a villus sample, the former having been attributed to maternal cell contamination. Po

  5. Hacia una historia de la literatura del siglo XX

    Directory of Open Access Journals (Sweden)

    Estanislao Gostautas

    1962-04-01

    Full Text Available Son muy pocos los ensayos que se han hecho sobre la literatura del siglo XX, y estos harto incompletos. Casi podría decirse que una época tan floreciente en novela y ensayo permanece más desconocida para el común de los intelectuales como les es conocida (? la literatura del siglo pasado.

  6. Overview of International Energy Agency Annex 18 on evaluation of integrated hydrogen energy systems

    Energy Technology Data Exchange (ETDEWEB)

    Miles, S. [Natural Resources Canada, Ottawa, ON (Canada); Schoenung, S. [Longitude 122 West Inc., Menlo Park, CA (United States); Dube, J. [Services Mij Inc., Ste. Thecle, Quebec, (Canada); Ulleberg, O. [Inst. of Energy Technology, Halden (Norway); Weeda, M. [Energy Research Center of the Netherlands, Petten (Netherlands)

    2007-07-01

    Hydrogen and fuel cell technologies have the potential to break the link between transportation and carbon dioxide emissions. As part of Annex 18, the International Energy Agency (IEA) provides information about hydrogen integration into society by providing data and analysis to the hydrogen community; evaluating hydrogen demonstration projects in member countries; and, synthesizing the lessons learned from projects. This paper presented projects that were motivated by the use of clean, renewable energy to produce hydrogen with reduced carbon emissions. Annex 18 has been underway since January 2003. Demonstration systems involving vehicle refuelling stations and electric power systems in different member countries were evaluated in the first phase of Annex 18 through detailed modeling and documentation. These projects included hydrogen refueling stations in Sweden, Iceland and Canada; a PV/MH-telecom showcase in Madrid, Spain; a regenerative PEM FC-power system in Aichi, Japan; a hydrogen and renewables integration (HARI) system in Leistershire, United Kingdom; a hydrogen from the sun/ecological house in Brunate, Italy; an RES2H2 wind-hydrogen project in Athens, Greece; a combined wind/hydrogen desalination plant in the Canary Islands, Spain; a renewable hydrogen system at a remote site Totara Valley, New Zealand; and, a hydrogen power park with combined wind and geothermal electricity generation in Hawaii, United States. Phase 2 and is now scheduled to continue through December 2009. It will involve an accounting of the emissions in order to quantify the carbon reductions. Participants will continue to evaluate the performance of these demonstration systems and determine how the use of hydrogen can mitigate climate change in the future. The final phase will determine best practices and general lessons learned regarding the commercialization and operation of integrated hydrogen systems. 7 refs., 2 tabs., 13 figs.

  7. IEA Implementing Agreements and Annexes: A Guide for Building Technologies Program Managers

    Energy Technology Data Exchange (ETDEWEB)

    Evans, Meredydd; Meier, Alan; Runci, Paul J.

    2008-08-05

    This guide presents insights and guidance from DOE’s gathered through longstanding and extensive participation in IEA implementing agreements (IAs) and annexes. Even though DOE has been a key participant in international research activities through the IEA since the 1970s, the experience, knowledge, and institutional memory associated with these activities can be lost or forgotten easily as key DOE managers retire or leave the department. The guide seeks to assemble in a single reference some of the learning that has occurred through participation in IEA IAs as a guide for BTP managers currently responsible for IAs and for those who might consider entering into new IEA activities in the future.

  8. International Conference on Harmonisation; guidance on Q8(R1) Pharmaceutical Development; addition of annex; availability. Notice.

    Science.gov (United States)

    2009-06-09

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "Q8(R1) Pharmaceutical Development." The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The ICH Q8(R1) guidance includes the previously published parent guidance entitled "Q8 Pharmaceutical Development" (Q8 parent guidance) (71 FR 29344; May 22, 2006) and a newly added annex. The annex provides further clarification of key concepts outlined in the Q8 parent guidance and describes the principles of quality by design (QbD). The annex is intended to show how concepts and tools (e.g., design space) outlined in the Q8 parent guidance could be put into practice by the applicant for all dosage forms.

  9. Daylighting monitoring protocols and procedures for buildings. A report of Task 21/Annex 29. Daylight in buildings

    Energy Technology Data Exchange (ETDEWEB)

    Atif, M.R. [National Research Council, Inst. for Research in Construction, Indoor Environment Research Program (Denmark); Love, J.A. [Univ. of Calgary, Faculty of Environmental Design (Canada); Littlefair, P. [Building Research Establishment, Lighting and Applied Vision Section (United Kingdom)

    1997-10-01

    This official IEA report is a deliverable of IEA SHC Task 21/IEA BCS Annex 29: Daylight in Buildings. The Task focuses on daylighting systems and strategies which can be applied in new and existing buildings with a high potential electricity saving potential such as offices, schools, commercial, and institutional buildings. The daylighting performance of these strategies and systems is tested in laboratory facilities, through modeling, and in real case study buildings. This paper provides methods and procedures to evaluate the daylighting performance of real buildings. Annex 29 case studies located in Europe, North America, and Australia. It is a deliverable of Subtask D research projects. The main objective of Subtask D, as stated in the Implementing Agreement of Task 21/Annex 29, is `to demonstrate the viability of daylighting buildings in various world climatic zones as a means of achieving significant improvements in building energy efficiency while maintaining a satisfactory visual and thermal environment for occupants`. (au)

  10. An empirical case study of the transfer of GHG mitigation technologies from Annex 1 countries to Malaysia under the Kyoto Protocol’s Clean Development Mechanism (CDM)

    DEFF Research Database (Denmark)

    Hansen, Ulrich Elmer

    2011-01-01

    This study assesses what role the CDM currently plays in relation to the transfer of GHG mitigation technologies from Annex 1 countries to non-Annex 1 countries. The study relies on multiple sources of qualitative data and is conducted as a case study of 13 CDM projects implemented in Malaysia. I...

  11. Application of annexation principle to the study of thermodynamic properties of Ag-Bi-In metallic melts

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Based on the measured activities, the phase diagrams and the annexation principle, the calculating models of mass action concentrations for Ag-Bi and Ag-Bi-In melts have been formulated. The calculated results agree with practice and obey the mass action law,showing that the models formulated can reflect the structural characteristics of both melts. Meanwhile, it confirms that annexation principle is applicable to the Ag-Bi-In metallic melts. The melts involving eutectic which give rise to phase separation, and in which activities exhibit positive deviation from Raoult's law is the basic cause of melts transforming from homogeneous to heterogeneous ones.

  12. Study of grain compositions in comet Levy 1990XX

    CERN Document Server

    Das, H S; Sinha, B K; Sen, A K

    2007-01-01

    In the present work, the non-spherical dust grain characteristics of comet Levy 1990XX with different silicate grain compositions (both pyroxene and olivine) are studied using the T-matrix method. Considering amorphous pyroxene grain (Mg$_x$Fe$_{1-x}$SiO$_3$) with $x$ (= 0.4, 0.5, 0.6, 0.7, 0.8, 0.95, 1) and amorphous olivine grain (Mg$_{2y}$Fe$_{2-2y}$SiO$_4$) with $y$ (= 0.4, 0.5) (Dorschner et al. 1995), the observed polarization data of comet Levy1990XX are analyzed using the T-matrix code at $\\lambda$ = 0.485 $\\mu m$.

  13. La Meteorologia a Ferrara dal XVIII al XX secolo

    Directory of Open Access Journals (Sweden)

    Clelia Caracciolo

    2009-03-01

    Full Text Available The meteorology is the science studying the physical phenomena responsible of the weather. The history of meteorology has endured in the centuries a long and laborious process; this discipline is considered a Science only in the XIX century. This study focuses on the researchers who made the history of meteorology in the University of Ferrara (Italy. The teaching, the researches, the effort for the development are reconstructed for the first time from archive documents, with references to the general history of meteorology. The article focuses the attention on the period between XVIII and XX century. This work is a continuation of a more extended research started a few years ago, and still in action, on the history of experimental physics in the University of Ferrara. [The Meteorology in Ferrara from XVIII to XX century

  14. Proceedings of the IEA implementing agreement on photovoltaic power systems. Annex 4 workshop

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-01-01

    The International Energy Agency (IEA) Implementing Agreement on Photovoltaic Power Systems (PVPS), established in 1993, is a collaborative effort of sponsoring countries to reduce costs of technology applications, increase awareness of potential value, and foster market deployment of PV. Task 4, the Modeling of Distributed Photovoltaic Power Generation in Support of the Electric Grid, is one of six project work areas established under the Implementing Agreement. The work under Task 4 has been assigned to Annex 4. Although Task 4 was framed in 1993, no progress had been made in implementation as of mid-1995. The Annex 4 Workshop, described herein, was a focused effort by the participants to redefine the issuer in light of today`s knowledge, and to gain interest among potential collaborators and participants. The purpose of the workshop was to determine the current status of methods for evaluating the benefits of and planning for grid-connected PV systems and to establish a plan for further action according to the needs and priorities of participants.

  15. 49 CFR 1242.28 - Roadway machines, small tools and supplies, and snow removal (accounts XX-19-36 to XX-19-38...

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Roadway machines, small tools and supplies, and... PASSENGER SERVICE FOR RAILROADS 1 Operating Expenses-Way and Structures § 1242.28 Roadway machines, small tools and supplies, and snow removal (accounts XX-19-36 to XX-19-38, inclusive). Separate...

  16. 78 FR 27982 - U.S. Flag Compliance With MARPOL Annex VI International Energy Efficiency (IEE) Requirements

    Science.gov (United States)

    2013-05-13

    ... SECURITY Coast Guard U.S. Flag Compliance With MARPOL Annex VI International Energy Efficiency (IEE... issuance of an International Energy Efficiency Certificate and the preparation of a Ship Energy Efficiency... Energy Efficiency Design Index. These requirements apply to all U.S. flag ships 400 gross tonnage...

  17. Paul Scherrer Institut annual report 1994. Annex II: PSI life sciences and institute for medical radiobiology newsletter 1994

    Energy Technology Data Exchange (ETDEWEB)

    Reist, H.W. [ed.] [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1995-10-01

    This annex reports on the PSI life science division`s progress achieved during 1994 in the fields of radiation medicine, radiopharmacy, magnetic resonance imaging, radiation hygiene, positron emission tomography (PET) and medical radiology. A bibliography of the department`s publications is included. figs., tabs., refs.

  18. The integrated engineering system for the HVAC branch. Annex; Das integrierte Ingenieursystem fuer die Haustechnikbranche; Anhang

    Energy Technology Data Exchange (ETDEWEB)

    Allenspach, J.; Duppenthaler, A.; Helbling, R.; Kohler, T.; Mantel, R.; Meineke, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1994-01-01

    In 1987, the intention of the former Swiss Federal Institute for Reactor Research was to initiate a transfer of know-how into practice by launching this project. The increasing need for software engineering tools by heating, ventilation and air conditioning (HVAC) companies demanded a new tool; to realise it, a joint venture project with private industry should concentrate the individual capabilities of each partner toward this goal. The present report describes the concept of the integrated engineering system, its user interface, the models, graphics, tools, multiuser operation and the system boundary. Results of field tests are presented together with information of the availability of the system. The annex contains the agreement for the usage of the public-domain-version of the system, experience reports of pilot clients and the end user`s and developer`s documentation. (author) figs., tabs., refs.

  19. Roadmap NRK 2012-2030. Annex; Routekaart NRK 2012-2030. Bijlage

    Energy Technology Data Exchange (ETDEWEB)

    Krebbekx, J.; Duivenvoorde, G.; De Wolf, W. [Berenschot Groep, Utrecht (Netherlands); Lenselink, J. [Energy Experts International, Huissen (Netherlands)

    2012-01-15

    This roadmap identifies how RKI companies (rubber and synthetic materials) can create new revenue opportunities: development of sustainable products, switching from petroleum to carbon chains from biobased materials, closing the material chain (reuse/recycling). Also within their own organizations more efficiency can be achieved by continuing to invest in innovation in processes and innovation in the organization itself. A selective overview is given of innovation projects. This report is a separate annex to the main report [Dutch] In deze routekaart wordt aangegeven op welke wijze RKI-bedrijven (rubber en kunststoffen) nieuwe omzetkansen kunnen creeren: ontwikkelen van duurzame producten; overschakelen van aardolie naar koolstofketens uit biobased materialen; sluiten van de materiaalketen (hergebruik/recycling). Ook binnen de eigen organisatie kan er meer rendement worden behaald door te blijven investeren in innovatie in de eigen processen en innovatie in de eigen organisatie. Er is een overzicht gegeven van alle mogelijke verzamelde en geselecteerde innovatieprojecten. Deze publikatie is een aparte bijlage bij het hoofdrapport.

  20. Ionizing radiation and legislation for personnel - Annex B; Radiacoes ionizantes e legislacao para trabalhadores - Anexo B

    Energy Technology Data Exchange (ETDEWEB)

    Delgado, Jose Ubiratan [Instituto de Radioprotecao e Dosimetria (LNMRI/IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. Nacional de Metrologia das Radiacoes Ionizantes

    2013-11-15

    This annex B presents a chronological approach on the set of laws related to the ionizing radiation personnel. This paper aims to discuss and clarify the main concepts that constitute the current legislation, pointing the scope of each, as well as its ambiguities or inaccuracies. The consequences of those issues discussed are easily noticeable related to difficulties in legal, administrative and human resource management, when seeking their efficient application. We also discuss issues associated with the extent and frequency of the gradient of risk in 5, 10 and 20%, models for assessing potential exposure in a risk area, dose calculation and criteria for defining benefits and framework for irradiation, bonus for activity, special retirement and period of vacations for personnel occupationally exposed within Unified Legal System (Regime Juridico Unico) and the Consolidation of Labor Laws (CLT)

  1. Variance squeezing and entanglement of the XX central spin model

    Energy Technology Data Exchange (ETDEWEB)

    El-Orany, Faisal A A [Department of Mathematics and Computer Science, Faculty of Science, Suez Canal University, Ismailia (Egypt); Abdalla, M Sebawe, E-mail: m.sebaweh@physics.org [Mathematics Department, College of Science, King Saud University PO Box 2455, Riyadh 11451 (Saudi Arabia)

    2011-01-21

    In this paper, we study the quantum properties for a system that consists of a central atom interacting with surrounding spins through the Heisenberg XX couplings of equal strength. Employing the Heisenberg equations of motion we manage to derive an exact solution for the dynamical operators. We consider that the central atom and its surroundings are initially prepared in the excited state and in the coherent spin state, respectively. For this system, we investigate the evolution of variance squeezing and entanglement. The nonclassical effects have been remarked in the behavior of all components of the system. The atomic variance can exhibit revival-collapse phenomenon based on the value of the detuning parameter.

  2. Ismos y vanguardias del siglo XX (continuación

    Directory of Open Access Journals (Sweden)

    Rocamora, Carmen

    1999-06-01

    Full Text Available Not available.En enero de 1998, en el n.º 625 de Arbor, publiqué un extracto de mi libro Ismos y vanguardias S. XX. En él, describí solamente las más conocidas y aquellas que pudiesen captar la atención del lector de forma rápida y atractiva, dejando para este nuevo trabajo las vanguardias más controvertidas, menos conocidas y hasta ignoradas y rechazadas por el público.

  3. Ismos y vanguardias del siglo XX (continuación)

    OpenAIRE

    Rocamora, Carmen

    1999-01-01

    Not available.En enero de 1998, en el n.º 625 de Arbor, publiqué un extracto de mi libro Ismos y vanguardias S. XX. En él, describí solamente las más conocidas y aquellas que pudiesen captar la atención del lector de forma rápida y atractiva, dejando para este nuevo trabajo las vanguardias más controvertidas, menos conocidas y hasta ignoradas y rechazadas por el público.

  4. Synchronization of Modified Chua's Circuit with x|x| Function

    Institute of Scientific and Technical Information of China (English)

    TANG Fang; WANG Ling

    2005-01-01

    This paper considers the chaos synchronization of the modified Chua 's circuit with x|x| function. We firstly show that a couple of the modified Chua systems with different parameters and initial conditions can be synchronized using active control when the values of parameters both in drive system and response system are known aforehand.Furthermore, based on Lyapunov stability theory we propose an adaptive active control approach to make the states of two identical Chua systems with unknown constant parameters asymptotically synchronized. Moreover the designed controller is independent of those unknown parameters. Numerical simulations are given to validate the proposed synchronization approach.

  5. La Salud Pública al Final del Siglo XX

    OpenAIRE

    Bustíos Romaní, Carlos; Departamento de Medicina Preventiva y Salud Pública Facultad de Medicina Universidad Nacional Mayor de San Marcos Lima, Perú

    2014-01-01

    La Salud Pública se define como una respuesta colectiva, que se explica como parte de una totalidad histórico-sociaL En su evolución después de la 11 Guerra Mundial, se distin- guen dos fases de orientación contraria. Con la crisis de los '70, los gobiernos del mundo iniciaron reformas de sus sistemas de salud, y al final del Siglo XX, los rasgos de la socie- dad occidental validan la teoría de la modernidad de Habermas. En este contexto, se verifica una práctica de la Salud Pública subo...

  6. La historia del linfocito en el siglo XX

    OpenAIRE

    Rinaldi Catalá, Teresa

    2016-01-01

    Introducción. El linfocito como tal surge a principios del siglo XX, gracias a autores como Pappenheimer. Los trabajos que marcan su historia y sus implicaciones a nivel fisiológico y clínico, son objeto de estudio. Objetivos. Estudiar los acontecimientos que rodearon al descubrimiento del linfocito, indagar las fases del conocimiento sobre la célula linfocítica y constatar la valoración clínica (actual) sobre el linfocito. Material y métodos . Una vez verificada la viabilidad del proyecto, l...

  7. 49 CFR 1242.46 - Computers and data processing equipment (account XX-27-46).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Computers and data processing equipment (account XX-27-46). 1242.46 Section 1242.46 Transportation Other Regulations Relating to Transportation... RAILROADS 1 Operating Expenses-Equipment § 1242.46 Computers and data processing equipment (account XX-27-46...

  8. 49 CFR 1242.59 - Train inspection and lubrication (account XX-51-62).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Train inspection and lubrication (account XX-51-62). 1242.59 Section 1242.59 Transportation Other Regulations Relating to Transportation (Continued) SURFACE...-Transportation § 1242.59 Train inspection and lubrication (account XX-51-62). Separate common expenses on...

  9. 49 CFR 1242.86 - Industrial development (account XX-61-90).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Industrial development (account XX-61-90). 1242.86 Section 1242.86 Transportation Other Regulations Relating to Transportation (Continued) SURFACE....86 Industrial development (account XX-61-90). These accounts pertain solely to freight service...

  10. XX sajandi väärtarhitektuuri hakatakse kaitse alla võtma / Alo Lõhmus

    Index Scriptorium Estoniae

    Lõhmus, Alo

    2011-01-01

    Muinsuskaitseameti ja kultuuriministeeriumi käivitatud "Eesti XX sajandi arhitektuuri kaitsmise ja väärtustamise" projekti käigus valminud XX sajandi väärtarhitektuuri registrist, mis on eelduseks möödunud aastasaja huvitavamate ehitiste riikliku kaitse alla võtmisele

  11. 49 CFR 1242.55 - Administration (account XX-51-01).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Administration (account XX-51-01). 1242.55 Section 1242.55 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION...-Transportation § 1242.55 Administration (account XX-51-01). Separate common expenses according to distribution of...

  12. XX sajandi väärtarhitektuuri hakatakse kaitse alla võtma / Alo Lõhmus

    Index Scriptorium Estoniae

    Lõhmus, Alo

    2011-01-01

    Muinsuskaitseameti ja kultuuriministeeriumi käivitatud "Eesti XX sajandi arhitektuuri kaitsmise ja väärtustamise" projekti käigus valminud XX sajandi väärtarhitektuuri registrist, mis on eelduseks möödunud aastasaja huvitavamate ehitiste riikliku kaitse alla võtmisele

  13. 49 CFR 1242.10 - Administration-track (account XX-19-02).

    Science.gov (United States)

    2010-10-01

    ... accounts are separated between freight and passenger services: Roadway: Running (XX-17-10) Switching (XX-18-10) Ties: Running (21-17-13) Switching (21-18-13) Rails: Running (21-17-14) Switching (21-18-14) Other Track Materials: Running (21-17-15) Switching (21-18-15) Ballast: Running (21-17-16) Switching...

  14. Disorder of sex development (XX male, SRY negative) in a French bulldog.

    Science.gov (United States)

    Silversides, David W; Benoit, Jean-Marc; Collard, Fabien; Gilson, Catherine

    2011-06-01

    A female French bulldog was presented with an enlarged clitoris. Abdominal surgery revealed a normal uterus and gonads resembling testes. Histologically, the gonads contained seminiferous tubules. The karyotype was XX, and the SRY gene was not detected. A diagnosis of XX male, SRY negative disorder of sexual development was made.

  15. 49 CFR 1242.47 - Machinery (account XX-27-40).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Machinery (account XX-27-40). 1242.47 Section 1242.47 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION...-Equipment § 1242.47 Machinery (account XX-27-40). Separate common expenses on the basis of the...

  16. Next generation 9xx/10xx nm high power laser diode bars for multi-kilowatt industrial applications

    Science.gov (United States)

    Commin, Paul; Todt, René; Krejci, Martin; Bättig, Rainer; Brunner, Reinhard; Lichtenstein, Norbert

    2013-02-01

    We report on the development of high power, 9xx-10xx nm laser diode bars for use in direct diode systems and for solidstate and fibre laser pumping with applications in industrial markets. For 1 cm wide bars on micro channel cooler (MCC) we have achieved a reliable output power of 250 W across the 900 nm - 1060 nm range. At this output power level we have achieved power conversion efficiencies of 65-66 % and 90 % power content slow axis beam divergence of ~6.5°. Results of a 6400 h life test show an average power degradation of 0.6 % per 1000 h at this operating power level. We will also show results of high power bars assembled on the new OCLARO conductive cooler, the BLM. This new cooler has a small footprint of 12.6 mm × 24.8 mm and is designed for lateral or vertical stacking of diodes in multi kilowatt systems but with the benefits associated with a conductive cooler. The thermal properties are shown to be the same as for a standard CS mount. 1 cm wide high fill factor bars and 0.5 cm wide low fill factor half bars assembled on the BLM operate at 63-64 % power conversion efficiency (PCE) with output powers of up to 250 W and 150 W, respectively.

  17. Application of the annexation principle to the study of thermodynamic properties of ternary metallic melts In-Pb-Ag and In-Bi-Sb

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Based on the phase diagrams, measured activities and the annexation principle, the calculating models of mass action concentrations for In-Pb-Ag and In-Bi-Sb ternary metallic melts have been formulated. The results of calculation both agree with practice, and obey the law of mass action, showing that the models formulated can reflect the structural reality of the corresponding melts and the annexation principle is applicable to the them.

  18. Status pissatelja v russkoi literature XX veka : metropolija i diaspora : 24-26 sentjabrja 2004 g., Tartu / Roman Voitehhovitsh

    Index Scriptorium Estoniae

    Voitehhovitš, Roman, 1974-

    2005-01-01

    Tartu Ülikoolis toimus 6. konverents projekti raames "XX sajandi vene kirjandus: metropol ja diasporaa", teemaks "Kirjaniku staatus XX saj. vene kirjanduses: metropol ja diasporaa". Osa ettekandeid oli pühendatud Valeri Bezzubovi mälestusele

  19. The Geopolitics of Central Asia after the Annexation of Crimea in 2014

    Directory of Open Access Journals (Sweden)

    Razma Ainis

    2015-12-01

    Full Text Available The annexation of Crimea accomplished by Russia in 2014 is the event that stands out sharply in the context of post-Cold War international relations: it was the first time after the end of WWII in Europe that a part of the territory of a sovereign state was forcefully annexed. This means that the re-drawing of borders and revisionism are back in international relations as the principles and ways of policy making. It would be plausible to assume that the consequences of an event of such scale would be noticeable not only in its direct neighborhood but as well in more distant, though geopolitically sensitive contexts. The article explores the impact that Russia‘s Crimea campaign has had on the geopolitics of Central Asia and what consequences could be deemed plausible in the future. It is assumed that, due to the annexation of Crimea, international relations started polarizing around the two centers of power: the West and Russia. This trend brings the mentality of strategic confrontation back into international relations. The polarization seemingly becomes a geopolitical factor, which influences the power dynamics in Central Asia in its cultural-informational, military and economic aspects. From the cultural-informational perspective, the polarization is incompatible with the provisions of multivector foreign policies, and pursued by the Central Asian states; therefore, they attempt to neutralize the trend by withholding from taking clear-cut positions with regard to the Ukrainian events. Such a stance, however, does not provide for hedging against military threats, which are perceived as rather real in Central Asia because of the Russian modus operandi in Ukraine, as well as due to the seemingly catalyzing impact of current Russian policies on the local separatist forces and radical Islamic groups. Apprehension about a replication of a Crimean scenario as well as the asymmetric character of military threat may push the Central Asian states to

  20. Annex to Solar heat storages in district heating networks. Comprehensive list of Danish literature and R and D projects

    Energy Technology Data Exchange (ETDEWEB)

    Ellehauge, K. (Ellehauge og Kildemoes, AArhus (DK)); Engberg Pedersen, T. (COWI A/S, Kgs. Lyngby (DK))

    2007-07-15

    This annex relates to the report 'Solar heat storages in district heating networks', which has been elaborated to inform about the Danish experiences and findings on the use of central solar heating plants in district heating networks, especially with the focus on the development of the storage part of the systems. The report has been funded as part of the IEE PREHEAT cooperation and by Energinet.dk, project no. 2006-2-6750. (au)

  1. Evaluation report of the Nordic-Baltic annex to the INEX-2-FIN-exercise April 17, 1997

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-10-01

    Under the auspices of the NKS programme and as a part of EKO-4 project a special Nordic-Baltic emergency exercise was carried out. In order to rationalise exercise activities it was organised as an annex to the international INEX-2-FIN exercise arranged by the OECD/NEA on April 17, 1997. Some countries carried out simultaneous national exercises as well. Only the Nordic-Baltic exercise is discussed in this report. The objectives of the INEX-2-FIN exercise were to test real time information exchange, decision making based on plant conditions and real weather, and public information. These objectives determined the framework for the scenario and necessary scripts of the exercise. For the Nordic-Baltic annex of the exercise five more detailed objectives, subordinated to the INEX-2-FIN objectives, were defined by the planning group under EKO-4 project. Since the exercise was the first of this kind for the Baltic countries only one of the special objectives was designed for them, namely N4. An independent evaluators group, consisting of one member from each participating country plus a chairperson, was set to evaluate the Nordic-Baltic annex of the INEX-2-FIN exercise. However, because of lack of personnel in the Baltic countries the evaluators were the same persons as in the planning group. (au)

  2. [The Epistolarum medicinalium libri XX by Giovanni Mainardi].

    Science.gov (United States)

    Carrara, Daniela Mugnai

    2005-01-01

    The paper aims at highlighting some aspects of the Epistolarum medicinalium libri XX by Giovanni Mainardi. This work, that enjoyed an European repute and was reprinted many times, has to be set against the background of the early 16th century attempts at reforming medical education. Mainardi, a skilled humanist and the pupil of Nicolb Leoniceno and Pico della Mirandola, advocated a return to the original sources of Greek and Latin medical thought. The choice of Epistolae as a literary genre was in itself meaningful, in that it allowed Mainardi an unusual freedom of expression on the whole range of medical problems. Mainardi advocated the notion of medicine as ars - not scientia - and he believed in disengaging it from natural philosophy in the Aristotelian sense. At the same time, he believed in the possibility of introducing novelties in medicine, and of correcting ancient but incorrect textual traditions.

  3. Seminoma in a Male Phenotype 46XX True Hermaphrodite

    Directory of Open Access Journals (Sweden)

    Vinod Malik

    2007-01-01

    Full Text Available Although true hermaphrodite is uncommon, it has been reported in more than 400 individuals. Tumours arising in the gonads of true hermaphrodite is a very rare finding and only very few cases have been reported in the literature. We report a case of a 35-year-old phenotype man with bilateral undescended testis with lump hypogastrium. On examination, he had an ovotestis on one side and pure seminoma arising in testis on the other side. The seminoma arising in the left undescended testis was successfully treated by excision and combination chemotherapy. Cytogenetic studies revealed that 46XX karyotype with primer specific for the sex-determining region of the Y chromosome was negative. The karyotypic abnormality noticed in the patient is also reviewed in the article.

  4. FAST20XX: Achievements On European Suborbital Space Flight

    Science.gov (United States)

    Mack, A.; Steelant, J.; Adirim, H.; Lentsch, A.; Marini, M.; Pilz, N.

    2011-05-01

    In Europe, the EC co-funded project FAST20XX aims at exploring the borderline between aviation and space by investigating suborbital vehicles. The main focus is the identification and mastering of critical technologies for such vehicles rather than the vehicle development itself. Besides the objectives and overall layout of the project, the paper addresses also the progress made during the first period of the project. Two vehicle concepts are considered. A first one is a space vehicle launched from an airplane providing a low-energy ballistic flight experience using hybrid propulsion. The second is a vertically starting two-stage rocket space vehicle system concept taken as a basis to identify the conditions and constraints experienced during high- energy suborbital ultra-fast transport. The paper mainly discusses the two actual reference vehicles and the technical aspects of prerequisites for commercial operation including safety, human spaceflight, business cases, environmental and legal issues.

  5. AIR JORDAN XX2重归蓝天

    Institute of Scientific and Technical Information of China (English)

    贾铭

    2007-01-01

    一提到AIR JORDAN,似乎每个SNEAKER都能滔滔不绝的说上许多,确实,这个系列为大家带来了太多的惊喜、感动。这22年来每个SNEAKER的发展都和AIR JORDAN有关,当你回忆起自己的球鞋之路时,肯定会拿一年一双的JORDAN BRAND做标尺。在步入22岁的时候,这个早已功成名就理应享受赞誉的长寿签名系列似乎一下又回归到了少时的战斗状态,科技概念并重的AIR JORDAN XX2不只是一件纪念品。

  6. Study supporting the phasing out of environmentally harmful subsidies. Annexes to Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Withana, S.; Ten Brink, P.; Franckx, L.; Hirschnitz-Garbers, M.; Mayeres, I.; Oosterhuis, F.; Porsch, L.

    2012-10-15

    The need to reform ineffective or harmful public subsidies has long been recognised and has been a contentious point of discussion for several years. The EU has a long-standing commitment to removing or phasing out environmentally harmful subsidies (EHS). Most recently, the need to phase out EHS is reiterated in the 'Roadmap for a resource efficient Europe' which includes a milestone that 'by 2020 EHS will be phased out, with due regard to the impact on people in need'. Despite several commitments, progress has been slow and subsidies remain an issue in most EU countries. This study focuses specifically on EHS at the level of EU Member States; it identifies key types of EHS and examines cases of existing EHS across a range of environmental sectors and issues, including subsidies from non-action. The study also analyses examples of good practices in the reform of EHS in EU Member States and the lessons that can be learnt from these cases. Finally, based on this analysis, it develops practical recommendations on phasing out and reforming EHS to support the objectives of the Europe 2020 Strategy and the resource efficiency agenda. The study was carried out between January and October 2012 and is based on an analysis of literature and consultation with experts and policy makers. The sectoral cases studied are listed and discussed in this annex report: agriculture, climate and energy, fisheries, food, forestry, materials, transport, waste, and water.

  7. Annex 34 : task 1 : analysis of biodiesel options : biomass-derived diesel fuels : final report

    Energy Technology Data Exchange (ETDEWEB)

    McGill, R. [Oak Ridge National Laboratory, TN (United States); Aakko-Saksa, P.; Nylund, N.O. [TransEnergy Consulting Ltd., Helsinki (Finland)

    2009-06-15

    Biofuels are derived from woody biomass, non-woody biomass, and organic wastes. The properties of vegetable oil feedstocks can have profound effects on the properties of the finished biodiesel product. However, all biodiesel fuels have beneficial effects on engine emissions. This report discussed the use of biodiesel fuels as replacements for part of the diesel fuel consumed throughout the world. Biodiesel fuels currently being produced from fatty acid esters today were reviewed, as well as some of the more advanced diesel replacement fuels. The report was produced as part of the International Energy Agency (IEA) Advanced Motor Fuels (AMF) Implementing Agreement Annex 34, and was divided into 14 sections: (1) an introduction, (2) biodiesel and biomass, (3) an explanation of biodiesel, (4) properties of finished biodiesel fuels, (5) exhaust emissions of finished biodiesel fuels and blends, (6) life-cycle emissions and energy, (7) international biodiesel (FAME) technical standards and specifications, (8) growth in production and use of biodiesel fuels, (9) biofuel refineries, (10) process technology, (11) development and status of biorefineries, (12) comparison of options to produce biobased diesel fuels, (13) barriers and gaps in knowledge, and (14) references. 113 refs., 37 tabs., 74 figs.

  8. Technical Basis for Radiological Emergency Plan Annex for WTD Emergency Response Plan: West Point Treatment Plant

    Energy Technology Data Exchange (ETDEWEB)

    Hickey, Eva E.; Strom, Daniel J.

    2005-08-01

    Staff of the King County Wastewater Treatment Division (WTD) have concern about the aftermath of a radiological dispersion event (RDE) leading to the introduction of significant quantities of radioactive material into the combined sanitary and storm sewer system in King County, Washington. Radioactive material could come from the use of a radiological dispersion device (RDD). RDDs include "dirty bombs" that are not nuclear detonations but are explosives designed to spread radioactive material (National Council on Radiation Protection and Measurements (NCRP) 2001). Radioactive material also could come from deliberate introduction or dispersion of radioactive material into the environment, including waterways and water supply systems. This document, Volume 3 of PNNL-15163 is the technical basis for the Annex to the West Point Treatment Plant (WPTP) Emergency Response Plan related to responding to a radiological emergency at the WPTP. The plan primarily considers response to radioactive material that has been introduced in the other combined sanitary and storm sewer system from a radiological dispersion device, but is applicable to any accidental or deliberate introduction of materials into the system.

  9. NATIONAL CAPACITY SELF ASSESSMENT FOR NON-ANNEX I NATIONS: THE CASE OF LEBANON

    Directory of Open Access Journals (Sweden)

    Farid B. Chaaban

    2013-01-01

    Full Text Available Countries, both developed and developing, are called on to identify, through self assessments, their priority environmental issues such as mitigating greenhouse gas emissions, combating deforestation, promoting sustainable land and water management, and minimizing their vulnerabilities to the impact of climate change. Root cause analysis is conducted to determine the major barriers and institutional capacities. This papers presents capacity constraints in national priority issues typically encountered in developing or non-annex one nations, with the national capacity self assessment of Lebanon taken as a case study. The analysis of the information has identified a number of achievements and difficulties related to the fulfillment of the commitments under the UN Framework Convention on Climate Change. The common priority issues are national action plan for GHG abatement, vulnerability and adaptation, research and systematic observation, technology transfer, and education and public awareness. Root cause analysis related to priority issues has been carried out during which the causes and impacts of the constraints have been identified. The corresponding assessment matrices are also presented. Lack of financial resources is found to be the constraint facing priority issues.

  10. Kinetic modeling of petroleum formation in the Maracaibo Basin: Final report, Annex 12

    Energy Technology Data Exchange (ETDEWEB)

    Burnham, A.K.; Braun, R.L.; Sweeney, J.J.; Reynolds, J.G. [Lawrence Livermore National Lab., CA (United States); Vallejos, C.; Talukdar, S. [INTEVEP, Filial de Petroleos de Venezuela, SA, Caracas (Venezuela)

    1992-07-01

    The purpose of this project is to develop and test improved kinetic models of petroleum generation and cracking, pore pressure buildup, and fluid expulsion. The work was performed jointly between Lawrence Livermore National Laboratory and Research Organization of the Venezuelan National Petroleum Company under Annex 12 of an agreement between DOE and the Venezuelan Ministry of Energy and Mines. Laboratory experiments were conducted at both LLNL and INTEVEP to obtain the reaction rate and product composition information needed to develop chemical kinetic models. Experiments at INTEVEP included hydrous pyrolysis and characterization of oils by gas and liquid chromatography. Experiments at LLNL included programmed pyrolysis in open and self-purging reactors, sometimes including on-line gas analysis by tandem mass spectrometry, and characterization of oils by gas chromatography and nuclear magnetic resonance. The PMOD code was used to develop a detailed pyrolysis mechanism from the extensive laboratory data. This mechanism is able to predict yield of bitumen, oil, and gas as a function of time and temperature for such diverse laboratory conditions as hydrous pyrolysis and rapid, programmed, open pyrolysis. PMOD calculations were compared to geologic observations for 22 wells in the Maracaibo basin. When permeability parameters are chosen to match calculated pore pressures with measured present day values, the PMOD calculations indicate that organic maturation reactions contribute a significant fraction of the overpressure during oil generation and early oil cracking. Calculations agreed with observed geochemical maturity parameters of the source rock. 37 refs., 64 figs., 20 tabs.

  11. Norwegian participation in the IEA Heat Pump Programme Annex 34 - final report

    Energy Technology Data Exchange (ETDEWEB)

    Nordtvedt, S.R.

    2012-07-01

    This report is the Norwegian team contribution to Task A within the IEA Heat Pumps Programme Annex 34 on #Left Double Quotation Mark#Thermally driven heat pumps#Right Double Quotation Mark#. It aims to give an overview of the thermally driven heat pump (TDHP) and chiller (TDC) market, recent developments in the area of TDHP and TDC, as well as to give an outlook of the progress of this technology. There are no Norwegian manufacturers on the TDHP market. There are only seven existing thermally driven absorption system installations in Norway. Three are district heat driven water/LiBr chillers, one is a steam driven water/LiBr chiller, one water/LiBr heat pump for flue gas condensation in a wood chip heating unit, and two gas driven ammonia-water chillers. The future market for thermally driven heat pumps and chillers in Norway is expected to be in combination of biomass, district heat or waste heat. (Author)

  12. Medizinbibliotheken 20XX. Zuverlässig, Zukunftsweisend, Unverzichtbar [Medical Libraries 20XX. Reliable, forward-looking, indispensible

    Directory of Open Access Journals (Sweden)

    Bauer, Bruno

    2012-12-01

    Full Text Available [english] The focus of the current issue 3/2012 of GMS Medizin – Bibliothek – Information is the annual conference 2012 of the German Medical Libraries Association in Aachen. The motto of the conference was “Medical Libraries 20XX. Reliable, forward-looking, indispensible”. Focal points of the meeting were innovation management, marketing and new applications and services in medical libraries.The authors in this issue are Bruno Bauer (Open Access Publishing in Austria 2012, Thomas M. Deserno (Literature for interdisciplinary scientists – a requirement engineering approach, Annette Kustos (The new Academic Health Sciences, Nursing and Therapeutics Library of the University of Applied Health Sciences, Bochum, Christoph Poley (On the way to semantic web – with MEDPILOT, Henriette Senst & Jens Erling (New areas of work in the library of the Robert Koch-Institute: Open Access and institutional repository, Matti Stöhr (“I was interested in competitive alternatives to Citavi”: About the workshop “Reference Management at the focal point”, held at the AGMB-Conference 2012, Martin Zangl (Quality management in art libraries – a starting point for patient libraries?! and Ulf Paepcke & Gabriele Menzel (Medical Libraries 20XX. – Reliable, forward-looking, indispensible. Annual Meeting 2012 of the German MLA (AGMB September 24th to 26th in Aachen.[german] Schwerpunktthema der aktuellen Ausgabe 3/2012 von GMS Medizin – Bibliothek – Information ist die Jahrestagung 2012 der Arbeitsgemeinschaft für Medizinisches Bibliothekswesen (AGMB in Aachen; das Motto lautete „Medizinbibliotheken 20XX. Zuverlässig, Zukunftsweisend, Unverzichtbar“. Zentrales Thema der diesjährigen Tagung waren Open Access Publishing, Innovationsmanagement und neue Arbeitsfelder für Medizinbibliotheken.Die Beiträge der Schwerpunktausgabe wurden verfasst von Bruno Bauer (Open Access Publishing in Österreich 2012, Thomas M. Deserno (Literatur f

  13. 76 FR 54507 - Proposed Generic Communication; Draft NRC Generic Letter 2011-XX: Seismic Risk Evaluations for...

    Science.gov (United States)

    2011-09-01

    ... COMMISSION Proposed Generic Communication; Draft NRC Generic Letter 2011-XX: Seismic Risk Evaluations for... the effects of natural phenomena, including earthquakes, without losing the capability to perform... Electric Power Research Institute models to estimate earthquake ground motion and updated models...

  14. Isodicentric Y mosaicism involving a 46, XX cell line: Implications for management.

    Science.gov (United States)

    Hipp, Lauren E; Mohnach, Lauren H; Wei, Sainan; Thomas, Inas H; Elhassan, Maha E; Sandberg, David E; Quint, Elisabeth H; Keegan, Catherine E

    2016-01-01

    Carriers of isodicentric Y (idicY) mosaicism exhibit a wide range of clinical features, including short stature, gonadal abnormalities, and external genital anomalies. However, the phenotypic spectrum for individuals carrying an idicY and a 46, XX cell line is less clearly defined. A more complete description of the phenotype related to idicY is thus essential to guide management related to pubertal development, fertility, and gonadoblastoma risk in mosaic carriers. Findings from the evaluation of twin females with an abnormal karyotype, 48, XX, +idic(Yq) x2/47, XX, +idic(Yq)/46, XX, are presented to highlight the importance of interdisciplinary care in the management of multifaceted disorders of sex development.

  15. Thermodynamics of a dilute XX chain in a field

    Science.gov (United States)

    Timonin, P. N.

    2016-06-01

    Gapless phases in ground states of low-dimensional quantum spin systems are rather ubiquitous. Their peculiarity is a remarkable sensitivity to external perturbations due to permanent criticality of such phases manifested by a slow (power-low) decay of pair correlations and the divergence of the corresponding susceptibility. A strong influence of various defects on the properties of the system in such a phase can then be expected. Here, we consider the influence of vacancies on the thermodynamics of the simplest quantum model with a gapless phase, the isotropic spin-1/2 XX chain. The existence of the exact solution of this model gives a unique opportunity to describe in detail the dramatic effect of dilution on the gapless phase—the appearance of an infinite series of quantum phase transitions resulting from level crossing under the variation of a longitudinal magnetic field. We calculate the jumps in the field dependences of the ground-state longitudinal magnetization, susceptibility, entropy, and specific heat appearing at these transitions and show that they result in a highly nonlinear temperature dependence of these parameters at low T. Also, the effect of enhancement of the magnetization and longitudinal correlations in the dilute chain is established. The changes of the pair spin correlators under dilution are also analyzed. The universality of the mechanism of the quantum transition generation suggests that similar effects of dilution can also be expected in gapless phases of other low-dimensional quantum spin systems.

  16. Quantum state transfer in a XX chain with impurities

    Energy Technology Data Exchange (ETDEWEB)

    Zwick, Analia; Osenda, Omar, E-mail: zwick@famaf.unc.edu.ar, E-mail: osenda@famaf.unc.edu.ar [Facultad de Matematica, AstronomIa y Fisica, Universidad Nacional de Cordoba and IFEG-CONICET, Ciudad Universitaria, X5016LAE, Cordoba (Argentina)

    2011-03-11

    One spin excitation states are involved in the transmission of quantum states and entanglement through a quantum spin chain, the localization properties of these states are crucial to achieve the transfer of information from one extreme of the chain to the other. We investigate the bipartite entanglement and localization of the one excitation states in a quantum XX chain with one impurity. The bipartite entanglement is obtained using the concurrence and the localization is analyzed using the inverse participation ratio (IPR). Changing the strength of the exchange coupling of the impurity allows us to control the number of localized or extended states. The analysis of the IPR allows us to identify scenarios where the transmission of quantum states or entanglement can be achieved with a high degree of fidelity. In particular, we identify a regime where the transmission of quantum states between the extremes of the chain is executed in a short transmission time {approx}N/2, where N is the number of spins in the chain, and with a large fidelity.

  17. Música y sonido en la danza contemporánea occidental del siglo XX

    OpenAIRE

    Juan Bernardo Pineda Pérez

    2013-01-01

    Durante varios cientos de años que han precedido al s. XX, la danza se ha visto de manera generalizada supeditada muchas veces al resto de las demás artes escénicas. El s. XX sitúa a la danza en igualdad respecto a otras artes, especialmente con la música, donde el ritmo define por igual a esta y a la danza, es decir, son lo mismo.

  18. Música y sonido en la danza contemporánea occidental del siglo XX

    Directory of Open Access Journals (Sweden)

    Juan Bernardo Pineda Pérez

    2013-01-01

    Full Text Available Durante varios cientos de años que han precedido al s. XX, la danza se ha visto de manera generalizada supeditada muchas veces al resto de las demás artes escénicas. El s. XX sitúa a la danza en igualdad respecto a otras artes, especialmente con la música, donde el ritmo define por igual a esta y a la danza, es decir, son lo mismo.

  19. Start up of a new annex Electrochemical Power Sources and Energy Storage Systems in the implementing agreement hybrid and electric vehicles of the International Energy Agency

    Energy Technology Data Exchange (ETDEWEB)

    Hacker, V.; Fuchs, H.; Kordesch, K. [Technical Univ. Graz, (Austria)

    2000-07-01

    It is understood that continuing research and development in battery and supercapacitor technologies should ensure the future of hybrid and electric vehicles. In order to promote research and development efforts along those lines, it was decided to prolong the work performed by Annex V Advanced Batteries and Supercapacitors for Electric Vehicles during the second phase of the Implementing Agreement on Hybrid and Electric Vehicles of the International Energy Agency. The authors, acting as intermediate Operating Agent, prepared a proposal to be used as framework for the organization and structure, without detailing exploratory research. They were careful not to overlap the work done on Advanced Fuel Cells by creating an interface of Fuel Cells and battery technology for mobile applications that meet the performance requirements of hybrid systems. They also included fuel cell electric vehicles and fuel cell hybrid vehicles in this new annex. The authors concluded with an invitation to former and other participating countries to join the Annex.

  20. Annex 1: Simulation of the Serso underground heat storage - Calibration using data from two-years measurements; Annexe 1: simulation du stockage de chaleur dans le terrain de l'installation Serso et calibrage sur deux ans de mesure

    Energy Technology Data Exchange (ETDEWEB)

    Pahud, D.

    2006-12-15

    This is the Annex 1 of the annual report 2006 of the Serso project. The basic idea of the Serso project is to defrost a road bridge in winter with heat produced by the bridge in summer by solar radiation absorption and stored in a diffusive underground store. Pipes are imbedded in the bridge surface material and connected to a set of underground borehole heat exchangers ('geothermal probes'). A heat transfer fluid is circulated by a pump. The store is loaded in summer and discharged in winter. In the present Annex the computer code developed to simulate the underground heat store is validated and tuned on the basis of a two-years series of field measurements. The agreement between predicted and measured values is good. A limitation of the computer model is that it cannot simulate only a part of the borehole heat exchangers, a feature that were implemented in the pilot store, to enable discharging the peripheral heat exchangers and leave the central ones untouched. The authors investigated the relevance of such a feature and found out that it does not significantly improve the store efficiency. As it is an additional hardware complication they recommend to ignore such a feature in future projects.

  1. PERKEMBANGAN INSTITUSI SOSIAL- POLITIK ISLAM INDONESIA SAMPAI AWAL ABAD XX

    Directory of Open Access Journals (Sweden)

    Noor Huda

    2015-11-01

    Full Text Available Berdirinya beberapa negara Islam di kepulauan Indonesia-Melayu merupakan salah satu bukti kuatnya pengaruh Islam. Selain itu, Islam sebagai faktor eksternal telah berhasil dalam mempersatukan kelompok- kelompok etnis yang terdiri atas ratusan suku yang ada di kepulauan ini. Walaupun Islam belum menciptakan kesatuan politis, tetapi Islam telah memberikan kelangsungan dasar-dasar untuk terwujudnya integrasi kultural, paling tidak sejak abad ke-15. artikel ini akan mencoba menguraikan tentang pembentukan institusi sosial politik umat Islam sejak masa yang paling awal. Analisis dimulai dengan masa awal pembentukan kerajaan Islam. Pembahasan dilanjutkan dengan respons kerajaan-kerajaan Islam terhadap kolonialisme sampai abad ke-19. Dikuasainya negeri-negeri Islam oleh Belanda, maka dimulailah tahap depolitisasi terhadap umat Islam di Indonesia. Kata kunci: Institusi,Sosial,Politik, Islam, Indonesia THE DEVELOPMENT OF ISLAMIC SOCIAL AND POLITICAL INSTITUTIONS IN INDONESIA TO THE BEGINNING OF XX CENTURY. The establishment of several Islamic state in Indonesia-Malay archipelago is one of the strong evidence of the influence of Islam. Moreover, Islam as external factors have succeeded in uniting ethnic groups made up of hundreds of tribes in these islands. Although Islam has not created a political unity, Islam has provided the continuity of the basics for the realization of cultural integration, at least since the 15th century. This paper will describe the formation of political and social institutions of Muslims since the earliest. The analysis begins with the early formation of the Islamic empire. The discussion explores the response Islamic kingdoms against colonialism until the 19th century. Mastered the lands of Islam by Dutch, then the stage of depoliticization against Muslims in Indonesia began. Keywords: Political and Social Institutions, Islam, Indonesia

  2. EEG II. Annexes and regulations. Comment; EEG II. Anlagen und Verordnungen. Kommentar

    Energy Technology Data Exchange (ETDEWEB)

    Frenz, Walter (ed.) [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Berg-, Umwelt- und Europarecht

    2016-11-01

    Berlin commentary EEG II: safe through the paraphernalia Like hardly any other law, the Renewable Energies Act (EEG) is subject to constant changes. With the 2014 amendment, the EEG was fundamentally redesigned. This makes the application of the complex rules a challenge even for experts. In addition, the sub-rules contain important statements in the form of numerous annexes and regulations - with the EEG amendment 2014, this has become even more detailed. In it, many calculations are only defined in detail and the legal provisions of the EEG are made more definite and supplemented. The Berlin commentary EEG II accompanies you expertly through this complex matter. Experts explain the widely divergent rules in practice. If necessary for a better understanding, the provisions of the EEG 2014 are also explained. Consistently designed for your practice As a buyer of the work, you also benefit from access to an extensive, regularly updated database. This contains important legal energy regulations of the EU, the federal government and the countries. Even earlier legal positions remain searchable and can be conveniently compared with current versions. So you can see at a glance what has changed. [German] Berliner Kommentar EEG II: sicher durch den Paragrafengeflecht Wie kaum ein anderes Gesetz ist das Erneuerbare-Energien-Gesetz (EEG) staendigen Aenderungen unterworfen. Mit der Novelle 2014 wurde das EEG grundlegend umgestaltet. Dies macht die Anwendung der komplexen Regeln selbst fuer Experten zu einer Herausforderung. Zudem enthaelt auch das untergesetzliche Regelwerk wichtige Aussagen in Form zahlreicher Anlagen und Verordnungen - mit der EEG-Novelle 2014 ist dieses noch ausfuehrlicher geworden. In ihm werden viele Berechnungen erst naeher festgelegt und gesetzliche Bestimmungen des EEG entscheidend konkretisiert und ergaenzt. Der Berliner Kommentar EEG II begleitet Sie fachkundig durch diese komplexe Materie. Experten erlaeutern Ihnen praxisorientiert die

  3. Environmentally Sustainable Solution for a Gas Turbine Upgrade Clean Development Mechanism Application in a Non-Annex I Country

    Energy Technology Data Exchange (ETDEWEB)

    Becker, Volker; Wolf, Markus; Fahrer, Roland; Brandett, Joergen; Hess, Stephen

    2007-07-01

    ALSTOM Power Service delivers solutions not only to recover degradation, but also to increase the performance and efficiency of the installed global power generation fleet. Such performance improvements also reduce greenhouse gases and particularly CO2 emissions. The mechanisms of the Kyoto Protocol promote the implementation of CO2-reducing state-of-the-art technologies to developing and emerging economies. ALSTOM, having installed the world's largest power generation fleet, wants to make use of the Clean Development Mechanism (CDM) to make technology implementation economically attractive for non-Annex I countries. This paper gives an overview and outlook for environmental mechanisms and technologies, the value proposition and some experience in pioneering a CDM project with a gas turbine upgrade in a non-Annex I country. It is shown that in a crediting period of 10 years 3 million tons of CO2eq can be saved on a mid-sized power plant. Assuming a price of euro 8 per ton of CO2eq for Certified Emission Reductions this would lead to an annual revenue of 20% of the initial implementation cost, representing a very attractive business case for the plant operator. The described CDM application can be a decisive factor for proceeding with a fuel switch or an upgrade. The revenues earned from emission trading enables the plant operator to make the investment to reduce Kyoto-relevant emissions.

  4. Serbian Astronomers in Science Citation Index in the XX Century

    Science.gov (United States)

    Dimitrijevic, Milan S.

    "Alpha". In 1996 Zrenjanin too got an organization of amateur astronomers, Astronomical Society "Milutin Milankovic". Moreover, in the book is given a selected bibliography of references concerning the history of astronomy among Serbs in XX century.

  5. ESTUDIO BIBLIOMÉTRICO DE EDUCACIÓN XX1

    Directory of Open Access Journals (Sweden)

    Almudena Gómez-García

    2012-01-01

    Full Text Available Los estudios bibliométricos han adquirido hoy en día gran importancia en el ámbito científico. El objetivo de este estudio es realizar un análisis bibliométrico de la Revista Educación XX1 de los últimos diez años, recientemente incorporada en la Web of Science donde se pretende conocer la situación actual de la misma. Para ello fueron analizados un total de 89 artículos, consultados en la versión electrónica de la revista, la base de datos INRECS y el sistema de información científica Redalyc, atendiendo a una serie de indicadores bibliométricos entre los que se encuentran: índice de autoría, nacionalidad de los autores, universidad de procedencia, idioma de publicación, número de referencias por año en cada artículo y número de descargas por artículo, entre otros. En los resultados de esta investigación se puede observar como el idioma predominante es el castellano, mayoritariamente los autores son de nacionalidad española, los artículos publicados en 2007 fueron los que más citas recibieron, existe un gran porcentaje de referencias de artículos publicados antes del 2000 y no existe relación entre los artículos más citados y los más descargados. Para finalizar, se proponen una serie de orientaciones que la revista puede considerar en relación a conseguir una mayor difusión, reconocimiento como revista internacional, la actualización de los años de publicación de las referencias, la filiación de los autores, así como las áreas temáticas de educación sobre las que publicar.

  6. Characterising the Actual Thermal Performance of Buildings: Current Results of Common Exercises Performed in the Framework of the IEA EBC Annex 58-Project

    DEFF Research Database (Denmark)

    Roels, Staf; Bacher, Peder; Bauwens, Geert

    2015-01-01

    Several studies have shown that actual thermal performance of buildings after construction may deviate significantly from that anticipated at design stage. As a result, there is growing interest in full scale testing of components and whole buildings. The IEA EBC Annex 58-project ‘Reliable Buildi...

  7. Road cross-section. Annex VI to SWOV-report `Safety effects of road design standards', R-94-7 (see C 2838 (IRRD 866221).

    NARCIS (Netherlands)

    Michalski, L.

    1995-01-01

    This volume is one of the annexes to a main report on safety effects of road design standards which was compiled by SWOV in collaboration with other European partners, in 1993-1994. For the covering abstract of the report or the report itself, see C 2838. The main objective of the project presented

  8. Preparing Teachers for Diversity: The Role of Initial Teacher Education. Annex 1 to the Final Report to DG Education, Youth, Sport and Culture of the European Commission

    Science.gov (United States)

    European Commission, 2017

    2017-01-01

    This document, "Annex 1 to the Final Report to DG Education, Youth, Sport and Culture of the European Commission" is intended as a companion piece to European Commission report "Preparing Teachers for Diversity: The Role of Initial Teacher Education. Final Report". It contains country fiches which are overviews of available…

  9. Inspiration and experiences from the joint analysis of shining examples of comprehensive energy renovation building projects within IEA EBC Annex 56

    DEFF Research Database (Denmark)

    Christen Mørck, Ove; Almeida, Manuela; Ferreira, Marco

    2016-01-01

    The International Energy Agency established in 2011 an Implementing Agreement within the Energy in Buildings and Communities Program to undertake research and provide an international focus on Cost Effective Energy and Carbon Emissions Optimization in Building Renovation (EBC Annex 56). The proje...

  10. Philosophical roots of the "eternal" questions in the XX-century theoretical physics

    CERN Document Server

    Ihnatovych, V

    2014-01-01

    The evolution of theoretical physics in the XX century differs significantly from that in XVII-XIX centuries. While continuous progress is observed for theoretical physics in XVII-XIX centuries, modern physics contains many questions that have not been resolved despite many decades of discussion. Based upon the analysis of works by the founders of the XX-century physics, the conclusion is made that the roots of the "eternal" questions by the XX-century theoretical physics lie in the philosophy used by its founders. The conclusion is made about the need to use the ideas of philosophy that guided C. Huygens, I. Newton, W. Thomson (Lord Kelvin), J. K. Maxwell, and the other great physicists of the XVII-XIX centuries, in all areas of theoretical physics.

  11. A rare case of 46,XX gonadal dysgenesis and Mayer-Rokitansky-Kuster-Hauser syndrome

    Directory of Open Access Journals (Sweden)

    Sriharibabu Manne

    2016-01-01

    Full Text Available 46,XX gonadal dysgenesis is a rare genetically heterogeneous disorder characterized by underdeveloped ovaries with consequent, impuberism, primary amenorrhea, and hypergonadotropic hypogonadism. Mullerian agenesis or Mayer-Rokitansky-Kuster-Hauser (MRKH syndrome is characterized by congenital aplasia of the uterus and the upper part (2/3 of the vagina in a woman with normal development of secondary sexual characteristics and a normal 46,XX karyotype. The phenotypic manifestations of MRKH syndrome may sometimes overlap with various other syndromes and require accurate delineation. The coexistence of both these disorders is extremely rare. Here, we report a case of 46,XX gonadal dysgenesis and MRKH syndrome with anatomically dispersed congenital anomalies unique among reported cases.

  12. A rare case of 46,XX gonadal dysgenesis and Mayer-Rokitansky-Kuster-Hauser syndrome.

    Science.gov (United States)

    Manne, Sriharibabu; Veeraabhinav, C H; Jetti, Mounica; Himabindu, Yalamanchali; Donthu, Kiranmai; Badireddy, Mutyalarayudu

    2016-01-01

    46,XX gonadal dysgenesis is a rare genetically heterogeneous disorder characterized by underdeveloped ovaries with consequent, impuberism, primary amenorrhea, and hypergonadotropic hypogonadism. Mullerian agenesis or Mayer-Rokitansky-Kuster-Hauser (MRKH) syndrome is characterized by congenital aplasia of the uterus and the upper part (2/3) of the vagina in a woman with normal development of secondary sexual characteristics and a normal 46,XX karyotype. The phenotypic manifestations of MRKH syndrome may sometimes overlap with various other syndromes and require accurate delineation. The coexistence of both these disorders is extremely rare. Here, we report a case of 46,XX gonadal dysgenesis and MRKH syndrome with anatomically dispersed congenital anomalies unique among reported cases.

  13. Long term outcomes in 46, XX adult patients with congenital adrenal hyperplasia reared as males.

    Science.gov (United States)

    Khattab, A; Yau, M; Qamar, A; Gangishetti, P; Barhen, A; Al-Malki, S; Mistry, H; Anthony, W; Toralles, M B; New, Maria I

    2017-01-01

    Patients with Congenital Adrenal Hyperplasia (CAH) owing to 21-hydroxylase deficiency and whose karyotype is 46, XX are usually assigned to the female gender. Reported herein are the long term outcomes in three patients with CAH whose karyotype is 46, XX and who were reared as males. A retrospective review of three CAH patients with a 46, XX karyotype who were reared as males was conducted. Gender assignment, clinical and biochemical data, pre and post-genitoplasty genital examinations were reviewed. Gender identity was tested by an extensive questionnaire. Gender role, sexual preference, marital status and sexual satisfaction were evaluated by interview. The three patients were genotyped for the CYP21A2 gene confirming the diagnosis of CAH. Owing to genital virilization, cultural preferences for male gender and the lack of newborn screening programs the three patients reported herein were assigned to the male gender at birth before the diagnosis of CAH was established. In adulthood the patients remained significantly virilized. Thorough psychosexual assessments in adulthood revealed well established male gender identities compatible with their male gender assignments at birth. In all three patients, gender role and behavior were consistent with male gender identity including sexual intercourse with female partners. The three patients reported herein revealed that male gender assignment to CAH patients with a 46, XX karyotype may have a successful outcome providing there is strong parental support and expert endocrine care. No standard guidelines have been published for the gender assignment of CAH patients with a 46, XX karyotype and genital ambiguity. More studies concerning gender assignment in CAH patients with a 46, XX karyotype reared as males are needed.

  14. High temperature increases the masculinization rate of the all-female (XX rainbow trout "Mal" population.

    Directory of Open Access Journals (Sweden)

    Karina Valdivia

    Full Text Available Salmonids are generally considered to have a robust genetic sex determination system with a simple male heterogamety (XX/XY. However, spontaneous masculinization of XX females has been found in a rainbow trout population of gynogenetic doubled haploid individuals. The analysis of this masculinization phenotype transmission supported the hypothesis of the involvement of a recessive mutation (termed mal. As temperature effect on sex differentiation has been reported in some salmonid species, in this study we investigated in detail the potential implication of temperature on masculinization in this XX mal-carrying population. Seven families issued from XX mal-carrying parents were exposed from the time of hatching to different rearing water temperatures ((8, 12 and 18°C, and the resulting sex-ratios were confirmed by histological analysis of both gonads. Our results demonstrate that masculinization rates are strongly increased (up to nearly two fold at the highest temperature treatment (18°C. Interestingly, we also found clear differences between temperatures on the masculinization of the left versus the right gonads with the right gonad consistently more often masculinized than the left one at lower temperatures (8 and 12°C. However, the masculinization rate is also strongly dependent on the genetic background of the XX mal-carrying families. Thus, masculinization in XX mal-carrying rainbow trout is potentially triggered by an interaction between the temperature treatment and a complex genetic background potentially involving some part of the genetic sex differentiation regulatory cascade along with some minor sex-influencing loci. These results indicate that despite its rather strict genetic sex determinism system, rainbow trout sex differentiation can be modulated by temperature, as described in many other fish species.

  15. Joint Egypt/United States report on Egypt/United States cooperative energy assessment. Volume 4 of 5 Vols. Annexes 6--10

    Energy Technology Data Exchange (ETDEWEB)

    Purvis, Edward E.; Teagan, Peter; Little, Arthur D.; Kaplan, George; Kunze, Jay; Warchol, Edward J.

    1979-04-01

    Annex 6, which investigates the possible hydroelectric resources of Egypt, reveals that presently the only existing sites are on the upper Nile at the High and Aswan Dams. There are 8 sites on the Nile where it is practical to add hydroelectric generation and, of these, only 4 are feasible for immediate construction. There are also pumped-storage sites on the Nile and the Red Sea. There is also the Qattara Depression in the Western Desert which can be utilized for conventional, as well as pumped-storage generation, by bringing water from the Mediterranean Sea to the depression by canal or tunnel. The options were considered for construction of hydro plants to met the electric load growth of Egypt when other forms of energy supply would be integrated into a comprehensive supply pattern. In Annex 7, the prospective use of nuclear energy to meet Egypt's resources (uranium and thorium) to implement a nuclear energy program, and potential effects of the expanded use of nuclear energy are discussed. Annex 8 discusses solar energy (technology descriptions and impacts, solar thermal power, photovoltaics). Also wind power generation, biomass utilization, desalination, solar air conditioning and refrigeration, and cost of power from diesel engines are discussed. Annex 9 covers geothermal potentials in Egypt, discussing resources with temperatures above 180/sup 0/C; from 150 to 180/sup 0/C; from 100 to 150/sup 0/C; and with temperatures below 100/sup 0/C. Annex 10 discusses the electric power systems in Egypt. The following subjects are covered: existing electric power systems; electrical power facilities under construction or planned for construction by 1985; past and projected growth of electrical energy; distribution; and electrical power system projected from 1985 to 2000. (MCW)

  16. Domestic policy frameworks for adaptation to climate change in the water sector. Part 2. Non-Annex I Countries. Lessons Learned from Mexico, India, Argentina and Zimbabwe

    Energy Technology Data Exchange (ETDEWEB)

    Levina, E.; Adams, H.

    2006-10-15

    This paper represents Part II of the analysis of the roles that domestic policy frameworks can play in adaptation to climate change in the water sector, conducted under the auspices of the Annex I Expert Group. Part I focused on Annex I countries and synthesised experiences of four case study countries: Canada, Finland, UK and the US. This paper focuses on non-Annex I countries and is based on four case studies in non-Annex I countries: Argentina, India, Mexico, and Zimbabwe. As in the previous paper, the water sector is defined as water resources (surface water and groundwater), their use (e.g. irrigation, public water supply, environmental needs) and their governance and management (legal and institutional issues, abstraction permitting, water infrastructure, water policies). Water quality issues are touched upon, as water quality and quantity issues cannot be looked at in isolation, but are not specifically analysed. The paper is based on four developing country case studies developed by local consultants. It is structured around the selected four elements that construct policy frameworks: (1) legislation, (2) institutional arrangements, (3) water management and policies, and (4) information availability and use in decisionmaking. Section 2 briefly examines current and projected future climatic conditions that necessitate adaptation. Section 3 focuses on domestic and international legal issues and informal rules that govern the water sector while Section 4 identifies institutions and key players in the water sector who should also become the key actors in adaptation. Section 5 examines water management approaches and policies and analyses how adaptation could be incorporated into the everyday management of water. Section 6 evaluates information needs and existing mechanisms for information sharing and dissemination that would be instrumental for successful adaptation. The paper concludes with a summary of key findings. The comparison with Annex I countries is

  17. Arquitectura religiosa guipuzcoana desde la segunda mitad del siglo xx a nuestros días

    OpenAIRE

    Aranjuelo Michelena, Alejandro

    2016-01-01

    279 p. Gipuzkoa carecía de un estudio pormenorizado y valorativo de su patrimonio artístico y arquitectónico, de los edificios religiosos desde mediados del siglo XX hasta la actualidad. Se ha pretendido, que este trabajo contribuya en el futuro a divulgar el cambio estilístico que ha sufrido la arquitectura religiosa de nuestra Provincia. Donde se ha pasado de una arquitectura vertical a comienzos del siglo XX, como puede ser la Catedral de Buen Pastor, a una arquitectura más horizontal ...

  18. La influencia liberal en el pensamiento constitucional peruano y en las constituciones del siglo XX

    OpenAIRE

    Ruiz Hidalgo, Rafael Manuel

    2014-01-01

    El objetivo general de la presente investigación es el estudio de las fuentes ideológicas y modelos políticos jurídicos que han influido en la formación del pensamiento constitucional en la conservación o cambio de las constituciones peruanas principalmente del siglo XX. La metodología empleada se ha basado en el estudio comparativo del pensamiento constitucional del siglo XX y el análisis sistemático de sus fuentes, modelo y especificaciones. El resultado más importante es que el pensami...

  19. ENFOQUES TEÓRICOS Y DEFINICIONES DE LA TECNOLOGÍA EDUCATIVA EN EL SIGLO XX (THEORETICAL APPROACHES AND EXPLANATION OF EDUCATIONAL TECHNOLOGIES IN THE XX CENTURY

    Directory of Open Access Journals (Sweden)

    Salas Madriz Flora

    2009-08-01

    Full Text Available Resumen:La tecnología educativa y los enfoques teóricos asociados al quehacer de los procesos de enseñanza y aprendizaje durante el siglo XX impactaron en la práctica educativa en las organizaciones de este tipo, la formación de los docentes, la selección, uso y evaluación de medios permitió valorar los aportes al sistema educativo sin descuidar las concepciones de las teorías de aprendizaje y la contribución de la didáctica al mejoramiento de la calidad. Este trabajo expone los principales enfoques teóricos y definiciones de la tecnología educativa en el siglo XX, su objetivo principal es presentar la e volución temática y las aplicaciones de la tecnología educativa y su relación con las diversas teorías de aprendizaje y la incorporación de los medios a la enseñanza.Abstract:The technology and the theoretical approaches associated to the task of the educational and learning processes during the XX century impacted educative practices in the educative organiz ations, the formation of the education professionals, the selection, media use and evaluation allowed to value the contributions to the educative system without neglecting the conceptions of the theories of learning and the contribution of Didactics to the improvement of education quality. This work exposes the main theoretical approaches and definitions of the educative technology in the XX century; its primary target is to present/display the thematic evolution and the applications of the educative technology and their relation with the diverse theories of learning and the incorporation of media to education.

  20. EMPLOY: Step-by-step guidelines for calculating employment effects of renewable energy investments [including annex 2

    Energy Technology Data Exchange (ETDEWEB)

    Breitschopf, Barbara [Fraunhofer Inst. for Systems and Innovation Research (Germany); Nathani, Carsten [Ruetter and Partner Socioeconomic Research and Consulting (Switzerland); Resch, Gustav [Vienna Univ. of Technology, Energy Economics Group (EEG) (Austria

    2012-07-15

    The EMPLOY project aimed to help achieve the IEA-RETD’s objective to 'empower policy makers and energy market actors through the provision of information, tools and resources' by underlining the economic and industrial impacts of renewable energy technology deployment and providing reliable methodological approaches for employment – similar to those available for the incumbent energy technologies. The EMPLOY project resulted in a comprehensive set of methodological guidelines for estimating the employment impacts of renewable energy deployment in a coherent, uniform and systematic way. Guidelines were prepared for four different methodological approaches. In the introduction section of the guidelines policy makers are guided in their choice for the most suited approach, depending on the policy questions to be answered, the data availability and budget. The guidelines were tested for the IEA-RETD member state countries and Tunisia. The results of these calculations are included in the annex to the guidelines.

  1. IEA SHC Task 42/ECES Annex 29 – A Simple Tool for the Economic Evaluation of Thermal Energy Storages

    DEFF Research Database (Denmark)

    Rathgeber, Christoph; Hiebler, Stefan; Lävemann, Eberhard;

    2016-01-01

    Within the framework of IEA SHC Task 42 / ECES Annex 29, a simple tool for the economic evaluation of thermal energy storages has been developed and tested on various existing storages. On that account, the storage capacity costs (costs per installed storage capacity) of thermal energy storages...... have been evaluated via a Top-down and a Bottom-up approach. The Top-down approach follows the assumption that the costs of energy supplied by the storage should not exceed the costs of energy from the market. The maximum acceptable storage capacity costs depend on the interest rate assigned......, seasonal heat storage is only economical via large sensible hot water storages. Contrary, if the annual number of storage cycles is sufficiently high, all thermal energy storage technologies can become competitive....

  2. IEA SHC Task 42/ECES Annex 29 – A Simple Tool for the Economic Evaluation of Thermal Energy Storages

    DEFF Research Database (Denmark)

    Rathgeber, Christoph; Hiebler, Stefan; Lävemann, Eberhard

    2016-01-01

    Within the framework of IEA SHC Task 42 / ECES Annex 29, a simple tool for the economic evaluation of thermal energy storages has been developed and tested on various existing storages. On that account, the storage capacity costs (costs per installed storage capacity) of thermal energy storages...... have been evaluated via a Top-down and a Bottom-up approach. The Top-down approach follows the assumption that the costs of energy supplied by the storage should not exceed the costs of energy from the market. The maximum acceptable storage capacity costs depend on the interest rate assigned...... to the capital costs, the intended payback period of the user class (e.g. industry or building), the reference energy costs, and the annual number of storage cycles. The Bottom-up approach focuses on the realised storage capacity costs of existing storages. The economic evaluation via Top-down and Bottom...

  3. Supporting technology for enhanced oil recovery: Sixth amendment and extension to Annex IV enhanced oil recovery thermal processes

    Energy Technology Data Exchange (ETDEWEB)

    Reid, T.B. (USDOE Bartlesville Project Office, OK (United States)); Rivas, O. (INTEVEP, Filial de Petroleos de Venezuela, SA, Caracas (Venezuela))

    1991-10-01

    This report contains the results of efforts under the six tasks of the Sixth Amendment and Extension of Annex 4, Enhanced Oil Recovery Thermal Processes of the Venezuela/USA Agreement. The report is presented in sections (for each of the 6 tasks) and each section contains one or more reports prepared by various individuals or groups describing the results of efforts under each of the tasks. A statement of each task, taken from the agreement, is presented on the first page of each section. The tasks are numbered 44 through 49. Tasks are: DOE-SUPRI-laboratory research on steam foam, CAT-SCAN, and in-situ combustion; INTEVEP-laboratory research and field projects on steam foam; DOE-NIPER-laboratory research and field projects light oil steam flooding; INTEVEP-laboratory research and field studies on wellbore heat losses; DOE-LLNL-laboratory research and field projects on electromagnetic induction tomography; INTEVEP-laoboratory research on mechanistic studies.

  4. Chimerism 47,XY,+21/46,XX in a female infant with anencephaly and other congenital defects

    Directory of Open Access Journals (Sweden)

    Danielle R. Lucon

    2006-01-01

    Full Text Available Chimerism is rare in humans and is usually discovered accidentally when a 46,XX and 46,XY karyotype is found in a same individual. We describe a malformed female infant with neural tube defect (NTD and a 47,XY,+21[5]/46,XX[30] karyotype.

  5. OES-IA Annex IV: Environmental Effects of Marine and Hydrokinetic Devices - Report from the Experts’ Workshop September 27th – 28th 2010 Clontarf Castle, Dublin Ireland

    Energy Technology Data Exchange (ETDEWEB)

    Copping, Andrea E.; O' Toole, Michael J.

    2010-12-02

    An experts' workshop was convened in Dublin Ireland September 27th – 28th 2010 in support of IEA Ocean Energy Systems Implementing Agreement Annex IV. PNNL was responsible for organizing the content of the workshop, overseeing the contractors (Irish Marine Institute) hosting the event, presenting material on Annex IV and materials applicable to the workshop intent. PNNL is also overseeing a contractor (Wave Energy Center/University of Plymouth – WEC/UP) in the collection and analysis of the Annex IV data. Fifty-eight experts from 8 countries attended the workshop by invitation, spending two days discussing the needs of Annex IV. Presentations by DOE (background on Annex IV), PNNL (process for developing Annex IV; presentation of the draft database for PNNL project, plans for incorporating Annex IV data), WEC/UP on the environmental effect matrix, and four MHK developers (two from the UK, one from Ireland and one from Sweden; each discussing their own projects and lessons learned for measuring and mitigating environmental effects, as well as interactions with consenting [permitting] processes) helped provide background. The workshop participants worked part of the time in the large group and most of the time in four smaller breakout groups. Participants engaged in the process and provided a wealth of examples of MHK environmental work, particularly in the European nations. They provided practical and actionable advice on the following: • Developing the Annex IV database, with specific uses and audiences • Strong consensus that we should collect detailed metadata on available data sets, rather than attempting to draw in copious datasets. The participants felt there would then be an opportunity to then ask for specific set of data as needed, with specific uses and ownership of the data specified. This is particularly important as many data collected, particularly in Europe but also in Canada, are proprietary; developers were not comfortable with the idea

  6. Apreciaciones sobre la evolución de “Las Talaveras”. Siglos XVI al XX

    Directory of Open Access Journals (Sweden)

    Portela Hernando, D.

    1999-08-01

    Full Text Available In this exposition we go over the Talavera Pottery from the XVI to the XX centuries, analyzing the main facts which marked its developement, and providing some of the keys neccesary to understand the importance and the influence its production had in other centers. We emphasize on items related to the XVI and XVII centuries, origin and decadence, giving some data about its chronology and series, based on the latest discoveries. In relation to the XVIII, XIX and XX centuries, we only expose the changes wich took place and the consequences they brought to the potteries of Talavera.

    En esta ponencia se hace un recorrido por la historia de la “Cerámica de Talavera” de los siglos XVI al XX, analizando los principales hechos que marcan su desarrollo y aportando algunas de las claves necesarias para comprender su importancia y la influencia que van a ejercer sus producciones en otros centros. Se hace especial hincapié en las cuestiones relativas a los siglos XVI y XVII, origen y decadencia, aportando algunos datos nuevos sobre su cronología y sus series, en base a los últimos descubrimientos. En relación a los siglos XVIII, XIX y XX, solamente se exponen los cambios que se producen y las consecuencias que para las lozas talaveranas acarrearon.

  7. A BRIEF HISTORY OF CILIATE STUDIES (LATE XVII THE FIRST THIRD OF THE XX CENTURY)

    OpenAIRE

    2004-01-01

    The most prominent protistologists who worked with ciliates from the Leeuwenhoek time up to the beginning of the XX century are mentioned. Their achievements in ciliatology and especially in taxonomy of ciliates are briefly discussed on the basis of the original literature and reviews, published during the last 150 years.

  8. 15 CFR Appendix A to Chapter Xx - Administration of the Trade Agreements Program

    Science.gov (United States)

    2010-01-01

    ... President as to which countries should be designated as beneficiary developing countries, and as to which... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Administration of the Trade Agreements Program A Appendix A to Chapter XX Commerce and Foreign Trade Regulations Relating to Foreign...

  9. Comprehensive performance comparison of airfoil fin PCHEs with NACA 00XX series airfoil

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Fei, E-mail: chenfei@iet.cn [Institute of Engineering Thermophysics, Chinese Academy of Sciences, Beijing 100190 (China); Heating Technology Research and Development Center, Beijing District Heating Group, Beijing 100028 (China); Zhang, Lishen, E-mail: lishenzhang@sina.com [Heating Technology Research and Development Center, Beijing District Heating Group, Beijing 100028 (China); Huai, Xiulan, E-mail: hxl@iet.cn [Institute of Engineering Thermophysics, Chinese Academy of Sciences, Beijing 100190 (China); Li, Jufeng, E-mail: lijufeng.net@163.com [Nuclear and Radiation Safety Center, Ministry of Environmental Protection, Beijing 100082 (China); Zhang, Hang, E-mail: zhanghang@iet.cn [Institute of Engineering Thermophysics, Chinese Academy of Sciences, Beijing 100190 (China); Liu, Zhigang, E-mail: zgliu9322@163.com [Energy Research Institute of Shandong Academy of Sciences, Jinan, Shandong 250014 (China)

    2017-04-15

    Highlights: • Pressure drop of NACA 0020 airfoil fin PCHE reduces strikingly in comparison with the zigzag PCHE. • Pressure drop of NACA 00XX airfoil fin PCHE decreases as airfoil thickness increases. • Heat transfer performance of NACA 00XX airfoil fin PCHE increases as airfoil thickness rises. • Comprehensive performance of NACA 00XX airfoil fin PCHE degrades as airfoil thickness increases. - Abstract: Printed circuit heat exchanger (PCHE) can be used in supercritical carbon dioxide (S-CO{sub 2}) Brayton cycle. The present study compares NACA 0020 airfoil fin PCHE with conventional zigzag PCHE by numerical analysis. Pressure drop of the former has a striking reduction while maintaining excellent heat transfer performance. Comparison on four NACA 00XX series airfoil fin PCHEs is performed to investigate the influence of airfoil profile on flow and heat transfer performance. With a fixed vertical pitch, heat transfer performance of NACA series airfoil fin PCHE increases as airfoil thickness increases. However, comprehensive performance, in which both flow and heat transfer are taken into account, degrades with increasing airfoil thickness. Among four NACA airfoil fin PCHEs presented in this paper, NACA 0010 airfoil fin PCHE demonstrates the best comprehensive performance.

  10. Arquitectura y estructura urbana en el Rif Central durante la primera mitad del siglo XX

    OpenAIRE

    Bravo Nieto, Antonio

    2013-01-01

    La región del Rif Central presenta unas características muy singulares respecto a su arquitectura y urbanización, que se basan en las realizaciones llevadas a cabo durante la primera mitad del siglo XX por la administración española en Marruecos. Ciu

  11. 49 CFR 1242.26 - Miscellaneous building and structures (account XX-19-28).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Miscellaneous building and structures (account XX-19-28). 1242.26 Section 1242.26 Transportation Other Regulations Relating to Transportation... RAILROADS 1 Operating Expenses-Way and Structures § 1242.26 Miscellaneous building and structures (account...

  12. The Russian religious painting of the end of XIX – the beginning of the XX centuries

    Directory of Open Access Journals (Sweden)

    Mickу Natalya

    2016-05-01

    Full Text Available Development of religious art, namely – religious painting, its specifics, in Russia of the end XIX – the beginning of the XX centuries, caused by system changes in the Russian society, on the example of painters – V. M. Vasnetsov, M. V. Nesterov, M. A. Vrubel is analyzed in article.

  13. XX sajandi klassika sarjad kogu maailmas menukad / Priit Hõbemägi

    Index Scriptorium Estoniae

    Hõbemägi, Priit, 1957-

    2005-01-01

    15. okt. ilmub Eesti Päevalehe XX saj. klassikasarja avaraamat Umberto Eco "Roosi nimi", teise raamatuna ilmub V. Nabokovi "Lolita". Vt. vastukaja: Sergei Stadnikov. Humanitaaria klassika jätkuvast avaldamisest, Eesti Päevaleht : Arkaadia, 14. okt., lk. 18

  14. XX sajandi klassika sarjad kogu maailmas menukad / Priit Hõbemägi

    Index Scriptorium Estoniae

    Hõbemägi, Priit, 1957-

    2005-01-01

    15. okt. ilmub Eesti Päevalehe XX saj. klassikasarja avaraamat Umberto Eco "Roosi nimi", teise raamatuna ilmub V. Nabokovi "Lolita". Vt. vastukaja: Sergei Stadnikov. Humanitaaria klassika jätkuvast avaldamisest, Eesti Päevaleht : Arkaadia, 14. okt., lk. 18

  15. Prenatal Diagnosis of 45,X/46,XX Mosaicism with Presence of SRY Gene. A Case Report

    Directory of Open Access Journals (Sweden)

    Pedro Alí Díaz-Véliz Jiménez

    2013-10-01

    Full Text Available The most common karyotype of the Turner syndrome is 45,X, although it may occur as mosaic 45,X/46,XX. In the Provincial Medical Genetics Center, a 42-year-old pregnant woman underwent an amniocentesis which led to the detection of mosaic Turner Syndrome (45,X/46,XX. A male was diagnosed through ultrasound and a sample of amniotic fluid was sent to the National Medical Genetics Center to confirm it. A study of the SRY gene was completed and the result was positive. The patient decided to terminate the pregnancy. The pathology report showed a fetal corpse of 25, 3 weeks of gestation, with penis and morphologically normal scrotal sacs, presenting alterations by cysts and hypoplasia of the prostate and seminal vesicles as well as testicular absence. In the literature, cases of XX males are considered uncommon while those combining a mosaic 45, X/46, XX with a SRY gene are less addressed; and therein lies the importance of this case. This article presents the results of a prenatal diagnosis of this rare chromosomal aberration.

  16. Use of the pinch method in heating and cooling systems. How to proceed, with an example. Annex to the main report; Einsatz der Pinch-Methode in der Haustechnik. Anhang. Schlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Hofstetter, U.

    1999-02-01

    This is the annex supplementing the main report with the same title by the same author. It gives additional information on the management of the project itself, and adds numerous technical details on a number of issues.

  17. Subtractive and differential hybridization molecular analyses of Ceratitis capitata XX/XY versus XX embryos to search for male-specific early transcribed genes.

    Science.gov (United States)

    Salvemini, Marco; D'Amato, Rocco; Petrella, Valeria; Ippolito, Domenica; Ventre, Giuseppe; Zhang, Ying; Saccone, Giuseppe

    2014-01-01

    The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, is a fruit crop pest of very high economic relevance in different continents. The strategy to separate Ceratitis males from females (sexing) in mass rearing facilities is a useful step before the sterilization and release of male-only flies in Sterile Insect Technique control programs (SIT). The identification of genes having early embryonic male-specific expression, including Y-linked genes, such as the Maleness factor, could help to design novel and improved methods of sexing in combination with transgenesis, aiming to confer conditional female-specific lethality or female-to-male sexual reversal. We used a combination of Suppression Subtractive Hybrydization (SSH), Mirror Orientation Selection (MOS) anddifferential screening hybridization (DSH) techniques to approach the problem of isolating corresponding mRNAs expressed in XX/XY embryos versus XX-only embryos during a narrow developmental window (8-10 hours after egg laying, AEL ). Here we describe a novel strategy we have conceived to obtain relatively large amounts of XX-only embryos staged at 8-10 h AEL and so to extract few micrograms of polyA+ required to apply the complex technical procedure. The combination of these 3 techniques led to the identification of a Y-linked putative gene, CcGm2, sharing high sequence identity to a paralogous gene, CcGm1, localized either on an autosome or on the X chromosome. We propose that CcGm2 is a first interesting putative Y-linked gene which could play a role in sex determination. The function exterted by this gene should be investigated by novel genetic tools, such as CRISPR-CAS9, which will permit to target only the Y-linked paralogue, avoiding to interfere with the autosomal or X-linked paralogue function.

  18. Application of annexation principle to the study of thermodynamic properties of ternary molten salts CaCl2-MgCl2-NaCl

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jian

    2004-01-01

    Based on the practical basis of measured activities and phase diagrams as well as in the light of the mass action law, the model of inseparable cations and anions of molten salts and mattes, and the annexation principle of two kinds of solutions in binary melts, the calculating model of mass action concentrations of molten salts CaC12-MgCl2-NaCl was formulated. The results of calculation not only agree with experimental values, but also obey the mass action law, testifying that the model formulated can embody the sauctural characteristics of these temary salts, and that the model of inseparable cations and anions as well as the annexation principle of two kinds of solutions in binary melts are also applicable to these ternary salts.

  19. Incidence, prevalence, diagnostic delay, morbidity, mortality and socioeconomic status in males with 46,XX disorders of sex development

    DEFF Research Database (Denmark)

    Berglund, A.; Johannsen, T. H.; Stochholm, K.

    2017-01-01

    STUDY QUESTION What is the epidemiology and trajectory of health and socioeconomic status in males with 46,XX disorders of sex development (DSD)? SUMMARY ANSWER 46,XX DSD males had an increased overall morbidity compared to male background population controls, and the socioeconomic status...... excluding endocrine and urogenital diseases as well as congenital malformations (HR = 1.2, 95% CI: 0.8-1.6). Mortality was not increased (HR = 0.6, 95% CI: 0.2-2.5) compared to male controls. 46,XX DSD males had poorer education (HR = 0.1, 95% CI: 0.0-0.9) and fewer fatherhoods (HR = 0.4, 95% CI: 0...

  20. Incidence, prevalence, diagnostic delay, morbidity, mortality and socioeconomic status in males with 46,XX disorders of sex development

    DEFF Research Database (Denmark)

    Berglund, A; Johannsen, T H; Stochholm, K

    2017-01-01

    STUDY QUESTION: What is the epidemiology and trajectory of health and socioeconomic status in males with 46,XX disorders of sex development (DSD)? SUMMARY ANSWER: 46,XX DSD males had an increased overall morbidity compared to male background population controls, and the socioeconomic status...... excluding endocrine and urogenital diseases as well as congenital malformations (HR = 1.2, 95% CI: 0.8-1.6). Mortality was not increased (HR = 0.6, 95% CI: 0.2-2.5) compared to male controls. 46,XX DSD males had poorer education (HR = 0.1, 95% CI: 0.0-0.9) and fewer fatherhoods (HR = 0.4, 95% CI: 0...

  1. Fundamentals for remote structural health monitoring of wind turbine blades - a preproject. Annex B. Sensors and non-destructive testing methods for damage detection in wind turbine blades

    DEFF Research Database (Denmark)

    Lading, Lars; McGugan, Malcolm; Sendrup, P.

    2002-01-01

    This annex provides a description of the sensor schemes and the non-destructive testing (NDT) methods that have been investigated in this project. Acoustic emission and fibre optic sensors are described in some detail whereas only the key features ofwell-established NDT methods are presented....... Estimates of the cost of different sensor systems are given and the advantages and disadvantages of the different schemes is discussed...

  2. Foreign Purchase & Annexation of China's Enterprises:Legal Problems%关于外商购并中国企业的法律问题探讨

    Institute of Scientific and Technical Information of China (English)

    刘波

    2001-01-01

    外商购并中国企业,是外商投资中国的一种新的形式,有着非常广阔的前景,尤其是国有企业改革和原有外商投资企业的改组,为此带来了更多的购并机遇,但我国现有关于外商购并的法律尚不完善,必须结合中国改革开放的实际和国际购并的惯例,去研究外商购并的相关法律问题,这样才能更好地保护外商的权益,吸引更多的外商参与中国建设。%Foreign businessmen's purchase and annexation of China's enterprises is a kind of new form of foreign investment in China. This kind of new form has a very broad vista, especially in the respect of the reformation of the state enterprises and the reorganization of the original the enterprise with foreign investment, and it brings more opportunities for the purchase and annexation. However, we have not had a perfect law of the foreign businessmen's purchase and annexation up to now. Therefore we have to study and investigate the law of the foreign businessmen's purchases and annexation, add corresponding law agreements in order to protect foreign businessmen's profits and attract more foreign businessmen to invest in China.

  3. Joint Egypt/United States report on Egypt/United States cooperative energy assessment. Volume 5 of 5 Vols. Annexes 11--13

    Energy Technology Data Exchange (ETDEWEB)

    1979-04-01

    The principal features of the existing environment of Egypt are characterized and the main problem areas identified in Annex 11. The environmental, health, and associated social issues that must be considered in choosing from among the options available to Egypt for meeting projected future energy needs are identified. The environmental impacts associated with these options are discussed and observations are made of alternte ways to minimize environmental insults. Annex 12, Manpower, analyzes the energy-related manpower situation of Egypt. Manpower education and training resources of Egypt; the existing manpower base of Egypt; manpower needs of the energy strategies; a comparison of manpower needs and existing manpower base; and the underlying economic and social factors that will make Egypt energy facility development very difficult to plan and execute are discussed. Annex 13 summarizes a preliminary analysis of the capital, labor, materials, and equipment resources required to implement alternative Egyptian energy futures and documents the assessment of several Egyptian energy development programs selected by the DOE. It egins with brief overviews of the ESPM model and data base. It then describes the method by which the system was adapted to Egyptian conditions and the results of this modification. The comparison Case energy development program is described, followed by a summary of ESPM-derived facility and resource requirements. Finally, the sensitivity of these results to several alternative energy strategies is illustrated.

  4. A fiber-coupled 9xx module with tap water cooling

    Science.gov (United States)

    Schleuning, D.; Anthon, D.; Chryssis, A.; Ryu, G.; Liu, G.; Winhold, H.; Fan, L.; Xu, Z.; Tanbun-Ek, T.; Lehkonen, S.; Acklin, B.

    2016-03-01

    A novel, 9XX nm fiber-coupled module using arrays of highly reliable laser diode bars has been developed. The module is capable of multi-kW output power in a beam parameter product of 80 mm-mrad. The module incorporates a hard-soldered, isolated stack package compatible with tap-water cooling. Using extensive, accelerated multi-cell life-testing, with more than ten million device hours of test, we have demonstrated a MTTF for emitters of >500,000 hrs. In addition we have qualified the module in hard-pulse on-off cycling and stringent environmental tests. Finally we have demonstrated promising results for a next generation 9xx nm chip design currently in applications and qualification testing

  5. París en el siglo XX según Julio Verne

    OpenAIRE

    Diego, Rosa de

    1995-01-01

    L'objet de cet article est l'analyse du roman de Jules Verne "Paris au XX siècle", écrit en 1863 et inédit jusqu'a 1994. Il s'agit d'un roman d'imagination scientifique parce qu'il décrit et anticipe, avec une exactitude surprenante, comment sera Paris pendant la deuxieme moitié du XX siècle, sous un point de vue urbanistique, technologique, économique et social. Jules Verne apparait également comme un écrivain philosophe, avec une vision péssimiste du progrès de la civilisation et de la soli...

  6. Desarrollo económico y social en Colombia: siglo XX

    OpenAIRE

    Corredor Martínez, Consuelo; Misas Arango, Gabriel; Kalmanovitz, Salomón; Machado C., Absalón; Giraldo, César; Rodríguez Salazar, Óscar; Flórez Enciso, Luis Bernardo; Balcázar V., Álvaro; Bejarano, Jesús Antonio; Hernández Gamarra, Antonio; Lozano E., Ignacio; Bonilla González, Ricardo; González, Jorge Iván; Restrepo Botero, Darío I.; Ramírez Gómez, Clara

    2001-01-01

    Capítulo 1. Presentación, pág. 9; Capítulo 2. La modernización inconclusa, pág. 15. Capítulo 3. Las instituciones colombianas en el siglo XX, pág. 39. Capítulo 4. El café en Colombia a principios del siglo XX, pág, 77. Capítulo 5. Primera Administración López Pumarejo: la revolución en marcha, pág. 99. Capítulo 6. De la sustitución de importaciones a la apertura económica - La difícil consolidación industrial, pág. 111. Capítulo 7. La inflación colombiana en el proceso de modernización, pág. ...

  7. París en el siglo XX según Julio Verne

    OpenAIRE

    Diego, Rosa de

    1995-01-01

    L'objet de cet article est l'analyse du roman de Jules Verne "Paris au XX siècle", écrit en 1863 et inédit jusqu'a 1994. Il s'agit d'un roman d'imagination scientifique parce qu'il décrit et anticipe, avec une exactitude surprenante, comment sera Paris pendant la deuxieme moitié du XX siècle, sous un point de vue urbanistique, technologique, économique et social. Jules Verne apparait également comme un écrivain philosophe, avec une vision péssimiste du progrès de la civilisation et de la soli...

  8. Añoranzas negras: la poesía negra uruguaya del siglo XX

    Directory of Open Access Journals (Sweden)

    Nicole Roberts

    2004-01-01

    Full Text Available Este artículo constituye un estudio de la poesía negra uruguaya. Se pretende ante todo la divulgación de los temas así como su análisis, tratados por cinco poetas uruguayos del siglo XX, cuya producción, aunque limitada, es muy rica en documentación histórica y de gran valor literario. El orden de presentación es cronológico, según aparecen los poemas en la Antología de poetas negros uruguayos (1990. Aquí no nos proponemos abarcar toda la poesía (ni mucho menos los temas escrita en el siglo XX por poetas negros uruguayos, sino mostrar la visión del mundo del poeta tal como la presenta en sus versos. Pretende ser, pues, sólo una muestra representativa del siglo.

  9. La universidad latinoamericana en el siglo XX: una aproximación

    Directory of Open Access Journals (Sweden)

    Renate Marsiske

    2015-01-01

    Full Text Available En este artículo tratamos de acercarnos a una definición del modelo de universidad latinoamericana en el siglo XX. Si bien hay muchas maneras de caracterizar las universidades públicas en el continente, nos parece que desde el punto de vista histórico las instituciones de educación superior públicas se distinguen de las mismas instituciones en otros continentes por una relación especial entre las universidades y la política. Expresión de ello son los constantes movimientos estudiantiles durante el siglo y por supuesto el anhelo y la concesión de la autonomía universitaria a partir de 1918 en Córdoba, Argentina hasta los años recientes. En este trabajo nos acercamos a la historia de estas dos características de las universidades latinoamericanas en el siglo XX.

  10. A case of sex reversal syndrome with sex-determining region (XX male).

    Science.gov (United States)

    Yamamoto, M; Yokoi, K; Katsuno, S; Hibi, H; Miyake, K

    1995-12-01

    We examined a 32-year-old man with a 4-year history of infertility. The man's sex life, male hair pattern, and penis were normal, and he had no history of erection problems. Left and right testicular volumes were 2 ml and 3 ml, respectively. Semen analysis showed no sperm. The endocrine panel revealed increased serum luteinizing hormone and follicle-stimulating hormone levels, and a normal serum testosterone level. A testicular biopsy demonstrated that both Leydig cell and Sertoli cell hyperplasia were present, and that no germ cells were found in the tubules. A chromosome analysis done on the peripheral blood lymphocytes revealed a karyotype of 46, XX. We identified the sex-determining region, Y, by polymerase chain reaction using Y-specific probes in this patient. The diagnosis was XX male.

  11. Derivation of internationally comparable reduction targets for the Annex-I countries of the climate convention. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Walz, R.; Landwehr, M.; Mannsbart, W.; Schoen, M.

    1997-05-01

    Since the start of international negotiations on the climate in 1991, the Federal Republic of Germany has supported the process of agreeing on binding limits especially for CO{sub 2} emissions among the industrialised countries under international law, after corresponding commitments had already been agreed upon for CFC emissions. The formation of the Adhoc group Berlin Mandate (AGBM) launched a process of negotiation which aimed to lead to the adoption of a protocol with, among other things, quantified limits and reduction targets for the Annex-I countries; this objective was reconfirmed at the Second Conference of Member States in July '96 in Geneva. The work carried out is documented in this final report. Chapter 2 deals with the fundamental principles of target differentiation. Justifications and possible correction factors are presented and methodological approaches to target differentiation developed. In the subsequent chapters, example calculations are made for different groups of countries (EU, OECD, OECD with selected Eastern European countries). Three different methods of target differentiation are employed: correction factors without sectoral differentiation (Chapter 3), correction factors with sectoral differentiation (Chapter 4) and a division into reduction clusters (Chapter 5). A summary of the results and the conclusions to be drawn can be found in Chapter 6 of this final report. The data collected during the study and the individual results of the example calculations are shown in the Appendices. (orig.)

  12. 75 FR 43165 - Information Collection; OMB Control No. 3090-00XX; FFATA Subaward and Executive Compensation...

    Science.gov (United States)

    2010-07-23

    ... (Transparency Act) requires information disclosure of entities receiving Federal financial assistance through... Information Collection 3090- 00XX, FFATA Subaward and Executive Compensation Reporting Requirements by any of... Subaward and Executive Compensation Reporting Requirements''. Follow the instructions provided at...

  13. Spanish economy XIX & XX century : does the past explain the present?

    OpenAIRE

    Gil Pérez, Carlos

    2012-01-01

    This thesis is an economic trip to the Spain of the XIX and XX century. We will analyze how the industrial revolution was in Spain, how it developed during these important centuries, and always taking in account Europe. We will compare the different economic sectors between all the European countries and its evolution during those centuries. It finally will give as a picture of how the past influences in our nowadays economic situation. After this analysis will get into an important answer to...

  14. Discordant sex in monozygotic XXY/XX twins: a case report.

    Science.gov (United States)

    Tachon, G; Lefort, G; Puechberty, J; Schneider, A; Jeandel, C; Boulot, P; Prodhomme, O; Meyer, P; Taviaux, S; Touitou, I; Pellestor, F; Geneviève, D; Gatinois, V

    2014-12-01

    We report a case of discordant phenotypic sex in monozygotic twins mosaic 47,XXY/46,XX: monozygotic heterokaryotypic twins. The twins presented with cognitive and comprehension delay, behavioural and language disorders, all symptoms frequently reported in Klinefelter syndrome. Molecular zygosity analysis with several markers confirmed that the twins are in effect monozygotic (MZ). Array comparative genomic hybridization found no evidence for the implication of copy number variation in the phenotypes. Ultrasound scans of the reproductive organs revealed no abnormalities. Endocrine tests showed a low testosterone level in Twin 1 (male phenotype) and a low gonadotrophin level in Twin 2 (female phenotype) which, combined with the results from ultrasound examination, provided useful information for potentially predicting the future fertility potential of the twins. Blood karyotypes revealed the presence of a normal 46,XX cell line and an aneuploïd 47,XXY cell line in both patients. Examination of the chromosome constitutions of various tissues such as blood, buccal smear and urinary sediment not surprisingly showed different proportions for the 46,XX and 47,XXY cell lines, which most likely explains the discordant phenotypic sex and mild Klinefelter features. The most plausible underlying biological mechanism is a post-zygotic loss of the Y chromosome in an initially 47,XXY zygote. This would result in an embryo with both 46,XX and 47,XXY cells lines which could subsequently divide into two monozygotic embryos through a twinning process. The two cell lines would then be distributed differently between tissues which could result in phenotypic discordances in the twins. These observations emphasize the importance of regular paediatric evaluations to determine the optimal timing for fertility preservation measures and to detect new Klinefelter features which could appear throughout childhood in the two subjects.

  15. Perfil del alumnado normalista castellano-leonés del primer tercio del siglo XX

    Directory of Open Access Journals (Sweden)

    Juan Francisco CEREZO MANRIQUE

    2009-11-01

    Full Text Available Nos proponemos en este trabajo dibujar el perfil del alumnado que acudió a los establecimientos normalistas castellano-leoneses durante el primer tercio del siglo XX. El análisis cuantitativo de una serie de variables de tipo clasificatorio nos ayudará a explicitar las características de entrada de un colectivo sobre el que la acción institucional de las Escuelas Normales habría de incidir.

  16. Gonadal Dysgenesis 46, XX Associated with Mayer-Rokitansky-Kuster-Hauser Syndrome: One Case Report

    OpenAIRE

    Bousfiha, N.; S Errarhay; Saadi, H; Ouldim, K.; Bouchikhi, C; Banani, A

    2010-01-01

    Introduction. The association of gonadal dysgenesis and Mayer-Rokitansky-Kuster-Hauser syndrome is very rare and appears to be coincidental, independent of chromosomal anomalies. Case Report. We report the case of a 19-year-old woman who presented primary amenorrhea and impuberism. The endocrine study revealed hypergonadotrophic hypogonadism. The karyotype was normal, 46XX. No chromosome Y was detected at the FISH analysis. Internal genitalia could not be identified on the pelvic ultrasound ...

  17. DARI METOBU HINGGA MEKAMBO: PERTUMBUHAN PEMUKIMAN KOTA KOLAKA PADA ABAD XX

    Directory of Open Access Journals (Sweden)

    Basrin Melamba

    2013-01-01

    Full Text Available This paper describes the growth of Kolaka city in Bone in XX century. In early XX century, Kolaka became the capital of onderafdeeling Kolaka since 1911. In 1912 indirectly the influence of this policy was the development and repair of city facilities in the form of port medium, warehouse, office of toll and duty, and road network in Kolaka. Those settlement growths in Kolaka affected the economic activity and commerce. The settlement and physical region got much better especially after Dutch government settled the resident settlement with the settlement model following the centripetal roadway pattern with the village (kampung pattern (o’kambo. The resident settlement pattern also followed the coastline of Mekongga and Bone Bay. Exploiting the nickel mine yielded the urban symptom in the center of area of nickel mining. Key words: growth, settlement, Kolaka city  Makalah ini menjelaskan tentang pertumbuhan Kota Kolaka di Bone pada abad XX. Pada awal abad XX, Kolaka menjadi ibukota daerah setingkat kabupaten (onderafdeeling Kolaka sejak tahun 1911. Pada tahun 1912 secara tidak langsung pengaruh dari kebijakan ini adalah adanya pengembangan dan perbaikan fasilitas kota dalam bentuk sarana pelabuhan, gudang, kantor tol dan pajak, serta jaringan jalan di Kolaka. Pertumbuhan pemukiman di Kolaka tersebut mempengaruhi kegiatan ekonomi dan perdagangan. Pemukiman dan fisik wilayah menjadi jauh lebih baik terutama setelah Pemerintah Belanda menyelesaikan pemukiman penduduk dengan model pemukiman yang mengikuti pola jalan sentripetal dengan pola kampung (o'kambo. Pola pemukiman penduduk juga mengikuti garis pantai Teluk Mekongga dan Bone. Memanfaatkan tambang nikel juga menghasilkan gejala urban di tengah area pertambangan nikel.Kata kunci: pertumbuhan, pemukiman, kota Kolaka

  18. 46,XX/69,XXX diploid-triploid mixoploidy with hypothyroidism and precocious puberty.

    OpenAIRE

    Järvelä, I E; Salo, M.K.; Santavuori, P.; Salonen, R K

    1993-01-01

    We report a 20 month old female patient with diploid-triploid mixoploidy (46,XX/69,XXX) syndrome with hypothyroidism and precocious puberty. The triploid cell line was only expressed in the fibroblast culture and comprised the majority (95%) of the cells. Chromosome analysis of the fetal blood sample and peripheral blood sample were normal. The patient shows typical features of full triploidy (growth and severe mental retardation, cranial and facial dysmorphism, complete syndactyly of fingers...

  19. SYSTEM OF CONTINUOUS AGRICULTURAL EDUCATION IN PRECARPATHIA (LATE XIX - EARLY XX CENTURIES)

    OpenAIRE

    2015-01-01

    Ukrainian public communities have important achievements in development of the system of continuous agricultural education in Precarpathia - Ukrainian Pedagogical Society “Ridna Shkola”, “Prosvita”, “Silskyi Hospodar”, the Union of Ukrainians and others. In the late XIX - early XX centuries, they held important educational work among adults, organized various forms of training - courses, professional-complementary schools, agricultural schools, high schools, colleges, courses, public universi...

  20. The specificity of female deviance in Tsaritsyn the end of XIX - beginning of XX centuries

    Directory of Open Access Journals (Sweden)

    E. V. Avstrijskov

    2015-01-01

    Full Text Available In this work there were analyzed the nature and specifics of female deviance in Tsaritsyn at the end of XIX - beginning of XX centuries, and also there was described the main socio-economic factors contributing to the development of anomie in this historical period in the society. There was investigated the motivational complex, structure and form of the women’s deviant behavior, and there were presented trends of the development of female deviance.

  1. Eigenfunctions of Five-Qubit XX Chain and Ground State Concurrence

    Institute of Scientific and Technical Information of China (English)

    LING Yin-Sheng

    2008-01-01

    Use Jordan-Wigner transformation the eigenstates and eigenenergies of five qubits XX chain including external magnetic field are obtained. The concurrences Co,1 and C0,2 of ground state are obtained. For the ferromagnetic,when [((√)5-1)/2]|J|

  2. Totalitarianism and Kazakh Literary Criticism in the 40s of the XX Century

    Directory of Open Access Journals (Sweden)

    Zhansaya Zharylgapov

    2013-01-01

    Full Text Available The article deals with urgent problems of Kazakh literary criticism in the 40s of the XX century, traces the artistic processes of the specified period and the impact of the totalitarian system on the writers’ artistic nature. The author of the article examines the genre originality of literary criticism. Besides, such genres as topical article, polemic article, literary review and other were considered

  3. [New aspects of diagnosing and treating pure gonadal dysgenesis 46XY and 46XX].

    Science.gov (United States)

    Baron, J; Warenik-Szymankiewicz, A; Miedzianowski, J; Baron, J J

    1993-01-01

    Among 67 women with pure gonadal dysgenesis, karyotype 46XY was found in 46 and karyotype 46XX in 21 (26.3% of all intersexual subjects). Karyotype 46XY was either of pure type or mosaicism 45,X/46,XY (10.9%). Primary amenorrhea, underdevelopment of mammary glands and lack or poor development of pubic hair were the main complaints of the patients. In gonadal dysgenesis 46XY mammary glands were developed in 21.8% and pubic hair in 26% suggesting the presence within the gonads of the hormonally active tumor or the state after hormonal treatment. The patients with gonadal dysgenesis 46XX had lowered levels of estrogens and elevated levels of FSH and LH. Karyotype 46XY was not associated with evident changes in hormonal levels. Estrogens were both low and normal, and FSH was elevated (21.5 + 16.6 ug/ml) or normal (3.2-5.0 ng/ml). Total testosterone values were normal or slightly elevated. Such situation can be explained by the presence in some patients of tumors secreting either estrogens or androgens. Taeniform character of gonads was observed by ultrasonography whenever the presence of gonadal tumor was excluded. Histology of specimens taken from gonads or tumors demonstrated the presence of dysgerminoma or gonadoblastoma type of malignancy in 53.1%, foci or proliferation of the Leydig cells in 31.3% and typical morphology of residual gonads without germinal cells only in 12.5%. The differentiation between pure gonadal dysgenesis 46XX and primary ovarian insufficiency is required whenever no characteristic pattern emerges from clinical, hormonal, cytogenetic or ultrasonographic examination. Diagnosis of pure gonadal dysgenesis 46XX can be finally confirmed by the absence of gonocytes in the residual gonad. Besides of removal of gonads or tumors by surgery, the treatment of patients with 46XY karyotype consists in cyclic administration of estrogens and progestagens restoring menstruation and bringing development of secondary sex attributes.

  4. Impacts of shaking Bengkulus seismicity to subsurface Wellbore in the XX area

    Science.gov (United States)

    Rusli, Saifatur; Pratama, M. Ardian; Mardiyan, Hilman; Mirza, Finisha, Brian

    2016-05-01

    Bengkulu earthquake was happened on Wednesday, May 5th 2010 at 23:29:03 WIB (UTC-7) with magnitude 6.5 Richter scale. The Epicentrum was very close to Mentawai Fault System located on latitude 4.063°S and longitude 101.085°E with depth subsurface 27 kms. It was occurred the result of the Indian Ocean Plate-Australia's activity with low angled-subducted beneath the island of Sumatra. Shaking Bengkulus seismicity impacted subsurface in the XX Area which situated on South Palembang Sub-Basin part of South Sumatra Basin (SSB) about 200 kms far away from the epicentrum. Due to XX Area has some producing wells so that the seismicity activities as hypothetically impacts to Subsurface Wellbore which has caused some wells casing problems in the same depth. The wells casing problem shown after conducted routine sand bailer by Sand Line Unit, it was a downhole device used to remove debris sands or similar small particles around the fishingnecks of downhole tools or equipment in the wellbore, and then Sand Bailer tools got scratch at one side body. Similarly, Sand Bailer tools couldnt lowered until Total Depth and got samples sands slightly. At the end, it has impacted to well performance to produce oil in the XX Area.

  5. Overrepresentation of the ACTN3 XX genotype in elite canoe and kayak paddlers.

    Science.gov (United States)

    Orysiak, Joanna; Sitkowski, Dariusz; Zmijewski, Piotr; Malczewska-Lenczowska, Jadwiga; Cieszczyk, Pawel; Zembron-Lacny, Agnieszka; Pokrywka, Andrzej

    2015-04-01

    The aim of the study was to examine the association between the ACTN3 R577X polymorphism in canoe sprint athletes (canoe and kayak paddlers) and their results at 200- or 1000-m distance. Eighty-six European white male athletes divided into 2 groups-successful, who were outstanding at national championships, and nonsuccessful in these competitions-and 354 nonathletic controls were included in this study. The R577X polymorphism of ACTN3 was typed using PCR-RFLP. ACTN3 genotype distribution among all tested athletes and controls was in Hardy-Weinberg equilibrium. The odds ratio (OR) for successful 1000-m athletes harboring the XX genotype compared with sedentary controls was 2.95 (95% confidence interval [CI]: 1.37-6.35), but the OR for nonsuccessful 200-m athletes having the XX genotype compared with controls was 2.64 (95% CI: 1.30-5.36). These results suggest that factors associated with the ACTN3 XX genotype in canoe and kayak paddlers might provide some competitive advantage in performance at 1000 m, but it seems to limit at 200 m. Further studies aimed at development of training strategies based on genetic factors are needed.

  6. Expression of selected genes escaping from X inactivation in the 41, XX(Y)* mouse model for Klinefelter's syndrome.

    Science.gov (United States)

    Werler, Steffi; Poplinski, Andreas; Gromoll, Jörg; Wistuba, Joachim

    2011-06-01

    We hypothesized that patients with Klinefelter's syndrome (KS) not only undergo X inactivation, but also that genes escape from inactivation. Their transcripts would constitute a significant difference, as male metabolism is not adapted to a 'female-like' gene dosage. We evaluated the expression of selected X-linked genes in our 41, XX(Y)* male mice to determine whether these genes escape inactivation and whether tissue-specific differences occur. Correct X inactivation was identified by Xist expression. Relative expression of X-linked genes was examined in liver, kidney and brain tissue by real-time PCR in adult XX(Y)* and XY* males and XX females. Expression of genes known to escape X inactivation was analysed. Relative mRNA levels of Pgk1 (control, X inactivated), and the genes Eif2s3x, Kdm5c, Ddx3x and Kdm6a escaping from X inactivation were quantified from liver, kidney and brain. Pgk1 mRNA expression showed no difference, confirming correct X inactivation. In kidney and liver, XX(Y)* males resembled the female expression pattern in all four candidate genes and were distinguishable from XY* males. Contrastingly, in brain tissue XX(Y)* males expressed all four genes higher than male and female controls. Altered expression of genes escaping X inactivation probably contributes directly to the XX(Y)* phenotype. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

  7. A viable fetus presenting 68,XX[73]/69,XXX[27] triploid mosaicism

    Directory of Open Access Journals (Sweden)

    A.X. Acosta

    1998-09-01

    Full Text Available Triploidy is common in human pregnancies. It is detected in 1 to 2% of clinically recognized pregnancies and in approximately 15 to 20% of spontaneous abortions produced by chromosome anomalies. We report a premature liveborn girl (30 weeks of gestation with microcephaly, facial dysmorphism and skeletal abnormalities who died at one day of age due to respiratory failure. The placenta showed partial hydatiform mole. Autopsy revealed no internal malformations. Cytogenetic analysis of 100 metaphases obtained from renal tissue culture revealed a 68,XX[73]/69,XXX[27] karyotype. To our knowledge this is the first report in the literature of 68,XX[73]/69,XXX[27] mosaicism in a liveborn infant.A triploidia é uma anomalia cromossômica comum encontrada em 1 a 2% das gestações clinicamente reconhecidas e em cerca de 15 a 20% dos abortos espontâneos de causa cromossômica. Em aproximadamente 5% dos casos, uma aneuploidia pode estar também associada (Boué et al., 1985. Descrevemos um recém-nascido do sexo feminino, prematuro (30 semanas de idade gestacional, com microcefalia, dismorfias faciais e alterações de membros, que foi a óbito com 1 dia de vida por insuficiência respiratória. O exame anátomo-patológico da placenta revelou alterações compatíveis com degeneração molar. A necrópsia da criança não evidenciou malformações internas. A análise citogenética de 100 metáfases, obtidas a partir de cultura de tecido renal, evidenciou cariótipo 68,XX[73]/69,XXX[27]. Apenas 9 casos de triploidia 68,XX foram descritos anteriormente, sendo 7 em abortos, 1 em feto de 21 semanas e 1 em recém-nascido a termo. Consideramos que este estudo seja o primeiro da literatura relatando a ocorrência de mosaicismo 69,XXX/68,XX em um recém-nascido vivo. Os autores discutem os achados clínicos e os possíveis mecanismos envolvidos nesta aberração cromossômica.

  8. EL ESPACIO ANEXO ENTRE LO ARTIFICIAL Y LO NATURAL / The annexed space between the natural and the artifical

    Directory of Open Access Journals (Sweden)

    Juan José Tuset Davó

    2011-11-01

    Full Text Available RESUMEN En la ciudad contemporánea, lo público está perdiendo relevancia respecto a lo privado. Presenciamos, además, una insistencia en encontrar y recuperar el equilibrio entre ambos. Ante la pregunta de cuál es la forma adecuada que la arquitectura da a los espacios donde lo público encuentra su lugar, vemos que a lo largo de la modernidad, en las utopías socialistas del siglo XIX, en los experimentos de vivienda social europea, oculto en la ciudad suburbana norteamericana, en los revisionismos de los años 70 y en la nueva vivienda colectiva de los años 90, existen unos espacios anexos a la arquitectura que pretenden complementarla y corregir la progresiva sustitución de lo público por lo privado. Actualmente, el activismo pasivo urbano aprovecha cualquier oportunidad en la ciudad para reivindicar el encuentro colectivo. Este planteamiento radica en la firme voluntad de diseñar escenarios urbanos donde lo público encuentre acomodo. Para ello, la constitución del suelo como un plano moldeable acompañado por una cobertura arbórea nos ofrece las condiciones esenciales para que la gente se encuentre bien en un lugar. Entre lo artificial y lo natural, es posible pensar que hay un espacio anexo arquitectónico que se abre a los acontecimientos imprevistos para que tenga lugar otro sentido de lo público.SUMMARY In the contemporary city, what is public is losing importance with respect to what is private. Witness also, an insistence on finding and recovering the balance between them. The appropriate way that architecture makes spaces for what is public can be seen throughout modernity: in the socialist utopias of the nineteenth century; in the European social housing experiments; hidden in the North American suburban town; in the revisionism of the 70’s, and, in the new collective housing of the 90’s, there are spaces annexed to the architecture which are intended to complement and correct the progressive change from public to

  9. Analysis of Photovoltaic Applications in Zero Energy Building Cases of IEA SHC/EBC Task 40/Annex 52

    Directory of Open Access Journals (Sweden)

    Jin-Hee Kim

    2015-07-01

    Full Text Available A Net Zero Energy Building (NZEB considerably reduces the building energy load through high efficiency equipment and passive elements such as building orientation, high insulation, natural daylighting, and ventilation in order to achieve zero energy balance with on-site energy production from renewable energy systems applied to the building. For a Zero Energy Building (ZEB, the heating energy demand can be significantly reduced with high insulation and air tightness, while the cooling energy demand can be curtailed by applying shading device, cross ventilation, etc. As such, the electrical energy demand for a ZEB is relatively higher than its heat energy demand. Therefore, the application of a Renewable Energy System (RES to produce electricity is necessary for a ZEB. In particular, Building Integrated Photovoltaic (BIPV systems that generate electricity can play an important role for achieving zero energy balance in buildings; BIPVs are multi-functional and there are many ways to apply them into buildings. This study comprehensively analyzes photovoltaic (PV applications in ZEB cases through the International Energy Agency Solar Heating and Cooling Programme (IEA SHC/Energy in Buildings and Communities Programme (EBC Task 40/Annex 52 activities, which include PV installation methods, PV cell type, and electricity generation. The most widely applied RES is the PV system, corresponding to 29 out of a total of 30 cases. Among the roof type PV systems, 71% were non-integrated. In addition, 14 of the 27 cases in which PV systems were applied, satisfied over 100% of the electricity energy demand from the PV system and were found to generate surplus electrical power.

  10. Commission staff working paper. Annex to the Communication from the Commission to the Council and the European Parliament on Community strategy concerning mercury. Extended impact assessment

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-06-28

    The Extended Impact Assessment (ExIA) accompanies the Community strategy concerning mercury (COM(2005)20 final). After explanning the risks posed by mercury and the policy options available to tackle the mercury problems, the document looks in turn at the impacts of options relating to: mercury supply and trade, and the fate of surplus mercury from the chlor-alkali industry; measuring and control equipment; coal combustion; and cremation. It then discusses how to monitor and evaluate the results and impacts of the mercury strategy after implementation, stakeholder consultation and final policy choice. 76 refs., 8 annexes.

  11. Remedial Investigations Report, Phase 2. Volume 4. Appendices Sites P11/P13 and A12/P36/P37, Fort Devens Sudbury Training Annex, Maynard, Massachusetts

    Science.gov (United States)

    1995-12-01

    40wWISA CSM N ’C4EPLI4~ A~L .9.0 ab IMIlvy -L irowa.sv -. o~ff I~mt p1..’ IL U)Fese w , t~lGfOVAft ( Project >ZtO)RY AtIWPC? Pag. C soivnock .E I...0 Date: October 1994 created by using a 12-pound sledge hammer to strike a rubberized -plastic plate. Three to five shots were "stacked" at each...Concentrations (RfC), and Carcinogen Slope Factors (SF) for Chemicals Detected at the E&E Sites at Sudbury Training Annex

  12. A economia internacional no século XX: um ensaio de síntese

    Directory of Open Access Journals (Sweden)

    Paulo Roberto de Almeida

    2001-06-01

    Full Text Available Ensaio sobre as grandes tendências da economia mundial no século XX, com ênfase nas transformações estruturais e institucionais de sua primeira metade, na expansão e crise da economia internacional no pós-Segunda Guerra e nas características do processo de globalização capitalista do final do século XX e princípios do XXI (discussão sobre as desigualdades estruturais entre países e sociedades. Seções específicas do trabalho são dedicadas ao comércio (do liberalismo ao protecionismo e do multilateralismo ao neoprotecionismo, às finanças internacionais e ao câmbio (do padrão ouro ao padrão ouro-dólar e à flutuação generalizada de moedas e à estrutura institucional da economia internacional no século XX.Essay on the main trends of the world economy during the XXth century, stressing the structural and institutional changes of the first half of that period, the expansion and crisis of the international economy in the post-WWII and the main features of the globalization process of the end of that century and the beginning of the XXIth (discussion on the structural inequalities among countries and societies. Special sections of the work are devoted to trade (from liberalism to protectionism and from multilateralism to neoprotectionism, to international finance and exchange (from gold standard to gold-dollar standard and the overall flotation of currencies and to the institutional structure of the international economy of the XXth century.

  13. Mosaic double aneuploidy (45,X/47,XX,+8) with aortic dissection.

    Science.gov (United States)

    Lee, M N; Choi, K H; Kim, D K; Kim, S H

    2014-01-01

    Chromosomal aneuploidy is considerably frequent and may involve either autosomes or sex chromosomes. While double aneuploidy involving both autosomal and sex chromosomes is rare, several reports described the cases of sex chromosomal aneuploidies in combination with trisomy 21, such as Down-Klinefelter and Down-Turner syndrome. However, trisomy 8-Turner syndrome has been rarely described to date. Here we report a case of a 28-year-old female with mosaic trisomy 8-Turner syndrome. The patient was referred to our hospital for aortic dissection. On physical evaluation, features of her phenotype, which included short stature, webbed neck and cubitus valgus, suggested congenital anomalies such as Turner syndrome. Chest CT revealed aortic dissection with bicuspid aortic valve and coarctation. G-banding cytogenetic analysis of peripheral blood showed mosaicism with two cell lines (45,X[17]/47,XX,+8[33]). FISH analysis indicated that 15% of the cells were of monosomy X karyotype and 85% of the cells were with XX karyotype and trisomy 8 was detected only in XX cells. Though the patient exhibited clinical features of Turner syndrome, somatic stigmas present were not clearly distinguishable from those of trisomy 8, such as short stature, skeletal and cardiac abnormalities. Observations from most of the double aneuploidy cases indicated that the patient's phenotype was not necessarily in correlation to the ratio of autosomal and sex chromosomal aberrations. Mosaicism in trisomy 8-Turner syndrome was rarely documented and we believe this is the first reported case of mosaicism in trisomy 8-Turner syndrome presenting with aortic dissection and surviving into adulthood.

  14. Reflexiones teóricas de arquitectos latinoamericanos en el último tercio del Siglo XX

    OpenAIRE

    2011-01-01

    El tema está referido al impacto que tuvieron las principales corrientes del pensamiento arquitectónico en el último tercio del siglo XX en América Latina y los principales aportes, que en el mismo periodo, ofreció el pensamiento arquitectónico latinoamericano. Esto se alcanzará a través de la revisión de los principales textos y escritos sobre teoría de la arquitectura, publicados dentro y fuera de Latinoamérica, en este periodo, encontrando sus principales propuestas y tratando de establec...

  15. XX Poemas de Salvador Novo desde una perspecti­va vanguardista

    OpenAIRE

    Trejo, Laura

    2013-01-01

    Casi todos los estudiosos del vanguardismo están de acuerdo en considerar que los descubrimientos, las investigaciones, las comunicaciones, la excesiva tecnificación, etc., han producido cambios y determinado una sucesión de mutaciones en nuestro siglo XX. Los hombres han estado sometidos a sensaciones inéditas, a reflexiones inusitadas, a revaloraciones complejas y a la necesidad de nombrar cosas que sus antepasados no habían conocido. Todo este nuevo mundo propicia el nacimiento de una nuev...

  16. Enhancing the geometric quantum discord in the Heisenberg XX chain by Dzyaloshinsky–Moriya interaction

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Jia-Min, E-mail: jmgong@yeah.net [School of Electronic Engineering, Xi' an University of Posts and Telecommunications, Xi' an 710121 (China); Tang, Qi [School of Electronic Engineering, Xi' an University of Posts and Telecommunications, Xi' an 710121 (China); Sun, Yu-Hang [School of Science, Xi' an University of Posts and Telecommunications, Xi' an 710121 (China); Qiao, Lin [School of Electronic Engineering, Xi' an University of Posts and Telecommunications, Xi' an 710121 (China)

    2015-03-15

    We studied the trace distance, the Hellinger distance, and the Bures distance geometric quantum discords (GQDs) for a two-spin Heisenberg XX chain with the Dzyaloshinsky–Moriya (DM) interaction and the external magnetic fields. We found that considerable enhancement of the GQDs can be achieved by introducing the DM interaction, and their maxima were obtained when the strength of the DM interaction approaches infinity. The external magnetic fields and the increase of the temperature can also enhance the GQDs to some extent during certain specific parameter regions.

  17. 46,XX Karyotype in a Male with Ambigious Genitalia: A Case Report

    Directory of Open Access Journals (Sweden)

    Mahmut Balkan

    2004-01-01

    Full Text Available 40 days old case who were diagnosed with ambigious genitalia were sentto laboratory of cytogenetics. Mother was 26 years old and have to alivechildren and case were the second child and applied to Child SurgeryDepartment due to continiously vomiting and uneasy conditions. Sexualdevelopment were as male on physical examinations. Cell culture wasapplied for chromosomal analysis. Slides were stained with GiemsaBanding Staining (GTG and 100 cells were totaly counted and karyotypingwere done with 15 metaphase. Chromosome with 46,XX karyotype. Casewere taken under consideration of congenital adrenel hyperplasia afterevalution of karyotype. Case were discussed according to by information ofpresents literatures.

  18. De Chirico y la arquitectura. Enigmas y mitos del S.XX

    OpenAIRE

    Puig Costa, Janina

    2013-01-01

    La obra de Giorgio de Chirico (1888-1978) abarca todo el siglo XX, su pintura retrata el periodo artístico que inician las vanguardias en París, continua el surrealismo, y cierra el pop-art de Andy Warhol. Esta investigación propone un recorrido arquitectónico por su imaginario metafísico, un lugar donde se reúnen enigmas modernos con mitos clásicos, chimeneas y fábricas con pórticos y ágoras, para poner de manifiesto la naturaleza de un futuro igual al pasado. Sus maniqu...

  19. A Case with 46,XX,dup(X(q21.3q24 karyotype

    Directory of Open Access Journals (Sweden)

    Selda Şimşek

    2010-03-01

    Full Text Available The relationship between phenotype and Xq duplicationsin females remains unclear. Some females are normal;some have short stature; and others have features suchas microcephaly, developmental delay/mental retardation,body asymmetries, and gonadal dysgenesis. Somefeatures in these females resemble those in Turner syndrome.We, herein, presented a 15 years-old girl withshort stature and primary amenorrhea, who was referredto cytogenetic laboratory. Through karyotipe analysis performedby Giemsa banding technique, the patient wasdetermined to have positive Barr body and 46,XX,dup(X(q21.3q24 chromosomal constitution. Case was discussedaccording to information of present literatures.

  20. Educación, sociabilidad y demandas populares de cultura. Asturias a principios del siglo XX

    Directory of Open Access Journals (Sweden)

    Jorge URÍA

    2013-11-01

    Full Text Available En la Asturias de principios del siglo xx, existieron múltiples alternativas educativas al sistema de enseñanza oficial que enlazaron con el complejo y diversificado sistema asociativo de carácter voluntario que iba a caracterizar a los sectores obreros y populares que sostenían también en el terreno sindical o político unas expectativas de cambio que conectaban a la perfección con las esperanzas depositadas en una educación supuestamente liberadora y emancipatoria.

  1. Ruralia, tradicionalismo y población en la puna de Jujuy durante el siglo XX

    Directory of Open Access Journals (Sweden)

    Alfredo Bolsi

    2005-01-01

    Full Text Available The growth of the population puneña during century XX is from the evolution of three central circumstances. First, it consists of which the society puneña, specially the rural one, has been, and largely it is it, ";a traditional"; society, that is to say, nonmodern, preindustrial, with social structure little differentiated, cultural guidelines differentials. The other is related to the process of joint between that traditional society and modern, the capitalist one, extra-puneña. The conjecture is that the consolidation of Capitalism in the Argentine Northwest from the last third of century XIX did not move nor replaced the traditional society: it coexisted with her during decades generating substantial changes in numerous aspects. Third it has to do with the action of the State: during the first decades of the XX it operated at least in the context of the positivismo, associated with the concept of development - nondistant to the one of progress. Through the progress, the traditional society transforms itself into a rational, secular society, with differentiated social structures.El crecimiento de la población puneña durante el siglo XX resulta de la evolución de tres circunstancias centrales. La primera consiste en que la sociedad puneña, especialmente la rural, ha sido, y en buena medida lo es, una sociedad "tradicional", es decir, no moderna, preindustrial, con estructura social poco diferenciada, con pautas culturales diferenciales. La otra se relaciona con el proceso de articulación entre esa sociedad tradicional y la moderna, capitalista, extra-puneña. La conjetura es que la consolidación del capitalismo en el Noroeste argentino a partir del último tercio del siglo XIX no desplazó ni reemplazó a la sociedad tradicional: convivió con ella durante décadas generando cambios sustanciales en numerosos aspectos. La tercera tiene que ver con la acción del Estado: al menos durante las primeras décadas del XX operó en el

  2. Inspectoras de primera enseñanza en el segundo tercio del siglo XX

    OpenAIRE

    Gómez San Miguel, Eva

    2016-01-01

    La presente investigación titulada: Inspectoras de enseñanza primaria en el segundo tercio del siglo XX, analiza la trayectoria de vida de seis inspectoras: Leonor Serrano de Pablo, Francisca Bohigas Gavilanes, Josefina Álvarez Díaz, Francisca Montilla Tirado, Julia Morrós Sarda y Aurora Medina de la Fuente. Todas ellas tienen en común el haber sido inspectoras de enseñanza primaria en España, aunque varía el momento en el que se incorporan a este cuerpo de la enseñanza. Se realiza una recons...

  3. Lecturas y sistemas educativos. Los modelos literarios escolares de la segunda mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Fernando E. GÓMEZ MARTÍN

    2010-03-01

    Full Text Available RESUMEN: La orientación de los manuales de Lengua y Literatura ha variado notablemente en la segunda mitad del siglo XX. Las lecturas ideológicas han dado paso a nuevos cometidos, como la formación estética del alumno y su creatividad. ABSTRACT: In the second part of the 20th century the course of the Spanish language and literature has changed. The ideological lectures of the franquist school have been forgoten, and now the creativity and aesthetic education prevail over.

  4. Fenomenologia e Psicologia Experimental no Início do Século XX

    OpenAIRE

    Thiago Gomes de Castro; William Barbosa Gomes

    2015-01-01

    RESUMOO estudo examina as relações entre fenomenologia e psicologia experimental no início do século XX para definir origem, especificidade e abrangência do termo fenomenologia experimental. Inicia com a indicação de que o termo está associado a Carl Stumpf em Berlim. A seguir, acompanha as relações conturbadas entre Husserl e o Departamento de Psicologia da Universidade de Göttingen. Na sequencia constata a influência frutuosa da fenomenologia na psicologia experimental da Universidade de Wü...

  5. La Administración de Tunja a través del siglo XX

    OpenAIRE

    Muñoz Cárdenas, Felipe Andrés

    2014-01-01

    El trabajo hace una primera aproximación al tema de la administración pública de la ciudad de Tunja, enfoncandose en dos puntos específicos, las personas que estuvieron al frente de la administración y la alcaldía como institución. La investigación se desarrolla bajo la premisa que la administración pública y específicamente la alcaldía de Tunja fue fundamental dentro del proceso de desarrollo de la ciudad desde finales del siglo XIX hasta finales del XX, enmarcando el trabajo ...

  6. La tradición hermenéutica en el siglo XX.

    OpenAIRE

    Flores Miguel, Cirilo

    2010-01-01

    El artículo analiza la tradición hermenéutica en el contexto del siglo XX y su peculiaridad frente a las otras tradiciones relevantes en dicho siglo, partiendo de la transformación que la hermenéutica experimenta a partir de Schleiermacher. Considera también la transformación que acontece en Heidegger y Gadamer. En el caso de este último autor estudia el mundo del texto y su peculiaridad, la noción de texto y los conceptos de tradición, conciencia histórica, historia de los efectos y aplicaci...

  7. Domains of attraction of the random vector $(X,X^2)$ and applications

    OpenAIRE

    Omey, Edward

    2007-01-01

    Many statistics are based on functions of sample moments. Important examples are the sample variance $s_{n-1}^2$, the sample coefficient of variation SV(n), the sample dispersion SD(n) and the non-central $t$-statistic $t(n)$. The definition of these quantities makes clear that the vector defined by (\\sum_{i=1}^nX_i,\\sum_{i=1}^nX_i^2) plays an important role. In studying the asymptotic behaviour of this vector we start by formulating best possible conditions under which the vector $(X,X^2)$ b...

  8. La muerte y el ritual funerario en Caravaca de la Cruz. Siglos XVIII al XX.

    OpenAIRE

    Melgares Guerrero, José Antonio

    2011-01-01

    La relación de la sociedad con la muerte en los pueblos de la región de Murcia y, concretamente en Caravaca de la Cruz, apenas varió en sus manifestaciones externas desde el siglo XVIII hasta la primera mitad del XX. Las costumbres vinculadas a ella constituyeron un verdadero ritual fúnebre que daba comienzo en el momento mismo del óbito y se prolongaba hasta la conclusión del luto, mucho tiempo después. Este ritual, que a veces lo iniciaba el propio finado preparándose social ...

  9. La muerte y el ritual funerario en Caravaca de la Cruz. Siglos XVIII al XX

    OpenAIRE

    Melgares Guerrero, José Antonio

    2011-01-01

    La relación de la sociedad con la muerte en los pueblos de la región de Murcia y, concretamente en Caravaca de la Cruz, apenas varió en sus manifestaciones externas desde el siglo XVIII hasta la primera mitad del XX. Las costumbres vinculadas a ella constituyeron un verdadero ritual fúnebre que daba comienzo en el momento mismo del óbito y se prolongaba hasta la conclusión del luto, mucho tiempo después. Este ritual, que a veces lo iniciaba el propio finado preparándose social ...

  10. AGITATION AND MASS FORMS OF ART IN THE 20-IES OF THE XX CENTURY IN RUSSIA

    OpenAIRE

    2016-01-01

    The article deals with the forms of agitation and mass art, the creation of which was authorized by the Bolsheviks in the 20ies of the XX century for effective advocacy activities. It is noted, that agitation and mass art is one of the most important and effective means of policies and has played a huge role in the establishment of Soviet power. Propaganda direction was manifested in the both of drawing and painting and was aimed at the formation of a new proletarian thinking in a socialist s...

  11. La estadística una ciencia del siglo xx. r.a. fisher, el genio

    OpenAIRE

    2011-01-01

    La Estadística como ciencia independiente es un desarrollo del siglo XX. La χ^2 de Karl Pearson (1900) puede considerarse la epifanía de la disciplina, pero el genio fundamentador, cuyas ideas y conceptos consolidaron el estatus científico de la estadística, es Sir Ronald Aylmer Fisher. Se presenta en esta charla el contexto histórico donde surge la estadística y sus principales referentes de desarrollo. Con Fisher como núcleo, se bosqueja la historia desde K. Pearson y Student hasta hoy....

  12. 46,XX patients with congenital adrenal hyperplasia: initial assignment as male, reassigned female.

    Science.gov (United States)

    Lee, Peter A; Witchel, Selma F

    2005-02-01

    Six 46,XX patients with congenital adrenal hyperplasia (CAH) presented with genital ambiguity, five so severe that initial gender assignment was male. Once diagnosis was realized, parents were involved in evaluation and chose sex re-assignment as female. To date, these girls and their parents all indicate satisfaction with their decision for a female sex of rearing. The girls have a female gender identity with behavior characteristics known for females with CAH. Thus, while outcome is satisfactory, it is realized that for most, expression of sexual orientation and adult life adjustments have not yet occurred.

  13. La política social del siglo XX en México

    OpenAIRE

    Martha Elisa Nateras González

    2007-01-01

    Dentro del marco de actuación estatal, en el ámbito mundial, las políticas sociales han pasado durante el siglo xx por dos periodos. El primero, después de la Segunda Guerra Mundial, que prácticamente marcó el inicio del llamado Estado de bienestar, el cual se caracterizó principalmente, por su intervención en la actividad económica y por construir una red institucional para garantizar el cuasipleno empleo, permitir el acceso universal a la educación básica y la seguridad social, y por otorga...

  14. La política social del siglo XX en México

    OpenAIRE

    Martha Elisa Nateras González

    2007-01-01

    Dentro del marco de actuación estatal, en el ámbito mundial, las políticas sociales han pasado durante el siglo xx por dos periodos. El primero, después de la Segunda Guerra Mundial, que prácticamente marcó el inicio del llamado Estado de bienestar, el cual se caracterizó principalmente, por su intervención en la actividad económica y por construir una red institucional para garantizar el cuasipleno empleo, permitir el acceso universal a la educación básica y la seguridad so...

  15. Thermal Entangled Quantum Refrigerator Working with Three-Qubit Heisenberg XX Model

    Institute of Scientific and Technical Information of China (English)

    郑洁; 何济洲; 何弦

    2011-01-01

    An entangled quantum refrigerator working with a three-qubit one-dimensional isotropic Heisenberg XX model in a constant external magnetic field is constructed in this paper. Based on the quantum first law of thermodynamics, the expressions for several basic thermodynamic quantities such as the heat transferred, the net work and the coefficient of performance are derived. Moreover, the influence of the thermal entanglement on the basic thermodynamic quantities is investigated. Several interesting features of the variation of the basic thermodynamic quantities with the thermal entanglement in zero and nonzero magnetic field are obtained.

  16. El análisis comparativo: algunos aportes latinoamericanos en la segunda mitad del siglo XX

    OpenAIRE

    Miguel Ángel Beltrán Villegas

    2014-01-01

    En este artículo se explora la importancia del análisis comparativo como instrumento de conocimiento de la realidad latinoamericana, a parti r de la identificación de algunos ejes problemáticos que durante el s iglo XIX y comienzos del XX predominaron en el pensamiento sociopolítico de América Latina . Específicamente , se centra la atención en la segunda mitad del siglo pasado cuando , desde una perspectiva histórica y sociológica , estos ejes aparecerán reformulados en la obra de autores co...

  17. Guerra y memoria : Una mirada sobre el siglo XX desde el presente

    OpenAIRE

    Enzo Traverso

    2003-01-01

    Quisiera plantear algunos elementos de reflexión sobre el problema de la violencia en el siglo XX. Mi ponencia será un acercamiento muy general a este tema y a la relación que, en este siglo, las violencias denominadas totalitarias tienen con el proceso de civilización, con la modernidad, en un sentido muy general. Este texto es la transcripción de una conferencia dada en Barcelona el 11 de noviembre 2002, en el marco del Centro de Cultura Contemporánea Centro de Investigaciones Socio H...

  18. Física, cultura y sociedad en el contexto europeo de principios del siglo XX

    OpenAIRE

    2011-01-01

    El objetivo del presente artículo es mostrar el carácter dinámico y complejo de la física en un momento de enorme trascendencia histórica para esta disciplina científica, que podemos identificar con los inicios del siglo XX. A lo largo del artículo ofreceremos diversos elementos de análisis que nos hablan del cambio revolucionario de una disciplina científica, como la física, con sus propias crisis internas, pero también inmersa en un determinado clima cultural e intelectual y una serie de re...

  19. Forms of Wages for Miners of Siberia in the Late XIX – Early XX Centuries

    Directory of Open Access Journals (Sweden)

    Vasiliy P. Zinovyev

    2014-03-01

    Full Text Available The article considers the question of forms of wages paid to workers in the mining industry of Siberia in the late XIX – early XX centuries. Of the two main forms of labor compensation – hourly rate and piecework pay, the latter was more corresponding to the spirit of capitalism, and it was most widespread in the mining enterprises of Siberia. The piecework pay was also the main instrument for intensifying labor productivity. This episode in the history of labor is studied on the basis of paperwork materials of mining companies and reporting documents of the mining inspectorate.

  20. O luto no Brasil no final do século XX

    Directory of Open Access Journals (Sweden)

    Mauro Guilherme Pinheiro Koury

    Full Text Available Este artigo tem por objetivo contribuir para a compreensão das mudanças comportamentais da população brasileira urbana frente ao fenômeno do luto e da perda. É resultado de um grande mapeamento do comportamento do homem brasileiro, de segmentos médios urbanos, e das mudanças experienciadas na sua sensibilidade, no decorrer da segunda metade da última década do século XX, tendo o processo de luto e da perda como mote analítico.

  1. Mister XX

    OpenAIRE

    Miletić Marija; Žarković Miloš; Ćirić Jasmina; Nedeljković-Beleslin Biljana; Tančić-Gajić Milina; Stojanović Miloš; Ivović Miomira; Stojković Mirjana; Rajović Ranko

    2016-01-01

    Female pseudohermaphroditism represents discrepancy between karyotype and gonadal features on one side and a psychogenic phenotype on the other. Congenital adrenal hyperplasia is the part of the spectrum of female pseudohaermaofroditism and is due to an enzyme deficiency in steroidogenesis. More than 95% of patients have 21 hydroxylase deficiency which leads to a lack of cortisol and ACTH hypersecretion of pituitary, overproduction of 17 hydroxy progesterone (17OHP) and androgens and adrenal ...

  2. La persistencia del surrealismo en la arquitectura religiosa española del siglo XX

    Directory of Open Access Journals (Sweden)

    Esteban Fernández Cobián

    2011-07-01

    Full Text Available Este artículo trata de averiguar si el surrealismo —no entendido tanto como estilo artístico, sino como manera compleja de entender la vida— puede postularse como hilo conductor de la arquitectura religiosa del siglo XX en España. Aunque es posible leer la arquitectura católica moderna como un intento de integrar el dogma con las aspiraciones del llamado espíritu de los tiempos, la pérdida de peso que supuso este planteamiento para la arquitectura todavía no se ha esclarecido lo suficiente. La pervivencia de las tradiciones, el diálogo entre la teología y el arte o la crisis de identidad católica tras el Concilio Vaticano II son facetas del intenso —y a veces obsesivo— debate que se desarrolló en España durante el siglo XX. A la postre, se constata que la perenne vena surrealista que subyace en todo lo español impregna también la arquitectura sacra y dificulta su correcta lectura. Se evidencia, finalmente, que la arquitectura religiosa es susceptible de miradas transversales sobre el hecho construido y que abre el campo a nuevas interpretaciones.

  3. TERASING DALAM BUDAYA BARAT DAN TIMUR: POTRET “NYAI” HINDIA BELANDA, ABAD XVII-XX

    Directory of Open Access Journals (Sweden)

    FX. Domini BB Hera

    2014-09-01

    Full Text Available “Nyai” is the concept that refer to native woman (including Chinese and Japanese woman who life without married relationship with European, Chinese, or Arabian man. However the position of “Nyai” is not accepted by foreigner (commonly western society and indigenous people (commonly eastern society, but they have important role in the family and social-culture in Hindia Belanda, XVII-XX. Beside the negative image attaching to “Nyai”, they also have positive side in society life as cultural mediator between western and eastern culture. It is giving a chance for “Nyai” to give any cultural influence from one society or group to another. The study can give the reader a lot of understanding about development of sexuality in Nusantara (The past Indonesia and the point is the study like the basic form to explain the phenomena of unmarried couple today. In short, this study will focus on the image and role of “Nyai” in Hindia Belanda, XVII-XX

  4. SYSTEM OF CONTINUOUS AGRICULTURAL EDUCATION IN PRECARPATHIA (LATE XIX - EARLY XX CENTURIES

    Directory of Open Access Journals (Sweden)

    Halyna Bilavych

    2015-04-01

    Full Text Available Ukrainian public communities have important achievements in development of the system of continuous agricultural education in Precarpathia - Ukrainian Pedagogical Society “Ridna Shkola”, “Prosvita”, “Silskyi Hospodar”, the Union of Ukrainians and others. In the late XIX - early XX centuries, they held important educational work among adults, organized various forms of training - courses, professional-complementary schools, agricultural schools, high schools, colleges, courses, public universities etc. All this contributed to increasing of economic culture of the Ukrainian land. Formation of economic culture of children and adults in Precarpathia had its own characteristics, mainly associated with the economic, social, historical, climatic, cultural and educational conditions of life and activities. The system of continuous agricultural education included some educational institutions such as courses, vocational schools, which performed various levels of training. Agricultural schools became an important area of lifelong education. Let us consider, for example, the activities of two schools - one of the first established societies “Enlightenment” in the Precarpathia - schools in Mylovanya (Tlumachchyna and Starokosivska, which was founded in 1942 during the German occupation. Thus, on condition of the absence of state Ukrainian professional schools in the late XIX - early XX centuries civil societies created a system of continuous agricultural education which was aimed at improving the economic culture of young people and adults.

  5. Evolution of Dosage Compensation in Anolis carolinensis, a Reptile with XX/XY Chromosomal Sex Determination

    Science.gov (United States)

    Rupp, Shawn M.; Webster, Timothy H.; Olney, Kimberly C.; Hutchins, Elizabeth D.; Kusumi, Kenro

    2017-01-01

    In species with highly heteromorphic sex chromosomes, the degradation of one of the sex chromosomes will result in unequal gene expression between the sexes (e.g. between XX females and XY males) and between the sex chromosomes and the autosomes. Dosage compensation is a process whereby genes on the sex chromosomes achieve equal gene expression. We compared genome-wide levels of transcription between males and females, and between the X chromosome and the autosomes in the green anole, Anolis carolinensis. We present evidence for dosage compensation between the sexes, and between the sex chromosomes and the autosomes. When dividing the X chromosome into regions based on linkage groups, we discovered that genes in the first reported X-linked region, anole linkage group b (LGb), exhibit complete dosage compensation, although the rest of the X-linked genes exhibit incomplete dosage compensation. Our data further suggest that the mechanism of this dosage compensation is upregulation of the X chromosome in males. We report that approximately 10% of coding genes, most of which are on the autosomes, are differentially expressed between males and females. In addition, genes on the X chromosome exhibited higher ratios of nonsynonymous to synonymous substitution than autosomal genes, consistent with the fast-X effect. Our results from the green anole add an additional observation of dosage compensation in a species with XX/XY sex determination. PMID:28206607

  6. Censorship and Printing in the Caucasus at the end of XIX – early XX centuries

    Directory of Open Access Journals (Sweden)

    Pavel N. Biriukov

    2016-03-01

    Full Text Available The article deals with the issues of censorship and printing in the Caucasus at the end of XIX – early XX centuries. The special attention is given to censorship during the First Russian revolution (1905-1907 years. Among the materials are the archival documents from the national archives of Georgia, as well as materials of pre-revolutionary periodicals and legislation dedicated to this issue. The scientific publications are important too. The authors come to the conclusion that in the late of XIX – early XX centuries in the Caucasus, as in the whole of the territory of the Russian Empire, there was a sharp rise of printing and publishing periodicals – magazines. With the growth of revolutionary events there was a need in the institute of censorship to control over the printed word. Especially the role of this institution was high during the First Russian revolution. Despite the small number of states and different problems, the censorship has contributed to the stabilization of the political and crime situation in the territory of the Caucasian viceroyalty.

  7. MUJERES EN LA PIANÍSTICA DEL SIGLO XX EN EL NORESTE MEXICANO

    Directory of Open Access Journals (Sweden)

    Antonina Dragan

    2014-05-01

    Full Text Available Over the centuries in Mexico, such as in many other countries, the traditional role of women has been that of being a housewife and a mother; therefore, they had no access to education. Young women from rich families studied art and music, mostly as entertainment. Music wasn’t considered a profession, there were no music schools, and some academies or private teachers filled that void. In this context, a particular merit is made for those women who took the decision to participate in the social, cultural and political life of the society they belonged to. Their contribution to education, spreading of the musical arts, and specially pianism in the northeast region hasn’t been appreciated enough, despite the great effort, enthusiasm and devotion they demonstrated. This article takes an approach on the role of women within the piano studies during the XX century in the northeast of Mexico from the following questions: Who were the women who made the educational work in the musical and pianistic field in the northeast of Mexico during the XX century? Who were the women who made piano their profession and turned out of a great importance for the dissemination of piano arts and the pianistic repertoire in the region of reference?

  8. Breve historia de los refugiados en Argentina durante el siglo XX

    Directory of Open Access Journals (Sweden)

    María Paula Cicogna

    2009-12-01

    Full Text Available Argentina ha sostenido, desde la letra escrita de la Constitución Nacional, ser un país receptor de inmigración, aunque en los hechos ha demostrado lo contrario. A pesar de ello, durante el siglo XX se instalaron grupos de exiliados, solicitantes de refugio y refugiados de las más diversas nacionalidades. Este artículo mostrará los contingentes que conformaron el mapa multicultural de la Argentina a partir del desarrollo de una cronología creada a en base a los trabajos de investigación que analizaron el establecimiento de las diversas comunidades._________________ABSTRACT:According to National Constitution Argentina has been an open doors country to immigration, although it has demonstrated the opposite. In spite of it, during XX century groups of exiles, asylum seekers and refugees of different nationalities settled in the country. Based in a chronology created from varied researches which analyzed the establishment of the diverse communities this article will show the groups that shape the multicultural map of Argentina.

  9. Superfund Record of Decision (EPA Region 9): Andersen Air Force Base, Operable Unit 3 (MARBO Annex), Yigo, Guam, June 16, 1998

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    This decision document, a Record of Decision (ROD), presents the selected remedial actions for soil and groundwater at the Marianas/Bonnis Command (MARBO) Annex Operable Unit (OU) at Andersen Air Force Base (AFB), Guam. No risk was found at Waste Pile 5 and the War Dog Borrow Pit, so no further action is planned for these two sites. Current risks associated with soil exceed acceptable risk levels at Waste Pile 6, Waste Pile 7, Landfill 29, and the MARBO Laundry. Based on alternatives evaluated in the OU 3 Focused FS the US Air Force, the USEPA, and Guam have selected Soil Removal (Alternative OU3-D) as the remedy for three of the sites, and Soil Cover (Alternative OU3-C) for one of the sites. Based on alternatives evaluated in the OU-2 Focused FS, the USAF, the USEPA, and the Guam EPA have selected Natural Attenuation with Wellhead Treatment (Alternative G-2) as the remedy for the TCE and PCE contaminated groundwater beneath the MARBO Annex.

  10. Supporting technology for enhanced oil recovery: EOR thermal processes. Seventh Amendment and Extension to Annex 4, Enhanced oil recovery thermal processes

    Energy Technology Data Exchange (ETDEWEB)

    Reid, T B [USDOE Bartlesville Project Office, OK (United States); Colonomos, P [INTEVEP, Filial de Petroleos de Venezuela, SA, Caracas (Venezuela)

    1993-02-01

    This report contains the results of efforts under the six tasks of the Seventh Amendment and Extension of Annex IV, Enhanced Oil Recovery Thermal Processes of the Venezuela/USA Agreement. The report is presented in sections (for each of the 6 tasks) and each section contains one or more reports prepared by various individuals or groups describing the results of efforts under each of the tasks. A statement of each task, taken from the agreement, is presented on the first page of each section. The tasks are numbered 50 through 55. The first, second, third, fourth, fifth, sixth and seventh reports on Annex IV, Venezuela MEM/USA-DOE Fossil Energy Report IV-1, IV-2, IV-3, IV-4, IV-5 and IV-6 (DOE/BETC/SP-83/15, DOE/BC-84/6/SP, DOE/BC-86/2/SP, DOE/BC-87/2/SP, DOE/BC-89/l/SP, DOE/BC-90/l/SP, and DOE/BC-92/l/SP) contain the results for the first 49 tasks. Those reports are dated April 1983, August 1984, March 1986, July 1987, November 1988, December 1989, and October 1991, respectively. Each task report has been processed separately for inclusion in the Energy Science and Technology Database.

  11. SU-E-T-778: Use of the 2D MatriXX Detector for Measuring Scanned Ion Beam Parameters

    Energy Technology Data Exchange (ETDEWEB)

    Anvar, M Varasteh; Monaco, V; Sacchi, R; Guarachi, L Fanola; Cirio, R [Istituto Nazionale di Fisica Nucleare (INFN), Division of Turin, TO (Italy); University of Torino, Turin, TO (Italy); Giordanengo, S; Marchetto, F; Vignati, A [Istituto Nazionale di Fisica Nucleare (INFN), Division of Turin, TO (Italy); Donetti, M [Istituto Nazionale di Fisica Nucleare (INFN), Division of Turin, TO (Italy); Centro Nazionale di Adroterapia Oncologica (CNAO), Pavia, PV (Italy); Ciocca, M; Panizza, D [Centro Nazionale di Adroterapia Oncologica (CNAO), Pavia, PV (Italy)

    2015-06-15

    Purpose: The quality assurance (QA) procedure has to check the most relevant beam parameters to ensure the delivery of the correct dose to patients. Film dosimetry, which is commonly used for scanned ion beam QA, does not provide immediate results. The purpose of this work is to answer whether, for scanned ion beam therapy, film dosimetry can be replaced with the 2D MatriXX detector as a real-time tool. Methods: MatriXX, equipped with 32×32 parallel plate ion-chambers, is a commercial device intended for pre-treatment verification of conventional radiation therapy.The MatriXX, placed at the isocenter, and GAFCHROMIC films, positioned on the MatriXX entrance, were exposed to 131.44 MeV proton and 221.45 MeV/u Carbon-ion beams.The OmniPro-I’mRT software, applied for the data taking of MatriXX, gives the possibility of acquiring consecutive snapshots. Using the NI LabVIEW, the data from snapshots were logged as text files for further analysis. Radiochromic films were scanned with EPSON scanner and analyzed using software programs developed in-house for comparative purposes. Results: The field dose uniformity, flatness, beam position and beam width were investigated. The field flatness for the region covering 6×6 cm{sup 2} square field was found to be better than 2%. The relative standard deviations, expected to be constant over 2×2, 4×4 and 6×6 pixels from MatriXX measurement gives a uniformity of 1.5% in good agreement with the film results.The beam center position is determined with a resolution better than 200 µm for Carbon and less than 100 µm for proton beam.The FWHM determination for a beam wider than 10 mm is satisfactory, whilst for smaller beams the determination is uncertain. Conclusion: Precise beam position and fast 2D dose distribution can be determined in real-time using MatriXX detector. The results show that MatriXX is quick and accurate enough to be used in charged-particle therapy QA.

  12. Ritmos contemporáneos. Género, política y sociedad en los siglos XIX y XX

    OpenAIRE

    Branciforte, Laura; Orsi, Rocío; Huguet, Montserrat; Povedano, Elisa; Rico Gómez, María Luisa; Souto Kustrín, Sandra; Valiente Fernández, Celia; Strazzeri, Irene; González Marín, Carmen; Reverter Bañón, Sonia; Saez Tajafuerce, Begonya

    2012-01-01

    INTRODUCCIÓN. Laura Branciforte y Rocío Orsi Portalo (Universidad Carlos III de Madrid).- I. LOS CAMINOS DE LA MODERNIZACIÓN (SIGLOS XIX Y XX): CIENCIA, EDUCACIÓN Y ACTIVISMOS POLÍTICO. : CAPÍTULO 1. Montserrat Huguet Santos (Universidad Carlos III de Madrid): La derrota del progreso. Especie y género en los discursos científicosociales (de los siglos XIX y XX).- CAPÍTULO 2. Elisa Povedano Marrugat (Universidad Carlos III de Madrid): Mujeres y Educación artística en el siglo XIX.- CAPÍTULO 3....

  13. National Response Framework: Annexes

    Science.gov (United States)

    2008-01-01

    Counterterrorism Security Group ( CSG ), DOT operating administrations and regional offices, and the RETCO. Activate the DOT Emergency Response Team...Staff ESF #1 at the NRCC. Dispatch staff to the Incident Management Planning Team (IMPT), DRG, CSG , NRCC, RRCC(s), JFO(s), and Evacuation... dams , levees, and water delivery facilities and structures. y Provides personnel to assist in damage assessment, structural inspections, debris

  14. Annex 1. References

    OpenAIRE

    2013-01-01

    ALM (A.) & al. (2004) A Cognitive Prosthesis and Communication Support for People with Dementia. Neuropsychological Rehabilitation, 14, p. 117-134(18). AMIRKHANYAN (A.) & WOLF (D.) (2003) Caregiver Stress and non Caregiver Stress: Exploring the Pathways of Psychiatric Morbidity. The Gerontologist, 43, p. 817-27. ANTTONEN (A.) & SIPILA (J.) (1996) European Social Care Services: Is it Possible to Identify Models? Journal of European Social Policy 6(2): p. 87-100. ARBER (S.) & GINN (J.) (1993) G...

  15. Bertoko Case: annex

    Directory of Open Access Journals (Sweden)

    GLORIA APARICIO DE CASTRO

    2002-06-01

    Full Text Available En el volumen 2, número uno de esta revista, dentro de la sección de casos de empresas, se publicaba la problemática empresarial de Bertoko Gar, S.A. Esta empresa era presentada como una microcervecera fundada y establecida en Barazar (Vizcaya en el año 1999 para la producción y comercialización de una cerveza caracterizada por su carácter local y artesanal. De forma excepcional y debido a los importantes cambios acontecidos en el devenir de esta empresa durante los últimos meses este anexo trata de actualice la información publicada sobre el caso en su edición anterior.

  16. Hudozhestvennõje novatsii sovremennoi prozõ Estonii v kontekste russko-jevropeiskogo mezhliteraturnogo dialoga kontsa XX veka / Naftoli Bassel

    Index Scriptorium Estoniae

    Bassel, Naftoli

    2002-01-01

    Varem ilmunud: Literatura rosyiska XX wieku. Nowe czasy. Nowe problemy. Warszawa, 1992. Uuendustest eesti proosas 1960-80. a-tel ning nende rollist vene kirjandusliku mõtte seostamisel euroopa omaga. Ettekanne konverentsil "Russkaja literatura XX veka : novõje vremena, novõje problemõ", Varssavis, septembris 1991

  17. Preparing Teachers for Diversity: The Role of Initial Teacher Education. Annex 2 To the Final Report to DG Education, Youth, Sport and Culture of the European Commission. Case Study Summaries

    Science.gov (United States)

    European Commission, 2017

    2017-01-01

    "Preparing Teachers for Diversity: The Role of Initial Teacher Education. Annex 2 To the Final Report to DG Education, Youth, Sport and Culture of the European Commission. Case Study Summaries" is designed as a companion document to the final report "Preparing Teachers for Diversity: The Role of Initial Teacher Education. Final…

  18. Increased basal and pulsatile secretion of FSH and LH in young men with 47,XXY or 46,XX karyotypes

    DEFF Research Database (Denmark)

    Aksglaede, L.; Jensen, Rikke Bodin Beck; Carlsen, E.;

    2008-01-01

    basal, pulsatile, and total LH and FSH secretion were associated with significantly more LH peaks per 24 h in comparison with healthy controls. Thus, our data indicate that in patients with Klinefelter syndrome and XX male karyotypes the entire hypothalamic-pituitary-gonadal axis has undergone...

  19. 46, XX true hermaphroditism associated with a terminal deletion of the short arm of the X chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Barbaux, S.; Vilain, E.; McElreavey, K. [Institut Pasteur, Paris (France)] [and others

    1994-09-01

    Testes are determined by the activity of the SRY gene product encoded by the Y chromosome. Mutations in SRY can lead to XY sex reversal (XY females) and the presence of the SRY gene in some XX individuals can lead either to complete (XX males) or incomplete (XX true hermaphrodites) sex reversal. Approximately 10% of XX true hermaphrodites contain a portion of the Y chromosome, including SRY, in their genome. The etiology of the remaining cases is unestablished but may be caused by mutations in other as yet unidentied sex determining genes downstream of SRY. Here we describe an SRY-negative true hermaphrodite with a 46,X,del(X)(p21.1-pter). The patient also presented with severe mental retardation, abnormal skin pigmentation and below average height. Histological examination of the gonad revealed bilateral ovotestis. We postulate that the Xp deletion has unmasked a recessive allele on the apparently normal X chromosome generating the intersex phenotype. This observation together with recent findings of certain XY females carrying duplications of Xp21.3 suggests that there may be a loci on Xp which acts as a switch in the testis/ovarian determination pathways.

  20. Muusikamaailm : Bachi orel Leipzigis valmis. XX sajandi ooperid laval. Huddersfieldi festivalil. "Liszt ja Bach" Weimaris / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2000-01-01

    Lepzigi Thomaskirches taastati Bachi-aegne barokkorel. Flandria Ooperis, Hamburgi Riigiooperis ja Brüsseli Thétre de la Monnaie's lavastuvatest XX saj. heliloojate ooperitest. 16.-26. nov. toimuvast Huddersfieldi kaasaegse muusika festivalist Inglismaal. Festivalist "Liszt ja Bach" Weimaris

  1. A rare case of lateral ovotesticular disorder with Klinefelter syndrome mosaicism 46, XX/47, XXY: An unusual presentation

    Directory of Open Access Journals (Sweden)

    Shyam M Talreja

    2015-01-01

    Full Text Available Ovotesticular disorder of sex development (OT-DSD is a rare disorder of sexual differentiation characterized by the presence of both ovarian and testicular tissues in the same individual. It's incidence ranges from 3% to 10% of all disorder of DSD's, and the most common presentation is 46, XX followed by 46, XX/46, XY mosaicism and 46, XY. Klinefelter syndrome (KS mosaicism 46, XX/47, XXY is extremely rare, and its association with the ovotesticular disorder is even rarer. We report an unusual case of 16-year-old with male habitus who presented with complains of cyclic hematuria. On examination, he had bilateral gynecomastia, unilateral left cryptorchidism, absent facial hair, sparse axillary hair growth, and pubic hair distribution of feminine type. The right testis was of normal size located normally in hemiscrotum and was confirmed by radio imaging. Ultrasonography and magnetic resonance imaging revealed a cystic area behind posterior half of urinary bladder. Chromosomal analysis revealed 46, XX/47, XXY mosaicism of female karyotype and KS. Histopathological report of this left side excised specimen confirmed the structures to be ovary, uterus, and fallopian tube, thus confirming our diagnosis of the lateral ovotesticular disorder. Meticulous workup combined interdisciplinary approach will lead to early diagnosis and resolve timely sex reassignment issues and also prevent consequences arising due to gonadal insufficiency.

  2. La arquitectura ordinaria del siglo xx como patrimonio cultural: tres barrios de promoción oficial de Madrid

    National Research Council Canada - National Science Library

    Luis Moya; Juan Monjo; Ainhoa Díez

    2017-01-01

    La incipiente construcción de la legitimidad de los barrios de vivienda pública de la segunda mitad del siglo xx como patrimonio ordinario de calidad requiere el desarrollo de medidas para su protección y rehabilitación...

  3. Hardware-Software Complex for Functional and Parametric Tests of ARM Microcontrollers STM32F1XX

    Directory of Open Access Journals (Sweden)

    Egorov Aleksey

    2016-01-01

    Full Text Available The article presents the hardware-software complex for functional and parametric tests of ARM microcontrollers STM32F1XX. The complex is based on PXI devices by National Instruments and LabVIEW software environment. Data exchange procedure between a microcontroller under test and the complex hardware is describes. Some test results are also presented.

  4. Muusikamaailm : Bachi orel Leipzigis valmis. XX sajandi ooperid laval. Huddersfieldi festivalil. "Liszt ja Bach" Weimaris / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2000-01-01

    Lepzigi Thomaskirches taastati Bachi-aegne barokkorel. Flandria Ooperis, Hamburgi Riigiooperis ja Brüsseli Thétre de la Monnaie's lavastuvatest XX saj. heliloojate ooperitest. 16.-26. nov. toimuvast Huddersfieldi kaasaegse muusika festivalist Inglismaal. Festivalist "Liszt ja Bach" Weimaris

  5. 49 CFR 1242.51 - Dismantling retired property and depreciation (accounts XX-27-39 and 62-27-00).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Dismantling retired property and depreciation (accounts XX-27-39 and 62-27-00). 1242.51 Section 1242.51 Transportation Other Regulations Relating to... FOR RAILROADS 1 Operating Expenses-Equipment § 1242.51 Dismantling retired property and...

  6. 49 CFR 1242.37 - Dismantling retired property and depreciation (accounts XX-26-39 and 62-26-00).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Dismantling retired property and depreciation (accounts XX-26-39 and 62-26-00). 1242.37 Section 1242.37 Transportation Other Regulations Relating to... FOR RAILROADS 1 Operating Expenses-Equipment § 1242.37 Dismantling retired property and...

  7. 78 FR 29131 - Solar Star California XX, LLC; Supplemental Notice that Initial Market-Based Rate Filing Includes...

    Science.gov (United States)

    2013-05-17

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Solar Star California XX, LLC; Supplemental Notice that Initial Market-Based Rate Filing Includes Request for Blanket Section 204 Authorization This is a supplemental notice in the above-referenced proceeding, of...

  8. Retratos fotográficos post-mortem en Galicia (siglos XIX y XX)

    OpenAIRE

    Cruz Lichet, Virginia de la

    2011-01-01

    La fotografía post-mortem es un género que se dio en el mundo occidental desde los orígenes de la Historia de la Fotografía hasta bien entrado el último cuarto del siglo XX. En su conjunto, todas estas imágenes nacieron partiendo de una causa común heredada de la tradición pictórica: la de perpetuar en la memoria el rostro de un ser querido ya desaparecido. Sin embargo, existe a su vez un gran número de variantes y matices, tanto formales como funcionales, en relación a las creencias y costum...

  9. La empresa en Colombia en la primera mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Jairo Andrés Campuzano Hoyos

    2011-12-01

    Full Text Available “Yo siempre he creído que el futuro de Colombia está en su pasado”, dijo alguna vez Gonzalo Restrepo Jaramillo, un destacado político y empresario antioqueño de la primera mitad del siglo xx. Como él, muchos otros pensamos que se puede aprender del pasado para construir el futuro; pero es importante precisar, desde ahora, que no se pretende mirar al pasado para construir modelos de imitación o réplica, y mucho menos para levantar ídolos sobre la premisa de que “todo tiempo pasado fue mejor”, como suelen afirmar algunos pesimistas.

  10. Cambios históricos en el paisaje de Cuenca, siglos XIX y XX

    Directory of Open Access Journals (Sweden)

    Ana Luz Borrero Vega

    2006-11-01

    Full Text Available Este artículo analiza la génesis del paisaje urbano de Cuenca. Se destacan los elementos patrimoniales, los procesos de crecimiento y expansión, y los cambios en su paisaje urbano entre los siglos XIX y XX. Utiliza el enfoque de la geografía histórica y de la geografía del paisaje y sus metodologías. Estudia la percepción que la población tiene del territorio, el plano urbano, la arquitectura y los usos del suelo. La investigación incorpora, además, un registro fotográfico de las principales edificaciones que conforman el patrimonio arquitectónico cuencano.

  11. “Ciencias de la Comunicación”, paradigma del siglo XX?

    Directory of Open Access Journals (Sweden)

    Eduardo A. Vizer

    2011-01-01

    Full Text Available La Modernidad es una categoría histórica. Un paradigma de  construcción de imaginarios sociales, asociados a una historia social de las ciencias y los modos de construír conocimiento, tecnología y poder de intervención sobre la “realidad”. Categorías como naturaleza, sociedad, individuo y subjetividad son construcciones sociales asociadas  a diferentes etapas de las ciencias: físiconaturales, sociales y psicológicas. En este contexto, las “ciencias de la comunicación” se constituyen en el imaginario social del siglo XX, en un paradigma marcado por la técnica, la transdisciplinariedad y la transsubjetividad en los procesos de construcción de sentido.

  12. Del lujo o la melancolía. Antioquia siglos XIX y XX

    Directory of Open Access Journals (Sweden)

    Federico García Barrientos

    2016-06-01

    Full Text Available Es abundante la bibliografía de estudios regionales de Antioquia que hacen referencia al auge y desarrollo de su comercio en el siglo XIX y de su industrialización en las tres primeras décadas del siglo XX. Se trata de un amplio abanico de investigaciones referido a la cosa comercial, industrial y empresarial. Parece un asunto agotado. Arriesgaremos a mirar un tema poco tratado: el lujo y el confort; ello desde la filosofía fenomenológica para los años en mención. Lo primero que hay que decir es que el lujo trata de un asunto moral y material, el cual presentamos como una tragedia melancólica en dos actos.

  13. Geometric Quantum Discord in the Heisenberg XX Model with Three-Spin Interactions

    Science.gov (United States)

    Xie, Yu-Xia; Liu, Jing; Sun, Yu-Hang

    2017-02-01

    Quantum discord is a resource for quantum information processing tasks, and seeking flexible ways to control it is of practical significance. We investigate the trace distance, Bures distance, and Hellinger distance geometric quantum discords (GQDs) for thermal states of the Heisenberg XX chain with three-spin interactions. The results show that both the XZX + YZY and XZY - YZX types of three-spin interactions can be used to enhance evidently the GQDs for the boundary spins of the chain. The optimal strengths of three-spin interactions for which the maximum enhancement of the GQDs are achieved are strongly dependent on the GQD measures we adopted and the number of spins in the chain.

  14. Politica y legislación de tierra en Colombia en los siglos XIX y XX

    OpenAIRE

    Vélez Alvarez, Luis Guillermo

    2012-01-01

    Se presenta en este documento una descripción de la política y la legislación de tierras en Colombia durante los siglos XIX y XX. El problema de la adjudicación de baldíos es el aspecto más notable de la legislación en el siglo XIX. También son importantes el tema de los resguardos y el de la desamortización. Como se verá, la forma en que se enfrentó el conflicto sobre baldíos entre los ocupantes productivos y los terratenientes y detentores de los bonos de tierra incidirá de forma determinan...

  15. Acromegaly accompanied by Turner syndrome with 47,XXX/45,X/46,XX mosaicism.

    Science.gov (United States)

    Yamazaki, Masanori; Sato, Ai; Nishio, Shin-ichi; Takeda, Teiji; Miyamoto, Takahide; Katai, Miyuki; Hashizume, Kiyoshi

    2009-01-01

    A 33-year-old woman was hospitalized for examination of edematous laryngopharynx. She was acromegalic. A pituitary adenoma with elevated serum levels of growth hormone (GH) and insulin-like growth factor-I (IGF-I) was detected, indicating acromegaly caused by GH-secreting pituitary adenoma. Multiple pigmented nevi were also noted without overt short stature and cubitus valgus. Chromosome analysis revealed that she had contracted Turner syndrome with 47,XXX/45,X/46,XX mosaicism. Transsphenoidal resection of the tumor decreased serum GH and IGF-I levels, but the edema was not improved. Both premature ovarian failure and hypertension appeared after surgery. This case may indicate the important relationships between GH/IGF-I and Turner syndrome.

  16. Triploidy mosaicism (45,X/68,XX) in an infant presenting with failure to thrive.

    Science.gov (United States)

    Posey, Jennifer E; Mohrbacher, Nikki; Smith, Janice L; Patel, Ankita; Potocki, Lorraine; Breman, Amy M

    2016-03-01

    Triploid mosaicism is a rare aneuploidy syndrome characterized by growth retardation, developmental delay, 3-4 syndactyly, microphthalmia, coloboma, cleft lip and/or palate, genitourinary anomalies, and facial or body asymmetry. In the present report, we describe a 3-month-old female presenting with failure to thrive, growth retardation, and developmental delay. A chromosomal microarray demonstrated monosomy X, but her atypical phenotype prompted further evaluation with a chromosome analysis, which demonstrated 45,X/68,XX mixoploidy. To our knowledge, this is the first report of a patient with this chromosome complement. Mosaicism in chromosomal aneuploidies is likely under-recognized and may obscure the clinical diagnosis. At a time when comparative genomic hybridization and genome sequencing are increasingly used as diagnostic tools, this report highlights the clinical utility of chromosome analysis when a molecular diagnosis is not consistent with the observed phenotype.

  17. Lectores y textos escolares durante la primera mitad del siglo XX en Colombia

    Directory of Open Access Journals (Sweden)

    Diana Paola Guzmán Méndez

    2016-01-01

    Full Text Available Este artículo presenta algunos aspectos de la historia de la lectura en Colombia durante la primera mitad del siglo XX, así como la caracterización de algunas prácticas lectoras que se hicieron evidentes durante el mismo período. Los intelectuales de los gobiernos de la República Liberal actuaron como agentes culturales claves para ejecutar diversas campañas que coadyuvaron en la ampliación del público lector, entre ellas, los programas de alfabetización, la creación de bibliotecas y misiones culturales. Dentro de estas campañas de alfabetización, se hicieron presentes importantes cambios en el diseño y empleo de los materiales para la enseñanza de la lectura que apuntaron a la diferenciación entre lectores rurales y urbanos.

  18. The BVRI Light Curves And Period Analysis Of The Beta Lyrae System XX Leonis

    CERN Document Server

    Zasche, P; Svoboda, P

    2007-01-01

    The contact eclipsing binary system XX Leonis (P = 0.97 days, sp A8) has been analysed using the PHOEBE programme, based on the Wilson Devinney code. The BVRI light curves were obtained during spring 2006 using the 20-cm telescope and ST-7 CCD detector. The effective temperature of the primary component determined from the photometric analysis is T=(7889+/-61)K, the inclination of the orbit is i=(89.98+/-2.45)deg and the photometric mass ratio q=(0.41+/-0.01). Also the third body hypothesis was suggested, based on the period analysis using 57 minimum times and resulting the period of the third body p3= (52.96+/-0.01)yr, amplitude A=(0.057+/-0.029)d and eccentricity e=(0.79+/-0.08) which gives the minimum mass m3,min=(3.6+/-0.8)M_sun.

  19. Gonadal Dysgenesis 46, XX Associated with Mayer-Rokitansky-Kuster-Hauser Syndrome: One Case Report

    Directory of Open Access Journals (Sweden)

    N. Bousfiha

    2010-01-01

    Full Text Available Introduction. The association of gonadal dysgenesis and Mayer-Rokitansky-Kuster-Hauser syndrome is very rare and appears to be coincidental, independent of chromosomal anomalies. Case Report. We report the case of a 19-year-old woman who presented primary amenorrhea and impuberism. The endocrine study revealed hypergonadotrophic hypogonadism. The karyotype was normal, 46XX. No chromosome Y was detected at the FISH analysis. Internal genitalia could not be identified on the pelvic ultrasound and pelvic MRI. Laparoscopy was undertaken and revealed concomitant ovarian dysgenesis and Mayer-Rokitansky-Kuster-Hauser syndrome. There were no other morphological malformations. Conclusion. The pathogenesis of the association of gonadal dysgenesis and Mayer Rokitansky kuster hauser syndrome is still mysterious. The treatment is based essentially on hormone substitution therapy. The fertility prognosis is unfortunately compromised.

  20. Gonadal Dysgenesis 46, XX Associated with Mayer-Rokitansky-Kuster-Hauser Syndrome: One Case Report

    Science.gov (United States)

    Bousfiha, N.; Errarhay, S.; Saadi, H.; Ouldim, K.; Bouchikhi, C.; Banani, A.

    2010-01-01

    Introduction. The association of gonadal dysgenesis and Mayer-Rokitansky-Kuster-Hauser syndrome is very rare and appears to be coincidental, independent of chromosomal anomalies. Case Report. We report the case of a 19-year-old woman who presented primary amenorrhea and impuberism. The endocrine study revealed hypergonadotrophic hypogonadism. The karyotype was normal, 46XX. No chromosome Y was detected at the FISH analysis. Internal genitalia could not be identified on the pelvic ultrasound and pelvic MRI. Laparoscopy was undertaken and revealed concomitant ovarian dysgenesis and Mayer-Rokitansky-Kuster-Hauser syndrome. There were no other morphological malformations. Conclusion. The pathogenesis of the association of gonadal dysgenesis and Mayer Rokitansky kuster hauser syndrome is still mysterious. The treatment is based essentially on hormone substitution therapy. The fertility prognosis is unfortunately compromised. PMID:21253547

  1. Geometric Quantum Discord in the Heisenberg XX Model with Three-Spin Interactions

    Science.gov (United States)

    Xie, Yu-Xia; Liu, Jing; Sun, Yu-Hang

    2016-11-01

    Quantum discord is a resource for quantum information processing tasks, and seeking flexible ways to control it is of practical significance. We investigate the trace distance, Bures distance, and Hellinger distance geometric quantum discords (GQDs) for thermal states of the Heisenberg XX chain with three-spin interactions. The results show that both the XZX + YZY and XZY -YZX types of three-spin interactions can be used to enhance evidently the GQDs for the boundary spins of the chain. The optimal strengths of three-spin interactions for which the maximum enhancement of the GQDs are achieved are strongly dependent on the GQD measures we adopted and the number of spins in the chain.

  2. Correlation functions of XX0 Heisenberg chain, q-binomial determinants, and random walks

    Energy Technology Data Exchange (ETDEWEB)

    Bogoliubov, N.M.; Malyshev, C.

    2014-02-15

    The XX0 Heisenberg model on a cyclic chain is considered. The representation of the Bethe wave functions via the Schur functions allows to apply the well-developed theory of the symmetric functions to the calculation of the thermal correlation functions. The determinantal expressions of the form-factors and of the thermal correlation functions are obtained. The q-binomial determinants enable the connection of the form-factors with the generating functions both of boxed plane partitions and of self-avoiding lattice paths. The asymptotical behavior of the thermal correlation functions is studied in the limit of low temperature provided that the characteristic parameters of the system are large enough.

  3. Correlation Functions of XX0 Heisenberg Chain, q-Binomial Determinants, and Random Walks

    CERN Document Server

    Bogoliubov, N M

    2014-01-01

    The XX0 Heisenberg model on a cyclic chain is considered. The representation of the Bethe wave functions via the Schur functions allows to apply the well-developed theory of the symmetric functions to the calculation of the thermal correlation functions. The determinantal expressions of the form-factors and of the thermal correlation functions are obtained. The q-binomial determinants enable the connection of the form-factors with the generating functions both of boxed plane partitions and of self-avoiding lattice paths. The asymptotical behavior of the thermal correlation functions is studied in the limit of low temperature provided that the characteristic parameters of the system are large enough.

  4. Un oficio del siglo XX: Guillermo Cabrera Infante en su laberinto fílmico

    Directory of Open Access Journals (Sweden)

    Javier Fernández Díaz

    2016-12-01

    Full Text Available El presente trabajo explora las relaciones entre literatura y cine en la obra de Guillermo Cabrera Infante. Para ello presenta dos bloques temáticos interrelacionados. En el primero se sugiere la lectura de Un oficio del siglo XX, un libro generalmente entendido como un conjunto de críticas cinematográficas, como un género híbrido, cercano al ensayo y a la autobiografía. El paratexto y las notas a pie de página del autor resultan clave. La segunda parte es una revisión de los tres guiones que Cabrera Infante escribió para cine a partir de la noción de texto fílmico.

  5. La mortalidad por tuberculosis en Argentina a lo largo del siglo XX

    Directory of Open Access Journals (Sweden)

    Maria Belen Herrero

    2013-06-01

    Full Text Available El objetivo de este artículo es realizar un análisis de la curva de mortalidad por tuberculosis en Argentina a lo largo del siglo XX, desde 1911 hasta 2007. A partir de los datos obtenidos de diversas fuentes de carácter oficial se marcan las etapas históricas de dicha mortalidad, generando dentro de éstas subperíodos, a fin de entender el comportamiento de la mortalidad por tuberculosis, dependiendo del momento histórico. De esta forma, se vincula el desarrollo de la enfermedad con los dispositivos que se generaron para combatirla. Se realiza un análisis del comportamiento de la mortalidad por regiones del país, partiendo del supuesto que el desarrollo de la misma fue diferente según condiciones económicas y sociales y desarrollo sanitario.

  6. O espaço da prostituta na literatura brasileira no século XX

    Directory of Open Access Journals (Sweden)

    Ariágda dos Santos Moreira

    2011-10-01

    Full Text Available Resumo: O artigo evidencia diferentes modos de representação da prostituta e de seu espaço de circulação em algumas obras da literatura brasileira, da segunda metade do século XX. As obras mostram personagens femininas, que ganham a vida vendendo seus corpos, em inusitados prostíbulos, integrados ironicamente ao espaço social e moralmente aceitos. A partir dessas representações, o que se pretende discutir aqui, embasado inicialmente nos conceitos de “mundo demoníaco” e “mundo divino” de Northrop Frye, é a relação de estreita interdependência e assimilação que marca espaços aparentemente antagônicos e inconciliáveis. Tal assimilação pode ser também observada por meio da noção de heterotopia, de que trata Michel Foucault, base das análises do crítico literário, o chileno Rodrigo Cánovas, que reforçam as discussões finais neste texto.Palavras-chave: Literatura brasileira; prostituta; século XX; Northrop Frye; mundo demoníaco; mundo divino; Michel Foucault; heterotopia; Rodrigo Cánovas.Resumen: El artículo evidencia diferentes formas de representación de la prostituta y de su espacio de circulación en algunas obras de la literatura brasileña, de la segunda mitad del siglo XX. Las obras muestran personajes femeninos que ganan la vida vendiendo sus cuerpos, en inusitados prostíbulos, integrados irónicamente al espacio social y moralmente aceptados. A partir de esas representaciones lo que se pretende discutir aquí, inicialmente a base de los conceptos de “mundo demoníaco” y “mundo divino” de Northrop Frye, es la relación de estrecha interdependencia y asimilación que marca espacios aparentemente antagónicos e inconciliables. Dicha asimilación puede ser también observada por medio de la noción de heterotopía, de que trata Michel Foucault, fundamento de los análisis del crítico literario, el chileno Rodrigo Cánovas, que refuerzan las discusiones finales en ese texto

  7. Textos y pedagogía en los albores del siglo XX en Colombia

    Directory of Open Access Journals (Sweden)

    Doris Lilia Torres Cruz

    2011-01-01

    Full Text Available En las tres primeras décadas del siglo XX, los textos escolares se utilizaron para promover proyectos políticos, ideológicos y pedagógicos. Sobre los textos escolares elementales de enseñanza del lenguaje, particularmente, se investigan las disposiciones jurídicas en cuanto tiene que ver con la normatividad educativa, los ideales, los principios, los métodos y las prácticas de enseñanza. Igualmente, se reconoce en los textos escolares las luchas en torno a las ideologías que propugnan por la manera en que se debe formar a los ciudadanos y en las orientaciones para construir un tipo de Nación.

  8. LA ACTIVIDAD INDUSTRIAL EN MAGALLANES ENTRE 1890 Y MEDIADOS DEL SIGLO XX

    Directory of Open Access Journals (Sweden)

    MATEO MARTINIC BEROS

    2001-01-01

    Full Text Available The former industrialization of Magallanes was a particular economic phenomena that typified the boom and development of the southern Chilena territory during the period between the last decade of the XIX century and the first two decades of the XX century. In a context of geographic isolation and remoteness served as a encouragement to the satisfaction of numerous requirements of service needs and supplies of goods, that the importing from Europe did not fulfill in time due. It was at he same time an evidence of the creativity, intelligence, and vigor of the Europeans immigrants, that contribute to the Magellan autonomy and self-sufficiency during a decisive span of its history.

  9. El análisis comparativo: algunos aportes latinoamericanos en la segunda mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Beltrán Villegas

    2014-01-01

    Full Text Available En este artículo se explora la importancia del análisis comparativo como instrumento de conocimiento de la realidad latinoamericana, a parti r de la identificación de algunos ejes problemáticos que durante el s iglo XIX y comienzos del XX predominaron en el pensamiento sociopolítico de América Latina . Específicamente , se centra la atención en la segunda mitad del siglo pasado cuando , desde una perspectiva histórica y sociológica , estos ejes aparecerán reformulados en la obra de autores como Sergio Bagú, Antonio García, y Fernando H. Cardoso, a través de conceptos como “ capitalismo comercial ” , “ situaciones de dependencia ” y “ reforma agraria ” .

  10. Relación entre quimerismo xx/xy y el fenotipo pseudohermafrodita masculino en porcinos.

    Directory of Open Access Journals (Sweden)

    Reinartz E. Mónica

    2001-09-01

    Full Text Available La causa genética del pseudohermafroditismo no está bien dilucidada, sin embargo se han reportado distintos casos de pseudohermafroditas masculinos los cuales en la mayoría de los casos se han tratado de explicar por efectos hormonales sobre las gónadas en formación durante el desarrollo embrionario. Además se ha explorado poco la relación de este fenotipo con la constitución genómica de los organismos que presentan la disfunción sexual. En el presente trabajo se encontró una fuerte relación entre el quimerismo cromosómico XX/XY y el fenotipo pseudohermafrodita masculino exhibido por dos ejemplares de porcinos Landrace X Largewhite similar a lo encontrado en freemartinismo de bovinos.

  11. El diseño de producto en el siglo XX. Un experimento narrativo occidental

    OpenAIRE

    2016-01-01

    Partiendo de las teorías de Hayden White y John Lewis Gaddis sobre la narratividad en la historia se componen una serie de relatos inéditos sobre el diseño de producto que hasta ahora no habían sido explorados sistemáticamente. Trabajando con fuentes secundarias, la investigación hace un recorrido por el siglo XX examinando la historia de la profesión, la historia de la enseñanza, la historia de los estilos, la historia de los ideales así como su relación con la historia de las ideologías que...

  12. Gender of rearing and psychosocial aspect in 46 XX congenital adrenal hyperplasia

    Directory of Open Access Journals (Sweden)

    Arushi Gangaher

    2016-01-01

    Full Text Available Background: In congenital adrenal hyperplasia (CAH with ambiguous genitalia, assigning gender of rearing can be complex, especially If genitalia is highly virilized. Apart from karyotype, prenatal androgen exposure, patient's gender orientation, sociocultural, and parental influences play a role. The aim of this study was to assess gender dysphoria and psychosocial issues in patients of CAH raised as males and females. Materials and Methods: This is a cross-sectional study that includes patients (old and new with CAH who were treated by us in the last 6 months. A semi-structured interview proforma was used to elicit history and psychosocial background of the patients. The clinical and biochemical details were noted. For psychological analysis, patients were screened for gender dysphoria using Parent Report Gender Identity Questionnaire for children <12 years and Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults. Results: We analyzed 22 46 XX CAH patients among which, 3 were reared as males and 19 as females. Among the 19 patients reared as females, 17 patients showed no gender dysphoria. Two patients revealed gender dysphoria as indicated by their marginally low scores on the gender dysphoria assessment. However, in view of current literature and the age groups of the patients, behavior of the 6-year-old patient can be best understood as being tomboyish. Gender dysphoria in the 22-year-old can be explained by the dominance of psychosocial factors and not hormones alone. Among the three patients reared as males, two prepubertal were satisfied with their male gender identity. The third patient, aged 32 years, had gender dysphoria when reared as a male that resolved when gender was reassigned as female and feminizing surgery was done. Conclusion: Gender assignment in 46 XX CAH is guided by factors such as degree of virilization of genitalia, gender orientation, patient involvement, sociocultural, and parental influences.

  13. TYPES OF THE COMIC IN BIOGRAPHICAL AND MEMORIALISTIC LITERATURE OF XX CENTURY

    Directory of Open Access Journals (Sweden)

    Оlga Ivanovna Osipova

    2014-11-01

    Full Text Available Article is devoted to poetics of biographical and memorialistic genres of XX century, especially to the analysis of such forms of laughter as irony and parody. The basic idea is concerned with fiction of the authors, which seek to destroy Genesis and alter reality, which in no way satisfied with the artists.The purpose of the article is identifying of the specifics of literary and imaginative reconstruction of historical events in the novels of M. Kuzmin and Sasha Sokolov by analyzing specifications of its narration.Method or the methodology of work: Among research material are M. Kuzmin’s novel "A wonderful life of Joseph Balsamo, count Cagliostro" and Sasha Sololov’s novel "Palisandria". Analyzing the texts of works on the researched topic were used comparative-historical, historical-biographical and structural methods.Results: Our study suggests that irony and parody in biographical and memorialistic genres of XX century have integrated, multifunctional meaning. Analysis of the novels allows us to observe the transformation of traditional biographical memorialistic narration into the grotesque model of the reality. There are interesting observations of the functioning in the works such approaches as parody, travesty, illogic, allegory, etc. As a result of the use of similar artistic techniques the novels become metatext about human nature in generalPractical implications: The results of our research can be used for lectures on the history of Russian literature of XXth century, in the course "History of Russian Literature" at faculties and departments of Russian Philology institutes and universities.

  14. Mujeres en la pianística del siglo XX en el noreste mexicano

    Directory of Open Access Journals (Sweden)

    Antonina Dragan

    2014-01-01

    Full Text Available En México, a través de los siglos, como en muchosotros países, el papel tradicional de la mujer fue ser esposa,madre y ama de casa; por lo tanto, no tenían accesoa la educación. Las jóvenes de familias pudientesestudiaban artes y música, en particular como entretenimiento.La música no se consideraba una profesión, nohabía escuelas de música y algunas academias o maestrosparticulares llenaban el vacío. En este contexto el méritoespecial es para aquellas mujeres que tomaron la decisiónde participar en la vida social, cultural y políticade la sociedad en que vivían. Su aporte a la educación,a la difusión de arte musical y, en particular, pianísticoen la región de noreste, no se ha valorado lo suficientea pesar del gran empeño, entusiasmo y entrega que ellasdemostraron. En este artículo se abordará el papel de lamujer en la pianística del siglo XX en el noreste de México,a partir de los siguientes cuestionamientos: ¿Quiénesfueron estas mujeres que realizaron la labor educativa enel ámbito musical y pianístico en el noreste de México enel siglo XX? ¿Quiénes fueron las mujeres que hicieron delpiano su profesión y resultaron de gran valía en la difusiónde arte de piano y del repertorio pianístico en la zonade referencia?

  15. Uniparental Disomy in Somatic Mosaicism 45,X/46,XY/46,XX Associated with Ambiguous Genitalia.

    Science.gov (United States)

    Serra, Alexandre; Denzer, Friederike; Hiort, Olaf; Barth, Thomas F; Henne-Bruns, Doris; Barbi, Gotthold; Rettenberger, Günther; Wabitsch, Martin; Just, Walter; Leriche, Clothilde

    2015-01-01

    Disorders of sex development (DSD) affect the development of chromosomal, gonadal and/or anatomical sex. We analyzed a patient with ambiguous genitalia aiming to correlate the genetic findings with the phenotype. Blood and tissue samples from a male patient with penoscrotal hypospadias were analyzed by immunohistochemistry, karyotyping and FISH. DNA was sequenced for the AR, SRY and DHH genes, and further 26 loci in different sex chromosomes were analyzed by MLPA. The gonosomal origin was evaluated by simple tandem repeat (STR) analysis and SNP array. Histopathology revealed a streak gonad, a fallopian tube and a rudimentary uterus, positive for placental alkaline phosphatase, cytokeratin-7 and c-kit, and negative for estrogen, androgen and progesterone receptors, alpha-inhibin, alpha-1-fetoprotein, β-hCG, and oct-4. Karyotyping showed a 45,X/46,XY mosaicism, yet FISH showed both 46,XX/46,XY mosaicism (gonad and urethral plate), 46,XX (uterus and tube) and 46,XY karyotypes (rudimentary testicular tissue). DNA sequencing revealed intact sequences in SOX9, WNT4, NR0B1, NR5A1, CYP21A2, SRY, AR, and DHH. STR analysis showed only one maternal allele for all X chromosome markers (uniparental isodisomy, UPD), with a weaker SRY signal and a 4:1 ratio in the X:Y signal. Our findings suggest that the observed complex DSD phenotype is the result of somatic gonosomal mosaicism and UPD despite a normal blood karyotype. The presence of UPD warrants adequate genetic counseling for the family and frequent, lifelong, preventive follow-up controls in the patient.

  16. Investigation of KIT gene mutations in women with 46,XX spontaneous premature ovarian failure

    Directory of Open Access Journals (Sweden)

    Nelson Lawrence M

    2002-08-01

    Full Text Available Abstract Background Spontaneous premature ovarian failure presents most commonly with secondary amenorrhea. Young women with the disorder are infertile and experience the symptoms and sequelae of estrogen deficiency. The mechanisms that give rise to spontaneous premature ovarian failure are largely unknown, but many reports suggest a genetic mechanism in some cases. The small family size associated with infertility makes genetic linkage analysis studies extremely difficult. Another approach that has proven successful has been to examine candidate genes based on known genetic phenotypes in other species. Studies in mice have demonstrated that c-kit, a transmembrane tyrosine kinase receptor, plays a critical role in gametogenesis. Here we test the hypothesis that human KIT mutations might be a cause of spontaneous premature ovarian failure. Methods and Results We examined 42 women with spontaneous premature ovarian failure and found partial X monosomy in two of them. In the remaining 40 women with known 46,XX spontaneous premature ovarian failure we evaluated the entire coding region of the KIT gene. We did this using polymerase chain reaction based single-stranded conformational polymorphism analysis and DNA sequencing. We did not identify a single mutation that would alter the amino acid sequence of the c-KIT protein in any of 40 patients (upper 95% confidence limit is 7.2%. We found one silent mutation at codon 798 and two intronic polymorphisms. Conclusion Mutations in the coding regions of the KIT gene appear not to be a common cause of 46,XX spontaneous premature ovarian failure in North American women.

  17. FORMACION DEL DISCURSO EN SALUD MENTAL EN LA PRIMERA MITAD DEL SIGLO XX

    Directory of Open Access Journals (Sweden)

    Mónica Mojica Perilla

    2013-03-01

    Full Text Available La formación del discurso en salud mental durante la primera mitad del siglo XX tiene en el Movimiento de Higiene Mental y en el Comité Nacional de Higiene Mental sus principales influencias. Como depositarios de un estilo de pensamiento biomédico, los dos entes mencionados tomaron la vocería en el campo de la salud mental, el cual para la época bajo estudio adolecía de una clara diferenciación conceptual. Con el objeto de comprender la influencia que ejerció este estilo de pensamiento en la formación del discurso en salud mental durante la primera mitad del siglo XX, se desarrollo una revisión de literatura de la época, empleando para tal fin una propuesta teórica que combinó el análisis del discurso de Michel Foucault y la sociología del conocimiento de Ludwik Fleck. Los resultados evidencian una hegemonía del estilo de pensamiento biomédico para abordar la salud mental, representada principalmente en el empleo de la prevención como estrategia de trabajo; de igual forma se constató que fueron los médicos, psiquiatras y salubristas de la época quienes asumieron para sí, como colectivo de pensamiento, la autoridad para hablar y actuar sobre la salud mental de la población, relegando a un segundo plano otros colectivos de pensamiento.

  18. Performance and wake predictions of HAWTs in wind farms

    Energy Technology Data Exchange (ETDEWEB)

    Leclerc, C.; Masson, C.; Paraschivoiu, I. [Ecole Polytechnique, Montreal (Canada)

    1997-12-31

    The present contribution proposes and describes a promising way towards performance prediction of an arbitrary array of turbines. It is based on the solution of the time-averaged, steady-state, incompressible Navier-Stokes equations with an appropriate turbulence closure model. The turbines are represented by distributions of momentum sources in the Navier-Stokes equations. In this paper, the applicability and viability of the proposed methodology is demonstrated using an axisymmetric implementation. The k-{epsilon} model has been chosen for the closure of the time-averaged, turbulent flow equations and the properties of the incident flow correspond to those of a neutral atmospheric boundary layer. The proposed mathematical model is solved using a Control-Volume Finite Element Method (CVFEM). Detailed results have been obtained using the proposed method for an isolated wind turbine and for two turbines one behind another. In the case of an isolated turbine, accurate wake velocity deficit predictions are obtained and an increase in power due to atmospheric turbulence is found in agreement with measurements. In the case of two turbines, the proposed methodology provides an appropriate modelling of the wind-turbine wake and a realistic prediction of the performance degradation of the downstream turbine.

  19. Determination of Elastic Twist in Horizontal Axis Wind Turbines (HAWTs)

    Energy Technology Data Exchange (ETDEWEB)

    Stoddard, F.; Nelson, V.; Starcher, K.; Andrews, B.

    2006-06-01

    This report presents the results of a project at the Alternative Energy Institute (AEI) which measured and calculated the elastic twist of three representative composite horizontal-axis blades: Carter 300, Gougeon ESI 54, and UTRC 8 kW.

  20. HiPTI - High Performance Thermal Insulation, Annex 39 to IEA/ECBCS-Implementing Agreement. Vacuum insulation in the building sector. Systems and applications

    Energy Technology Data Exchange (ETDEWEB)

    Binz, A.; Moosmann, A.; Steinke, G.; Schonhardt, U.; Fregnan, F. [Fachhochschule Nordwestschweiz (FHNW), Muttenz (Switzerland); Simmler, H.; Brunner, S.; Ghazi, K.; Bundi, R. [Swiss Federal Laboratories for Materials Testing and Research (EMPA), Duebendorf (Switzerland); Heinemann, U.; Schwab, H. [ZAE Bayern, Wuerzburg (Germany); Cauberg, H.; Tenpierik, M. [Delft University of Technology, Delft (Netherlands); Johannesson, G.; Thorsell, T. [Royal Institute of Technology (KTH), Stockholm (Sweden); Erb, M.; Nussbaumer, B. [Dr. Eicher und Pauli AG, Basel and Bern (Switzerland)

    2005-07-01

    This final report on vacuum insulation panels (VIP) presents and discusses the work done under IEA/Energy Conservation in Buildings and Community Systems (ECBCS) Annex 39, subtask B on the basis of a wide selection of reports from practice. The report shows how the building trade deals with this new material today, the experience gained and the conclusions drawn from this work. As well as presenting recommendations for the practical use of VIP, the report also addresses questions regarding the effective insulation values to be expected with current VIP, whose insulation performance is stated as being a factor of five to eight times better than conventional insulation. The introduction of this novel material in the building trade is discussed. Open questions and risks are examined. The fundamentals of vacuum insulation panels are discussed and the prerequisites, risks and optimal application of these materials in the building trade are examined.

  1. Commissioning of building HVAC systems for improvement of energy performance; Commissioning of building HVAC systems for improvement of energy performance. Teilnahme IEA-ECBCS Annex 40 (Betreiberkompetenz)

    Energy Technology Data Exchange (ETDEWEB)

    Chuard, J.-M.

    2005-06-15

    This paper takes a look at the tasks performed in Task 40 of the 'Energy Conservation in Buildings and Community Systems ECBCS' programme of the International Energy Agency IEA that is taking a look at the commissioning of building HVAC systems with the aim of improving the energy performance of such systems. Emphasis is put on the Swiss contribution to the task. This well-illustrated paper presents information on the structure of the task, time-lines and a diagram for its implementation structures. Also, the countries participating in Task 40 and their representatives are listed, and various work already published by the annex is noted. The paper places a focus on operator competence and lists points to be taken into account when carrying out work on optimising energy consumption. The various processes involved are noted and discussed. Management guidelines are presented and economical and market aspects are discussed. Finally, projects that will continue the work are noted.

  2. Fundamentals for remote structural health monitoring of wind turbine blades - a preproject. Annex C. Fibre transducer for damage detection in adhesive layers of wind turbine blades

    DEFF Research Database (Denmark)

    Sendrup, P.

    2002-01-01

    displacement transducer for detection of damage in adhesive layers of wind turbine blades. It was chosen to base the transducer on the fibre optic micro-bend principle. The report contains the result of measurementsand optical simulations of light transmittance through optical fibres with micro......-bends and a suggestion for a micro-bend transducer design specifically suitable for detection of damage in adhesive layers between larger composite structures, as the shellsin a wind turbine blade. Such a damage will cause the joined parts to move slightly relative to each other, and the transducer is designed to change......This report (annex to the summary report "Grundlag for fjernovervågning af vindmøllevingers tilstand (Fase I: Forprojekt)", of a project partly supported by PSO-funding through Elkraft System, contract no. Bro-91.055, FU nr. 1102) describes the work carriedout to design and test a fibre optic...

  3. Joint Egypt/United States report on Egypt/United States cooperative energy assessment. Volume 3 of 5 Vols. Annexes 2--5

    Energy Technology Data Exchange (ETDEWEB)

    1979-04-01

    The principal objectives of the energy assessment project for Egypt are to develop understanding of the current status of the principal energy users in Egypt's industrial and agricultural sectors; to estimate the energy demand and efficiency for each selected subsector within these major sectors; to identify opportunities for fuel type changes, technology switches, or production pattern changes which might increase the efficiency with which Egypt's energy is used both now and in the future; and based on options identified, to forecast energy efficiencies for selected Egyptian subsectors for the years 1985 and 2000. The areas studied in the industrial sector are the iron and steel, aluminum, fertilizer, chemical, petrochemical, cement, textile, and automotive manufacturing industries. Those studied in the agricultural sector concern drainage and irrigation, mechanization, and food processing. Additional information in 4 annexes include industrial/agricultural sector options; residential/commercial, transportation, and fossil fuels supply options.

  4. Upgrading of Venezuelan heavy crude. Continuation of the Orinoco feasibility study within the Venezuelan-German Agreement (Annex IIIB). Final report

    Energy Technology Data Exchange (ETDEWEB)

    Gonzales, M.; Lezuo, A.; Kastner, W.; Kuenstle, K.; Ostendorf, F.J.; Reiter, K.; Rodriguez, J.; Thelen, H.J.

    1989-06-01

    Within the framework of the Venezuelan-German Agreement, Annex 3B, the following projects were performed under the responsibility of Siemens, KWU-Group. Project No. 5: Development of a mathematical model for the design and simulation of field-scale systems for the distribution of two-phase water-steam mixtures. The model has been verified in a test rig under field conditions. Project No. 6: Investigation of different steam generating systems for the production of supercritical injection steam from water of varying quality for deep oil reservoirs and investigation of the effect on oil yield and cost-effectiveness. Project No. 9: Investigation of possible improvement to achieve more efficient fuel utilization by increasing the efficiency and availability of different facilities in the Lake Maracaibo area and economic evaluation. (orig.) With 28 refs., 2 tabs., 16 figs.

  5. Synthetic gasoline and diesel oil produced by Fischer-Tropsch Technology. A possibility for the future? IEA/AMF annex XXXI

    Energy Technology Data Exchange (ETDEWEB)

    Rehnlund, B., (Atrax Energy AB, Goeteborg (SE)); Blinge, M., (The Swedish Transport Research Institute, TFK (SE)); Schramm, J.; Larsen, Ulrik, (Technical Univ. of Denmark, DTU, Kgs. Lyngby (DK))

    2007-03-15

    This report is the result of an annex (annex XXXI, Fischer-Tropsch Fuels) initiated by the International Energy Agency's Implementing Agreement on Advanced Motor Fuels. The annex has been managed by Atrax Energi AB, Bjorn Rehnlund, acting as the operating agent of the annex. The work in the annex has been carried out in co-operation with the Swedish Transportation Research Institute - TFK, Magnus Blinge and the Technical University of Denmark - DTU, Jesper Schramm and Ulrik Larsen. In this report the possibilities to produce synthetic gasoline and synthetic diesel oil from biomass, and also from natural gas, by Fischer-Tropsch (FT) Technology are analysed and discussed. After an introduction of the technology as such, environmental aspects and the life cycle perspective of synthetic gasoline and diesel oil are discussed, and some possible national/regional scenarios are analysed and presented. Vehicle emission tests with synthetic gasoline carried out at DTU are described and discussed in this report as well. Based on the result of the analysis and the vehicle emission tests presented in the report, a first SWOT analysis of Fischer-Tropsch technology is then presented, and finally some main conclusions are drawn. During the execution of the annex Sasol in South Africa, Nykomb Synergetics in Sweden, Chemrec in Sweden, the Technical University of Denmark, VTT in Finland, the Varnamo gasification research project in Sweden, and the Black liquor gasification project in Pitea, Sweden have been visited. Some of the most important conclusions are that: 1) FT-Fuels such as FT-Diesel (FTD) and FT-Gasoline (FTG) produced through CoalTo-Liquid, (CTL), Gas-To-Liquid (GTL) and Biomass-To-Liquid (BTL) technologies can contribute to reducing the dependency on crude oil. 2) FTD and FTG are attractive for use in neat form and also as components in blends with low quality diesel and gasoline, to upgrade fuels to meet the ever more stringent regulations. 3) Production and use of

  6. Análise: indicadores de pesquisa do XX Congresso Brasileiro de Ciência e Tecnologia de Alimentos Analysis: research indicators of the XX Brazilian Congress of Food Science and Technology

    Directory of Open Access Journals (Sweden)

    Renato João Sossela de Freitas

    2007-08-01

    Full Text Available Em outubro de 2006, a Regional do Paraná sediou em Curitiba o XX Congresso Brasileiro de Ciência e Tecnologia de Alimentos (XX CBCTA com o tema Alimentos e Agroindústrias Brasileiras no Contexto Internacional. O objetivo deste Congresso foi discutir o desenvolvimento científico e tecnológico e a inovação na indústria de alimentos no cenário nacional e internacional. O programa científico foi abrangente e diversificado, com Conferências, Palestras, Mesas-Redondas, Curso de Atualização, Clínicas Tecnológicas, Visitas Técnicas e Apresentações de Trabalhos Científicos em oito áreas definidas pelo Congresso. Como resultado da realização do XX CBCTA, esta análise visa uma apresentação e discussão dos indicadores da pesquisa da área de Ciência e Tecnologia de Alimentos do País e contribuição ao desenvolvimento científico e tecnológico da área, bem como subsídios para órgãos de fomento para decisão de investimentos na pesquisa e na formação de recursos humanos. No XX CBCTA, foi apresentado um total de 2066 trabalhos científicos de todo o Brasil, com exceção do Estado de Rondônia. Os trabalhos foram registrados no banco de dados e utilizados para esta análise. As inscrições foram escolhidas de acordo com a área da pesquisa de cada trabalho, sob responsabilidade de cada autor. As áreas definidas pela Comissão Científica do Congresso foram: Embalagem (EB; Método Analítico (MA; Microbiologia, Micotoxicologia e Biotecnologia (MB; Nutrição, Saúde e Alimentação (NA; Processo e Desenvolvimento de Produto (PD; Qualidade de Alimentos (QA; Química e Bioquímica (QB; e Resíduo Agroindustrial e Meio Ambiente (RM. Foi utilizado o Programa da Microsoft® Office Excel para a composição dos gráficos, versão Windows XP.In October, 2006, the Brazilian Society of Food Science and Technology - Regional Paraná got up in Curitiba the XX Brazilian Congress of Food Science and Technology (XX CBCTA with the theme

  7. Anti-corruption legislation of the Russian empire XIX – early XX centuries

    Directory of Open Access Journals (Sweden)

    Nadezhda M. Korneva

    2016-03-01

    Full Text Available The article is devoted to the history of anti-corruption and bribery as one of its kinds in the Russian Empire. Corruption as a complex social phenomenon that occurs in the process of socio-economic, political and social relations has become one of the most pressing political, social and economic problems of modern Russia. The corruption in the state apparatus not only cause serious, sometimes unsolvable problems for the citizens, but also hinder the normal functioning of the administrative bodies and authorities. The legal component, the development and adoption of relevant laws perform a special role in combating corruption. For many centuries government has repeatedly attempted if not to eliminate or at least to curb corruption in numerous managerial and administrative apparatus. The greatest interest in this regard is the imperial period of Russian history. The authors study the history of the development of criminal and civil law in the Code of the Russian Empire Publishing Laws 1832 of the penal Code and criminal Corrections 1845 judicial statutes in 1864 and subsequent legislation late XIX – the beginning of the XX century, the history of the development of appropriate laws, trace the change in order to prosecute and the degree of responsibility of the officials on the basis of unpublished material of the State Council, the State Duma and the Ministry of Justice, are stored in the Russian State Historical Archive, as well as the published acts of the Russian legislation, the verbatim records of the State Duma and the Council of State. During the XIX and early XX centuries Russian legislation has been streamlined and systematized: work was carried out on the codification of laws, created new codes of substantive and procedural law, a significant development has been and anti-corruption legislation. The appeal to the legislative materials, to the works of pre-revolutionary Russian lawyers and statesmen and the Ministry of Justice, are

  8. Las ondas largas de la política en el siglo XX

    Directory of Open Access Journals (Sweden)

    Gregorio Valdelvira González

    1998-01-01

    Full Text Available En el siglo XX podemos distinguir dos grandes ciclos políticos de onda larga. En el primero las dictaduras son fuertes y la democracia encuentra serias dificultades para mantenerse. En el segundo los regímenes autoritarios son los débiles y la democracia se extiende y fortalece. Estos ciclos coinciden con otros de tipo económico. La concordancia se debe a que los problemas de cada ciclo económico se abordan de manera más eficaz desde las correspondientes formas políticas generadas por los imperativos de la economía. Igual que las crisis de 1920 y 1929 contribuyeron a la expansión del fascismo y del autoritarismo, las de 1973 y 1979 coadyuvaron a la de la democracia. Este postulado no debe interpretarse de manera mecanicista; se trata de explicar un proceso histórico general, el de las transiciones democráticas del último cuarto del siglo XX, investigando una de las claves, quizá la más importante, las fluctuaciones de la economía.In the 20th century, we can differentiate two major long wave political cycles. In tfie first one, dictatorstiips become strong, while democracy finds itself at great pains to maintain its claims. In the second cycle, authoritarian regimes weaken and democracy spreads and grows stronger. There two cycles coincide with others of economic nature. This coincidence is due to the fact that in each economic cycle, problems are more efficiently deait with as seen from their corresponding political Systems, generated in turn by the imperativos of economy. In the same way as the crisis of 1920 and 1929 contribute to expand fascism and authoritarianism, so those of 1973 and 1979 also favoured the expansión of democracy. This postúlate should not be interpreted in a mechanistic way; we are trying to explain a general historical process, the transitions to democracy in the final quarter of the 20th century, investigating one of the key factors, perhaps the fundamental one, which is the fluctuations in economy.

  9. XX true hemaphroditism in Southern Africa blacks: Exclusion of SRY sequences and uniparental disomy of the X chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Spurdle, A.B.; Shankman, S.; Ramsay, M. [Univ. of Witwatersrand, Johannesburg (South Africa)

    1995-01-02

    A molecular investigation of 16 Bantu-speaking Black XX true hermaphrodites was undertaken in an attempt to determine the cause of the disorder. Y-specific sequences, including sequences mapping to the sex-determining region of the Y, were shown to be absent from lymphocyte tissue of all 16 patients tested. Y chromosome sequences were also absent from the ovarian and testicular components of both ovotestes of a single XX true hermaphrodite, thus excluding gonadal mosaicism involving Y chromosome sequences. Since there is evidence of Xp genes involved in testis determination/differentiation, uniparental disomy of the X chromosome was investigated in 14 XXTH families. Uniparental disomy was excluded in 12 of the 14 families, and isodisomy was excluded in the remaining two cases. 29 refs., 2 tabs.

  10. Rare case of massive congenital bilateral chylothorax in a hydropic fetus with true mosaicism 47,XXX/46,XX.

    Science.gov (United States)

    Cremonini, Giorgio; Poggi, Alice; Capucci, Roberta; Vesce, Fortunato; Patella, Alfredo; Marci, Roberto

    2014-01-01

    Fetal congenital chylothorax is a rare condition that occurs sporadically or can be associated with abnormal karyotype or structural chromosomal anomalies. We report a unique case of fetal congenital bilateral chylothorax associated with mosaicism 47,XXX/46,XX. A female fetus affected by massive bilateral hydrothorax and ascites was diagnosed at 34(+1) weeks of gestation. Previous ultrasonographic exams were completely normal. Immune causes of hydrops were excluded. Elective cesarean section was performed soon after bilateral thoracocentesis. The analysis of drained pleural fluid revealed its lymphatic nature. The fetal karyotyping, performed on chorionic villi at the 11th week, had shown mosaicism 47,XXX/46,XX, later confirmed in the newborn's blood. We hypothesized that chylothorax may be part of the phenotypic spectrum of 47 XXX karyotype and we suggest an ultrasound follow-up of the fetus at closer intervals than the routine timing for this condition, even if it is not usually characterized by severe phenotypic features.

  11. Paraísos artificiales. La imagen drogada en la pintura europea del entresiglos XIX-XX

    OpenAIRE

    2015-01-01

    Paraísos artificiales. La imagen drogada en la pintura europea del entresiglos XIX-XX. La presente investigación recopila y analiza la imagen pictórica drogada en el entresiglos XIX-XX europeo, prestando especial atención al caso español, desde la exposición descriptiva; un trabajo elaborado con voluntad de catálogo. Las conclusiones teóricas dan cuenta no sólo de que el leitmotiv tóxico puede convertirse en una temática cambiosecular en sí misma, también pone de manifiesto como el uso y ...

  12. Universidad y Estado. Del pensamiento del siglo XIX a las reflexiones de la primera mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Hugo Casanova Cardiel

    2015-01-01

    Full Text Available En este artículo se presenta una mirada panorámica sobre la idea de universidad en el siglo XIX y la primera mitad del siglo XX. Se busca identificar algunos de los rasgos fundamentales del vínculo entre la universidad y el Estado. Así, a partir de la revisión del pensamiento de destacados filósofos y estudiosos de la educación superior, es ofrecida una interpretación de los modelos universitarios europeos del siglo XIX. Con ese mismo propósito, se presenta también una revisión de influyentes autores de inicios del siglo XX en torno a sus ideas sobre la universidad. Todo lo anterior tiene una gran significación para el cabal entendimiento de la universidad del siglo XXI.

  13. [Martin Klesment. Fertility development in Estonia during the second half of the XX century: the economic context and its implications] / Olaf Mertelsmann

    Index Scriptorium Estoniae

    Mertelsmann, Olaf, 1969-

    2011-01-01

    Arvustus: Martin Klesment. Fertility development in Estonia during the second half of the XX century: the economic context and its implications. Tallinna Ülikooli sotsiaalteaduste dissertatsioonid, 46. Tallinn: Tallinna Ülikool 2010

  14. [Martin Klesment. Fertility development in Estonia during the second half of the XX century: the economic context and its implications] / Olaf Mertelsmann

    Index Scriptorium Estoniae

    Mertelsmann, Olaf, 1969-

    2011-01-01

    Arvustus: Martin Klesment. Fertility development in Estonia during the second half of the XX century: the economic context and its implications. Tallinna Ülikooli sotsiaalteaduste dissertatsioonid, 46. Tallinn: Tallinna Ülikool 2010

  15. Molecular cytogenetic characterization of Rumex papillaris, a dioecious plant with an XX/XY(1)Y (2) sex chromosome system.

    Science.gov (United States)

    Navajas-Pérez, Rafael; Schwarzacher, Trude; Rejón, Manuel Ruiz; Garrido-Ramos, Manuel A

    2009-01-01

    Rumex papillaris Boiss, & Reut., an Iberian endemic, belongs to the section Acetosa of the genus Rumex whose main representative is R. acetosa L., a species intensively studied in relation to sex-chromosome evolution. Here, we characterize cytogenetically the chromosomal complement of R. papillaris in an effort to enhance future comparative genomic approaches and to better our understanding of sex chromosome structure in plants. Rumex papillaris, as is common in this group, is a dioecious species characterized by the presence of a multiple sex chromosome system (with females 2n = 12 + XX and males 2n = 12 + XY(1)Y(2)). Except for the X chromosome both Y chromosomes are the longest in the karyotype and appear heterochromatic due to the accumulation of at least two satellite DNA families, RAE180 and RAYSI. Each chromosome of pair VI has an additional major heterochromatin block at the distal region of the short arm. These supernumerary heterochromatic blocks are occupied by RAE730 satellite DNA family. The Y-related RAE180 family is also present in an additional minor autosomal locus. Our comparative study of the chromosomal organization of the different satellite-DNA sequences in XX/XY and XX/XY(1)Y(2) Rumex species demonstrates that of active mechanisms of heterochromatin amplification occurred and were accompanied by chromosomal rearrangements giving rise to the multiple XX/XY(1)Y(2) chromosome systems observed in Rumex. Additionally, Y(1) and Y(2) chromosomes have undergone further rearrangements leading to differential patterns of Y-heterochromatin distribution between Rumex species with multiple sex chromosome systems.

  16. Should male gender assignment be considered in the markedly virilized patient With 46,XX and congenital adrenal hyperplasia?

    Science.gov (United States)

    Lee, Peter A; Houk, Christopher P; Husmann, Douglas A

    2010-10-01

    We assess the outcome in 46,XX men with congenital adrenal hyperplasia who were born with Prader 4 or 5 genitalia and assigned male gender at birth. After receiving institutional review board approval and subject consent we reviewed the medical records of 12 men 35 to 69 years old with 46,XX congenital adrenal hyperplasia, of whom 6 completed social and gender issue questionnaires. All subjects were assigned male gender at birth, were diagnosed with virilizing congenital adrenal hyperplasia at age greater than 3 years and indicated a male gender identity with sexual orientation to females. Ten of the 12 subjects had always lived as male and 2 who were reassigned to female gender in childhood subsequently self-reassigned as male. Nine of the 12 men had long-term female partners, including 7 married 12 years or more. The 3 subjects without a long-term female partner included 1 priest, 1 who was reassigned female gender, married, divorced and self-reassigned as male, and 1 with a girlfriend and sexual activity. All except the priest and the subject who was previously married when female indicated a strong libido and frequent orgasmic sexual activity. Responses to self-esteem, masculinity, body image, social adjustment and symptom questionnaires suggested adjustments related to the extent of familial and social support. Outcome data on severely masculinized 46,XX patients with congenital adrenal hyperplasia who were assigned male gender at birth indicate male gender identity in adulthood with satisfactory male sexual function in those retaining male genitalia. In men who completed questionnaires results were poorer in those lacking familial/social support. Male gender of rearing may be a viable option for parents whose children are born with congenital adrenal hyperplasia, a 46,XX karyotype and male genitalia, although positive parental and other support, and counseling are needed for adjustment. Copyright © 2010 American Urological Association Education and Research

  17. Unique sex chromosome systems in Ellobius: How do male XX chromosomes recombine and undergo pachytene chromatin inactivation?

    OpenAIRE

    Sergey Matveevsky; Irina Bakloushinskaya; Oxana Kolomiets

    2016-01-01

    Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂ ) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate sho...

  18. Terminal deletion of the long arm of chromosome 3 [46,XX,del(3)(q27{r_arrow}qter)

    Energy Technology Data Exchange (ETDEWEB)

    Chitayat, D.; Babul, R.; Silver, M.M. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-01-02

    We report on a terminal deletion of the long arm of chromosome 3[46,XX,del(3)(q27{r_arrow}qter)] in a female newborn infant who died 45 hours after delivery and had multiple congenital abnormalities including bilateral anophthalmia, congenital heart disease, and abnormal genitalia. The findings are compared to those of four previously reported cases with terminal de (3q). 8 refs., 4 figs., 1 tab.

  19. XX/XY System of Sex Determination in the Geophilomorph Centipede Strigamia maritima.

    Directory of Open Access Journals (Sweden)

    Jack E Green

    Full Text Available We show that the geophilomorph centipede Strigamia maritima possesses an XX/XY system of sex chromosomes, with males being the heterogametic sex. This is, to our knowledge, the first report of sex chromosomes in any geophilomorph centipede. Using the recently assembled Strigamia genome sequence, we identified a set of scaffolds differentially represented in male and female DNA sequence. Using quantitative real-time PCR, we confirmed that three candidate X chromosome-derived scaffolds are present at approximately twice the copy number in females as in males. Furthermore, we confirmed that six candidate Y chromosome-derived scaffolds contain male-specific sequences. Finally, using this molecular information, we designed an X chromosome-specific DNA probe and performed fluorescent in situ hybridization against mitotic and meiotic chromosome spreads to identify the Strigamia XY sex-chromosome pair cytologically. We found that the X and Y chromosomes are recognizably different in size during the early pachytene stage of meiosis, and exhibit incomplete and delayed pairing.

  20. O "acontecimento" e o discurso literário do século XX

    Directory of Open Access Journals (Sweden)

    Francisco Elias Simão Merçon

    2009-12-01

    Full Text Available

    Central na obra de Claude Zilberberg, o conceito de “acontecimento” tem um papel inegável nos estudos semióticos, uma vez que anima as discussões sobre a possibilidade de investigação num universo de sentido ainda pouco explorado (o da afetividade, especialmente se o compararmos com os estudos da narratividade de herança proppiana. Um ponto importante que a investigação sobre o acontecimento traz para os estudos semióticos é a possibilidade de traduzir as operações discursivas de determinados textos, em termos de regimes discursivos do fato ou do acontecimento, a partir do reconhecimento de duas lógicas operantes distintas, respectivamente a implicativa e a concessiva. Este artigo faz parte de uma investigação maior que procura depreender e descrever as operações discursivas de algumas obras representativas do discurso literário do século XX, nas quais o “acontecimento” parece exercer um papel significativo. A título de ilustração das refl exões desenvolvidas no presente texto, serão abordadas obras de autores como Jean-Paul Sartre, Franz Kafka, Dino Buzzati e Samuel Beckett.

  1. Thermal quantum and classical correlations in two qubit XX model in a nonuniform external magnetic field

    CERN Document Server

    Hassan, Ali Saif M; Joag, Pramod S

    2010-01-01

    We investigate how thermal quantum discord $(QD)$ and classical correlations $(CC)$ of a two qubit one-dimensional XX Heisenberg chain in thermal equilibrium depend on temperature of the bath as well as on nonuniform external magnetic fields applied to two qubits and varied separately. We show that the behaviour of $QD$ differs in many unexpected ways from thermal entanglement $(EN)$. For the nonuniform case, $(B_1= - B_2)$ we find that $QD$ and $CC$ are equal for all values of $(B_1=-B_2)$ and for different temperatures. We show that, in this case, the thermal states of the system belong to a class of mixed states and satisfy certain conditions under which $QD$ and $CC$ are equal. The specification of this class and the corresponding conditions is completely general and apply to any quantum system in a state in this class and satisfying these conditions. We further find the relative contributions of $QD$ and $CC$ can be controlled easily by changing the relative magnitudes of $B_1$ and $B_2$.

  2. LA COLECTIVIDAD BRITÁNICA EN VALPARAÍSO DURANTE LA PRIMERA MITAD DEL SIGLO XX

    Directory of Open Access Journals (Sweden)

    BALDOMERO ESTRADA TURRA

    2006-06-01

    Full Text Available En este trabajo analizamos la importancia de la colectividad británica en el desarrollo económico de Valparaíso (Chile, pese a su limitada presencia, durante la primera mitad del siglo XX. Se hace notar el predominio de la colectividad el comercio internacional como también en la actividad industrial especialmente en aquellas que poseían un mayor desarrollo tecnológico. La disminución de la importancia económica y también demográfica de la colectividad británica en Valparaíso, a partir de la década de 1920, se relaciona directamente con la perdida de influencia británica, en nuestro Continente, luego de la Primera Guerra MundialIn this work we analyze the importance of the british immigrants in the economic development of Valparaiso during the first half of twenty century. We highlight their predominance in the international trade and in the industrial activity especially those that reveal a high technological development. The economic and demographic decline of the british immigrants from 1920 is in close relation with the lost of the british influence in Latin America after the First World War

  3. hispanoamericana Poesía experimental (en la segunda mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Óscar Galindo V.

    2014-03-01

    Full Text Available El artículo propone una aproximación a la poesía neovanguardista hispanoamericana de raigambre experimental, durante la segunda mitad del siglo XX. Se advierte la dimensión continental de la emergencia de movimientos, agrupaciones, revistas y autores neovanguardistas a partir de fines de los años 50 y hasta los años 80 al menos. Lo anterior ha producido una nueva semioticidad que emparenta la escritura poética con las artes visuales, escénicas, musicales, audiovisuales y digitales, generando nuevos discursos y nuevos repertorios. Estos procesos suponen el reciclaje y resemantización de los de los ideales antiartísticos de tradición vanguardista y, particularmente, del proyecto arte-vida, revitalizando la relación entre arte y política, en consonancia con los debates públicos y las transformaciones en los sistemas de producción cultural. Se analizan como ejemplos de poesía experimental, visual y accional, a dos poetas chilenos: Cecilia Vicuña y Juan Luis Martínez.

  4. Hurst exponent of very long birth time series in XX century Romania. Social and religious aspects

    CERN Document Server

    Rotundo, G; Herteliu, C; Ileanu, B

    2015-01-01

    The Hurst exponent of very long birth time series in Romania has been extracted from official daily records, i.e. over 97 years between 1905 and 2001 included. The series result from distinguishing between families located in urban (U) or rural (R) areas, and belonging (Ox) or not (NOx) to the orthodox religion. Four time series combining both criteria, (U,R) and (Ox, NOx), are also examined. A statistical information is given on these sub-populations measuring their XX-th century state as a snapshot. However, the main goal is to investigate whether the "daily" production of babies is purely noisy or is fluctuating according to some non trivial fractional Brownian motion, - in the four types of populations, characterized by either their habitat or their religious attitude, yet living within the same political regime. One of the goals was also to find whether combined criteria implied a different behavior. Moreover, we wish to observe whether some seasonal periodicity exists. The detrended fluctuation analysis...

  5. AGITATION AND MASS FORMS OF ART IN THE 20-IES OF THE XX CENTURY IN RUSSIA

    Directory of Open Access Journals (Sweden)

    Bochkareva A. S.

    2016-09-01

    Full Text Available The article deals with the forms of agitation and mass art, the creation of which was authorized by the Bolsheviks in the 20ies of the XX century for effective advocacy activities. It is noted, that agitation and mass art is one of the most important and effective means of policies and has played a huge role in the establishment of Soviet power. Propaganda direction was manifested in the both of drawing and painting and was aimed at the formation of a new proletarian thinking in a socialist society. It is stated, that the content of works of art is determined, above all, by the military-political situation that prevailed in the 20-ies. It is shown, that in the works of art displayed figures of the new revolutionary themes, events and characters, but also significant presence of the image of the new man - working men and women, sailors, soldiers, peasants was traced. Festive decoration of cities and towns, from the capital to the smallest provincial towns was filled with agitation and propaganda content. The conclusion is that artistic and political design of squares, streets, public buildings should help to create a festive mood, increase employment, ideological and socio-political activity of the workers. In general, new forms of agitation and propaganda were created through art, by turning the novelty of content, depth of the emotional impact, thematic literacy and specificity for the necessary psychological mood of society during the study period

  6. Tratamiento isotérmico de los aceros aleados al silicio Tipo SAE 92XX

    Directory of Open Access Journals (Sweden)

    Páez, J. L.

    1996-02-01

    Full Text Available SAE 9260 type steels have silicon and carbon contents similar to those of the ductile iron matrix, and present a bainitic transformation with the same characteristics as ADI (Austempered Ductile Iron. The hypothesis is that excellent mechanical properties can be obtained by means of austempering (in times so short as to be accessible from the industrial point of view, the same as in ADI and even better because it is a rolling material instead of a cast material. It will be compared with the mechanical properties obtained by quenching and tempering at different temperatures.

    La composición química de los aceros SAE 92XX es similar a la de la matriz metálica de una fundición esferoidal, por lo que se pensó en someter a un acero de ese tipo a tratamientos de austempering similares a los que se aplican para lograr una ADI (Austempered Ductile Iron, y verificar si se alcanzaban valores aceptables de plasticidad con elevados valores de resistencia a la tracción para el mismo acero, tal y como sucede con aquellas fundiciones, y comparar dichos resultados con los obtenidos en el mismo acero con tratamientos convencionales de temple y revenido. Se alcanzaron valores que demostraron que, por austempering, se logran excelentes valores de plasticidad, muy superiores a los alcanzados por temple y revenido para durezas del mismo orden.

  7. XX/XY System of Sex Determination in the Geophilomorph Centipede Strigamia maritima.

    Science.gov (United States)

    Green, Jack E; Dalíková, Martina; Sahara, Ken; Marec, František; Akam, Michael

    2016-01-01

    We show that the geophilomorph centipede Strigamia maritima possesses an XX/XY system of sex chromosomes, with males being the heterogametic sex. This is, to our knowledge, the first report of sex chromosomes in any geophilomorph centipede. Using the recently assembled Strigamia genome sequence, we identified a set of scaffolds differentially represented in male and female DNA sequence. Using quantitative real-time PCR, we confirmed that three candidate X chromosome-derived scaffolds are present at approximately twice the copy number in females as in males. Furthermore, we confirmed that six candidate Y chromosome-derived scaffolds contain male-specific sequences. Finally, using this molecular information, we designed an X chromosome-specific DNA probe and performed fluorescent in situ hybridization against mitotic and meiotic chromosome spreads to identify the Strigamia XY sex-chromosome pair cytologically. We found that the X and Y chromosomes are recognizably different in size during the early pachytene stage of meiosis, and exhibit incomplete and delayed pairing.

  8. La influencia del manual en el pensamiento económico colombiano durante el siglo xx

    Directory of Open Access Journals (Sweden)

    Alberto Mayor Mora

    2017-02-01

    Full Text Available El uso de los manuales en economía ha sido masivo en su profesionalización y ha repercutido en las ideas económicas colombianas. Durante el siglo XX se presentaron cuatro etapas; la primera de ellas se dio a inicios del siglo, cuando predominó el autodidactismo en los manuales franceses, entre profesores, políticos y hombres de empresa de Bogotá y Medellín. La segunda etapa se caracterizó por el contacto de algunos protoeconomistas con el pensamiento económico original en el exterior, lo que ocasionó el inicio de la crítica a la utilización de manuales. La tercera surgió con las primeras facultades de Economía, en los años 40, época en que se reemplazó el manual francés por el anglosajón neoclásico; y la última etapa se inicia desde 1980, cuando se hace una crítica coherente al manual y comienza la producción de textos “criollos”, que ofrecen facilidades pedagógicas con pensamiento teórico de vanguardia.

  9. CONFIGURACIONES DE SUJETO EN LA MODERNIDAD LATINOAMERICANA: EL CASO DE PERÚ A INICIOS DEL SIGLO XX

    Directory of Open Access Journals (Sweden)

    Kathya Araujo

    2010-04-01

    Full Text Available Este texto se aproxima al estudio del sujeto y de los lazos sociales en nuestra región a partir del análisis del caso del Perú en las primeras décadas del siglo XX. Lo hace tomando apoyo en la noción de configuraciones de sujeto como operador analítico y usando como corpus textos autobiográficos en cuanto se considera que ellos son una vía privilegiada para este tipo de estudios. El texto se inicia con una presentación de los fundamentos teóricos y metodológicos que lo sustentan y, posteriormente, discute tres rasgos sobresalientes de las configuraciones de sujeto encontradas para el caso peruano en el momento histórico estudiado y lo que ellos revelan sobre el lazo social.This paper approaches the study of the subject and the social bond in the case of Peru in the first three decades of the 20th century. It uses as analytical operator the notion of subject configurations and it is based upon the analysis of autobiographical texts. The text begins with the presentation of its theoretical and methodological foundations and then goes on to discuss three of the main features of the subject configurations founding of these texts, and their meaning for the understanding of the social bond.

  10. Time-series spectroscopy of the pulsating eclipsing binary XX Cephei

    CERN Document Server

    Koo, Jae-Rim; Hong, Kyeongsoo; Kim, Seung-Lee; Lee, Chung-Uk

    2016-01-01

    Oscillating Algol-type eclipsing binaries (oEA) are very interesting objects that have three observational features of eclipse, pulsation, and mass transfer. Direct measurement of their masses and radii from the double-lined radial velocity data and photometric light curves would be the most essential for understanding their evolutionary process and for performing the asteroseismological study. We present the physical properties of the oEA star XX Cep from high-resolution time-series spectroscopic data. The effective temperature of the primary star was determined to be 7,946 $\\pm$ 240 K by comparing the observed spectra and the Kurucz models. We detected the absorption lines of the secondary star, which had never been detected in previous studies, and obtained the radial velocities for both components. With the published $BVRI$ light curves, we determined the absolute parameters for the binary via Wilson-Devinney modeling. The masses and radii are $M_{1} = 2.49 \\pm 0.06$ $M_\\odot$, $M_{2} = 0.38 \\pm 0.01$ $M_...

  11. The XX century architectural heritage in the Marche region. The Masters’ drawings and designs.

    Directory of Open Access Journals (Sweden)

    Ramona Quattrini

    2010-12-01

    Full Text Available In the history of architecture, Marche is often considered as a region that did not take part in the big developments of national architecture. Hence it’s meaningful to examine the architectonic events of the Region in the XX century and how much the Marche region has been the object of work by the great masters of the past century. A list of architects - called ‘masters’ – has been selected: Franco Albini, Gae Aulenti, Carlo Aymonino, Ernesto Basile, BBPRGuido Canella, Giancarlo De Carlo, Luigi Figini, Massimiliano Fuksas, Roberto Gabetti, Ignazio Gardella, Giorgio Grassi, Vittorio Gregotti, Adalberto Libera, Giovanni Michelucci, Gaetano Minnucci, Carlo Mollino, Luigi Moretti, Pier Luigi Nervi, Giuseppe Pagano, Edoardo Persico, Marcello Piacentini, Renzo Piano, Gio Ponti, Paolo Portoghesi, Franco Purini, Ludovico Quaroni, Mario Ridolfi, Aldo Rossi, Giuseppe Samonà, Antonio Sant’Elia; Alberto Sartoris, Carlo Scarpa, Giuseppe Terragni, Gino Valle, Vittoriano Viganò, Marco Zanuso, The research is a meaningful census of the works of the 20th century, whether they have been realized or not (projects, competitions, studies etc. and assigned to the masters listed above.

  12. Clubes de fútbol y desarrollo urbano en el siglo XX de Buenos Aires

    Directory of Open Access Journals (Sweden)

    Mariano Gruschetsky

    2015-07-01

    Full Text Available Resumen El artículo muestra la estrecha relación que ha existido entre los clubes de fútbol, los poderes públicos y el desarrollo urbano de la ciudad de Buenos Aires durante el siglo XX. Se presentarán las principales ideas e hipótesis generadas por diversos trabajos de investigación desarrollados en los últimos cinco años, los cuales dan cuenta del rol central jugado por los clubes en la conformación y expansión de la ciudad, tanto en lo que respecta al plano territorial como en el que remite a la constitución de identidades. Abstract The article proposes to illuminate the close relationship that has existed between football clubs, public officials, and urban development in the city of Buenos Aires in the 20th century. It presents the principal ideas and hypotheses generated by various research projects conducted in the last five years. These investigations reveal the central role played by clubs in the shaping and expansion of the city in a territorial sense as well as in the construction of identities.

  13. Estructuras agrarias comparadas: la Puna argentina y el sur boliviano a comienzos del siglo XX

    Directory of Open Access Journals (Sweden)

    Ana A. Teruel

    2005-01-01

    Full Text Available This article expects to be another contribution to the knowledge about the social-economic problems from the Argentine Puna, especifically to its agricultural structure, paying special attention to changes and permanences, concerning to property and land, key to economical and social power and fundamental axis of production relationship of this society. It focuses on the problematical fact of indian lands, making a comparison between the North of Argentina and the South of Bolivia, considering both political state systems about comunity lands and its effects in the agrarian structures in the begining of the XXth century.Este artículo tiene por propósito realizar un aporte más al conocimiento de la problemática socio-económica de la Puna argentina, específicamente a su estructura agraria, atendiendo los cambios y permanencias relativos a la propiedad y tenencia de la tierra, clave del poder económico y social y eje fundamental en las relaciones de producción de esta sociedad agraria. Se trata la cuestión en el marco de la problemática de las tierras indígenas, comparando la situación del Norte argentino con la del Sur boliviano, analizando las políticas de ambos Estados en torno a la tierra de las comunidades y sus efectos en las estructuras agrarias de comienzos del siglo XX.

  14. De fundadoras e irreverentes. Poesía venezolana, siglo XX

    Directory of Open Access Journals (Sweden)

    Carmen Rodríguez González

    2009-12-01

    Full Text Available En el siguiente artículo, se pasa revista a las principales exponentes femeninas de la poesía venezolana durante el siglo XX, mostrando cómo a través de su obra literaria ejercieron una labor de resistencia contra la sociedad patriarcal imperante y ayudaron a conformar la identidad femenina de las mujeres de aquel país, haciendo del cuerpo femenino su principal santo y seña. Su producción, en libros, prensa y revistas del espacio intelectual venezolano, es analizada y señala cuáles fueron los principales lugares comunes a los que recurrieron para conformar un discurso alternativo de liberación y dignidad.____________________ABSTRACT:The following article presents the main female exponents of the Venezuelan poetry of the 20th century and shows how by means of their literary work those poets strove to resist against the prevailing patriarchal society and helped to create the female identity of the women of the country, making the female body its main “key notion”. The author analyses their work published in books, press and magazines of the Venezuelan intellectual circles and shows which were the main clichés they resorted to in order to provide an alternative discourse of liberation and dignity.

  15. Los hogares latinoamericanos durante la segunda mitad del siglo XX: una perspectiva sociodemográfica

    Directory of Open Access Journals (Sweden)

    Brígida García

    2002-01-01

    Full Text Available El objetivo de este trabajo es analizar los cambios sociodemográficos más significativos ocurridos en los hogares latinoamericanos durante la segunda mitad del siglo xx. Para ello se tienen en cuenta dos aspectos fundamentales: la posible convergencia hacia las familias pequeñas y nucleares; y la naturaleza e incremento de los hogares con jefatura femenina. Se intenta no sólo sintetizar el conocimiento existente sobre dichos temas, sino también dar cuenta de las conexiones entre los cambios sociodemográficos de los hogares y la desigualdad social y de género persistente en América Latina. Algunas de las principales conclusiones son: a A pesar de la existencia de un claro proceso de nuclearización en los hogares latinoamericanos, la importancia de los arreglos familiares de tipo extendido continúa siendo distintiva del sistema familiar en la región, especialmente entre la población de escasos recursos; y b los hogares encabezados por mujeres muestran un claro incremento, y posiblemente éste se aprecie en diversos sectores de nuestras sociedades.

  16. Transformaciones ambientales y producción agroforestal: El Gran Chaco Argentino en el siglo XX

    Directory of Open Access Journals (Sweden)

    Adrián Gustavo Zarrilli

    2016-01-01

    Full Text Available En tiempos de la independencia hacia principios del siglo XIX, había en Argentina 160 millones de hectáreas de bosques, montes y selvas originales. En menos de dos siglos el país perdió más de dos tercios de su patrimonio forestal autóctono. Hoy le quedan menos 33 millones de hectáreas forestales. La explotación de la esta extraordinaria riqueza forestal Argentina, es el punto de partida de este análisis que se propone trazar un cuadro interpretativo – desde una perspectiva histórico-ambiental – de la evolución de las transformaciones histórico-ambientales de la región del Gran Chaco Argentino en el siglo XX, sus ciclos productivos y su relación con la expansión del modelo de agricultura capitalista. Nuestro objetivo central es, entonces, el estudio histórico-ambiental de este proceso de transformación de esta región, en el contexto de su incorporación al mercado y la relación que se establece entre este proceso de deforestación y la expansión de la frontera agrícola, su transformación artificial, conflictos, grados de especialización, racionalidad, interacción y el deterioro progresivo de los mismos.

  17. Sex steroid levels in XY males and sex-reversed XX males, of rainbow trout (Oncorhynchus mykiss), during the reproductive cycle.

    Science.gov (United States)

    Espinosa, E; Josa, A; Gil, L; González, N

    2011-02-01

    In this study, the annual cycle of the gonadal steroids testosterone (T), 11-ketotestosterone (11-KT), 17β-oestradiol (E2) and 17α, 20β-dihydroxy-4-pregnen-3-one (DHP) was determined using radioimmunoassay and then compared, for XY males (n=35) and sex-reversed XX males (n=27) rainbow trout, to establish possible endocrinology differences. Both in XY males and sex-reversed XX males, significant correlation was shown between body weight and T (r=0.5046 and 0.34078, respectively; psex-reversed XX males were similar and showed an intense seasonal variation. The highest levels for T and 11-KT were detected from December to April with a peak in January (51.67 ± 5.11 and 61.95 ± 4.25 ng/ml, for XY males and 57.1 ± 5.82 and 59.27 ± 4.84 ng/ml, respectively, for XX males). In addition, there was a positive correlation (psex-reversed XX males (r=0.6019). Concentrations of DHP in XY males also showed seasonal variation with a peak in February (25.18 ± 12.99 ng/ml). However, DHP levels in sex-reversed XX males were undetectable (sex-reversed XX males were similar to those observed in XY males. The only difference in the annual gonadal steroid cycle between XY and sex-reversed XX males was in the DHP profile. © 2009 Blackwell Verlag GmbH.

  18. 46,XX, der(15,t(Y;15(q12;p11 karyotype in an azoospermic male

    Directory of Open Access Journals (Sweden)

    Serap T Onrat

    2012-01-01

    Full Text Available We report on a Yq/15p translocation in a 23-year-old infertile male referred for Klinefelter Syndrome testing, who had azoospermia and bilateral small testes. Hormonal studies revealed hypergonadotropic hypogonadism. Conventional cytogenetic procedures giemsa trypsin giemsa (GTG and high resolution banding (HRB and molecular cytogenetic techniques Fluorescence In Situ Hybridization (FISH performed on high-resolution lymphocyte chromosomes revealed the karyotype 46,XX, t(Y;15(q12;p11. SRY-gene was confirmed to be present by classical Polymerase Chain Reaction (PCR methods. His father carried de novo derivative chromosome 15 [45,X, t(Y;15(q12;p11] and was fertile; the karyotype of the father using G-band technique confirmed a reciprocal balanced translocation between chromosome Y and 15. In the proband, the der (15 has been inherited from the father because the mother had a normal karyotype (46,XX. In the proband, the der (15 could have produced genetic imbalance leading to unbalanced robertson translocation between chromosome Y and 15, which might have resulted in azoospermia and infertility in the proband. The paternal translocation might have lead to formation of imbalanced ova, which might be resulted infertility in the proband. Sister′s karyotypes was normal (46,XX while his brother was not analyzed.

  19. Phenotypic variation in a Chinese family with 46,XY and 46,XX 17α-hydroxylase deficiency.

    Science.gov (United States)

    Bee, Yong Mong; Manju, Chandran; Papari-Zareei, Mahboubeh; Auchus, Richard J

    2012-04-01

    17α-hydroxylase deficiency is a rare autosomal recessive disorder characterized by sexual infantilism, amenorrhea, hypertension and hypokalemia, which is caused by mutations in the CYP17A1 gene. To date, more than 50 mutations in this gene have been described. The clinical features and biochemical data of a pair of 46,XY and 46,XX Chinese siblings with 17α-hydroxylase deficiency from Singapore were studied. Direct DNA sequence analysis of the CYP17A1 gene was performed. There was significant phenotypic variation between the siblings. The proband (46,XY) presented classically with sexual infantilism, amenorrhea and hypertension. The younger sibling (46,XX) also presented with amenorrhea, but she had breast development and absence of hypokalemic hypertension. The same compound heterozygous mutations in CYP17A1 gene were identified in both patients. A missense mutation (P409R) was detected in exon 7, and a 9-bp deletion (D487-S488-F489del) was detected in exon 8. We confirmed the diagnosis of 17α-hydroxylase deficiency in these two patients. Both P409R and D487-S488-F489del have been described previously and are widely propagated in the Chinese population in East and Southeast Asia. We propose that the phenotypic expression of affected individuals with 17α-hydroxylase deficiency is karyotype-dependent, with individuals having the 46,XX karyotype having less pronounced clinical symptoms.

  20. Unique sex chromosome systems in Ellobius: How do male XX chromosomes recombine and undergo pachytene chromatin inactivation?

    Science.gov (United States)

    Matveevsky, Sergey; Bakloushinskaya, Irina; Kolomiets, Oxana

    2016-07-18

    Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate short synaptic fragments and crossover-associated MLH1 foci in both telomeric regions only. The chromatin undergoes modifications in the meiotic sex chromosomes. SUMO-1 marks a small nucleolus-like body of the meiotic XX. ATR and ubiH2A are localized in the asynaptic area and the histone γH2AFX covers the entire XX bivalent. The distribution of some markers of chromatin inactivation differentiates sex chromosomes of mole voles from those of other mammals. Sex chromosomes of both studied species have identical recombination and meiotic inactivation patterns. In Ellobius, similar chromosome morphology masks the functional heteromorphism of the male sex chromosomes, which can be seen at meiosis.

  1. METHODOLOGICAL PROBLEMS OF RESEARCH IN HISTORY OF PHYSICAL CULTURE OF XX CENTURY IN THE TERRITORY OF FORMER YUGOSLAVIA

    Directory of Open Access Journals (Sweden)

    Slađana Mijatović

    2009-11-01

    Full Text Available The entire XX century has passed in turbulent political and economic changes in the entire world, and especially in Europe. This was particularly expressed on the terri- tory of the Kingdom of Yugoslavia and Socialist Federal Republic of Yugoslavia (SFRY, were a few independent states were created at the beginning of XX century. All these changes reflected also in the field of culture and science and created ob- stacles for many cultural events, and especially scientific researches of certain phenome- na in these territories at the beginning of the XXI century. These difficulties will continue to be present for many years because the SFRY was disintegrated in wars, violence and crimes resulting in impossibility to establish faster normal collaboration between the newly created states. This problem has not speared even the researches in history of physical culture of the XX century on the territory of former SFRY, because no normal communication bet- ween some of the newly formed states has been established, so the access to researches of primary historic resources, which is necessary in heurictc phase, is lacking. Therefore it is necessary to establish collaboration between colleagues-resear- chers from these territories, more that usually in order to create possibilities for valid researches with objective and worthy conclusions

  2. Democracy and the Portuguese Polytechnic Education. The Case of the Polytechnic Institute of Portalegre (80s of the XX century

    Directory of Open Access Journals (Sweden)

    Helder Henriques

    2015-05-01

    Full Text Available In this paper we intend to demonstrate how important was the creation of the Polytechnic Higher Education Institutions as a way to the democratization, access and success in the system of Portuguese higher education in the 70s and 80s of the XX century. Taking the example of the Polytechnic Institute of Portalegre, in particular its School of Education, and using the method of document analysis articulated by content analysis of the interviews with students of the 80s of the XX century, we aimed to highlight the importance of this Higher Education Institution in the democratization on the access and success for a large number of students attending this institution in such a decade. We conclude emphasizing the importance of regional decentralization of higher education institutions across the country and of democratic opportunity in order to allow more citizens to access and complet a degree, regardless of their social, economic and cultural roots. How to reference this article Henriques, H., Marchão, A., & Mourato, J. (2015. A Democracia e o Ensino Superior Politécnico Português. O caso do Instituto Politécnico de Portalegre (década de 80 do séc. XX. Espacio, Tiempo y Educación, 2(2, 173-196. doi: http://dx.doi.org/10.14516/ete.2015.002.002.009

  3. Sexual Assault and Sexual Harassment in the U.S. Military: Annex to Volume 3. Tabular Results from the 2014 RAND Military Workplace Study for Coast Guard Service Members

    Science.gov (United States)

    2015-01-01

    punished or treated unfairly in the workplace if you did not do something sexual? (Follow-up questions established that target had direct evidence of an...from work made you feel like you would get punished or treated unfairly in the workplace if you did not do something sexual? (Follow-up questions...SEXUAL ASSAULT AND SEXUAL HARASSMENT IN THE U.S. MILITARY Annex to Volume 3. Tabular Results from the 2014 RAND Military Workplace Study for

  4. Fundamentals for remote structural health monitoring of wind turbine blades - a pre-project. Annex B - Sensors and non-destructive testing methods for damage detection in wind turbine blades

    Energy Technology Data Exchange (ETDEWEB)

    Lading, L.; McGugan, M.; Sendrup, P.; Rheinlaender, J.; Rusborg, J.

    2002-05-01

    This annex provides a description of the sensor schemes and the non-destructive testing (NDT) methods that have been investigated in this project. Acoustic emission and fibre optic sensors are described in some detail whereas only the key features of well-established NDT methods are presented. Estimates of the cost of different sensor systems are given and the advantages and disadvantages of the different schemes is discussed. (au)

  5. Wide spectrum of NR5A1‐related phenotypes in 46,XY and 46,XX individuals

    Science.gov (United States)

    Domenice, Sorahia; Machado, Aline Zamboni; Ferreira, Frederico Moraes; Ferraz‐de‐Souza, Bruno; Lerario, Antonio Marcondes; Lin, Lin; Nishi, Mirian Yumie; Gomes, Nathalia Lisboa; da Silva, Thatiana Evelin; Silva, Rosana Barbosa; Correa, Rafaela Vieira; Montenegro, Luciana Ribeiro; Narciso, Amanda; Costa, Elaine Maria Frade; Achermann, John C

    2016-01-01

    Steroidogenic factor 1 (NR5A1, SF‐1, Ad4BP) is a transcriptional regulator of genes involved in adrenal and gonadal development and function. Mutations in NR5A1 have been among the most frequently identified genetic causes of gonadal development disorders and are associated with a wide phenotypic spectrum. In 46,XY individuals, NR5A1‐related phenotypes may range from disorders of sex development (DSD) to oligo/azoospermia, and in 46,XX individuals, from 46,XX ovotesticular and testicular DSD to primary ovarian insufficiency (POI). The most common 46,XY phenotype is atypical or female external genitalia with clitoromegaly, palpable gonads, and absence of Müllerian derivatives. Notably, an undervirilized external genitalia is frequently seen at birth, while spontaneous virilization may occur later, at puberty. In 46,XX individuals, NR5A1 mutations are a rare genetic cause of POI, manifesting as primary or secondary amenorrhea, infertility, hypoestrogenism, and elevated gonadotropin levels. Mothers and sisters of 46,XY DSD patients carrying heterozygous NR5A1 mutations may develop POI, and therefore require appropriate counseling. Moreover, the recurrent heterozygous p.Arg92Trp NR5A1 mutation is associated with variable degrees of testis development in 46,XX patients. A clear genotype‐phenotype correlation is not seen in patients bearing NR5A1 mutations, suggesting that genetic modifiers, such as pathogenic variants in other testis/ovarian‐determining genes, may contribute to the phenotypic expression. Here, we review the published literature on NR5A1‐related disease, and discuss our findings at a single tertiary center in Brazil, including ten novel NR5A1 mutations identified in 46,XY DSD patients. The ever‐expanding phenotypic range associated with NR5A1 variants in XY and XX individuals confirms its pivotal role in reproductive biology, and should alert clinicians to the possibility of NR5A1 defects in a variety of phenotypes presenting with gonadal

  6. Mercado de trabajo y condiciones de vida en Mendoza a comienzos del siglo XX

    Directory of Open Access Journals (Sweden)

    Juan Manuel Cerdá

    2006-01-01

    Full Text Available El propósito del presente trabajo es analizar los cambios y las continuidades en el proceso de formación del mercado de trabajo en la provincia de Mendoza a comienzos del siglo XX. La incorporación de un número significativo de inmigrantes a finales del siglo XIX junto a un proceso de reorganización productiva asociado al desarrollo de la industria vitivinícola, implicó cambios en las relaciones sociales y en las condiciones de vida de amplios sectores de la población mendocina. Iniciado el siglo XX, la vitivinicultura se convirtió en la principal actividad productiva de la provincia y la más importante en su rubro a nivel nacional. Los viñateros, productores agroindustriales, industriales bodegueros, contratistas de viñas , etc., fueron constituyéndose en parte de una sociedad cada vez más heterogénea y diversa, producto del desarrollo capitalista que experimentó la región desde el último tercio del siglo XIX y que se insertó en el proceso de incorporación de la economía Argentina al mercado mundial. Este período resulta de suma importancia porque se determinó un sistema productivo en torno a la actividad vitivinícola de la provincia que dio forma al mercado de trabajo regional. En este contexto, la inserción de los trabajadores se dio de una manera muy dispar en el proceso productivo, caracterizado por una alta estacionalidad y una escasa especialización de la mano de obra requerida.The aim of this work is to analyze the changes and continuities during the process of formation of the labor market in the province of Mendoza in the early 1900s. Wide sectors of the Mendoza population saw their life conditions and social interactions change as a result of the absorption of a significant amount of immigrants by the end of 19 th century, together with a restructuring of production connected to the development of the wine industry. Shortly after the turn of the century, wine had become the main productive activity of that

  7. IEA ECBCS Annex 42 'FC+GOGEN-SIM'. The simulation of building-integrated fuel cell and other cogeneration systems - Summary; IEA ECBCS Annex 42 'FC+GOGEN-SIM'. The simulation of building-integrated fuel cell and other cogeneration systems - Summary

    Energy Technology Data Exchange (ETDEWEB)

    Dorer, V.

    2008-07-01

    This summary report for the Swiss Federal Office of Energy (SFOE) takes a look at the results of three sub-tasks performed within the framework of an IEA task-annex. The sub-tasks aimed to develop simulation models for fuel-cell appliances and other micro-CHP units and to integrate them into various building simulation programs. The first sub-task covered the compilation of a technology overview as well as household power and hot-water requirements. The second one was devoted to the development of models for micro-CHP units. A third sub-task covered the simulation of various system configurations and evaluated general methods for dealing with energy, emissions and costs. The work done is briefly reviewed and the various institutions involved in the work are noted.

  8. La modernidad sin centro Pintores griegos de la primera mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Miguel Fernández Belmonte

    2011-01-01

    Full Text Available En el campo de la pintura, desde principios del siglo XX hasta la Segunda Guerra Mundial, en un contexto de crisis social, económica y política, se llevó a cabo una intensa experimentación y se conformaron diversas corrientes artísticas que crearon nuevos lenguajes expresivos. En Grecia, país alejado de los grandes centros culturales y los grandes nombres, hubo pintores que tuvieron entonces un papel de suma importancia en la asimilación de las novedades artísticas y en su reinterpretación a través de las propias experiencias y características culturales. Estos pintores secundarios, como Parthenis, Maleas, Theofilos, Kontoglou y Tsarouchis, crearon una obra de gran calidad y tuvieron un papel fundamental en la creación de una identidad griega moderna en el campo artístico.In the field of Painting, from the beggining of the XXth Century to the Second World War, in a context of social, economic and political crisis, there was an intense experimentation and different artistic trends were formed. In Greece, a country that was far away from the big cultural centers and the reknowed names, there were painters who played a very important role regarding the assimilation of the artistic novelties and their reinterpretation through the own experiences and cultural characteristics. These secondary painters, like Parthenis, Maleas, Theofilos, Kontoglou and Tsarouchis, had a work of great quality and had a decisive role in the creation of a modern Greek identity in the artistic field.

  9. Vida cotidiana y laboral en las haciendas de Zinacantepec, siglos xix y xx

    Directory of Open Access Journals (Sweden)

    Hilda Lagunas Ruiz

    2011-01-01

    Full Text Available La finalidad de este artículo es presentar una perspectiva sobre las condiciones generales de vida y relaciones laborales de los trabajadores de las haciendas y ranchos del municipio de Zinacantepec en los siglos XIX y primera mitad del XX. Las haciendas y ranchos se fortalecieron durante el Porfiriato, uno de los planteamientos más aceptados señala que se logró en detrimento de la tierra de los habitantes de los pueblos, mismos que pasaron a formar parte del ejército de trabajo de estas unidades de producción, por lo que en este artículo también se analizarán las relaciones de interdependencia entre los dueños de las haciendas y los habitantes de los pueblos circunvecinos. Se define como trabajador al individuo que se adscribía voluntariamente para trabajar en el recinto de estas unidades productivas, desde españoles pobres, mestizos e indígenas. Los indígenas pertenecían a diversos grupos étnicos, como matlatzincas, otomíes, nahuas. Eran individuos que generalmente carecían de tierra propia. Los trabajadores de las haciendas recibieron diferentes denominaciones que se relacionaban con el cargo o actividad desempeñada. Estos aspectos les daban cierta jerarquía y a la vez dependencia. Existían varias clasificaciones, entre ellas la de los trabajadores permanentes, eventuales o temporales, y arrendatarios.

  10. PHILOSOPHICAL-CULTURAL CONCEPTION OF TELEVISION AS A VISUAL PRACTICES OF XX-XXI CENTURY

    Directory of Open Access Journals (Sweden)

    A. M. Tormakhova

    2016-12-01

    Full Text Available Purpose of the article is to analyze the philosophical and cultural ideas about television, which is a leading visual practice of XX century. It does not lose its relevance in the beginning of the XXI. The role of television lies in visual presentation and formation of the basic norms of taste and traditions of different social groups. Television is the leading communicative practice, which consideration is represented differently in modern science. Research methodology involves an appeal to the philosophical and cultural concepts, representing different approaches to the understanding of television. The paper considers the views of Western scholars, such as R. Arnheim, M. Wolff, A. Kroker, G. Lipovetsky, M. McLuhan, D. Mulvin, J. Mittell, N. Postman, L. Saffhil, J. Sterne, E. Thompson, J. Fiske, S. Shapiro. During analysis of the issue of the specific nature of television content the works of Russian scientists – T. Savitskaya, N. Samutina and Polish contemporary author – R. Sapenko were used. Originality lies in the depiction of the main approaches to the study of television as a visual communicative practice. Deployment of the author's position within the designated issues is presented as a historical digression – from the first attempts at understanding the phenomenon of television to the newest scientific theories that have found expression in contemporary American philosophical and cultural thought. Results of the study can be used in the training course "Visual communication and practices." Conclusions indicated that the majority of contemporary visual practices based on certain patterns, embedded TV. Despite the emergence of new media practices, TV does not lose relevance, everywhere present in the culture, which means that his research will allow a better understanding of the specificity of cultural creativity process.

  11. NOTAS PARA UNA HISTORIA DE LAS RELACIONES VECINALES DE CHILE EN EL SIGLO XX

    Directory of Open Access Journals (Sweden)

    Eduardo Araya Leüpin

    2017-04-01

    Full Text Available En una retrospectiva histórica sobre las relaciones de Chile con sus países vecinos a lo largo del siglo XX hay algunas tendencias que resaltan y que pese a los cambios en el sistema internacional han tendido a permanecer a lo largo del tiempo, adquiriendo por tanto rasgos de “larga duración” o aquello que la Escuela Francesa de Historia de las Relaciones Internacionales denominó corrientesprofundas. Lo primero es que en la construcción mutua de nuestras identidades, estas se han basado durante períodos prolongados en la imagen del otro como un vecino amenazante, con lo cual las relaciones bilaterales tienden a ser percibidas como un juego en donde alguien pierde a costa de las ganancias del otro. Lo segundo es que la relación con nuestros vecinos, incluso con aquellos como en el caso de Argentina han tenido una mejoría significativa al menos desde la década de los 90s con la recuperación de la democracia en ambos países, ha mantenido cursos zigzagueantes entre la cooperación y el conflicto. Lo tercero es un notorio contraste entre la tendencia a la continuidad en la política exterior de Chile en relación a los temas vecinales, independiente del tipo de gobierno que exista, esta continuidad se ha explicado como política de estado, sin embargo, por sus características, esta difícilmente cumple con los estándares de una efectiva política de estado. De manera contrastante, las fluctuaciones en las políticas exteriores de nuestros vecinos han dependido del alto grado de personalismo en las decisiones, la menor institucionalización de la política interna y/o de las fluctuaciones en la popularidad de los gobernantes.

  12. La política internacional migratoria colombiana a principios del siglo XX

    Directory of Open Access Journals (Sweden)

    María Angélica Gómez

    2009-06-01

    Full Text Available This paper studies the first Japanese immigrants in Colombia. 1922-1936. This research is a compilation of legal resolutions dictated in the 1886 Colombia’s Republic Constitution towards immigration. Particularly, this research points out debates around the improvement of the race project through promoting alien immigration in the late 19th and early 20th centuries. To come up with such a compilation, reviewing primary official sources (laws and decrees, discourses and related literature was fundamental. The analysis of the research shows that there is a correlation between diverse laws that allowed or restricted aliens to enter the country. In addition the debates taking place in different groups of the local society around the benefits and disadvantages of letting immigrants enter the country.//Este artículo estudia la primera ola de inmigrantes japoneses hacia Colombia (1922-1936. Es una recopilación de las disposiciones legales formuladas desde la Constitución de la República de Colombia de 1886 frente a la inmigración en general y de los debates que se generaron con respecto al proyecto de mejorar la raza por medio de extranjeros a finales del siglo XIX y principios del siglo XX. Se utilizaron fuentes primarias oficiales (leyes y decretos, discursos y bibliografía referente al tema. Se encuentra una correlación entre la promulgación de leyes que restringieron o no la entrada de extranjeros. En algunos sectores de la sociedad se daban debates por los beneficios o desventajas de permitir el ingreso de inmigrantes en el país.

  13. CONVERGENCIA DIGITAL EN LA UNIVERSIDAD COLOMBIANA. DEL SIGLO XX AL XXI

    Directory of Open Access Journals (Sweden)

    Diana Elvira Soto Arango

    2012-01-01

    Full Text Available La investigación presenta los orígenes de la convergencia digital desde la tecnología educativa, con la educación programada, la evolución, tendencias teóricas y la prospectiva en el contexto universitario colombiano. El período de estudio se enmarca desde el siglo XX, con la tecnología educativa hasta la prospectiva en el siglo XXI, con el reto de integrar las innovaciones tecnológicas, para optimizar la calidad en las funciones misionales, la competitividad, el reconocimiento y la cobertura estudiantil en el nivel universitario. Por tanto, analizamos algunas experiencias de influencia de la unificación de medios y la forma como se pueden beneficiar las instituciones universitarias dentro del contexto de la legislación colombiana. El método se sustentó en la historia social de la educación con la metodología de la educación comparada. Las estrategias se soportaron en fuentes documentales de legislación, informes y la bibliografía acompañada de proyectos en desarrollo. Se concluye cómo la convergencia digital permite la fusión de las dependencias en Tecnologías de la Información y la Comunicación (TIC de las universidades, para producir contenidos y servicios académicos, cambios en los hábitos de consumo de información por parte de los sujetos sociales y generar actitudes colaborativas y de aprendizaje autónomo, que permiten aportar a los procesos de enseñanza y aprendizaje y a la construcción de conocimiento desde cualquier momento y lugar.

  14. Male genitoplasty for 46 XX congenital adrenal hyperplasia patients presenting late and reared as males

    Science.gov (United States)

    Sharma, Shilpa; Gupta, Devendra K.

    2012-01-01

    Aim: To evaluate the clinical profile and management of 46 XX Congenital Adrenal Hyperplasia (CAH) patients presenting with severe virilization and assigned a male gender. Materials and Methods: Of 173 children diagnosed with CAH at the Pediatric Intersex Clinic since 1980, seven children with CAH presented late with severe virilization and were reared as males. All of them were assigned the male sex with removal of the female adnexa. Six were treated with male genitoplasty. Appropriate hormonal supplementation was offered after puberty. Results: The mean age at presentation was 14.2 years (7 – 21). Six patients had presented after puberty, only one at seven years of age. Staged male genitoplasty comprising of chordee correction, male urethroplasty, and bilateral testicular prosthesis was performed. The female adnexa (uterus, ovaries, most of the upper vagina, and the fallopian tubes) were removed. The mental makeup was masculine in six and bigender in one. Bilateral mastectomy was performed at puberty in all. Hormonal treatment comprised of glucocorticoids and testosterone. Six patients were comfortable with the outcome of the masculinizing genitoplasty. One had a short-sized phallus. One had repeated attacks of urinary tract infection arising from the retained lower vaginal pouch. Social adjustments were good in all, except in one who had a bigender mental makeup. Conclusion: CAH patients with severe virilization presenting late and reared as males are extremely rare. However, the assigned gender can be retained adequately as males, meeting the socioeconomic compulsions of the society. The results are satisfactory following appropriate surgical procedures and hormonal supplementation. PMID:23226638

  15. Male genitoplasty for 46 XX congenital adrenal hyperplasia patients presenting late and reared as males

    Directory of Open Access Journals (Sweden)

    Shilpa Sharma

    2012-01-01

    Full Text Available Aim: To evaluate the clinical profile and management of 46 XX Congenital Adrenal Hyperplasia (CAH patients presenting with severe virilization and assigned a male gender. Materials and Methods: Of 173 children diagnosed with CAH at the Pediatric Intersex Clinic since 1980, seven children with CAH presented late with severe virilization and were reared as males. All of them were assigned the male sex with removal of the female adnexa. Six were treated with male genitoplasty. Appropriate hormonal supplementation was offered after puberty. Results: The mean age at presentation was 14.2 years (7 - 21. Six patients had presented after puberty, only one at seven years of age. Staged male genitoplasty comprising of chordee correction, male urethroplasty, and bilateral testicular prosthesis was performed. The female adnexa (uterus, ovaries, most of the upper vagina, and the fallopian tubes were removed. The mental makeup was masculine in six and bigender in one. Bilateral mastectomy was performed at puberty in all. Hormonal treatment comprised of glucocorticoids and testosterone. Six patients were comfortable with the outcome of the masculinizing genitoplasty. One had a short-sized phallus. One had repeated attacks of urinary tract infection arising from the retained lower vaginal pouch. Social adjustments were good in all, except in one who had a bigender mental makeup. Conclusion: CAH patients with severe virilization presenting late and reared as males are extremely rare. However, the assigned gender can be retained adequately as males, meeting the socioeconomic compulsions of the society. The results are satisfactory following appropriate surgical procedures and hormonal supplementation.

  16. Torino 2006. XX Olympic and IX Paralympic Winter Games: the ENT experience

    Science.gov (United States)

    Succo, G; Crosetti, E; Mattiazzo, A; Riontino, E; Massazza, G

    2008-01-01

    Summary A total of 27 competition days, more than 3000 athletes, over 10,000 components of the Olympic family, 3,500 workers, 2,500 volunteers, an overall business of more than 2 billion Euros. These, in a nutshell, are just a few of the data concerning the XX Olympic and the IX Paralympic Winter Games, Torino, Italy, 2006. Such a huge event, obviously required a meticulously organized medical service to cope with the healthcare of the athletes, official workers and the Olympic family, distributed over a geographic area of approximately 80 km in diameter. An ENT service was organized within the medical service, which was divided between 3 Polyclinics, in which 12 ENT Specialists were on duty. The present report gives an account of the final data concerning the service involved, together with a description of the approach used in the actual organization, with a view to providing useful information for colleagues who will be called upon, for a similar service, in future Olympic Winter Games. The ENT healthcare offered was confirmed to be proportional to the requirements, both from a qualitative and quantitative point of view. All the ENT specialists involved, reported having gained an immense store of human experience from having lived the Olympic atmosphere as a volunteer exerting one’s own profession. The facilities available in the Polyclinics, which were at a considerable distance from the Hospital, were found to be more than adequate with respect to the pathological conditions and service requested, particularly in 17% of the cases which would otherwise have been sent to a Hospital Outpatient Unit at least 80 km away. PMID:18646571

  17. La política social del siglo XX en México

    Directory of Open Access Journals (Sweden)

    Martha Elisa Nateras González

    2007-01-01

    Full Text Available Dentro del marco de actuación estatal, en el ámbito mundial, las políticas sociales han pasado durante el siglo xx por dos periodos. El primero, después de la Segunda Guerra Mundial, que prácticamente marcó el inicio del llamado Estado de bienestar, el cual se caracterizó principalmente, por su intervención en la actividad económica y por construir una red institucional para garantizar el cuasipleno empleo, permitir el acceso universal a la educación básica y la seguridad social, y por otorgar a un amplio sector de la población ciertas garantías sociales y un nivel mínimo de bienestar. El segundo inicia en la década de los ochenta, periodo en que se establecieron las primeras políticas de ajuste y de “retiro” del Estado de la economía —la instauración de las llamadas políticas neoliberales—, lo cual generó un cambio en la defi nición de la política social. Los criterios cambiaron, pues no interesó ya tanto la universalización de algunos benefi cios, sino la selección de la población considerada como pobre, a la cual dirigieron los esfuerzos de las políticas sociales.

  18. Climate Change of Franz Josef Land in the XX-XXI Centuries

    Science.gov (United States)

    Shilovtseva, Olga; Romanenko, Fedor

    2016-04-01

    The results of climatic observations on the most northern land of Eurasia - Franz Josef Land, that was discovered in 1874, are presented. The gaps in the observations of the observatory named after Ernst Krenkel (Hayes's Island) were supplemented by calculations using reanalysis ERA Interim. It was received the positive trend in surface air temperature during 1958-2013. It is mainly achieved by increasing of the air temperature in winter but the summer trend is not statistically significant. Data of observation and reanalysis are perfectly correlated in cold period when underlying surface is uniform (correlation coefficient of more than 0.95). In summer, the correlation coefficients between the calculated and the real data are significantly lower (up to 0.68). This fact may be a consequence of the small values of the mean air temperatures of summer months (for example, during the July they varied in the interval -1-+2 degrees C.). Furthermore, it may be caused by the difficulty of model reproduction of the real state of the underlying surface, where land, ice, snow and water are chaotically combined. The analysis of circulation types by B.L. Dzerdzeevsky has shown that in the mid-XX Century, the northern meridional and western zonal types of circulation were replaced by southern meridional one, which prevailed during the first decade of the XXI too. This causes a reduction of the ice cover period, which resulted in a strengthening of the beach erosion and of slope processes. But short-term flows of warm air from the south, causing a catastrophic melting of glaciers, were also repeatedly marked in the past. This work is supported by the Russian Science Foundation (project № 14-37-00038) and by the national park "Russian Arctic".

  19. El triunfo de la democracia a finales del siglo XX: ¿fin de la Historia?

    Directory of Open Access Journals (Sweden)

    David Hidalgo Rodríguez

    2007-09-01

    Full Text Available El artículo que se ofrece a continuación pretende reflexionar acerca de los procesos de democratización de finales del siglo XX (la tercera ola, e introducir una nueva perspectiva que revise este fenómeno histórico partiendo de la comprensión particular de cada caso a través de la línea de investigación abierta por la historia del tiempo presente. Las ventajas que se derivan de utilizar la óptica propuesta son de dos tipos. Desde el plano teórico el campo temático en cuestión representa un periodo repleto de elementos e incógnitas que dan forma a la historia contemporánea de un grueso generacional importante y, por lo tanto, el análisis de los mismos resulta imprescindible para comprender su realidad contemporánea. En cuanto a la vertiente metodológica disponemos, además de las pautas interpretativas procedentes de otras ciencias (politología, sociología, etc., del testimonio oral de actores implicados directa o indirectamente y, por supuesto, de todo el enorme caudal informativo generado por estos en diversas plataformas: prensa, cine, radio, televisión, cartelística, etc. El objeti- vo central es aspirar a entender la democratización desde el punto de vista de sus pro- tagonistas dentro de contextos muy variados para señalar las claves del que pudo ser el último gran cambio que sienta las bases materiales e ideológicas del mundo actual. Palabras clave: Democratización, Historia del tiempo presente, Cambio político. 

  20. Teorías y modelos en la salud pública del siglo XX.

    Directory of Open Access Journals (Sweden)

    Gustavo Alonso Cabrera

    2009-11-01

    Full Text Available Objetivo: Se presenta una selección de teorías y modelos usados en el desarrollo e historia de la salud pública global. Materiales y métodos: Se revisó bibliografía física y material de referencia electrónica para identificar y rastrear propuestas teóricas o modelos aplicados a lo largo del siglo XX para fundamentar la investigación e intervenciones orientadas a prevenir enfermedades y a promocionar la salud del público en el mundo. Las propuestas se identificaron según nombre genérico, autor, año de reseña y objeto o campo principal de interés. Resultados: Se identificaron 52 teorías así como 60 modelos según la denominación genérica con la que históricamente se reconocen en la literatura; se presentan los más relevantes por sus aportes al desarrollo del campo y uso diseminado en diversas áreas temáticas y problemáticas. Conclusiones: La mayoría de las propuestas teóricas reseñadas se derivan en algún grado en sólidas explicaciones conceptuales precedentes y de sus correspondientes validaciones hipotéticas. Se observó la frecuente derivación de modelos, sobre todo en la segunda mitad del siglo, a partir de teorías ya consolidadas y reconocidas como tal, así como del registro sistemático y discusión de la realidad por estudios e intervenciones de los autores originales de las propuestas.

  1. Protocol for the building construction process. Results of the implementation trajectory protocols EWN and EUN. Annexes; Opnameprotocol versterkt bouwkolom. Resultaten implementatietraject opnameprotocollen EWN en EUN. Bijlagen

    Energy Technology Data Exchange (ETDEWEB)

    Neeleman, J.; Uitbeijerse, G.C.M. [DWA installatie- en energieadvies, Duitslandweg 4, Postbus 274, 2410 AG Bodegraven (Netherlands)

    2013-04-15

    In the year 2012 it was foreseen to base the energy label for new buildings on the Energy Efficiency Coefficient (EPC in Dutch). This is a protocol for residential and utility buildings, with the aim to check whether and to what extent buildings were constructed according the EPC and to determine the realized EPC. In order to gain experience with the new protocols and the voluntary ventilation test the Protocol for the Energy Label for New Houses (EWN in Dutch) and the Protocol for the Energy Label for New Utility Buildings (EUN in Dutch) were conducted in 12 newly built housing projects and 5 projects in the utility building sector. This report presents the annexes [Dutch] In het jaar 2012 was voorzien om het nieuwbouwlabel te baseren op de EPC (Energie Prestatie Coefficient). Hiervoor is een opnameprotocol opgesteld voor de woningbouw en de utiliteitsbouw, met als doel te controleren of en in hoeverre conform de EPC is gebouwd en om de gerealiseerde EPC te bepalen. Om ervaring op te doen met de nieuwe opnameprotocollen en de vrijwillige ventilatietoets werden het Opnameprotocol Energielabel Woningen Nieuwbouw (EWN) en Opnameprotocol Energielabel Utiliteitsgebouwen Nieuwbouw (EUN) uitgevoerd bij 12 nieuwbouwprojecten in de woningbouw en 5 projecten in de utiliteitsbouw. In dit rapport worden de bijlagen weergegeven.

  2. EXploring non road TRansport EMISsions in Europe. Development of a Reference System on Emissions Factors for Rail, Maritime and Air Transport. Annex to Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Chiffi, C.; Fiorello, D. [Trasporti e Territorio TRT, Milan (Italy); Schrooten, L.; De Vlieger, I. [Flemish Institute for Technological Research VITO, Mol (Belgium)

    2008-06-15

    EX-TREMIS brings together the most comprehensive and up-to-date information on non-road transport vehicle emission factors and activity statistics, which together make it possible to estimate the energy consumption and emissions resulting from different transport operations. The database covers four main data types: fleet data, transport activity data, emission and energy consumption factors, total energy consumption and emissions data, where total emissions and emission factors are calculated for CO2, NOX, SOX, CO, VOC, CH4, NMVOC and PM. All the related datasets are made available on the project website www.ex-tremis.eu. The report illustrates the final resulting datasets and presents the development of some selected transport activity units and pollutant emissions. On a separate annex, the methodologies related to the three domains are described in detail together with the references to the relevant sources used and the activities for homogenising data from different sources and filling gaps to cover the whole set of information required.

  3. Ground subsidence Wadden Sea 1977-2011. Precision and reliability of measurements. Annex; Bodemdaling Waddenzee 1977-2011. Precisie en betrouwbaarheid uit metingen. Appendix

    Energy Technology Data Exchange (ETDEWEB)

    Houtenbos, A.P.E.M.

    2011-12-15

    What about the subsidence caused by gas exploitation around the Wadden Sea? Is subsidence on the Wadden Sea really manageable by extraction with the 'hand on the faucet'? These and other questions are examined in an analysis of the measurements around the Wadden Sea in the period 1977-2011. After publication of the main report on the effects of ground subsidence at the island Ameland-Oost two more aspects were investigated: sedimentation and the speed of ground subsidence. This annex reports on those aspects [Dutch] Hoe staat het met de bodemdaling door gaswinning rond de Waddenzee? Is bodemdaling op de Waddenzee werkelijk beheersbaar door winning met de 'Hand aan de kraan'? Deze en andere vragen zijn onderzocht in een analyse van de metingen rond de Waddenzee tot over de periode 1977-2011. Na publicatie van het hoofdrapport over de effecten van bodemdaling op Ameland-Oost op 9 dec 2011 zijn nog twee aspecten met consequenties voor de bodemdaling op het Wad nader onderzocht: sedimentatie en bodemdalingsnelheid. Deze appendix geeft de resultaten weer.

  4. Leadership Revised: How Did the Ukraine Crisis and the Annexation of Crimea Affirm Germany’s Leading Role in EU Foreign Policy?

    Directory of Open Access Journals (Sweden)

    Koeth Wolfgang

    2016-12-01

    Full Text Available The recent string of existential crises in Europe - the Euro crisis, Russia’s aggression in Ukraine and the refugee crisis of 2015 - have resulted in new dynamics within the European Union. In Brussels, Germany has emerged as the hardly contested nexus of decision making. It was in particular through the Ukraine crisis and the annexation of Crimea by Russia in 2014 that Germany found itself assuming a leadership role also in the EU’s foreign policy, a role it has shunned in the past. However, for Berlin this new role is far from obvious - it is only gradually that Germany grew comfortable with its enhanced role, which is due more to external circumstances than by its own design. Conscious of its own image abroad and, due to the still prevalent feeling of historical guilt, the fear of being perceived as a dominating power has so far prevented Germany from occupying the forefront of the stage, preferring to pulling strings from behind and presenting itself as the EU’s “Chief Facilitation Officer”. This article analyses how Germany, in particular through the Ukraine crisis starting in 2014, affirmed itself - albeit reluctantly - as a nexus of decision making in the EU’s Common Foreign and Security Policy (CFSP and became the de facto leading nation for defining the EU’s response towards Russia. The article points out the internal and external consequences of this new role and, in particular, its impact on the Baltic States.

  5. The treatment of land use, land use change and forestry in the post-2012 climate agreement: a perspective from non-Annex I Parties

    Directory of Open Access Journals (Sweden)

    Federici S

    2010-05-01

    Full Text Available Given the greater vulnerability of developing countries to climate change, their paramount interest is to establish effective mitigation policies including the land use and forestry sectors as part of the post-2012 Climate Agreement. In this context, an accounting system for land use, land use change and forestry acceptable to non-Annex I Parties can arise only if critical elements in current accounting rules are removed and a solution to data uncertainties is found. Indeed, current accounting rules oppose the fundamental principles outlined in the both Convention on climate change and in the Kyoto protocol. They require accounting of only a portion of land-use activities and exclude forest management, give special provisions to exclude some net emissions from accounting, do not require the use of a reference level in quantifying net emissions and risk remunerating business as usual mitigation actions. Encouragingly, the current negotiation text contains options which, if adopted, would define an accounting system capable of responding to developing countries’ expectations. These options include the establishment of a national reference level suited to country-specific circumstances and other measures to ensure that only truly additional mitigation actions are remunerated and that all anthropogenic net emissions on managed lands are included. Finally, the opportunity of applying the principle of conservativeness in the future accounting routine is discussed, as a straightforward and effective instrument to correct uncertain estimates and therefore to reduce the risks of assigning an incorrect amount of credits and debits in this complex sector.

  6. The role of the sex-determining region Y gene in the etiology of 46,XX maleness

    Energy Technology Data Exchange (ETDEWEB)

    Fechner, P.Y.; Marcantonio, S.M.; Jaswaney, V.; Stetten, G.; Migeon, C.J.; Smith, K.D.; Berkovitz, G.D. (Johns Hopkins Univ., Baltimore, MD (United States)); Goodfellow, P.N. (Imperial Cancer Research Fund, London (United Kingdom)); Amrhein, J.A. (Forbes Regional Health Center, Monroeville, PA (United States)); Bard, P.A. (Kaiser Permanente, Sacramento, CA (United States)); Lee, P.A. (Univ. of Pittsburgh, PA (United States)); Reid, C. (Robert Wood Johnson Medical School, Camden, NJ (United States)); Tsalikian, E. (Univ. of Iowa, Iowa City (United States)); Urban, M.D. (Wright State Univ., Dayton, OH (United States))

    1993-03-01

    The condition of 46,XX maleness is characterized by testicular development in subjects who have two X chromosomes but who lack a normal Y chromosome. Several etiologies have been proposed to explain 46,XX maleness: (1) translocation of the testis-determining factor from the Y to the X chromosome, (2) mutation in an autosomal or X chromosome gene which permits testicular determination in the absence of TDF, and (3) undetected mosaicism with a Y-bearing cell line. The authors evaluated 10 affected subjects who were ascertained for different reasons and who had several distinct phenotypes. Six subjects had inherited sequences from the short arm of the Y chromosome including the sex-determining region Y gene (SRY). Five of the subjects were pubertal at the time of evaluation and had a phenotype similar to that of Klinefelter syndrome with evidence of Sertoli cell and Leydig cell dysfunction. One subject had evidence from Southern blot analysis and in situ hybridization for the presence of an intact Y chromosome in approximately 1% of cells. Three subjects lacked Y sequences by Southern blot analysis and by polymerase chain reaction amplification of SRY. These subjects were ascertained in the newborn period because of congenital anomalies. One had multiple anomalies including cardiac abnormalities; one had cardiac anomalies alone; and one had ambiguous genitalia. The data confirm the genetic heterogeneity of 46,XX maleness, in which some subjects have SRY while other subjects lack it. In addition, there is phenotypic heterogeneity among subjects who lack SRY suggesting that there is also genetic heterogeneity within this subgroup. 43 refs., 3 figs., 4 tabs.

  7. Municipalismo em Portugal: dinâmicas locais e oferta educativa (séculos XVIII-XX)

    OpenAIRE

    2014-01-01

    O Encontro Nacional “Municipalismo em Portugal: dinâmicas locais e oferta educativa e cultural (séculos XVIII-XX). Centenário da Reforma Republicana da Administração local”, realizado em 20 de Dezembro de 2013, foi assumido por membros da equipa do projecto Atlas-Repertório. Este Encontro destinou-se a proporcionar ao conjunto de investigadores, que está directamente envolvido no trabalho de campo, oportunidade para apresentar publicamente resultados da própria investigação. O Encontro inclui...

  8. Peasant Self-Government in the Ukrainian Danube Region (End of XIX - Early XX Century.: Social and Cultural Aspects

    Directory of Open Access Journals (Sweden)

    Irina Verkhovtseva

    2013-08-01

    Full Text Available The complex historical destiny of Ukrainian Danube region in the nineteenth century led to the fact that by the end of this century, in the counties of the region peasant self-government was organized in different ways: in Akkerman - according to the reform in 1868, carried out by the Russian authorities in Bessarabia, and in Ismail - in accordance with the reforms of 1864-1874 years conducted by the Romanian government. The author compares and analyzes the peasant self-government in the counties of the province in the context of its sociocultural development in the unfolding process of modernization of the late XIX - early XX centuries.

  9. Atar a la sociedad: adolescencia, riesgo y población en la primera mitad del siglo XX

    OpenAIRE

    Ariza Montañez, Vladimir Alejandro

    2012-01-01

    En el marco de las reformas a la educación normalista y secundaria del país por los años 30 y 50 del siglo XX, orientadas por la apropiación de pedagogías activas y los saberes modernos que las sustentaron –psicología, psicoanálisis, biología, fisiología, higiene, medicina, criminología, saberes sociales- surgieron una serie de discursos sobre la adolescencia. La presente investigación busca dar cuenta de la apropiación de dicho concepto-objeto. Definida como una etapa transitoria, sexuada y ...

  10. Autoimmune myelofibrosis accompanied by Sjögren's syndrome in a 47, XXX/46, XX mosaic woman.

    Science.gov (United States)

    Takahashi, Tohru

    2014-01-01

    This report describes a patient with autoimmune myelofibrosis accompanied by Sjögren's syndrome (SS). A 36-year-old woman was admitted due to petechiae, purpura, gingival bleeding, dyspnea on exertion, and a lack of concentration. She had pancytopenia and was diagnosed with SS. A bone marrow study showed hypercellular marrow with reticulin fibrosis. Lymphocytic infiltrates and aggregates composed of a mixture of T and B cells in the marrow were also observed. A chromosomal analysis of the marrow cells showed 47, XXX and an analysis of peripheral lymphocytes revealed 47, XXX/46, XX mosaic results. The patient's cytopenia resolved following treatment with oral prednisolone.

  11. Lizardo Seiner Lizarrága. Estudios de Historia Medioambiental. Perú, siglos XVI-XX

    OpenAIRE

    2014-01-01

    El libro de Lizardo Seiner Lizárraga, Estudios de historia medioambiental. Perú, siglos XVI-XX explora una temática que hasta hace poco era solo marginalmente tratada dentro de la perspectiva histórica. Indagar sobre la historia del medio ambiente en la larga duración es, por lo tanto, un mérito incuestionable del trabajo realizado por Seiner. El libro en cuestión abre con un ensayo sobre el tema de los desastres naturales y su impacto sobre el medio ambiente. Así, haciendo uso de fuentes pri...

  12. O advento das incubadoras e os cuidados de enfermagem aos prematuros na primeira metade do século XX

    OpenAIRE

    Isabel Cristina dos Oliveira Santos

    2004-01-01

    El estudio de abordaje histórica que tuve como objetivos describir los diferentes tipos de incubadoras existentes hasta la primera mitad del siglo XX y relacionar los cuidados de enfermería a los prematuros en cuanto al uso de las incubadoras. Las fuentes primarias son dos artículos existentes en la Biblioteca Nacional y tres artículos de la Revista Brasileña de Enfermería de las décadas del 40 y del 50; y las fuentes secundarias son libros y artículos de periódicos nacionais e in...

  13. MUJERES MALAS. LA REPRESENTACIÓN DEL DELITO FEMENINO EN LA PRENSA DE PRINCIPIOS DEL SIGLO XX

    Directory of Open Access Journals (Sweden)

    CARLA RIVERA ARAVENA

    2011-10-01

    Full Text Available La investigadora analiza la construcción de un imaginario específico acerca de los sujetos femeninos delictivos a principios del siglo XX, desde un soporte eminentemente moderno: la prensa. Su trabajo intenta desentrañar los mecanismos que se encuentran en el «poder del discurso periodístico» para conservar el statu quo, controlando a quienes se escapan de la norma a través de la creación de imágenes que marcan y resignifican a las sujetos sociales que rompen con el orden imperante.

  14. Ullrich-Turner phenotype with unusual manifestation in a patient with mosaicism 45,X/47,XX,+18

    Energy Technology Data Exchange (ETDEWEB)

    Franceschini, P.; Guala, A.; Camerano, P.; Franceschini, D.; Vardeu, M.P.; Signorile, F. [Universita di Torino (Italy)

    1996-03-01

    We report on a girl with Ullrich-Turner phenotype and 45,X/47,XX,+18 chromosomal mosaicism. Only two other patients with similar mosaicism have been reported, both girls with XY sex chromosome constitution. The face of the patient was highly asymmetric, the right side being almost normal, the left showing a typical Ullrich-Turner syndrome appearance. This clinical impression was strengthened by photographic doubling of both hemifaces. The patient had normal intelligence and did not show any stigmata of trisomy 18. 13 refs., 2 figs., 1 tab.

  15. Atar a la sociedad: adolescencia, riesgo y población en la primera mitad del siglo XX

    OpenAIRE

    Ariza Montañez, Vladimir Alejandro

    2012-01-01

    En el marco de las reformas a la educación normalista y secundaria del país por los años 30 y 50 del siglo XX, orientadas por la apropiación de pedagogías activas y los saberes modernos que las sustentaron –psicología, psicoanálisis, biología, fisiología, higiene, medicina, criminología, saberes sociales- surgieron una serie de discursos sobre la adolescencia. La presente investigación busca dar cuenta de la apropiación de dicho concepto-objeto. Definida como una etapa transitoria, sexuada y ...

  16. O advento das incubadoras e os cuidados de enfermagem aos prematuros na primeira metade do século XX

    OpenAIRE

    Isabel Cristina dos Oliveira Santos

    2004-01-01

    El estudio de abordaje histórica que tuve como objetivos describir los diferentes tipos de incubadoras existentes hasta la primera mitad del siglo XX y relacionar los cuidados de enfermería a los prematuros en cuanto al uso de las incubadoras. Las fuentes primarias son dos artículos existentes en la Biblioteca Nacional y tres artículos de la Revista Brasileña de Enfermería de las décadas del 40 y del 50; y las fuentes secundarias son libros y artículos de periódicos nacionais e in...

  17. O pensamento estratégico no século XX : explicações históricas

    OpenAIRE

    Conke, Leonardo Silveira

    2013-01-01

    Considerando a relação entre as organizações e seu ambiente admite-se, neste ensaio, que o estudo do contexto histórico auxilia no entendimento dos motivos pelos quais elas realizam determinadas escolhas. Assim, tem-se como objetivo situar historicamente as principais teorias e ferramentas estratégicas desenvolvidas a partir do século XX, descrevendo como os fatos da história geral (relacionados à economia, cultura, política, tecnologia etc.) influenciaram no seu surgimento, na sua aceitação,...

  18. The Schrödinger System H=-12(tot)a∂xx+12ω2(tto)bX2

    Science.gov (United States)

    Nieto, Michael Martin; Truax, D. Rodney

    2001-08-01

    We attack the specific time-dependent Hamiltonian problem H=-12(tot)a∂xx+12ω2(tto)bx2. This corresponds to a time-dependent mass (TM) Schrödinger equation. We give the specific transformations to a different time-dependent quadratic Schrödinger equation (TQ) and to a different time-dependent oscillator (TO) equation. For each Schrödinger system, we give the Lie algebra of space-time symmetries, the number states, the squeezed-state and (with their classical motion), (Δx)2, (Δp)2, and the uncertainty product.

  19. The Metaphorical Applications of Heavenly Bodies and Phenomena in Western Armenian Poetry at the Beginning of the XX Century

    Science.gov (United States)

    Arakelyan, Karine

    2015-07-01

    The metaphorical applications of heavenly bodies and phenomena in Western Armenian poetry at the beginning of the XX century are very diverse and of great variety. Art Workers eulogize the creation of God, admire the beauty of stars, and perceive the man as a part of nature and in the close connection with all other parts. These units are often used for bringing to light one's inner life, his old gone paths, expectations and hopes, many times they become the heart and the basis of poetical image and create unique beauty.

  20. [THE SOCIAL HYGIENE AS A PHENOMENON OF SCIENTIFIC REVOLUTION IN MEDICINE OF LATE XIX--FIRST HALF XX CENTURIES].

    Science.gov (United States)

    Schepin, V O; Zatravkin, S N

    2015-01-01

    The article presents results of analysis of works of late XIX--first quarter of XY centuries devoted to problems of social hygiene. It is established that origin of social hygiene was directly related to crucial revision of conceptions of causes and essence of diseases that created necessary conditions for transfer into medicine ideas and methods of political economy, sociology and eugenics. It is proved that origin of social hygiene was appropriate consequence of those crucial alterations in mass physician's consciousness that characterize scientific revolution in medicine of late XIX--first half XX centuries.

  1. Colonización en armas y narcotráfico. La violencia en Colombia durante el siglo XX

    Directory of Open Access Journals (Sweden)

    Carlos Mario Perea

    2009-01-01

    Full Text Available El artículo mira la historia de la violencia y el conflicto armado en Colombia durante el siglo XX a través de tres grandes problemas: primero, los cuatro episodios violentos; segundo, las características de dichos episodios en relación con Latinoamérica; y tercero, las fragmentaciones tras de las cuales se explica la recurrencia de la guerra y la violencia. El artículo hace una mirada particular desde la cultura política.

  2. La romería en el templo y otras licencias del canto gregoriano en el siglo XX

    OpenAIRE

    Ángel Medina

    2009-01-01

    El objetivo del presente artículo es el de presentar algunas prácticas singulares de la música litúrgica, habituales en España durante los primeros dos tercios del siglo XX, es decir, entre el motu proprio sobre la música sagrada del papa Pío X y los cambios litúrgicos derivados del Concilio vaticano II. Estas licencias tienen lugar básicamente coincidiendo con dos tipos de situaciones contrapuestas: por un lado cuando triunfa la alegría de determinadas fiestas (el Corpus, las celebraciones p...

  3. Gestos, mapas y colores del silencio : estudio comparativo en literatura, arte y pensamiento, siglos XII-XX

    OpenAIRE

    Labraña Cortés, Marcela Andrea

    2014-01-01

    Esta tesis propone un estudio comparado de la poética del silencio desde el siglo XII al XX en una serie de obras en las que se relacionan imagen y texto, ordenadas en tres series: gestos, mapas y colores. La primera considera la representación de la inefabilidad del lenguaje divino en Hildegard von Bingen, y las variaciones del gesto harpocrático en la emblemática barroca. La segunda reúne las descripciones excesivas de Georges Perec y Jorge Luis Borges con los saturados mapas portulanos del...

  4. First order quantum phase transitions of the XX spin-1/2 chain in a uniform transverse field

    Energy Technology Data Exchange (ETDEWEB)

    Pan Feng [Department of Physics, Liaoning Normal University, Dalian 116029 (China) and Department of Physics and Astronomy, Louisiana State University, Baton Rouge, LA 70803-4001 (United States)]. E-mail: daipan@dlut.edu.cn; Ma Nan [Department of Physics, Liaoning Normal University, Dalian 116029 (China); Guan Xin [Department of Physics, Liaoning Normal University, Dalian 116029 (China); Draayer, J.P. [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, LA 70803-4001 (United States)

    2007-08-06

    Quantum phase transitional behavior of a finite periodic XX spin-12 chain with nearest neighbor interaction in a uniform transverse field is studied based on the simple exact solutions. It is found that there are [N/2] level-crossing points in the ground state, where N is the periodic number of the system and [x] stands for the integer part of x, when the interaction strength and magnitude of the magnetic field satisfy certain conditions. The quantum phase transitional behavior in the thermodynamic is also studied.

  5. Physical education curriculums in the educational institutions of Zakarpattia in the 20-30 years of the XX century

    Directory of Open Access Journals (Sweden)

    Trifan A.

    2010-01-01

    Full Text Available The questions of history of introduction of the programs are analysed on a physical culture in educational establishments of Zakarpattia in 20-30 years of XX age. From 1924 on Zakarpattia the school programs on physical education were used only in incomplete middle schools and gymnasia. Basis of on-line tutorials and plans of that time was made by the elements of physical exercises, developed the Czech specialists. Directions of taking approach are rotined to school program development in modern education. A decision of the expounded problems in planning is necessary pre-condition of successful and effective educational process.

  6. Aspectos de la cultura política del carlismo en el siglo XX

    Directory of Open Access Journals (Sweden)

    Josep Miralles Climent

    2005-01-01

    Full Text Available A través de unas cuantas pinceladas de tíectios y acontecimientos que se han dado en el movimiento carlista durante el siglo XX, he intentado plasmar el desarrollo o evolución de su cultura política. He partido de la base de que el carlismo es un movimiento más complejo de analizar de lo que a simple vista parece; que su evolución no ha sido lineal, y que no se puede hablar de uno, sino de varios carlismos. En este trabajo me he centrado en los acontecimientos que ha venido reivindicando el sector más progresista del mismo, y que de alguna manera son la justificación de su evolución hacia la izquierda, pero sin desdeñar otros aspectos que estarían más próximos al sector tradicionalista. He focalizado la evolución político-cultural del carlismo en los siguientes aspectos: la religiosidad; la sociabilidad en los Círculos Culturales; la defensa de las culturas autóctonas periféricas; la cultura obrera y sindical; la cultura juvenil y estudiantil; la cultura de la violencia; fiestas, ritos y conmemoraciones carlistas; y la evolución cultural e ideológica, incluyendo el papel de las mujeres.Across a few facts and events that have been given in the carlist movement during the 20th century, I have tried to shape the development or evolution of its political culture. I have started from the base that carlism is a more complex movement to analize that at first sight seems, that its evolution has not been linear, and one cannot speak aboutjust one carlism but several ones. In this work I have centred on the events that have been reivlndicated by carlism more progressive sector, and that somehow, are the justiflcatlon ofits evolution towards the left side ofpolitics, but without disdaining other aspects closer to the traditionalist sector I focused the carlism political and cultural evolution in the following aspects: the religiousness; sociableness in the Cultural Circles; autochthonous peripheral cultures defense; the labour and

  7. PREFACE: XX International School on Nuclear Physics, Neutron Physics and Applications (Varna2013)

    Science.gov (United States)

    Stoyanov, Chavdar; Dimitrova, Sevdalina

    2014-09-01

    The present volume contains the lectures and short talks given at the XX International School on Nuclear Physics, Neutron Physics and Applications. The School was held from 16-22 September 2013 in 'Club Hotel Bolero' located in 'Golden Sands' (Zlatni Pyasaci) Resort Complex on the Black Sea coast, near Varna, Bulgaria. The School was organized by the Institute for Nuclear Research and Nuclear Energy of Bulgarian Academy of Sciences. Co-organizer of the School was the Bulgarian Nuclear Regulatory Agency and the Bogoliubov Laboratory of Theoretical Physics of Joint Institute for Nuclear Research - Dubna. Financial support was also provided by the Bulgarian Ministry of Education and Science. According to the long-standing tradition the School has been held every second year since 1973. The School's program has been restructured according to our enlarged new international links and today it is more similar to an international conference than to a classical nuclear physics school. This new image attracts many young scientists and students from around the world. This year, 2013, we had the pleasure to welcome more than sixty distinguished scientists as lecturers. Additionally, twenty young colleagues received the opportunity to present a short contribution. Ninety-four participants altogether enjoyed the scientific presentations and discussions as well as the relaxing atmosphere at the beach and during the pleasant evenings. The program of the School ranged from latest results in fundamental areas such as nuclear structure and reactions to the hot issues of application of nuclear methods, reactor physics and nuclear safety. The main topics have been the following: Nuclear excitations at various energies. Nuclei at high angular moments and temperature. Structure and reactions far from stability. Symmetries and collective phenomena. Methods for lifetime measurements. Astrophysical aspects of nuclear structure. Neutron nuclear physics. Nuclear data. Advanced methods in

  8. El tribunal tutelar de Sevilla, una alternativa para los menores delincuentes a principios del siglo XX

    Directory of Open Access Journals (Sweden)

    Ana María MONTERO PEDRERA

    2015-04-01

    Full Text Available El estudio de la atención a la infancia delincuente y de todas las instituciones encargadas de su tutela y educación es un asunto poco estudiado en Andalucía y en concreto en Sevilla. Hasta la implantación de los Tribunales para niños en España, el tratamiento de menores delincuentes tomaba el camino del hospicio o el de la cárcel de adultos. Existían escasos centros donde además de acogerlos se les diera educación. Hasta la época de entre siglos no hay una verdadera preocupación por el asunto, tanto en América como en Europa. En España, la protección de menores como empresa pública, organizada y regulada por el Estado, aparece a principios del siglo XX. Se origina en el marco de un movimiento de reforma social a partir de 1900, impulsado decididamente desde el Gobierno por la vía de la legislación social. Todo ello transformaría el Estado liberal-burgués en un Estado social de Derecho. Hubo una creciente concienciación por el tema que se reflejó en los temas de congresos, en publicaciones de libros y artículos. La preocupación se concretó en la Ley de Tribunales Tutelares de menores de 1918, con una jurisdicción especial que impedía su internamiento en prisiones. Para su funcionamiento, eran necesarias las instituciones auxiliares: las casas de observación y las casas tutelares o reformatorios. El retraso en su expansión se debe a que no existía presupuesto para crear todas las infraestructuras en cada provincia. En Sevilla hubo un movimiento intenso a través de la prensa para que se creara, en consonancia con lo que ocurría a nivel nacional. Y a pesar del interés político, tanto de instituciones judiciales, educativas o municipales no se implantó hasta 1930. La prensa será el impulso que necesitaba la ciudad para animar a su creación.

  9. Spanish Radiology in the second half of the XX Century: a view from inside.

    Science.gov (United States)

    Bonmatí, José

    2008-09-01

    Radiology was born in 1896 with the immediate recognition of the diagnostic value of X-rays in medicine and progressed throughout the XX Century with the increasing knowledge of its properties and clinical applications. By mid-century Radiology was a respected clinical specialty in advanced countries, the radiological report was a requirement in hospital practice and radiologists' opinions requested in scientific meetings. In the last decades of the century has had a spectacular expansion with the emergence of new imaging modalities and revolutionary technologies that have transformed the specialty worldwide. In Spain Radiology lagged behind needs and demand in 1950. Radiological practice was unregulated and performance of X-ray exams by non-radiologists was common. Teaching of Radiology was non-existent in Medical Schools or postgraduation. The diagnostic value of the specialty was unrecognized by physicians and the role of radiologists ignored. Most hospital radiology services were poorly equipped and functionally inadequate. The shadow of the Civil War (1936-39) was conditioning Radiology in the country. The point of inflexion in the development of Radiology in Spain was the inclusion of film reading sessions in the 1965 academic program of the Society of Radiology. It was in the presentation of cases at these conferences that Clinical Radiology found the finest demonstration ground and as a result was immediately adopted by radiologists and progressively applied in scientific meetings, clinical practices and training programs. Its influence was important in reforming hospital practice, legislation on specialization and education, as well as in national health care plans. At the end of the century radiology in Spain was at a par with the standards of other western nations. The author was a witness of the evolution of Radiology during his 50 years of professional life. This article does not pretend to be exhaustive in names or contributions. It is an overview of

  10. Twentieth century european exiles Os exílios europeus no século XX

    Directory of Open Access Journals (Sweden)

    Bruno Groppo

    2010-05-01

    Full Text Available The phenomenon of exile in Europe, especially in France, throughout the 20th century and its peculiarities when compared to those in previous centuries is provided. Theoretical and conceptual definitions, including the terms “exiles”, “refugees” and “emigrants” have paramount importance in our historical reconstruction. Political exile and the broader problem of political refugees are dealt with, coupled to an in-depth analysis of the historical construction of the still binding international statute for refugees according to the 1951 Geneva Convention. The exile problem, taken within the context of the migration phenomenon, is intimately linked to the development of immigration policies and to economical and political structures. Actually it boils down to an investigation on possible typologies and the development of exile historiography.O presente artigo aborda o fenômeno do exílio europeu, com ênfase na França, no decorrer do século XX e as suas especificidades nesse século em relação à épocas anteriores. Definições teóricas e de conceitos, como as noções de “exilado”, “refugiado” e “emigrado”, assumem um papel essencial nessa reconstrução histórica. O exílio político e o problema mais amplo dos refugiados também são abordados com ênfase, com o estudo, inclusive, da construção histórica de um estatuto internacional do refugiado, organizado pela Convenção de Genebra de 1951 e até hoje em vigor. Mostra-se, enfim, como o problema do exílio, enquanto componente do fenômeno migratório, está estreitamente ligado à evolução das políticas de imigração e das conjunturas econômicas e políticas e apresenta-se uma reflexão sobre as tipologias possíveis e sobre a evolução da historiografia a respeito.

  11. Retrospective analysis of the mutagenicity/genotoxicity data of the cosmetic ingredients present on the Annexes of the Cosmetic EU legislation (2000-12).

    Science.gov (United States)

    Ates, Gamze; Doktorova, Tatyana Y; Pauwels, Marleen; Rogiers, Vera

    2014-03-01

    To evaluate the mutagenicity/genotoxicity of cosmetic ingredients at the regulatory level, usually a battery of three in vitro tests is applied. This battery, designed to be very sensitive, produces a high number of positive results, imposing the need for in vivo follow-up testing to clear the substance under study. In Europe, the use of experimental animals has become impossible for cosmetic ingredients due to the implementation of animal testing and marketing bans. Consequently, the possibility to 'de-risk' substances with positive in vitro results disappear and potentially safe cosmetic substances will be lost for the EU market unless currently used in vitro assays can be adapted or new non-animal mutagenicity/genotoxicity studies become available. Described strategies to improve the specificity of existing in vitro assays include optimisation of the used cell type and cytotoxicity assay and lowering of the applied top concentration. A reduction of the number of tests in the battery from three to two also has been suggested. In this study, the performance of the 'standard' in vitro mutagenicity/genotoxicity testing battery is analysed for a number of cosmetic ingredients. We composed a database with toxicological information on 249 cosmetic ingredients, mainly present on the Annexes of the European cosmetic legislation. Results revealed that the in vitro mutagenicity/genotoxicity tests showed a low specificity for the cosmetic ingredients concerned, comparable to the specificity published for chemicals. Non-confirmed or 'misleading' positive results amounted up to 93% for the in vitro test batteries. The cell type and top concentrations did not have a major impact on the specificity. With respect to cytotoxicity determinations, different end points were used, potentially leading to different testing concentrations, suggesting the need for a consensus in this matter. Overall, the results of this retrospective analysis point to an urgent need of better regulatory

  12. The Main Lines in Social and Civil Education in the Russian Pedagogics and School of the Late XIX – Early XX Centuries

    Directory of Open Access Journals (Sweden)

    Sergey I. Belentsov

    2014-03-01

    Full Text Available Based on the analysis of main works by domestic and foreign researchers, the article makes an attempt for all-round and objective consideration of main historiographic development on the problem of civil education of the youth in Russia of the late XIX – early XX centuries. It characterizes achievements and problems of modern historiography in this field, formulates the author’s evaluative judgment and generalized conclusions on the problem under discussion, and suggests directions for further research of various aspects of civil education. The beginning of research on this problem was marked by our work “The problem of civilian education in the Russian pedagogics and school in the late XIX 0 early XX centuries”, and continued in the work “Influence of pedagogical factors on civil activities of schoolchildren in Russia of the second half of the XIX – early XX centuries.”

  13. TO THE QUESTION ABOUT THE REASONS FOR THE DEVELOPMENT OF PROTESTANTISM IN THE SOUTH OF RUSSIA (LATE XIX – EARLY XX CENTURIES

    Directory of Open Access Journals (Sweden)

    Belikova N. Y.

    2016-04-01

    Full Text Available The reasons for the development of Protestantism in the South of Russia in the late XIX - early XX centuries are discussed in this article. Standpattism is spreading among the population of southern Russia. The ranks of the Protestants were replenished with the social strata associated with the development of capitalist relations in town and village. The emergence and development of Protestantism is an important feature of capitalization and Europeanization of Russia. By the beginning of XX century the Baptists are widely distributed throughout the South of Russia. In the late XIX - early XX century the process of converting from Orthodoxy to Protestantism of Cossacks was observed in the South of Russia. The article also researches Russian Protestantism – the old belief. In 1883 it became possible the old believers' worship. Russian Protestantism gained almost full rights

  14. De conventillos y conventilleras: género y poder en las viviendas populares colectivas en el Chile de inicios del siglo XX

    Directory of Open Access Journals (Sweden)

    Claudia Calquín Donoso

    2011-12-01

    Full Text Available El artículo problematiza las relaciones de género y poder en la construcción de las viviendas urbanas populares en Chile, siglos XIX-XX, específicamente las denominadas como conventillos, viviendas urbanas de tipo colectivo que alojaron a miles de familias obreras hasta mediados del siglo XX. Desde una perspectiva que destaca la relación entre construcción de las ciudades y formación de identidades sociales (clase y género se analiza los discursos sociales que se construyeron en torno a los conventillos y sus habitantes, discursos fuertemente influenciados por las perspectivas higienistas de la época, rescatando asimismo el lugar social de las mujeres populares en las transformaciones sociales y de género que inauguran el siglo XX en Chile y Latinoamérica.

  15. Gender Role, Gender Identity and Sexual Orientation in CAIS ("XY-Women") Compared With Subfertile and Infertile 46,XX Women.

    Science.gov (United States)

    Brunner, Franziska; Fliegner, Maike; Krupp, Kerstin; Rall, Katharina; Brucker, Sara; Richter-Appelt, Hertha

    2016-01-01

    The perception of gender development of individuals with complete androgen insensitivity syndrome (CAIS) as unambiguously female has recently been challenged in both qualitative data and case reports of male gender identity. The aim of the mixed-method study presented was to examine the self-perception of CAIS individuals regarding different aspects of gender and to identify commonalities and differences in comparison with subfertile and infertile XX-chromosomal women with diagnoses of Mayer-Rokitansky-Küster-Hauser syndrome (MRKHS) and polycystic ovary syndrome (PCOS). The study sample comprised 11 participants with CAIS, 49 with MRKHS, and 55 with PCOS. Gender identity was assessed by means of a multidimensional instrument, which showed significant differences between the CAIS group and the XX-chromosomal women. Other-than-female gender roles and neither-female-nor-male sexes/genders were reported only by individuals with CAIS. The percentage with a not exclusively androphile sexual orientation was unexceptionally high in the CAIS group compared to the prevalence in "normative" women and the clinical groups. The findings support the assumption made by Meyer-Bahlburg ( 2010 ) that gender outcome in people with CAIS is more variable than generally stated. Parents and professionals should thus be open to courses of gender development other than typically female in individuals with CAIS.

  16. Drosophila myosin-XX functions as an actin-binding protein to facilitate the interaction between Zyx102 and actin.

    Science.gov (United States)

    Cao, Yang; White, Howard D; Li, Xiang-Dong

    2014-01-21

    The class XX myosin is a member of the diverse myosin superfamily and exists in insects and several lower invertebrates. DmMyo20, the class XX myosin in Drosophila, is encoded by dachs, which functions as a crucial downstream component of the Fat signaling pathway, influencing growth, affinity, and gene expression during development. Sequence analysis shows that DmMyo20 contains a unique N-terminal extension, the motor domain, followed by one IQ motif, and a C-terminal tail. To investigate the biochemical properties of DmMyo20, we expressed several DmMyo20 truncated constructs containing the motor domain in the baculovirus/Sf9 system. We found that the motor domain of DmMyo20 had neither ATPase activity nor the ability to bind to ATP, suggesting that DmMyo20 does not function as a molecular motor. We found that the motor domain of DmMyo20 could specifically bind to actin filaments in an ATP-independent manner and enhance the interaction between actin filaments and Zyx102, a downstream component of DmMyo20 in the Fat signaling pathway. These results suggest that DmMyo20 functions as a scaffold protein, but not as a molecular motor, in a signaling pathway controlling cell differentiation.

  17. MODEL OF STRUCTURAL-FUNCTIONAL ANALYSIS OF VISUALS IN RUSSIAN ABC BOOKS AND PRIMERS OF LATE XIX - EARLY XX CENTURIES

    Directory of Open Access Journals (Sweden)

    Ivan I. Teterin

    2016-01-01

    Full Text Available Today the prevalence of visual information coding determines the changes in the text and extra-textual components of the textbook, the problem affects the placement and number of illustrative material, defines the relationship and interaction of text and image information, focuses on new forms of organization of the learning process. The movement of humanity from the dominant culture of text oriented logos or the spread and adoption of visual forms of information broadcast began at the turn of the XIX and XX centuries. It was during this period in the academic literature visual components acquired independent didactic value. I began to develop a holistic visual range of a school textbook.The visual tutorial series has been the subject of special study for many scientific disciplines. The overall goal of our research is to answer the question. What didactic features were inherent in visual range of textbooks for initial literacy in Russia in the second half of XIX - early XX century, why, how, and how they changed. In this article, we will focus on the issue of allocation of structural components of the visual range of the spectrum and the functions they perform.Offering a model of this analysis, we relied on the development problems of the textbook functions V. Krajewski, V. Beilinson, I. Lerner, V. Bespal'ko and characteristics of the major structural components of the textbook, the proposed D. Zuev, A. Sochor, J. Mickey and others. 

  18. Anamnesis de una estructura. La Catedral de Vitoria entre los siglos XII y XX

    Directory of Open Access Journals (Sweden)

    Cámara Muñoz, Leandro

    2002-12-01

    Full Text Available The Cathedral of Vitoria is a building with an extended historical life. We have attempted to produce a chronological sequence of the interventions and architectural “projects” since the beginning of the construction of the church on the early 13th century to the last restorations during the 1960s. This study attempts to fill a void on the available information, crucial for the evaluation of safety and durability issues on the Cathedral. The “anamnesis” practiced on the monument is one of the cornerstones of the method we have chosen for restoration, not only regarding the structural aspects, but regarding the problems of functional interpretation and symbolic content as well. This historical reading the key of structural analysis is what we intend to present: the extraction of the historical building sequence that leads to the current situation of the building, discriminating the different moments of the architectural project, phases of building growth and repair interventions on the structure that comment on or contradict among themselves, to result in the form that we witness now. We use that sequence to evaluate, albeit partially, the safety status of the structure, and to build a working hypothesis for the structural aspects of the restoration tasks.La Catedral de Vitoria es un edificio con una larga vida histórica, llena de acontecimientos constructivos que han venido interesando su comportamiento como estructura construida. Ha sido un objetivo primordial del Plan Director evaluar las sucesivas consecuencias de todos esos acontecimientos y explicar su concatenación. Todo ello se ha investigado durante su redacción, consiguiendo una secuencia cronológica en la que se relaciona el conjunto de intervenciones y de "proyectos" arquitectónicos que se suceden desde el comienzo de la construcción de la iglesia en los inicios del siglo XIII hasta sus últimas restauraciones en los años 60 del siglo XX. Este estudio histórico tiene

  19. La construcción de pianos en Valencia hasta inicios del siglo XX

    Directory of Open Access Journals (Sweden)

    Alemany Ferrer, Victoria

    2007-12-01

    entonces en Valencia una demanda local de instrumentos que justificaba suficientemente su labor. Se han obtenido datos de cuatro fábricas de pianos que funcionaron entre 1830 y principios del siglo XX. Dicha documentación constata que los instrumentos valencianos construidos durante aquel período (1830-1915 obtuvieron gran aceptación tanto en el mercado interno como en el foráneo, y consiguieron prestigiosos galardones en exposiciones y muestras nacionales y extranjeras. También se ha facilitado el conocimiento de los sistemas de producción y comercialización de aquellos talleres, y de las características organológicas que poseyeron los pianos valencianos construidos en las diversas épocas; esa información ha ayudado a valorar la función económica y social que tuvo la fabricación valenciana de pianos en el siglo XIX y ha permitido su comparación con la desarrollada en otras provincias españolas durante la misma época.

  20. Heat pump concepts for nZEB Technology developments, design tools and testing of heat pump systems for nZEB in the USA: Country report IEA HPT Annex 40 Task 2, Task 3 and Task 4 of the USA

    Energy Technology Data Exchange (ETDEWEB)

    Baxter, Van D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Payne, W. Vance [National Inst. of Standards and Technology (NIST), Gaithersburg, MD (United States); Ling, Jiazhen [Univ. of Maryland, College Park, MD (United States); Radermacher, Reinhard [Univ. of Maryland, College Park, MD (United States)

    2015-12-01

    The IEA HPT Annex 40 "Heat pump concepts for Nearly Zero Energy Buildings" deals with the application of heat pumps as a core component of the HVAC system for Nearly or Net Zero energy buildings (nZEB). This report covers Task 2 on the system comparison and optimisation and Task 3 dedicated to the development of adapted technologies for nZEB and field monitoring results of heat pump systems in nZEB. In the US team three institutions are involved and have worked on the following projects: The Oak Ridge National Laboratory (ORNL) will summarize development activities through the field demonstration stage for several integrated heat pump (IHP) systems electric ground-source (GS-IHP) and air-source (AS-IHP) versions and an engine driven AS-IHP version. The first commercial GS-IHP product was just introduced to the market in December 2012. This work is a contribution to Task 3 of the Annex. The University of Maryland will contribute a software development project to Task 2 of the Annex. The software ThermCom evaluates occupied space thermal comfort conditions accounting for all radiative and convective heat transfer effects as well as local air properties. The National Institute of Standards and Technology (NIST) is working on a field study effort on the NIST Net Zero Energy Residential Test Facility (NZERTF). This residential building was constructed on the NIST campus and officially opened in summer 2013. During the first year, between July 2013 and June 2014, baseline performance of the NZERTF was monitored under a simulated occupancy protocol. The house was equipped with an air-to-air heat pump which included a dedicated dehumidification operating mode. Outdoor conditions, internal loads and modes of heat pump operation were monitored. Field study results with respect to heat pump operation will be reported and recommendations on heat pump optimization for a net zero energy building will be provided. This work is a contribution to Task 3 of the Annex.

  1. Application of the ARCAL XX Project documents for industrial radiography control in Peru; Aplicacion en el Peru de los documentos del Proyecto Arcal XX para el control en radiografia industrial

    Energy Technology Data Exchange (ETDEWEB)

    Medina Gironzini, E. [Instituto Peruano de Energia Nuclear, Lima (Peru). Oficina Tecnica de la Autoridad Nacional

    2001-07-01

    The objectives of the ARCAL XX Project: 'Guidelines on Control of Radiation Sources' (1997-2000) were to elaborate several documents, product of the regional experience that has had great utility for Regulatory Authorities and radiation ionizing users. Some of these documents contain Radiological Safety Requirements, Guide for Authorisation Application and Inspections Procedures. The implementation of these guidelines will improve the effectiveness of regulatory control of radiation sources in Peru by Regulatory Authority (IPEN) and the radiological protection in aspects of occupational, medical, public and potential exposure. This document presents the experience in the development of these guidelines and their contribution for elaborating national regulations for use of industrial radiography.

  2. De sastres a ideólogos: movilizadores de ideas a finales del siglo XIX comienzos del XX = From tailors to ideologists: ideas promoters late XIX century and early XX century

    Directory of Open Access Journals (Sweden)

    Trujillo, Eduard Moreno

    2014-01-01

    Full Text Available El objetivo de este texto es describir la forma en la que los sastres Antonio Guedes Coutinho de Brasil e Ignacio Torres Giraldo de Colombia se transformaron en importantes articuladores de ideas de izquierda durante las últimas décadas del siglo XIX y comienzos del siglo XX. El texto se divide en cuatro secciones en las que se abordan: los contextos históricos de estos líderes obreros, la composición de las ideas de izquierda a partir de la concepción de libertad, las formas en que fueron apropiadas retóricamente estas ideas, y una conclusión en la que se presentan las diferencias y las similitudes de las actuaciones de los dos líderes obreros, quienes progresivamente se convirtieron en ideólogos de las clases obreras y populares

  3. State of Washington Department of Health radioactive air emission notice of construction phase 1 for spent nuclear fuel project - hot conditioning system annex, project W-484

    Energy Technology Data Exchange (ETDEWEB)

    Turnbaugh, J.E.

    1996-08-15

    This notice of construction (NOC) provides information regarding the source and the estimated annual possession quantity resulting from the operation of the Hot Conditioning System Annex (HCSA). This information will be discussed again in the Phase II NOC, providing additional details on emissions generated by the operation of the HCSA. This Phase I NOC is defined as construct in the substructure, including but limited to, pouring the concrete for the floor; construction of the process pits and exterior walls; making necessary interface connections to the Canister Storage Building (CSB) ventilation and utility systems for personnel comfort; and extending the multi-canister over-pack (MCO) handling machine rails into the HCSA. A Phase II NOC will be submitted for approval prior to installation and is defined as the completion of the HCSA, which will consist of installation of Hot Conditioning System Equipment (HCSA), air emissions control equipment, and emission monitoring equipment. About 80 percent of the U.S. Department of Energy`s spent nuclear fuel (SNF) inventory is stored under water in the Hanford Site K Basins. Spent nuclear fuel in the K West Basin is contained in closed canisters, while the SNF in the K East Basin is contained in open canisters, which allow free release of corrosion products to the K East Basin water. Storage in the K Basins was originally intended to be on an as-needed basis to sustain operation of the N Reactor while the Plutonium-Uranium Extraction (PUREX) Plant was refurbished and restarted. The decision in December 1992 to deactivate the PUREX Plant left approximately 2,300 MT (2,530 tons) of N Reactor SNF in the K Basins with no means for near-term removal and processing. The HCSA will be constructed as an addition to the CSB and will contain the HCSA. The hot conditioning system (HCS) will remove chemically-bound water and will passivate the exposed uranium surfaces associated,with the SNF. The HCSA will house seven hot

  4. El endemismo por paludismo, lepra, leishmaniosis y leptospirosis en la provincia de Castellón, a mediados del siglo XX : vivencias personales

    OpenAIRE

    Martínez Urrea, José

    2009-01-01

    Discurso de inauguración del curso 2009 de la Reial Acadèmia de Medicina de la Comunitat Valenciana por el Ilmo. Sr. Dr. D. José Martínez Urrea: El endemismo por paludismo, lepra, leishmaniosis y leptospirosis en la provincia de Castellón, a mediados del siglo XX. Vivencias personales.

  5. GÊNESE E MEMÓRIA DO ESTRUTURALISMO COMO PARADIGMA DE INTERPRETAÇÃO NO DISCURSO DAS CIÊNCIAS HUMANAS NO SÉCULO XX

    Directory of Open Access Journals (Sweden)

    Halysson Dias Santos

    2009-01-01

    Full Text Available This article analyses the relationships between Russian Formalism and Structuralism, and the historical conditions of the emergence of structuralism, like an interpretation´s paradigm on the Human Sciences, can be comprehended as a social memory of the XX century.

  6. Grandes corrientes de la matemáticas en el siglo xx. vi. panorama de los premios abel (2003-2013)

    OpenAIRE

    Zalamea, Fernando

    2012-01-01

    Este artculo nal de la serie Catedra Granés 2008 ofrece una mirada transversal sobre las matematicas de la segunda parte del siglo XX ("matemáticas contemporaneas"), gracias a un estudio global de los Premios Abel. Se revisan ciertos aportes de tres galardonados -Serre, Atiyah, Gromov- y se ofrecen algunas conclusiones globales de la Catedra Granés 2008.

  7. [Apparent internal male pseudo-hermaphroditism. Gynecomastia. Negative gonad surgical research. Caryotype 46, XX. Presence of H-Y antigen (author's transl)].

    Science.gov (United States)

    Vague, J; Guidon, J; Mattei, J F; Luciani, J M; Jouve, R; Le Gall, F

    1977-01-01

    Boy 15. Aspect of delayed puberty with empty scrotum and gynecomastia. Caryotype 46, XX. Presence of H.Y. Antigen. Plasmatic testosterone 1 020 pg/ml. Normal plasmatic FSH and LH. Hypotrophic uterus and tubes. No gonad found. Small right epididymis. Complete virilization by testosterone.

  8. [Lind tulemäe kohal : valik XX sajandi teise poole türgi luulet] / Helen Geršman

    Index Scriptorium Estoniae

    Geršman, Helen

    2010-01-01

    Tutvustus: Lind tulemäe kohal : valik XX sajandi teise poole türgi luulet / türgi keelest tõlkinud Ly Seppel ja Andres Ehin ; koostanud Ly Seppel ; järelsõna: Andres Ehin. Tallinn : Kultuurileht, 2010. (Loomingu Raamatukogu, 1406-0515 ; 2010, 11)

  9. Un infierno catalán. Apuntes para una bibliografía de publicaciones eróticas catalanas clandestinas (siglo XIX - primer tercio del siglo XX

    Directory of Open Access Journals (Sweden)

    Jean-Louis Guereña

    2014-06-01

    Full Text Available El presente artículo colecciona un buen número de las publicaciones catalanas de tema erótico que vieron la luz clancestinamente durante el siglo XIX y principios del XX. This article collects a good number of Catalan publications with a erotic topic that came out clandestinely during the 19th and early 20th centuries.

  10. What Does f[subscript xx]f[subscript yy] - f[superscript 2][subscript xy] Greater than 0 "Really" Mean?

    Science.gov (United States)

    McCartin, Brian J.

    2008-01-01

    This note presents geometric and physical interpretations of the sufficient condition for a critical point to be a strict relative extremum: f[subscript xx]f[subscript yy] - f[superscript 2][subscript xy] greater than 0. The role of the double derivative f[subscript xy] in this inequality will be highlighted in these interpretations. (Contains 14…

  11. Sox10 gain-of-function causes XX sex reversal in mice: implications for human 22q-linked disorders of sex development.

    Science.gov (United States)

    Polanco, Juan Carlos; Wilhelm, Dagmar; Davidson, Tara-Lynne; Knight, Deon; Koopman, Peter

    2010-02-01

    Male development in mammals is normally initiated by the Y-linked gene Sry, which activates expression of Sox9, leading to a cascade of gene activity required for testis formation. Although defects in this genetic cascade lead to human disorders of sex development (DSD), only a dozen DSD genes have been identified, and causes of 46,XX DSD (XX maleness) other than SRY translocation are almost completely unknown. Here, we show that transgenic expression of Sox10, a close relative of Sox9, in gonads of XX mice resulted in development of testes and male physiology. The degree of sex reversal correlated with levels of Sox10 expression in different transgenic lines. Sox10 was expressed at low levels in primordial gonads of both sexes during normal mouse development, becoming male-specific during testis differentiation. SOX10 protein was able to activate transcriptional targets of SOX9, explaining at a mechanistic level its ability to direct male development. Because over-expression of SOX10 alone is able to mimic the XX DSD phenotypes associated with duplication of human chromosome 22q13, and given that human SOX10 maps to 22q13.1, our results functionally implicate SOX10 in the etiology of these DSDs.

  12. What Does f[subscript xx]f[subscript yy] - f[superscript 2][subscript xy] Greater than 0 "Really" Mean?

    Science.gov (United States)

    McCartin, Brian J.

    2008-01-01

    This note presents geometric and physical interpretations of the sufficient condition for a critical point to be a strict relative extremum: f[subscript xx]f[subscript yy] - f[superscript 2][subscript xy] greater than 0. The role of the double derivative f[subscript xy] in this inequality will be highlighted in these interpretations. (Contains 14…

  13. Selective blockade of leukotriene production by a single dose of the FPL 64170XX 0.5% enema in active ulcerative colitis

    DEFF Research Database (Denmark)

    Kjeldsen, J; Laursen, L S; Hillingsø, Jens

    1995-01-01

    5-Lipoxygenase products of arachidonic acid metabolism are thought to play a central role in the secondary amplification of the inflammatory response of several inflammatory diseases, including ulcerative colitis. FPL 64170XX is a selective inhibitor of the enzyme 5-lipoxygenase. Concentrations o...

  14. A TRAJETÓRIA DO SAMBA NO SÉCULO XX: DA MARGINALIDADE À INDÚSTRIA CULTURAL

    Directory of Open Access Journals (Sweden)

    Valdemar Valente Junior

    2012-01-01

    Full Text Available Uma visão panorâmica do samba a partir de sua inserção como produto cultural no Brasil do século XX. Sua configuração de gênero musical moderno e sua ascensão de manifestação periférica e marginal à condição de música definidora de um sentido de nacionalidade. A influência dos gêneros estrangeiros e o papel da indústria do rádio, do disco e mais tarde da televisão como multiplicadora de sua importância como música de consumo.

  15. Generación XX. Teorías sobre la juventud en la era contemporánea

    Directory of Open Access Journals (Sweden)

    Carles Feixa

    2006-10-01

    Full Text Available La historia del Siglo XX puede verse como la sucesión de diferentes generaciones de jóvenes que irrumpen en la escena pública para ser protagonistas en la reforma, la revolución, la guerra, la paz, el rock, el amor, las drogas, la globalización o la antiglobalización. En este artículo propongo realizar un paseo por las teorías sobre la juventud en la era contemporánea, poniendo en relación los cambios en la forma de vida de los jóvenes con las reflexiones científicas, filosóficas y literarias en torno a este grupo de edad.

  16. El discurso del civismo en Pereira o la “sacralidad” de lo público durante el siglo XX

    Directory of Open Access Journals (Sweden)

    John Jaime Correa Ramírez

    2009-01-01

    Full Text Available La referencia constante al civismo es uno de los rasgos más distintivos de la historia urbana de Pereira. Al igual que en muchas ciudades colombianas, la ideología del civismo asume la necesidad de establecer una especie de simbiosis entre la ciudad, sus espacios públicos y sus ciudadanos, tanto en lo material como en lo espiritual. En el caso de Pereira se busca identificar los aspectos más relevantes del discurso cívico que desarrollaron entidades como la Sociedad de Mejoras y el Club Rotario a través de diferentes medios escritos, poniendo especial énfasis en los valores morales que debían exhibir los ciudadanos cívicos o los “ciudadanos de bien” de la ciudad, en el proceso de transformación y modernización vivido a lo largo del siglo XX.

  17. Dinámica del espacio geográfico margariteño en el siglo XX. (Trabajo Preliminar

    Directory of Open Access Journals (Sweden)

    Antonio R. Boadas

    2007-01-01

    Full Text Available En el siglo XX se produjeron grandes transformaciones en el espacio geográfico margariteño. En este trabajo, previo a un análisis posterior, se señalan factores y agentes de acontecimientos que han concurrido y favorecido tales transformaciones. Entre otros se anotan movimientos demográficos de entrada y salida de población, dotación de infraestructuras y medios para transporte, comercio y servicios, y valorización de la isla como destino turístico y recreacional. Estos acontecimientos y las transformaciones generadas ocurrieron mayoritariamente en la segunda mitad del siglo, y se tradujeron en cambios en la utilización del territorio, que son evidentes en las expansiones urbanas, la aparición de nuevos espacios urbanizados y la conformación de zonas de aprovechamiento turístico y comercial.

  18. Literatura e mudança: teoria e sociedade na segunda metade do século XX

    Directory of Open Access Journals (Sweden)

    Hugo Langone

    2008-12-01

    Full Text Available http://dx.doi.org/10.5007/2175-7917.2008v13n2p86 A partir da segunda metade do século XX, os estudos literários foram tomados por diversas concepções da relação entre literatura e sociedade, esquivando-se das visões que colocavam a obra de arte como um objeto isolado. Filiados a diferentes correntes de pensamento, muitos foram os autores que se aventuraram a analisar a dimensão política da ficção. Através de um recorte que passa por teóricos como T. S. Eliot, Jacques Ranciére, Theodor Adorno, Gilles Deleuze e Wolfgang Iser, este artigo procura apresentar, da maneira mais neutra possível, os pontos de convergência e distanciamento entre os pensadores, revelando a complexidade deste rico terreno.

  19. Fuentes orales e identidades profesionales: Médicas españolas en la segunda mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Ortiz Gómez, Teresa

    2005-06-01

    Full Text Available This paper analyses the importance and significance of oral sources for the production of collective biographies and prosopographic studies and for the history of the health professions and healthcare. As an example, it contains a study of the professional experience of female Spanish doctors in the second half of the 20th century based on indepth interviews.

    En este trabajo se analiza interés y el significado de las fuentes orales para la elaboración de biografías colectivas y relatos prosopográficos y para la historia de las profesiones y la asistencia sanitaria. Se ejemplifica con el estudio de la experiencia profesional de las médicas españolas de la segunda mitad del siglo XX a partir de entrevistas en profundidad.

  20. Química en Puebla durante el siglo XX: continuación de una tradición

    OpenAIRE

    2001-01-01

    Se presentan datos históricos del desarrollo de la Química en los siglos XVIII y XIX, donde los estudios de farmacia predominan. Es durante el siglo XX que se dan cambios que permiten ampliar la formación de los químicos; así en 1921 se registra la carrera de Químico Farmacéutico. Durante 1946 se crea la carrera de Químico Técnico que en 1952 se establece como la licenciatura en Química. A partir de los años setenta, comienza el desarrollo de la investigación al integrarse los primeros grupos...

  1. PROCESUL DE CONSTRUCŢIE EUROPEANĂ ÎN PRIMA JUMĂTATE A SECOLULUI AL XX-LEA

    Directory of Open Access Journals (Sweden)

    Anton Florin Bota

    2006-05-01

    Full Text Available Dans l’étude “Le processus de construction européenne de la première moitié du XX-ème siècle”, l’auteur se propose de présenter les principaux moments du développement de l’idée inter-européenne, les étapes de la construction européenne – marquées par la théorie fédéraliste et fonctionnelle, concrétisées dans l’approche intergouvernementale – et l’apparition des organismes internationaux intergouvernementaux de coopération classique, tout comme dans l’approche communautaire – et l’apparition des organismes supranationaux à partir du 9 mai 1950, lorsque la présentation du plan Schuman a eu lieu.

  2. Movilización social frente a gobiernos injustos: un acercamiento a las resistencias latinoamericanas del siglo XX

    OpenAIRE

    Osorio Valencia, Yhony Alexander

    2016-01-01

    A partir de la pregunta, ¿cuál fue la influencia de la parrhesía en las dictaduras que se dieron después de la mitad del siglo XX en América Latina?, y entendiendo la parrhesía desde el filósofo de Poitiers, Michel Foucault, como el coraje de decir la verdad en quien habla y asume el riesgo de decir, a pesar de todo, la verdad que concibe, aun corriendo el peligro de muerte; al levantar el velo de lo que es, al decir la verdad respecto a todo y contra todo, se intentarán mostrar las consecuen...

  3. Phase gap in pseudoternary R1-yRy'Mn2X2-xXx' compounds

    Science.gov (United States)

    Wang, J. L.; Kennedy, S. J.; Campbell, S. J.; Hofmann, M.; Dou, S. X.

    2013-03-01

    Our neutron diffraction investigation of PrMn2Ge2-xSix reveals a clear separation into two magnetic phases, canted ferromagnetic (Fmc) and antiferromagnetic (AFmc), between x = 1.0 and 1.2 and a commensurate phase gap in the lattice, due to magnetostrictive distortion. This remarkable magnetoelastic phenomenon is driven by a nonuniform atomic distribution on the X site which in turn produces subtle variations in the local lattice and abrupt changes in the Mn-Mn magnetic exchange interaction. Our results show that coexistence of Fmc and AFmc phases depends on lattice parameter, chemical pressure from the rare-earth and metalloid sites, and local lattice strain distributions. We demonstrate that these magnetostructural correlations act across the entire family of R1-yRy'Mn2X2-xXx' compounds.

  4. p-Electron Magnetism in anion doped BaTiO3-xXx (X=C,N,B)

    Science.gov (United States)

    Gruber, Christoph; Osvaldo Bedolla Velazquez, Pedro; Redinger, Josef; Mohn, Peter; Marsman, Martijn

    2012-02-01

    We present VASP calculations using the HSE functional for carbon, nitrogen, and boron doped BaTiO3-xXx (X=C,N,B). We calculate a 40-atom supercell and replace one oxygen atom by C,N, or B. For all three substituents we find a magnetically ordered groundstate which is insulating for C and N and halfmetallic for B. The changes in the electronic structure between the undoped and the doped case are dominated by the strong crystal field effects together with the large band splitting for the impurity p-bands. Using an MO picture we give an explanation for the pronounced changes in the electronic structure between the insulating non-magnetic state and the as well insulating magnetic state for doped BaTiO3. p-element doped perovskites could provide a new class of materials for various applications ranging from spin-electronics to magneto-optics.

  5. Religinė ir politinė Teosofų draugijos veikla Indijoje XIX a. pab. - XX a. pr

    OpenAIRE

    Beinorius, Audrius

    2012-01-01

    Straipsnyje analizuojama 1875 m. Jelenos Petrovnos Blavatskajos ir Henry Steelo Olcotto įkurtos Teosofų draugijos politinė ideologija, jos indėlis į hindų nacionalizmo formavimąsi ir hindų bei budistų religinį atgimimą XIX a. pab. – XX a. pr. Siekiama atskleisti, kaip Indijoje modernioji teosofija tapo sudėtine neohinduistinio sąjūdžio dalimi, kovojusia su krikščionių misijomis, britų kolonializmu ir suteikusia indų nacionalistams legitimizuojančią ideologiją, naują pasitikėjimą, organizacinę...

  6. Pioneer institutions of distance electronic learning in Poland in the years nineteen sixties and seventies of the XX century

    Directory of Open Access Journals (Sweden)

    Mariusz Portalski

    2012-12-01

    Full Text Available In the final years of XX century, and especially in first decade of recent century was developed a number of formal learning forms, informal and outside formal with using systems and devices based on electronic techniques. Especially Internet and computer techniques next to multitude of television channels, mobile telephony and many others opportunities of data processing, accumulation and sending allow for realisation modern forms of intramural and remote teaching and learning. Persons, which are interested in remote education, open education or e-learning is worth to close pioneer activities in Poland in this areas in years nineteen sixties and seventies of the previous century. Two of activities like that, one worldwide and second in local scale implemented electronic remote education with using television are exactly subjects of this publication.

  7. [The major achievements of medicine in XX-early XXI centuries and their significance for the near future].

    Science.gov (United States)

    Lisitsyn, Iu P; Zhuravleva, T V

    2012-01-01

    Among major achievements of medicine in XX-early XXI centuries considered as the most outstanding contribution are the development of theory of system of control of functions of organism and its integrity by I.P. Pavlov and his disciples and followers: the concept of psycho-somatic medicine by Z. Freud and social psychology; the theory of stress and general adaptive syndrome by H. Selye and the discovering of nature of many infectious and parasitic diseases. Then establishment of pathogenic impact of extra-environmental factors, decoding of gene chromosomal structure of organism, development of genetic engineering, effective pharmaceuticals, and techniques of treatment and prevention of various inherent and acquired diseases also can be put into this category. The achievements and discoveries in the area of public health, social medicine and hygiene and development of concept of healthy life-style are discussed too.

  8. Entanglement and localization of the one spin excitation states in a quantum $XX$ chain with a impurity

    CERN Document Server

    Zwick, A

    2009-01-01

    One spin excitation states are involved in the transmission of quantum states and entanglement through a quantum spin chain, the localization properties of these states are crucial to achieve the transfer of information from one extreme of the chain to the other. We investigate the bipartite entanglement and localization of the one excitation states in a quantum $XX$ chain with one impurity. The bipartite entanglement is obtained using the Concurrence and the localization is analyzed using the inverse participation ratio. Changing the strength of the exchange coupling of the impurity allows us to control the number of localized or extended states. Our results show that equally localized states do not possess the same bipartite entanglement and suggest that only a restricted class of localizated states allows the storage and transmission of quantum states.

  9. Un médico higienista buscando ordenar el mundo urbano argentino de comienzos del siglo XX

    Directory of Open Access Journals (Sweden)

    Diego Armus

    2007-01-01

    Full Text Available Aferrándose a las altas expectativas generadas por el discurso del progreso y las promesas de la ciencia, la higiene fue una suerte de gran consejera, de experta en el arte de observar, corregir, mejorar o tratar de cambiar radicalmente la salud del cuerpo social en su conjunto. En ese contexto llegó incluso a imaginar ciudades alternativas o utópicas. Emilio Coni, probablemente el higienista argentino más destacado de fines del siglo XIX y comienzos del XX, imaginó una de esas ciudades. Las notas que siguen contextualizan su "Ciudad argentina ideal o del porvenir", cuyo texto original publicado por primera vez el 3 de abril de 1919 en La Semana Médica se reproduce.

  10. Development Status of classical archivistics to the 30s of XX century: Three archivistics manuals of universal significance

    Directory of Open Access Journals (Sweden)

    Leomar José Montilla Peña

    2013-10-01

    Full Text Available The purpose of this article is to present a theoretical review the developed state the of classical archivistics until the first three decades of the XX century, with the purpose of exposing the theories and references of the epistemological subjection of this science, that is, describe the budgets the technical scientific discourse in which orbits this scientific discipline. In order to develop some preliminary ideas on this discernment will raise first an overview of the first three manuals published and their authors within the European context. Then, we refer to the characterization of archival conceived to the period briefly describing the object study, the principles and fundamental concepts and processes treatment of document archival.

  11. Cytogenetic Investigation in a Group of Ten Infertile Men with Non-Obstructive Azoospermia: First Algerian 46, XX Syndrome

    Directory of Open Access Journals (Sweden)

    Meriem BAZIZ

    2016-08-01

    Full Text Available Background: In Algeria, the data on infertility and its various causes are rare. Recently, the introduction of assisted reproduction has allowed expecting that 300000 couples, which represent 7% of couples of reproductive age, face difficulty conceiving a child. Knowing that most idiopathic cases are likely to be due to chromosomal abnormalities, we aimed to investigate genetic defects by karyotype analysis in Algerian infertile men, using peripheral blood lymphocytes.Methods: A cytogenetic study was conducted on 10 men from infertile couples by Karyotype analysis of R-banding performed by lymphocyte culture technique. Fluorescence in situ hybridization was performed and molecular abnormalities were investigated by polymerase chain reaction. Follicle stimulating hormone (FSH and luteinizing hormone (LH levels were evaluated by immunoradiometric method.Results: Chromosomal abnormalities were observed in 30% of the patients. We identified a homogenous Klinefelter syndrome patient with 47, XXY karyotype, a mosaic Klinefelter syndrome patient with 47, XXY/46, XY karyotype and a 46, XX male. Fluorescence in situ hybridization showed that the sex-determining region Y was translocated to the short arm of the X chromosome in patient with 46, XX chromosomal constitution and the presence of the SRY gene was confirmed by polymerase chain reaction and electrophoresis.Conclusion: The occurrence of chromosomal abnormalities in 30% of the infertile men strongly supports the inclusion of routine cytogenetic testing for diagnostic establishment and suitable counseling for couples seeking for assisted reproduction technologies. Keywords: Male infertility, Cytogenetic, Azoospermia, Severe oligozoospermia

  12. O Pensamento Estratégico no Século XX: Explicações Históricas

    Directory of Open Access Journals (Sweden)

    Leonardo Silveira Conke

    2013-12-01

    Full Text Available Considerando a relação entre as organizações e seu ambiente admite-se, neste ensaio, que o estudo do contexto histórico auxilia no entendimento dos motivos pelos quais elas realizam determinadas escolhas. Assim, tem-se como objetivo situar historicamente as principais teorias e ferramentas estratégicas desenvolvidas a partir do século XX, descrevendo como os fatos da história geral (relacionados à economia, cultura, política, tecnologia etc. influenciaram no seu surgimento, na sua aceitação, na sua expansão ou na sua consolidação. Normalmente, a história tradicional é preterida nos textos da Administração, limitando-se às explicações sobre a Revolução Industrial e à transição do feudalismo para o capitalismo. Neste artigo, a extensa pesquisa bibliográfica permitiu oferecer explicações adicionais, baseadas em acontecimentos históricos marcantes, para a evolução ocorrida no pensamento estratégico a partir do século XX. Como resultado, foram percebidos quatro momentos nos quais há um alinhamento mais nítido entre os desafios criados pelas condições históricas e as estratégias oportunamente propostas para enfrentá-los. Nas considerações finais, são apresentadas duas possíveis tendências estratégicas dos próximos anos. DOI:10.5585/riae.v12i4.1951

  13. O comunismo na história do século XX Communism in the Twentieth-Century history

    Directory of Open Access Journals (Sweden)

    Bruno Groppo

    2008-01-01

    Full Text Available O comunismo do século XX teve, desde seu início, uma dimensão dupla: o movimento revolucionário, por um lado; o sistema de poder estatal, por outro. Os dois aspectos são indissociáveis. A história do comunismo como movimento revolucionário em escala mundial está estreitamente ligada à história da Rússia e, em seguida, à da União Soviética. E o sistema soviético, na configuração definitiva que lhe foi impressa pelo stalinismo, foi ao longo de muitas décadas o modelo de referência para o conjunto do mundo comunista. Em outras palavras, o comunismo do século XX identifica-se primordialmente com a experiência histórica do poder soviético. Os demais comunismos, heréticos ou dissidentes em relação à ortodoxia stalinista, desempenharam um papel menos importante, freqüentemente marginal.Twentieth-century communism had, since the beginning, a double dimension: the revolutionary movement, on the one hand; the state power system, on the other. Both sides are inseparable. The history of communism as a revolutionary movement in world scale is intimately linked to the Russian and then Soviet history. And the Soviet system, in the final configuration stalinism gave to it, was a model to the whole communist world along many decades. So that twentieth-century communism is primordially identical with the historical experience of the Soviet power. Other brands of communism, heretical or dissident to Stalinist ortodoxy, performed a less important, often marginal, role.

  14. Husserl y la fenomenología trascendental: Perspectivas del sujeto en las ciencias del siglo XX

    Directory of Open Access Journals (Sweden)

    Antonio Paoli Bolio

    2012-01-01

    Full Text Available Este artículo muestra de manera general la gran importancia de la fenomenología como un paradigma teórico clave, porque influyó de manera contundente en la ciencia y la filosofía del siglo xx. Su influencia se deja ver en los autores más conspicuos del existencialismo, del historicismo, de la hermenéutica, de la historia de la ciencia, de la filosofía analítica, de la llamada postmodernidad; su ascendiente es notable en personajes importantes de las místicas y las religiones contemporáneas. Aquí se señala también el surgimiento y la influencia de la fenomenología en pensadores mexicanos de mediados del siglo xx. Como filosofía, se opone al positivismo y a lo que Husserl llamó el "objetivismo", se muestra cómo la fenomenología reivindica la perspectiva del sujeto y se opone a la falta de voluntad y de método de diversas escuelas para esclarecer la intencionalidad. Se introduce a nociones básicas de esta corriente como son: "fenomenología trascendental", la perspectiva del sujeto, "reducción fenomenológica", "acto intencional" y "objeto intencional", "lo constituido" y "lo constituyente", para terminar con la presentación de lo que Husserl define como "psicología fenomenológica", que es un camino al autoconocimiento del individuo y la sociedad.

  15. Carlos Esplá : anticlericalismo y masonería en un republicano español del siglo XX

    Directory of Open Access Journals (Sweden)

    Pedro Luis Angosto Vélez

    2002-01-01

    Full Text Available A través de este artículo se ha intentado dar una explicación —dentro del contexto español— al tradicional vínculo entre republicanismo, anticlericalismo y masonería. Para ello hemos recurrido a analizar la trayectoria de un hombre público, Carlos Esplá, que responde plenamente al perfil esencial del republicano del primer tercio del siglo XX. Se ha querido, otra cosa es que se haya conseguido, demostrar como en muchos casos tal vinculación no respondía tanto a cuestiones dogmáticas, como a motivaciones racionalistas o coyunturales. Es decir, buena parte de los republicanos eran anticlericales y masones, lo que no quería decir que fuesen antirreligiosos, ni tampoco que cumpliesen con los ritos y las consignas del Grande Oriente. Ambas militancias estaban estrechamente ligadas a una coyuntura histórica específica.Through this article we have tried to explain —within the spanish context— the traditional link between republicanism, anticlericalism and masonry. For that reason we have resorted to analise he career of a republic man, Carlos Esplá, who perfectly answers to the profile of the republican of the first third of the xx Century. We have, we don't know if we have succeeded, to show how in lots of cases such a connection doesn't have to do with dogmatic questions as much as rationalistic or current motives. A great idea of republicans were anticlerical and masons, which didn't mean they were anti-religious, ñor that they followed the rites and instructions of the Great East. Both affiliations/tendencies were closely linked to a specific historical situation.

  16. THEATER OF THE RUSSIAN FAR EAST SOUTH AT THE TURN OF XX – XXI CENTURIES: HISTORIOGRAPHY OF THE PROBLEM

    Directory of Open Access Journals (Sweden)

    Ms. Nalalia N. Ababkova

    2016-12-01

    Full Text Available In XX and XXI centuries in connection with the radical social changes researchers have at-tempted to analyze the current transformation and to show their influence on the political, economic, social and cultural development of the country. The most important institutions of culture, i.e. theater, has passed a long way of reforming. The goals and objectives have always reflected the needs of society, the level of cultural development, profound moral needs of different social groups, as well as state policy concerning culture. Modernization of Russian theater took place in difficult historical conditions. Historical retrospective allows us to consider the development of theatrical business in Russia at the turn of XX – XXI centuries, to identify the positive aspects and shortcomings in the work of theaters in the new reality, to identify trends in the further development. Of particular importance for the study of Russian theater period of radical change is the study of theatrical business in the south of the Far East. The border location of the region, the special composition of the population, remoteness from the center of the country determined its specific development. At present, despite the attention of the Russian government paid at the development of the Far East, the region remains being the area with the lack of the necessary infrastructure. The problem of human resources and staff turnover is much sharper than in the central regions of the Russian Federation. Therefore, the study and compilation of the historical experience gained by researchers of the Far East, is important.

  17. International Conference on Harmonisation; Guidance on Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 14 on Bacterial Endotoxins Test General Chapter; availability. Notice.

    Science.gov (United States)

    2013-10-23

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 14: Bacterial Endotoxins Test General Chapter.'' The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance provides the results of the ICH Q4B evaluation of the Bacterial Endotoxins Test General Chapter harmonized text from each of the three pharmacopoeias (United States, European, and Japanese) represented by the Pharmacopoeial Discussion Group (PDG). The guidance conveys recognition of the three pharmacopoeial methods by the three ICH regulatory regions and provides specific information regarding the recognition. The guidance is intended to recognize the interchangeability between the local regional pharmacopoeias, thus avoiding redundant testing in favor of a common testing strategy in each regulatory region. The guidance is in the form of an annex to the core guidance on the Q4B process entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions (core ICH Q4B guidance).

  18. International Conference on Harmonisation; guidance on Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 6 on Uniformity of Dosage Units General Chapter; availability. Notice.

    Science.gov (United States)

    2014-06-16

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 6: Uniformity of Dosage Units General Chapter.'' The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance provides the results of the ICH Q4B evaluation of the Uniformity of Dosage Units General Chapter harmonized text from each of the three pharmacopoeias (United States, European, and Japanese) represented by the Pharmacopoeial Discussion Group (PDG). The guidance conveys recognition of the three pharmacopoeial methods by the three ICH regulatory regions and provides specific information regarding the recognition. The guidance is intended to recognize the interchangeability between the local regional pharmacopoeias, thus avoiding redundant testing in favor of a common testing strategy in each regulatory region. The guidance is in the form of an annex to the core guidance on the Q4B process entitled ``Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions'' (core ICH Q4B guidance).

  19. International Conference on Harmonisation; Guidance on Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 13 on Bulk Density and Tapped Density of Powders General Chapter; availability. Notice.

    Science.gov (United States)

    2013-05-28

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 13: Bulk Density and Tapped Density of Powders General Chapter.'' The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance provides the results of the ICH Q4B evaluation of the Bulk Density and Tapped Density of Powders General Chapter harmonized text from each of the three pharmacopoeias (United States, European, and Japanese) represented by the Pharmacopoeial Discussion Group (PDG). The guidance conveys recognition of the three pharmacopoeial methods by the three ICH regulatory regions and provides specific information regarding the recognition. The guidance is intended to recognize the interchangeability between the local regional pharmacopoeias, thus avoiding redundant testing in favor of a common testing strategy in each regulatory region. The guidance is in the form of an annex to the core guidance on the Q4B process entitled ``Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions (core ICH Q4B guidance).

  20. International Conference on Harmonisation; Guidance on Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 9 on Tablet Friability General Chapter; availability. Notice.

    Science.gov (United States)

    2010-04-05

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions; Annex 9: Tablet Friability General Chapter." The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance provides the results of the ICH Q4B evaluation of the Tablet Friability General Chapter harmonized text from each of the three pharmacopoeias (United States, European, and Japanese) represented by the Pharmacopoeial Discussion Group (PDG). The guidance conveys recognition of the three pharmacopoeial methods by the three ICH regulatory regions and provides specific information regarding the recognition. The guidance is intended to recognize the interchangeability between the local regional pharmacopoeias, thus avoiding redundant testing in favor of a common testing strategy in each regulatory region. This guidance is in the form of an annex to the core guidance on the Q4B process entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions" (core ICH Q4B guidance).

  1. International Conference on Harmonisation; Guidance on Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the International Conference on Harmonisation Regions; Annex 7 on Dissolution Test General Chapter; availability. Notice.

    Science.gov (United States)

    2010-04-05

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions; Annex 7: Dissolution Test General Chapter." The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance provides the results of the ICH Q4B evaluation of the Dissolution Test General Chapter harmonized text from each of the three pharmacopoeias (United States, European, and Japanese) represented by the Pharmacopoeial Discussion Group (PDG). The guidance conveys recognition of the three pharmacopoeial methods by the three ICH regulatory regions and provides specific information regarding the recognition. The guidance is intended to recognize the interchangeability between the local regional pharmacopoeias, thus avoiding redundant testing in favor of a common testing strategy in each regulatory region. This guidance is in the form of an annex to the core guidance on the Q4B process entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions" (core ICH Q4B guidance).

  2. International Conference on Harmonisation; guidance on Q4B Evaluation and Recommendation of Pharmacopoeial texts for use in the International Conference on Harmonisation Regions; Annex 12 on Analytical Sieving General Chapter; availability. Notice.

    Science.gov (United States)

    2010-09-02

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions; Annex 12: Analytical Sieving General Chapter." The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance provides the results of the ICH Q4B evaluation of the Analytical Sieving General Chapter harmonized text from each of the three pharmacopoeias (United States, European, and Japanese) represented by the Pharmacopoeial Discussion Group (PDG). The guidance conveys recognition of the three pharmacopoeial methods by the three ICH regulatory regions and provides specific information regarding the recognition. The guidance is intended to recognize the interchangeability between the local regional pharmacopoeias, thus avoiding redundant testing in favor of a common testing strategy in each regulatory region. This guidance is in the form of an annex to the core guidance on the Q4B process entitled "Q4B Evaluation and Recommendation of Pharmacopoeial Texts for Use in the ICH Regions" (the core ICH Q4B guidance).

  3. Principales exposiciones de arte en Chile durante el siglo XX: circulación, recepcion y debates escriturales = Principais exposições de arte no Chile durante o século XX: circulação, recepção e debates escriturais = Principal art expositions in Chile during the XX century: circulation, reception and scriptural debates

    Directory of Open Access Journals (Sweden)

    Zamorano Pérez, Pedro Emilio

    2013-01-01

    Full Text Available O cenário das Artes Visuais no Chile durante o século XX esteve fortemente marcado por um conjunto de exposições artísticas que, por sua importância e propostas, tiveram capacidade de se tornarem marcos importantes de mudanças na arte nacional. Algumas o marcaram pelo caráter simbólico e oficial que tiveram, como a de 1910. Esta exposição, além da presença de grande quantidade de países, marcou solenemente as atividades comemorativas do primeiro centenário da Independência Nacional. Outras, como a do grupo Montparnase, a de Tótila Albert e a De Manet aos Nossos Dias, por trazer e instalar novos conceitos e debates estéticos no país

  4. Annex 2. The cosmetics industry

    OpenAIRE

    2013-01-01

    OVERVIEW The cosmetics industry is probably among the most promising for utilisation of natural substances. The dermocosmetics market is booming and, as the use of animal-based substances declines, natural marine or plant-based substances are increasingly sought after. Scientific approach “The cosmetics industry bases a lot of its communication on natural substances. But there is genuine scientific work going on behind the fashion for environmentalism”, says Patrice André, Director of the Dio...

  5. Características del parasitismo intestinal en niños de dos comunidades del policlínico "XX Aniversario" Intestinal parasitism features in children from two communities of "XX Aniversario" Polyclinic

    Directory of Open Access Journals (Sweden)

    Gladys Antonia Cueto Montoya

    2009-03-01

    Full Text Available Dentro de las enfermedades infecciosas, aun en estos modernos tiempos, el parasitismo intestinal constituye un problema para países en vías de desarrollo y para los altamente desarrollados. Para caracterizar el parasitismo intestinal en niños de 1 a 12 años se realizó un estudio descriptivo transversal durante los meses de mayo a julio de 2007, en 2 comunidades, una suburbana del reparto "América Latina" y otra urbana del reparto "Virginia", ambas pertenecientes al área de salud del Policlínico "XX Aniversario", del municipio de Santa Clara. Se visitaron las viviendas y se aplicó encuesta a los padres para obtener datos al respecto. Fueron estudiados 243 niños de ambas comunidades, a quienes se les tomó muestras de heces fecales y región anal por el método de Graham. La frecuencia general de parasitismo fue de 65,8 %, mayor en los niños del reparto "América Latina", y las especies más frecuentes fueron Giardia lamblia y Enterobius vermicularis. Una inadecuada desinfección del agua, la presencia de vectores, comerse las uñas, la poca higiene después del contacto con animales, la presencia de estos en el hogar, no lavar las verduras, andar descalzos y el hacinamiento, fueron factores que favorecieron las parasitosis.Included in infectious diseases, yet at present times, intestinal parasitism is a problem for underdeveloped countries, and for those highly developed. To characterize intestinal parasitism in children aged 1 and 12, we carried out a cross-sectional descriptive study during May to July, 2007 in 2 communities, one suburban of "América Latina" parcel and other urban of "Virginia" parcel, both served by "XX Aniversario" Polyclinic of Santa Clara municipality. We visited homes and we applied survey to parents to obtain data in this respect. A total of 243 children ware studied in both communities, taking samples of feces and of anal region by Graham method. General frequency of parasitism was of 6,8 % greater in the

  6. The Introduction of Western Psychiatry into Korea (II Psychiatric Education in Korea during the Forced Japanese Annexation of Korea (1910-1945

    Directory of Open Access Journals (Sweden)

    CHUNG Wonyong,

    2006-12-01

    Full Text Available In the second report in our series on the historical investigation on the introduction of western psychiatry into Korea, authors deal with the status of psychiatric education during the Japanese forced annexation of Korea. The first lecture on psychiatry in Korea under the title "Mental Diseases" was held in Dae-han-eui-won around 1910. In 1913, the Department of Psychiatry branched off from the Department of Internal Medicine of Chosen-sotoku-fu-iing, the Colonial Governmental Clinic, the successor of Dae-han-eui-won. The chairman, Professor Suiju Sinji; and the Korean assistant Sim Ho-seop administered the psychiatric ward with 35 beds. Since 1913, an Australian missionary psychiatrist, Dr. McLaren began to teach neurology and psychiatry at Severance Union Medical College and established a Department of Psychiatry in 1923. Dr. McLaren was a faithful Christian and open minded toward Oriental religious thought such as in Buddhism and Taoism. He devoted himself to the humanitarian care of mentally ill patients and served there until 1937 when he had to leave the land due to Japanese persecution. His disciple, Dr. Lee Jung Cheol succeeded the chair of the Psychiatric Department of Severance Medical College and served until 1939. In 1916, Keijo(Seoul Medical College was established and in 1928, Keijo Teikoku Daigaku(Imperial University. From 1929 to 1941, the Department of Neurology and Psychiatry of Keijo Imperial University grew under the chairmanship of Professor Kubo Kioji followed by Professor Watanabe until 1945. Many assistants including a few Koreans were gathered to the Department for training and research. The main textbook used for the psychiatric education for medical students in Korea was on Kraepelinian German Psychiatry translated and edited by Japanese psychiatrists. Lectures and clerkships for Neurology and Psychiatry were allocated generally in the curriculum for senior students for weekly 1-3 hours. Postgraduate professional

  7. [The introduction of Western psychiatry into Korea (II). Psychiatric education in Korea during the forced Japanese annexation of Korea (1910-1945)].

    Science.gov (United States)

    Chung, Wonyong; Lee, Nami; Rhi, Bou-Yong

    2006-12-01

    In the second report in our series on the historical investigation on the introduction of western psychiatry into Korea, authors deal with the status of psychiatric education during the Japanese forced annexation of Korea. The first lecture on psychiatry in Korea under the title "Mental Diseases" was held in Dae-han-eui-won around 1910. In 1913, the Department of Psychiatry branched off from the Department of Internal Medicine of Chosen-sotoku-fu-iing, the Colonial Governmental Clinic, the successor of Dae-han-eui-won. The chairman, Professor Suiju Sinji; and the Korean assistant Sim Ho-seop administered the psychiatric ward with 35 beds. Since 1913, an Australian missionary psychiatrist, Dr. McLaren began to teach neurology and psychiatry at Severance Union Medical College and established a Department of Psychiatry in 1923. Dr. McLaren was a faithful Christian and open minded toward Oriental religious thought such as in Buddhism and Taoism. He devoted himself to the humanitarian care of mentally ill patients and served there until 1937 when he had to leave the land due to Japanese persecution. His disciple, Dr. Lee Jung Cheol succeeded the chair of the Psychiatric Department of Severance Medical College and served until 1939. In 1916, Keijo (Seoul) Medical College was established and in 1928, Keijo Teikoku Daigaku (Imperial University). From 1929 to 1941, the Department of Neurology and Psychiatry of Keijo Imperial University grew under the chairmanship of Professor Kubo Kioji followed by Professor Watanabe until 1945. Many assistants including a few Koreans were gathered to the Department for training and research. The main textbook used for the psychiatric education for medical students in Korea was on Kraepelinian German Psychiatry translated and edited by Japanese psychiatrists. Lectures and clerkships for Neurology and Psychiatry were allocated generally in the curriculum for senior students for weekly 1-3 hours. Postgraduate professional training for the

  8. ENTRE CARTILHAS E LIVROS DE ALFABETIZAÇÃO: LER E ESCREVER EM BIRIGUI NO SÉCULO XX

    Directory of Open Access Journals (Sweden)

    Áurea Esteves Serra

    2014-04-01

    Full Text Available O presente trabalho de cunho histórico teve como objetivo mapear as cartilhas e os livros de alfabetização que circularam na cidade de Birigui no século XX. Para que este objetivo fosse alcançado buscou-se em bibliografia especializada apropriar-se dos temas que envolvem a temática do estudo. Para o mapeamento das cartilhas e dos livros de alfabetização mais usados para ensinar a ler e escrever no presente município foi realizado entrevistas e levantamento de dados em todas as bibliotecas da cidade de Birigui. Com o levantamento realizado foi possível se chegar ao resultado final deste trabalho, que se apresenta dividido em três partes: na primeira, apresenta-se um breve histórico sobre a alfabetização, desde o final do século XIX, até a reforma no modelo de ensino com a implantação do construtivismo; em seguida apresentam-se os manuais de alfabetização: as cartilhas e os livros didáticos, discorrendo sobre suas características e utilização na alfabetização brasileira. Na segunda parte, inicia-se com um breve histórico sobre a cidade de Birigui, desde sua fundação, os primeiros habitantes, as primeiras casas, igrejas, escolas e fábricas, fatos importantes que aqui ocorreram, possibilitando o desenvolvimento do município, para em seguida apresentar os manuais escolares localizados nas bibliotecas da cidade, como também os citados nas entrevistas com os ex-professores alfabetizadores do município. Ao final, aponta-se uma junção e análise das duas primeiras partes, que nos remete a compreender como era direcionada a questão do ler e escrever em Birigui no século XX, isto é quais materiais foram utilizados para alfabetização. Desse modo contribui-se com um registro por meio do qual as futuras gerações poderão conhecer como era a alfabetização naquele período tendo por objetivo primeiro a preservação da memória e do patrimônio cultural quanto dos manuais utilizados.   Palavras-chaves: alfabetiza

  9. The study of the hydrological regime extreme effects of the Caspian Sea during the XX-XXI centuries

    Science.gov (United States)

    Yaitskaya, Natalia

    2016-04-01

    The Caspian Sea - the unique largest enclosed inland body of water on Earth. Significant periodic sea level fluctuations are a typical feature of the sea. In the XIX-XX centuries a number of comprehensive studies of the Caspian Sea was carried out. The results are published in the papers, monographs and climatic atlases. But a number of fundamental questions about the features of the hydrological regime of the Caspian Sea is still open: 1. How does the water circulation change during the level variations? 2. What is the effect of heterogeneity of evaporation from the water surface on the formation of the flow field in the conditions of long-term level changes? 3. How does the water salinity regime change depending on the sea level position, water circulation, river flow and different climatic influences? 4. What is the effect of extreme events (multi-hazards) (ice, storms, destruction of the coasts) on coastal infrastructure? In 2016, the project aims to study hydrological regime extreme effects of the Caspian Sea was supported by the Russian Foundation for Basic Research. Within this project all of the above problems will be solved. Geographic information system "Caspian Sea" for the storage and data processing, including a database of primary oceanographic information for the period of instrumental observations (1897-2013), cartographic database (1921-2011) and tools for multidimensional analysis of spatio-temporal information is the basis of the study. The scheme of interconnected hydrodynamic models (Caspian Sea MODel - Ocean Model - Wind wave model) was developed. The important factors are taken into account in the structure of the models: long-term and seasonal dynamics of the sea waves parameters, new long-term values of evaporation from the shallow waters areas of the Caspian Sea, water circulation. Schemes of general seasonal circulation of the Caspian Sea and the Northern Caspian at different positions of the sea level in XX-XXI centuries using

  10. A enfermeira-chefe como figura-tipo em meados do século XX La enfermera-jefe como figura-tipo en mediados del siglo XX The head nurse as figure - type in the middle of the XX century

    Directory of Open Access Journals (Sweden)

    Lílian Silva de França

    2004-08-01

    Full Text Available Estudo histórico-social sobre a atuação da enfermeira-chefe nos hospitais, em meados do século XX. Objetivos: descrever o teor da matéria publicada na Revista Anais de Enfermagem sobre a enfermeira-chefe; analisar a atuação das instrutoras da Escola Anna Nery (EAN nos campos de estágio e comparar os registros das atas de reuniões sobre essa atuação com os conteúdos selecionados na citada Revista. Acervos: Centro de Documentação, Biblioteca de Pós-Graduação e Nuphebras, todos da EEAN. Evidenciou-se um consenso entre autoras dos artigos e as enfermeiras diplomadas da EAN que, como chefes de serviço e instrutoras das alunas, eram regidas por uma forte ação coordenadora e centralizadora da diretora da EAN, contribuindo decisivamente na elevação do padrão do serviço de enfermagem dos hospitais onde atuavam.Estudio histórico-social sobre la actuación de la enfermera-jefe en los hospitales, en mediados do siglo XX. Objetivos: describir el tenor de la materia publicada en la Revista Anais de Enfermagem ("Revista Anales de Enfermería" sobre la enfermera- jefe; analizar la actuación de las instructoras de la Escuela Anna Nery (EAN en los campos de práctica laboral y comparar los registros de las actas de reuniones sobre esa actuación con los contenidos seleccionados en la citada Revista. Acervos: Centro de Documentación, Biblioteca de Pos grado y Nuphebras, todos de la EEAN. Se evidenció un consenso entre las autoras de los artículos y las enfermeras diplomadas de la EAN que, como jefes de servicio y instructoras de las alunas, eran regidas por una fuerte acción coordinadora y centralizadora de la directora de la EAN, contribuyendo decisivamente para la elevación del padrón del servicio de enfermería de los hospitales donde trabajaban.Social _ historical study about the actuation of the head nurse in the hospitals, in the middle of the XX century. Objectives: describe the meaning of the matter published in the Revista

  11. The Design and Realization of XX Info System Based on Solaris%基于Solaris的综合信息系统设计与实现

    Institute of Scientific and Technical Information of China (English)

    喻刚; 王国生; 张磊

    2012-01-01

    Compared with Windows OS, Solaris OS has the advantage of high stability and perfect network function. In order to provide a more steady platform for data transmitting storage and display, We decided to transplant XX info system to Solaris OS. This paper has introduced the design and realization of XX info system based on Solaris.%相对Windows操作系统,Solaris具有稳定性高、网络功能完善等优点。为了提高综合信息系统的稳定性,将其从Windows移植到Solaris操作系统上,从而为外场试验各监测项目提供了一个更加稳定的数据传输、存储和显示平台。

  12. Diagnóstico prenatal de mosaicismo 45,X/46,XX con presencia del gen SRY. Presentación de un caso

    OpenAIRE

    Pedro Alí Díaz-Véliz Jiménez; María Antonia Ocaña Gil; Leydi María Sosa Águila; Belkis Vidal Hernández

    2013-01-01

    El cariotipo más frecuente del Síndrome de Turner es 45,X, aunque también puede presentarse como mosaico 45,X/46,XX. En el Centro Provincial de Genética Médica de Cienfuegos se le realizó la amniocentesis a una gestante de 42 años de edad, detectándose un mosaico de Síndrome de Turner (45,X/46,XX). Por ultrasonido se diagnosticó un varón, por lo que se envió una muestra de líquido amniótico al Centro Nacional de Genética Médica para corroborarlo y se indicó realizar estudio del gen SRY, cuyo ...

  13. El ambulantaje en imágenes : una historia de representaciones de la venta callejera en la Ciudad de México (siglos XVIII-XX)

    OpenAIRE

    Arnaud Exbalin; Georgina Rodríguez; Martha de Alba

    2007-01-01

    Este trabajo es un análisis de las representaciones del ambulantaje (comercio ambulante, trabajo en la vía pública) en la Ciudad de México, a través de la pintura de castas del siglo XVIII, la fotografía de finales del siglo XIX y principios del XX y la fotografía de prensa de finales del siglo XX. Este ensayo observa las transformaciones que esta actividad ha tenido en las diferentes épocas de desarrollo de la ciudad de México, a través del análisis de los productores de la imagen y del imag...

  14. El ambulantaje en imágenes : una historia de representaciones de la venta callejera en la Ciudad de México (siglos XVIII-XX)1

    OpenAIRE

    De Alba, Martha; Exbalin, Arnaud; Rodríguez, Georgina

    2014-01-01

    Este trabajo es un análisis de las representaciones del ambulantaje (comercio ambulante, trabajo en la vía pública) en la Ciudad de México, a través de la pintura de castas del siglo XVIII, la fotografía de finales del siglo XIX y principios del XX y la fotografía de prensa de finales del siglo XX. Este ensayo observa las transformaciones que esta actividad ha tenido en las diferentes épocas de desarrollo de la ciudad de México, a través del análisis de los productores de la imagen y del imag...

  15. Bronio Railos politinės pažiūros ir veikla XX a. ketvirtajame dešimtmetyje

    OpenAIRE

    Linauskas, Vaidas

    2007-01-01

    Magistrinio darbo tiriamasis objektas – Bronio Railos, žymaus lietuvių intelektualo, buvusio trečiafrontininko, tautininko, po Antrojo pasaulinio karo perėjusio į liberalų stovyklą, politinės pažiūros ir veikla XX a. ketvirtajame dešimtmetyje. Ši tema istoriografijoje iš viso nėra sulaukusi tyrėjų dėmesio. Tyrimas atliktas remiantis gausiais istorijos šaltiniais. Atlikus tyrimą paaiškėjo, kad Bronys Raila - kontraversiška XX a. Lietuvos istorijos asmenybė, neturėjusi aiškių ideologinių nuosta...

  16. Por uma História das Relações entre Teatro e Neurociência no Século XX

    Directory of Open Access Journals (Sweden)

    Gabriele

    2014-05-01

    Full Text Available Este artigo aborda algumas reflexões preliminares referentes à história do teatro e da neurociência no século XX. Até agora, a história do teatro no século XX era demasiadamente fragmentada e irregular, perdendo-se nas conexões subterrâneas que, direta ou indiretamente, ligavam diferentes experiências. O artigo pretende colocar em evidência os problemas recorrentes desses encontros. A hipótese do ensaio refere-se à possibilidade de reunir e agrupar grande parte das relações entre teatro e neurociência em torno de quatro trajetórias: a fisiologia da ação, a fisiologia das emoções, a etologia e os estudos sobre a percepção do espectador

  17. Synthèse sur la modélisation thermo-hygro-aéraulique des bâtiments dans l’Annexe 41 de l’Agence Internationale de l’Energie

    DEFF Research Database (Denmark)

    Woloszyn, Monika; Rode, Carsten; Roux, Jean-Jacques

    2008-01-01

    L'Annexe 41 de l'Agence Internationale de l'Energie(programme ESBCS) s'est intéressée aux transferts couplés thermo-hygro-aérauliques dans les bâtiments. L'objectif etait d'une part d'améliorer les connaissances scientifiques et d'autre part d'analyser les effets de la réponse couplée thermo...... la modélisation thermo-hygro-aéraulique des bâtiments. Six exercices de simulation ont été conduits, donnant des éléments de validation des codes de calcul. Par ailleurs des travaux de modélisation ont été développés à plusieurs échelles : des modèles globaux simplifiés, à travers des modèles multi...

  18. RESEÑA de : Larrinaga, Carlos: Diputaciones provinciales e infraestructuras en el País Vasco durante el primer tercio del siglo XX (1900–1936. Bilbao: Universidad del País Vasco, 2013.

    Directory of Open Access Journals (Sweden)

    Rafael Barquín Gil

    2014-05-01

    Full Text Available RESEÑA de : Larrinaga, Carlos: Diputaciones provinciales e infraestructuras en el País Vasco durante el primer tercio del siglo XX (1900–1936. Bilbao: Universidad del País Vasco, 2013.

  19. Mudança em dois períodos do século XX: inter-relacionando análises em tempo aparente

    Directory of Open Access Journals (Sweden)

    Maria Alice Tavares

    2011-12-01

    Full Text Available À luz da sociolinguística variacionista, tomo os conectores E, AÍ, DAÍ e ENTÃO como variantes da variável dependente “sequenciação retroativo-propulsora”. Os dados são oriundos das seguintes fontes: (i As vinhas da ira, romance escrito por John Steinbeck em 1939, cuja tradução brasileira, datada de 1940, apresenta marcas da fala de classes populares do Rio Grande do Sul; (ii 48 entrevistas provenientes do Banco de Dados VARSUL de Florianópolis, que foram coletadas ao longo da última década do século XX. Tenho por objetivos: (i buscar indícios de mudança em tempo real; (ii buscar indícios de mudança em tempo aparente através do controle da variável social idade; (iii inter-relacionar os resultados referentes à variável idade nos dois períodos de tempo considerados. Obtive indícios de mudança em tempo real e de mudança em tempo aparente. Além disso, fiz uma inter-relação entre os resultados referentes à variável idade no final da primeira metade do século XX e no final da segunda metade do século XX. Baseada nessa inter-relação, consegui traçar um panorama mais detalhado das mudanças possivelmente sofridas por E, AÍ, DAÍ e ENTÃO ao longo do século XX.

  20. Mudança em dois períodos do século XX: inter-relacionando análises em tempo aparente

    Directory of Open Access Journals (Sweden)

    Maria Alice Tavares

    2011-12-01

    Full Text Available À luz da sociolinguística variacionista, tomo os conectores E, AÍ, DAÍ e ENTÃO como variantes da variável dependente "sequenciação retroativo-propulsora". Os dados são oriundos das seguintes fontes: (i As vinhas da ira, romance escrito por John Steinbeck em 1939, cuja tradução brasileira, datada de 1940, apresenta marcas da fala de classes populares do Rio Grande do Sul; (ii 48 entrevistas provenientes do Banco de Dados VARSUL de Florianópolis, que foram coletadas ao longo da última década do século XX. Tenho por objetivos: (i buscar indícios de mudança em tempo real; (ii buscar indícios de mudança em tempo aparente através do controle da variável social idade; (iii inter-relacionar os resultados referentes à variável idade nos dois períodos de tempo considerados. Obtive indícios de mudança em tempo real e de mudança em tempo aparente. Além disso, fiz uma inter-relação entre os resultados referentes à variável idade no final da primeira metade do século XX e no final da segunda metade do século XX. Baseada nessa inter-relação, consegui traçar um panorama mais detalhado das mudanças possivelmente sofridas por E, AÍ, DAÍ e ENTÃO ao longo do século XX.

  1. La figura histórico-mítica de Quetzalcóatl (Serpiente Emplumada) como objeto para el discurso teatral: tres ejemplos del siglo XX

    OpenAIRE

    Albert Alonso, Alberto

    2015-01-01

    Quetzalcóatl (Serpiente Emplumada) ha sido considerada una de las principales divinidades de la religión mesoamericana. La formación de la identidad mexicana está estrechamente ligada a esta trayectoria histórico-mítica. En el presente trabajo, la figura de Quetzalcóatl es abordada en tres textos teatrales de la segunda mitad del siglo XX que, desde diferentes perspectivas, configuran un discurso teatral independiente.

  2. Hybrid plan verification for intensity-modulated radiation therapy (IMRT) using the 2D ionization chamber array I'mRT MatriXX--a feasibility study.

    Science.gov (United States)

    Dobler, Barbara; Streck, Natalia; Klein, Elisabeth; Loeschel, Rainer; Haertl, Petra; Koelbl, Oliver

    2010-01-21

    The 2D ionization chamber array I'mRT MatriXX (IBA, Schwarzenbruck, Germany) has been developed for absolute 2D dosimetry and verification of intensity-modulated radiation therapy (IMRT) for perpendicular beam incidence. The aim of this study is to evaluate the applicability of I'mRT MatriXX for oblique beam incidence and hybrid plan verification of IMRT with original gantry angles. For the assessment of angular dependence, open fields with gantry angles in steps of 10 degrees were calculated on a CT scan of I'mRT MatriXX. For hybrid plan verification, 17 clinical IMRT plans and one rotational plan were used. Calculations were performed with pencil beam (PB), collapsed cone (CC) and Monte Carlo (MC) methods, which had been previously validated. Measurements were conducted on an Elekta SynergyS linear accelerator. To assess the potential and limitations of the system, gamma evaluation was performed with different dose tolerances and distances to agreement. Hybrid plan verification passed the gamma test with 4% dose tolerance and 3 mm distance to agreement in all cases, in 82-88% of the cases for tolerances of 3%/3 mm, and in 59-76% of the cases if 3%/2 mm were used. Separate evaluation of the low dose and high dose regions showed that I'mRT MatriXX can be used for hybrid plan verification of IMRT plans within 3% dose tolerance and 3 mm distance to agreement with a relaxed dose tolerance of 4% in the low dose region outside the multileaf collimator (MLC).

  3. Review of Outcome Information in 46,XX Patients with Congenital Adrenal Hyperplasia Assigned/Reared Male: What Does It Say about Gender Assignment?

    OpenAIRE

    Lee, Peter A; Houk, Christopher P.

    2010-01-01

    There is ample historical verification of 46,XX congenital adrenal hyperplasia (CAH) patients being born with essentially male genitaliawhile outcome information is scant. Prior to glucocorticoid therapy, most patients died very young from adrenal insufficiency. Most available reports from laterchildhood, contain little information concerning sexual identity. Reports on older individuals lack adequate information about sexual identity and quality of life. The difficulty in assessing the relat...

  4. Review of Outcome Information in 46,XX Patients with Congenital Adrenal Hyperplasia Assigned/Reared Male: What Does It Say about Gender Assignment?

    OpenAIRE

    Lee PeterA; Houk ChristopherP

    2010-01-01

    There is ample historical verification of 46,XX congenital adrenal hyperplasia (CAH) patients being born with essentially male genitaliawhile outcome information is scant. Prior to glucocorticoid therapy, most patients died very young from adrenal insufficiency. Most available reports from laterchildhood, contain little information concerning sexual identity. Reports on older individuals lack adequate information about sexual identity and quality of life. The difficulty in assessing the rela...

  5. Evolución de la música de cámara en Ecuador en el formato de quinteto de vientos maderas durante el siglo XX

    OpenAIRE

    Morocho Guamo, Paulo César

    2014-01-01

    El presente trabajo investigativo tiene por objeto el estudio formal de los quintetos para vientos maderas conformado por flauta, oboe, clarinete, fagot y corno francés, escritos por compositores académicos ecuatorianos durante el siglo XX, las obras que se encontrarán son: • Quinteto de Alientos. Compositor Luis Humberto Salgado. • Cinco miniaturas. Compositor Gerardo Guevara. • Danza profana. Compositor Marcelo Ruano. • Quinteto silvestre. Compositor Diego Luzuriaga. En este ...

  6. Diagnóstico prenatal de mosaicismo 45,X/46,XX con presencia del gen SRY. Presentación de un caso

    Directory of Open Access Journals (Sweden)

    Pedro Alí Díaz-Véliz Jiménez

    2013-10-01

    Full Text Available El cariotipo más frecuente del Síndrome de Turner es 45,X, aunque también puede presentarse como mosaico 45,X/46,XX. En el Centro Provincial de Genética Médica de Cienfuegos se le realizó la amniocentesis a una gestante de 42 años de edad, detectándose un mosaico de Síndrome de Turner (45,X/46,XX. Por ultrasonido se diagnosticó un varón, por lo que se envió una muestra de líquido amniótico al Centro Nacional de Genética Médica para corroborarlo y se indicó realizar estudio del gen SRY, cuyo resultado fue positivo. La gestante decidió interrumpir el embarazo. El reporte de anatomía patológica informó de cadáver de feto de 25,3 semanas de gestación, con pene y bolsas escrotales morfológicamente normales, con alteraciones por quistificación e hipoplasia de la próstata y vesículas seminales y ausencia testicular. En la literatura se reportan casos de varones 46,XX, como poco frecuentes y se refieren menos aún aquellos donde se combina un mosaico 45,X/46,XX con presencia del gen SRY, hecho en que radica el interés del caso. En este artículo se expone el resultado de un diagnóstico prenatal de esta aberración cromosómica de tan baja frecuencia.

  7. A Newborn Case of Hypoxic-Ischemic Encephalopathy Accompanied with 46,XX,-21,+t(21;21)%新生儿缺氧性脑病伴46,XX,-21,+t(21;21)罕见核型一例

    Institute of Scientific and Technical Information of China (English)

    付建华; 宁建英; 张青; 付睿婷; 李露霞

    2003-01-01

    This report describes a cytogenetic aberration in one neonatal patient with hypoxic-ischemic encephalopathy. A rare karyotype,46,XX, -21, +t(21;21), was detected. This de nono chromosomal abnormality may be caused by the meiotic non-disjunction of chromosomes during gametogenesis along with the formation of Robertsonian translocation between homologous chromosome 21.

  8. Observation of the Curative Effect of Fukeqianjin Capsule Combined With Antibiotics in the Treatment of Chronic Annexitis%妇科千金胶囊联合抗生素治疗慢性附件炎疗效观察

    Institute of Scientific and Technical Information of China (English)

    仉瑞

    2016-01-01

    目的:探讨妇科千金胶囊联合抗生素治疗慢性附件炎的效果。方法随机将180例慢性附件炎患者平均分为两组,对照组行常规方法治疗,观察组给予妇科千金胶囊联合抗生素治疗。比较两组临床效果。结果观察组有效率(97.78%)、复发率(6.67%)及不良反应发生率(8.89%)均优于对照组(71.11%,31.1%,20.0%)(P<0.05)。结论妇科千金胶囊联合抗生素治疗慢性附件炎效果理想。%ObjectiveTo study the curative effect of Fukeqianjin capsule combined antibiotics in the treatment of chronic annexitis.Methods 180 cases of patients were divided into two groups,control group was used about conventional therapy,observation group was used about Fukeqianjin capsule combined antibiotics,to compare the efficacy of two groups.ResultsThe effective rate (97.78%),recurrence rate (6.67%),the incidence rate of adverse reaction (8.89%) of observation group were better than those of control group (P<0.05).Conclusion Fukeqianjin capsule combined antibiotics in the treatment of chronic annexitis has ideal effects.

  9. Scientific Opinion on the evaluation of the substances currently on the list in the annex to Commission Directive 96/3/EC as acceptable previous cargoes for edible fats and oils – Part III of III

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Contaminants in the Food Chain (CONTAM

    2012-12-01

    Full Text Available Shipping of edible fats and oils into Europe is permitted in bulk tanks, in which substances, included in a positive list, had been previously transported. The European Commission requested EFSA to evaluate the list of substances in the Annex to Commission Directive 96/3/EC as acceptable previous cargoes for edible fats and oils, taking into account its review of the Scientific Committee on Food criteria for acceptable previous cargoes and criteria proposed by the Codex Committee for Fats and Oils. This is the third and last scientific opinion of the EFSA Panel on Contaminants in the Food Chain (CONTAM Panel on this topic, in which sixteen of these substances or groups of substances have been evaluated. The CONTAM Panel concluded that sodium silicate (water glass solution, iso-octanol, iso-nonanol, iso-decanol, 1,3-propanediol, isobutyl acetate, sec-butyl acetate, tert-butyl acetate, n-butyl acetate, propylene tetramer, paraffin wax, candelilla wax, white mineral oils and glycerol would not be of health concern as previous cargoes. The CONTAM Panel concluded that carnauba wax was not acceptable as a previous cargo because of its insolubility in water and high melting point, which raise concerns regarding the efficiency of tank cleaning. There was insufficient information available on the composition of montan wax for the CONTAM Panel to conclude that it would be of no health concern when used as previous cargo and hence it does not meet the criteria for acceptability as previous cargo. The CONTAM Panel made several recommendations regarding the way in which the substances are described in the Annex to Commission Directive 96/3/EC, to correct inaccuracies and to better reflect current transport practices.

  10. La villa de Noia (A Coruña. Recorrido por su arquitectura de la primera mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Vázquez Astorga, Mónica

    2010-12-01

    Full Text Available This text is a result of a lengthy investigation that explores the architecture that designed and constructed in Noia (A Coruña during first half of the 20th century. The industrial and economic growth of this urban nucleo, favored the temporary introduction of the rising architectonic styles, designed by the hand of prestigious architects of the time, rooted in in the Galician provincial capitals. This architecture essentially is notable in the construction of houses and establishments of leisure and spectacle, in which the triumph of the new architectonic languages was possible.

    Este texto está dedicado a la arquitectura proyectada y construida en Noia (A Coruña en la primera mitad del siglo XX. El crecimiento industrial y económico de este núcleo urbano favoreció la temperada introducción de los estilos arquitectónicos en alza en ese momento, que vino de la mano de prestigiosos arquitectos de la época, asentados en las capitales de provincia gallegas. Esta arquitectura se concreta fundamentalmente en edificios de viviendas y en establecimientos de ocio y espectáculo, en los que fue posible el triunfo de los nuevos lenguajes arquitectónicos.

  11. Movement of Goc and podgorina population in the second half of XX and on the begging of XXI century

    Directory of Open Access Journals (Sweden)

    Kovačević Tamara

    2007-01-01

    Full Text Available Analysis of movement of Goc and podgorina population in the second half of XX and on the begging of XXI century is elaborated in the paper. Parameters of natural and mechanical movement of population have showed that population number of Goc and podgorina increase because of mechanical movement. In the period between two last censuses, the greater part of immigrants has arrived. Refugees and outcast population from Ex-Yugoslav Republics represents smaller part of immigrants. Greater part of immigrants belongs to population from others municipalities of Republic of Serbia, especially to population from Kosovo and from municipalities of Raska region. According to the results of exploration, there are many differences in the movements of population between twenty six settlements of Goc and podgorina. As consequences of that, among other, there are some geographic factors. Among geographic factors, traffic-geographic position and relief are relieved. Importance of the paper is that it enriches the knowledge about West Morava valley and Goc, which is northernmost mountain of Kopaonik mountain system.

  12. Thermal quantum and classical correlations in a two-qubit XX model in a nonuniform external magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Hassan, Ali Saif M [Department of Physics, University of Amran, Amran (Yemen); Lari, Behzad; Joag, Pramod S, E-mail: alisaif73@gmail.co, E-mail: behzadlari1979@yahoo.co, E-mail: pramod@physics.unipune.ac.i [Department of Physics, University of Pune, Pune 411007 (India)

    2010-12-03

    We investigate how thermal quantum discord (QD) and classical correlations (CC) of a two-qubit one-dimensional XX Heisenberg chain in thermal equilibrium depend on the temperature of the bath as well as on nonuniform external magnetic fields applied to two qubits and varied separately. We show that the behavior of QD differs in many unexpected ways from the thermal entanglement (EOF). For the nonuniform case (B{sub 1} = -B{sub 2}), we find that QD and CC are equal for all values of (B{sub 1} = -B{sub 2}) and for different temperatures. We show that, in this case, the thermal states of the system belong to a class of mixed states and satisfy certain conditions under which QD and CC are equal. The specification of this class and the corresponding conditions are completely general and apply to any quantum system in a state in this class satisfying these conditions. We further find that the relative contributions of QD and CC can be controlled easily by changing the relative magnitudes of B{sub 1} and B{sub 2}. Finally, we connect our results with the monogamy relations between the EOF, CC and the QD of two qubits and the environment.

  13. Chromosome banding in Amphibia. XXIX. The primitive XY/XX sex chromosomes of Hyla femoralis (Anura, Hylidae).

    Science.gov (United States)

    Schmid, M; Steinlein, C

    2003-01-01

    The karyotype of the pine woods treefrog, Hyla femoralis, is characterized by primitive XY female/XX male sex chromosomes. The sole difference between the X and the Y is the presence of a nucleolus organizer region (NOR) in the X. Due to a deletion of the NOR in the Y, this chromosome is distinctly smaller than the X. Since no autosomal NORs exist in the karyotype of this species, the NOR deletion in the Y results in a sex-specific difference in the number of ribosomal RNA genes, with a female:male ratio of about 2:1. Interphase nuclei of male animals contain always one silver-stained nucleolus, whereas most nuclei of female specimens exhibit two nucleoli. This is in agreement with the absence of dosage compensation for sex-linked genes in amphibian cells. The consequences of the loss of about 50% of ribosomal RNA genes for the viability of male individuals and spermatogenesis are discussed. Copyright 2003 S. Karger AG, Basel

  14. “Postdramatic” Tendencies in the German Dramatic Art at the End of XX — Beginning of XXI Centuries

    Directory of Open Access Journals (Sweden)

    Sharypina T. A.

    2014-01-01

    Full Text Available Disintegration and integration processes of German culture of the end of XX and beginning of XXI are analyzed by giving examples of stage interpretations of mythological plots in theatres of present-day Germany. It is stated that pluralism and multidimensionality of the spiritual experience of modern cultural workers, both writers (such as V. Braun, S. Schutz, B. Strauss etc. and leading producers (D. Dorn, S. Nubling and others contribute to the drawing up of a special syncretic style of theatre staging, first of all with the use of the ancient material which is appropriate for it. Ancient myth, as one of the steadiest constants of the European literature, gives a universal key to the interpretation of various cultural and ethic-aesthetic phenomena that are irredundant to nothing else. There is a sociocultural context in which German spectators nowadays try to comprehend these dramaturgy phenomena; and there is a genuine stage director interpretations of them (in Aachen City Theatre, Dramatic Theatre of Hannover, Munich Chamber Theatre etc. that not only lead to the decanonization of the classic model, but also pinpoint problematique of these performances.

  15. Mujeres dramaturgas obreras a principios del siglo XX en Chile y la estrategia de la escritura solapada

    Directory of Open Access Journals (Sweden)

    Miguel Alvarado Borgoño

    2016-01-01

    Full Text Available Este artículo se constituye desde el estudio y presentación explo - ratoria de una creación escritural que a la vez es una “no escri - tura”, la cual se instituyó en una palabra dramatúrgica concreta, la que al mismo tiempo definió un proceso histórico. Específica - mente hablaremos de la contribución de mujeres proletarias en la creación, representación y recepción de la dramaturgia anar - quista chilena de principios del siglo xx. Ello como un modo de autoría indesmentible, no solo en la constitución de los perso - najes, sino también en el aporte encubierto de voces femeninas silenciadas, pero que, no obstante, en estos textos dramáticos de agitación están plenamente presentes a nivel valórico; expresán - dose en una subjetividad creativa femenina que se diferencia de la voz masculina con nitidez. Lo anterior asumido desde la pers - pectiva de la antropología literaria.

  16. La tabla periódica en el Journal of chemical education a través del siglo XX.

    Directory of Open Access Journals (Sweden)

    RITA LINARES

    2010-09-01

    Full Text Available Ante la amplia literatura con la que se encuentra quien comienza una investigación, presentamos esta revisión cronológica de 109 artículos relacionados con la tabla periódica (TP, publicados en el Journal of Chemical Education (JCE a lo largo del siglo XX, que puede servir de guía hacia otras fuentes a quienes se inician en este apasionante tema de los elementos químicos y su organización en la TP, según sea el interés particular de cada quien. Esta revisión incluye también la del concepto elemento, el cual, en los albores del siglo XXI, sigue teniendo más de una definición. Sin embargo, este trabajo no constituye un análisis histórico social del desarrollo de los conceptos aquí tratados.

  17. La romería en el templo y otras licencias del canto gregoriano en el siglo XX

    Directory of Open Access Journals (Sweden)

    Ángel Medina

    2009-01-01

    Full Text Available El objetivo del presente artículo es el de presentar algunas prácticas singulares de la música litúrgica, habituales en España durante los primeros dos tercios del siglo XX, es decir, entre el motu proprio sobre la música sagrada del papa Pío X y los cambios litúrgicos derivados del Concilio vaticano II. Estas licencias tienen lugar básicamente coincidiendo con dos tipos de situaciones contrapuestas: por un lado cuando triunfa la alegría de determinadas fiestas (el Corpus, las celebraciones patronales, por ejemplo y, por otro, en los ritos funerarios. Una tradición de ámbito geográfico limitado, la Misa de gaita , y otra de ámbito del todo general, el gorigori , son las dos realidades que muestran la pervivencia de hibridaciones y prácticas del canto gregoriano particularmente chocantes en el marco de las severas directrices propias de la música sagrada en este período.

  18. Wprowadzenie do badań na temat konwersji form architektury cerkwi wojskowych XIX-XX w. w Polsce

    OpenAIRE

    Januszkiewicz, A.

    2014-01-01

    В статье представлены результаты предварительных исследований конверсии архитектурных форм православных церквей, возведенных для русских военных на польских землях в XIX – XX вв.

  19. Publicaciones periódicas de la Biblioteca del IVAM: el fondo de la primera mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Goberna, María Victoria

    2014-07-01

    Full Text Available Desde la creación del IVAM (Ley 9 /1986, de 30 de diciembre de la Generalitat Valenciana, el departamento de lo que iba a ser la futura Biblioteca, inició la política de adquisiciones. De hecho, al inaugurarse el edificio Julio González en febrero de 1989, los fondos de la Biblioteca estaban constituidos por más de 7.000 volúmenes. Hoy nos aproximamos a los 28.000 documentos, que conforman diversas secciones: Referencia, Teoría, Historia y Movimientos artísticos; una importante y voluminosa sección de catálogos y monografías de artistas; sección de exposiciones colectivas, de catálogos de mano, catálogos de subastas, dossiers del IVAM, archivos de artistas, y audiovisuales. En cuanto a la sección de Publicaciones periódicas, además de las suscripciones a revistas en curso, la Biblioteca cuenta con un interesante fondo de revistas de la primera mitad del siglo XX, que va a ser el tema, en absoluto exhaustivo, de esta colaboración

  20. Influencia del género en la formación de las matronas en el siglo XX

    Directory of Open Access Journals (Sweden)

    Natalia Emilia Rodríguez Portilla

    2014-09-01

    Full Text Available Objetivo principal: analizar la influencia del género en la formación de las matronas durante el siglo XX. El punto de inflexión será el Decreto de 18 de enero de 1957. Metodología: este trabajo es un estudio cualitativo con enfoque fenomenológico. Realizamos entrevistas en profundidad a 13 matronas y el análisis de textos legislativos. Resultados principales: el Decreto de 1957 que estableció la especialización de matronas para las Ayudantes Técnicos Sanitarios femeninas supuso un cambio, ampliando las enseñanzas de estas profesionales y exigiéndoles un mayor esfuerzo en sus vidas. La capacitación percibida por las matronas no fue suficiente para que se les reconociera como profesión autónoma hasta el siglo XXI. Conclusión principal: el género será determinante en la formación de las matronas. Como mujeres inmersas en una profesión femenina se les ha exigido una serie de requisitos legislativos desiguales a otros profesionales.

  1. XX/XO, a rare sex chromosome system in Potamotrygon freshwater stingray from the Amazon Basin, Brazil.

    Science.gov (United States)

    de Souza Valentim, Francisco Carlos; Porto, Jorge Ivan Rebelo; Bertollo, Luiz Antonio Carlos; Gross, Maria Claudia; Feldberg, Eliana

    2013-09-01

    Potamotrygonidae is a representative family of South American freshwater elasmobranchs. Cytogenetic studies were performed in a Potamotrygon species from the middle Negro River, Amazonas, Brazil, here named as Potamotrygon sp. C. Mitotic and meiotic chromosomes were analyzed using conventional staining techniques, C-banding, and detection of the nucleolus organizing regions (NOR) with Silver nitrate (Ag-NOR). The diploid number was distinct between sexes, with males having 2n = 67 chromosomes, karyotype formula 19m + 8sm + 10st + 30a, and fundamental number (FN) = 104, and females having 2n = 68 chromosomes, karyotype formula 20m + 8sm + 10st + 30a, and FN = 106. A large chromosome, corresponding to pair number two in the female karyotype, was missing in the male complement. Male meiotic cells had 33 bivalents plus a large univalent chromosome in metaphase I, and n = 33 and n = 34 chromosomes in metaphase II. These characteristics are consistent with a sex chromosome system of the XX/XO type. Several Ag-NOR sites were identified in both male and female karyotypes. Positive C-banding was located only in the centromeric regions of the chromosomes. This sex chromosome system, which rarely occurs in fish, is now being described for the first time among the freshwater rays of the Amazon basin.

  2. Insulin and IGF1 receptors are essential for XX and XY gonadal differentiation and adrenal development in mice.

    Directory of Open Access Journals (Sweden)

    Jean-Luc Pitetti

    Full Text Available Mouse sex determination provides an attractive model to study how regulatory genetic networks and signaling pathways control cell specification and cell fate decisions. This study characterizes in detail the essential role played by the insulin receptor (INSR and the IGF type I receptor (IGF1R in adrenogenital development and primary sex determination. Constitutive ablation of insulin/IGF signaling pathway led to reduced proliferation rate of somatic progenitor cells in both XX and XY gonads prior to sex determination together with the downregulation of hundreds of genes associated with the adrenal, testicular, and ovarian genetic programs. These findings indicate that prior to sex determination somatic progenitors in Insr;Igf1r mutant gonads are not lineage primed and thus incapable of upregulating/repressing the male and female genetic programs required for cell fate restriction. In consequence, embryos lacking functional insulin/IGF signaling exhibit (i complete agenesis of the adrenal cortex, (ii embryonic XY gonadal sex reversal, with a delay of Sry upregulation and the subsequent failure of the testicular genetic program, and (iii a delay in ovarian differentiation so that Insr;Igf1r mutant gonads, irrespective of genetic sex, remained in an extended undifferentiated state, before the ovarian differentiation program ultimately is initiated at around E16.5.

  3. Insulin and IGF1 receptors are essential for XX and XY gonadal differentiation and adrenal development in mice.

    Science.gov (United States)

    Pitetti, Jean-Luc; Calvel, Pierre; Romero, Yannick; Conne, Béatrice; Truong, Vy; Papaioannou, Marilena D; Schaad, Olivier; Docquier, Mylène; Herrera, Pedro Luis; Wilhelm, Dagmar; Nef, Serge

    2013-01-01

    Mouse sex determination provides an attractive model to study how regulatory genetic networks and signaling pathways control cell specification and cell fate decisions. This study characterizes in detail the essential role played by the insulin receptor (INSR) and the IGF type I receptor (IGF1R) in adrenogenital development and primary sex determination. Constitutive ablation of insulin/IGF signaling pathway led to reduced proliferation rate of somatic progenitor cells in both XX and XY gonads prior to sex determination together with the downregulation of hundreds of genes associated with the adrenal, testicular, and ovarian genetic programs. These findings indicate that prior to sex determination somatic progenitors in Insr;Igf1r mutant gonads are not lineage primed and thus incapable of upregulating/repressing the male and female genetic programs required for cell fate restriction. In consequence, embryos lacking functional insulin/IGF signaling exhibit (i) complete agenesis of the adrenal cortex, (ii) embryonic XY gonadal sex reversal, with a delay of Sry upregulation and the subsequent failure of the testicular genetic program, and (iii) a delay in ovarian differentiation so that Insr;Igf1r mutant gonads, irrespective of genetic sex, remained in an extended undifferentiated state, before the ovarian differentiation program ultimately is initiated at around E16.5.

  4. The Formation of Historical Metrology as Scientific Discipline at the XVI – the beginning of the XX century

    Directory of Open Access Journals (Sweden)

    Vyacheslav V. Shevtsov

    2016-06-01

    Full Text Available This article discusses the process of formation of Russian historical metrology as scientific discipline during the pre-revolutionary period. Recording of practical metrological knowledge of the second half of the XVI-XVII centuries was replaced by scientific interest in the XVIII century. It was characterized by systematization of information on old and modern measures of the peoples of Russia, Europe and the East. In the first half of the XIX century, generalizing studies on historical metrology appeared. Further development of this field of knowledge needed expansion of historical sources, criticism, development of the conceptual and methodological framework. In the second half the XIX – beginning of the XX century these problems were solved within separate metrological studies, specialized lecture courses and manuals that were necessary for professional training of historians, archivists and archaeographs. Pre-revolutionary authors laid the theoretical, methodological and factual foundation of historical metrology which gained further development in works of the Soviet and modern Russian historians.

  5. La moral institucionalizada.Reflexiones sobre el Estado, las sexualidades y la violencia en la Argentina del siglo XX

    Directory of Open Access Journals (Sweden)

    Patricio Simonetto

    2016-06-01

    Full Text Available Este artículo analiza la trayectoria de políticas coercitivas con las que el Estado argentino intentó inferir en la producción de sexualidades durante el siglo XX. La “violencia moral” incluyó prácticas de represión: códigos de faltas provinciales y razzias como formas de delimitación a homosexuales, prostitutas y pobres urbanos. Las mismas constituyeron un hilo de continuidad entre gobiernos civiles y regímenes castrenses. La premisa sostiene que ante la percepción de precarización de una identidad de la cultura nacional oficial, promovida por cambios sociales, demográficos, económicos y culturales en los albores del siglo, el Estado actuó progresivamente como catalizador de la reproducción directa de relaciones dominantes. La sensación de fragilidad de las condiciones que hacían perdurable una ciudadanía imaginada como heterosexual, blanca, masculina y capitalista se institucionalizó en un modo de concebir la moral que devino en políticas violentas. Partiendo de esta hipótesis se analizaran las formas especificas que asumieron estas políticas en el territorio urbano bonaerense. Con el fin de problematizar el vínculo entre Estado, sexualidades y violencias.

  6. La imagen de la familia en la prensa religiosa de Murcia en los inicios del siglo XX

    Directory of Open Access Journals (Sweden)

    Crespo Sánchez, Francisco Javier

    2014-12-01

    Full Text Available In the early twentieth century, Murcia will be an example of the consolidation of the Catholic press in the provinces. As a transmitter of the ideas of the capital, the Church will use this media to promote their ideal model of family among the people in a time of remarkable social and political conflicts. Through the articles in the press, we will see the construction and dissemination of a discourse based on the perpetuation of the Christian family at home, the exaltation of marriage and the definition of the role of the spouses.En el inicio del siglo XX, Murcia será ejemplo del proceso de consolidación de la prensa católica de provincias. Transmisora de las ideas de la capital, la Iglesia utilizará este medio para promocionar su modelo ideal de familia en la sociedad en una etapa de marcada conflictividad social y política. A través de los artículos recogidos en la prensa, comprobaremos la construcción y difusión de un discurso basado en la perpetuación de la familia cristiana en el hogar, la exaltación del matrimonio y la definición del rol de los cónyuges.

  7. Difundiendo y afianzando la "argentinidad". La prensa local rionegrina en las primeras décadas del siglo XX

    Directory of Open Access Journals (Sweden)

    Cielo Zaidenwerg

    2013-02-01

    Full Text Available La consolidación del proyecto nacional en Argentina comenzó a afianzarse hacia finales del siglo xix y principios del siglo xx a través de diferentes estrategias: económicas, políticas y finalmente ideológicas. No obstante, estas prácticas de nacionalización definidas y proyectadas por el estado argentino no fueron asimiladas ni recibidas de igual manera en todo el territorio. En este sentido y centrándonos en las prácticas simbólicas, tomaremos como estudio de caso la gobernación de Río Negro, para observar, desde la prensa local, cómo se articularon las estrategias argentizadoras en los ámbitos locales de esta región patagónica. El objetivo de este trabajo, en consecuencia, es resaltar la incidencia que la prensa, a través de sus textos y sus prácticas, tuvo en los modos de imaginar la pertenencia al conjunto nacional.

  8. El problema sanitario de España: saneamiento y medio rural en los primeros decenios del siglo XX

    Directory of Open Access Journals (Sweden)

    Galiana, Mª Eugenia

    2006-12-01

    Full Text Available During the early decades of the 20th century, the Spanish socio-sanitary situation was described as catastrophic, both in the urban as well as in the rural setting. In that context, sanitation emerged as one of the key elements of the regeneration process taken on by hygiene in its role as mediator. Through the works of hygienists G. de Membrillera and Luis Muñoz Antuñano, published in 1921, we have approached the analysis of the sanitary situation of rural Spain during this period.

    En los primeros decenios del siglo XX, la situación socio-sanitaria de la sociedad española fue descrita como catastrófica, tanto en el ámbito urbano como en el rural. En aquel contexto, el saneamiento del medio aparece como una de las claves del proceso de regeneración que asumió la higiene en su papel de mediadora. A través de las obras de los higienistas G. De Membrillera y Luis Muñoz Antuñano, publicadas en 1921, nos hemos acercado al análisis de la situación sanitaria de la España rural durante este periodo.

  9. Memórias de estudantes do início do século XX

    Directory of Open Access Journals (Sweden)

    Lilian Rose Margotto

    2009-12-01

    Full Text Available O propósito deste artigo é analisar alguns aspectos das memórias de escolarização de pessoas que estudaram durante as três primeiras décadas do século XX. Concederam depoimentos dez homens e dez mulheres. Esses depoimentos foram analisados partindo da concepção de que o homem é um ser histórica e socialmente determinado, o que possibilitou uma contextualização das falas a partir de um referencial proveniente da história da educação, bem como análise das narrativas, decorrentes de um trabalho de rememoração, lidas a partir da perspectiva de Halbwachs. O desenvolvimento do texto está centrado principalmente em dois aspectos dos depoimentos: as dificuldades encontradas pelos sujeitos para permanecerem na escola e as comparações entre o passado e o presente. Os depoimentos mostram tanto o que há de particular nas memórias arroladas, quanto o que elas trazem de um momento histórico, permitindo que se vislumbre parte do que permaneceu do cotidiano escolar para essas pessoas.

  10. POLICY ON MOSLEM EDUCATION & UPBRINGING RUSSIA IMPLEMENTED IN THE NORTHERN CAUCASUS IN THE LATE XIX AND EARLY XX CENTURIES

    Directory of Open Access Journals (Sweden)

    R. A. KHACHIDOGOV

    2015-01-01

    Full Text Available The paper presented some archive records and documented materials not published earlier. The survey examined the Russian policy in the domain of Moslem education of the late XIX and early XX centuries in the Northern Caucasus, and proved that a specific setup of Moslem education has been established in that period in the region representing two types of school, namely mektebe (maktaba and medrese, with the training standards in both having essential faults; however, since another type of training institutions did not appear there, the mentioned schools stood high among the Moslems. The established setup of education and upbringing gave rise to fair criticism among the Russian and highlander thinkers, who dreamed about a new pro-democratic school that did not maintain class segregation. The study made an inference that the Government by means of an inspection system under the Ministry of Public Education, that for years to come slowed down advancement of the framework of Moslem training institutions not only for the Northern Caucasian region, but also for the entire Russian Empire.

  11. La salud al poder. Tracoma y políticas migratorias argentinas en la primera mitad del siglo XX

    Directory of Open Access Journals (Sweden)

    Emma Gioia

    2016-01-01

    Full Text Available En este artículo se estudió la recepción de los inmigrantes con tracoma en el puerto de Buenos Aires entre 1908 y 1943, con base en las relaciones entre los discursos de los médicos y las prácticas concretas de rechazo. Analizamos las teorías de los tracomatólogos argentinos y de otras partes del mundo, para luego confrontarlas con la construcción de las categorías presentes en las estadísticas de la Dirección General de Migración durante la primera mitad del siglo XX y con las representaciones de las distintas nacionalidades de los granulosos rechazados. El estudio de los vínculos entre los discursos y las prácticas revela una sobrerrepresentación y una estigmatización de los inmigrantes sirios, al mismo tiempo que la construcción de un mito alrededor de los inmigrantes judíos, rusos, húngaros y egipcios, entre otros. Dicho imaginario está arraigado tanto en el nacionalismo como en los intercambios internacionales de los tracomatólogos sobre la etiología, la historia, la epidemiología del tracoma, y sobre los modos legales y prácticos de selección de los inmigrantes considerados deseables.

  12. Book Review Imaginary modernity and tradition. Architecture of the twentieth century in Latin America / Reseña del Libro Imaginarios de modernidad y tradición. Arquitectura del siglo XX en América Latina

    Directory of Open Access Journals (Sweden)

    Adolfo Benito Narváez Tijerina

    2016-10-01

    Full Text Available Book Review Imaginary modernity and tradition. Architecture of the twentieth century in Latin America Reseña del Libro Imaginarios de modernidad y tradición. Arquitectura del siglo XX en América Latina. Ettinger, Catherine R. (coord. (2015. Imaginarios de modernidad y tradición. Arquitectura del siglo XX en América Latina. México: Miguel Ángel Porrúa, 259 páginas. ISBN: 978-6074019681.

  13. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  14. Crédito privado antes da grande depressão do século XX: o mercado hipotecário

    Directory of Open Access Journals (Sweden)

    Renato Leite Marcondes

    2014-12-01

    Full Text Available Apesar das restrições existentes, o mercado hipotecário cresceu no Brasil ao longo do século XIX e início do século XX. As mudanças institucionais possibilitaram a expansão do mercado por meio de bancos e de particulares, principalmente a partir da década de 1870. Houve um avanço do sistema bancário, especialmente ao final do século XIX. A presença de instituições estrangeiras ressaltou-se no início do século XX. Não obstante estas transformações do período em estudo, o mercado hipotecário ainda se concentrava nas mãos de agentes privados. A quase totalidade das transações ocorreu entre indivíduos, especialmente no meio urbano mesmo antes de 1930. No início do século XX, quando havia um sistema bancário mais avançado, os emprestadores particulares ainda realizavam mais transações do que os bancos.

  15. Review of Outcome Information in 46,XX Patients with Congenital Adrenal Hyperplasia Assigned/Reared Male: What Does It Say about Gender Assignment?

    Directory of Open Access Journals (Sweden)

    Lee PeterA

    2010-12-01

    Full Text Available There is ample historical verification of 46,XX congenital adrenal hyperplasia (CAH patients being born with essentially male genitaliawhile outcome information is scant. Prior to glucocorticoid therapy, most patients died very young from adrenal insufficiency. Most available reports from laterchildhood, contain little information concerning sexual identity. Reports on older individuals lack adequate information about sexual identity and quality of life. The difficulty in assessing the relative impact of multiple dynamic environmental factors on the development of sexual identity, self- and body esteem and overall adjustment to life is clear. Nevertheless, it remains unclear whether those infants whose masculine genitalia at birth resulted in an initial male assignment would have enjoyed a better adult outcome had they been allowed to remain male rather than the female reassignment that most received. Further, one could ask whether a male sex of rearing should be considered in 46,XX CAH infants with male external genitalia. After reviewing available literature, we conclude that because those extremely virlized 46,XX CAH patients who were reared male with healthy social support demonstrated satisfactory levels of social and sexual function as adults a male sex assignment should be considered in these types of infants when social and cultural environment are supportive.

  16. Review of Outcome Information in 46,XX Patients with Congenital Adrenal Hyperplasia Assigned/Reared Male: What Does It Say about Gender Assignment?

    Science.gov (United States)

    Lee, Peter A; Houk, Christopher P

    2010-01-01

    There is ample historical verification of 46,XX congenital adrenal hyperplasia (CAH) patients being born with essentially male genitaliawhile outcome information is scant. Prior to glucocorticoid therapy, most patients died very young from adrenal insufficiency. Most available reports from laterchildhood, contain little information concerning sexual identity. Reports on older individuals lack adequate information about sexual identity and quality of life. The difficulty in assessing the relative impact of multiple dynamic environmental factors on the development of sexual identity, self- and body esteem and overall adjustment to life is clear. Nevertheless, it remains unclear whether those infants whose masculine genitalia at birth resulted in an initial male assignment would have enjoyed a better adult outcome had they been allowed to remain male rather than the female reassignment that most received. Further, one could ask whether a male sex of rearing should be considered in 46,XX CAH infants with male external genitalia. After reviewing available literature, we conclude that because those extremely virlized 46,XX CAH patients who were reared male with healthy social support demonstrated satisfactory levels of social and sexual function as adults a male sex assignment should be considered in these types of infants when social and cultural environment are supportive.

  17. Heisenberg XX自旋环中的纠缠开关%Entanglement Switch in Heisenberg XX Spin Rings

    Institute of Scientific and Technical Information of China (English)

    杨海超; 揭泉林

    2012-01-01

    This paper is devoted to analyse the three-qubit Heisenberg XX rings in a uniform magnetic field, and by controlling of the coupling of a site we can change the entanglement between other two sites. We find that thermal entanglement exhibits a platform-like behaviour and entangled value is equal to 1 when coupling of the site which was controlled is small than that was not controlled,the width of the platform-like region could he controlled by changing the coupling between was not sites, This novel property may be used as a quantum entanglement switch. At the same time, we analyse the situation that two sites were controlled, the entanglement maximal switch still can be realized. Moreover, we find that there are linear relation in the spin-spin interactions.%研究了在均匀磁场中的三格点Heisenberg XX自旋环,通过控制一个格点的耦合参数,来调控另外两个格点之间的纠缠.理论上发现当控制格点的耦合参数比未控制格点的耦合参数小时,未控制格点间的纠缠随磁场变化会出现一个纠缠值为1的平台.在较低温度下,平台的宽度与未控制格点间的耦合参数值相等,是一个很好的纠缠开关.同时,分析了存在两个控制格点的情况,也可以得到纠缠值为1的开关,并发现自旋相互作用具有线性关系.

  18. Paternalismo empresarial y condiciones de vida en los ingenios azucareros tucumanos. Fines del siglo XIX y principios del XX

    Directory of Open Access Journals (Sweden)

    Landaburu, Alejandra

    2015-11-01

    Full Text Available El objetivo de este trabajo es establecer cuáles eran los beneficios sociales otorgados por los propietarios de ingenios en sus fábricas y qué relación tenían estos beneficios con las concepciones que tenían los industriales en torno a la “cuestión social” en un período que se extiende desde fines del siglo XIX hasta principios del siglo XX. La actividad azucarera demostró tempranamente la necesidad de contar con una mano de obra disciplinada y para lograrlo fue importante el respaldo de los poderes públicos a través del diseño de un marco legal que respaldaba las estrategias desplegadas por las fábricas y cañeros para asegurar ese objetivo. A la par de esta legislación coercitiva, los industriales tucumanos otorgaban también una serie de beneficios como vivienda, seguros, asistencia médica primaria y educación. Es decir, que desde temprano las prácticas coactivas se combinaron con asistencialismo, y resulta de interés ofrecer alguna clave explicativa del sentido de estas acciones. Las diferencias existentes entre los ingenios, se traducían en marcadas desigualdades en los beneficios que recibían los trabajadores, pero sin duda era la pertenencia a la fábrica en calidad de trabajador lo que aseguraba la vivienda, la ración y la atención médica y por lo tanto pérdida del puesto laboral no sólo implicaba la pérdida del salario sino también del lugar de residencia y el acceso a los beneficios.

  19. Breve síntesis sobre el armamento en Egipto durante las dinastías XIX y XX

    Directory of Open Access Journals (Sweden)

    Javier Martínez Babón

    2005-01-01

    Full Text Available Los ejércitos de Seti y de Ramses II que lucharon contra los hititas estaban en posesión de la mayoría de las armas más modernas de su época. Las tropas egipcias dependían de los carros y de la infantería que esencialmente luchaba con hachas, espadas cortas, espadas de hoz, jabalinas, mazas, venablos, hondas y se defendían con escudos. El uso de cascos, cotas de placas de bronce se extendió con rapidez y los mercenarios shardana introdujeron las espadas largas. Con la crisis política a finales de la dinastía XIX, y la pérdida de territorios a inicios de la dinastía del XX, el ejército perdió también parte de sus recursos y los artesanos asiáticos especializados en la metalurgia.The army of Seti I and Ramses II, which fought against the hittites, possessed the most modem weapons of that era. The Egyptian troops depended upon chariots and infantry which essentially fought with axes, short swords, sickle swords, spears, javelins, lances, self and composite bows and who defended themselves with shields. The use of helmets and coats of mail became more and more widespread and the shardana mercenaries introduced long swords. With the political crisis at the end of the XIXth. Dynasty and the loss of territory at the beginning of the XXth. Dynasty, the army lost its arms resources, which come from Asian towns specialized in metallurgy.

  20. INTERCITY RAIL COMMUNICATION IN KUBAN REGION IN THE LATE XIX – BEGINNING OF XX CENTURY: DESIGN AND EXECUTION

    Directory of Open Access Journals (Sweden)

    A. G. Sidyakina

    2016-01-01

    Full Text Available The article deals with construction projects of intercity rail communications inKubanregion in the late XIX early XX century and assesses the extent of their implementation. Appeal to the subject allows you to analyze the conditions of the beginning of the public transport system in the region, and to identify its place and role in the emerging urban infrastructure of the North-West Caucasus. We analyze the degree of efficiency in Ekaterinodar tram and suburban lines to the village Pashkovskaya. The article also highlights the unrealized projects of equestrian railways and tram in the towns and villages of theKubanregion in the early twentieth century. It noted the interest of the residents of certain localities in the appearance of the public means of transport, which was intended to resolve the problem of intra-urban mobility and accelerate the improvement of urban infrastructure. The author draws the attention to the changes of urban infrastructure and planning structure of the capital ofKubanregion caused by the laying of rail communications for electric tram with a companion set of technical installations for its operation and maintenance. The construction and expansion of the tram lines contributed to engineering transform city environment. The conditions of the Treaty of the municipal authorities and the Belgian anonymous society "traction Company and electricity of building in Ekaterinodar, electric railway, the terms and conditions of its operation. Describes how to extend the network of tramway messages indicating the major and minor routes in the early twentieth century. Evaluates the degree of accessibility and facilities for Ekaterinodar citizens and guests of the city a new mode of transport. Cities and towns are indicated in theKubanregion, which in the early twentieth century, projects and applied a concession contract for the construction of inner city and suburban tram routes, but because of socio-economic and political