WorldWideScience

Sample records for anisotropic diffusion problems

  1. Finite-volume scheme for anisotropic diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Es, Bram van, E-mail: bramiozo@gmail.com [Centrum Wiskunde & Informatica, P.O. Box 94079, 1090GB Amsterdam (Netherlands); FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, The Netherlands" 1 (Netherlands); Koren, Barry [Eindhoven University of Technology (Netherlands); Blank, Hugo J. de [FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, The Netherlands" 1 (Netherlands)

    2016-02-01

    In this paper, we apply a special finite-volume scheme, limited to smooth temperature distributions and Cartesian grids, to test the importance of connectivity of the finite volumes. The area of application is nuclear fusion plasma with field line aligned temperature gradients and extreme anisotropy. We apply the scheme to the anisotropic heat-conduction equation, and compare its results with those of existing finite-volume schemes for anisotropic diffusion. Also, we introduce a general model adaptation of the steady diffusion equation for extremely anisotropic diffusion problems with closed field lines.

  2. Anisotropic diffusion in a toroidal geometry

    International Nuclear Information System (INIS)

    Fischer, Paul F

    2005-01-01

    As part of the Department of Energy's applications oriented SciDAC project, three model problems have been proposed by the Center for Extended Magnetohydrodynamics Modeling to test the potential of numerical algorithms for challenging magnetohydrodynamics (MHD) problems that are required for future fusion development. The first of these, anisotropic diffusion in a toroidal geometry, is considered in this note

  3. Finite-difference schemes for anisotropic diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Es, Bram van, E-mail: es@cwi.nl [Centrum Wiskunde and Informatica, P.O. Box 94079, 1090GB Amsterdam (Netherlands); FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, Association EURATOM-FOM (Netherlands); Koren, Barry [Eindhoven University of Technology (Netherlands); Blank, Hugo J. de [FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, Association EURATOM-FOM (Netherlands)

    2014-09-01

    In fusion plasmas diffusion tensors are extremely anisotropic due to the high temperature and large magnetic field strength. This causes diffusion, heat conduction, and viscous momentum loss, to effectively be aligned with the magnetic field lines. This alignment leads to different values for the respective diffusive coefficients in the magnetic field direction and in the perpendicular direction, to the extent that heat diffusion coefficients can be up to 10{sup 12} times larger in the parallel direction than in the perpendicular direction. This anisotropy puts stringent requirements on the numerical methods used to approximate the MHD-equations since any misalignment of the grid may cause the perpendicular diffusion to be polluted by the numerical error in approximating the parallel diffusion. Currently the common approach is to apply magnetic field-aligned coordinates, an approach that automatically takes care of the directionality of the diffusive coefficients. This approach runs into problems at x-points and at points where there is magnetic re-connection, since this causes local non-alignment. It is therefore useful to consider numerical schemes that are tolerant to the misalignment of the grid with the magnetic field lines, both to improve existing methods and to help open the possibility of applying regular non-aligned grids. To investigate this, in this paper several discretization schemes are developed and applied to the anisotropic heat diffusion equation on a non-aligned grid.

  4. Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.; Larsen, E.W.

    1992-01-01

    The diffusion synthetic acceleration (DSA) algorithm effectively accelerates the iterative solution of transport problems with isotropic or mildly anisotropic scattering. However, DSA loses its effectiveness for transport problems that have strongly anisotropic scattering. Two generalizations of DSA are proposed, which, for highly anisotropic scattering problems, converge at least an order of magnitude (clock time) faster than the DSA method. These two methods are developed, the results of Fourier analysis that theoretically predict their efficiency are described, and numerical results that verify the theoretical predictions are presented. (author). 10 refs., 7 figs., 5 tabs

  5. Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.; Larsen, E.W.

    1991-01-01

    This paper reports on the diffusion synthetic acceleration (DSA) algorithm that effectively accelerates the iterative solution of transport problems with isotropic or mildly anisotropic scattering. However, DSA loses its effectiveness for transport problems that have strongly anisotropic scattering. Two generalizations of DSA are proposed, which, for highly anisotropic scattering problems, converge at least an order of magnitude (clock time) faster than the DSA method. These two methods are developed, the results of Fourier analyses that theoretically predict their efficiency are described, and numerical results that verify the theoretical predictions are presented

  6. Absence of saturation of void growth in rate theory with anisotropic diffusion

    CERN Document Server

    Hudson, T S; Sutton, A P

    2002-01-01

    We present a first attempt at solution the problem of the growth of a single void in the presence of anisotropically diffusing radiation induced self-interstitial atom (SIA) clusters. In order to treat a distribution of voids we perform ensemble averaging over the positions of centres of voids using a mean-field approximation. In this way we are able to model physical situations in between the Standard Rate Theory (SRT) treatment of swelling (isotropic diffusion), and the purely 1-dimensional diffusion of clusters in the Production Bias Model. The background absorption by dislocations is however treated isotropically, with a bias for interstitial cluster absorption assumed similar to that of individual SIAs. We find that for moderate anisotropy, unsaturated void growth is characteristic of this anisotropic diffusion of clusters. In addition we obtain a higher initial void swelling rate than predicted by SRT whenever the diffusion is anisotropic.

  7. Analysis of the Numerical Diffusion in Anisotropic Mediums: Benchmarks for Magnetic Field Aligned Meshes in Space Propulsion Simulations

    Directory of Open Access Journals (Sweden)

    Daniel Pérez-Grande

    2016-11-01

    Full Text Available This manuscript explores numerical errors in highly anisotropic diffusion problems. First, the paper addresses the use of regular structured meshes in numerical solutions versus meshes aligned with the preferential directions of the problem. Numerical diffusion in structured meshes is quantified by solving the classical anisotropic diffusion problem; the analysis is exemplified with the application to a numerical model of conducting fluids under magnetic confinement, where rates of transport in directions parallel and perpendicular to a magnetic field are quite different. Numerical diffusion errors in this problem promote the use of magnetic field aligned meshes (MFAM. The generation of this type of meshes presents some challenges; several meshing strategies are implemented and analyzed in order to provide insight into achieving acceptable mesh regularity. Second, Gradient Reconstruction methods for magnetically aligned meshes are addressed and numerical errors are compared for the structured and magnetically aligned meshes. It is concluded that using the latter provides a more correct and straightforward approach to solving problems where anisotropicity is present, especially, if the anisotropicity level is high or difficult to quantify. The conclusions of the study may be extrapolated to the study of anisotropic flows different from conducting fluids.

  8. Adaptive weighted anisotropic diffusion for computed tomography denoising

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Zhi; Silver, Michael D. [Toshiba Medical Research Institute USA, Inc., Vernon Hills, IL (United States); Noshi, Yasuhiro [Toshiba Medical System Corporation, Tokyo (Japan)

    2011-07-01

    With increasing awareness of radiation safety, dose reduction has become an important task of modern CT system development. This paper proposes an adaptive weighted anisotropic diffusion method and an adaptive weighted sharp source anisotropic diffusion method as image domain filters to potentially help dose reduction. Different from existing anisotropic diffusion methods, the proposed methods incorporate an edge-sensitive adaptive source term as part of the diffusion iteration. It provides better edge and detail preservation. Visual evaluation showed that the new methods can reduce noise substantially without apparent edge and detail loss. The quantitative evaluations also showed over 50% of noise reduction in terms of noise standard deviations, which is equivalent to over 75% of dose reduction for a normal dose image quality. (orig.)

  9. Patch-based anisotropic diffusion scheme for fluorescence diffuse optical tomography—part 1: technical principles

    International Nuclear Information System (INIS)

    Correia, Teresa; Arridge, Simon

    2016-01-01

    Fluorescence diffuse optical tomography (fDOT) provides 3D images of fluorescence distributions in biological tissue, which represent molecular and cellular processes. The image reconstruction problem is highly ill-posed and requires regularisation techniques to stabilise and find meaningful solutions. Quadratic regularisation tends to either oversmooth or generate very noisy reconstructions, depending on the regularisation strength. Edge preserving methods, such as anisotropic diffusion regularisation (AD), can preserve important features in the fluorescence image and smooth out noise. However, AD has limited ability to distinguish an edge from noise. In this two-part paper, we propose a patch-based anisotropic diffusion regularisation (PAD), where regularisation strength is determined by a weighted average according to the similarity between patches around voxels within a search window, instead of a simple local neighbourhood strategy. However, this method has higher computational complexity and, hence, we wavelet compress the patches (PAD-WT) to speed it up, while simultaneously taking advantage of the denoising properties of wavelet thresholding. The proposed method combines the nonlocal means (NLM), AD and wavelet shrinkage methods, which are image processing methods. Therefore, in this first paper, we used a denoising test problem to analyse the performance of the new method. Our results show that the proposed PAD-WT method provides better results than the AD or NLM methods alone. The efficacy of the method for fDOT image reconstruction problem is evaluated in part 2. (paper)

  10. General PFG signal attenuation expressions for anisotropic anomalous diffusion by modified-Bloch equations

    Science.gov (United States)

    Lin, Guoxing

    2018-05-01

    Anomalous diffusion exists widely in polymer and biological systems. Pulsed-field gradient (PFG) anomalous diffusion is complicated, especially in the anisotropic case where limited research has been reported. A general PFG signal attenuation expression, including the finite gradient pulse (FGPW) effect for free general anisotropic fractional diffusion { 0 integral modified-Bloch equation, were extended to obtain general PFG signal attenuation expressions for anisotropic anomalous diffusion. Various cases of PFG anisotropic anomalous diffusion were investigated, including coupled and uncoupled anisotropic anomalous diffusion. The continuous-time random walk (CTRW) simulation was also carried out to support the theoretical results. The theory and the CTRW simulation agree with each other. The obtained signal attenuation expressions and the three-dimensional fractional modified-Bloch equations are important for analyzing PFG anisotropic anomalous diffusion in NMR and MRI.

  11. Speckle Suppression by Weighted Euclidean Distance Anisotropic Diffusion

    Directory of Open Access Journals (Sweden)

    Fengcheng Guo

    2018-05-01

    Full Text Available To better reduce image speckle noise while also maintaining edge information in synthetic aperture radar (SAR images, we propose a novel anisotropic diffusion algorithm using weighted Euclidean distance (WEDAD. Presented here is a modified speckle reducing anisotropic diffusion (SRAD method, which constructs a new edge detection operator using weighted Euclidean distances. The new edge detection operator can adaptively distinguish between homogenous and heterogeneous image regions, effectively generate anisotropic diffusion coefficients for each image pixel, and filter each pixel at different scales. Additionally, the effects of two different weighting methods (Gaussian weighting and non-linear weighting of de-noising were analyzed. The effect of different adjustment coefficient settings on speckle suppression was also explored. A series of experiments were conducted using an added noise image, GF-3 SAR image, and YG-29 SAR image. The experimental results demonstrate that the proposed method can not only significantly suppress speckle, thus improving the visual effects, but also better preserve the edge information of images.

  12. Anisotropic diffusion of volatile pollutants at air-water interface

    Directory of Open Access Journals (Sweden)

    Li-ping Chen

    2013-04-01

    Full Text Available The volatile pollutants that spill into natural waters cause water pollution. Air pollution arises from the water pollution because of volatilization. Mass exchange caused by turbulent fluctuation is stronger in the direction normal to the air-water interface than in other directions due to the large density difference between water and air. In order to explore the characteristics of anisotropic diffusion of the volatile pollutants at the air-water interface, the relationship between velocity gradient and mass transfer rate was established to calculate the turbulent mass diffusivity. A second-order accurate smooth transition differencing scheme (STDS was proposed to guarantee the boundedness for the flow and mass transfer at the air-water interface. Simulations and experiments were performed to study the trichloroethylene (C2HCl3 release. By comparing the anisotropic coupling diffusion model, isotropic coupling diffusion model, and non-coupling diffusion model, the features of the transport of volatile pollutants at the air-water interface were determined. The results show that the anisotropic coupling diffusion model is more accurate than the isotropic coupling diffusion model and non-coupling diffusion model. Mass transfer significantly increases with the increase of the air-water relative velocity at a low relative velocity. However, at a higher relative velocity, an increase in the relative velocity has no effect on mass transfer.

  13. Adaptive anisotropic diffusion filtering of Monte Carlo dose distributions

    International Nuclear Information System (INIS)

    Miao Binhe; Jeraj, Robert; Bao Shanglian; Mackie, Thomas R

    2003-01-01

    The Monte Carlo method is the most accurate method for radiotherapy dose calculations, if used correctly. However, any Monte Carlo dose calculation is burdened with statistical noise. In this paper, denoising of Monte Carlo dose distributions with a three-dimensional adaptive anisotropic diffusion method was investigated. The standard anisotropic diffusion method was extended by changing the filtering parameters adaptively according to the local statistical noise. Smoothing of dose distributions with different noise levels in an inhomogeneous phantom, a conventional and an IMRT treatment case is shown. The resultant dose distributions were analysed using several evaluating criteria. It is shown that the adaptive anisotropic diffusion method can reduce statistical noise significantly (two to five times, corresponding to the reduction of simulation time by a factor of up to 20), while preserving important gradients of the dose distribution well. The choice of free parameters of the method was found to be fairly robust

  14. 3-D anisotropic neutron diffusion in optically thick media with optically thin channels

    International Nuclear Information System (INIS)

    Trahan, Travis J.; Larsen, Edward W.

    2011-01-01

    Standard neutron diffusion theory accurately approximates the neutron transport process for optically thick, scattering-dominated systems in which the angular neutron flux is a weak (nearly linear) function of angle. Therefore, standard diffusion theory is not directly applicable for Very High Temperature Reactor (VHTR) cores, which contain numerous narrow, axially-oriented, nearly-voided coolant channels. However, we have derived a new, accurate diffusion equation for such problems, which contains nonstandard anisotropic diffusion coefficients near and within the channels, but which reduces to the standard diffusion approximation away from the channels. The new diffusion approximation significantly improves the accuracy of VHTR diffusion simulations, while having lower computational cost than higher-order transport methods. (author)

  15. An efficient explicit numerical scheme for diffusion-type equations with a highly inhomogeneous and highly anisotropic diffusion tensor

    International Nuclear Information System (INIS)

    Larroche, O.

    2007-01-01

    A locally split-step explicit (LSSE) algorithm was developed for efficiently solving a multi-dimensional advection-diffusion type equation involving a highly inhomogeneous and highly anisotropic diffusion tensor, which makes the problem very ill-conditioned for standard implicit methods involving the iterative solution of large linear systems. The need for such an optimized algorithm arises, in particular, in the frame of thermonuclear fusion applications, for the purpose of simulating fast charged-particle slowing-down with an ion Fokker-Planck code. The LSSE algorithm is presented in this paper along with the results of a model slowing-down problem to which it has been applied

  16. Patch-based anisotropic diffusion scheme for fluorescence diffuse optical tomography--part 2: image reconstruction.

    Science.gov (United States)

    Correia, Teresa; Koch, Maximilian; Ale, Angelique; Ntziachristos, Vasilis; Arridge, Simon

    2016-02-21

    Fluorescence diffuse optical tomography (fDOT) provides 3D images of fluorescence distributions in biological tissue, which represent molecular and cellular processes. The image reconstruction problem is highly ill-posed and requires regularisation techniques to stabilise and find meaningful solutions. Quadratic regularisation tends to either oversmooth or generate very noisy reconstructions, depending on the regularisation strength. Edge preserving methods, such as anisotropic diffusion regularisation (AD), can preserve important features in the fluorescence image and smooth out noise. However, AD has limited ability to distinguish an edge from noise. We propose a patch-based anisotropic diffusion regularisation (PAD), where regularisation strength is determined by a weighted average according to the similarity between patches around voxels within a search window, instead of a simple local neighbourhood strategy. However, this method has higher computational complexity and, hence, we wavelet compress the patches (PAD-WT) to speed it up, while simultaneously taking advantage of the denoising properties of wavelet thresholding. Furthermore, structural information can be incorporated into the image reconstruction with PAD-WT to improve image quality and resolution. In this case, the weights used to average voxels in the image are calculated using the structural image, instead of the fluorescence image. The regularisation strength depends on both structural and fluorescence images, which guarantees that the method can preserve fluorescence information even when it is not structurally visible in the anatomical images. In part 1, we tested the method using a denoising problem. Here, we use simulated and in vivo mouse fDOT data to assess the algorithm performance. Our results show that the proposed PAD-WT method provides high quality and noise free images, superior to those obtained using AD.

  17. An anisotropic diffusion approximation to thermal radiative transfer

    International Nuclear Information System (INIS)

    Johnson, Seth R.; Larsen, Edward W.

    2011-01-01

    This paper describes an anisotropic diffusion (AD) method that uses transport-calculated AD coefficients to efficiently and accurately solve the thermal radiative transfer (TRT) equations. By assuming weak gradients and angular moments in the radiation intensity, we derive an expression for the radiation energy density that depends on a non-local function of the opacity. This nonlocal function is the solution of a transport equation that can be solved with a single steady-state transport sweep once per time step, and the function's second angular moment is the anisotropic diffusion tensor. To demonstrate the AD method's efficacy, we model radiation flow down a channel in 'flatland' geometry. (author)

  18. Inverse anisotropic diffusion from power density measurements in two dimensions

    International Nuclear Information System (INIS)

    Monard, François; Bal, Guillaume

    2012-01-01

    This paper concerns the reconstruction of an anisotropic diffusion tensor γ = (γ ij ) 1⩽i,j⩽2 from knowledge of internal functionals of the form γ∇u i · ∇u j with u i for 1 ⩽ i ⩽ I solutions of the elliptic equation ∇ · γ∇u i = 0 on a two-dimensional bounded domain with appropriate boundary conditions. We show that for I = 4 and appropriately chosen boundary conditions, γ may uniquely and stably be reconstructed from such internal functionals, which appear in coupled-physics inverse problems involving the ultrasound modulation of electrical or optical coefficients. Explicit reconstruction procedures for the diffusion tensor are presented and implemented numerically. (paper)

  19. Extended phase graphs with anisotropic diffusion

    Science.gov (United States)

    Weigel, M.; Schwenk, S.; Kiselev, V. G.; Scheffler, K.; Hennig, J.

    2010-08-01

    The extended phase graph (EPG) calculus gives an elegant pictorial description of magnetization response in multi-pulse MR sequences. The use of the EPG calculus enables a high computational efficiency for the quantitation of echo intensities even for complex sequences with multiple refocusing pulses with arbitrary flip angles. In this work, the EPG concept dealing with RF pulses with arbitrary flip angles and phases is extended to account for anisotropic diffusion in the presence of arbitrary varying gradients. The diffusion effect can be expressed by specific diffusion weightings of individual magnetization pathways. This can be represented as an action of a linear operator on the magnetization state. The algorithm allows easy integration of diffusion anisotropy effects. The formalism is validated on known examples from literature and used to calculate the effective diffusion weighting in multi-echo sequences with arbitrary refocusing flip angles.

  20. Edge Probability and Pixel Relativity-Based Speckle Reducing Anisotropic Diffusion.

    Science.gov (United States)

    Mishra, Deepak; Chaudhury, Santanu; Sarkar, Mukul; Soin, Arvinder Singh; Sharma, Vivek

    2018-02-01

    Anisotropic diffusion filters are one of the best choices for speckle reduction in the ultrasound images. These filters control the diffusion flux flow using local image statistics and provide the desired speckle suppression. However, inefficient use of edge characteristics results in either oversmooth image or an image containing misinterpreted spurious edges. As a result, the diagnostic quality of the images becomes a concern. To alleviate such problems, a novel anisotropic diffusion-based speckle reducing filter is proposed in this paper. A probability density function of the edges along with pixel relativity information is used to control the diffusion flux flow. The probability density function helps in removing the spurious edges and the pixel relativity reduces the oversmoothing effects. Furthermore, the filtering is performed in superpixel domain to reduce the execution time, wherein a minimum of 15% of the total number of image pixels can be used. For performance evaluation, 31 frames of three synthetic images and 40 real ultrasound images are used. In most of the experiments, the proposed filter shows a better performance as compared to the state-of-the-art filters in terms of the speckle region's signal-to-noise ratio and mean square error. It also shows a comparative performance for figure of merit and structural similarity measure index. Furthermore, in the subjective evaluation, performed by the expert radiologists, the proposed filter's outputs are preferred for the improved contrast and sharpness of the object boundaries. Hence, the proposed filtering framework is suitable to reduce the unwanted speckle and improve the quality of the ultrasound images.

  1. A new noise erosion operator for anisotropic diffusion

    Institute of Scientific and Technical Information of China (English)

    蔡超; 丁名跃; 周成平; 张天序

    2004-01-01

    A noise erosion operator based on partial differential equation (PDE) is introduced, which has an excellent ability of noise removal and edge preservation for two-dimensional (2D) gradient data. The operator is applied to estimate a new diffusion coefficient. Experimental results demonstrate that anisotropic diffusion based on this new erosion operator can efficiently reduce noise and sharpen object boundaries.

  2. Anisotropic diffusion tensor applied to temporal mammograms

    DEFF Research Database (Denmark)

    Karemore, Gopal; Brandt, Sami; Sporring, Jon

    2010-01-01

    changes related to  specific  effects  like  Hormonal  Replacement  Therapy  (HRT) and aging. Given effect-grouped patient data, we demonstrated how  anisotropic  diffusion  tensor  and  its  coherence  features computed in an anatomically oriented breast coordinate system followed by statistical learning...

  3. Pulsed neutron determination of anisotropic diffusion constants in multi-layered slabs

    International Nuclear Information System (INIS)

    Sri Ram, K.

    1978-01-01

    Anisotropic neutron diffusion parameters for graphite and plexiglas slab assemblies were calculated using one-dimensional discrete ordinates code ANISN, and also Case's eigenfunction expansion technique as suggested by Leonard. These calculated values were checked with the pulsed neutron experimental results as well as simple diffusion theory calculations of Spinrad. Relatively little experimental work has been done with heterogeneous assemblies which do not contain voids. The present comparison shows that the experimental results agree well with transport theory calculations. It appears from the results and inter-comparison of this work in simple geometries, that the pulsed neutron method can yield accurate experimental anisotropic diffusion constants, and can therefore be applied to more complicated geometries which may be difficult to calculate. (author)

  4. A simplified model exploration research of new anisotropic diffuse radiation model

    International Nuclear Information System (INIS)

    Yao, Wanxiang; Li, Zhengrong; Wang, Xiao; Zhao, Qun; Zhang, Zhigang; Lin, Lin

    2016-01-01

    Graphical abstract: The specific process of measured diffuse radiation data. - Highlights: • Simplified diffuse radiation model is extremely important for solar radiation simulation and energy simulation. • A new simplified anisotropic diffuse radiation model (NSADR model) is proposed. • The accuracy of existing models and NSADR model is compared based on the measured values. • The accuracy of the NSADR model is higher than that of the existing models, and suitable for calculating diffuse radiation. - Abstract: More accurate new anisotropic diffuse radiation model (NADR model) has been proposed, but the parameters and calculation process of NADR model used in the process are complex. So it is difficult to widely used in the simulation software and engineering calculation. Based on analysis of the diffuse radiation model and measured diffuse radiation data, this paper put forward three hypotheses: (1) diffuse radiation from sky horizontal region is concentrated in a very thin layer which is close to the line source; (2) diffuse radiation from circumsolar region is concentrated in the point of the sun; (3) diffuse radiation from orthogonal region is concentrated in the point located at 90 degree angles with the Sun. Based on these hypotheses, NADR model is simplified to a new simplified anisotropic diffuse radiation model (NSADR model). Then the accuracy of NADR model and its simplified model (NSADR model) are compared with existing models based on the measured values, and the result shows that Perez model and its simplified model are relatively accurate among existing models. However, the accuracy of these two models is lower than the NADR model and NSADR model due to neglect the influence of the orthogonal diffuse radiation. The accuracy of the NSADR model is higher than that of the existing models, meanwhile, another advantage is that the NSADR model simplifies the process of solution parameters and calculation. Therefore it is more suitable for

  5. Estimating anisotropic diffusion of neutrons near the boundary of a pebble bed random system

    Energy Technology Data Exchange (ETDEWEB)

    Vasques, R. [Department of Mathematics, Center for Computational Engineering Science, RWTH Aachen University, Schinkel Strasse 2, D-52062 Aachen (Germany)

    2013-07-01

    Due to the arrangement of the pebbles in a Pebble Bed Reactor (PBR) core, if a neutron is located close to a boundary wall, its path length probability distribution function in directions of flight parallel to the wall is significantly different than in other directions. Hence, anisotropic diffusion of neutrons near the boundaries arises. We describe an analysis of neutron transport in a simplified 3-D pebble bed random system, in which we investigate the anisotropic diffusion of neutrons born near one of the system's boundary walls. While this simplified system does not model the actual physical process that takes place near the boundaries of a PBR core, the present work paves the road to a formulation that may enable more accurate diffusion simulations of such problems to be performed in the future. Monte Carlo codes have been developed for (i) deriving realizations of the 3-D random system, and (ii) performing 3-D neutron transport inside the heterogeneous model; numerical results are presented for three different choices of parameters. These numerical results are used to assess the accuracy of estimates for the mean-squared displacement of neutrons obtained with the diffusion approximations of the Atomic Mix Model and of the recently introduced [1] Non-Classical Theory with angular-dependent path length distribution. The Non-Classical Theory makes use of a Generalized Linear Boltzmann Equation in which the locations of the scattering centers in the system are correlated and the distance to collision is not exponentially distributed. We show that the results predicted using the Non-Classical Theory successfully model the anisotropic behavior of the neutrons in the random system, and more closely agree with experiment than the results predicted by the Atomic Mix Model. (authors)

  6. Estimating anisotropic diffusion of neutrons near the boundary of a pebble bed random system

    International Nuclear Information System (INIS)

    Vasques, R.

    2013-01-01

    Due to the arrangement of the pebbles in a Pebble Bed Reactor (PBR) core, if a neutron is located close to a boundary wall, its path length probability distribution function in directions of flight parallel to the wall is significantly different than in other directions. Hence, anisotropic diffusion of neutrons near the boundaries arises. We describe an analysis of neutron transport in a simplified 3-D pebble bed random system, in which we investigate the anisotropic diffusion of neutrons born near one of the system's boundary walls. While this simplified system does not model the actual physical process that takes place near the boundaries of a PBR core, the present work paves the road to a formulation that may enable more accurate diffusion simulations of such problems to be performed in the future. Monte Carlo codes have been developed for (i) deriving realizations of the 3-D random system, and (ii) performing 3-D neutron transport inside the heterogeneous model; numerical results are presented for three different choices of parameters. These numerical results are used to assess the accuracy of estimates for the mean-squared displacement of neutrons obtained with the diffusion approximations of the Atomic Mix Model and of the recently introduced [1] Non-Classical Theory with angular-dependent path length distribution. The Non-Classical Theory makes use of a Generalized Linear Boltzmann Equation in which the locations of the scattering centers in the system are correlated and the distance to collision is not exponentially distributed. We show that the results predicted using the Non-Classical Theory successfully model the anisotropic behavior of the neutrons in the random system, and more closely agree with experiment than the results predicted by the Atomic Mix Model. (authors)

  7. Micromagnetic simulation of anisotropic grain boundary diffusion for sintered Nd-Fe-B magnets

    Science.gov (United States)

    Li, W.; Zhou, Q.; Zhao, L. Z.; Wang, Q. X.; Zhong, X. C.; Liu, Z. W.

    2018-04-01

    A systematic investigation on the anisotropic grain boundary diffusion in sintered Nd-Fe-B magnets is carried out by micromagnetic simulation. The results indicate that the critical reason for the anisotropic diffusion effect is not the difference in the amount of Dy diffused along different directions but the macroscopic demagnetizing field. The diffusion parallel to the easy axis from both pole surfaces of the magnet can increase the nucleation fields in the two major regions with large macroscopic demagnetizing fields, where the reverse domains can nucleate easily. As a consequence, the grain boundary diffusion along the directions parallel to the easy axis from two pole surfaces is more effective to improve the coercivity of the magnets than that along other directions. It is also found that, to enhance the coercivity, only a limited diffusion depth is required. The present result is in good agreement with the recent experimental findings.

  8. A parametric finite element method for solid-state dewetting problems with anisotropic surface energies

    Science.gov (United States)

    Bao, Weizhu; Jiang, Wei; Wang, Yan; Zhao, Quan

    2017-02-01

    We propose an efficient and accurate parametric finite element method (PFEM) for solving sharp-interface continuum models for solid-state dewetting of thin films with anisotropic surface energies. The governing equations of the sharp-interface models belong to a new type of high-order (4th- or 6th-order) geometric evolution partial differential equations about open curve/surface interface tracking problems which include anisotropic surface diffusion flow and contact line migration. Compared to the traditional methods (e.g., marker-particle methods), the proposed PFEM not only has very good accuracy, but also poses very mild restrictions on the numerical stability, and thus it has significant advantages for solving this type of open curve evolution problems with applications in the simulation of solid-state dewetting. Extensive numerical results are reported to demonstrate the accuracy and high efficiency of the proposed PFEM.

  9. Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

    International Nuclear Information System (INIS)

    Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

    2014-01-01

    Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

  10. MR imaging evidence of anisotropic diffusion in the cat brain

    International Nuclear Information System (INIS)

    Moseley, M.E.; Mintorovich, J.; Cohen, Y.; Chilevitt, L.; Tsuruda, J.; Norman, D.; Weinstein, P.

    1989-01-01

    This paper discusses a study of diffusion behavior of brain water in the cat. Diffusion-weighted images, acquired with large gradient b values of 1,000-2,000 sec/mm 2 , showed no clear evidence of anisotropic water diffusion in either gray matter or basal ganglia. Large directional differences in image intensities and diffusion values were observed in cortical and deep white matter. Faster diffusion was sen when the direction of the applied diffusion gradient was parallel to the orientation of the white matter. Diffusion perpendicular to the gradient direction was significantly lower. This effect was proportional to gradient duration and strength and was seen in both pre- and immediate post-mortem images in all axial, sagittal, and coronal images

  11. Nanoscale Rheology and Anisotropic Diffusion Using Single Gold Nanorod Probes

    Science.gov (United States)

    Molaei, Mehdi; Atefi, Ehsan; Crocker, John C.

    2018-03-01

    The complex rotational and translational Brownian motion of anisotropic particles depends on their shape and the viscoelasticity of their surroundings. Because of their strong optical scattering and chemical versatility, gold nanorods would seem to provide the ultimate probes of rheology at the nanoscale, but the suitably accurate orientational tracking required to compute rheology has not been demonstrated. Here we image single gold nanorods with a laser-illuminated dark-field microscope and use optical polarization to determine their three-dimensional orientation to better than one degree. We convert the rotational diffusion of single nanorods in viscoelastic polyethylene glycol solutions to rheology and obtain excellent agreement with bulk measurements. Extensions of earlier models of anisotropic translational diffusion to three dimensions and viscoelastic fluids give excellent agreement with the observed motion of single nanorods. We find that nanorod tracking provides a uniquely capable approach to microrheology and provides a powerful tool for probing nanoscale dynamics and structure in a range of soft materials.

  12. Analysis of an aggregation-based algebraic two-grid method for a rotated anisotropic diffusion problem

    KAUST Repository

    Chen, Meng-Huo; Greenbaum, Anne

    2015-01-01

    Summary: A two-grid convergence analysis based on the paper [Algebraic analysis of aggregation-based multigrid, by A. Napov and Y. Notay, Numer. Lin. Alg. Appl. 18 (2011), pp. 539-564] is derived for various aggregation schemes applied to a finite element discretization of a rotated anisotropic diffusion equation. As expected, it is shown that the best aggregation scheme is one in which aggregates are aligned with the anisotropy. In practice, however, this is not what automatic aggregation procedures do. We suggest approaches for determining appropriate aggregates based on eigenvectors associated with small eigenvalues of a block splitting matrix or based on minimizing a quantity related to the spectral radius of the iteration matrix. © 2015 John Wiley & Sons, Ltd.

  13. Analysis of an aggregation-based algebraic two-grid method for a rotated anisotropic diffusion problem

    KAUST Repository

    Chen, Meng-Huo

    2015-03-18

    Summary: A two-grid convergence analysis based on the paper [Algebraic analysis of aggregation-based multigrid, by A. Napov and Y. Notay, Numer. Lin. Alg. Appl. 18 (2011), pp. 539-564] is derived for various aggregation schemes applied to a finite element discretization of a rotated anisotropic diffusion equation. As expected, it is shown that the best aggregation scheme is one in which aggregates are aligned with the anisotropy. In practice, however, this is not what automatic aggregation procedures do. We suggest approaches for determining appropriate aggregates based on eigenvectors associated with small eigenvalues of a block splitting matrix or based on minimizing a quantity related to the spectral radius of the iteration matrix. © 2015 John Wiley & Sons, Ltd.

  14. Survey on visualization and analysis techniques based on diffusion MRI for in-vivo anisotropic diffusion structures

    International Nuclear Information System (INIS)

    Masutani, Yoshitaka; Sato, Tetsuo; Urayama, Shin-ichi; Bihan, D.L.

    2008-01-01

    In association with development of diffusion MR imaging technologies for anisotropic diffusion measurement in living body, related research is explosively increasing including research fields of applied mathematics and visualization in addition to MR imaging, biomedical image technology, and medical science. One of the reasons is that the diffusion MRI data set is a set of high dimensional image information beyond conventional scalar or vector images, and is attractive for the researchers in the related fields. This survey paper is mainly aimed at introducing state-of-the-art of post processing techniques reported in the literature for diffusion MRI data, such as analysis and visualization. (author)

  15. Development and application of an exchange model for anisotropic water diffusion in the microporous MOF aluminum fumarate

    Science.gov (United States)

    Splith, Tobias; Fröhlich, Dominik; Henninger, Stefan K.; Stallmach, Frank

    2018-06-01

    Diffusion of water in aluminum fumarate was studied by means of pulsed field gradient (PFG) nuclear magnetic resonance (NMR). Due to water molecules exchanging between the intracrystalline anisotropic pore space and the isotropic intercrystalline void space the model of intracrystalline anisotropic diffusion fails to describe the experimental PFG NMR data at high observation times. Therefore, the two-site exchange model developed by Kärger is extended to the case of exchange between an anisotropic and an isotropic site. This extended exchange model is solved by numerical integration. It describes the experimental data very well and yields values for the intracrystalline diffusion coefficient and the mean residence times of the respective sites. Further PFG NMR studies were performed with coatings consisting of small aluminum fumarate crystals, which are used in adsorptive heat transformation applications. The diffusion coefficients of water in the small crystal coating are compared to the values expected from the extended two-site exchange model and from the model of long-range diffusion.

  16. Artifact reduction of compressed images and video combining adaptive fuzzy filtering and directional anisotropic diffusion

    DEFF Research Database (Denmark)

    Nadernejad, Ehsan; Forchhammer, Søren; Korhonen, Jari

    2011-01-01

    and ringing artifacts, we have applied directional anisotropic diffusion. Besides that, the selection of the adaptive threshold parameter for the diffusion coefficient has also improved the performance of the algorithm. Experimental results on JPEG compressed images as well as MJPEG and H.264 compressed......Fuzzy filtering is one of the recently developed methods for reducing distortion in compressed images and video. In this paper, we combine the powerful anisotropic diffusion equations with fuzzy filtering in order to reduce the impact of artifacts. Based on the directional nature of the blocking...... videos show improvement in artifact reduction of the proposed algorithm over other directional and spatial fuzzy filters....

  17. Multiresolution, Multi-Scale Target Identification and Tracking using the Anisotropic Diffusion Pyramid

    National Research Council Canada - National Science Library

    Acton, Scott

    1998-01-01

    ...: the anisotropic diffusion pyramid and the morphological pyramid. Coarse-to-fine target searches are implemented within the image pyramids, providing a lOOX improvement in computational expense over standard correlation-based approaches...

  18. Speckle reduction in echocardiography by temporal compounding and anisotropic diffusion filtering

    Science.gov (United States)

    Giraldo-Guzmán, Jader; Porto-Solano, Oscar; Cadena-Bonfanti, Alberto; Contreras-Ortiz, Sonia H.

    2015-01-01

    Echocardiography is a medical imaging technique based on ultrasound signals that is used to evaluate heart anatomy and physiology. Echocardiographic images are affected by speckle, a type of multiplicative noise that obscures details of the structures, and reduces the overall image quality. This paper shows an approach to enhance echocardiography using two processing techniques: temporal compounding and anisotropic diffusion filtering. We used twenty echocardiographic videos that include one or three cardiac cycles to test the algorithms. Two images from each cycle were aligned in space and averaged to obtain the compound images. These images were then processed using anisotropic diffusion filters to further improve their quality. Resultant images were evaluated using quality metrics and visual assessment by two medical doctors. The average total improvement on signal-to-noise ratio was up to 100.29% for videos with three cycles, and up to 32.57% for videos with one cycle.

  19. Variational Multiscale error estimator for anisotropic adaptive fluid mechanic simulations: application to convection-diffusion problems

    OpenAIRE

    Bazile , Alban; Hachem , Elie; Larroya-Huguet , Juan-Carlos; Mesri , Youssef

    2018-01-01

    International audience; In this work, we present a new a posteriori error estimator based on the Variational Multiscale method for anisotropic adaptive fluid mechanics problems. The general idea is to combine the large scale error based on the solved part of the solution with the sub-mesh scale error based on the unresolved part of the solution. We compute the latter with two different methods: one using the stabilizing parameters and the other using bubble functions. We propose two different...

  20. An Efficient FPGA Implementation of Optimized Anisotropic Diffusion Filtering of Images

    Directory of Open Access Journals (Sweden)

    Chandrajit Pal

    2016-01-01

    Full Text Available Digital image processing is an exciting area of research with a variety of applications including medical, surveillance security systems, defence, and space applications. Noise removal as a preprocessing step helps to improve the performance of the signal processing algorithms, thereby enhancing image quality. Anisotropic diffusion filtering proposed by Perona and Malik can be used as an edge-preserving smoother, removing high-frequency components of images without blurring their edges. In this paper, we present the FPGA implementation of an edge-preserving anisotropic diffusion filter for digital images. The designed architecture completely replaced the convolution operation and implemented the same using simple arithmetic subtraction of the neighboring intensities within a kernel, preceded by multiple operations in parallel within the kernel. To improve the image reconstruction quality, the diffusion coefficient parameter, responsible for controlling the filtering process, has been properly analyzed. Its signal behavior has been studied by subsequently scaling and differentiating the signal. The hardware implementation of the proposed design shows better performance in terms of reconstruction quality and accelerated performance with respect to its software implementation. It also reduces computation, power consumption, and resource utilization with respect to other related works.

  1. Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.

    1989-01-01

    One of the iterative methods which is used to solve the discretized transport equation is called the Source Iteration Method (SI). The SI method converges very slowly for problems with optically thick regions and scattering ratios (σ s /σ t ) near unity. The Diffusion-Synthetic Acceleration method (DSA) is one of the methods which has been devised to improve the convergence rate of the SI method. The DSA method is a good tool to accelerate the SI method, if the particle which is being dealt with is a neutron. This is because the scattering process for neutrons is not severely anisotropic. However, if the particle is a charged particle (electron), DSA becomes ineffective as an acceleration device because here the scattering process is severely anisotropic. To improve the DSA algorithm for electron transport, the author approaches the problem in two different ways in this thesis. He develops the first approach by accelerating more angular moments (φ 0 , φ 1 , φ 2 , φ 3 ,...) than is done in DSA; he calls this approach the Modified P N Synthetic Acceleration (MPSA) method. In the second approach he modifies the definition of the transport sweep, using the physics of the scattering; he calls this approach the Modified Diffusion Synthetic Acceleration (MDSA) method. In general, he has developed, analyzed, and implemented the MPSA and MDSA methods in this thesis and has shown that for a high order quadrature set and mesh widths about 1.0 cm, they are each about 34 times faster (clock time) than the DSA method. Also, he has found that the MDSA spectral radius decreases as the mesh size increases. This makes the MDSA method a better choice for large spatial meshes

  2. Imaging of postthalamic visual fiber tracts by anisotropic diffusion weighted MRI and diffusion tensor imaging: principles and applications

    International Nuclear Information System (INIS)

    Reinges, Marcus H.T.; Schoth, Felix; Coenen, Volker A.; Krings, Timo

    2004-01-01

    Diffusion weighted MRI offers the possibility to study the course of the cerebral white matter tracts. In the present manuscript, the basics, the technique and the limitations of diffusion tensor imaging and anisotropic diffusion weighted MRI are presented and their applications in various neurological and neurosurgical diseases are discussed with special emphasis on the visual system. A special focus is laid on the combination of fiber tract imaging, anatomical imaging and functional MRI for presurgical planning and intraoperative neuronavigation of lesions near the visual system

  3. Non-integrability of the Anisotropic Stormer Problem and the Isosceles Three-Body Problem

    Science.gov (United States)

    Nomikos, D. G.; Papageorgiou, V. G.

    2009-02-01

    We study the Anisotropic Stormer Problem (ASP) and the Isosceles Three-Body Problem (IP), from the viewpoint of integrability, using Morales-Ramis theory and its generalization. The study of their integrability presents particular interest since they model important physical phenomena. Both problems can be reduced with respect to the S1 symmetry. Almeida and Stuchi [M.A. Almeida, T.J. Stuchi, Non-integrability of the anisotropic Stormer problem with angular momentum, Physica D 189 (2004) 219-233] proved that the reduced ASP is non-integrable for almost all values of the parameters. In this paper we establish the non-integrability (in the extended Liouville sense) of the remaining cases. The IP is a special case of the three-body problem and it can be considered as a generalization of the Sitnikov problem. Here we prove that the complexified reduced IP does not admit an additional independent meromorphic first integral.

  4. Understanding the anisotropic strain effects on lithium diffusion in graphite anodes: A first-principles study

    Science.gov (United States)

    Ji, Xiang; Wang, Yang; Zhang, Junqian

    2018-06-01

    The lithium diffusion in graphite anode, which is the most widely used commercial electrode material today, affects the charge/discharge performance of lithium-ion batteries. In this study, the anisotropic strain effects on lithium diffusion in graphite anodes are systematically investigated using first-principles calculations based on density functional theory (DFT) with van der Waals corrections. It is found that the effects of external applied strains along various directions of LixC6 (i.e., perpendicular or parallel to the basal planes of the graphite host) on lithium diffusivity are different. Along the direction perpendicular to the graphite planes, the tensile strain facilitates in-plane Li diffusion by reducing the energy barrier, and the compressive strain hinders in-plane Li diffusion by raising the energy barrier. In contrast, the in-plane biaxial tensile strain (parallel to the graphite planes) hinders in-plane Li diffusion, and the in-plane biaxial compressive strain facilitates in-plane Li diffusion. Furthermore, both in-plane and transverse shear strains slightly influence Li diffusion in graphite anodes. A discussion is presented to explain the anisotropic strain dependence of lithium diffusion. This research provides data for the continuum modelling of the electrodes in the lithium-ion batteries.

  5. Explosive anisotropic grain growth of delta-NiMo by solid-state diffusion

    International Nuclear Information System (INIS)

    Chou, T.C.; Nieh, T.G.

    1991-01-01

    Anomalous, anisotropic grain growth has been observed in delta(δ)-NiMo intermetallic compound during the annealings of Mo/Ni thin-film diffusion couples at 700 and 800 degree C. Two layered microstructures showing median-sized, equiaxed grains and large columnar single crystalline grains were generated. The growth direction of the columnar grains was parallel to the direction of Ni diffusion flux. Electron diffraction indicated that both the median-sized and the columnar grains were δ-NiMo. The composition of δ-NiMo was determined to be Ni48-Mo52 (at.%). According to the thickness of reaction-formed δ-NiMo, the apparent interdiffusion coefficient was measured to be about 10 -10 cm 2 /s which is 4 to 5 orders of magnitude greater than literature data. The enhanced diffusion rate in Ni-Mo, and the anomalous anisotropic grain growth of δ-NiMo compound are discussed on the basis of exothermic reactions between Ni and Mo during diffusional intermixing. The enthalpy of the formation of δ-NiMo is calculated and demonstrated to be sufficient to cause melting/solidification of the compound

  6. Stefan-Maxwell Relations and Heat Flux with Anisotropic Transport Coefficients for Ionized Gases in a Magnetic Field with Application to the Problem of Ambipolar Diffusion

    Science.gov (United States)

    Kolesnichenko, A. V.; Marov, M. Ya.

    2018-01-01

    The defining relations for the thermodynamic diffusion and heat fluxes in a multicomponent, partially ionized gas mixture in an external electromagnetic field have been obtained by the methods of the kinetic theory. Generalized Stefan-Maxwell relations and algebraic equations for anisotropic transport coefficients (the multicomponent diffusion, thermal diffusion, electric and thermoelectric conductivity coefficients as well as the thermal diffusion ratios) associated with diffusion-thermal processes have been derived. The defining second-order equations are derived by the Chapman-Enskog procedure using Sonine polynomial expansions. The modified Stefan-Maxwell relations are used for the description of ambipolar diffusion in the Earth's ionospheric plasma (in the F region) composed of electrons, ions of many species, and neutral particles in a strong electromagnetic field.

  7. Dynamic problem of generalized thermoelastic diffusive medium

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Rajneesh; Kansal, Tarun [Kurukshetra University, Kurukshetra (India)

    2010-01-15

    The equations of generalized thermoelastic diffusion, based on the theory of Lord and Shulman with one relaxation time, are derived for anisotropic media with rotation. The variational principle and reciprocity theorem for the governing equations are derived. The propagation of leaky Rayleigh waves in a viscous fluid layer overlying a homogeneous isotropic, generalized thermoelastic diffusive half space with rotating frame of reference is studied

  8. Remarks on the percolation problem in anisotropic systems

    International Nuclear Information System (INIS)

    Chaves, C.M.G.F.; Oliveira, P.M.C. de; Queiroz, S.L.A. de; Riera, R.

    1979-07-01

    The bond percolation problem is discused in an anisotropic square lattice using the position space renormalization group. It is shown that, due to symmetry, this treatment reproduces known exact results for this problem. The phase diagram and the flow lines in parameter space are also shown. Results are in agreement with universality.(Author) [pt

  9. Numerical analysis of anisotropic diffusion effect on ICF hydrodynamic instabilities

    Directory of Open Access Journals (Sweden)

    Olazabal-Loumé M.

    2013-11-01

    Full Text Available The effect of anisotropic diffusion on hydrodynamic instabilities in the context of Inertial Confinement Fusion (ICF flows is numerically assessed. This anisotropy occurs in indirect-drive when laminated ablators are used to modify the lateral transport [1,2]. In direct-drive, non-local transport mechanisms and magnetic fields may modify the lateral conduction [3]. In this work, numerical simulations obtained with the code PERLE [4], dedicated to linear stability analysis, are compared with previous theoretical results [5]. In these approaches, the diffusion anisotropy can be controlled by a characteristic coefficient which enables a comprehensive study. This work provides new results on the ablative Rayleigh-Taylor (RT, ablative Richtmyer-Meshkov (RM and Darrieus-Landau (DL instabilities.

  10. Speckle Reduction and Structure Enhancement by Multichannel Median Boosted Anisotropic Diffusion

    Directory of Open Access Journals (Sweden)

    Yang Zhi

    2004-01-01

    Full Text Available We propose a new approach to reduce speckle noise and enhance structures in speckle-corrupted images. It utilizes a median-anisotropic diffusion compound scheme. The median-filter-based reaction term acts as a guided energy source to boost the structures in the image being processed. In addition, it regularizes the diffusion equation to ensure the existence and uniqueness of a solution. We also introduce a decimation and back reconstruction scheme to further enhance the processing result. Before the iteration of the diffusion process, the image is decimated and a subpixel shifted image set is formed. This allows a multichannel parallel diffusion iteration, and more importantly, the speckle noise is broken into impulsive or salt-pepper noise, which is easy to remove by median filtering. The advantage of the proposed technique is clear when it is compared to other diffusion algorithms and the well-known adaptive weighted median filtering (AWMF scheme in both simulation and real medical ultrasound images.

  11. A review of anisotropic conductivity models of brain white matter based on diffusion tensor imaging.

    Science.gov (United States)

    Wu, Zhanxiong; Liu, Yang; Hong, Ming; Yu, Xiaohui

    2018-06-01

    The conductivity of brain tissues is not only essential for electromagnetic source estimation (ESI), but also a key reflector of the brain functional changes. Different from the other brain tissues, the conductivity of whiter matter (WM) is highly anisotropic and a tensor is needed to describe it. The traditional electrical property imaging methods, such as electrical impedance tomography (EIT) and magnetic resonance electrical impedance tomography (MREIT), usually fail to image the anisotropic conductivity tensor of WM with high spatial resolution. The diffusion tensor imaging (DTI) is a newly developed technique that can fulfill this purpose. This paper reviews the existing anisotropic conductivity models of WM based on the DTI and discusses their advantages and disadvantages, as well as identifies opportunities for future research on this subject. It is crucial to obtain the linear conversion coefficient between the eigenvalues of anisotropic conductivity tensor and diffusion tensor, since they share the same eigenvectors. We conclude that the electrochemical model is suitable for ESI analysis because the conversion coefficient can be directly obtained from the concentration of ions in extracellular liquid and that the volume fraction model is appropriate to study the influence of WM structural changes on electrical conductivity. Graphical abstract ᅟ.

  12. Perona Malik anisotropic diffusion model using Peaceman Rachford scheme on digital radiographic image

    International Nuclear Information System (INIS)

    Halim, Suhaila Abd; Razak, Rohayu Abd; Ibrahim, Arsmah; Manurung, Yupiter HP

    2014-01-01

    In image processing, it is important to remove noise without affecting the image structure as well as preserving all the edges. Perona Malik Anisotropic Diffusion (PMAD) is a PDE-based model which is suitable for image denoising and edge detection problems. In this paper, the Peaceman Rachford scheme is applied on PMAD to remove unwanted noise as the scheme is efficient and unconditionally stable. The capability of the scheme to remove noise is evaluated on several digital radiography weld defect images computed using MATLAB R2009a. Experimental results obtained show that the Peaceman Rachford scheme improves the image quality substantially well based on the Peak Signal to Noise Ratio (PSNR). The Peaceman Rachford scheme used in solving the PMAD model successfully removes unwanted noise in digital radiographic image

  13. Perona Malik anisotropic diffusion model using Peaceman Rachford scheme on digital radiographic image

    Energy Technology Data Exchange (ETDEWEB)

    Halim, Suhaila Abd; Razak, Rohayu Abd; Ibrahim, Arsmah [Center of Mathematics Studies, Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA, 40450 Shah Alam. Selangor DE (Malaysia); Manurung, Yupiter HP [Advanced Manufacturing Technology Excellence Center (AMTEx), Faculty of Mechanical Engineering, Universiti Teknologi MARA, 40450 Shah Alam. Selangor DE (Malaysia)

    2014-06-19

    In image processing, it is important to remove noise without affecting the image structure as well as preserving all the edges. Perona Malik Anisotropic Diffusion (PMAD) is a PDE-based model which is suitable for image denoising and edge detection problems. In this paper, the Peaceman Rachford scheme is applied on PMAD to remove unwanted noise as the scheme is efficient and unconditionally stable. The capability of the scheme to remove noise is evaluated on several digital radiography weld defect images computed using MATLAB R2009a. Experimental results obtained show that the Peaceman Rachford scheme improves the image quality substantially well based on the Peak Signal to Noise Ratio (PSNR). The Peaceman Rachford scheme used in solving the PMAD model successfully removes unwanted noise in digital radiographic image.

  14. A numerical method for two-dimensional anisotropic transport problem in cylindrical geometry

    International Nuclear Information System (INIS)

    Du Mingsheng; Feng Tiekai; Fu Lianxiang; Cao Changshu; Liu Yulan

    1988-01-01

    The authors deal with the triangular mesh-discontinuous finite element method for solving the time-dependent anisotropic neutron transport problem in two-dimensional cylindrical geometry. A prior estimate of the numerical solution is given. Stability is proved. The authors have computed a two dimensional anisotropic neutron transport problem and a Tungsten-Carbide critical assembly problem by using the numerical method. In comparision with DSN method and the experimental results obtained by others both at home and abroad, the method is satisfactory

  15. Anisotropic Thermal Diffusivities of Plasma-Sprayed Thermal Barrier Coatings

    Science.gov (United States)

    Akoshima, Megumi; Takahashi, Satoru

    2017-09-01

    Thermal barrier coatings (TBCs) are used to shield the blades of gas turbines from heat and wear. There is a pressing need to evaluate the thermal conductivity of TBCs in the thermal design of advanced gas turbines with high energy efficiency. These TBCs consist of a ceramic-based top coat and a bond coat on a superalloy substrate. Usually, the focus is on the thermal conductivity in the thickness direction of the TBC because heat tends to diffuse from the surface of the top coat to the substrate. However, the in-plane thermal conductivity is also important in the thermal design of gas turbines because the temperature distribution within the turbine cannot be ignored. Accordingly, a method is developed in this study for measuring the in-plane thermal diffusivity of the top coat. Yttria-stabilized zirconia top coats are prepared by thermal spraying under different conditions. The in-plane and cross-plane thermal diffusivities of the top coats are measured by the flash method to investigate the anisotropy of thermal conduction in a TBC. It is found that the in-plane thermal diffusivity is higher than the cross-plane one for each top coat and that the top coats have significantly anisotropic thermal diffusivity. The cross-sectional and in-plane microstructures of the top coats are observed, from which their porosities are evaluated. The thermal diffusivity and its anisotropy are discussed in detail in relation to microstructure and porosity.

  16. Two-relaxation-time lattice Boltzmann method for the anisotropic dispersive Henry problem

    Science.gov (United States)

    Servan-Camas, Borja; Tsai, Frank T.-C.

    2010-02-01

    This study develops a lattice Boltzmann method (LBM) with a two-relaxation-time collision operator (TRT) to cope with anisotropic heterogeneous hydraulic conductivity and anisotropic velocity-dependent hydrodynamic dispersion in the saltwater intrusion problem. The directional-speed-of-sound technique is further developed to address anisotropic hydraulic conductivity and dispersion tensors. Forcing terms are introduced in the LBM to correct numerical errors that arise during the recovery procedure and to describe the sink/source terms in the flow and transport equations. In order to facilitate the LBM implementation, the forcing terms are combined with the equilibrium distribution functions (EDFs) to create pseudo-EDFs. This study performs linear stability analysis and derives LBM stability domains to solve the anisotropic advection-dispersion equation. The stability domains are used to select the time step at which the lattice Boltzmann method provides stable solutions to the numerical examples. The LBM was implemented for the anisotropic dispersive Henry problem with high ratios of longitudinal to transverse dispersivities, and the results compared well to the solutions in the work of Abarca et al. (2007).

  17. Fourth-order discrete anisotropic boundary-value problems

    Directory of Open Access Journals (Sweden)

    Maciej Leszczynski

    2015-09-01

    Full Text Available In this article we consider the fourth-order discrete anisotropic boundary value problem with both advance and retardation. We apply the direct method of the calculus of variations and the mountain pass technique to prove the existence of at least one and at least two solutions. Non-existence of non-trivial solutions is also undertaken.

  18. An anisotropic standing wave braneworld and associated Sturm-Liouville problem

    International Nuclear Information System (INIS)

    Gogberashvili, Merab; Herrera-Aguilar, Alfredo; Malagón-Morejón, Dagoberto

    2012-01-01

    We present a consistent derivation of the recently proposed 5D anisotropic standing wave braneworld generated by gravity coupled to a phantom-like scalar field. We explicitly solve the corresponding junction conditions, a fact that enables us to give a physical interpretation to the anisotropic energy-momentum tensor components of the brane. So matter on the brane represents an oscillating fluid which emits anisotropic waves into the bulk. We also analyze the Sturm-Liouville problem associated with the correct localization condition of the transverse to the brane metric and scalar fields. It is shown that this condition restricts the physically meaningful space of solutions for the localization of the fluctuations of the model. (paper)

  19. Evidence for equivalence of diffusion processes of passive scalar and magnetic fields in anisotropic Navier-Stokes turbulence.

    Science.gov (United States)

    Jurčišinová, E; Jurčišin, M

    2017-05-01

    The influence of the uniaxial small-scale anisotropy on the kinematic magnetohydrodynamic turbulence is investigated by using the field theoretic renormalization group technique in the one-loop approximation of a perturbation theory. The infrared stable fixed point of the renormalization group equations, which drives the scaling properties of the model in the inertial range, is investigated as the function of the anisotropy parameters and it is shown that, at least at the one-loop level of approximation, the diffusion processes of the weak passive magnetic field in the anisotropically driven kinematic magnetohydrodynamic turbulence are completely equivalent to the corresponding diffusion processes of passively advected scalar fields in the anisotropic Navier-Stokes turbulent environments.

  20. A GENERALIZED DIFFUSION TENSOR FOR FULLY ANISOTROPIC DIFFUSION OF ENERGETIC PARTICLES IN THE HELIOSPHERIC MAGNETIC FIELD

    International Nuclear Information System (INIS)

    Effenberger, F.; Fichtner, H.; Scherer, K.; Barra, S.; Kleimann, J.; Strauss, R. D.

    2012-01-01

    The spatial diffusion of cosmic rays in turbulent magnetic fields can, in the most general case, be fully anisotropic, i.e., one has to distinguish three diffusion axes in a local, field-aligned frame. We reexamine the transformation for the diffusion tensor from this local to a global frame, in which the Parker transport equation for energetic particles is usually formulated and solved. Particularly, we generalize the transformation formulae to allow for an explicit choice of two principal local perpendicular diffusion axes. This generalization includes the 'traditional' diffusion tensor in the special case of isotropic perpendicular diffusion. For the local frame, we describe the motivation for the choice of the Frenet-Serret trihedron, which is related to the intrinsic magnetic field geometry. We directly compare the old and the new tensor elements for two heliospheric magnetic field configurations, namely the hybrid Fisk and Parker fields. Subsequently, we examine the significance of the different formulations for the diffusion tensor in a standard three-dimensional model for the modulation of galactic protons. For this, we utilize a numerical code to evaluate a system of stochastic differential equations equivalent to the Parker transport equation and present the resulting modulated spectra. The computed differential fluxes based on the new tensor formulation deviate from those obtained with the 'traditional' one (only valid for isotropic perpendicular diffusion) by up to 60% for energies below a few hundred MeV depending on heliocentric distance.

  1. Half-space albedo problem with modified F{sub N} method for linear and quadratic anisotropic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Tuereci, R.G. [Kirikkale Univ., Kirikkale (Turkey). Kirikkale Vocational School; Tuereci, D. [Ministry of Education, Ankara (Turkey). 75th year Anatolia High School

    2017-05-15

    One speed, time independent and homogeneous medium neutron transport equation can be solved with the anisotropic scattering which includes both the linear anisotropic and the quadratic anisotropic scattering properties. Having solved Case's eigenfunctions and the orthogonality relations among these eigenfunctions, some neutron transport problems such as albedo problem can be calculated as numerically by using numerical or semi-analytic methods. In this study the half-space albedo problem is investigated by using the modified F{sub N} method.

  2. Three anisotropic benchmark problems for adaptive finite element methods

    Czech Academy of Sciences Publication Activity Database

    Šolín, Pavel; Čertík, O.; Korous, L.

    2013-01-01

    Roč. 219, č. 13 (2013), s. 7286-7295 ISSN 0096-3003 R&D Projects: GA AV ČR IAA100760702 Institutional support: RVO:61388998 Keywords : benchmark problem * anisotropic solution * boundary layer Subject RIV: BA - General Mathematics Impact factor: 1.600, year: 2013

  3. The generalized PN synthetic acceleration method for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.

    1997-01-01

    The diffusion synthetic acceleration (DSA) method has been known to be an effective tool for accelerating the iterative solution of transport equations with isotropic or mildly anisotropic scattering. However, the DSA method is not effective for transport equations that have strongly anisotropic scattering. A generalization of the modified DSA (MDSA) method is proposed that converges (clock time) faster than the MDSA method. This method is developed, the results of a Fourier analysis that theoretically predicts its efficiency are described, and numerical results that verify the theoretical prediction are presented

  4. Anisotropic Diffusion In Layered Argillaceous Rocks: A Case Study With Opalinus Clay

    International Nuclear Information System (INIS)

    Van Loon, L.R.; Soler, J.; Mueller, W.; Bradbury, M.H.

    2003-01-01

    Anisotropic diffusion was studied in Opalinus Clay, a potential host rock for the disposal of spent fuel, vitrified high-level waste and intermediate-level waste. Diffusion parallel to the bedding was measured using a radial through-diffusion technique, while diffusion perpendicular to the bedding was measured using the classical (planar) through-diffusion method. The materials used were samples from Mont Terri (MT) and Benken (BE), respectively. Diffusion of Tritiated Water (HTO), parallel and perpendicular to the bedding, was studied under confining pressures of 7 MPa (MT) and 14 MPa (BE), respectively. The effective diffusion coefficient for diffusion parallel to the bedding, D e , was found to be 3.20(±0.26)x10 11 m 2 s -1 and for the Benken 5.39(±0.43)x10 -11 m 2 s-1 for the Mont Terri samples. The diffusion accessible porosity was ∼ 0.15(±0.02) in both cases. For diffusion perpendicular to the bedding, the effective diffusion coefficient was 5.44(±0.35)x10 -12 m 2 s-1 and 1.37(±0.08)x10 -11 m 2 s -1 for the Benken and Mont Terri samples, respectively. The diffusion accessible porosity was also ∼0.15(±0.02) in both cases. These first results indicate that diffusion parallel to bedding is larger than that perpendicular to the bedding by a factor of 4 to 6. This might be explained in terms of smaller path lengths (tortuosity) for species diffusing parallel to the fabric. (author)

  5. Anisotropic Diffusion In Layered Argillaceous Rocks: A Case Study With Opalinus Clay

    Energy Technology Data Exchange (ETDEWEB)

    Van Loon, L.R.; Soler, J.; Mueller, W.; Bradbury, M.H

    2003-03-01

    Anisotropic diffusion was studied in Opalinus Clay, a potential host rock for the disposal of spent fuel, vitrified high-level waste and intermediate-level waste. Diffusion parallel to the bedding was measured using a radial through-diffusion technique, while diffusion perpendicular to the bedding was measured using the classical (planar) through-diffusion method. The materials used were samples from Mont Terri (MT) and Benken (BE), respectively. Diffusion of Tritiated Water (HTO), parallel and perpendicular to the bedding, was studied under confining pressures of 7 MPa (MT) and 14 MPa (BE), respectively. The effective diffusion coefficient for diffusion parallel to the bedding, D{sub e}, was found to be 3.20({+-}0.26)x10{sup 11} m{sup 2}s{sup -1} and for the Benken 5.39({+-}0.43)x10{sup -11} m{sup 2}s-1 for the Mont Terri samples. The diffusion accessible porosity was {approx} 0.15({+-}0.02) in both cases. For diffusion perpendicular to the bedding, the effective diffusion coefficient was 5.44({+-}0.35)x10{sup -12} m{sup 2}s-1 and 1.37({+-}0.08)x10{sup -11} m{sup 2}s{sup -1} for the Benken and Mont Terri samples, respectively. The diffusion accessible porosity was also {approx}0.15({+-}0.02) in both cases. These first results indicate that diffusion parallel to bedding is larger than that perpendicular to the bedding by a factor of 4 to 6. This might be explained in terms of smaller path lengths (tortuosity) for species diffusing parallel to the fabric. (author)

  6. Diffusion Based Photon Mapping

    DEFF Research Database (Denmark)

    Schjøth, Lars; Fogh Olsen, Ole; Sporring, Jon

    2007-01-01

    . To address this problem we introduce a novel photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way we preserve the important illumination features......, while eliminating noise. We call our method diffusion based photon mapping....

  7. Diffusion Based Photon Mapping

    DEFF Research Database (Denmark)

    Schjøth, Lars; Olsen, Ole Fogh; Sporring, Jon

    2006-01-01

    . To address this problem we introduce a novel photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way we preserve the important illumination features......, while eliminating noise. We call our method diffusion based photon mapping....

  8. The generalized PN synthetic acceleration method for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.

    1998-01-01

    The diffusion synthetic acceleration (DSA) method has been known to be an effective tool for accelerating the iterative solution of transport equations with isotopic or mildly anisotropic scattering. However, the DSA method is not effective for transport equations that have strongly anisotropic scattering. A generalization of the modified DSA (MDSA) methods is proposed. This method converges (Clock time) faster than the MDSA method. It is developed, the results of a Fourier analysis that theoretically predicts its efficiency are described, and numerical results that verify the theoretical prediction are presented. (author). 9 refs., 2 tabs., 5 figs

  9. Solution of the linearly anisotropic neutron transport problem in a infinite cylinder combining the decomposition and HTSN methods

    International Nuclear Information System (INIS)

    Goncalves, Glenio A.; Bodmann, Bardo; Bogado, Sergio; Vilhena, Marco T.

    2008-01-01

    Analytical solutions for neutron transport in cylindrical geometry is available for isotropic problems, but to the best of our knowledge for anisotropic problems are not available, yet. In this work, an analytical solution for the neutron transport equation in an infinite cylinder assuming anisotropic scattering is reported. Here we specialize the solution, without loss of generality, for the linearly anisotropic problem using the combined decomposition and HTS N methods. The key feature of this method consists in the application of the decomposition method to the anisotropic problem by virtue of the fact that the inverse of the operator associated to isotropic problem is well know and determined by the HTS N approach. So far, following the idea of the decomposition method, we apply this operator to the integral term, assuming that the angular flux appearing in the integrand is considered to be equal to the HTS N solution interpolated by polynomial considering only even powers. This leads to the first approximation for an anisotropic solution. Proceeding further, we replace this solution for the angular flux in the integral and apply again the inverse operator for the isotropic problem in the integral term and obtain a new approximation for the angular flux. This iterative procedure yields a closed form solution for the angular flux. This methodology can be generalized, in a straightforward manner, for transport problems with any degree of anisotropy. For the sake of illustration, we report numerical simulations for linearly anisotropic transport problems. (author)

  10. Anisotropic harmonic oscillator, non-commutative Landau problem and exotic Newton-Hooke symmetry

    International Nuclear Information System (INIS)

    Alvarez, Pedro D.; Gomis, Joaquim; Kamimura, Kiyoshi; Plyushchay, Mikhail S.

    2008-01-01

    We investigate the planar anisotropic harmonic oscillator with explicit rotational symmetry as a particle model with non-commutative coordinates. It includes the exotic Newton-Hooke particle and the non-commutative Landau problem as special, isotropic and maximally anisotropic, cases. The system is described by the same (2+1)-dimensional exotic Newton-Hooke symmetry as in the isotropic case, and develops three different phases depending on the values of the two central charges. The special cases of the exotic Newton-Hooke particle and non-commutative Landau problem are shown to be characterized by additional, so(3) or so(2,1) Lie symmetry, which reflects their peculiar spectral properties

  11. Realization of Anisotropic Diamagnetic Kepler Problem in a Solid State Environment

    International Nuclear Information System (INIS)

    Chen Zhanghai; Zhou Weihang; Zhang Bo; Yu, C. H.; Zhu Jingbing; Lu Wei; Shen, S. C.

    2009-01-01

    The anisotropic diamagnetic Kepler problem (ADKP) is realized experimentally by the orbital electrons of a P donor in Si under magnetic fields. The interference of electron wave packets which leads to quasi-Landau resonances (QLR) were observed. Applying the closed-orbit theory to an anisotropic solid state environment, we have identified orbits responsible for the QLR manifesting the quantum chaotic behavior in Rydberg atoms. The excellent consistency between the measured spectra and theoretical calculation provides unambiguous evidence of quantum chaotic dynamics of electrons in the ADKP.

  12. Anisotropic Rotational Diffusion Studied by Nuclear Spin Relaxation and Molecular Dynamics Simulation: An Undergraduate Physical Chemistry Laboratory

    Science.gov (United States)

    Fuson, Michael M.

    2017-01-01

    Laboratories studying the anisotropic rotational diffusion of bromobenzene using nuclear spin relaxation and molecular dynamics simulations are described. For many undergraduates, visualizing molecular motion is challenging. Undergraduates rarely encounter laboratories that directly assess molecular motion, and so the concept remains an…

  13. Drag and diffusion of heavy quarks in a hot and anisotropic QCD medium

    International Nuclear Information System (INIS)

    Srivastava, P.K.; Patra, Binoy Krishna

    2017-01-01

    The propagation of heavy quarks (HQs) in a medium was quite often modeled by the Fokker-Planck (FP) equation. Since the transport coefficients, related to drag and diffusion processes, are the main ingredients in the FP equation, the evolution of HQs is thus effectively controlled by them. At the initial stage of the relativistic heavy-ion collisions, asymptotic weak-coupling causes the free-streaming motions of partons in the beam direction and the expansions in transverse directions are almost frozen, hence an anisotropy in the momentum space sets in. Since HQs are too produced in the same time, the study of the effect of momentum anisotropy on the drag and diffusion coefficients becomes highly desirable. In this article we have thus studied the drag and diffusion of HQs in the anisotropic medium and found that the presence of the anisotropy reduces both drag and diffusion coefficients. In addition, the anisotropy introduces an angular dependence to both the drag and diffusion coefficients, as a result both coefficients get more inflated when the partons are moving transversely to the direction of anisotropy than when moving parallel to the direction of anisotropy. (orig.)

  14. Drag and diffusion of heavy quarks in a hot and anisotropic QCD medium

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, P.K.; Patra, Binoy Krishna [Indian Institute of Technology Roorkee, Department of Physics, Roorkee (India)

    2017-06-15

    The propagation of heavy quarks (HQs) in a medium was quite often modeled by the Fokker-Planck (FP) equation. Since the transport coefficients, related to drag and diffusion processes, are the main ingredients in the FP equation, the evolution of HQs is thus effectively controlled by them. At the initial stage of the relativistic heavy-ion collisions, asymptotic weak-coupling causes the free-streaming motions of partons in the beam direction and the expansions in transverse directions are almost frozen, hence an anisotropy in the momentum space sets in. Since HQs are too produced in the same time, the study of the effect of momentum anisotropy on the drag and diffusion coefficients becomes highly desirable. In this article we have thus studied the drag and diffusion of HQs in the anisotropic medium and found that the presence of the anisotropy reduces both drag and diffusion coefficients. In addition, the anisotropy introduces an angular dependence to both the drag and diffusion coefficients, as a result both coefficients get more inflated when the partons are moving transversely to the direction of anisotropy than when moving parallel to the direction of anisotropy. (orig.)

  15. The problem solution on wedge penetration in an initially anisotropic medium within the rigid-plastic scheme

    Science.gov (United States)

    Chanyshev, AI; Abdulin, IM

    2018-03-01

    Two problems are solved in the paper: on ultimate loads in the initial stage of indentation of an absolutely rigid smooth wedge into a layer of an initially anisotropic plastic medium and in the final stage when the tool penetrates through the layer. The problems are solved with Chanyshev’s constitutive relations of plasticity of the initially anisotropic medium based on use of the eigen elasticity tensors.

  16. Multimodel analysis of anisotropic diffusive tracer-gas transport in a deep arid unsaturated zone

    Science.gov (United States)

    Green, Christopher T.; Walvoord, Michelle Ann; Andraski, Brian J.; Striegl, Robert G.; Stonestrom, David A.

    2015-01-01

    Gas transport in the unsaturated zone affects contaminant flux and remediation, interpretation of groundwater travel times from atmospheric tracers, and mass budgets of environmentally important gases. Although unsaturated zone transport of gases is commonly treated as dominated by diffusion, the characteristics of transport in deep layered sediments remain uncertain. In this study, we use a multimodel approach to analyze results of a gas-tracer (SF6) test to clarify characteristics of gas transport in deep unsaturated alluvium. Thirty-five separate models with distinct diffusivity structures were calibrated to the tracer-test data and were compared on the basis of Akaike Information Criteria estimates of posterior model probability. Models included analytical and numerical solutions. Analytical models provided estimates of bulk-scale apparent diffusivities at the scale of tens of meters. Numerical models provided information on local-scale diffusivities and feasible lithological features producing the observed tracer breakthrough curves. The combined approaches indicate significant anisotropy of bulk-scale diffusivity, likely associated with high-diffusivity layers. Both approaches indicated that diffusivities in some intervals were greater than expected from standard models relating porosity to diffusivity. High apparent diffusivities and anisotropic diffusivity structures were consistent with previous observations at the study site of rapid lateral transport and limited vertical spreading of gas-phase contaminants. Additional processes such as advective oscillations may be involved. These results indicate that gases in deep, layered unsaturated zone sediments can spread laterally more quickly, and produce higher peak concentrations, than predicted by homogeneous, isotropic diffusion models.

  17. Experimental evaluation of electrical conductivity imaging of anisotropic brain tissues using a combination of diffusion tensor imaging and magnetic resonance electrical impedance tomography

    Energy Technology Data Exchange (ETDEWEB)

    Sajib, Saurav Z. K.; Jeong, Woo Chul; Oh, Tong In; Kim, Hyung Joong, E-mail: bmekim@khu.ac.kr, E-mail: ejwoo@khu.ac.kr; Woo, Eung Je, E-mail: bmekim@khu.ac.kr, E-mail: ejwoo@khu.ac.kr [Department of Biomedical Engineering, Kyung Hee University, Seoul 02447 (Korea, Republic of); Kyung, Eun Jung [Department of Pharmacology, Chung-Ang University, Seoul 06974 (Korea, Republic of); Kim, Hyun Bum [Department of East-West Medical Science, Kyung Hee University, Yongin 17104 (Korea, Republic of); Kwon, Oh In [Department of Mathematics, Konkuk University, Seoul 05029 (Korea, Republic of)

    2016-06-15

    Anisotropy of biological tissues is a low-frequency phenomenon that is associated with the function and structure of cell membranes. Imaging of anisotropic conductivity has potential for the analysis of interactions between electromagnetic fields and biological systems, such as the prediction of current pathways in electrical stimulation therapy. To improve application to the clinical environment, precise approaches are required to understand the exact responses inside the human body subjected to the stimulated currents. In this study, we experimentally evaluate the anisotropic conductivity tensor distribution of canine brain tissues, using a recently developed diffusion tensor-magnetic resonance electrical impedance tomography method. At low frequency, electrical conductivity of the biological tissues can be expressed as a product of the mobility and concentration of ions in the extracellular space. From diffusion tensor images of the brain, we can obtain directional information on diffusive movements of water molecules, which correspond to the mobility of ions. The position dependent scale factor, which provides information on ion concentration, was successfully calculated from the magnetic flux density, to obtain the equivalent conductivity tensor. By combining the information from both techniques, we can finally reconstruct the anisotropic conductivity tensor images of brain tissues. The reconstructed conductivity images better demonstrate the enhanced signal intensity in strongly anisotropic brain regions, compared with those resulting from previous methods using a global scale factor.

  18. Anisotropic diffusion of meteor trails due to the geomagnetic field over King Sejong Station (62.2°S, 58.8°W), Antarctica

    Science.gov (United States)

    Choi, Jong-Min; Kwak, Young-Sil; Kim, Yong Ha; Lee, Changsup; Kim, Jeong-Han; Jee, Geonhwa; Yang, Tae-Yong

    2018-06-01

    We analyzed meteor decay times measured by a VHF meteor radar at King Sejong Station, Antarctica (62.22°S, 58.78°W) to study diffusion processes of the meteor trails above the altitude of ˜93 km. Above this altitude, where the atmospheric density is so dilute that collisions between trail ions and ambient molecules become rare, diffusion of a meteor trail can be greatly affected by the geomagnetic field, resulting in anisotropic distribution of measured decay times over the azimuthal and elevation angles. Our preliminary analysis confirm the anisotropic nature of meteor decay times due to geomagnetic field.

  19. Diffusion Based Photon Mapping

    DEFF Research Database (Denmark)

    Schjøth, Lars; Sporring, Jon; Fogh Olsen, Ole

    2008-01-01

    . To address this problem, we introduce a photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way, we preserve important illumination features, while...

  20. Determination of 13C CSA Tensors: Extension of the Model-independent Approach to an RNA Kissing Complex Undergoing Anisotropic Rotational Diffusion in Solution

    International Nuclear Information System (INIS)

    Ravindranathan, Sapna; Kim, Chul-Hyun; Bodenhausen, Geoffrey

    2005-01-01

    Chemical shift anisotropy (CSA) tensor parameters have been determined for the protonated carbons of the purine bases in an RNA kissing complex in solution by extending the model-independent approach [Fushman, D., Cowburn, D. (1998) J. Am. Chem. Soc. 120, 7109-7110]. A strategy for determining CSA tensor parameters of heteronuclei in isolated X-H two-spin systems (X = 13 C or 15 N) in molecules undergoing anisotropic rotational diffusion is presented. The original method relies on the fact that the ratio κ 2 =R 2 auto /R 2 cross of the transverse auto- and cross-correlated relaxation rates involving the X CSA and the X-H dipolar interaction is independent of parameters related to molecular motion, provided rotational diffusion is isotropic. However, if the overall motion is anisotropic κ 2 depends on the anisotropy D parallel /D -perpendicular of rotational diffusion. In this paper, the field dependence of both κ 2 and its longitudinal counterpart κ 1 =R 1 auto /R 1 cross are determined. For anisotropic rotational diffusion, our calculations show that the average κ av = 1/2 (κ 1 +κ 2 ), of the ratios is largely independent of the anisotropy parameter D parallel /D -perpendicular . The field dependence of the average ratio κ av may thus be utilized to determine CSA tensor parameters by a generalized model-independent approach in the case of molecules with an overall motion described by an axially symmetric rotational diffusion tensor

  1. Convex variational problems linear, nearly linear and anisotropic growth conditions

    CERN Document Server

    Bildhauer, Michael

    2003-01-01

    The author emphasizes a non-uniform ellipticity condition as the main approach to regularity theory for solutions of convex variational problems with different types of non-standard growth conditions. This volume first focuses on elliptic variational problems with linear growth conditions. Here the notion of a "solution" is not obvious and the point of view has to be changed several times in order to get some deeper insight. Then the smoothness properties of solutions to convex anisotropic variational problems with superlinear growth are studied. In spite of the fundamental differences, a non-uniform ellipticity condition serves as the main tool towards a unified view of the regularity theory for both kinds of problems.

  2. Effects of MR parameter changes on the quantification of diffusion anisotropy and apparent diffusion coefficient in diffusion tensor imaging: Evaluation using a diffusional anisotropic phantom

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Joon; Choi, Choong Gon; Kim, Jeong Kon [Dept. of Radiology, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Yun, Sung Cheol [Dept. of Biostatistics, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Jeong, Ha Kyu [Dept. of Radiology, East-West Neomedical Center, Kyung Hee University College of Medicine, Seoul (Korea, Republic of); Kim, Eun Ju [Clinical Scientist, MR, Philips Healthcare, Seoul (Korea, Republic of)

    2015-04-15

    To validate the usefulness of a diffusional anisotropic capillary array phantom and to investigate the effects of diffusion tensor imaging (DTI) parameter changes on diffusion fractional anisotropy (FA) and apparent diffusion coefficient (ADC) using the phantom. Diffusion tensor imaging of a capillary array phantom was performed with imaging parameter changes, including voxel size, number of sensitivity encoding (SENSE) factor, echo time (TE), number of signal acquisitions, b-value, and number of diffusion gradient directions (NDGD), one-at-a-time in a stepwise-incremental fashion. We repeated the entire series of DTI scans thrice. The coefficients of variation (CoV) were evaluated for FA and ADC, and the correlation between each MR imaging parameter and the corresponding FA and ADC was evaluated using Spearman's correlation analysis. The capillary array phantom CoVs of FA and ADC were 7.1% and 2.4%, respectively. There were significant correlations between FA and SENSE factor, TE, b-value, and NDGD, as well as significant correlations between ADC and SENSE factor, TE, and b-value. A capillary array phantom enables repeated measurements of FA and ADC. Both FA and ADC can vary when certain parameters are changed during diffusion experiments. We suggest that the capillary array phantom can be used for quality control in longitudinal or multicenter clinical studies.

  3. Deuterium diffusion along the three principal directions in anisotropic Zr–2.5Nb

    Energy Technology Data Exchange (ETDEWEB)

    Khatamian, D., E-mail: khatamiand@aecl.ca

    2013-12-15

    Highlights: •Diffusivity of deuterium in a Zr–2.5Nb plate was measured. •The plate had similar microstructure to that of a CANDU pressure tube. •Diffusion coefficients in the radial direction were 24% less than in the longitudinal direction. •These findings are in close agreement with the theoretical estimates made in the literature. -- Abstract: Pressure tubes of cold-worked Zr–2.5Nb material are used in the CANDU (CANada Deuterium Uranium is a registered trademark of Atomic Energy of Canada Ltd.) reactors to contain the fuel bundles and the heavy water coolant. The pressure tube microstructure consists of α-Zr platelets, with an aspect ratio of 1:5:50 in the radial, transverse and longitudinal directions, surrounded by a thin layer of β-Zr. The diffusivity of hydrogen in β-Zr is higher than in α-Zr. As a result, the diffusivity of hydrogen in the pressure tube material is enhanced compared to unalloyed α-Zr. Due to the anisotropic microstructure of the pressure tube with respect to the β-Zr network, the diffusivity of hydrogen is thought to be different in the three principal pressure tube directions. Measurements made using specimens machined from an 8 mm thick Zr–2.5Nb plate, with a microstructure similar to that of a CANDU pressure tube, suggest the difference between the diffusion constants for deuterium in different directions of an as-installed pressure tube may be as high as 25%.

  4. Magnetic resonance temporal diffusion tensor spectroscopy of disordered anisotropic tissue

    DEFF Research Database (Denmark)

    Nielsen, Jonathan Scharff; Dyrby, Tim B; Lundell, Henrik

    2018-01-01

    Molecular diffusion measured with diffusion weighted MRI (DWI) offers a probe for tissue microstructure. However, inferring microstructural properties from conventional DWI data is a complex inverse problem and has to account for heterogeneity in sizes, shapes and orientations of the tissue...

  5. Dynamics of interface in three-dimensional anisotropic bistable reaction-diffusion system

    International Nuclear Information System (INIS)

    He Zhizhu; Liu, Jing

    2010-01-01

    This paper presents a theoretical investigation of dynamics of interface (wave front) in three-dimensional (3D) reaction-diffusion (RD) system for bistable media with anisotropy constructed by means of anisotropic surface tension. An equation of motion for the wave front is derived to carry out stability analysis of transverse perturbations, which discloses mechanism of pattern formation such as labyrinthine in 3D bistable media. Particularly, the effects of anisotropy on wave propagation are studied. It was found that, sufficiently strong anisotropy can induce dynamical instabilities and lead to breakup of the wave front. With the fast-inhibitor limit, the bistable system can further be described by a variational dynamics so that the boundary integral method is adopted to study the dynamics of wave fronts.

  6. Identification of the Diffusion Parameter in Nonlocal Steady Diffusion Problems

    Energy Technology Data Exchange (ETDEWEB)

    D’Elia, M., E-mail: mdelia@fsu.edu, E-mail: mdelia@sandia.gov [Sandia National Laboratories (United States); Gunzburger, M. [Florida State University (United States)

    2016-04-15

    The problem of identifying the diffusion parameter appearing in a nonlocal steady diffusion equation is considered. The identification problem is formulated as an optimal control problem having a matching functional as the objective of the control and the parameter function as the control variable. The analysis makes use of a nonlocal vector calculus that allows one to define a variational formulation of the nonlocal problem. In a manner analogous to the local partial differential equations counterpart, we demonstrate, for certain kernel functions, the existence of at least one optimal solution in the space of admissible parameters. We introduce a Galerkin finite element discretization of the optimal control problem and derive a priori error estimates for the approximate state and control variables. Using one-dimensional numerical experiments, we illustrate the theoretical results and show that by using nonlocal models it is possible to estimate non-smooth and discontinuous diffusion parameters.

  7. An optimization-based framework for anisotropic simplex mesh adaptation

    Science.gov (United States)

    Yano, Masayuki; Darmofal, David L.

    2012-09-01

    We present a general framework for anisotropic h-adaptation of simplex meshes. Given a discretization and any element-wise, localizable error estimate, our adaptive method iterates toward a mesh that minimizes error for a given degrees of freedom. Utilizing mesh-metric duality, we consider a continuous optimization problem of the Riemannian metric tensor field that provides an anisotropic description of element sizes. First, our method performs a series of local solves to survey the behavior of the local error function. This information is then synthesized using an affine-invariant tensor manipulation framework to reconstruct an approximate gradient of the error function with respect to the metric tensor field. Finally, we perform gradient descent in the metric space to drive the mesh toward optimality. The method is first demonstrated to produce optimal anisotropic meshes minimizing the L2 projection error for a pair of canonical problems containing a singularity and a singular perturbation. The effectiveness of the framework is then demonstrated in the context of output-based adaptation for the advection-diffusion equation using a high-order discontinuous Galerkin discretization and the dual-weighted residual (DWR) error estimate. The method presented provides a unified framework for optimizing both the element size and anisotropy distribution using an a posteriori error estimate and enables efficient adaptation of anisotropic simplex meshes for high-order discretizations.

  8. Simultaneous characterization of rotational and translational diffusion of optically anisotropic particles by optical microscopy

    International Nuclear Information System (INIS)

    Giavazzi, Fabio; Cerbino, Roberto; Haro-Pérez, Catalina

    2016-01-01

    We probe the roto-translational Brownian motion of optically anisotropic particles suspended in water with a simple and straightforward optical microscopy experiment that does not require positional or rotational particle tracking. We acquire a movie of the suspension placed between two polarizing elements and we extract the translational diffusion coefficient D T and the rotational diffusion coefficient D R from the analysis of the temporal correlation properties of the spatial Fourier modes of the intensity fluctuations in the movie. Our method is successfully tested with a dilute suspension of birefringent spherical colloidal particles obtained by polymerizing an emulsion of droplets of liquid crystal in a nematic phase, whose roto-translational dynamics is found to be well described by theory. The simplicity of our approach makes our method a viable alternative to particle tracking and depolarized dynamic light scattering. (paper)

  9. Radiative Transfer Equation for Anisotropic Spherical Medium with Specular Reflective Index

    International Nuclear Information System (INIS)

    Elghazaly, A.

    2009-01-01

    Radiative transfer problem for anisotropic scattering in a spherical homogeneous, turbid medium with diffuse and angular dependent (specular) reflecting boundaries is solved using the Pomraning-Eddington approximation method. The angular dependent specular reflectivity of the boundary is considered as Fresnel's reflection probability function. The partial heat flux is calculated with anisotropic scattering through a homogeneous solid sphere. The calculations are carried out for spherical media of radii 0.1, 1.0, and 10 mfp and for different scattering albedo. Two different weight functions are used to verify the boundary conditions. Our results are compared with the available data and give an excellent agreement for thick and highly scattering media

  10. Anisotropic elastic plates

    CERN Document Server

    Hwu, Chyanbin

    2010-01-01

    As structural elements, anisotropic elastic plates find wide applications in modern technology. The plates here are considered to be subjected to not only in plane load but also transverse load. In other words, both plane and plate bending problems as well as the stretching-bending coupling problems are all explained in this book. In addition to the introduction of the theory of anisotropic elasticity, several important subjects have are discussed in this book such as interfaces, cracks, holes, inclusions, contact problems, piezoelectric materials, thermoelastic problems and boundary element a

  11. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  12. Effects of anisotropic turbulent thermal diffusion on spherical magnetoconvection in the Earth's core

    Science.gov (United States)

    Ivers, D. J.; Phillips, C. G.

    2018-03-01

    We re-consider the plate-like model of turbulence in the Earth's core, proposed by Braginsky and Meytlis (1990), and show that it is plausible for core parameters not only in polar regions but extends to mid- and low-latitudes where rotation and gravity are not parallel, except in a very thin equatorial layer. In this model the turbulence is highly anisotropic with preferred directions imposed by the Earth's rotation and the magnetic field. Current geodynamo computations effectively model sub-grid scale turbulence by using isotropic viscous and thermal diffusion values significantly greater than the molecular values of the Earth's core. We consider a local turbulent dynamo model for the Earth's core in which the mean magnetic field, velocity and temperature satisfy the Boussinesq induction, momentum and heat equations with an isotropic turbulent Ekman number and Roberts number. The anisotropy is modelled only in the thermal diffusion tensor with the Earth's rotation and magnetic field as preferred directions. Nonlocal organising effects of gravity and rotation (but not aspect ratio in the Earth's core) such as an inverse cascade and nonlocal transport are assumed to occur at longer length scales, which computations may accurately capture with sufficient resolution. To investigate the implications of this anisotropy for the proposed turbulent dynamo model we investigate the linear instability of turbulent magnetoconvection on length scales longer than the background turbulence in a rotating sphere with electrically insulating exterior for no-slip and isothermal boundary conditions. The equations are linearised about an axisymmetric basic state with a conductive temperature, azimuthal magnetic field and differential rotation. The basic state temperature is a function of the anisotropy and the spherical radius. Elsasser numbers in the range 1-20 and turbulent Roberts numbers 0.01-1 are considered for both equatorial symmetries of the magnetic basic state. It is found

  13. Thermal diffusivity and butterfly velocity in anisotropic Q-lattice models

    Science.gov (United States)

    Jeong, Hyun-Sik; Ahn, Yongjun; Ahn, Dujin; Niu, Chao; Li, Wei-Jia; Kim, Keun-Young

    2018-01-01

    We study a relation between the thermal diffusivity ( D T ) and two quantum chaotic properties, Lyapunov time (τ L ) and butterfly velocity ( v B ) in strongly correlated systems by using a holographic method. Recently, it was shown that E_i:={D}_{T,i}/({v}{^{B,i}}^2{τ}_L)(i=x,y) is universal in the sense that it is determined only by some scaling exponents of the IR metric in the low temperature limit regardless of the matter fields and ultraviolet data. Inspired by this observation, by analyzing the anisotropic IR scaling geometry carefully, we find the concrete expressions for E_i in terms of the critical dynamical exponents z i in each direction, E_i={z}_i/2({z}_i-1) . Furthermore, we find the lower bound of E_i is always 1 /2, which is not affected by anisotropy, contrary to the η/s case. However, there may be an upper bound determined by given fixed anisotropy.

  14. An integrated simulator of structure and anisotropic flow in gas diffusion layers with hydrophobic additives

    Science.gov (United States)

    Burganos, Vasilis N.; Skouras, Eugene D.; Kalarakis, Alexandros N.

    2017-10-01

    The lattice-Boltzmann (LB) method is used in this work to reproduce the controlled addition of binder and hydrophobicity-promoting agents, like polytetrafluoroethylene (PTFE), into gas diffusion layers (GDLs) and to predict flow permeabilities in the through- and in-plane directions. The present simulator manages to reproduce spreading of binder and hydrophobic additives, sequentially, into the neat fibrous layer using a two-phase flow model. Gas flow simulation is achieved by the same code, sidestepping the need for a post-processing flow code and avoiding the usual input/output and data interface problems that arise in other techniques. Compression effects on flow anisotropy of the impregnated GDL are also studied. The permeability predictions for different compression levels and for different binder or PTFE loadings are found to compare well with experimental data for commercial GDL products and with computational fluid dynamics (CFD) predictions. Alternatively, the PTFE-impregnated structure is reproduced from Scanning Electron Microscopy (SEM) images using an independent, purely geometrical approach. A comparison of the two approaches is made regarding their adequacy to reproduce correctly the main structural features of the GDL and to predict anisotropic flow permeabilities at different volume fractions of binder and hydrophobic additives.

  15. A locally conservative non-negative finite element formulation for anisotropic advective-diffusive-reactive systems

    Science.gov (United States)

    Mudunuru, M. K.; Shabouei, M.; Nakshatrala, K.

    2015-12-01

    Advection-diffusion-reaction (ADR) equations appear in various areas of life sciences, hydrogeological systems, and contaminant transport. Obtaining stable and accurate numerical solutions can be challenging as the underlying equations are coupled, nonlinear, and non-self-adjoint. Currently, there is neither a robust computational framework available nor a reliable commercial package known that can handle various complex situations. Herein, the objective of this poster presentation is to present a novel locally conservative non-negative finite element formulation that preserves the underlying physical and mathematical properties of a general linear transient anisotropic ADR equation. In continuous setting, governing equations for ADR systems possess various important properties. In general, all these properties are not inherited during finite difference, finite volume, and finite element discretizations. The objective of this poster presentation is two fold: First, we analyze whether the existing numerical formulations (such as SUPG and GLS) and commercial packages provide physically meaningful values for the concentration of the chemical species for various realistic benchmark problems. Furthermore, we also quantify the errors incurred in satisfying the local and global species balance for two popular chemical kinetics schemes: CDIMA (chlorine dioxide-iodine-malonic acid) and BZ (Belousov--Zhabotinsky). Based on these numerical simulations, we show that SUPG and GLS produce unphysical values for concentration of chemical species due to the violation of the non-negative constraint, contain spurious node-to-node oscillations, and have large errors in local and global species balance. Second, we proposed a novel finite element formulation to overcome the above difficulties. The proposed locally conservative non-negative computational framework based on low-order least-squares finite elements is able to preserve these underlying physical and mathematical properties

  16. Measurement of Three-Dimensional Anisotropic Thermal Diffusivities for Carbon Fiber-Reinforced Plastics Using Lock-In Thermography

    Science.gov (United States)

    Ishizaki, Takuya; Nagano, Hosei

    2015-11-01

    A new measurement technique to measure the in-plane thermal diffusivity, the distribution of in-plane anisotropy, and the out-of-plane thermal diffusivity has been developed to evaluate the thermal conductivity of anisotropic materials such as carbon fiber-reinforced plastics (CFRPs). The measurements were conducted by using a laser-spot-periodic-heating method. The temperature of the sample is detected by using lock-in thermography. Thermography can analyze the phase difference between the periodic heat input and the temperature response of the sample. Two kinds of samples, unidirectional (UD) and cross-ply (CP) pitch-based CFRPs, were fabricated and tested in an atmospheric condition. All carbon fibers of the UD sample run in one direction [90°]. The carbon fibers of the CP sample run in two directions [0°/90°]. It is found that, by using lock-in thermography, it is able to visualize the thermal anisotropy and calculate the angular dependence of the in-plane thermal diffusivity of the CFRPs. The out-of-plane thermal diffusivity of CFRPs was also measured by analyzing the frequency dependence of the phase difference.

  17. Scalable explicit implementation of anisotropic diffusion with Runge-Kutta-Legendre super-time stepping

    Science.gov (United States)

    Vaidya, Bhargav; Prasad, Deovrat; Mignone, Andrea; Sharma, Prateek; Rickler, Luca

    2017-12-01

    An important ingredient in numerical modelling of high temperature magnetized astrophysical plasmas is the anisotropic transport of heat along magnetic field lines from higher to lower temperatures. Magnetohydrodynamics typically involves solving the hyperbolic set of conservation equations along with the induction equation. Incorporating anisotropic thermal conduction requires to also treat parabolic terms arising from the diffusion operator. An explicit treatment of parabolic terms will considerably reduce the simulation time step due to its dependence on the square of the grid resolution (Δx) for stability. Although an implicit scheme relaxes the constraint on stability, it is difficult to distribute efficiently on a parallel architecture. Treating parabolic terms with accelerated super-time-stepping (STS) methods has been discussed in literature, but these methods suffer from poor accuracy (first order in time) and also have difficult-to-choose tuneable stability parameters. In this work, we highlight a second-order (in time) Runge-Kutta-Legendre (RKL) scheme (first described by Meyer, Balsara & Aslam 2012) that is robust, fast and accurate in treating parabolic terms alongside the hyperbolic conversation laws. We demonstrate its superiority over the first-order STS schemes with standard tests and astrophysical applications. We also show that explicit conduction is particularly robust in handling saturated thermal conduction. Parallel scaling of explicit conduction using RKL scheme is demonstrated up to more than 104 processors.

  18. Modelling anisotropic water transport in polymer composite

    Indian Academy of Sciences (India)

    This work reports anisotropic water transport in a polymer composite consisting of an epoxy matrix reinforced with aligned triangular bars made of vinyl ester. By gravimetric experiments, water diffusion in resin and polymer composites were characterized. Parameters for Fickian diffusion and polymer relaxation models were ...

  19. ONETRAN, 1-D Transport in Planar, Cylindrical, Spherical Geometry for Homogeneous, Inhomogeneous Problem, Anisotropic Source

    International Nuclear Information System (INIS)

    1982-01-01

    1 - Description of problem or function: ONETRAN solves the one- dimensional multigroup transport equation in plane, cylindrical, spherical, and two-angle plane geometries. Both regular and adjoint, inhomogeneous and homogeneous (K-eff and eigenvalue searches) problems subject to vacuum, reflective, periodic, white, albedo or inhomogeneous boundary flux conditions are solved. General anisotropic scattering is allowed and anisotropic inhomogeneous sources are permitted. 2 - Method of solution: The discrete ordinates approximation for the angular variable is used with the diamond (central) difference approximation for the angular extrapolation in curved geometries. A linear discontinuous finite element representation for the angular flux in each spatial mesh cell is used. Negative fluxes are eliminated by a local set-to-zero and correct algorithm. Standard inner (within-group) iteration cycles are accelerated by system re-balance, coarse mesh re-balance, or Chebyshev acceleration. Outer iteration cycles are accelerated by coarse-mesh re-balance. 3 - Restrictions on the complexity of the problem: Variable dimensioning is used so that any combination of problem parameters leading to a container array less than MAXCOR can be accommodated. On CDC machines MAXCOR can be about 25 000 words and peripheral storage is used for most group-dependent data

  20. Antiproton cross-field diffusion in antihydrogen production experiments due to anisotropic binary interactions

    International Nuclear Information System (INIS)

    Ordonez, C.A.; Correa, J.R.

    2007-01-01

    Collisional processes in electrostatic ion storage rings and reflecting-beam-type electrostatic ion traps can be associated with anisotropic binary interactions, because shielding of the Coulomb interactions may not take place in one or more dimensions. Collisional scattering theory has recently been developed for describing the velocity-space scattering processes in such systems [J.R. Correa, Y. Chang, C.A. Ordonez, Phys. Plasmas 12 (2005) 084505]. The theory is extended to enable the effect of a magnetic field to be included. The theory is intended to be applicable, for example, to antiproton scattering within nested Penning traps that are used to produce antihydrogen [M. Amoretti et al., Nature 419 (2002) 456; G. Gabrielse et al., Phys. Rev. Lett. 89 (2002) 213401]. The theory is applied for considering the cross-magnetic-field diffusion of the antiprotons

  1. A tutorial on inverse problems for anomalous diffusion processes

    International Nuclear Information System (INIS)

    Jin, Bangti; Rundell, William

    2015-01-01

    Over the last two decades, anomalous diffusion processes in which the mean squares variance grows slower or faster than that in a Gaussian process have found many applications. At a macroscopic level, these processes are adequately described by fractional differential equations, which involves fractional derivatives in time or/and space. The fractional derivatives describe either history mechanism or long range interactions of particle motions at a microscopic level. The new physics can change dramatically the behavior of the forward problems. For example, the solution operator of the time fractional diffusion diffusion equation has only limited smoothing property, whereas the solution for the space fractional diffusion equation may contain weak singularity. Naturally one expects that the new physics will impact related inverse problems in terms of uniqueness, stability, and degree of ill-posedness. The last aspect is especially important from a practical point of view, i.e., stably reconstructing the quantities of interest. In this paper, we employ a formal analytic and numerical way, especially the two-parameter Mittag-Leffler function and singular value decomposition, to examine the degree of ill-posedness of several ‘classical’ inverse problems for fractional differential equations involving a Djrbashian–Caputo fractional derivative in either time or space, which represent the fractional analogues of that for classical integral order differential equations. We discuss four inverse problems, i.e., backward fractional diffusion, sideways problem, inverse source problem and inverse potential problem for time fractional diffusion, and inverse Sturm–Liouville problem, Cauchy problem, backward fractional diffusion and sideways problem for space fractional diffusion. It is found that contrary to the wide belief, the influence of anomalous diffusion on the degree of ill-posedness is not definitive: it can either significantly improve or worsen the conditioning

  2. Solving global problem by considering multitude of local problems: Application to fluid flow in anisotropic porous media using the multipoint flux approximation

    KAUST Repository

    Salama, Amgad; Sun, Shuyu; Wheeler, Mary Fanett

    2014-01-01

    In this work we apply the experimenting pressure field approach to the numerical solution of the single phase flow problem in anisotropic porous media using the multipoint flux approximation. We apply this method to the problem of flow in saturated anisotropic porous media. In anisotropic media the component flux representation requires, generally multiple pressure values in neighboring cells (e.g., six pressure values of the neighboring cells is required in two-dimensional rectangular meshes). This apparently results in the need for a nine points stencil for the discretized pressure equation (27 points stencil in three-dimensional rectangular mesh). The coefficients associated with the discretized pressure equation are complex and require longer expressions which make their implementation prone to errors. In the experimenting pressure field technique, the matrix of coefficients is generated automatically within the solver. A set of predefined pressure fields is operated on the domain through which the velocity field is obtained. Apparently such velocity fields do not satisfy the mass conservation equations entailed by the source/sink term and boundary conditions from which the residual is calculated. In this method the experimenting pressure fields are designed such that the residual reduces to the coefficients of the pressure equation matrix. © 2014 Elsevier B.V. All rights reserved.

  3. Solving global problem by considering multitude of local problems: Application to fluid flow in anisotropic porous media using the multipoint flux approximation

    KAUST Repository

    Salama, Amgad

    2014-09-01

    In this work we apply the experimenting pressure field approach to the numerical solution of the single phase flow problem in anisotropic porous media using the multipoint flux approximation. We apply this method to the problem of flow in saturated anisotropic porous media. In anisotropic media the component flux representation requires, generally multiple pressure values in neighboring cells (e.g., six pressure values of the neighboring cells is required in two-dimensional rectangular meshes). This apparently results in the need for a nine points stencil for the discretized pressure equation (27 points stencil in three-dimensional rectangular mesh). The coefficients associated with the discretized pressure equation are complex and require longer expressions which make their implementation prone to errors. In the experimenting pressure field technique, the matrix of coefficients is generated automatically within the solver. A set of predefined pressure fields is operated on the domain through which the velocity field is obtained. Apparently such velocity fields do not satisfy the mass conservation equations entailed by the source/sink term and boundary conditions from which the residual is calculated. In this method the experimenting pressure fields are designed such that the residual reduces to the coefficients of the pressure equation matrix. © 2014 Elsevier B.V. All rights reserved.

  4. Uniqueness in the inverse boundary value problem for piecewise homogeneous anisotropic elasticity

    OpenAIRE

    Cârstea, Cătălin I.; Honda, Naofumi; Nakamura, Gen

    2016-01-01

    Consider a three dimensional piecewise homogeneous anisotropic elastic medium $\\Omega$ which is a bounded domain consisting of a finite number of bounded subdomains $D_\\alpha$, with each $D_\\alpha$ a homogeneous elastic medium. One typical example is a finite element model with elements with curvilinear interfaces for an ansiotropic elastic medium. Assuming the $D_\\alpha$ are known and Lipschitz, we are concerned with the uniqueness in the inverse boundary value problem of identifying the ani...

  5. A Numerical Model of Anisotropic Mass Transport Through Grain Boundary Networks

    Science.gov (United States)

    Wang, Yibo

    Tin (Sn) thin films are commonly used in electronic circuit applications as coatings on contacts and solders for joining components. It is widely observed, for some such system, that whiskers---long, thin crystalline structures---emerge and grow from the film. The Sn whisker phenomenon has become a highly active research area since Sn whiskers have caused a large amount of damage and loss in manufacturing, military, medical and power industries. Though lead (Pb) addition to Sn has been used to solve this problem for over five decades, the adverse environmental and health effects of Pb have motivated legislation to severely constrain Pb use in society. People are researching and seeking the reasons which cause whiskers and corresponding methods to solve the problem. The contributing factors to cause a Sn whisker are potentially many and much still remains unknown. Better understanding of fundamental driving forces should point toward strategies to improve (a) the accuracy with which we can predict whisker formation, and (b) our ability to mitigate the phenomenon. This thesis summarizes recent important research achievements in understanding Sn whisker formation and growth, both experimentally and theoretically. Focus is then placed on examining the role that anisotropy in grain boundary diffusivity plays in determining whisker characteristics (specifically, whether they form and, if so, where on a surface). To study this aspect of the problem and to enable future studies on stress driven grain boundary diffusion, this thesis presents a numerical anisotropic mass transport model. In addition to presenting details of the model and implementation, model predictions for a set of increasingly complex grain boundary networks are discussed. Preliminary results from the model provide evidence that anisotropic grain boundary diffusion may be a primary driving mechanism in whisker formation.

  6. VARIANT: VARIational anisotropic nodal transport for multidimensional Cartesian and hexadgonal geometry calculation

    International Nuclear Information System (INIS)

    Palmiotti, G.; Carrico, C.B.; Lewis, E.E.

    1995-10-01

    The theoretical basis, implementation information and numerical results are presented for VARIANT (VARIational Anisotropic Neutron Transport), a FORTRAN module of the DIF3D code system at Argonne National Laboratory. VARIANT employs the variational nodal method to solve multigroup steady-state neutron diffusion and transport problems. The variational nodal method is a hybrid finite element method that guarantees nodal balance and permits spatial refinement through the use of hierarchical complete polynomial trial functions. Angular variables are expanded with complete or simplified P 1 , P 3 or P 5 5 spherical harmonics approximations with full anisotropic scattering capability. Nodal response matrices are obtained, and the within-group equations are solved by red-black or four-color iteration, accelerated by a partitioned matrix algorithm. Fission source and upscatter iterations strategies follow those of DIF3D. Two- and three-dimensional Cartesian and hexagonal geometries are implemented. Forward and adjoint eigenvalue, fixed source, gamma heating, and criticality (concentration) search problems may be performed

  7. New complex variable meshless method for advection—diffusion problems

    International Nuclear Information System (INIS)

    Wang Jian-Fei; Cheng Yu-Min

    2013-01-01

    In this paper, an improved complex variable meshless method (ICVMM) for two-dimensional advection—diffusion problems is developed based on improved complex variable moving least-square (ICVMLS) approximation. The equivalent functional of two-dimensional advection—diffusion problems is formed, the variation method is used to obtain the equation system, and the penalty method is employed to impose the essential boundary conditions. The difference method for two-point boundary value problems is used to obtain the discrete equations. Then the corresponding formulas of the ICVMM for advection—diffusion problems are presented. Two numerical examples with different node distributions are used to validate and inestigate the accuracy and efficiency of the new method in this paper. It is shown that ICVMM is very effective for advection—diffusion problems, and has a good convergent character, accuracy, and computational efficiency

  8. Anisotropic gravitational instability

    International Nuclear Information System (INIS)

    Polyachenko, V.L.; Fridman, A.M.

    1988-01-01

    Exact solutions of stability problems are obtained for two anisotropic gravitational systems of different geometries - a layer of finite thickness at rest and a rotating cylinder of finite radius. It is shown that the anisotropic gravitational instability which develops in both cases is of Jeans type. However, in contrast to the classical aperiodic Jeans instability, this instability is oscillatory. The physics of the anisotropic gravitational instability is investigated. It is shown that in a gravitating layer this instability is due, in particular, to excitation of previously unknown interchange-Jeans modes. In the cylinder, the oscillatory Jeans instability is associated with excitation of a rotational branch, this also being responsible for the beam gravitational instability. This is the reason why this instability and the anisotropic gravitational instability have so much in common

  9. Calculation of anisotropic few-group constants in asymptotic cells: the code ANICELL

    International Nuclear Information System (INIS)

    Devenyi, A.

    1985-10-01

    The theoretical background of the ANICELL computer program together with a user's manual is presented. ANICELL is a nuclear reactor neutron transport code which solves the traditional asymptotic and the so-called tilted flux transport problems in one-dimensional cylindrical geometry using linearly anisotropic scattering. The method of solution used is the first flight collision probability technique. Few-group constants including radial and axial diffusion coefficients for the cell are also prepared by the program. (author)

  10. Diffusion-synthetic acceleration methods for discrete-ordinates problems

    International Nuclear Information System (INIS)

    Larsen, E.W.

    1984-01-01

    The diffusion-synthetic acceleration (DSA) method is an iterative procedure for obtaining numerical solutions of discrete-ordinates problems. The DSA method is operationally more complicated than the standard source-iteration (SI) method, but if encoded properly it converges much more rapidly, especially for problems with diffusion-like regions. In this article we describe the basic ideas behind the DSA method and give a (roughly chronological) review of its long development. We conclude with a discussion which covers additional topics, including some remaining open problems an the status of current efforts aimed at solving these problems

  11. Diffusion tensor optical coherence tomography

    Science.gov (United States)

    Marks, Daniel L.; Blackmon, Richard L.; Oldenburg, Amy L.

    2018-01-01

    In situ measurements of diffusive particle transport provide insight into tissue architecture, drug delivery, and cellular function. Analogous to diffusion-tensor magnetic resonance imaging (DT-MRI), where the anisotropic diffusion of water molecules is mapped on the millimeter scale to elucidate the fibrous structure of tissue, here we propose diffusion-tensor optical coherence tomography (DT-OCT) for measuring directional diffusivity and flow of optically scattering particles within tissue. Because DT-OCT is sensitive to the sub-resolution motion of Brownian particles as they are constrained by tissue macromolecules, it has the potential to quantify nanoporous anisotropic tissue structure at micrometer resolution as relevant to extracellular matrices, neurons, and capillaries. Here we derive the principles of DT-OCT, relating the detected optical signal from a minimum of six probe beams with the six unique diffusion tensor and three flow vector components. The optimal geometry of the probe beams is determined given a finite numerical aperture, and a high-speed hardware implementation is proposed. Finally, Monte Carlo simulations are employed to assess the ability of the proposed DT-OCT system to quantify anisotropic diffusion of nanoparticles in a collagen matrix, an extracellular constituent that is known to become highly aligned during tumor development.

  12. Diffusion with Varying Drag; the Runaway Problem.

    Science.gov (United States)

    Rollins, David Kenneth

    We study the motion of electrons in an ionized plasma of electrons and ions in an external electric field. A probability distribution function describes the electron motion and is a solution of a Fokker-Planck equation. In zero field, the solution approaches an equilibrium Maxwellian. For arbitrarily small field, electrons overcome the diffusive effects and are freely accelerated by the field. This is the electron runaway phenomenon. We treat the electric field as a small perturbation. We consider various diffusion coefficients for the one dimensional problem and determine the runaway current as a function of the field strength. Diffusion coefficients, non-zero on a finite interval are examined. Some non-trivial cases of these can be solved exactly in terms of known special functions. The more realistic case where the diffusion coefficient decays with velocity are then considered. To determine the runaway current, the equivalent Schrodinger eigenvalue problem is analysed. The smallest eigenvalue is shown to be equal to the runaway current. Using asymptotic matching a solution can be constructed which is then used to evaluate the runaway current. The runaway current is exponentially small as a function of field strength. This method is used to extract results from the three dimensional problem.

  13. Diffusion with varying drag; the runaway problem

    International Nuclear Information System (INIS)

    Rollins, D.K.

    1986-01-01

    The motion of electrons in an ionized plasma of electrons and ions in an external electric field is studied. A probability distribution function describes the electron motion and is a solution of a Fokker-Planck equation. In zero field, the solution approaches an equilibrium Maxwellian. For arbitrarily small field, electrons overcome the diffusive effects and are freely accelerated by the field. This is the electron-runaway phenomenon. The electric field is treated as a small perturbation. Various diffusion coefficients are considered for the one dimensional problem, and the runaway current is determined as a function of the field strength. Diffusion coefficients, non-zero on a finite interval are examined. Some non-trivial cases of these can be solved exactly in terms of known special functions. The more realistic case where the diffusion coeffient decays with velocity are then considered. To determine the runaway current, the equivalent Schroedinger eigenvalue problem is analyzed. The smallest eigenvalue is shown to be equal to the runaway current. Using asymptotic matching, a solution can be constructed which is then used to evaluate the runaway current. The runaway current is exponentially small as a function of field strength. This method is used to extract results from the three dimensional problem

  14. Heuristic geometric ''eigenvalue universality'' in a one-dimensional neutron transport problem with anisotropic scattering

    International Nuclear Information System (INIS)

    Goncalves, G.A.; Vilhena, M.T. de; Bodmann, B.E.J.

    2010-01-01

    In the present work we propose a heuristic construction of a transport equation for neutrons with anisotropic scattering considering only the radial cylinder dimension. The eigenvalues of the solutions of the equation correspond to the positive values for the one dimensional case. The central idea of the procedure is the application of the S N method for the discretisation of the angular variable followed by the application of the zero order Hankel transformation. The basis the construction of the scattering terms in form of an integro-differential equation for stationary transport resides in the hypothesis that the eigenvalues that compose the elementary solutions are independent of geometry for a homogeneous medium. We compare the solutions for the cartesian one dimensional problem for an infinite cylinder with azimuthal symmetry and linear anisotropic scattering for two cases. (orig.)

  15. Enhancing Rotational Diffusion Using Oscillatory Shear

    KAUST Repository

    Leahy, Brian D.

    2013-05-29

    Taylor dispersion - shear-induced enhancement of translational diffusion - is an important phenomenon with applications ranging from pharmacology to geology. Through experiments and simulations, we show that rotational diffusion is also enhanced for anisotropic particles in oscillatory shear. This enhancement arises from variations in the particle\\'s rotation (Jeffery orbit) and depends on the strain amplitude, rate, and particle aspect ratio in a manner that is distinct from the translational diffusion. This separate tunability of translational and rotational diffusion opens the door to new techniques for controlling positions and orientations of suspended anisotropic colloids. © 2013 American Physical Society.

  16. Solution of the neutron transport problem with anisotropic scattering in cylindrical geometry by the decomposition method

    International Nuclear Information System (INIS)

    Goncalves, G.A.; Bogado Leite, S.Q.; Vilhena, M.T. de

    2009-01-01

    An analytical solution has been obtained for the one-speed stationary neutron transport problem, in an infinitely long cylinder with anisotropic scattering by the decomposition method. Series expansions of the angular flux distribution are proposed in terms of suitably constructed functions, recursively obtainable from the isotropic solution, to take into account anisotropy. As for the isotropic problem, an accurate closed-form solution was chosen for the problem with internal source and constant incident radiation, obtained from an integral transformation technique and the F N method

  17. A symmetrized quasi-diffusion method for solving multidimensional transport problems

    International Nuclear Information System (INIS)

    Miften, M.M.; Larsen, E.W.

    1992-01-01

    In this paper, the authors propose a 'symmetrized' QD (SQD) method in which the non-self-adjoint QD diffusion problem is replaced by two self-adjoint diffusion problems. These problems are more easily discretized and more efficiently solved than in the standard QD method. They also give SQD calculational results for transport problems in x-y geometry

  18. Spectral Green’s function nodal method for multigroup SN problems with anisotropic scattering in slab-geometry non-multiplying media

    International Nuclear Information System (INIS)

    Menezes, Welton A.; Filho, Hermes Alves; Barros, Ricardo C.

    2014-01-01

    Highlights: • Fixed-source S N transport problems. • Energy multigroup model. • Anisotropic scattering. • Slab-geometry spectral nodal method. - Abstract: A generalization of the spectral Green’s function (SGF) method is developed for multigroup, fixed-source, slab-geometry discrete ordinates (S N ) problems with anisotropic scattering. The offered SGF method with the one-node block inversion (NBI) iterative scheme converges numerical solutions that are completely free from spatial truncation errors for multigroup, slab-geometry S N problems with scattering anisotropy of order L, provided L < N. As a coarse-mesh numerical method, the SGF method generates numerical solutions that generally do not give detailed information on the problem solution profile, as the grid points can be located considerably away from each other. Therefore, we describe in this paper a technique for the spatial reconstruction of the coarse-mesh solution generated by the multigroup SGF method. Numerical results are given to illustrate the method’s accuracy

  19. An inverse diffusivity problem for the helium production–diffusion equation

    International Nuclear Information System (INIS)

    Bao, Gang; Xu, Xiang

    2012-01-01

    Thermochronology is a technique for the extraction of information about the thermal history of rocks. Such information is crucial for determining the depth below the surface at which rocks were located at a given time (Bao G et al 2011 Commun. Comput. Phys. 9 129). Mathematically, extracting the time–temperature path can be formulated as an inverse diffusivity problem for the helium production–diffusion equation which is the underlying process of thermochronology. In this paper, to reconstruct the diffusivity which depends on space only and accounts for the structural information of rocks, a local Hölder conditional stability is obtained by a Carleman estimate. A uniqueness result is also proven for extracting the thermal history, i.e. identifying the time-dependant part of the diffusion coefficient, provided that it is analytical with respect to time. Numerical examples are presented to illustrate the validity and effectiveness of the proposed regularization scheme. (paper)

  20. On some applications of diffusion processes for image processing

    International Nuclear Information System (INIS)

    Morfu, S.

    2009-01-01

    We propose a new algorithm inspired by the properties of diffusion processes for image filtering. We show that purely nonlinear diffusion processes ruled by Fisher equation allows contrast enhancement and noise filtering, but involves a blurry image. By contrast, anisotropic diffusion, described by Perona and Malik algorithm, allows noise filtering and preserves the edges. We show that combining the properties of anisotropic diffusion with those of nonlinear diffusion provides a better processing tool which enables noise filtering, contrast enhancement and edge preserving.

  1. Simulation of anisotropic diffusion by means of a diffusion velocity method

    CERN Document Server

    Beaudoin, A; Rivoalen, E

    2003-01-01

    An alternative method to the Particle Strength Exchange method for solving the advection-diffusion equation in the general case of a non-isotropic and non-uniform diffusion is proposed. This method is an extension of the diffusion velocity method. It is shown that this extension is quite straightforward due to the explicit use of the diffusion flux in the expression of the diffusion velocity. This approach is used to simulate pollutant transport in groundwater and the results are compared to those of the PSE method presented in an earlier study by Zimmermann et al.

  2. Integral transform method for solving neutron transport problems with general anisotropic scattering in a cylinder of finite height

    International Nuclear Information System (INIS)

    Kumar, V.; Sahni, D.C.

    1983-01-01

    In this paper, the authors present the mathematical techniques that were developed for solving the integral transport equation for the criticality of a homogeneous cylinder of finite height with general anisotropic scattering. They present the integral transport equations for the Fourier transformed spherical harmonic moments of the angular flux. These moments are also represented by a series of products of spherical Bessel functions. The criticality problem is, then, posed by the matrix eigenvalue problem whose eigenvector is composed of the expansion coefficients mentioned above. An methodology of calculating the general matrix element is discussed by using the recursion relations derived in this paper. Finally, for the one-group criticality of finite cylinders, the benchmark results are generated when scattering is linearly anisotropic. Also, these benchmarks are solved and compared with the S/sub N/ method of TWOTRAN

  3. Theoretical and numerical study of highly anisotropic turbulent flows

    NARCIS (Netherlands)

    Biferale, L.; Daumont, I.; Lanotte, A.; Toschi, F.

    2004-01-01

    We present a detailed numerical study of anisotropic statistical fluctuations in stationary, homogeneous turbulent flows. We address both problems of intermittency in anisotropic sectors, and the relative importance of isotropic and anisotropic fluctuations at different scales on a direct numerical

  4. Anisotropic diffusion within human white matter

    International Nuclear Information System (INIS)

    Chenevert, T.L.; Brunberg, J.A.; Pipe, J.G.

    1990-01-01

    This paper reports on measurements performed to assess the impact of fiber orientation on the apparent diffusion coefficient of human white matter in vivo. Orthogonal section selection pulses and strong motion sensitization gradient pulses were used for localized diffusion measurement along an anteroposteriorly oriented 1 x 1 cm tissue column in the left cerebral hemisphere. This region was selected since white matter fiber orientations are reasonably well defined. Independent acquisitions with motion sensitivity along anteroposterior and right-left directions allowed study of diffusion anisotropy. Motion artifacts were minimized by magnitude summation after one-dimensional Fourier transform of frequency-encoded echoes; consequently, cardiac gating was not required. Five normal volunteers were studied on a 1.5-T clinical MR system

  5. A Variational Approach to Perturbed Discrete Anisotropic Equations

    Directory of Open Access Journals (Sweden)

    Amjad Salari

    2016-01-01

    Full Text Available We continue the study of discrete anisotropic equations and we will provide new multiplicity results of the solutions for a discrete anisotropic equation. We investigate the existence of infinitely many solutions for a perturbed discrete anisotropic boundary value problem. The approach is based on variational methods and critical point theory.

  6. Emissivity of discretized diffusion problems

    International Nuclear Information System (INIS)

    Densmore, Jeffery D.; Davidson, Gregory; Carrington, David B.

    2006-01-01

    The numerical modeling of radiative transfer by the diffusion approximation can produce artificially damped radiation propagation if spatial cells are too optically thick. In this paper, we investigate this nonphysical behavior at external problem boundaries by examining the emissivity of the discretized diffusion approximation. We demonstrate that the standard cell-centered discretization produces an emissivity that is too low for optically thick cells, a situation that leads to the lack of radiation propagation. We then present a modified boundary condition that yields an accurate emissivity regardless of cell size. This modified boundary condition can be used with a deterministic calculation or as part of a hybrid transport-diffusion method for increasing the efficiency of Monte Carlo simulations. We also discuss the range of applicability, as a function of cell size and material properties, when this modified boundary condition is employed in a hybrid technique. With a set of numerical calculations, we demonstrate the accuracy and usefulness of this modified boundary condition

  7. The importance of anisotropic scattering in high energy neutron transport problems

    International Nuclear Information System (INIS)

    Prillinger, G.; Mattes, M.

    1984-01-01

    To describe the highly anisotropic scattering of very fast neutrons adequately the transport code ANISN has been improved. Fokker-Planck terms have been introduced into the transport equation which accurately describe the small changes in energy and angle. The new code has been tested for a d(50)-Be neutron source in a deep penetration iron problem. The influence of the forward peaked elastic scattering on the fast neutron spectrum is shown to be significant and can be handled efficiently in the new ANISN version. Since common cross-section libraries are limited by Legendre expansion, or by their upper energy boundary, or exclude elastic scattering above 20 MeV a special library has been created. (Auth.)

  8. On some examples of pollutant transport problems solved numerically using the boundary element method

    Science.gov (United States)

    Azis, Moh. Ivan; Kasbawati; Haddade, Amiruddin; Astuti Thamrin, Sri

    2018-03-01

    A boundary element method (BEM) is obtained for solving a boundary value problem of homogeneous anisotropic media governed by diffusion-convection equation. The application of the BEM is shown for two particular pollutant transport problems of Tello river and Unhas lake in Makassar Indonesia. For the two particular problems a variety of the coefficients of diffusion and the velocity components are taken. The results show that the solutions vary as the parameters change. And this suggests that one has to be careful in measuring or determining the values of the parameters.

  9. Matrix-dependent multigrid-homogenization for diffusion problems

    Energy Technology Data Exchange (ETDEWEB)

    Knapek, S. [Institut fuer Informatik tu Muenchen (Germany)

    1996-12-31

    We present a method to approximately determine the effective diffusion coefficient on the coarse scale level of problems with strongly varying or discontinuous diffusion coefficients. It is based on techniques used also in multigrid, like Dendy`s matrix-dependent prolongations and the construction of coarse grid operators by means of the Galerkin approximation. In numerical experiments, we compare our multigrid-homogenization method with homogenization, renormalization and averaging approaches.

  10. RKC time-stepping for advection-diffusion-reaction problems

    International Nuclear Information System (INIS)

    Verwer, J.G.; Sommeijer, B.P.; Hundsdorfer, W.

    2004-01-01

    The original explicit Runge-Kutta-Chebyshev (RKC) method is a stabilized second-order integration method for pure diffusion problems. Recently, it has been extended in an implicit-explicit manner to also incorporate highly stiff reaction terms. This implicit-explicit RKC method thus treats diffusion terms explicitly and the highly stiff reaction terms implicitly. The current paper deals with the incorporation of advection terms for the explicit method, thus aiming at the implicit-explicit RKC integration of advection-diffusion-reaction equations in a manner that advection and diffusion terms are treated simultaneously and explicitly and the highly stiff reaction terms implicitly

  11. Study of ODE limit problems for reaction-diffusion equations

    Directory of Open Access Journals (Sweden)

    Jacson Simsen

    2018-01-01

    Full Text Available In this work we study ODE limit problems for reaction-diffusion equations for large diffusion and we study the sensitivity of nonlinear ODEs with respect to initial conditions and exponent parameters. Moreover, we prove continuity of the flow and weak upper semicontinuity of a family of global attractors for reaction-diffusion equations with spatially variable exponents when the exponents go to 2 in \\(L^{\\infty}(\\Omega\\ and the diffusion coefficients go to infinity.

  12. Domain decomposition method for nonconforming finite element approximations of anisotropic elliptic problems on nonmatching grids

    Energy Technology Data Exchange (ETDEWEB)

    Maliassov, S.Y. [Texas A& M Univ., College Station, TX (United States)

    1996-12-31

    An approach to the construction of an iterative method for solving systems of linear algebraic equations arising from nonconforming finite element discretizations with nonmatching grids for second order elliptic boundary value problems with anisotropic coefficients is considered. The technique suggested is based on decomposition of the original domain into nonoverlapping subdomains. The elliptic problem is presented in the macro-hybrid form with Lagrange multipliers at the interfaces between subdomains. A block diagonal preconditioner is proposed which is spectrally equivalent to the original saddle point matrix and has the optimal order of arithmetical complexity. The preconditioner includes blocks for preconditioning subdomain and interface problems. It is shown that constants of spectral equivalence axe independent of values of coefficients and mesh step size.

  13. Analysis of Diffusion Problems using Homotopy Perturbation and Variational Iteration Methods

    DEFF Research Database (Denmark)

    Barari, Amin; Poor, A. Tahmasebi; Jorjani, A.

    2010-01-01

    In this paper, variational iteration method and homotopy perturbation method are applied to different forms of diffusion equation. The diffusion equations have found wide applications in heat transfer problems, theory of consolidation and many other problems in engineering. The methods proposed...

  14. A signature of anisotropic cosmic-ray transport in the gamma-ray sky

    Energy Technology Data Exchange (ETDEWEB)

    Cerri, Silvio Sergio; Grasso, Dario [Dipartimento di Fisica ' ' E. Fermi' ' , Università di Pisa, Largo B. Pontecorvo 3, I-56127 Pisa (Italy); Gaggero, Daniele [GRAPPA, University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Vittino, Andrea [Physik-Department T30d, Technische Universität München, James Franck-Str. 1, D-85748, Garching (Germany); Evoli, Carmelo, E-mail: silvio.cerri@df.unipi.it, E-mail: d.gaggero@uva.nl, E-mail: andrea.vittino@tum.de, E-mail: carmelo.evoli@gssi.it, E-mail: dario.grasso@pi.infn.it [Gran Sasso Science Institute, Viale Francesco Crispi 7, 67100 L' Aquila (Italy)

    2017-10-01

    A crucial process in Galactic cosmic-ray (CR) transport is the spatial diffusion due to the interaction with the interstellar turbulent magnetic field. Usually, CR diffusion is assumed to be uniform and isotropic all across the Galaxy. However, this picture is clearly inaccurate: several data-driven and theoretical arguments, as well as dedicated numerical simulations, show that diffusion exhibits highly anisotropic properties with respect to the direction of a background (ordered) magnetic field (i.e., parallel or perpendicular to it). In this paper we focus on a recently discovered anomaly in the hadronic CR spectrum inferred by the Fermi-LAT gamma-ray data at different positions in the Galaxy, i.e. the progressive hardening of the proton slope at low Galactocentric radii. We propose the idea that this feature can be interpreted as a signature of anisotropic diffusion in the complex Galactic magnetic field: in particular, the harder slope in the inner Galaxy is due, in our scenario, to the parallel diffusive escape along the poloidal component of the large-scale, regular, magnetic field. We implement this idea in a numerical framework, based on the DRAGON code, and perform detailed numerical tests on the accuracy of our setup. We discuss how the effect proposed depends on the relevant free parameters involved. Based on low-energy extrapolation of the few focused numerical simulations aimed at determining the scalings of the anisotropic diffusion coefficients, we finally present a set of plausible models that reproduce the behavior of the CR proton slopes inferred by gamma-ray data.

  15. On a hierarchical construction of the anisotropic LTSN solution from the isotropic LTSN solution

    International Nuclear Information System (INIS)

    Foletto, Taline; Segatto, Cynthia F.; Bodmann, Bardo E.; Vilhena, Marco T.

    2015-01-01

    In this work, we present a recursive scheme targeting the hierarchical construction of anisotropic LTS N solution from the isotropic LTS N solution. The main idea relies in the decomposition of the associated LTS N anisotropic matrix as a sum of two matrices in which one matrix contains the isotropic and the other anisotropic part of the problem. The matrix containing the anisotropic part is considered as the source of the isotropic problem. The solution of this problem is made by the decomposition of the angular flux as a truncated series of intermediate functions and replace in the isotropic equation. After the replacement of these into the split isotropic equation, we construct a set of isotropic recursive problems, that are readily solved by the classic LTS N isotropic method. We apply this methodology to solve problems considering homogeneous and heterogeneous anisotropic regions. Numerical results are presented and compared with the classical LTS N anisotropic solution. (author)

  16. Generalization of Asaoka method to linearly anisotropic scattering: benchmark data in cylindrical geometry

    International Nuclear Information System (INIS)

    Sanchez, Richard.

    1975-11-01

    The Integral Transform Method for the neutron transport equation has been developed in last years by Asaoka and others. The method uses Fourier transform techniques in solving isotropic one-dimensional transport problems in homogeneous media. The method has been extended to linearly anisotropic transport in one-dimensional homogeneous media. Series expansions were also obtained using Hembd techniques for the new anisotropic matrix elements in cylindrical geometry. Carlvik spatial-spherical harmonics method was generalized to solve the same problem. By applying a relation between the isotropic and anisotropic one-dimensional kernels, it was demonstrated that anisotropic matrix elements can be calculated by a linear combination of a few isotropic matrix elements. This means in practice that the anisotropic problem of order N with the N+2 isotropic matrix for the plane and spherical geometries, and N+1 isotropic matrix for cylindrical geometries can be solved. A method of solving linearly anisotropic one-dimensional transport problems in homogeneous media was defined by applying Mika and Stankiewicz observations: isotropic matrix elements were computed by Hembd series and anisotropic matrix elements then calculated from recursive relations. The method has been applied to albedo and critical problems in cylindrical geometries. Finally, a number of results were computed with 12-digit accuracy for use as benchmarks [fr

  17. Problems with Discontinuous Diffusion/Dispersion Coefficients

    Directory of Open Access Journals (Sweden)

    Stefano Ferraris

    2012-01-01

    accurate on smooth solutions and based on a special numerical treatment of the diffusion/dispersion coefficients that makes its application possible also when such coefficients are discontinuous. Numerical experiments confirm the convergence of the numerical approximation and show a good behavior on a set of benchmark problems in two space dimensions.

  18. Analytical solutions to matrix diffusion problems

    Energy Technology Data Exchange (ETDEWEB)

    Kekäläinen, Pekka, E-mail: pekka.kekalainen@helsinki.fi [Laboratory of Radiochemistry, Department of Chemistry, P.O. Box 55, FIN-00014 University of Helsinki (Finland)

    2014-10-06

    We report an analytical method to solve in a few cases of practical interest the equations which have traditionally been proposed for the matrix diffusion problem. In matrix diffusion, elements dissolved in ground water can penetrate the porous rock surronuding the advective flow paths. In the context of radioactive waste repositories this phenomenon provides a mechanism by which the area of rock surface in contact with advecting elements is greatly enhanced, and can thus be an important delay mechanism. The cases solved are relevant for laboratory as well for in situ experiments. Solutions are given as integral representations well suited for easy numerical solution.

  19. Numerical study of the thermal degradation of isotropic and anisotropic polymeric materials

    Energy Technology Data Exchange (ETDEWEB)

    Soler, E. [Departamento de Lenguajes y Ciencias de la Computacion, ETSI Informatica, Universidad de Malaga, 29071 Malaga (Spain); Ramos, J.I. [Room I-320-D, ETS Ingenieros Industriales, Universidad de Malaga, Plaza El Ejido, s/n, 29013 Malaga (Spain)

    2005-08-01

    The thermal degradation of two-dimensional isotropic, orthotropic and anisotropic polymeric materials is studied numerically by means of a second-order accurate (in both space and time) linearly implicit finite difference formulation which results in linear algebraic equations at each time step. It is shown that, for both isotropic and orthotropic composites, the monomer mass diffusion tensor plays a role in initiating the polymerization kinetics, the formation of a polymerization kernel and the initial front propagation, whereas the later stages of the polymerization are nearly independent of the monomer mass diffusion tensor. In anisotropic polymeric composites, it has been found that the monomer mass diffusion tensor plays a paramount role in determining the initial stages of the polymerization and the subsequent propagation of the polymerization front, the direction and speed of propagation of which are found to be related to the principal directions of both the monomer mass and the heat diffusion tensors. It is also shown that the polymerization time and temperatures depend strongly on the anisotropy of the mass and heat diffusion tensors. (authors)

  20. An inverse problem for a one-dimensional time-fractional diffusion problem

    KAUST Repository

    Jin, Bangti; Rundell, William

    2012-01-01

    We study an inverse problem of recovering a spatially varying potential term in a one-dimensional time-fractional diffusion equation from the flux measurements taken at a single fixed time corresponding to a given set of input sources. The unique

  1. Multigrid treatment of implicit continuum diffusion

    Science.gov (United States)

    Francisquez, Manaure; Zhu, Ben; Rogers, Barrett

    2017-10-01

    Implicit treatment of diffusive terms of various differential orders common in continuum mechanics modeling, such as computational fluid dynamics, is investigated with spectral and multigrid algorithms in non-periodic 2D domains. In doubly periodic time dependent problems these terms can be efficiently and implicitly handled by spectral methods, but in non-periodic systems solved with distributed memory parallel computing and 2D domain decomposition, this efficiency is lost for large numbers of processors. We built and present here a multigrid algorithm for these types of problems which outperforms a spectral solution that employs the highly optimized FFTW library. This multigrid algorithm is not only suitable for high performance computing but may also be able to efficiently treat implicit diffusion of arbitrary order by introducing auxiliary equations of lower order. We test these solvers for fourth and sixth order diffusion with idealized harmonic test functions as well as a turbulent 2D magnetohydrodynamic simulation. It is also shown that an anisotropic operator without cross-terms can improve model accuracy and speed, and we examine the impact that the various diffusion operators have on the energy, the enstrophy, and the qualitative aspect of a simulation. This work was supported by DOE-SC-0010508. This research used resources of the National Energy Research Scientific Computing Center (NERSC).

  2. Forward and inverse problems for surface acoustic waves in anisotropic media: A Ritz-Rayleigh method based approach

    Czech Academy of Sciences Publication Activity Database

    Stoklasová, Pavla; Sedlák, Petr; Seiner, Hanuš; Landa, Michal

    2015-01-01

    Roč. 56, February 2015 (2015), s. 381-389 ISSN 0041-624X R&D Projects: GA ČR GPP101/12/P428 Institutional support: RVO:61388998 Keywords : surface acoustic waves * anisotropic materials * Ritz-Rayleigh method * inverse problem Subject RIV: BI - Acoustics Impact factor: 1.954, year: 2015 http://www.sciencedirect.com/science/article/pii/S0041624X14002686

  3. An Adaptive Approach to Variational Nodal Diffusion Problems

    International Nuclear Information System (INIS)

    Zhang Hui; Lewis, E.E.

    2001-01-01

    An adaptive grid method is presented for the solution of neutron diffusion problems in two dimensions. The primal hybrid finite elements employed in the variational nodal method are used to reduce the diffusion equation to a coupled set of elemental response matrices. An a posteriori error estimator is developed to indicate the magnitude of local errors stemming from the low-order elemental interface approximations. An iterative procedure is implemented in which p refinement is applied locally by increasing the polynomial order of the interface approximations. The automated algorithm utilizes the a posteriori estimator to achieve local error reductions until an acceptable level of accuracy is reached throughout the problem domain. Application to a series of X-Y benchmark problems indicates the reduction of computational effort achievable by replacing uniform with adaptive refinement of the spatial approximations

  4. Anisotropic swim stress in active matter with nematic order

    Science.gov (United States)

    Yan, Wen; Brady, John F.

    2018-05-01

    Active Brownian particles (ABPs) transmit a swim pressure {{{\\Pi }}}{{swim}}=n\\zeta {D}{{swim}} to the container boundaries, where ζ is the drag coefficient, D swim is the swim diffusivity and n is the uniform bulk number density far from the container walls. In this work we extend the notion of the isotropic swim pressure to the anisotropic tensorial swim stress {{\\boldsymbol{σ }}}{{swim}}=-n\\zeta {{\\boldsymbol{D}}}{{swim}}, which is related to the anisotropic swim diffusivity {{\\boldsymbol{D}}}{{swim}}. We demonstrate this relationship with ABPs that achieve nematic orientational order via a bulk external field. The anisotropic swim stress is obtained analytically for dilute ABPs in both 2D and 3D systems. The anisotropy, defined as the ratio of the maximum to the minimum of the three principal stresses, is shown to grow exponentially with the strength of the external field. We verify that the normal component of the anisotropic swim stress applies a pressure {{{\\Pi }}}{{swim}}=-({{\\boldsymbol{σ }}}{{swim}}\\cdot {\\boldsymbol{n}})\\cdot {\\boldsymbol{n}} on a wall with normal vector {\\boldsymbol{n}}, and, through Brownian dynamics simulations, this pressure is shown to be the force per unit area transmitted by the active particles. Since ABPs have no friction with a wall, the difference between the normal and tangential stress components—the normal stress difference—generates a net flow of ABPs along the wall, which is a generic property of active matter systems.

  5. Mentalizing and interpersonal problems in borderline personality disorder: The mediating role of identity diffusion.

    Science.gov (United States)

    De Meulemeester, Celine; Lowyck, Benedicte; Vermote, Rudi; Verhaest, Yannic; Luyten, Patrick

    2017-12-01

    Individuals with borderline personality disorder (BPD) are characterized by problems in interpersonal functioning and their long-term social integration often remains problematic. Extant theories have linked identity diffusion to many of the interpersonal problems characteristic of BPD patients. Recent theoretical accounts have suggested that identity diffusion results from problems with mentalizing or reflective functioning, that is, the capacity to understand oneself and others in terms of intentional mental states. In this study we tested these assumptions, i.e., whether identity diffusion plays a mediating role in the relationship between mentalizing difficulties and interpersonal problems, in a sample of 167 BPD patients. Highly significant correlations were found between mentalizing impairments, identity diffusion and interpersonal problems. Mediation analyses showed that identity diffusion fully mediated the relationship between mentalizing difficulties and interpersonal problems. This study provides preliminary evidence that impairments in mentalizing are related to identity diffusion, which in turn is related to interpersonal problems in BPD. Further longitudinal research is needed to further substantiate these conclusions. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Perturbation on diffusion problems in domain with interfaces

    International Nuclear Information System (INIS)

    Watson, F.V.

    1985-01-01

    A perturbative type algorithm for the solution of linear diffusion equation at two dimensions, in domain with interfaces is presented. The perturbative scheme should be assembled in the weak formulation of diffusion equation, even if the strong solution exists, and when it is taken in terms superiors to first order, it should be calculated analytically, in one of the dimensions to avoid problems of slow convergence. (M.C.K.) [pt

  7. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  8. Disadvantage factor for anisotropic scattering

    International Nuclear Information System (INIS)

    Saad, E.A.; Abdel Krim, M.S.; EL-Dimerdash, A.A.

    1990-01-01

    The invariant embedding method is used to solve the problem for a two region reactor with anisotropic scattering and to compute the disadvantage factor necessary for calculating some reactor parameters

  9. The Dirichlet problem of a conformable advection-diffusion equation

    Directory of Open Access Journals (Sweden)

    Avci Derya

    2017-01-01

    Full Text Available The fractional advection-diffusion equations are obtained from a fractional power law for the matter flux. Diffusion processes in special types of porous media which has fractal geometry can be modelled accurately by using these equations. However, the existing nonlocal fractional derivatives seem complicated and also lose some basic properties satisfied by usual derivatives. For these reasons, local fractional calculus has recently been emerged to simplify the complexities of fractional models defined by nonlocal fractional operators. In this work, the conformable, a local, well-behaved and limit-based definition, is used to obtain a local generalized form of advection-diffusion equation. In addition, this study is devoted to give a local generalized description to the combination of diffusive flux governed by Fick’s law and the advection flux associated with the velocity field. As a result, the constitutive conformable advection-diffusion equation can be easily achieved. A Dirichlet problem for conformable advection-diffusion equation is derived by applying fractional Laplace transform with respect to time t and finite sin-Fourier transform with respect to spatial coordinate x. Two illustrative examples are presented to show the behaviours of this new local generalized model. The dependence of the solution on the fractional order of conformable derivative and the changing values of problem parameters are validated using graphics held by MATLcodes.

  10. Effect of reflecting modes on combined heat transfer within an anisotropic scattering slab

    International Nuclear Information System (INIS)

    Yi Hongliang; Tan Heping; Lu Yiping

    2005-01-01

    Under various interface reflecting modes, different transient thermal responses will occur in the media. Combined radiative-conductive heat transfer is investigated within a participating, anisotropic scattering gray planar slab. The two interfaces of the slab are considered to be diffuse and semitransparent. Using the ray tracing method, an anisotropic scattering radiative transfer model for diffuse reflection at boundaries is set up, and with the help of direct radiative transfer coefficients, corresponding radiative transfer coefficients (RTCs) are deduced. RTCs are used to calculate the radiative source term in energy equation. Transient energy equation is solved by the full implicit control-volume method under the external radiative-convective boundary conditions. The influences of two reflecting modes including both specular reflection and diffuse reflection on transient temperature fields and steady heat flux are examined. According to numerical results obtained in this paper, it is found that there exits great difference in thermal behavior between slabs with diffuse interfaces and that with specular interfaces for slabs with big refractive index

  11. Correlation of Local Structure and Diffusion Pathways in the Modulated Anisotropic Oxide Ion Conductor CeNbO4.25

    KAUST Repository

    Pramana, Stevin S.

    2016-01-15

    CeNbO is reported to exhibit fast oxygen ion diffusion at moderate temperatures, making this the prototype of a new class of ion conductor with applications in a range of energy generation and storage devices. To date, the mechanism by which this ion transport is achieved has remained obscure, in part due to the long-range commensurately modulated structural motif. Here we show that CeNbO forms with a unit cell 12 times larger than the stoichiometric tetragonal parent phase of CeNbO as a result of the helical ordering of Ce and Ce ions along z. Interstitial oxygen ion incorporation leads to a cooperative displacement of the surrounding oxygen species, creating interlayer NbO connectivity by extending the oxygen coordination number to 7 and 8. Molecular dynamic simulations suggest that fast ion migration occurs predominantly within the xz plane. It is concluded that the oxide ion diffuses anisotropically, with the major migration mechanism being intralayer; however, when obstructed, oxygen can readily move to an adjacent layer along y via alternate lower energy barrier pathways.

  12. Correlation of Local Structure and Diffusion Pathways in the Modulated Anisotropic Oxide Ion Conductor CeNbO4.25

    KAUST Repository

    Pramana, Stevin S.; Baikie, Tom; An, Tao; Tucker, Matthew G.; Wu, Ji; Schreyer, Martin K.; Wei, Fengxia; Bayliss, Ryan D.; Kloc, Christian L.; White, Timothy J.; Horsfield, Andrew P.; Skinner, Stephen J.

    2016-01-01

    CeNbO is reported to exhibit fast oxygen ion diffusion at moderate temperatures, making this the prototype of a new class of ion conductor with applications in a range of energy generation and storage devices. To date, the mechanism by which this ion transport is achieved has remained obscure, in part due to the long-range commensurately modulated structural motif. Here we show that CeNbO forms with a unit cell 12 times larger than the stoichiometric tetragonal parent phase of CeNbO as a result of the helical ordering of Ce and Ce ions along z. Interstitial oxygen ion incorporation leads to a cooperative displacement of the surrounding oxygen species, creating interlayer NbO connectivity by extending the oxygen coordination number to 7 and 8. Molecular dynamic simulations suggest that fast ion migration occurs predominantly within the xz plane. It is concluded that the oxide ion diffuses anisotropically, with the major migration mechanism being intralayer; however, when obstructed, oxygen can readily move to an adjacent layer along y via alternate lower energy barrier pathways.

  13. Diffusion-weighted MR imaging of intracranial tumors

    International Nuclear Information System (INIS)

    Bydder, G.M.; Baudouin, C.J.; Steiner, R.E.; Hajnal, J.V.; Young, I.R.

    1991-01-01

    This paper assesses the effect of anisotropic diffusion weighting on the appearances of cerebral tumors as well as vasogenic and interstitial edema. Diffusion weighting produced a reduction in signal intensity in all or part of the tumors in the majority of cases. However, a relative increase in signal intensity was apparent in four cases. The decrease in signal intensity in vasogenic edema depended on the site and direction of gradient sensitization. Marked increase in conspicuity between tumor and edema was apparent in three cases. Changes in interstitial edema depended in detail in fiber direction. Differentiation between tumor and edema can be improved with diffusion-weighted imaging. Anisotropic change is seen in both vasogenic and interstitial edema

  14. Quark–gluon plasma phenomenology from anisotropic lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Skullerud, Jon-Ivar; Kelly, Aoife [Department of Mathematical Physics, Maynooth University, Maynooth, Co Kildare (Ireland); Aarts, Gert; Allton, Chris; Amato, Alessandro; Evans, P. Wynne M.; Hands, Simon [Department of Physics, Swansea University, Swansea SA2 8PP, Wales (United Kingdom); Burnier, Yannis [Institut de Théorie des Phénomènes Physiques, Ecole Polytechnique Fédérale de Lausanne, CH–1015 Lausanne (Switzerland); Giudice, Pietro [Institut für Theoretische Physik, Universität Münster, D–48149 Münster (Germany); Harris, Tim; Ryan, Sinéad M. [School of Mathematics, Trinity College, Dublin 2 (Ireland); Kim, Seyong [Department of Physics, Sejong University, Seoul 143-747 (Korea, Republic of); Lombardo, Maria Paola [INFN–Laboratori Nazionali di Frascati, I–00044 Frascati (RM) (Italy); Oktay, Mehmet B. [Department of Physics and Astronomy, University of Iowa, Iowa City, Iowa 52242 (United States); Rothkopf, Alexander [Institut für Theoretische Physik, Universität Heidelberg, Philosophenweg 16, D–69120 Heidelberg (Germany)

    2016-01-22

    The FASTSUM collaboration has been carrying out simulations of N{sub f} = 2 + 1 QCD at nonzero temperature in the fixed-scale approach using anisotropic lattices. Here we present the status of these studies, including recent results for electrical conductivity and charge diffusion, and heavy quarkonium (charm and beauty) physics.

  15. Anisotropic diffusion of 51Cr in Zr-α monocrystals

    International Nuclear Information System (INIS)

    Varela, N.; Balart, S.; Tendler, R.

    1983-01-01

    The volume diffusion coefficients of the fast-diffusing solute 51 Cr were obtained in oriented α-Zr single-crystals, in the directions parallel and perpendicular to the c axis. The dependence of those diffusion coefficients with temperature was also measured between 750 0 C and 848 0 C. Single-crystals were grown by thermal cycling through the transformation α β (863 0 C). Diffusion coefficients were measured using the 'thin film' method. In some experiments non-gaussian penetration profiles were obtained and this behaviour is analyzed in the Appendix. The diffusion of 51 Cr is faster in the c axis direction, with Q sub(//) (1.59 eV) [pt

  16. Domain decomposition methods for the neutron diffusion problem

    International Nuclear Information System (INIS)

    Guerin, P.; Baudron, A. M.; Lautard, J. J.

    2010-01-01

    The neutronic simulation of a nuclear reactor core is performed using the neutron transport equation, and leads to an eigenvalue problem in the steady-state case. Among the deterministic resolution methods, simplified transport (SPN) or diffusion approximations are often used. The MINOS solver developed at CEA Saclay uses a mixed dual finite element method for the resolution of these problems. and has shown his efficiency. In order to take into account the heterogeneities of the geometry, a very fine mesh is generally required, and leads to expensive calculations for industrial applications. In order to take advantage of parallel computers, and to reduce the computing time and the local memory requirement, we propose here two domain decomposition methods based on the MINOS solver. The first approach is a component mode synthesis method on overlapping sub-domains: several Eigenmodes solutions of a local problem on each sub-domain are taken as basis functions used for the resolution of the global problem on the whole domain. The second approach is an iterative method based on a non-overlapping domain decomposition with Robin interface conditions. At each iteration, we solve the problem on each sub-domain with the interface conditions given by the solutions on the adjacent sub-domains estimated at the previous iteration. Numerical results on parallel computers are presented for the diffusion model on realistic 2D and 3D cores. (authors)

  17. A multilevel in space and energy solver for multigroup diffusion eigenvalue problems

    Directory of Open Access Journals (Sweden)

    Ben C. Yee

    2017-09-01

    Full Text Available In this paper, we present a new multilevel in space and energy diffusion (MSED method for solving multigroup diffusion eigenvalue problems. The MSED method can be described as a PI scheme with three additional features: (1 a grey (one-group diffusion equation used to efficiently converge the fission source and eigenvalue, (2 a space-dependent Wielandt shift technique used to reduce the number of PIs required, and (3 a multigrid-in-space linear solver for the linear solves required by each PI step. In MSED, the convergence of the solution of the multigroup diffusion eigenvalue problem is accelerated by performing work on lower-order equations with only one group and/or coarser spatial grids. Results from several Fourier analyses and a one-dimensional test code are provided to verify the efficiency of the MSED method and to justify the incorporation of the grey diffusion equation and the multigrid linear solver. These results highlight the potential efficiency of the MSED method as a solver for multidimensional multigroup diffusion eigenvalue problems, and they serve as a proof of principle for future work. Our ultimate goal is to implement the MSED method as an efficient solver for the two-dimensional/three-dimensional coarse mesh finite difference diffusion system in the Michigan parallel characteristics transport code. The work in this paper represents a necessary step towards that goal.

  18. On the radiative transfer problem in a spherical medium subject to Fresnel's reflective boundary conditions

    International Nuclear Information System (INIS)

    Mohammed, M.H.H.

    2012-01-01

    Radiation transfer problem for anisotropic scattering in a spherical homogeneous, turbid medium with angular dependent (specular) and diffuse reflecting boundary is considered. The angular dependent reflectivity of the boundary is considered as Fresnel's reflection probability function. The solution of the problem containing an energy source in a medium of specular and diffuse reflecting boundaries is given in terms of the solution of the source-free problem. The source-free problem for anisotropic scattering through a homogeneous solid sphere and two concentric spheres is solved by using the Pomraning- Eddington approximation method. This method transform the integro-differential equation into two differential equations for the radiance g (x) and net flux q (x) which has an analytical solution in terms of the modified Bessel function. Two different weight functions are used to verify the boundary conditions and so, find the solution constants. The partial heat fluxes at the boundaries of a solid sphere and spherical shell of transparent and reflecting boundaries are calculated. The media are taken with or without internal black-body radiation. The calculations are carried out for various values of refractive index and different radii. The results are compared with those of the Galerkin technique

  19. Recent advances in computational-analytical integral transforms for convection-diffusion problems

    Science.gov (United States)

    Cotta, R. M.; Naveira-Cotta, C. P.; Knupp, D. C.; Zotin, J. L. Z.; Pontes, P. C.; Almeida, A. P.

    2017-10-01

    An unifying overview of the Generalized Integral Transform Technique (GITT) as a computational-analytical approach for solving convection-diffusion problems is presented. This work is aimed at bringing together some of the most recent developments on both accuracy and convergence improvements on this well-established hybrid numerical-analytical methodology for partial differential equations. Special emphasis is given to novel algorithm implementations, all directly connected to enhancing the eigenfunction expansion basis, such as a single domain reformulation strategy for handling complex geometries, an integral balance scheme in dealing with multiscale problems, the adoption of convective eigenvalue problems in formulations with significant convection effects, and the direct integral transformation of nonlinear convection-diffusion problems based on nonlinear eigenvalue problems. Then, selected examples are presented that illustrate the improvement achieved in each class of extension, in terms of convergence acceleration and accuracy gain, which are related to conjugated heat transfer in complex or multiscale microchannel-substrate geometries, multidimensional Burgers equation model, and diffusive metal extraction through polymeric hollow fiber membranes. Numerical results are reported for each application and, where appropriate, critically compared against the traditional GITT scheme without convergence enhancement schemes and commercial or dedicated purely numerical approaches.

  20. A new analytical solution to the diffusion problem: Fourier series ...

    African Journals Online (AJOL)

    This paper reviews briefly the origin of Fourier Series Method. The paper then gives a vivid description of how the method can be applied to solve a diffusion problem, subject to some boundary conditions. The result obtained is quite appealing as it can be used to solve similar examples of diffusion equations. JONAMP Vol.

  1. An introduction to visualization of diffusion tensor imaging and its applications

    NARCIS (Netherlands)

    Vilanova, A.; Zhang, S.; Kindlmann, G.; Laidlaw, D.H.; Weickert, J.; Hagen, H.

    2005-01-01

    Summary. Water diffusion is anisotropic in organized tissues such as white matter and muscle. Diffusion tensor imaging (DTI), a non-invasive MR technique, measures water self-diffusion rates and thus gives an indication of the underlying tissue microstructure. The diffusion rate is often expressed

  2. Transient electromagnetic scattering on anisotropic media

    International Nuclear Information System (INIS)

    Stewart, R.D.

    1990-01-01

    This dissertation treats the problem of transient scattering of obliquely incident electromagnetic plane waves on a stratified anisotropic dielectric slab. Scattering operators are derived for the reflective response of the medium. The internal fields are calculated. Wave splitting and invariant imbedding techniques are used. These techniques are first presented for fields normally incident on a stratified, isotropic dielectric medium. The techniques of wave splitting and invariant imbedding are applied to normally incident plane waves on an anisotropic medium. An integro-differential equation is derived for the reflective response and the direct and inverse scattering problems are discussed. These techniques are applied to the case of obliquely incident plane waves. The reflective response is derived and the direct and inverse problems discussed and compared to those for the normal incidence case. The internal fields are investigated for the oblique incidence via a Green's function approach. A numerical scheme is presented to calculate the Green's function. Finally, symmetry relations of the reflective response are discussed

  3. Remarks on the relativistic magnetohydrodynamics of an anisotropic fluid

    International Nuclear Information System (INIS)

    Ignat, M.

    1980-01-01

    Considering a pressure tensor of a general form, a relativistic rarefied, anisotropic, infinite electrically conducting and nondissipative plasma is studied. For this purpose, the method of the orthonormal frame of reference is used. The choice of the frame of reference is made adequately to the problem. Some thermodynamical properties of such a relativistic, anisotropic plasma are also given. (author)

  4. A resistor interpretation of general anisotropic cardiac tissue.

    Science.gov (United States)

    Shao, Hai; Sampson, Kevin J; Pormann, John B; Rose, Donald J; Henriquez, Craig S

    2004-02-01

    This paper describes a spatial discretization scheme for partial differential equation systems that contain anisotropic diffusion. The discretization method uses unstructured finite volumes, or the boxes, that are formed as a secondary geometric structure from an underlying triangular mesh. We show how the discretization can be interpreted as a resistive circuit network, where each resistor is assigned at each edge of the triangular element. The resistor is computed as an anisotropy dependent geometric quantity of the local mesh structure. Finally, we show that under certain conditions, the discretization gives rise to negative resistors that can produce non-physical hyperpolarizations near depolarizing stimuli. We discuss how the proper choice of triangulation (anisotropic Delaunay triangulation) can ensure monotonicity (i.e. all resistors are positive).

  5. Diffusion tensor analysis with nuclear magnetic resonance in human central nervous system

    International Nuclear Information System (INIS)

    Nakayama, Naoki

    1998-01-01

    Nuclear magnetic resonance has been used to measure the diffusivity of water molecules. In central nervous system, anisotropic diffusion, which is characterized by apparent diffusion tensor D app ξ , is thought to be related to neuronal fiber tract orientation. For precise observation of anisotropic diffusion, it is needed to determine the diagonal and off-diagonal elements of D app ξ . Once D app ξ is estimated from a series of diffusion weighted images, a tissue's orthotropic principal axes and diffusivity of each direction are determined from eigenvalues and eigenvectors of D app ξ . There are several methods to represent anisotropic diffusion with D app ξ . Examples are diffusion ellipsoids constructed in each voxel depicting both these principal axes and the mean diffusion length in these directions, trace invariant values and its mapping image, largest eigenvalue, and ratio of largest eigenvalue to the other eigenvalue. In this study, the author investigated practical procedure to analyze diffusion tensor D app ξ using both of spin-echo end echo-planer diffusion weighted imagings with 3-tesla magnetic resonance machine in human brain. The ellipsoid representation provided particularly useful information about microanatomy including neuronal fiber tract orientation and molecular mobility reflective of microstructure. Furthermore, in the lesion of Wallerian degeneration, the loss of anisotropy of local apparent diffusion was observed. It is suggested that the function of axons can be observed via degree of anisotropy of apparent diffusion. Consequently, diffusion tensor analysis is expected to be a powerful, noninvasive method capable of quantitative and functional evaluation of the central nervous system. (author)

  6. Tokamak plasma equilibrium problems with anisotropic pressure and rotation and their numerical solution

    International Nuclear Information System (INIS)

    Ivanov, A. A.; Martynov, A. A.; Medvedev, S. Yu.; Poshekhonov, Yu. Yu.

    2015-01-01

    In the MHD tokamak plasma theory, the plasma pressure is usually assumed to be isotropic. However, plasma heating by neutral beam injection and RF heating can lead to a strong anisotropy of plasma parameters and rotation of the plasma. The development of MHD equilibrium theory taking into account the plasma inertia and anisotropic pressure began a long time ago, but until now it has not been consistently applied in computational codes for engineering calculations of the plasma equilibrium and evolution in tokamak. This paper contains a detailed derivation of the axisymmetric plasma equilibrium equation in the most general form (with arbitrary rotation and anisotropic pressure) and description of the specialized version of the SPIDER code. The original method of calculation of the equilibrium with an anisotropic pressure and a prescribed rotational transform profile is proposed. Examples of calculations and discussion of the results are also presented

  7. A balancing domain decomposition method by constraints for advection-diffusion problems

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Xuemin; Li, Jing

    2008-12-10

    The balancing domain decomposition methods by constraints are extended to solving nonsymmetric, positive definite linear systems resulting from the finite element discretization of advection-diffusion equations. A pre-conditioned GMRES iteration is used to solve a Schur complement system of equations for the subdomain interface variables. In the preconditioning step of each iteration, a partially sub-assembled finite element problem is solved. A convergence rate estimate for the GMRES iteration is established, under the condition that the diameters of subdomains are small enough. It is independent of the number of subdomains and grows only slowly with the subdomain problem size. Numerical experiments for several two-dimensional advection-diffusion problems illustrate the fast convergence of the proposed algorithm.

  8. Fast solution of neutron diffusion problem by reduced basis finite element method

    International Nuclear Information System (INIS)

    Chunyu, Zhang; Gong, Chen

    2018-01-01

    Highlights: •An extremely efficient method is proposed to solve the neutron diffusion equation with varying the cross sections. •Three orders of speedup is achieved for IAEA benchmark problems. •The method may open a new possibility of efficient high-fidelity modeling of large scale problems in nuclear engineering. -- Abstract: For the important applications which need carry out many times of neutron diffusion calculations such as the fuel depletion analysis and the neutronics-thermohydraulics coupling analysis, fast and accurate solutions of the neutron diffusion equation are demanding but necessary. In the present work, the certified reduced basis finite element method is proposed and implemented to solve the generalized eigenvalue problems of neutron diffusion with variable cross sections. The order reduced model is built upon high-fidelity finite element approximations during the offline stage. During the online stage, both the k eff and the spatical distribution of neutron flux can be obtained very efficiently for any given set of cross sections. Numerical tests show that a speedup of around 1100 is achieved for the IAEA two-dimensional PWR benchmark problem and a speedup of around 3400 is achieved for the three-dimensional counterpart with the fission cross-sections, the absorption cross-sections and the scattering cross-sections treated as parameters.

  9. Shape functions for separable solutions to cross-field diffusion problems

    International Nuclear Information System (INIS)

    Luning, C.D.; Perry, W.L.

    1984-01-01

    The shape function S(x), which arises in the study of nonlinear diffusion for cross-field diffusion in plasmas, satisfies the equation S''(x)+lambdaa(x)S/sup α/(x) = 0, 0 0. In the cases of physical interest a(x) possesses an integrable singularity at some point in (0,1) but is otherwise continuous. Existence of a positive solution to this problem is established

  10. Analytical and numerical investigation of double diffusion in thermally anisotropy multilayer porous medium

    Energy Technology Data Exchange (ETDEWEB)

    Bennacer, R. [Neuville sur Oise, LEEVAM 5 mail Gay Lussac, Cergy-Pontoise Cedex (France); Mohamad, A.A. [CEERE University of Calgary, Department of Mechanical and Manufacturing Engineering, Calgary, Alberta (Canada); Ganaoui, M.El [Faculte des Sciences et Techniques de Limoges, Limoges (France)

    2005-02-01

    Double-diffusive natural convection within a multilayer anisotropic porous medium is studied numerically and analytically. The domain composed of two horizontal porous layers is subjected to a uniform horizontal heat flux and a vertical mass flux, where only the lower one is thermally anisotropic. Darcy model with classical Boussinesq approximation is used in formulating the mathematical model. The effect of thermal anisotropy and the relative width of the two layers on the flow and transfers is illustrated with characterising the transitions from the diffusive to the convective solution. Results were well compared with respect to a developed analytical approach, based on a parallel flow approximation for thermally anisotropic multilayer media. (orig.)

  11. Neutron transport in two dissimilar media anisotropic scattering

    International Nuclear Information System (INIS)

    Burkart, A.R.; Ishiguro, Y.; Siewert, C.E.

    1976-01-01

    The elementary solution of the one-speed neutron-transport equation with linearly anisotropic scattering are used in conjunction with Chandrasekhar's invariance principles to solve in a concise manner the Milne problem for two adjoining half-spaces and the critical reactor problem for a reflected slab

  12. Anisotropic Conductivity Tensor Imaging of In Vivo Canine Brain Using DT-MREIT.

    Science.gov (United States)

    Jeong, Woo Chul; Sajib, Saurav Z K; Katoch, Nitish; Kim, Hyung Joong; Kwon, Oh In; Woo, Eung Je

    2017-01-01

    We present in vivo images of anisotropic electrical conductivity tensor distributions inside canine brains using diffusion tensor magnetic resonance electrical impedance tomography (DT-MREIT). The conductivity tensor is represented as a product of an ion mobility tensor and a scale factor of ion concentrations. Incorporating directional mobility information from water diffusion tensors, we developed a stable process to reconstruct anisotropic conductivity tensor images from measured magnetic flux density data using an MRI scanner. Devising a new image reconstruction algorithm, we reconstructed anisotropic conductivity tensor images of two canine brains with a pixel size of 1.25 mm. Though the reconstructed conductivity values matched well in general with those measured by using invasive probing methods, there were some discrepancies as well. The degree of white matter anisotropy was 2 to 4.5, which is smaller than previous findings of 5 to 10. The reconstructed conductivity value of the cerebrospinal fluid was about 1.3 S/m, which is smaller than previous measurements of about 1.8 S/m. Future studies of in vivo imaging experiments with disease models should follow this initial trial to validate clinical significance of DT-MREIT as a new diagnostic imaging modality. Applications in modeling and simulation studies of bioelectromagnetic phenomena including source imaging and electrical stimulation are also promising.

  13. Anisotropic magnetotelluric inversion using a mutual information constraint

    Science.gov (United States)

    Mandolesi, E.; Jones, A. G.

    2012-12-01

    In recent years, several authors pointed that the electrical conductivity of many subsurface structures cannot be described properly by a scalar field. With the development of field devices and techniques, data quality improved to the point that the anisotropy in conductivity of rocks (microscopic anisotropy) and tectonic structures (macroscopic anisotropy) cannot be neglected. Therefore a correct use of high quality data has to include electrical anisotropy and a correct interpretation of anisotropic data characterizes directly a non-negligible part of the subsurface. In this work we test an inversion routine that takes advantage of the classic Levenberg-Marquardt (LM) algorithm to invert magnetotelluric (MT) data generated from a bi-dimensional (2D) anisotropic domain. The LM method is routinely used in inverse problems due its performance and robustness. In non-linear inverse problems -such the MT problem- the LM method provides a spectacular compromise betwee quick and secure convergence at the price of the explicit computation and storage of the sensitivity matrix. Regularization in inverse MT problems has been used extensively, due to the necessity to constrain model space and to reduce the ill-posedness of the anisotropic MT problem, which makes MT inversions extremely challenging. In order to reduce non-uniqueness of the MT problem and to reach a model compatible with other different tomographic results from the same target region, we used a mutual information (MI) based constraint. MI is a basic quantity in information theory that can be used to define a metric between images, and it is routinely used in fields as computer vision, image registration and medical tomography, to cite some applications. We -thus- inverted for the model that best fits the anisotropic data and that is the closest -in a MI sense- to a tomographic model of the target area. The advantage of this technique is that the tomographic model of the studied region may be produced by any

  14. Determination of oxygen effective diffusivity in porous gas diffusion layer using a three-dimensional pore network model

    International Nuclear Information System (INIS)

    Wu Rui; Zhu Xun; Liao Qiang; Wang Hong; Ding Yudong; Li Jun; Ye Dingding

    2010-01-01

    In proton exchange membrane fuel cell (PEMFC) models, oxygen effective diffusivity is the most important parameter to characterize the oxygen transport in the gas diffusion layer (GDL). However, its determination is a challenge due to its complex dependency on GDL structure. In the present study, a three-dimensional network consisting of spherical pores and cylindrical throats is developed and used to investigate the effects of GDL structural parameters on oxygen effective diffusivity under the condition with/without water invasion process. Oxygen transport in the throat is described by Fick's law and water invasion process in the network is simulated using the invasion percolation with trapping algorithm. The simulation results reveal that oxygen effective diffusivity is slightly affected by network size but increases with decreasing the network heterogeneity and with increasing the pore connectivity. Impacts of network anisotropy on oxygen transport are also investigated in this paper. The anisotropic network is constructed by constricting the throats in the through-plane direction with a constriction factor. It is found that water invasion has a more severe negative influence on oxygen transport in an anisotropic network. Finally, two new correlations are introduced to determine the oxygen effective diffusivity for the Toray carbon paper GDLs.

  15. Computational Study of Subdural Cortical Stimulation: Effects of Simulating Anisotropic Conductivity on Activation of Cortical Neurons.

    Directory of Open Access Journals (Sweden)

    Hyeon Seo

    Full Text Available Subdural cortical stimulation (SuCS is an appealing method in the treatment of neurological disorders, and computational modeling studies of SuCS have been applied to determine the optimal design for electrotherapy. To achieve a better understanding of computational modeling on the stimulation effects of SuCS, the influence of anisotropic white matter conductivity on the activation of cortical neurons was investigated in a realistic head model. In this paper, we constructed pyramidal neuronal models (layers 3 and 5 that showed primary excitation of the corticospinal tract, and an anatomically realistic head model reflecting complex brain geometry. The anisotropic information was acquired from diffusion tensor magnetic resonance imaging (DT-MRI and then applied to the white matter at various ratios of anisotropic conductivity. First, we compared the isotropic and anisotropic models; compared to the isotropic model, the anisotropic model showed that neurons were activated in the deeper bank during cathodal stimulation and in the wider crown during anodal stimulation. Second, several popular anisotropic principles were adapted to investigate the effects of variations in anisotropic information. We observed that excitation thresholds varied with anisotropic principles, especially with anodal stimulation. Overall, incorporating anisotropic conductivity into the anatomically realistic head model is critical for accurate estimation of neuronal responses; however, caution should be used in the selection of anisotropic information.

  16. The Cn method applied to problems with an anisotropic diffusion law

    International Nuclear Information System (INIS)

    Grandjean, P.M.

    A 2-dimensional Cn calculation has been applied to homogeneous media subjected to the Rayleigh impact law. Results obtained with collision probabilities and Chandrasekhar calculations are compared to those from Cn method. Introducing in the expression of the transport equation, an expansion truncated on a polynomial basis for the outgoing angular flux (or possibly entrance flux) gives two Cn systems of algebraic linear equations for the expansion coefficients. The matrix elements of these equations are the moments of the Green function in infinite medium. The search for the Green function is effected through the Fourier transformation of the integrodifferential equation and its moments are derived from their Fourier transforms through a numerical integration in the complex plane. The method has been used for calculating the albedo in semi-infinite media, the extrapolation length of the Milne problem, and the albedo and transmission factor of a slab (a concise study of convergence is presented). A system of integro-differential equations bearing on the moments of the angular flux inside the medium has been derived, for the collision probability method. It is numerically solved with approximately the bulk flux by step functions. The albedo in semi-infinite medium has also been computed through the semi-analytical Chandrasekhar method. In the latter, the outgoing flux is expressed as a function of the entrance flux by means of a integral whose kernel is numerically derived [fr

  17. Anisotropic ray trace

    Science.gov (United States)

    Lam, Wai Sze Tiffany

    Optical components made of anisotropic materials, such as crystal polarizers and crystal waveplates, are widely used in many complex optical system, such as display systems, microlithography, biomedical imaging and many other optical systems, and induce more complex aberrations than optical components made of isotropic materials. The goal of this dissertation is to accurately simulate the performance of optical systems with anisotropic materials using polarization ray trace. This work extends the polarization ray tracing calculus to incorporate ray tracing through anisotropic materials, including uniaxial, biaxial and optically active materials. The 3D polarization ray tracing calculus is an invaluable tool for analyzing polarization properties of an optical system. The 3x3 polarization ray tracing P matrix developed for anisotropic ray trace assists tracking the 3D polarization transformations along a ray path with series of surfaces in an optical system. To better represent the anisotropic light-matter interactions, the definition of the P matrix is generalized to incorporate not only the polarization change at a refraction/reflection interface, but also the induced optical phase accumulation as light propagates through the anisotropic medium. This enables realistic modeling of crystalline polarization elements, such as crystal waveplates and crystal polarizers. The wavefront and polarization aberrations of these anisotropic components are more complex than those of isotropic optical components and can be evaluated from the resultant P matrix for each eigen-wavefront as well as for the overall image. One incident ray refracting or reflecting into an anisotropic medium produces two eigenpolarizations or eigenmodes propagating in different directions. The associated ray parameters of these modes necessary for the anisotropic ray trace are described in Chapter 2. The algorithms to calculate the P matrix from these ray parameters are described in Chapter 3 for

  18. Numerical approach to the inverse convection-diffusion problem

    International Nuclear Information System (INIS)

    Yang, X-H; She, D-X; Li, J-Q

    2008-01-01

    In this paper, the inverse problem on source term identification in convection-diffusion equation is transformed into an optimization problem. To reduce the computational cost and improve computational accuracy for the optimization problem, a new algorithm, chaos real-coded hybrid-accelerating evolution algorithm (CRHAEA), is proposed, in which an initial population is generated by chaos mapping, and new chaos mutation and simplex evolution operation are used. With the shrinking of searching range, CRHAEA gradually directs to an optimal result with the excellent individuals obtained by real-coded evolution algorithm. Its convergence is analyzed. Its efficiency is demonstrated by 15 test functions. Numerical simulation shows that CRHAEA has some advantages over the real-coded accelerated evolution algorithm, the chaos algorithm and the pure random search algorithm

  19. 3-D direct current resistivity anisotropic modelling by goal-oriented adaptive finite element methods

    Science.gov (United States)

    Ren, Zhengyong; Qiu, Lewen; Tang, Jingtian; Wu, Xiaoping; Xiao, Xiao; Zhou, Zilong

    2018-01-01

    Although accurate numerical solvers for 3-D direct current (DC) isotropic resistivity models are current available even for complicated models with topography, reliable numerical solvers for the anisotropic case are still an open question. This study aims to develop a novel and optimal numerical solver for accurately calculating the DC potentials for complicated models with arbitrary anisotropic conductivity structures in the Earth. First, a secondary potential boundary value problem is derived by considering the topography and the anisotropic conductivity. Then, two a posteriori error estimators with one using the gradient-recovery technique and one measuring the discontinuity of the normal component of current density are developed for the anisotropic cases. Combing the goal-oriented and non-goal-oriented mesh refinements and these two error estimators, four different solving strategies are developed for complicated DC anisotropic forward modelling problems. A synthetic anisotropic two-layer model with analytic solutions verified the accuracy of our algorithms. A half-space model with a buried anisotropic cube and a mountain-valley model are adopted to test the convergence rates of these four solving strategies. We found that the error estimator based on the discontinuity of current density shows better performance than the gradient-recovery based a posteriori error estimator for anisotropic models with conductivity contrasts. Both error estimators working together with goal-oriented concepts can offer optimal mesh density distributions and highly accurate solutions.

  20. Anisotropic Interactions between Cold Rydberg Atoms

    Science.gov (United States)

    2015-09-28

    AFRL-AFOSR-CL-TR-2015-0002 Anisotropic interactions between cold Rydberg atoms Luis Marcassa INSTITUTO DE FISICA DE SAO CARLOS Final Report 09/28...problem with the report +551633739806 Organization / Institution name Instituto de Fisica de Sao Carlos Grant/Contract Title The full title of the

  1. Data of NODDI diffusion metrics in the brain and computer simulation of hybrid diffusion imaging (HYDI acquisition scheme

    Directory of Open Access Journals (Sweden)

    Chandana Kodiweera

    2016-06-01

    Full Text Available This article provides NODDI diffusion metrics in the brains of 52 healthy participants and computer simulation data to support compatibility of hybrid diffusion imaging (HYDI, “Hybrid diffusion imaging” [1] acquisition scheme in fitting neurite orientation dispersion and density imaging (NODDI model, “NODDI: practical in vivo neurite orientation dispersion and density imaging of the human brain” [2]. HYDI is an extremely versatile diffusion magnetic resonance imaging (dMRI technique that enables various analyzes methods using a single diffusion dataset. One of the diffusion data analysis methods is the NODDI computation, which models the brain tissue with three compartments: fast isotropic diffusion (e.g., cerebrospinal fluid, anisotropic hindered diffusion (e.g., extracellular space, and anisotropic restricted diffusion (e.g., intracellular space. The NODDI model produces microstructural metrics in the developing brain, aging brain or human brain with neurologic disorders. The first dataset provided here are the means and standard deviations of NODDI metrics in 48 white matter region-of-interest (ROI averaging across 52 healthy participants. The second dataset provided here is the computer simulation with initial conditions guided by the first dataset as inputs and gold standard for model fitting. The computer simulation data provide a direct comparison of NODDI indices computed from the HYDI acquisition [1] to the NODDI indices computed from the originally proposed acquisition [2]. These data are related to the accompanying research article “Age Effects and Sex Differences in Human Brain White Matter of Young to Middle-Aged Adults: A DTI, NODDI, and q-Space Study” [3].

  2. Total variation regularization for a backward time-fractional diffusion problem

    International Nuclear Information System (INIS)

    Wang, Liyan; Liu, Jijun

    2013-01-01

    Consider a two-dimensional backward problem for a time-fractional diffusion process, which can be considered as image de-blurring where the blurring process is assumed to be slow diffusion. In order to avoid the over-smoothing effect for object image with edges and to construct a fast reconstruction scheme, the total variation regularizing term and the data residual error in the frequency domain are coupled to construct the cost functional. The well posedness of this optimization problem is studied. The minimizer is sought approximately using the iteration process for a series of optimization problems with Bregman distance as a penalty term. This iteration reconstruction scheme is essentially a new regularizing scheme with coupling parameter in the cost functional and the iteration stopping times as two regularizing parameters. We give the choice strategy for the regularizing parameters in terms of the noise level of measurement data, which yields the optimal error estimate on the iterative solution. The series optimization problems are solved by alternative iteration with explicit exact solution and therefore the amount of computation is much weakened. Numerical implementations are given to support our theoretical analysis on the convergence rate and to show the significant reconstruction improvements. (paper)

  3. Two-dimensional boundary-value problem for ion-ion diffusion

    International Nuclear Information System (INIS)

    Tuszewski, M.; Lichtenberg, A.J.

    1977-01-01

    Like-particle diffusion is usually negligible compared with unlike-particle diffusion because it is two orders higher in spatial derivatives. When the ratio of the ion gyroradius to the plasma transverse dimension is of the order of the fourth root of the mass ratio, previous one-dimensional analysis indicated that like-particle diffusion is significant. A two-dimensional boundary-value problem for ion-ion diffusion is investigated. Numerical solutions are found with models for which the nonlinear partial differential equation reduces to an ordinary fourth-order differential equation. These solutions indicate that the ion-ion losses are higher by a factor of six for a slab geometry, and by a factor of four for circular geometry, than estimated from dimensional analysis. The solutions are applied to a multiple mirror experiment stabilized with a quadrupole magnetic field which generates highly elliptical flux surfaces. It is found that the ion-ion losses dominate the electron-ion losses and that these classical radial losses contribute to a significant decrease of plasma lifetime, in qualitiative agreement with the experimental results

  4. P-wave ray velocities and the inverse acoustic problem for anisotropic media

    Czech Academy of Sciences Publication Activity Database

    Zel, I. Yu.; Ivankina, T. I.; Levin, D.M.; Lokajíček, Tomáš

    2016-01-01

    Roč. 61, č. 4 (2016), s. 633-639 ISSN 1063-7745 Institutional support: RVO:67985831 Keywords : anisotropic media * P-Wawe velocities * elasticity Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.563, year: 2016

  5. 2.5D inversion of CSEM data in a vertically anisotropic earth

    International Nuclear Information System (INIS)

    Ramananjaona, Christophe; MacGregor, Lucy

    2010-01-01

    The marine Controlled-Source Electromagnetic (CSEM) method is a low frequency (diffusive) electromagnetic subsurface imaging technique aimed at mapping the electric resistivity of the earth by measuring the response to a source dipole emitting an electromagnetic field in a marine environment. Although assuming isotropy for the inversion is the most straightforward approach, in many situations horizontal layering of the earth strata and grain alignment within earth materials creates electric anisotropy. Ignoring this during interpretation may create artifacts in the inversion results. Accounting for this effect therefore requires adequate forward modelling and inversion procedures. We present here an inversion algorithm for vertically anisotropic media based on finite element modelling, the use of Frechet derivatives, and different types of regularisation. Comparisons between isotropic and anisotropic inversion results are given for the characterisation of an anisotropic earth from data measured in line with the source dipole for both synthetic and real data examples.

  6. Algebraic collapsing acceleration of the characteristics method with anisotropic scattering

    International Nuclear Information System (INIS)

    Le Tellier, R.; Hebert, A.; Roy, R.

    2004-01-01

    In this paper, the characteristics solvers implemented in the lattice code Dragon are extended to allow a complete anisotropic treatment of the collision operator. An efficient synthetic acceleration method, called Algebraic Collapsing Acceleration (ACA), is presented. Tests show that this method can substantially speed up the convergence of scattering source iterations. The effect of boundary conditions, either specular or white reflections, on anisotropic scattering lattice-cell problems is also considered. (author)

  7. Statics and buckling problems of aircraft structurally-anisotropic composite panels with the influence of production technology

    Science.gov (United States)

    Gavva, L. M.; Endogur, A. I.

    2018-02-01

    The mathematical model relations for stress-strain state and for buckling investigation of structurally-anisotropic panels made of composite materials are presented. The mathematical model of stiffening rib being torsioned under one-side contact with the skin is refined. One takes into account the influence of panel production technology: residual thermal stresses and reinforcing fibers preliminary tension. The resolved eight order equation and natural boundary conditions are obtained with variation Lagrange procedure. Exact analytical solutions for edge problems are considered. Computer program package is developed using operating MATLAB environment. The influence of the structure parameters on the level of stresses, displacements, of critical buckling forces for bending and for torsion modes has analyzed.

  8. First-Order Hyperbolic System Method for Time-Dependent Advection-Diffusion Problems

    Science.gov (United States)

    2014-03-01

    accuracy, with rapid convergence over each physical time step, typically less than five Newton iter - ations. 1 Contents 1 Introduction 3 2 Hyperbolic...however, we employ the Gauss - Seidel (GS) relaxation, which is also an O(N) method for the discretization arising from hyperbolic advection-diffusion system...advection-diffusion scheme. The linear dependency of the iterations on Table 1: Boundary layer problem ( Convergence criteria: Residuals < 10−8.) log10Re

  9. High-coercivity ultrafine-grained anisotropic Nd–Fe–B magnets processed by hot deformation and the Nd–Cu grain boundary diffusion process

    International Nuclear Information System (INIS)

    Sepehri-Amin, H.; Ohkubo, T.; Nagashima, S.; Yano, M.; Shoji, T.; Kato, A.; Schrefl, T.; Hono, K.

    2013-01-01

    The grain boundary diffusion process using an Nd 70 Cu 30 eutectic alloy has been applied to hot-deformed anisotropic Nd–Fe–B magnets, resulting in a substantial enhancement of coercivity, from 1.5 T to 2.3 T, at the expense of remanence. Scanning electron microscopy showed that the areal fraction of an Nd-rich intergranular phase increased from 10% to 37%. The intergranular phase of the hot-deformed magnet initially contained ∼55 at.% ferromagnetic element, while it diminished to an undetectable level after the process. Microscale eutectic solidification of Nd/NdCu as well as a fine lamellae structure of Nd 70 (Co,Cu) 30 /Nd were observed in the intergranular phase. Micromagnetic simulations indicated that the reduction of the magnetization in the intergranular phases leads to the enhancement of coercivity in agreement with the experimental observation

  10. A nodal method applied to a diffusion problem with generalized coefficients

    International Nuclear Information System (INIS)

    Laazizi, A.; Guessous, N.

    1999-01-01

    In this paper, we consider second order neutrons diffusion problem with coefficients in L ∞ (Ω). Nodal method of the lowest order is applied to approximate the problem's solution. The approximation uses special basis functions in which the coefficients appear. The rate of convergence obtained is O(h 2 ) in L 2 (Ω), with a free rectangular triangulation. (authors)

  11. Features of the electric-field distribution in anisotropic semiconductor wafers in a transverse magnetic field

    International Nuclear Information System (INIS)

    Filippov, V. V.; Bormontov, E. N.

    2013-01-01

    A macroscopic model of the Hall effects and magnetoresistance in anisotropic semiconductor wafers is developed. The results obtained by solving the electrodynamic boundary problem allow the potential and eddy currents in anisotropic semiconductors to be calculated at different current-contact locations, depending on the parameters of the sample material’s anisotropy. The results of this study are of great practical importance for investigating the physical properties of anisotropic semiconductors and simulating the electron-transport phenomena in devices based on anisotropic semiconductors

  12. Features of the electric-field distribution in anisotropic semiconductor wafers in a transverse magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Filippov, V. V., E-mail: wwfilippow@mail.ru [Lipetsk State Pedagogical University (Russian Federation); Bormontov, E. N. [Voronezh State University (Russian Federation)

    2013-07-15

    A macroscopic model of the Hall effects and magnetoresistance in anisotropic semiconductor wafers is developed. The results obtained by solving the electrodynamic boundary problem allow the potential and eddy currents in anisotropic semiconductors to be calculated at different current-contact locations, depending on the parameters of the sample material's anisotropy. The results of this study are of great practical importance for investigating the physical properties of anisotropic semiconductors and simulating the electron-transport phenomena in devices based on anisotropic semiconductors.

  13. Interactions, strings and isotopies in higher order anisotropic superspaces

    CERN Document Server

    Vacaru, Sergiu Ion

    2001-01-01

    The monograph summarizes the author's results on the geometry of anholonomic and locally anisotropic interactions, published in J. Math. Phys., Nucl. Phys. B, Ann. Phys. (NY), JHEP, Rep. Math. Phys., Int. J. Theor. Phys. and in some former Soviet Union and Romanian scientific journals. The main subjects are in the theory of field interactions, strings and diffusion processes on spaces, superspaces and isospaces with higher order anisotropy and inhomogeneity. The approach proceeds by developing the concept of higher order anisotropic (super)space which unifies the logical and manthematical aspects of modern Kaluza--Klein theories and generalized Lagrange and Finsler geometry and leads to modeling of physical processes on higher order fiber (super)bundles provided with nonlinear and distinguished connections and metric structures. This book can be also considered as a pedagogical survey on the mentioned subjects.

  14. The problem of birth of autowaves in parabolic systems with small diffusion

    International Nuclear Information System (INIS)

    Kolesov, A Yu; Rozov, N Kh; Sadovnichii, V A

    2007-01-01

    A parabolic reaction-diffusion system with zero Neumann boundary conditions at the end-points of a finite interval is considered under the following basic assumptions. First, the matrix diffusion coefficient in the system is proportional to a small parameter ε>0, and the system itself possesses a spatially homogeneous cycle (independent of the space variable) of amplitude of order √ε born by a zero equilibrium at an Andronov-Hopf bifurcation. Second, it is assumed that the matrix diffusion depends on an additional small parameter μ≥0, and for μ=0 there occurs in the stability problem for the homogeneous cycle the critical case of characteristic multiplier 1 of multiplicity 2 without Jordan block. Under these constraints and for independently varied parameters ε and μ the problem of the existence and the stability of spatially inhomogeneous auto-oscillations branching from the homogeneous cycle is analysed. Bibliography: 16 titles.

  15. Mimetic Discretization of Vector-valued Diffusion Problems

    DEFF Research Database (Denmark)

    Olesen, Kennet

    this is the balance of the change of mass in a finite volume with mass fluxes across the surfaces bounding this volume? In the FDM and FEM the derivatives in the gradient-, curl- and divergence operator are approximated by formulating expressions with respect to a finite number of selected points. The continuous...... gradient-, curl- and divergence operators are derived based on geometrical considerations on finite domains, and by introducing geometry into the numerical scheme these operators can be replicated exactly. To incorporate the geometry into the PDEs the field of differential geometry is applied, which has...... of different dimensions through Stokes' theorem. - A clear separation of balance/equilibrium equations and constitutive equations is possible. As mentioned the emphasis is put on diffusion dominated problems containing second order tensors. Earlier work has developed a rigorous framework for problems involving...

  16. Domain decomposition methods for the mixed dual formulation of the critical neutron diffusion problem; Methodes de decomposition de domaine pour la formulation mixte duale du probleme critique de la diffusion des neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Guerin, P

    2007-12-15

    The neutronic simulation of a nuclear reactor core is performed using the neutron transport equation, and leads to an eigenvalue problem in the steady-state case. Among the deterministic resolution methods, diffusion approximation is often used. For this problem, the MINOS solver based on a mixed dual finite element method has shown his efficiency. In order to take advantage of parallel computers, and to reduce the computing time and the local memory requirement, we propose in this dissertation two domain decomposition methods for the resolution of the mixed dual form of the eigenvalue neutron diffusion problem. The first approach is a component mode synthesis method on overlapping sub-domains. Several Eigenmodes solutions of a local problem solved by MINOS on each sub-domain are taken as basis functions used for the resolution of the global problem on the whole domain. The second approach is a modified iterative Schwarz algorithm based on non-overlapping domain decomposition with Robin interface conditions. At each iteration, the problem is solved on each sub domain by MINOS with the interface conditions deduced from the solutions on the adjacent sub-domains at the previous iteration. The iterations allow the simultaneous convergence of the domain decomposition and the eigenvalue problem. We demonstrate the accuracy and the efficiency in parallel of these two methods with numerical results for the diffusion model on realistic 2- and 3-dimensional cores. (author)

  17. Magnetic resonance temporal diffusion tensor spectroscopy of disordered anisotropic tissue

    DEFF Research Database (Denmark)

    Nielsen, Jonathan Scharff; Dyrby, Tim Bjørn; Lundell, Henrik

    2018-01-01

    of the oscillating gradient spin echo (OGSE) experiment, giving a basic contrast mechanism closely linked to both the temporal diffusion spectrum and the compartment anisotropy. We demonstrate our new method on post mortem brain tissue and show that we retrieve the correct temporal diffusion tensor spectrum...

  18. A 3D finite-difference BiCG iterative solver with the Fourier-Jacobi preconditioner for the anisotropic EIT/EEG forward problem.

    Science.gov (United States)

    Turovets, Sergei; Volkov, Vasily; Zherdetsky, Aleksej; Prakonina, Alena; Malony, Allen D

    2014-01-01

    The Electrical Impedance Tomography (EIT) and electroencephalography (EEG) forward problems in anisotropic inhomogeneous media like the human head belongs to the class of the three-dimensional boundary value problems for elliptic equations with mixed derivatives. We introduce and explore the performance of several new promising numerical techniques, which seem to be more suitable for solving these problems. The proposed numerical schemes combine the fictitious domain approach together with the finite-difference method and the optimally preconditioned Conjugate Gradient- (CG-) type iterative method for treatment of the discrete model. The numerical scheme includes the standard operations of summation and multiplication of sparse matrices and vector, as well as FFT, making it easy to implement and eligible for the effective parallel implementation. Some typical use cases for the EIT/EEG problems are considered demonstrating high efficiency of the proposed numerical technique.

  19. Efficient analysis of macromolecular rotational diffusion from heteronuclear relaxation data

    International Nuclear Information System (INIS)

    Dosset, Patrice; Hus, Jean-Christophe; Blackledge, Martin; Marion, Dominique

    2000-01-01

    A novel program has been developed for the interpretation of 15 N relaxation rates in terms of macromolecular anisotropic rotational diffusion. The program is based on a highly efficient simulated annealing/minimization algorithm, designed specifically to search the parametric space described by the isotropic, axially symmetric and fully anisotropic rotational diffusion tensor models. The high efficiency of this algorithm allows extensive noise-based Monte Carlo error analysis. Relevant statistical tests are systematically applied to provide confidence limits for the proposed tensorial models. The program is illustrated here using the example of the cytochrome c' from Rhodobacter capsulatus, a four-helix bundle heme protein, for which data at three different field strengths were independently analysed and compared

  20. Domain decomposition methods for the mixed dual formulation of the critical neutron diffusion problem

    International Nuclear Information System (INIS)

    Guerin, P.

    2007-12-01

    The neutronic simulation of a nuclear reactor core is performed using the neutron transport equation, and leads to an eigenvalue problem in the steady-state case. Among the deterministic resolution methods, diffusion approximation is often used. For this problem, the MINOS solver based on a mixed dual finite element method has shown his efficiency. In order to take advantage of parallel computers, and to reduce the computing time and the local memory requirement, we propose in this dissertation two domain decomposition methods for the resolution of the mixed dual form of the eigenvalue neutron diffusion problem. The first approach is a component mode synthesis method on overlapping sub-domains. Several Eigenmodes solutions of a local problem solved by MINOS on each sub-domain are taken as basis functions used for the resolution of the global problem on the whole domain. The second approach is a modified iterative Schwarz algorithm based on non-overlapping domain decomposition with Robin interface conditions. At each iteration, the problem is solved on each sub domain by MINOS with the interface conditions deduced from the solutions on the adjacent sub-domains at the previous iteration. The iterations allow the simultaneous convergence of the domain decomposition and the eigenvalue problem. We demonstrate the accuracy and the efficiency in parallel of these two methods with numerical results for the diffusion model on realistic 2- and 3-dimensional cores. (author)

  1. Urban diffusion problems

    International Nuclear Information System (INIS)

    Hanna, S.R.

    1976-01-01

    It is hoped that urban diffusion models of air pollutants can eventually confidently be used to make major decisions, such as in planning the layout of a new industrial park, determining the effects of a new highway on air quality, or estimating the results of a new automobile emissions exhaust system. The urban diffusion model itself should be able to account for point, line, and area sources, and the local aerodynamic effects of street canyons and building wakes. Removal or transformations due to dry or wet deposition and chemical reactions are often important. It would be best if the model included meteorological parameters such as wind speed and temperature as dependent variables, since these parameters vary significantly when air passes from rural surfaces over urban surfaces

  2. Anisotropic transport of microalgae Chlorella vulgaris in microfluidic channel

    International Nuclear Information System (INIS)

    Ishak, Nur Izzati; Muniandy, S V; Periasamy, Vengadesh; Ng, Fong-Lee; Phang, Siew-Moi

    2017-01-01

    In this work, we study the regional dependence of transport behavior of microalgae Chlorella vulgaris inside microfluidic channel on applied fluid flow rate. The microalgae are treated as spherical naturally buoyant particles. Deviation from the normal diffusion or Brownian transport is characterized based on the scaling behavior of the mean square displacement (MSD) of the particle trajectories by resolving the displacements in the streamwise (flow) and perpendicular directions. The channel is divided into three different flow regions, namely center region of the channel and two near-wall boundaries and the particle motions are analyzed at different flow rates. We use the scaled Brownian motion to model the transitional characteristics in the scaling behavior of the MSDs. We find that there exist anisotropic anomalous transports in all the three flow regions with mixed sub-diffusive, normal and super-diffusive behavior in both longitudinal and transverse directions. (paper)

  3. Fourier convergence analysis applied to neutron diffusion Eigenvalue problem

    International Nuclear Information System (INIS)

    Lee, Hyun Chul; Noh, Jae Man; Joo, Hyung Kook

    2004-01-01

    Fourier error analysis has been a standard technique for the stability and convergence analysis of linear and nonlinear iterative methods. Though the methods can be applied to Eigenvalue problems too, all the Fourier convergence analyses have been performed only for fixed source problems and a Fourier convergence analysis for Eigenvalue problem has never been reported. Lee et al proposed new 2-D/1-D coupling methods and they showed that the new ones are unconditionally stable while one of the two existing ones is unstable at a small mesh size and that the new ones are better than the existing ones in terms of the convergence rate. In this paper the convergence of method A in reference 4 for the diffusion Eigenvalue problem was analyzed by the Fourier analysis. The Fourier convergence analysis presented in this paper is the first one applied to a neutronics eigenvalue problem to the best of our knowledge

  4. Newton–Hooke-type symmetry of anisotropic oscillators

    International Nuclear Information System (INIS)

    Zhang, P.M.; Horvathy, P.A.; Andrzejewski, K.; Gonera, J.; Kosiński, P.

    2013-01-01

    Rotation-less Newton–Hooke-type symmetry, found recently in the Hill problem, and instrumental for explaining the center-of-mass decomposition, is generalized to an arbitrary anisotropic oscillator in the plane. Conversely, the latter system is shown, by the orbit method, to be the most general one with such a symmetry. Full Newton–Hooke symmetry is recovered in the isotropic case. Star escape from a galaxy is studied as an application. -- Highlights: ► Rotation-less Newton–Hooke (NH) symmetry is generalized to an arbitrary anisotropic oscillator. ► The orbit method is used to find the most general case for rotation-less NH symmetry. ► The NH symmetry is decomposed into Heisenberg algebras based on chiral decomposition

  5. The accuracy of the diffusion theory component of removal-diffusion theory

    International Nuclear Information System (INIS)

    Donnelly, I.J.

    1976-03-01

    The neutron fluxes in five neutron shields consisting of water, concrete, graphite, iron and an iron-water lattice respectively, have been calculated using P 1 theory, diffusion theory with the usual transport correction for anisotropic scattering (DT), and diffusion theory with a diagonal transport correction (DDT). The calculations have been repeated using transport theory for the flux above 0.5 MeV and the diffusion theories for lower energies. Comparisons with transport theory calculations reveal the accuracy of each diffusion theory when it is used for flux evaluation at all energies, and also its accuracy when used for flux evaluation below 0.5 MeV given the correct flux above 0.5 MeV. It is concluded that the diffusion component of removal-diffusion theory has adequate accuracy unless the high energy diffusion entering the shield is significantly larger than the removal flux. In general, P 1 and DT are more accurate than DDT and give similar fluxes except for shields having a large hydrogen content, in which case DT is better. Therefore it is recommended that DT be used in preference to P 1 theory or DDT. (author)

  6. Anisotropic hydrodynamics for conformal Gubser flow

    Energy Technology Data Exchange (ETDEWEB)

    Strickland, Michael; Nopoush, Mohammad [Kent State University, Kent OH 44242 (United States); Ryblewski, Radoslaw [The H. Niewodniczański Institute of Nuclear Physics, Polish Academy of Sciences, PL-31342 Kraków (Poland)

    2016-12-15

    In this proceedings contribution, we review the exact solution of the anisotropic hydrodynamics equations for a system subject to Gubser flow. For this purpose, we use the leading-order anisotropic hydrodynamics equations which assume that the distribution function is ellipsoidally symmetric in local-rest-frame momentum. We then prove that the SO(3){sub q} symmetry in de Sitter space constrains the anisotropy tensor to be of spheroidal form with only one independent anisotropy parameter remaining. As a consequence, the exact solution reduces to the problem of solving two coupled non-linear differential equations. We show that, in the limit that the relaxation time goes to zero, one obtains Gubser's ideal hydrodynamic solution and, in the limit that the relaxation time goes to infinity, one obtains the exact free streaming solution obtained originally by Denicol et al. For finite relaxation time, we solve the equations numerically and compare to the exact solution of the relaxation-time-approximation Boltzmann equation subject to Gubser flow. Using this as our standard, we find that anisotropic hydrodynamics describes the spatio-temporal evolution of the system better than all currently known dissipative hydrodynamics approaches.

  7. Anisotropic hydrodynamics for conformal Gubser flow

    International Nuclear Information System (INIS)

    Strickland, Michael; Nopoush, Mohammad; Ryblewski, Radoslaw

    2016-01-01

    In this proceedings contribution, we review the exact solution of the anisotropic hydrodynamics equations for a system subject to Gubser flow. For this purpose, we use the leading-order anisotropic hydrodynamics equations which assume that the distribution function is ellipsoidally symmetric in local-rest-frame momentum. We then prove that the SO(3)_q symmetry in de Sitter space constrains the anisotropy tensor to be of spheroidal form with only one independent anisotropy parameter remaining. As a consequence, the exact solution reduces to the problem of solving two coupled non-linear differential equations. We show that, in the limit that the relaxation time goes to zero, one obtains Gubser's ideal hydrodynamic solution and, in the limit that the relaxation time goes to infinity, one obtains the exact free streaming solution obtained originally by Denicol et al. For finite relaxation time, we solve the equations numerically and compare to the exact solution of the relaxation-time-approximation Boltzmann equation subject to Gubser flow. Using this as our standard, we find that anisotropic hydrodynamics describes the spatio-temporal evolution of the system better than all currently known dissipative hydrodynamics approaches.

  8. Variational methods applied to problems of diffusion and reaction

    CERN Document Server

    Strieder, William

    1973-01-01

    This monograph is an account of some problems involving diffusion or diffusion with simultaneous reaction that can be illuminated by the use of variational principles. It was written during a period that included sabbatical leaves of one of us (W. S. ) at the University of Minnesota and the other (R. A. ) at the University of Cambridge and we are grateful to the Petroleum Research Fund for helping to support the former and the Guggenheim Foundation for making possible the latter. We would also like to thank Stephen Prager for getting us together in the first place and for showing how interesting and useful these methods can be. We have also benefitted from correspondence with Dr. A. M. Arthurs of the University of York and from the counsel of Dr. B. D. Coleman the general editor of this series. Table of Contents Chapter 1. Introduction and Preliminaries . 1. 1. General Survey 1 1. 2. Phenomenological Descriptions of Diffusion and Reaction 2 1. 3. Correlation Functions for Random Suspensions 4 1. 4. Mean Free ...

  9. Noise-induced drift in two-dimensional anisotropic systems

    Science.gov (United States)

    Farago, Oded

    2017-10-01

    We study the isothermal Brownian dynamics of a particle in a system with spatially varying diffusivity. Due to the heterogeneity of the system, the particle's mean displacement does not vanish even if it does not experience any physical force. This phenomenon has been termed "noise-induced drift," and has been extensively studied for one-dimensional systems. Here, we examine the noise-induced drift in a two-dimensional anisotropic system, characterized by a symmetric diffusion tensor with unequal diagonal elements. A general expression for the mean displacement vector is derived and presented as a sum of two vectors, depicting two distinct drifting effects. The first vector describes the tendency of the particle to drift toward the high diffusivity side in each orthogonal principal diffusion direction. This is a generalization of the well-known expression for the noise-induced drift in one-dimensional systems. The second vector represents a novel drifting effect, not found in one-dimensional systems, originating from the spatial rotation in the directions of the principal axes. The validity of the derived expressions is verified by using Langevin dynamics simulations. As a specific example, we consider the relative diffusion of two transmembrane proteins, and demonstrate that the average distance between them increases at a surprisingly fast rate of several tens of micrometers per second.

  10. Study on diffusion anisotropy of cerebral ischemia using diffusion weighted echo-planar MRI

    International Nuclear Information System (INIS)

    Kajima, Toshio

    1997-01-01

    Focal cerebral ischemia was produced by occlusion of the intracranial main cerebral artery with a silicone cylinder in Wistar rats. Diffusion-weighted echo-planar images (DW-EPls) using the motion-probing gradient (MPG) method were acquired at 1-3 hours and 24-48 hours after occlusion. Apparent diffusion coefficients (ADCs) were calculated from these images in ischemic lesions and in normal unoccluded regions. Results were as follows. Ischemic lesions could be detected on the DW-EPIs at 1 hour after occlusion. The ADC of water in the brain tissue was smaller than that of free water as a result of restricted diffusion. Anisotropic diffusion that probably can be attributed to the myelin sheath was observed in the normal white matter. In the ischemic lesions, the ADC decreased rapidly within 1-3 hours after occlusion and then decreased gradually after 24-48 hours. In the ischemic white matter, diffusion anisotropy disappeared at 24-48 hours after occlusion. Diffusion-weighted imaging may have applications in the examination of pathophysiological mechanisms in cerebral ischemia by means of evaluation of ADC and diffusion anisotropy. (author)

  11. Performance characteristics of specified power reactors in multidimensional neutron diffusion problems

    International Nuclear Information System (INIS)

    Kim, M.G.

    1980-01-01

    The multigroup neutron diffusion equations with the constraint of specified power distributions are investigated by the application of the straight-line method which can be considered as the limiting case of zero mesh space in the finite difference method. The standard partial differential form of the diffusion equation is reduced to sets of ordinary differential equations and then converted into sets of integral equations by using Green's functions defined on the pseudo straight lines. Coupling of each straight line to the adjacent lines arises from the application of a three-point central difference formula. The interfaces encountered between two regions are taken into account by imposing the continuity conditions for the grown fluxes and net currents with Taylor expansions of internal fluxes at the interface positions. A few sample problems are selected to test the validity of the method. It is found that the proposed method of solution is similar to the finite Fourier sine transform. Numerical results for the solutions obtained by the method of straight lines are compared with the results of the exact analytical solutions for simple geometries. These comparisons indicate that the proposed method is compatible with the analytical method, and in some problems considered the straight-line solutions are much more efficient than the exact solutions. The method is also extended to the reactor kinetics problem by expressing the kinetics parameters in terms of the basis functions which are used to obtain the solutions of the steady-state neutron diffusion equations

  12. Nonlinear reaction-diffusion equations with delay: some theorems, test problems, exact and numerical solutions

    Science.gov (United States)

    Polyanin, A. D.; Sorokin, V. G.

    2017-12-01

    The paper deals with nonlinear reaction-diffusion equations with one or several delays. We formulate theorems that allow constructing exact solutions for some classes of these equations, which depend on several arbitrary functions. Examples of application of these theorems for obtaining new exact solutions in elementary functions are provided. We state basic principles of construction, selection, and use of test problems for nonlinear partial differential equations with delay. Some test problems which can be suitable for estimating accuracy of approximate analytical and numerical methods of solving reaction-diffusion equations with delay are presented. Some examples of numerical solutions of nonlinear test problems with delay are considered.

  13. Generalization of the Fourier Convergence Analysis in the Neutron Diffusion Eigenvalue Problem

    International Nuclear Information System (INIS)

    Lee, Hyun Chul; Noh, Jae Man; Joo, Hyung Kook

    2005-01-01

    Fourier error analysis has been a standard technique for the stability and convergence analysis of linear and nonlinear iterative methods. Lee et al proposed new 2- D/1-D coupling methods and demonstrated several advantages of the new methods by performing a Fourier convergence analysis of the methods as well as two existing methods for a fixed source problem. We demonstrated the Fourier convergence analysis of one of the 2-D/1-D coupling methods applied to a neutron diffusion eigenvalue problem. However, the technique cannot be used directly to analyze the convergence of the other 2-D/1-D coupling methods since some algorithm-specific features were used in our previous study. In this paper we generalized the Fourier convergence analysis technique proposed and analyzed the convergence of the 2-D/1-D coupling methods applied to a neutron diffusion Eigenvalue problem using the generalized technique

  14. Moving-boundary problems for the time-fractional diffusion equation

    Directory of Open Access Journals (Sweden)

    Sabrina D. Roscani

    2017-02-01

    Full Text Available We consider a one-dimensional moving-boundary problem for the time-fractional diffusion equation. The time-fractional derivative of order $\\alpha\\in (0,1$ is taken in the sense of Caputo. We study the asymptotic behaivor, as t tends to infinity, of a general solution by using a fractional weak maximum principle. Also, we give some particular exact solutions in terms of Wright functions.

  15. Diffusion Influenced Adsorption Kinetics.

    Science.gov (United States)

    Miura, Toshiaki; Seki, Kazuhiko

    2015-08-27

    When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

  16. Analytical results for entanglement in the five-qubit anisotropic Heisenberg model

    International Nuclear Information System (INIS)

    Wang Xiaoguang

    2004-01-01

    We solve the eigenvalue problem of the five-qubit anisotropic Heisenberg model, without use of Bethe's ansatz, and give analytical results for entanglement and mixedness of two nearest-neighbor qubits. The entanglement takes its maximum at Δ=1 (Δ>1) for the case of zero (finite) temperature with Δ being the anisotropic parameter. In contrast, the mixedness takes its minimum at Δ=1 (Δ>1) for the case of zero (finite) temperature

  17. The dynamics of nucleation and growth of a particle in the ternary alloy melt with anisotropic surface tension.

    Science.gov (United States)

    Chen, Ming-Wen; Li, Lin-Yan; Guo, Hui-Min

    2017-08-28

    The dynamics of nucleation and growth of a particle affected by anisotropic surface tension in the ternary alloy melt is studied. The uniformly valid asymptotic solution for temperature field, concentration field, and interface evolution of nucleation and particle growth is obtained by means of the multiple variable expansion method. The asymptotic solution reveals the critical radius of nucleation in the ternary alloy melt and an inward melting mechanism of the particle induced by the anisotropic effect of surface tension. The critical radius of nucleation is dependent on isotropic surface tension, temperature undercooling, and constitutional undercooling in the ternary alloy melt, and the solute diffusion melt decreases the critical radius of nucleation. Immediately after a nucleus forms in the initial stage of solidification, the anisotropic effect of surface tension makes some parts of its interface grow inward while some parts grow outward. Until the inward melting attains a certain distance (which is defined as "the melting depth"), these parts of interface start to grow outward with other parts. The interface of the particle evolves into an ear-like deformation, whose inner diameter may be less than two times the critical radius of nucleation within a short time in the initial stage of solidification. The solute diffusion in the ternary alloy melt decreases the effect of anisotropic surface tension on the interface deformation.

  18. Linear finite element method for one-dimensional diffusion problems

    Energy Technology Data Exchange (ETDEWEB)

    Brandao, Michele A.; Dominguez, Dany S.; Iglesias, Susana M., E-mail: micheleabrandao@gmail.com, E-mail: dany@labbi.uesc.br, E-mail: smiglesias@uesc.br [Universidade Estadual de Santa Cruz (LCC/DCET/UESC), Ilheus, BA (Brazil). Departamento de Ciencias Exatas e Tecnologicas. Laboratorio de Computacao Cientifica

    2011-07-01

    We describe in this paper the fundamentals of Linear Finite Element Method (LFEM) applied to one-speed diffusion problems in slab geometry. We present the mathematical formulation to solve eigenvalue and fixed source problems. First, we discretized a calculus domain using a finite set of elements. At this point, we obtain the spatial balance equations for zero order and first order spatial moments inside each element. Then, we introduce the linear auxiliary equations to approximate neutron flux and current inside the element and architect a numerical scheme to obtain the solution. We offer numerical results for fixed source typical model problems to illustrate the method's accuracy for coarse-mesh calculations in homogeneous and heterogeneous domains. Also, we compare the accuracy and computational performance of LFEM formulation with conventional Finite Difference Method (FDM). (author)

  19. ANISOTROPIC THERMAL CONDUCTION AND THE COOLING FLOW PROBLEM IN GALAXY CLUSTERS

    International Nuclear Information System (INIS)

    Parrish, Ian J.; Sharma, Prateek; Quataert, Eliot

    2009-01-01

    We examine the long-standing cooling flow problem in galaxy clusters with three-dimensional magnetohydrodynamics simulations of isolated clusters including radiative cooling and anisotropic thermal conduction along magnetic field lines. The central regions of the intracluster medium (ICM) can have cooling timescales of ∼200 Myr or shorter-in order to prevent a cooling catastrophe the ICM must be heated by some mechanism such as active galactic nucleus feedback or thermal conduction from the thermal reservoir at large radii. The cores of galaxy clusters are linearly unstable to the heat-flux-driven buoyancy instability (HBI), which significantly changes the thermodynamics of the cluster core. The HBI is a convective, buoyancy-driven instability that rearranges the magnetic field to be preferentially perpendicular to the temperature gradient. For a wide range of parameters, our simulations demonstrate that in the presence of the HBI, the effective radial thermal conductivity is reduced to ∼<10% of the full Spitzer conductivity. With this suppression of conductive heating, the cooling catastrophe occurs on a timescale comparable to the central cooling time of the cluster. Thermal conduction alone is thus unlikely to stabilize clusters with low central entropies and short central cooling timescales. High central entropy clusters have sufficiently long cooling times that conduction can help stave off the cooling catastrophe for cosmologically interesting timescales.

  20. Diffusion tensor imaging for nerve fiber bundles in the brain stem and spinocerebellar degeneration

    International Nuclear Information System (INIS)

    Honma, Tsuguo

    2009-01-01

    Diffusion tensor imaging (DTI) can create an image of the anisotropic nature of diffusion and express it quantitatively. Nerve fibers have a large anisotropic diffusion, and it is possible to obtain images of the nerve fiber bundle. The purpose of this study is to observe the nerve fiber bundles in the brain stem using DTI and study its potential for diagnosing the type of spinocerebellar degeneration (SCD). Fractional anisotropy (FA) maps and 3D-tractography images were obtained for 41 subjects with no brain stem abnormalities. We created an apparent diffusion coefficient (ADC) map and an FA map using DTI for 16 subjects in the disease group (11 with hereditary SCD and 5 with non-hereditary SCD) and 25 in the control group. The diffusion value of the pons and middle cerebellar peduncle was measured using ADC, and the degree of anisotropic diffusion was measured using FA. The pyramidal tract, superior cerebellar peduncle, and inferior cerebellar peduncle were clearly demonstrated for all cases. ADC for the middle cerebellar peduncle in spinocerebellar ataxin (SCA)1 was significantly higher, similar to that for the pons in dentatorubro-pallidoluysian atrophy (DRPLA). In MSA-C, ADC for both the pons and middle cerebellar peduncle was significantly elevated and FA was significantly decreased. There were no significant changes in SCA3. We could observe the nerve fiber bundles in the brain stem using DTI. FA and ADC measurements with DTI can aid in diagnosing the type of SCD. (author)

  1. An FDTD algorithm for simulating light propagation in anisotropic dynamic gain media

    KAUST Repository

    Al-Jabr, A. A.; San Roman Alerigi, Damian; Ooi, Boon S.; Alsunaidi, M. A.

    2014-01-01

    Simulating light propagation in anisotropic dynamic gain media such as semiconductors and solid-state lasers using the finite difference time-domain FDTD technique is a tedious process, as many variables need to be evaluated in the same instant of time. The algorithm has to take care of the laser dynamic gain, rate equations, anisotropy and dispersion. In this paper, to the best of our knowledge, we present the first algorithm that solves this problem. The algorithm is based on separating calculations into independent layers and hence solving each problem in a layer of calculations. The anisotropic gain medium is presented and tested using a one-dimensional set-up. The algorithm is then used for the analysis of a two-dimensional problem.

  2. An FDTD algorithm for simulating light propagation in anisotropic dynamic gain media

    KAUST Repository

    Al-Jabr, A. A.

    2014-05-02

    Simulating light propagation in anisotropic dynamic gain media such as semiconductors and solid-state lasers using the finite difference time-domain FDTD technique is a tedious process, as many variables need to be evaluated in the same instant of time. The algorithm has to take care of the laser dynamic gain, rate equations, anisotropy and dispersion. In this paper, to the best of our knowledge, we present the first algorithm that solves this problem. The algorithm is based on separating calculations into independent layers and hence solving each problem in a layer of calculations. The anisotropic gain medium is presented and tested using a one-dimensional set-up. The algorithm is then used for the analysis of a two-dimensional problem.

  3. Numerical solution of non-linear diffusion problems

    International Nuclear Information System (INIS)

    Carmen, A. del; Ferreri, J.C.

    1998-01-01

    This paper presents a method for the numerical solution of non-linear diffusion problems using finite-differences in moving grids. Due to the presence of steep fronts in the solution domain and to the presence of advective terms originating in the grid movement, an implicit TVD scheme, first order in time and second order in space has been developed. Some algebraic details of the derivation are given. Results are shown for the pure advection of a scalar as a test case and an example dealing with the slow spreading of viscous fluids over plane surfaces. The agreement between numerical and analytical solutions is excellent. (author). 8 refs., 3 figs

  4. Multiple Scale Reaction-Diffusion-Advection Problems with Moving Fronts

    Science.gov (United States)

    Nefedov, Nikolay

    2016-06-01

    In this work we discuss the further development of the general scheme of the asymptotic method of differential inequalities to investigate stability and motion of sharp internal layers (fronts) for nonlinear singularly perturbed parabolic equations, which are called in applications reaction-diffusion-advection equations. Our approach is illustrated for some new important cases of initial boundary value problems. We present results on stability and on the motion of the fronts.

  5. The Induced Dimension Reduction method applied to convection-diffusion-reaction problems

    NARCIS (Netherlands)

    Astudillo, R.; Van Gijzen, M.B.

    2016-01-01

    Discretization of (linearized) convection-diffusion-reaction problems yields a large and sparse non symmetric linear system of equations, Ax = b. (1) In this work, we compare the computational behavior of the Induced Dimension Reduction method (IDR(s)) [10], with other short-recurrences Krylov

  6. Quantum transport of atomic matter waves in anisotropic two-dimensional and three-dimensional disorder

    International Nuclear Information System (INIS)

    Piraud, M; Pezzé, L; Sanchez-Palencia, L

    2013-01-01

    The macroscopic transport properties in a disordered potential, namely diffusion and weak/strong localization, closely depend on the microscopic and statistical properties of the disorder itself. This dependence is rich in counter-intuitive consequences. It can be particularly exploited in matter wave experiments, where the disordered potential can be tailored and controlled, and anisotropies are naturally present. In this work, we apply a perturbative microscopic transport theory and the self-consistent theory of Anderson localization to study the transport properties of ultracold atoms in anisotropic two-dimensional (2D) and three-dimensional (3D) speckle potentials. In particular, we discuss the anisotropy of single-scattering, diffusion and localization. We also calculate disorder-induced shift of the energy states and propose a method to include it, which amounts to renormalizing energies in the standard on-shell approximation. We show that the renormalization of energies strongly affects the prediction for the 3D localization threshold (mobility edge). We illustrate the theoretical findings with examples which are relevant for current matter wave experiments, where the disorder is created with laser speckle. This paper provides a guideline for future experiments aiming at the precise location of the 3D mobility edge and study of anisotropic diffusion and localization effects in 2D and 3D. (paper)

  7. Spatial Mapping of Translational Diffusion Coefficients Using Diffusion Tensor Imaging: A Mathematical Description.

    Science.gov (United States)

    Shetty, Anil N; Chiang, Sharon; Maletic-Savatic, Mirjana; Kasprian, Gregor; Vannucci, Marina; Lee, Wesley

    2014-01-01

    In this article, we discuss the theoretical background for diffusion weighted imaging and diffusion tensor imaging. Molecular diffusion is a random process involving thermal Brownian motion. In biological tissues, the underlying microstructures restrict the diffusion of water molecules, making diffusion directionally dependent. Water diffusion in tissue is mathematically characterized by the diffusion tensor, the elements of which contain information about the magnitude and direction of diffusion and is a function of the coordinate system. Thus, it is possible to generate contrast in tissue based primarily on diffusion effects. Expressing diffusion in terms of the measured diffusion coefficient (eigenvalue) in any one direction can lead to errors. Nowhere is this more evident than in white matter, due to the preferential orientation of myelin fibers. The directional dependency is removed by diagonalization of the diffusion tensor, which then yields a set of three eigenvalues and eigenvectors, representing the magnitude and direction of the three orthogonal axes of the diffusion ellipsoid, respectively. For example, the eigenvalue corresponding to the eigenvector along the long axis of the fiber corresponds qualitatively to diffusion with least restriction. Determination of the principal values of the diffusion tensor and various anisotropic indices provides structural information. We review the use of diffusion measurements using the modified Stejskal-Tanner diffusion equation. The anisotropy is analyzed by decomposing the diffusion tensor based on symmetrical properties describing the geometry of diffusion tensor. We further describe diffusion tensor properties in visualizing fiber tract organization of the human brain.

  8. FDTD analysis of 3-D conducting target coated by anisotropic magnetized plasma

    International Nuclear Information System (INIS)

    Xu Lijun; Liu Shaobin; Mo Jinjun; Yuan Naichang

    2006-01-01

    The JEC finite-difference time-domain (JEC-FDTD) method is extended to three dimensional anisotropic dispersive media- the magnetized plasma. The problem which incorporates both anisotropy and frequency dispersion at the same time is solved for the electromagnetic wave propagation. The three dimensional JEC-FDTD formulations for anisotropic magnetized plasma are derived. The method is applied to the electromagnetic scattering of dihedral corner reflector and sphere-cone coated with anisotropic magnetized plasma. By simulating the interaction of electromagnetic wave with magnetized plasma, some numerical results are obtained, which indicate that an appropriate plasma coating may efficiently reduce the RCS of a metallic target. (authors)

  9. Anisotropic constant-roll inflation

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Asuka; Soda, Jiro [Kobe University, Department of Physics, Kobe (Japan)

    2018-01-15

    We study constant-roll inflation in the presence of a gauge field coupled to an inflaton. By imposing the constant anisotropy condition, we find new exact anisotropic constant-roll inflationary solutions which include anisotropic power-law inflation as a special case. We also numerically show that the new anisotropic solutions are attractors in the phase space. (orig.)

  10. Modeling Diffusion and Buoyancy-Driven Convection with Application to Geological CO2 Storage

    KAUST Repository

    Allen, Rebecca

    2015-04-01

    ABSTRACT Modeling Diffusion and Buoyancy-Driven Convection with Application to Geological CO2 Storage Rebecca Allen Geological CO2 storage is an engineering feat that has been undertaken around the world for more than two decades, thus accurate modeling of flow and transport behavior is of practical importance. Diffusive and convective transport are relevant processes for buoyancy-driven convection of CO2 into underlying fluid, a scenario that has received the attention of numerous modeling studies. While most studies focus on Darcy-scale modeling of this scenario, relatively little work exists at the pore-scale. In this work, properties evaluated at the pore-scale are used to investigate the transport behavior modeled at the Darcy-scale. We compute permeability and two different forms of tortuosity, namely hydraulic and diffusive. By generating various pore ge- ometries, we find hydraulic and diffusive tortuosity can be quantitatively different in the same pore geometry by up to a factor of ten. As such, we emphasize that these tortuosities should not be used interchangeably. We find pore geometries that are characterized by anisotropic permeability can also exhibit anisotropic diffusive tortuosity. This finding has important implications for buoyancy-driven convection modeling; when representing the geological formation with an anisotropic permeabil- ity, it is more realistic to also account for an anisotropic diffusivity. By implementing a non-dimensional model that includes both a vertically and horizontally orientated 5 Rayleigh number, we interpret our findings according to the combined effect of the anisotropy from permeability and diffusive tortuosity. In particular, we observe the Rayleigh ratio may either dampen or enhance the diffusing front, and our simulation data is used to express the time of convective onset as a function of the Rayleigh ratio. Also, we implement a lattice Boltzmann model for thermal convective flows, which we treat as an analog for

  11. In situ anisotropic parameter determination using refraction seismic and VSP methods

    Energy Technology Data Exchange (ETDEWEB)

    Leslie, J.M.; Lawton, D.C. (Calgary Univ., AB (Canada))

    1999-01-01

    A prime concern in the time-to-depth conversion of reflection seismic data is seismic anisotropy, because it can produce velocity anomalies in seismic data that mimic the structural plays of interest to the petroleum prospector in both size and shape. Ongoing techniques of time-to-depth conversion of P-wave seismic data do not handle the travel time and velocity distortions caused by seismic anisotropy, particularly in areas of complex geologic structures. To address this problem, the first step is to know which rock units are anisotropic and measure their anisotropic parameters. Laboratory means are available, but there are problems with these mainly with shales because of their fissile nature. In situ measurements are preferable because they yield a more robust value, and at the University of Calgary such measurements were undertaken using refraction seismic and vertical seismic profiling (VSP) methods. Results indicate that the two Thomsen anisotropic parameters of interest can be determined from the VSP experiment, but these values are slightly less than those obtained using the refraction technique. This may be because of the sensitivity of the shot statics which arises from the direct travel time measurement of the technique. The experiment yields another method to measure velocity anisotropy, in situ, where steeply dipping strata outcrop, which allows for the accurate measurement of the anisotropic parameters for use in depth migration routines. 4 refs.

  12. In situ anisotropic parameter determination using refraction seismic and VSP methods

    Energy Technology Data Exchange (ETDEWEB)

    Leslie, J.M.; Lawton, D.C. [Calgary Univ., AB (Canada)

    1999-11-01

    A prime concern in the time-to-depth conversion of reflection seismic data is seismic anisotropy, because it can produce velocity anomalies in seismic data that mimic the structural plays of interest to the petroleum prospector in both size and shape. Ongoing techniques of time-to-depth conversion of P-wave seismic data do not handle the travel time and velocity distortions caused by seismic anisotropy, particularly in areas of complex geologic structures. To address this problem, the first step is to know which rock units are anisotropic and measure their anisotropic parameters. Laboratory means are available, but there are problems with these mainly with shales because of their fissile nature. In situ measurements are preferable because they yield a more robust value, and at the University of Calgary such measurements were undertaken using refraction seismic and vertical seismic profiling (VSP) methods. Results indicate that the two Thomsen anisotropic parameters of interest can be determined from the VSP experiment, but these values are slightly less than those obtained using the refraction technique. This may be because of the sensitivity of the shot statics which arises from the direct travel time measurement of the technique. The experiment yields another method to measure velocity anisotropy, in situ, where steeply dipping strata outcrop, which allows for the accurate measurement of the anisotropic parameters for use in depth migration routines. 4 refs.

  13. Fast rigorous numerical method for the solution of the anisotropic neutron transport problem and the NITRAN system for fusion neutronics application. Pt. 1

    International Nuclear Information System (INIS)

    Takahashi, A.; Rusch, D.

    1979-07-01

    Some recent neutronics experiments for fusion reactor blankets show that the precise treatment of anisotropic secondary emissions for all types of neutron scattering is needed for neutron transport calculations. In the present work new rigorous methods, i.e. based on non-approximative microscopic neutron balance equations, are applied to treat the anisotropic collision source term in transport equations. The collision source calculation is free from approximations except for the discretization of energy, angle and space variables and includes the rigorous treatment of nonelastic collisions, as far as nuclear data are given. Two methods are presented: first the Ii-method, which relies on existing nuclear data files and then, as an ultimate goal, the I*-method, which aims at the use of future double-differential cross section data, but which is also applicable to the present single-differential data basis to allow a smooth transition to the new data type. An application of the Ii-method is given in the code system NITRAN which employs the Ssub(N)-method to solve the transport equations. Both rigorous methods, the Ii- and the I*-method, are applicable to all radiation transport problems and they can be used also in the Monte-Carlo-method to solve the transport problem. (orig./RW) [de

  14. Cortical fibers orientation mapping using in-vivo whole brain 7 T diffusion MRI

    NARCIS (Netherlands)

    Gulban, Omer F; De Martino, Federico; Vu, An T; Yacoub, Essa; Uğurbil, Kamil; Lenglet, Christophe

    Diffusion MRI of the cortical gray matter is challenging because the micro-environment probed by water molecules is much more complex than within the white matter. High spatial and angular resolutions are therefore necessary to uncover anisotropic diffusion patterns and laminar structures, which

  15. Diffusion archeology for diffusion progression history reconstruction.

    Science.gov (United States)

    Sefer, Emre; Kingsford, Carl

    2016-11-01

    Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring - perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial diffusion data. Here, we tackle the problem of reconstructing a diffusion history from one or more snapshots of the diffusion state. This ability can be invaluable to learn when certain computer nodes are infected or which people are the initial disease spreaders to control future diffusions. We formulate this problem over discrete-time SEIRS-type diffusion models in terms of maximum likelihood. We design methods that are based on submodularity and a novel prize-collecting dominating-set vertex cover (PCDSVC) relaxation that can identify likely diffusion steps with some provable performance guarantees. Our methods are the first to be able to reconstruct complete diffusion histories accurately in real and simulated situations. As a special case, they can also identify the initial spreaders better than the existing methods for that problem. Our results for both meme and contaminant diffusion show that the partial diffusion data problem can be overcome with proper modeling and methods, and that hidden temporal characteristics of diffusion can be predicted from limited data.

  16. The Stress Distribution in an Infinite Anisotropic Plate with Co-Linear Cracks

    DEFF Research Database (Denmark)

    Krenk, Steen

    1975-01-01

    A general solution of the plane problem of a finite number of co-linear cracks in an anisotropic material is presented. The solution is obtained by reducing the problem to four very simple Riemann-Hilbert problems. From the solution it is concluded that if the loads acting on the cracks have the ...

  17. SHADOK-3-6, Transport Equation with Anisotropic Diffusion in P1 Approximation for Spherical and Cylindrical Geometry

    International Nuclear Information System (INIS)

    Ligou, J.; Thomi, P.A.

    1973-01-01

    1 - Nature of physical problem solved: Integral transport equation, anisotropy of diffusion in P1 approximation. SHADOK3 - cylindrical geometry; direct solution of the linear system. SHADOK4 - cylindrical geometry; Thermalization iteration; solution of the linear system with inverse matrix calculation. SHADOK5 - like SHADOK3 for spherical geometry. SHADOK6 - like SHADOK4 for spherical geometry. 2 - Method of solution: Analysis in terms of annuli for each of which polynomial approximation is applied. Dynamic allocation (for formulas see report TM(10)). 3 - Restrictions on the complexity of the problem: Relative accuracy of the Bickley functions about 1.0E-13

  18. ANALYSIS OF DEFORMABILITY OF ANISOTROPIC AGRILLITE CLAYSTONES

    Directory of Open Access Journals (Sweden)

    Ponomaryov Andrey Budimirovicn

    2017-08-01

    Full Text Available In the paper, the results of deformability study of agrillite claystones are used for determination of the Jointed rock model parameters. The number of stamp, pressuremeter and compressive tests allowed to research anisotropic deformability of argillite claystone in vertical and horizontal direction. The following problems were solved during the study: 1 the in-place and laboratory experiments to calculate the anisotropy coefficient were done for anisotropic agrillite claystones with both natural moisture and total water saturation; 2 the deformation parameters were determined and the numerical simulation of the stress-strain state of claystone in field tests was carried out with the use of Plaxis 2D software application; 3 the comparative analysis was done for calculated claystone deformation and the values obtained during the in-place tests. The authors proved that agrillite claystones shows two times less deformation under loading in the horizontal direction than vertically. The ratio is obtained to determine the parameters for numerical simulation of the Jointed Rock model used as a practical tool for analysis of stress-strain behavior of anisotropic soils. The authors provided a recommended practice for consideration of specific properties of argillite claystones when carrying out foundation works.

  19. Ultraviolet laser-induced voltage in anisotropic shale

    Science.gov (United States)

    Miao, Xinyang; Zhu, Jing; Li, Yizhang; Zhao, Kun; Zhan, Honglei; Yue, Wenzheng

    2018-01-01

    The anisotropy of shales plays a significant role in oil and gas exploration and engineering. Owing to various problems and limitations, anisotropic properties were seldom investigated by direct current resistivity methods. Here in this work, a 248 nm ultraviolet laser was employed to assess the anisotropic electrical response of a dielectric shale. Angular dependence of laser-induced voltages (V p) were obtained, with a data symmetry at the location of 180° and a ~62.2% V p anisotropy of the sample. The double-exponential functions have provided an explanation for the electrical field controlled carrier transportation process in horizontal and vertical directions. The results demonstrate that the combination of optics and electrical logging analysis (Opti-electrical Logging) is a promising technology for the investigation of unconventional reservoirs.

  20. Anisotropic temperature relaxation of plasmas in an external magnetic field

    International Nuclear Information System (INIS)

    Hassan, M.H.A.

    1977-01-01

    The magnetized kinetic equation derived in an earlier paper (Hassan and Watson, 1977) is used to study the problem of relaxation of anisotropic electron and ion temperatures in a magnetized plasma. In the case of anisotropic electron temperature relaxation, it is shown that for small anisotropies the exchange of energy within the electrons between the components parallel and perpendicular to the magnetic field direction determine the relaxation rate. For anisotropic ion temperature relaxation it is shown that the essential mechanism for relaxation is provided by energy transfer between ions and electrons, and that the expression for the relaxation rate perpendicular to the magnetic field contains a significant term proportional to ln eta 0 ln (msub(e)/msub(i)) (where eta 0 = Ωsub(e)/ksub(D)Vsub(e perpendicular to)), in addition to the term proportional to the Coulomb logarithm. (author)

  1. Analysis and correction of gradient nonlinearity bias in apparent diffusion coefficient measurements.

    Science.gov (United States)

    Malyarenko, Dariya I; Ross, Brian D; Chenevert, Thomas L

    2014-03-01

    Gradient nonlinearity of MRI systems leads to spatially dependent b-values and consequently high non-uniformity errors (10-20%) in apparent diffusion coefficient (ADC) measurements over clinically relevant field-of-views. This work seeks practical correction procedure that effectively reduces observed ADC bias for media of arbitrary anisotropy in the fewest measurements. All-inclusive bias analysis considers spatial and time-domain cross-terms for diffusion and imaging gradients. The proposed correction is based on rotation of the gradient nonlinearity tensor into the diffusion gradient frame where spatial bias of b-matrix can be approximated by its Euclidean norm. Correction efficiency of the proposed procedure is numerically evaluated for a range of model diffusion tensor anisotropies and orientations. Spatial dependence of nonlinearity correction terms accounts for the bulk (75-95%) of ADC bias for FA = 0.3-0.9. Residual ADC non-uniformity errors are amplified for anisotropic diffusion. This approximation obviates need for full diffusion tensor measurement and diagonalization to derive a corrected ADC. Practical scenarios are outlined for implementation of the correction on clinical MRI systems. The proposed simplified correction algorithm appears sufficient to control ADC non-uniformity errors in clinical studies using three orthogonal diffusion measurements. The most efficient reduction of ADC bias for anisotropic medium is achieved with non-lab-based diffusion gradients. Copyright © 2013 Wiley Periodicals, Inc.

  2. An inverse problem for a one-dimensional time-fractional diffusion problem

    KAUST Repository

    Jin, Bangti

    2012-06-26

    We study an inverse problem of recovering a spatially varying potential term in a one-dimensional time-fractional diffusion equation from the flux measurements taken at a single fixed time corresponding to a given set of input sources. The unique identifiability of the potential is shown for two cases, i.e. the flux at one end and the net flux, provided that the set of input sources forms a complete basis in L 2(0, 1). An algorithm of the quasi-Newton type is proposed for the efficient and accurate reconstruction of the coefficient from finite data, and the injectivity of the Jacobian is discussed. Numerical results for both exact and noisy data are presented. © 2012 IOP Publishing Ltd.

  3. User's manual for ONEDANT: a code package for one-dimensional, diffusion-accelerated, neutral-particle transport

    International Nuclear Information System (INIS)

    O'Dell, R.D.; Brinkley, F.W. Jr.; Marr, D.R.

    1982-02-01

    ONEDANT is designed for the CDC-7600, but the program has been implemented and run on the IBM-370/190 and CRAY-I computers. ONEDANT solves the one-dimensional multigroup transport equation in plane, cylindrical, spherical, and two-angle plane geometries. Both regular and adjoint, inhomogeneous and homogeneous (k/sub eff/ and eigenvalue search) problems subject to vacuum, reflective, periodic, white, albedo, or inhomogeneous boundary flux conditions are solved. General anisotropic scattering is allowed and anisotropic inhomogeneous sources are permitted. ONEDANT numerically solves the one-dimensional, multigroup form of the neutral-particle, steady-state form of the Boltzmann transport equation. The discrete-ordinates approximation is used for treating the angular variation of the particle distribution and the diamond-difference scheme is used for phase space discretization. Negative fluxes are eliminated by a local set-to-zero-and-correct algorithm. A standard inner (within-group) iteration, outer (energy-group-dependent source) iteration technique is used. Both inner and outer iterations are accelerated using the diffusion synthetic acceleration method

  4. Separation of variables in anisotropic models: anisotropic Rabi and elliptic Gaudin model in an external magnetic field

    Science.gov (United States)

    Skrypnyk, T.

    2017-08-01

    We study the problem of separation of variables for classical integrable Hamiltonian systems governed by non-skew-symmetric non-dynamical so(3)\\otimes so(3) -valued elliptic r-matrices with spectral parameters. We consider several examples of such models, and perform separation of variables for classical anisotropic one- and two-spin Gaudin-type models in an external magnetic field, and for Jaynes-Cummings-Dicke-type models without the rotating wave approximation.

  5. Acoustic anisotropic wavefields through perturbation theory

    KAUST Repository

    Alkhalifah, Tariq Ali

    2013-09-01

    Solving the anisotropic acoustic wave equation numerically using finite-difference methods introduces many problems and media restriction requirements, and it rarely contributes to the ability to resolve the anisotropy parameters. Among these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing the solution of the anisotropic acoustic wave equation allows direct access to the desired limitation-free solutions, that is, solutions perturbed from the elliptical anisotropic background medium. It also provides a platform for parameter estimation because of the ability to isolate the wavefield dependency on the perturbed anisotropy parameters. As a result, I derive partial differential equations that relate changes in the wavefield to perturbations in the anisotropy parameters. The solutions of the perturbation equations represented the coefficients of a Taylor-series-type expansion of the wavefield as a function of the perturbed parameter, which is in this case η or the tilt of the symmetry axis. The expansion with respect to the symmetry axis allows use of an acoustic transversely isotropic media with a vertical symmetry axis (VTI) kernel to estimate the background wavefield and the corresponding perturbation coefficients. The VTI extrapolation kernel is about one-fourth the cost of the transversely isotropic model with a tilt in the symmetry axis kernel. Thus, for a small symmetry axis tilt, the cost of migration using a first-order expansion can be reduced. The effectiveness of the approach was demonstrated on the Marmousi model.

  6. MULTISCALE TENSOR ANISOTROPIC FILTERING OF FLUORESCENCE MICROSCOPY FOR DENOISING MICROVASCULATURE.

    Science.gov (United States)

    Prasath, V B S; Pelapur, R; Glinskii, O V; Glinsky, V V; Huxley, V H; Palaniappan, K

    2015-04-01

    Fluorescence microscopy images are contaminated by noise and improving image quality without blurring vascular structures by filtering is an important step in automatic image analysis. The application of interest here is to automatically extract the structural components of the microvascular system with accuracy from images acquired by fluorescence microscopy. A robust denoising process is necessary in order to extract accurate vascular morphology information. For this purpose, we propose a multiscale tensor with anisotropic diffusion model which progressively and adaptively updates the amount of smoothing while preserving vessel boundaries accurately. Based on a coherency enhancing flow with planar confidence measure and fused 3D structure information, our method integrates multiple scales for microvasculature preservation and noise removal membrane structures. Experimental results on simulated synthetic images and epifluorescence images show the advantage of our improvement over other related diffusion filters. We further show that the proposed multiscale integration approach improves denoising accuracy of different tensor diffusion methods to obtain better microvasculature segmentation.

  7. Possibility to explain the temperature distribution in sunspots by an anisotropic heat transfer

    Energy Technology Data Exchange (ETDEWEB)

    Eschrich, K O; Krause, F [Akademie der Wissenschaften der DDR, Potsdam. Zentralinstitut fuer Astrophysik

    1977-01-01

    Numerical solutions of a heat conduction problem in an anisotropic medium are used for a discussion of the possibility to explain the temperature distribution in sunspots and their environment. The anisotropy is assumed being due to the strong magnetic field in sunspots and the region below. This magnetic field forces the convection to take an anisotropic structure (two-dimensional turbulence) and thus the region gets anisotropic conduction properties, on the average. The discussion shows that the observed temperature profiles can be explained in the case the depth of the region of anisotropy is about as large as the diameter of the spot or larger.

  8. A novel family of DG methods for diffusion problems

    Science.gov (United States)

    Johnson, Philip; Johnsen, Eric

    2017-11-01

    We describe and demonstrate a novel family of numerical schemes for handling elliptic/parabolic PDE behavior within the discontinuous Galerkin (DG) framework. Starting from the mixed-form approach commonly applied for handling diffusion (examples include Local DG and BR2), the new schemes apply the Recovery concept of Van Leer to handle cell interface terms. By applying recovery within the mixed-form approach, we have designed multiple schemes that show better accuracy than other mixed-form approaches while being more flexible and easier to implement than the Recovery DG schemes of Van Leer. While typical mixed-form approaches converge at rate 2p in the cell-average or functional error norms (where p is the order of the solution polynomial), many of our approaches achieve order 2p +2 convergence. In this talk, we will describe multiple schemes, including both compact and non-compact implementations; the compact approaches use only interface-connected neighbors to form the residual for each element, while the non-compact approaches add one extra layer to the stencil. In addition to testing the schemes on purely parabolic PDE problems, we apply them to handle the diffusive flux terms in advection-diffusion systems, such as the compressible Navier-Stokes equations.

  9. NON-AXISYMMETRIC PERPENDICULAR DIFFUSION OF CHARGED PARTICLES AND THEIR TRANSPORT ACROSS TANGENTIAL MAGNETIC DISCONTINUITIES

    Energy Technology Data Exchange (ETDEWEB)

    Strauss, R. D.; Engelbrecht, N. E.; Dunzlaff, P. [Center for Space Research, North-West University, Potchefstroom, 2522 (South Africa); Roux, J. A. le [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 3585 (United States); Ruffolo, D., E-mail: dutoit.strauss@nwu.ac.za [Department of Physics, Faculty of Science, Mahidol University, Bangkok 10400 (Thailand)

    2016-07-01

    We investigate the transport of charged particles across magnetic discontinuities, focusing specifically on stream interfaces associated with co-rotating interaction regions in the solar wind. We argue that the magnetic field fluctuations perpendicular to the magnetic discontinuity, and usually also perpendicular to the mean magnetic field, are strongly damped in the vicinity of such a magnetic structure, leading to anisotropic perpendicular diffusion. Assuming that perpendicular diffusion arises from drifts in a turbulent magnetic field, we adopt a simplified approach to derive the relevant perpendicular diffusion coefficient. This approach, which we believe gives the correct principal dependences as expected from more elaborate calculations, allows us to investigate transport in different turbulent geometries, such as longitudinal compressional turbulence that may be present near the heliopause. Although highly dependent on the (possibly anisotropic) perpendicular length scales and turbulence levels, we generally find perpendicular diffusion to be strongly damped at magnetic discontinuities, which may in turn provide an explanation for the large particle gradients associated with these structures.

  10. Divergent series and memory of the initial condition in the long-time solution of some anomalous diffusion problems.

    Science.gov (United States)

    Yuste, S Bravo; Borrego, R; Abad, E

    2010-02-01

    We consider various anomalous d -dimensional diffusion problems in the presence of an absorbing boundary with radial symmetry. The motion of particles is described by a fractional diffusion equation. Their mean-square displacement is given by r(2) proportional, variant t(gamma)(0divergent series appear when the concentration or survival probabilities are evaluated via the method of separation of variables. While the solution for normal diffusion problems is, at most, divergent as t-->0 , the emergence of such series in the long-time domain is a specific feature of subdiffusion problems. We present a method to regularize such series, and, in some cases, validate the procedure by using alternative techniques (Laplace transform method and numerical simulations). In the normal diffusion case, we find that the signature of the initial condition on the approach to the steady state rapidly fades away and the solution approaches a single (the main) decay mode in the long-time regime. In remarkable contrast, long-time memory of the initial condition is present in the subdiffusive case as the spatial part Psi1(r) describing the long-time decay of the solution to the steady state is determined by a weighted superposition of all spatial modes characteristic of the normal diffusion problem, the weight being dependent on the initial condition. Interestingly, Psi1(r) turns out to be independent of the anomalous diffusion exponent gamma .

  11. Neutron transfer with anisotropic scattering

    International Nuclear Information System (INIS)

    El Wakil, S.A.; Haggag, M.H.; Saad, E.A.

    1979-01-01

    The finite slab problem is reduced to a semi-infinite one by adding an infinitesimally thick layer such that both the added layer and the total layer are semi-infinite. The relation between the reflection and transmission functions for a finite slab and those for an infinite one are obtained in terms of an operator which satisfies a semigroup equation. The method is applied to anisotropic scattering with azimuthal dependence. Numerical calculations are made and the results compared with those of other workers. (author)

  12. Quantitative multi-waves migration in elastic anisotropic media; Migration quantitative multi-ondes en milieu elastique anisotrope

    Energy Technology Data Exchange (ETDEWEB)

    Borgne, H.

    2004-12-01

    modelling of waves propagation in anisotropic media. With the approximations of ray theory, 1 develop an expression of the geometrical spreading, the amplitude, and their reciprocity relations. I set up imaging formulas in order to reconstruct the reflection coefficients of the subsurface in elastic anisotropic media. In a first time, 1 salve the direct problem, by expressing the integral relation between the scattered wave field recorded by the receivers and the subsurface reflection coefficients. In a second time, 1 apply an elastic anisotropic quantitative migration method, based on the properties of the inverse Radon transforms (Beylkin's approach), in order to express the reflection coefficient in 2D, 2.5D and 3D media. 1 implemented these formulas in a new preserved amplitude migration algorithm, where the images are sorted by angle classes. At last, 1 apply these theoretical results to synthetic and real datasets. 1 show that migration is able to reconstruct the correct A V A behavior of anisotropic reflection coefficients if hath. modifications are achieved. Then, 1 degrade the process, by keeping an anisotropic ray tracing but using the classical isotropic imaging formula. F'or this commonly used configuration, 1 evaluate the error that can be expected in the A V A response of the migrated reflection coefficient. Methodological applications show the sensibility of the migration results to the velocity model smoothing and to an error on the anisotropic axis. (author)

  13. Wetting and Diffusion of Water on Pristine and Strained Phosphorene

    OpenAIRE

    Zhang, Wei; Ye, Chao; Bi, Lin; Yang, Zaixing; Zhou, Ruhong

    2015-01-01

    Phosphorene, a newly fabricated two-dimensional (2D) nanomaterial, have exhibited promising application prospect in biology. Nonetheless, the wetting and diffusive properties of bio-fluids on phosphorene are still elusive. In this study, using molecular dynamics (MD) simulations, we investigated the structural and dynamic properties of water on pristine and strained phosphorene. The MD simulations illustrated that the diffusion of water molecules on the phosphorene surface is anisotropic, whi...

  14. Anisotropic contrast optical microscope.

    Science.gov (United States)

    Peev, D; Hofmann, T; Kananizadeh, N; Beeram, S; Rodriguez, E; Wimer, S; Rodenhausen, K B; Herzinger, C M; Kasputis, T; Pfaunmiller, E; Nguyen, A; Korlacki, R; Pannier, A; Li, Y; Schubert, E; Hage, D; Schubert, M

    2016-11-01

    An optical microscope is described that reveals contrast in the Mueller matrix images of a thin, transparent, or semi-transparent specimen located within an anisotropic object plane (anisotropic filter). The specimen changes the anisotropy of the filter and thereby produces contrast within the Mueller matrix images. Here we use an anisotropic filter composed of a semi-transparent, nanostructured thin film with sub-wavelength thickness placed within the object plane. The sample is illuminated as in common optical microscopy but the light is modulated in its polarization using combinations of linear polarizers and phase plate (compensator) to control and analyze the state of polarization. Direct generalized ellipsometry data analysis approaches permit extraction of fundamental Mueller matrix object plane images dispensing with the need of Fourier expansion methods. Generalized ellipsometry model approaches are used for quantitative image analyses. These images are obtained from sets of multiple images obtained under various polarizer, analyzer, and compensator settings. Up to 16 independent Mueller matrix images can be obtained, while our current setup is limited to 11 images normalized by the unpolarized intensity. We demonstrate the anisotropic contrast optical microscope by measuring lithographically defined micro-patterned anisotropic filters, and we quantify the adsorption of an organic self-assembled monolayer film onto the anisotropic filter. Comparison with an isotropic glass slide demonstrates the image enhancement obtained by our method over microscopy without the use of an anisotropic filter. In our current instrument, we estimate the limit of detection for organic volumetric mass within the object plane of ≈49 fg within ≈7 × 7 μm 2 object surface area. Compared to a quartz crystal microbalance with dissipation instrumentation, where contemporary limits require a total load of ≈500 pg for detection, the instrumentation demonstrated here improves

  15. A novel image inpainting technique based on median diffusion

    Indian Academy of Sciences (India)

    numerical methods such as anisotropic diffusion and multiresolution schemes. Some steps ... Roth & Black (2005) have developed a framework for learning a generic and expressive image priors that ..... This paper presents a new approach for image inpainting by propagating median information .... J. Graphics Tools 9(1):.

  16. Simple types of anisotropic inflation

    International Nuclear Information System (INIS)

    Barrow, John D.; Hervik, Sigbjoern

    2010-01-01

    We display some simple cosmological solutions of gravity theories with quadratic Ricci curvature terms added to the Einstein-Hilbert Lagrangian which exhibit anisotropic inflation. The Hubble expansion rates are constant and unequal in three orthogonal directions. We describe the evolution of the simplest of these homogeneous and anisotropic cosmological models from its natural initial state and evaluate the deviations they will create from statistical isotropy in the fluctuations produced during a period of anisotropic inflation. The anisotropic inflation is not a late-time attractor in these models but the rate of approach to a final isotropic de Sitter state is slow and is conducive to the creation of observable anisotropic statistical effects in the microwave background. The statistical anisotropy would not be scale invariant and the level of statistical anisotropy will grow with scale.

  17. Diffusion properties of NAA in human corpus callosum as studied with diffusion tensor spectroscopy.

    Science.gov (United States)

    Upadhyay, Jaymin; Hallock, Kevin; Erb, Kelley; Kim, Dae-Shik; Ronen, Itamar

    2007-11-01

    In diffusion tensor imaging (DTI) the anisotropic movement of water is exploited to characterize microstructure. One confounding issue of DTI is the presence of intra- and extracellular components contributing to the measured diffusivity. This causes an ambiguity in determining the underlying cause of diffusion properties, particularly the fractional anisotropy (FA). In this study an intracellular constituent, N-acetyl aspartate (NAA), was used to probe intracellular diffusion, while water molecules were used to probe the combined intra- and extracellular diffusion. NAA and water diffusion measurements were made in anterior and medial corpus callosum (CC) regions, which are referred to as R1 and R2, respectively. FA(NAA) was found to be greater than FA(Water) in both CC regions, thus indicating a higher degree of anisotropy within the intracellular space in comparison to the combined intra- and extracellular spaces. A decreasing trend in the FA of NAA and water was observed between R1 and R2, while the radial diffusivity (RD) for both molecules increased. The increase in RD(NAA) is particularly significant, thus explaining the more significant decrease in FA(NAA) between the two regions. It is suggested that diffusion tensor spectroscopy of NAA can potentially be used to further characterize microscopic anatomic organization in white matter. Copyright 2007 Wiley-Liss, Inc.

  18. Slab albedo for linearly and quadratically anisotropic scattering kernel with modified F{sub N} method

    Energy Technology Data Exchange (ETDEWEB)

    Tuereci, R. Goekhan [Kirikkale Univ. (Turkey). Kirikkale Vocational School; Tuereci, D. [Ministry of Education, Ankara (Turkey). 75th year Anatolia High School

    2017-11-15

    One speed, time independent and homogeneous medium neutron transport equation is solved with the anisotropic scattering which includes both the linearly and the quadratically anisotropic scattering kernel. Having written Case's eigenfunctions and the orthogonality relations among of these eigenfunctions, slab albedo problem is investigated as numerically by using Modified F{sub N} method. Selected numerical results are presented in tables.

  19. Multi-level nonlinear diffusion acceleration method for multigroup transport k-Eigenvalue problems

    International Nuclear Information System (INIS)

    Anistratov, Dmitriy Y.

    2011-01-01

    The nonlinear diffusion acceleration (NDA) method is an efficient and flexible transport iterative scheme for solving reactor-physics problems. This paper presents a fast iterative algorithm for solving multigroup neutron transport eigenvalue problems in 1D slab geometry. The proposed method is defined by a multi-level system of equations that includes multigroup and effective one-group low-order NDA equations. The Eigenvalue is evaluated in the exact projected solution space of smallest dimensionality, namely, by solving the effective one- group eigenvalue transport problem. Numerical results that illustrate performance of the new algorithm are demonstrated. (author)

  20. The numerical analysis of eigenvalue problem solutions in multigroup neutron diffusion theory

    International Nuclear Information System (INIS)

    Woznicki, Z.I.

    1995-01-01

    The main goal of this paper is to present a general iteration strategy for solving the discrete form of multidimensional neutron diffusion equations equivalent mathematically to an eigenvalue problem. Usually a solution method is based on different levels of iterations. The presented matrix formalism allows us to visualize explicitly how the used matrix splitting influences the matrix structure in an eigenvalue problem to be solved as well as the interdependence between inner and outer iterations within global iterations. Particular iterative strategies are illustrated by numerical results obtained for several reactor problems. (author). 21 refs, 35 figs, 16 tabs

  1. On the nature of the NAA diffusion attenuated MR signal in the central nervous system.

    Science.gov (United States)

    Kroenke, Christopher D; Ackerman, Joseph J H; Yablonskiy, Dmitriy A

    2004-11-01

    In the brain, on a macroscopic scale, diffusion of the intraneuronal constituent N-acetyl-L-aspartate (NAA) appears to be isotropic. In contrast, on a microscopic scale, NAA diffusion is likely highly anisotropic, with displacements perpendicular to neuronal fibers being markedly hindered, and parallel displacements less so. In this report we first substantiate that local anisotropy influences NAA diffusion in vivo by observing differing diffusivities parallel and perpendicular to human corpus callosum axonal fibers. We then extend our measurements to large voxels within rat brains. As expected, the macroscopic apparent diffusion coefficient (ADC) of NAA is practically isotropic due to averaging of the numerous and diverse fiber orientations. We demonstrate that the substantially non-monoexponential diffusion-mediated MR signal decay vs. b value can be quantitatively explained by a theoretical model of NAA confined to an ensemble of differently oriented neuronal fibers. On the microscopic scale, NAA diffusion is found to be strongly anisotropic, with displacements occurring almost exclusively parallel to the local fiber axis. This parallel diffusivity, ADCparallel, is 0.36 +/- 0.01 microm2/ms, and ADCperpendicular is essentially zero. From ADCparallel the apparent viscosity of the neuron cytoplasm is estimated to be twice as large as that of a temperature-matched dilute aqueous solution. (c) 2004 Wiley-Liss, Inc.

  2. Methods for high-resolution anisotropic finite element modeling of the human head: automatic MR white matter anisotropy-adaptive mesh generation.

    Science.gov (United States)

    Lee, Won Hee; Kim, Tae-Seong

    2012-01-01

    This study proposes an advanced finite element (FE) head modeling technique through which high-resolution FE meshes adaptive to the degree of tissue anisotropy can be generated. Our adaptive meshing scheme (called wMesh) uses MRI structural information and fractional anisotropy maps derived from diffusion tensors in the FE mesh generation process, optimally reflecting electrical properties of the human brain. We examined the characteristics of the wMeshes through various qualitative and quantitative comparisons to the conventional FE regular-sized meshes that are non-adaptive to the degree of white matter anisotropy. We investigated numerical differences in the FE forward solutions that include the electrical potential and current density generated by current sources in the brain. The quantitative difference was calculated by two statistical measures of relative difference measure (RDM) and magnification factor (MAG). The results show that the wMeshes are adaptive to the anisotropic density of the WM anisotropy, and they better reflect the density and directionality of tissue conductivity anisotropy. Our comparison results between various anisotropic regular mesh and wMesh models show that there are substantial differences in the EEG forward solutions in the brain (up to RDM=0.48 and MAG=0.63 in the electrical potential, and RDM=0.65 and MAG=0.52 in the current density). Our analysis results indicate that the wMeshes produce different forward solutions that are different from the conventional regular meshes. We present some results that the wMesh head modeling approach enhances the sensitivity and accuracy of the FE solutions at the interfaces or in the regions where the anisotropic conductivities change sharply or their directional changes are complex. The fully automatic wMesh generation technique should be useful for modeling an individual-specific and high-resolution anisotropic FE head model incorporating realistic anisotropic conductivity distributions

  3. How to approximate the heat equation with Neumann boundary conditions by nonlocal diffusion problems

    OpenAIRE

    Cortazar, C.; Elgueta, M.; Rossi, J. D.; Wolanski, N.

    2006-01-01

    We present a model for nonlocal diffusion with Neumann boundary conditions in a bounded smooth domain prescribing the flux through the boundary. We study the limit of this family of nonlocal diffusion operators when a rescaling parameter related to the kernel of the nonlocal operator goes to zero. We prove that the solutions of this family of problems converge to a solution of the heat equation with Neumann boundary conditions.

  4. Anisotropic biodegradable lipid coated particles for spatially dynamic protein presentation.

    Science.gov (United States)

    Meyer, Randall A; Mathew, Mohit P; Ben-Akiva, Elana; Sunshine, Joel C; Shmueli, Ron B; Ren, Qiuyin; Yarema, Kevin J; Green, Jordan J

    2018-05-01

    There has been growing interest in the use of particles coated with lipids for applications ranging from drug delivery, gene delivery, and diagnostic imaging to immunoengineering. To date, almost all particles with lipid coatings have been spherical despite emerging evidence that non-spherical shapes can provide important advantages including reduced non-specific elimination and increased target-specific binding. We combine control of core particle geometry with control of particle surface functionality by developing anisotropic, biodegradable ellipsoidal particles with lipid coatings. We demonstrate that these lipid coated ellipsoidal particles maintain advantageous properties of lipid polymer hybrid particles, such as the ability for modular protein conjugation to the particle surface using versatile bioorthogonal ligation reactions. In addition, they exhibit biomimetic membrane fluidity and demonstrate lateral diffusive properties characteristic of natural membrane proteins. These ellipsoidal particles simultaneously provide benefits of non-spherical particles in terms of stability and resistance to non-specific phagocytosis by macrophages as well as enhanced targeted binding. These biomaterials provide a novel and flexible platform for numerous biomedical applications. The research reported here documents the ability of non-spherical polymeric particles to be coated with lipids to form anisotropic biomimetic particles. In addition, we demonstrate that these lipid-coated biodegradable polymeric particles can be conjugated to a wide variety of biological molecules in a "click-like" fashion. This is of interest due to the multiple types of cellular mimicry enabled by this biomaterial based technology. These features include mimicry of the highly anisotropic shape exhibited by cells, surface presentation of membrane bound protein mimetics, and lateral diffusivity of membrane bound substrates comparable to that of a plasma membrane. This platform is demonstrated to

  5. Image denoising using non linear diffusion tensors

    International Nuclear Information System (INIS)

    Benzarti, F.; Amiri, H.

    2011-01-01

    Image denoising is an important pre-processing step for many image analysis and computer vision system. It refers to the task of recovering a good estimate of the true image from a degraded observation without altering and changing useful structure in the image such as discontinuities and edges. In this paper, we propose a new approach for image denoising based on the combination of two non linear diffusion tensors. One allows diffusion along the orientation of greatest coherences, while the other allows diffusion along orthogonal directions. The idea is to track perfectly the local geometry of the degraded image and applying anisotropic diffusion mainly along the preferred structure direction. To illustrate the effective performance of our model, we present some experimental results on a test and real photographic color images.

  6. Ionic diffusion in the double layer at model electrode/molten salt interfaces

    International Nuclear Information System (INIS)

    Tankeshwar, K.; Tosi, M.P.

    1991-08-01

    The anisotropic ionic diffusion coefficients in model electrochemical cells in the molten-salt regime for the electrolyte are evaluated from the ionic density profiles reported in simulation work of Grout and coworkers. A local description of the diffusion processes for counterions and coions in the electrical double layer is obtained from the data. (author). 10 refs, 1 fig., 1 tab

  7. Many-dimensional anisotropic anharmonic oscillator

    International Nuclear Information System (INIS)

    Turbiner, A.V.

    1987-01-01

    Precision calculation of energies of several first states at d=2 and first 17 states at d=3 has been performed within the framework of a unique method based on ''nonlinearization'' method for d-dimension anisotropic an harmonic oscillator. Spectrum behaviour within the limit d → ∞ has been investigated and problems of the given approach accuracy have been studied. For the first time properties of nodal surfaces of the given task have been investigated. Routine perturbation theory in degrees of a perturbation parameter has been constructed for several first states

  8. Complex stiffness formulation for the finite element analysis of anisotropic axisymmetric solids subjected to nonsymmetric loads

    International Nuclear Information System (INIS)

    Frater, J.; Lestingi, J.; Padovan, J.

    1977-01-01

    This paper describes the development of an improved semi-analytical finite element for the stress analysis of anisotropic axisymmetric solids subjected to nonsymmetric loads. Orthogonal functions in the form of finite Fourier exponential transforms, which satisfy the equations of equilibrium of the theory of elasticity for an anisotropic solid of revolution, are used to expand the imposed loadings and displacement field. It is found that the orthogonality conditions for the assumed solution reduce the theta-dependency, thus reducing the three dimensional problem to an infinite series of two dimensional problems. (Auth.)

  9. Local fields and effective conductivity tensor of ellipsoidal particle composite with anisotropic constituents

    Science.gov (United States)

    Kushch, Volodymyr I.; Sevostianov, Igor; Giraud, Albert

    2017-11-01

    An accurate semi-analytical solution of the conductivity problem for a composite with anisotropic matrix and arbitrarily oriented anisotropic ellipsoidal inhomogeneities has been obtained. The developed approach combines the superposition principle with the multipole expansion of perturbation fields of inhomogeneities in terms of ellipsoidal harmonics and reduces the boundary value problem to an infinite system of linear algebraic equations for the induced multipole moments of inhomogeneities. A complete full-field solution is obtained for the multi-particle models comprising inhomogeneities of diverse shape, size, orientation and properties which enables an adequate account for the microstructure parameters. The solution is valid for the general-type anisotropy of constituents and arbitrary orientation of the orthotropy axes. The effective conductivity tensor of the particulate composite with anisotropic constituents is evaluated in the framework of the generalized Maxwell homogenization scheme. Application of the developed method to composites with imperfect ellipsoidal interfaces is straightforward. Their incorporation yields probably the most general model of a composite that may be considered in the framework of analytical approach.

  10. Solution verification, goal-oriented adaptive methods for stochastic advection–diffusion problems

    KAUST Repository

    Almeida, Regina C.

    2010-08-01

    A goal-oriented analysis of linear, stochastic advection-diffusion models is presented which provides both a method for solution verification as well as a basis for improving results through adaptation of both the mesh and the way random variables are approximated. A class of model problems with random coefficients and source terms is cast in a variational setting. Specific quantities of interest are specified which are also random variables. A stochastic adjoint problem associated with the quantities of interest is formulated and a posteriori error estimates are derived. These are used to guide an adaptive algorithm which adjusts the sparse probabilistic grid so as to control the approximation error. Numerical examples are given to demonstrate the methodology for a specific model problem. © 2010 Elsevier B.V.

  11. Solution verification, goal-oriented adaptive methods for stochastic advection–diffusion problems

    KAUST Repository

    Almeida, Regina C.; Oden, J. Tinsley

    2010-01-01

    A goal-oriented analysis of linear, stochastic advection-diffusion models is presented which provides both a method for solution verification as well as a basis for improving results through adaptation of both the mesh and the way random variables are approximated. A class of model problems with random coefficients and source terms is cast in a variational setting. Specific quantities of interest are specified which are also random variables. A stochastic adjoint problem associated with the quantities of interest is formulated and a posteriori error estimates are derived. These are used to guide an adaptive algorithm which adjusts the sparse probabilistic grid so as to control the approximation error. Numerical examples are given to demonstrate the methodology for a specific model problem. © 2010 Elsevier B.V.

  12. Diffusion and mixing in gravity-driven dense granular flows.

    Science.gov (United States)

    Choi, Jaehyuk; Kudrolli, Arshad; Rosales, Rodolfo R; Bazant, Martin Z

    2004-04-30

    We study the transport properties of particles draining from a silo using imaging and direct particle tracking. The particle displacements show a universal transition from superdiffusion to normal diffusion, as a function of the distance fallen, independent of the flow speed. In the superdiffusive (but sub-ballistic) regime, which occurs before a particle falls through its diameter, the displacements have fat-tailed and anisotropic distributions. In the diffusive regime, we observe very slow cage breaking and Péclet numbers of order 100, contrary to the only previous microscopic model (based on diffusing voids). Overall, our experiments show that diffusion and mixing are dominated by geometry, consistent with long-lasting contacts but not thermal collisions, as in normal fluids.

  13. Determination of anisotropic velocity model by reflection tomography of compression and shear modes; Determination de modele de vitesse anisotrope par tomographie de reflexion des modes de compression et de cisaillement

    Energy Technology Data Exchange (ETDEWEB)

    Stopin, A.

    2001-12-01

    As the jump from 2D to 3D, seismic exploration lives a new revolution with the use of converted PS waves. Indeed PS converted waves are proving their potential as a tool for imaging through gas; lithology discrimination; structural confirmation; and more. Nevertheless, processing converted shear data and in particular determining accurate P and S velocity models for depth imaging of these data is still a challenging problem, especially when the subsurface is anisotropic. To solve this velocity model determination problem we propose to use reflection travel time tomography. In a first step, we derive a new approximation of the exact phase velocity equation of the SV wave in anisotropic (TI) media. This new approximation is valid for non-weak anisotropy and is mathematically simpler to handle than the exact equation. Then, starting from an isotropic reflection tomography tool developed at Lt-'P, we extend the isotropic bending ray tracing method to the anisotropic case and we implement the quantities necessary for the determination of the anisotropy parameters from the travel time data. Using synthetic data we then study the influence of the different anisotropy parameters on the travel times. From this analysis we propose a methodology to determine a complete anisotropic subsurface model (P and S layer velocities, interface geometries, anisotropy parameters). Finally, on a real data set from the Gulf of Mexico we demonstrate that this new anisotropic reflection tomography tool allows us to obtain a reliable subsurface model yielding kinematically correct and mutually coherent PP and PS images in depth; such a result could not be obtained with an isotropic velocity model. Similar results are obtained on a North Sea data set. (author)

  14. Determination of anisotropic velocity model by reflection tomography of compression and shear modes; Determination de modele de vitesse anisotrope par tomographie de reflexion des modes de compression et de cisaillement

    Energy Technology Data Exchange (ETDEWEB)

    Stopin, A

    2001-12-01

    As the jump from 2D to 3D, seismic exploration lives a new revolution with the use of converted PS waves. Indeed PS converted waves are proving their potential as a tool for imaging through gas; lithology discrimination; structural confirmation; and more. Nevertheless, processing converted shear data and in particular determining accurate P and S velocity models for depth imaging of these data is still a challenging problem, especially when the subsurface is anisotropic. To solve this velocity model determination problem we propose to use reflection travel time tomography. In a first step, we derive a new approximation of the exact phase velocity equation of the SV wave in anisotropic (TI) media. This new approximation is valid for non-weak anisotropy and is mathematically simpler to handle than the exact equation. Then, starting from an isotropic reflection tomography tool developed at Lt-'P, we extend the isotropic bending ray tracing method to the anisotropic case and we implement the quantities necessary for the determination of the anisotropy parameters from the travel time data. Using synthetic data we then study the influence of the different anisotropy parameters on the travel times. From this analysis we propose a methodology to determine a complete anisotropic subsurface model (P and S layer velocities, interface geometries, anisotropy parameters). Finally, on a real data set from the Gulf of Mexico we demonstrate that this new anisotropic reflection tomography tool allows us to obtain a reliable subsurface model yielding kinematically correct and mutually coherent PP and PS images in depth; such a result could not be obtained with an isotropic velocity model. Similar results are obtained on a North Sea data set. (author)

  15. Diffusing diffusivity: Rotational diffusion in two and three dimensions

    Science.gov (United States)

    Jain, Rohit; Sebastian, K. L.

    2017-06-01

    We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

  16. Homogenization of linearly anisotropic scattering cross sections in a consistent B1 heterogeneous leakage model

    International Nuclear Information System (INIS)

    Marleau, G.; Debos, E.

    1998-01-01

    One of the main problems encountered in cell calculations is that of spatial homogenization where one associates to an heterogeneous cell an homogeneous set of cross sections. The homogenization process is in fact trivial when a totally reflected cell without leakage is fully homogenized since it involved only a flux-volume weighting of the isotropic cross sections. When anisotropic leakages models are considered, in addition to homogenizing isotropic cross sections, the anisotropic scattering cross section must also be considered. The simple option, which consists of using the same homogenization procedure for both the isotropic and anisotropic components of the scattering cross section, leads to inconsistencies between the homogeneous and homogenized transport equation. Here we will present a method for homogenizing the anisotropic scattering cross sections that will resolve these inconsistencies. (author)

  17. 3D controlled-source electromagnetic modeling in anisotropic medium using edge-based finite element method

    DEFF Research Database (Denmark)

    Cai, Hongzhu; Xiong, Bin; Han, Muran

    2014-01-01

    This paper presents a linear edge-based finite element method for numerical modeling of 3D controlled-source electromagnetic data in an anisotropic conductive medium. We use a nonuniform rectangular mesh in order to capture the rapid change of diffusive electromagnetic field within the regions of...... are in a good agreement with the solutions obtained by the integral equation method....

  18. Modeling the characteristic etch morphologies along specific crystallographic orientations by anisotropic chemical etching

    Directory of Open Access Journals (Sweden)

    Kun-Dar Li

    2018-02-01

    Full Text Available To improve the advanced manufacturing technology for functional materials, a sophisticated control of chemical etching process is highly demanded, especially in the fields of environment and energy related applications. In this study, a phase-field-based model is utilized to investigate the etch morphologies influenced by the crystallographic characters during anisotropic chemical etching. Three types of etching modes are inspected theoretically, including the isotropic, and preferred oriented etchings. Owing to the specific etching behavior along the crystallographic directions, different characteristic surface structures are presented in the simulations, such as the pimple-like, pyramidal hillock and ridge-like morphologies. In addition, the processing parameters affecting the surface morphological formation and evolution are also examined systematically. According to the numerical results, the growth mechanism of surface morphology in a chemical etching is revealed distinctly. While the etching dynamics plays a dominant role on the surface formation, the characteristic surface morphologies corresponding to the preferred etching direction become more apparent. As the atomic diffusion turned into a determinative factor, a smoothened surface would appear, even under the anisotropic etching conditions. These simulation results provide fundamental information to enhance the development and application of anisotropic chemical etching techniques.

  19. Modeling the characteristic etch morphologies along specific crystallographic orientations by anisotropic chemical etching

    Science.gov (United States)

    Li, Kun-Dar; Miao, Jin-Ru

    2018-02-01

    To improve the advanced manufacturing technology for functional materials, a sophisticated control of chemical etching process is highly demanded, especially in the fields of environment and energy related applications. In this study, a phase-field-based model is utilized to investigate the etch morphologies influenced by the crystallographic characters during anisotropic chemical etching. Three types of etching modes are inspected theoretically, including the isotropic, and preferred oriented etchings. Owing to the specific etching behavior along the crystallographic directions, different characteristic surface structures are presented in the simulations, such as the pimple-like, pyramidal hillock and ridge-like morphologies. In addition, the processing parameters affecting the surface morphological formation and evolution are also examined systematically. According to the numerical results, the growth mechanism of surface morphology in a chemical etching is revealed distinctly. While the etching dynamics plays a dominant role on the surface formation, the characteristic surface morphologies corresponding to the preferred etching direction become more apparent. As the atomic diffusion turned into a determinative factor, a smoothened surface would appear, even under the anisotropic etching conditions. These simulation results provide fundamental information to enhance the development and application of anisotropic chemical etching techniques.

  20. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  1. Building an Anisotropic Meniscus with Zonal Variations

    Science.gov (United States)

    Higashioka, Michael M.; Chen, Justin A.; Hu, Jerry C.

    2014-01-01

    Toward addressing the difficult problems of knee meniscus regeneration, a self-assembling process has been used to re-create the native morphology and matrix properties. A significant problem in such attempts is the recapitulation of the distinct zones of the meniscus, the inner, more cartilaginous and the outer, more fibrocartilaginous zones. In this study, an anisotropic and zonally variant meniscus was produced by self-assembly of the inner meniscus (100% chondrocytes) followed by cell seeding the outer meniscus (coculture of chondrocytes and meniscus cells). After 4 weeks in culture, the engineered, inner meniscus exhibited a 42% increase in both instantaneous and relaxation moduli and a 62% increase in GAG/DW, as compared to the outer meniscus. In contrast, the circumferential tensile modulus and collagen/DW of the outer zone was 101% and 129% higher, respectively, than the values measured for the inner zone. Furthermore, there was no difference in the radial tensile modulus between the control and zonal engineered menisci, suggesting that the inner and outer zones of the engineered zonal menisci successfully integrated. These data demonstrate that not only can biomechanical and biochemical properties be engineered to differ by the zone, but they can also recapitulate the anisotropic behavior of the knee meniscus. PMID:23931258

  2. Turbulent Output-Based Anisotropic Adaptation

    Science.gov (United States)

    Park, Michael A.; Carlson, Jan-Renee

    2010-01-01

    Controlling discretization error is a remaining challenge for computational fluid dynamics simulation. Grid adaptation is applied to reduce estimated discretization error in drag or pressure integral output functions. To enable application to high O(10(exp 7)) Reynolds number turbulent flows, a hybrid approach is utilized that freezes the near-wall boundary layer grids and adapts the grid away from the no slip boundaries. The hybrid approach is not applicable to problems with under resolved initial boundary layer grids, but is a powerful technique for problems with important off-body anisotropic features. Supersonic nozzle plume, turbulent flat plate, and shock-boundary layer interaction examples are presented with comparisons to experimental measurements of pressure and velocity. Adapted grids are produced that resolve off-body features in locations that are not known a priori.

  3. Fractal behavior of single-particle trajectories and isosets in isotropic and anisotropic fluids

    International Nuclear Information System (INIS)

    Kalia, R.K.; Vashishta, P.; de Leeuw, S.W.

    1985-08-01

    Molecular dynamics simulations for a variety of systems in 2 spatial dimensions reveal fractual behavior associated with trajectories and isosets of single particle motion. The fractual dimensions of trajectories and isosets are 2 and 0.5, respectively, irrespective of the nature of the interparticle interaction or thermodynamic state of the system. Recently, we have investigated the fractual behavior of diffusing Ag ions in the superionic phase of Ag 2 S. MD calculations have shown that the Ag ions diffuse anisotropically along certain directions in the lattice of S particles. Fractual dimensions D and anti D for Ag ions are again 2 and 0.5, respectively. These results confirm the universal nature of fractual dimensions of trails and isosets

  4. Sound attenuation and absorption by anisotropic fibrous materials: Theoretical and experimental study

    Science.gov (United States)

    Bravo, Teresa; Maury, Cédric

    2018-03-01

    This paper describes analytical and experimental studies carried out to examine the attenuation and absorption properties of rigidly-backed fibrous anisotropic materials in contact with a uniform mean flow. The aim is to provide insights for the development of non-locally reacting wall-treatments able to dissipate the noise induced by acoustic excitations over in-duct or external lining systems. A model of sound propagation in anisotropic bulk-reacting liners is presented that fully accounts for anisotropic losses due to heat conduction, viscous dissipation and diffusion processes along and across the material fibres as well as for the convective effect of an external flow. The propagation constant for the least attenuated mode of the coupled system is obtained using a simulated annealing search method. The predicted acoustical performance is validated in the no-flow case for a wide range of fibre diameters. They are assessed against impedance tube and free-field pressure-velocity measurements of the normal incidence absorption coefficient and surface impedance. Parametric studies are then conducted to determine the key constitutive parameters such as the fibres orientation or the amount of anisotropy that mostly influence the axial attenuation or the normal absorption. They are supported by a low-frequency approximation to the axial attenuation under a low-speed flow.

  5. On Inverse Coefficient Heat-Conduction Problems on Reconstruction of Nonlinear Components of the Thermal-Conductivity Tensor of Anisotropic Bodies

    Science.gov (United States)

    Formalev, V. F.; Kolesnik, S. A.

    2017-11-01

    The authors are the first to present a closed procedure for numerical solution of inverse coefficient problems of heat conduction in anisotropic materials used as heat-shielding ones in rocket and space equipment. The reconstructed components of the thermal-conductivity tensor depend on temperature (are nonlinear). The procedure includes the formation of experimental data, the implicit gradient-descent method, the economical absolutely stable method of numerical solution of parabolic problems containing mixed derivatives, the parametric identification, construction, and numerical solution of the problem for elements of sensitivity matrices, the development of a quadratic residual functional and regularizing functionals, and also the development of algorithms and software systems. The implicit gradient-descent method permits expanding the quadratic functional in a Taylor series with retention of the linear terms for the increments of the sought functions. This substantially improves the exactness and stability of solution of the inverse problems. Software systems are developed with account taken of the errors in experimental data and disregarding them. On the basis of a priori assumptions of the qualitative behavior of the functional dependences of the components of the thermal-conductivity tensor on temperature, regularizing functionals are constructed by means of which one can reconstruct the components of the thermal-conductivity tensor with an error no higher than the error of the experimental data. Results of the numerical solution of the inverse coefficient problems on reconstruction of nonlinear components of the thermal-conductivity tensor have been obtained and are discussed.

  6. On the Diffusion Coefficient of Two-step Method for LWR analysis

    International Nuclear Information System (INIS)

    Lee, Deokjung; Choi, Sooyoung; Smith, Kord S.

    2015-01-01

    The few-group constants including diffusion coefficients are generated from the assembly calculation results. Once the assembly calculation is done, the cross sections (XSs) are spatially homogenized, and a critical spectrum calculation is performed in order to take into account the neutron leakages of the lattice. The diffusion coefficient is also generated through the critical spectrum calculation. Three different methods of the critical spectrum calculation such as B1 method, P1 method, and fundamental mode (FM) calculation method are considered in this paper. The diffusion coefficients can also be affected by transport approximations for the transport XS calculation which is used in the assembly transport lattice calculation in order to account for the anisotropic scattering effects. The outflow transport approximation and the inflow transport approximation are investigated in this paper. The accuracy of the few group data especially the diffusion coefficients has been studied to optimize the combination of the transport correction methods and the critical spectrum calculation methods using the UNIST lattice physics code STREAM. The combination of the inflow transport approximation and the FM method is shown to provide the highest accuracy in the LWR core calculations. The methodologies to calculate the diffusion coefficients have been reviewed, and the performances of them have been investigated with a LWR core problem. The combination of the inflow transport approximation and the fundamental mode critical spectrum calculation shows the smallest errors in terms of assembly power distribution

  7. Silicon as an anisotropic mechanical material

    DEFF Research Database (Denmark)

    Thomsen, Erik Vilain; Reck, Kasper; Skands, Gustav Erik

    2014-01-01

    While silicon is an anisotropic material it is often in literature treated as an isotropic material when it comes to plate calculations. This leads to considerable errors in the calculated deflection. To overcome this problem, we present an in-depth analysis of the bending behavior of thin crysta...... analytical models involving crystalline plates, such as those often found in the field of micro electro mechanical systems. The effect of elastic boundary conditions is taken into account by using an effective radius of the plate....

  8. Diffusive heat transport across magnetic islands and stochastic layers in tokamaks

    International Nuclear Information System (INIS)

    Hoelzl, Matthias

    2010-01-01

    Heat transport in tokamak plasmas with magnetic islands and ergodic field lines was simulated at realistic plasma parameters in realistic tokamak geometries. This requires the treatment of anisotropic heat diffusion, which is more efficient along magnetic field lines by up to ten orders of magnitude than perpendicular to them. Comparisons with analytical predictions and experimental measurements allow to determine the stability properties of neoclassical tearing modes as well as the experimental heat diffusion anisotropy.

  9. 3D anisotropic modeling and identification for airborne EM systems based on the spectral-element method

    Science.gov (United States)

    Huang, Xin; Yin, Chang-Chun; Cao, Xiao-Yue; Liu, Yun-He; Zhang, Bo; Cai, Jing

    2017-09-01

    The airborne electromagnetic (AEM) method has a high sampling rate and survey flexibility. However, traditional numerical modeling approaches must use high-resolution physical grids to guarantee modeling accuracy, especially for complex geological structures such as anisotropic earth. This can lead to huge computational costs. To solve this problem, we propose a spectral-element (SE) method for 3D AEM anisotropic modeling, which combines the advantages of spectral and finite-element methods. Thus, the SE method has accuracy as high as that of the spectral method and the ability to model complex geology inherited from the finite-element method. The SE method can improve the modeling accuracy within discrete grids and reduce the dependence of modeling results on the grids. This helps achieve high-accuracy anisotropic AEM modeling. We first introduced a rotating tensor of anisotropic conductivity to Maxwell's equations and described the electrical field via SE basis functions based on GLL interpolation polynomials. We used the Galerkin weighted residual method to establish the linear equation system for the SE method, and we took a vertical magnetic dipole as the transmission source for our AEM modeling. We then applied fourth-order SE calculations with coarse physical grids to check the accuracy of our modeling results against a 1D semi-analytical solution for an anisotropic half-space model and verified the high accuracy of the SE. Moreover, we conducted AEM modeling for different anisotropic 3D abnormal bodies using two physical grid scales and three orders of SE to obtain the convergence conditions for different anisotropic abnormal bodies. Finally, we studied the identification of anisotropy for single anisotropic abnormal bodies, anisotropic surrounding rock, and single anisotropic abnormal body embedded in an anisotropic surrounding rock. This approach will play a key role in the inversion and interpretation of AEM data collected in regions with anisotropic

  10. The numerical analysis of eigenvalue problem solutions in the multigroup neutron diffusion theory

    International Nuclear Information System (INIS)

    Woznicki, Z.I.

    1994-01-01

    The main goal of this paper is to present a general iteration strategy for solving the discrete form of multidimensional neutron diffusion equations equivalent mathematically to an eigenvalue problem. Usually a solution method is based on different levels of iterations. The presented matrix formalism allows us to visualize explicitly how the used matrix splitting influences the matrix structure in an eigenvalue problem to be solved as well as the interdependence between inner and outer iteration within global iterations. Particular interactive strategies are illustrated by numerical results obtained for several reactor problems. (author). 21 refs, 32 figs, 15 tabs

  11. The numerical analysis of eigenvalue problem solutions in the multigroup neutron diffusion theory

    Energy Technology Data Exchange (ETDEWEB)

    Woznicki, Z I [Institute of Atomic Energy, Otwock-Swierk (Poland)

    1994-12-31

    The main goal of this paper is to present a general iteration strategy for solving the discrete form of multidimensional neutron diffusion equations equivalent mathematically to an eigenvalue problem. Usually a solution method is based on different levels of iterations. The presented matrix formalism allows us to visualize explicitly how the used matrix splitting influences the matrix structure in an eigenvalue problem to be solved as well as the interdependence between inner and outer iteration within global iterations. Particular interactive strategies are illustrated by numerical results obtained for several reactor problems. (author). 21 refs, 32 figs, 15 tabs.

  12. Antisites and anisotropic diffusion in GaAs and GaSb

    KAUST Repository

    Tahini, H. A.; Bracht, H.; Chroneos, Alexander; Grimes, R. W.; Murphy, S. T.; Schwingenschlö gl, Udo

    2013-01-01

    The significant diffusion of Ga under Ga-rich conditions in GaAs and GaSb is counter intuitive as the concentration of Ga vacancies should be depressed although Ga vacancies are necessary to interpret the experimental evidence for Ga transport

  13. Spectral nodal methodology for multigroup slab-geometry discrete ordinates neutron transport problems with linearly anisotropic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Oliva, Amaury M.; Filho, Hermes A.; Silva, Davi M.; Garcia, Carlos R., E-mail: aoliva@iprj.uerj.br, E-mail: halves@iprj.uerj.br, E-mail: davijmsilva@yahoo.com.br, E-mail: cgh@instec.cu [Universidade do Estado do Rio de Janeiro (UERJ), Nova Friburgo, RJ (Brazil). Instituto Politecnico. Departamento de Modelagem Computacional; Instituto Superior de Tecnologias y Ciencias Aplicadas (InSTEC), La Habana (Cuba)

    2017-07-01

    In this paper, we propose a numerical methodology for the development of a method of the spectral nodal class that will generate numerical solutions free from spatial truncation errors. This method, denominated Spectral Deterministic Method (SDM), is tested as an initial study of the solutions (spectral analysis) of neutron transport equations in the discrete ordinates (S{sub N}) formulation, in one-dimensional slab geometry, multigroup approximation, with linearly anisotropic scattering, considering homogeneous and heterogeneous domains with fixed source. The unknowns in the methodology are the cell-edge, and cell average angular fluxes, the numerical values calculated for these quantities coincide with the analytic solution of the equations. These numerical results are shown and compared with the traditional ne- mesh method Diamond Difference (DD) and the coarse-mesh method spectral Green's function (SGF) to illustrate the method's accuracy and stability. The solution algorithms problems are implemented in a computer simulator made in C++ language, the same that was used to generate the results of the reference work. (author)

  14. A multipoint flux approximation of the steady-state heat conduction equation in anisotropic media

    KAUST Repository

    Salama, Amgad; Sun, Shuyu; El-Amin, M. F.

    2013-01-01

    In this work, we introduce multipoint flux (MF) approximation method to the problem of conduction heat transfer in anisotropic media. In such media, the heat flux vector is no longer coincident with the temperature gradient vector. In this case, thermal conductivity is described as a second order tensor that usually requires, at least, six quantities to be fully defined in general three-dimensional problems. The two-point flux finite differences approximation may not handle such anisotropy and essentially more points need to be involved to describe the heat flux vector. In the framework of mixed finite element method (MFE), the MFMFE methods are locally conservative with continuous normal fluxes. We consider the lowest order Brezzi-Douglas-Marini (BDM) mixed finite element method with a special quadrature rule that allows for nodal velocity elimination resulting in a cell-centered system for the temperature. We show comparisons with some analytical solution of the problem of conduction heat transfer in anisotropic long strip. We also consider the problem of heat conduction in a bounded, rectangular domain with different anisotropy scenarios. It is noticed that the temperature field is significantly affected by such anisotropy scenarios. Also, the technique used in this work has shown that it is possible to use the finite difference settings to handle heat transfer in anisotropic media. In this case, heat flux vectors, for the case of rectangular mesh, generally require six points to be described. Copyright © 2013 by ASME.

  15. A multipoint flux approximation of the steady-state heat conduction equation in anisotropic media

    KAUST Repository

    Salama, Amgad

    2013-03-20

    In this work, we introduce multipoint flux (MF) approximation method to the problem of conduction heat transfer in anisotropic media. In such media, the heat flux vector is no longer coincident with the temperature gradient vector. In this case, thermal conductivity is described as a second order tensor that usually requires, at least, six quantities to be fully defined in general three-dimensional problems. The two-point flux finite differences approximation may not handle such anisotropy and essentially more points need to be involved to describe the heat flux vector. In the framework of mixed finite element method (MFE), the MFMFE methods are locally conservative with continuous normal fluxes. We consider the lowest order Brezzi-Douglas-Marini (BDM) mixed finite element method with a special quadrature rule that allows for nodal velocity elimination resulting in a cell-centered system for the temperature. We show comparisons with some analytical solution of the problem of conduction heat transfer in anisotropic long strip. We also consider the problem of heat conduction in a bounded, rectangular domain with different anisotropy scenarios. It is noticed that the temperature field is significantly affected by such anisotropy scenarios. Also, the technique used in this work has shown that it is possible to use the finite difference settings to handle heat transfer in anisotropic media. In this case, heat flux vectors, for the case of rectangular mesh, generally require six points to be described. Copyright © 2013 by ASME.

  16. An algorithm for solving the optical problem for stratified anisotropic media

    Energy Technology Data Exchange (ETDEWEB)

    Palto, S P [Shubnikov Institute of Crystallography, Russian Academy of Sciences, Leninskii pr. 59, Moscow, 117333 (Russian Federation)

    2001-04-01

    An algorithm for solving the Maxwell equations for propagation of light through anisotropic stratified media is considered. The algorithm uses the Berreman matrices of order 4 x 4. In contrast to the numerical methods suggested by Berreman, the new method is exact. The Sylvester theorem for calculating functions of a matrix and the Laguerre method for determining eigenvalues provide the basis for an algorithm with an efficiency comparable to that of the algorithms based on analytic solutions, which exist only in the case of uniaxial media. The method suggested in this paper allows for the analysis of complex optical systems where the effects of biaxiality, magnetic anisotropy, and optical activity play an important role.

  17. THEMIS Observations of the Magnetopause Electron Diffusion Region: Large Amplitude Waves and Heated Electrons

    Science.gov (United States)

    Tang, Xiangwei; Cattell, Cynthia; Dombeck, John; Dai, Lei; Wilson, Lynn B. III; Breneman, Aaron; Hupack, Adam

    2013-01-01

    We present the first observations of large amplitude waves in a well-defined electron diffusion region based on the criteria described by Scudder et al at the subsolar magnetopause using data from one Time History of Events and Macroscale Interactions during Substorms (THEMIS) satellite. These waves identified as whistler mode waves, electrostatic solitary waves, lower hybrid waves, and electrostatic electron cyclotron waves, are observed in the same 12 s waveform capture and in association with signatures of active magnetic reconnection. The large amplitude waves in the electron diffusion region are coincident with abrupt increases in electron parallel temperature suggesting strong wave heating. The whistler mode waves, which are at the electron scale and which enable us to probe electron dynamics in the diffusion region were analyzed in detail. The energetic electrons (approx. 30 keV) within the electron diffusion region have anisotropic distributions with T(sub e(right angle))/T(sub e(parallel)) > 1 that may provide the free energy for the whistler mode waves. The energetic anisotropic electrons may be produced during the reconnection process. The whistler mode waves propagate away from the center of the "X-line" along magnetic field lines, suggesting that the electron diffusion region is a possible source region of the whistler mode waves.

  18. Convergence Analysis of a FV-FE Scheme for Partially Miscible Two-Phase Flow in Anisotropic Porous Media

    KAUST Repository

    Saad, Bilal Mohammed; Saad, Mazen

    2014-01-01

    We study the convergence of a combined finite volume nonconforming finite element scheme on general meshes for a partially miscible two-phase flow model in anisotropic porous media. This model includes capillary effects and exchange between the phase. The diffusion term,which can be anisotropic and heterogeneous, is discretized by piecewise linear nonconforming triangular finite elements. The other terms are discretized by means of a cell-centered finite volume scheme on a dual mesh. The relative permeability of each phase is decentred according the sign of the velocity at the dual interface. The convergence of the scheme is proved thanks to an estimate on the two pressures which allows to show estimates on the discrete time and compactness results in the case of degenerate relative permeabilities. A key point in the scheme is to use particular averaging formula for the dissolution function arising in the diffusion term. We show also a simulation of CO2 injection in a water saturated reservoir and nuclear waste management. Numerical results are obtained by in-house numerical code. © Springer International Publishing Switzerland 2014.

  19. A two-dimensional linear elasticity problem for anisotropic materials, solved with a parallelization code

    Directory of Open Access Journals (Sweden)

    Mihai-Victor PRICOP

    2010-09-01

    Full Text Available The present paper introduces a numerical approach of static linear elasticity equations for anisotropic materials. The domain and boundary conditions are simple, to enhance an easy implementation of the finite difference scheme. SOR and gradient are used to solve the resulting linear system. The simplicity of the geometry is also useful for MPI parallelization of the code.

  20. Quantifying brain microstructure with diffusion MRI

    DEFF Research Database (Denmark)

    Novikov, Dmitry S.; Jespersen, Sune N.; Kiselev, Valerij G.

    2016-01-01

    the potential to quantify the relevant length scales for neuronal tissue, such as the packing correlation length for neuronal fibers, the degree of neuronal beading, and compartment sizes. The second avenue corresponds to the long-time limit, when the observed signal can be approximated as a sum of multiple non......-exchanging anisotropic Gaussian components. Here the challenge lies in parameter estimation and in resolving its hidden degeneracies. The third avenue employs multiple diffusion encoding techniques, able to access information not contained in the conventional diffusion propagator. We conclude with our outlook...... on the future research directions which can open exciting possibilities for developing markers of pathology and development based on methods of studying mesoscopic transport in disordered systems....

  1. New PDE-based methods for image enhancement using SOM and Bayesian inference in various discretization schemes

    International Nuclear Information System (INIS)

    Karras, D A; Mertzios, G B

    2009-01-01

    A novel approach is presented in this paper for improving anisotropic diffusion PDE models, based on the Perona–Malik equation. A solution is proposed from an engineering perspective to adaptively estimate the parameters of the regularizing function in this equation. The goal of such a new adaptive diffusion scheme is to better preserve edges when the anisotropic diffusion PDE models are applied to image enhancement tasks. The proposed adaptive parameter estimation in the anisotropic diffusion PDE model involves self-organizing maps and Bayesian inference to define edge probabilities accurately. The proposed modifications attempt to capture not only simple edges but also difficult textural edges and incorporate their probability in the anisotropic diffusion model. In the context of the application of PDE models to image processing such adaptive schemes are closely related to the discrete image representation problem and the investigation of more suitable discretization algorithms using constraints derived from image processing theory. The proposed adaptive anisotropic diffusion model illustrates these concepts when it is numerically approximated by various discretization schemes in a database of magnetic resonance images (MRI), where it is shown to be efficient in image filtering and restoration applications

  2. On one model problem for the reaction-diffusion-advection equation

    Science.gov (United States)

    Davydova, M. A.; Zakharova, S. A.; Levashova, N. T.

    2017-09-01

    The asymptotic behavior of the solution with boundary layers in the time-independent mathematical model of reaction-diffusion-advection arising when describing the distribution of greenhouse gases in the surface atmospheric layer is studied. On the basis of the asymptotic method of differential inequalities, the existence of a boundary-layer solution and its asymptotic Lyapunov stability as a steady-state solution of the corresponding parabolic problem is proven. One of the results of this work is the determination of the local domain of the attraction of a boundary-layer solution.

  3. Parallel preconditioned conjugate gradient algorithm applied to neutron diffusion problem

    International Nuclear Information System (INIS)

    Majumdar, A.; Martin, W.R.

    1992-01-01

    Numerical solution of the neutron diffusion problem requires solving a linear system of equations such as Ax = b, where A is an n x n symmetric positive definite (SPD) matrix; x and b are vectors with n components. The preconditioned conjugate gradient (PCG) algorithm is an efficient iterative method for solving such a linear system of equations. In this paper, the authors describe the implementation of a parallel PCG algorithm on a shared memory machine (BBN TC2000) and on a distributed workstation (IBM RS6000) environment created by the parallel virtual machine parallelization software

  4. An axisymmetric diffusion experiment for the determination of diffusion and sorption coefficients of rock samples.

    Science.gov (United States)

    Takeda, M; Hiratsuka, T; Ito, K; Finsterle, S

    2011-04-25

    Diffusion anisotropy is a critical property in predicting migration of substances in sedimentary formations with very low permeability. The diffusion anisotropy of sedimentary rocks has been evaluated mainly from laboratory diffusion experiments, in which the directional diffusivities are separately estimated by through-diffusion experiments using different rock samples, or concurrently by in-diffusion experiments in which only the tracer profile in a rock block is measured. To estimate the diffusion anisotropy from a single rock sample, this study proposes an axisymmetric diffusion test, in which tracer diffuses between a cylindrical rock sample and a surrounding solution reservoir. The tracer diffusion between the sample and reservoir can be monitored from the reservoir tracer concentrations, and the tracer profile could also be obtained after dismantling the sample. Semi-analytical solutions are derived for tracer concentrations in both the reservoir and sample, accounting for an anisotropic diffusion tensor of rank two as well as the dilution effects from sampling and replacement of reservoir solution. The transient and steady-state analyses were examined experimentally and numerically for different experimental configurations, but without the need for tracer profiling. These experimental configurations are tested for in- and out-diffusion experiments using Koetoi and Wakkanai mudstones and Shirahama sandstone, and are scrutinized by a numerical approach to identify favorable conditions for parameter estimation. The analysis reveals the difficulty in estimating diffusion anisotropy; test configurations are proposed for enhanced identifiability of diffusion anisotropy. Moreover, it is demonstrated that the axisymmetric diffusion test is efficient in obtaining the sorption parameter from both steady-state and transient data, and in determining the effective diffusion coefficient if isotropic diffusion is assumed. Moreover, measuring reservoir concentrations in an

  5. An asixymmetric diffusion experiment for the determination of diffusion and sorption coefficients of rock samples

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, M.; Hiratsuka, T.; Ito, K.; Finsterle, S.

    2011-02-01

    Diffusion anisotropy is a critical property in predicting migration of substances in sedimentary formations with very low permeability. The diffusion anisotropy of sedimentary rocks has been evaluated mainly from laboratory diffusion experiments, in which the directional diffusivities are separately estimated by through-diffusion experiments using different rock samples, or concurrently by in-diffusion experiments in which only the tracer profile in a rock block is measured. To estimate the diffusion anisotropy from a single rock sample, this study proposes an axisymmetric diffusion test, in which tracer diffuses between a cylindrical rock sample and a surrounding solution reservoir. The tracer diffusion between the sample and reservoir can be monitored from the reservoir tracer concentrations, and the tracer profile could also be obtained after dismantling the sample. Semi-analytical solutions are derived for tracer concentrations in both the reservoir and sample, accounting for an anisotropic diffusion tensor of rank two as well as the dilution effects from sampling and replacement of reservoir solution. The transient and steady-state analyses were examined experimentally and numerically for different experimental configurations, but without the need for tracer profiling. These experimental configurations are tested for in- and out-diffusion experiments using Koetoi and Wakkanai mudstones and Shirahama sandstone, and are scrutinized by a numerical approach to identify favorable conditions for parameter estimation. The analysis reveals the difficulty in estimating diffusion anisotropy; test configurations are proposed for enhanced identifiability of diffusion anisotropy. Moreover, it is demonstrated that the axisymmetric diffusion test is efficient in obtaining the sorption parameter from both steady-state and transient data, and in determining the effective diffusion coefficient if isotropic diffusion is assumed. Moreover, measuring reservoir concentrations in an

  6. Effective diffusion in time-periodic linear planar flow

    International Nuclear Information System (INIS)

    Indeikina, A.; Chang, H.

    1993-01-01

    It is shown that when a point source of solute is inserted into a time-periodic, unbounded linear planar flow, the large-time, time-average transport of the solute can be described by classical anisotropic diffusion with constant effective diffusion tensors. For a given vorticity and forcing period, elongational flow is shown to be the most dispersive followed by simple shear and rotational flow. Large-time diffusivity along the major axis of the time-average concentration ellipse, whose alignment is predicted from the theory, is shown to increase with vorticity for all flows and decrease with increasing forcing frequency for elongational flow and simple shear. For the interesting case of rotational flow, there exist discrete resonant frequencies where the time-average major diffusivity reaches local maxima equal to the time-average steady flow case with zero forcing frequency

  7. Efficient Wavefield Extrapolation In Anisotropic Media

    KAUST Repository

    Alkhalifah, Tariq; Ma, Xuxin; Waheed, Umair bin; Zuberi, Mohammad Akbar Hosain

    2014-01-01

    Various examples are provided for wavefield extrapolation in anisotropic media. In one example, among others, a method includes determining an effective isotropic velocity model and extrapolating an equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. The effective isotropic velocity model can be based upon a kinematic geometrical representation of an anisotropic, poroelastic or viscoelastic wavefield. Extrapolating the equivalent propagation can use isotopic, acoustic or elastic operators based upon the determined effective isotropic velocity model. In another example, non-transitory computer readable medium stores an application that, when executed by processing circuitry, causes the processing circuitry to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. In another example, a system includes processing circuitry and an application configured to cause the system to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield.

  8. Efficient Wavefield Extrapolation In Anisotropic Media

    KAUST Repository

    Alkhalifah, Tariq

    2014-07-03

    Various examples are provided for wavefield extrapolation in anisotropic media. In one example, among others, a method includes determining an effective isotropic velocity model and extrapolating an equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. The effective isotropic velocity model can be based upon a kinematic geometrical representation of an anisotropic, poroelastic or viscoelastic wavefield. Extrapolating the equivalent propagation can use isotopic, acoustic or elastic operators based upon the determined effective isotropic velocity model. In another example, non-transitory computer readable medium stores an application that, when executed by processing circuitry, causes the processing circuitry to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. In another example, a system includes processing circuitry and an application configured to cause the system to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield.

  9. Investigate the effect of anisotropic order parameter on the specific heat of anisotropic two-band superconductors

    International Nuclear Information System (INIS)

    Udomsamuthirun, P.; Peamsuwan, R.; Kumvongsa, C.

    2009-01-01

    The effect of anisotropic order parameter on the specific heat of anisotropic two-band superconductors in BCS weak-coupling limit is investigated. An analytical specific heat jump and the numerical specific heat are shown by using anisotropic order parameters, and the electron-phonon interaction and non-electron-phonon interaction. The two models of anisotropic order parameters are used for numerical calculation that we find little effect on the numerical results. The specific heat jump of MgB 2 , Lu 2 Fe 3 Si 5 and Nb 3 Sn superconductors can fit well with both of them. By comparing the experimental data with overall range of temperature, the best fit is Nb 3 Sn, MgB 2 , and Lu 2 Fe 3 Si 5 superconductors.

  10. Numerical investigation of nanoparticles transport in anisotropic porous media

    KAUST Repository

    Salama, Amgad

    2015-07-13

    In this work the problem related to the transport of nanoparticles in anisotropic porous media is investigated numerically using the multipoint flux approximation. Anisotropy of porous media properties are an essential feature that exist almost everywhere in subsurface formations. In anisotropic media, the flux and the pressure gradient vectors are no longer collinear and therefore interesting patterns emerge. The transport of nanoparticles in subsurface formations is affected by several complex processes including surface charges, heterogeneity of nanoparticles and soil grain collectors, interfacial dynamics of double-layer and many others. We use the framework of the theory of filtration in this investigation. Processes like particles deposition, entrapment, as well as detachment are accounted for. From the numerical methods point of view, traditional two-point flux finite difference approximation cannot handle anisotropy of media properties. Therefore, in this work we use the multipoint flux approximation (MPFA). In this technique, the flux components are affected by more neighboring points as opposed to the mere two points that are usually used in traditional finite volume methods. We also use the experimenting pressure field approach which automatically constructs the global system of equations by solving multitude of local problems. This approach facilitates to a large extent the construction of the global system. A set of numerical examples is considered involving two-dimensional rectangular domain. A source of nanoparticles is inserted in the middle of the anisotropic layer. We investigate the effects of both anisotropy angle and anisotropy ratio on the transport of nanoparticles in saturated porous media. It is found that the concentration plume and porosity contours follow closely the principal direction of anisotropy of permeability of the central domain.

  11. Numerical investigation of nanoparticles transport in anisotropic porous media

    KAUST Repository

    Salama, Amgad; Negara, Ardiansyah; El Amin, Mohamed; Sun, Shuyu

    2015-01-01

    In this work the problem related to the transport of nanoparticles in anisotropic porous media is investigated numerically using the multipoint flux approximation. Anisotropy of porous media properties are an essential feature that exist almost everywhere in subsurface formations. In anisotropic media, the flux and the pressure gradient vectors are no longer collinear and therefore interesting patterns emerge. The transport of nanoparticles in subsurface formations is affected by several complex processes including surface charges, heterogeneity of nanoparticles and soil grain collectors, interfacial dynamics of double-layer and many others. We use the framework of the theory of filtration in this investigation. Processes like particles deposition, entrapment, as well as detachment are accounted for. From the numerical methods point of view, traditional two-point flux finite difference approximation cannot handle anisotropy of media properties. Therefore, in this work we use the multipoint flux approximation (MPFA). In this technique, the flux components are affected by more neighboring points as opposed to the mere two points that are usually used in traditional finite volume methods. We also use the experimenting pressure field approach which automatically constructs the global system of equations by solving multitude of local problems. This approach facilitates to a large extent the construction of the global system. A set of numerical examples is considered involving two-dimensional rectangular domain. A source of nanoparticles is inserted in the middle of the anisotropic layer. We investigate the effects of both anisotropy angle and anisotropy ratio on the transport of nanoparticles in saturated porous media. It is found that the concentration plume and porosity contours follow closely the principal direction of anisotropy of permeability of the central domain.

  12. An iterative algorithm for the finite element approximation to convection-diffusion problems

    International Nuclear Information System (INIS)

    Buscaglia, Gustavo; Basombrio, Fernando

    1988-01-01

    An iterative algorithm for steady convection-diffusion is presented, which avoids unsymmetric matrices by means of an equivalent mixed formulation. Upwind is introduced by adding a balancing dissipation in the flow direction, but there is no dependence of the global matrix on the velocity field. Convergence is shown in habitual test cases. Advantages of its use in coupled calculation of more complex problems are discussed. (Author)

  13. Uniqueness for cross-diffusion systems issuing from seawater intrusion problems

    Directory of Open Access Journals (Sweden)

    Catherine Choquet

    2017-10-01

    Full Text Available We consider a model mixing sharp and diffuse interface approaches for seawater intrusion phenomenons in confined and unconfined aquifers. More precisely, a phase field model is introduced in the boundary conditions on the virtual sharp interfaces. We thus include in the model the existence of diffuse transition zones but we preserve the simplified structure allowing front tracking. The three-dimensional problem then reduces to a two-dimensional model involving a strongly coupled system of partial differential equations of parabolic and elliptic type describing the evolution of the depth of the interface between salt- and freshwater and the evolution of the freshwater hydraulic head. Assuming a low hydraulic conductivity inside the aquifer, we prove the uniqueness of a weak solution for the model completed with initial and boundary conditions. Thanks to a generalization of a Meyer's regularity result, we establish that the gradient of the solution belongs to the space $L^r$, r>2. This additional regularity combined with the Gagliardo-Nirenberg inequality for r=4 allows to handle the nonlinearity of the system in the proof of uniqueness.

  14. Boundary element methods applied to two-dimensional neutron diffusion problems

    International Nuclear Information System (INIS)

    Itagaki, Masafumi

    1985-01-01

    The Boundary element method (BEM) has been applied to two-dimensional neutron diffusion problems. The boundary integral equation and its discretized form have been derived. Some numerical techniques have been developed, which can be applied to critical and fixed-source problems including multi-region ones. Two types of test programs have been developed according to whether the 'zero-determinant search' or the 'source iteration' technique is adopted for criticality search. Both programs require only the fluxes and currents on boundaries as the unknown variables. The former allows a reduction in computing time and memory in comparison with the finite element method (FEM). The latter is not always efficient in terms of computing time due to the domain integral related to the inhomogeneous source term; however, this domain integral can be replaced by the equivalent boundary integral for a region with a non-multiplying medium or with a uniform source, resulting in a significant reduction in computing time. The BEM, as well as the FEM, is well suited for solving irregular geometrical problems for which the finite difference method (FDM) is unsuited. The BEM also solves problems with infinite domains, which cannot be solved by the ordinary FEM and FDM. Some simple test calculations are made to compare the BEM with the FEM and FDM, and discussions are made concerning the relative merits of the BEM and problems requiring future solution. (author)

  15. Comparison of finite-difference and variational solutions to advection-diffusion problems

    International Nuclear Information System (INIS)

    Lee, C.E.; Washington, K.E.

    1984-01-01

    Two numerical solution methods are developed for 1-D time-dependent advection-diffusion problems on infinite and finite domains. Numerical solutions are compared with analytical results for constant coefficients and various boundary conditions. A finite-difference spectrum method is solved exactly in time for periodic boundary conditions by a matrix operator method and exhibits excellent accuracy compared with other methods, especially at late times, where it is also computationally more efficient. Finite-system solutions are determined from a conservational variational principle with cubic spatial trial functions and solved in time by a matrix operator method. Comparisons of problems with few nodes show excellent agreement with analytical solutions and exhibit the necessity of implementing Lagrangian conservational constraints for physically-correct solutions. (author)

  16. The Effective Coherence Length in Anisotropic Superconductors

    International Nuclear Information System (INIS)

    Polturak, E.; Koren, G.; Nesher, O

    1999-01-01

    If electrons are transmitted from a normal conductor(N) into a superconductor(S), common wisdom has it that the electrons are converted into Cooper pairs within a coherence length from the interface. This is true in conventional superconductors with an isotropic order parameter. We have established experimentally that the situation is rather different in high Tc superconductors having an anisotropic order parameter. We used epitaxial thin film S/N bilayers having different interface orientations in order to inject carriers from S into N along different directions. The distance to which these carriers penetrate were determined through their effect on the Tc of the bilayers. We found that the effective coherence length is 20A only along the a or b directions, while in other directions we find a length of 250dr20A out of plane, and an even larger value for in-plane, off high symmetry directions. These observations can be explained using the Blonder-Tinkham-Klapwijk model adapted to anisotropic superconductivity. Several implications of our results on outstanding problems with high Tc junctions will be discussed

  17. Nano-sized Adsorbate Structure Formation in Anisotropic Multilayer System

    Science.gov (United States)

    Kharchenko, Vasyl O.; Kharchenko, Dmitrii O.; Yanovsky, Vladimir V.

    2017-05-01

    In this article, we study dynamics of adsorbate island formation in a model plasma-condensate system numerically. We derive the generalized reaction-diffusion model for adsorptive multilayer system by taking into account anisotropy in transfer of adatoms between neighbor layers induced by electric field. It will be found that with an increase in the electric field strength, a structural transformation from nano-holes inside adsorbate matrix toward separated nano-sized adsorbate islands on a substrate is realized. Dynamics of adsorbate island sizes and corresponding distributions are analyzed in detail. This study provides an insight into details of self-organization of adatoms into nano-sized adsorbate islands in anisotropic multilayer plasma-condensate systems.

  18. Albedo of low-energy light ions: case of anisotropic approximation of the collision integral

    International Nuclear Information System (INIS)

    Simovic, R.; Vukanic, J. . E-mail address of corresponding author: simovicr@vin.bg.ac.yu; Simovic, R.)

    2005-01-01

    For diffusion and slowing-down of low-energy light ions, the linear transport equation in the path length form was rederived taking into account a common anisotropic approximation of the collision integral. Assuming that the transport cross section depends only on the ion initial energy, the equation was Laplace-transformed over the relative path length and half-space albedo problem was considered by using the ordinary DPN technique. The Laplace-transformed reflection function was found in the lowest order of DPN flux approximation, and then was inverted analytically leading to the distribution of backscattered particles in the relative path-length. For the general power potential V(R)∞R -1/m the particle reflection coefficient was obtained as a series, while for the special case of the inverse square potential (m=1/2) this coefficient was determined in a compact form. The present approach was compared with the TRIM simulations of helium ion reflection, as well as with the Tilinin - Betz fitting formula and the MARLOWE simulations of proton reflection. (author)

  19. Complex Anisotropic Structure of the Mantle Wedge Beneath Kamchatka Volcanoes

    Science.gov (United States)

    Levin, V.; Park, J.; Gordeev, E.; Droznin, D.

    2002-12-01

    the slab. To explain the vertical stratification of anisotropy implied from receiver functions, and the strong lateral dependence of shear-wave splitting observations, we cannot rely on simple models of mantle wedge behaviour e.g., olivine-crystal alignment through subduction-driven corner flow. Diverse mechanisms can contribute to the observed pattern of anisotropic properties, with volatiles likely being a key influence. For instance, we find evidence in favor of a slow-symmetry-axis anisotropy within the uppermost 10-20 km of the mantle wedge, implying either excessive hydration of the mantle or else a presence of systematically aligned volatile-filled cracks or lenses. Also, shear-wave splitting is weak beneath the Avachinsky-Koryaksky volcanic center, suggesting either vertical flow or the influence of volatiles and/or thermally-enhanced diffusion creep.

  20. Measuring anisotropic muscle stiffness properties using elastography.

    Science.gov (United States)

    Green, M A; Geng, G; Qin, E; Sinkus, R; Gandevia, S C; Bilston, L E

    2013-11-01

    Physiological and pathological changes to the anisotropic mechanical properties of skeletal muscle are still largely unknown, with only a few studies quantifying changes in vivo. This study used the noninvasive MR elastography (MRE) technique, in combination with diffusion tensor imaging (DTI), to measure shear modulus anisotropy in the human skeletal muscle in the lower leg. Shear modulus measurements parallel and perpendicular to the fibre direction were made in 10 healthy subjects in the medial gastrocnemius, soleus and tibialis anterior muscles. The results showed significant differences in the medial gastrocnemius (μ‖ = 0.86 ± 0.15 kPa; μ⊥ = 0.66 ± 0.19 kPa, P < 0.001), soleus (μ‖ = 0.83 ± 0.22 kPa; μ⊥ = 0.65 ± 0.13 kPa, P < 0.001) and the tibialis anterior (μ‖ = 0.78 ± 0.24 kPa; μ⊥ = 0.66 ± 0.16 kPa, P = 0.03) muscles, where the shear modulus measured in the direction parallel is greater than that measured in the direction perpendicular to the muscle fibres. No significant differences were measured across muscle groups. This study provides the first direct estimates of the anisotropic shear modulus in the triceps surae muscle group, and shows that the technique may be useful for the probing of mechanical anisotropy changes caused by disease, aging and injury. Copyright © 2013 John Wiley & Sons, Ltd.

  1. CT reconstruction from few-views with anisotropic edge-guided total variance

    International Nuclear Information System (INIS)

    Rong, Junyan; Liu, Wenlei; Gao, Peng; Liao, Qimei; Jiao, Chun; Ma, Jianhua; Lu, Hongbing

    2016-01-01

    To overcome the oversmoothing drawback in the edge areas when reconstructing few-view CT with total variation (TV) minimization, in this paper, we propose an anisotropic edge-guided TV minimization framework for few-view CT reconstruction. In the framework, anisotropic TV is summed with pre-weighted image gradient and then used as the object function for minimizing. It includes edge-guided TV minimization (EGTV) and edge-guided adaptive-weighted TV minimization (EGAwTV) algorithms. For EGTV algorithm, the weights of the TV discretization term are updated by anisotropic edge information detected from the image, whereas the weights for EGAwTV are determined based on edge information and local image-intensity gradients. To solve the minimization problem of the proposed algorithm, a similar TV-based minimization implementation is developed to address the raw data fidelity and other constraints. The evaluation results using both computer simulations with the Shepp-Logan phantom and experimental data from a physical phantom demonstrate that the proposed algorithms exhibit noticeable gains in the merits of spatial resolution compared with the conventional TV and other modified TV algorithms.

  2. Anisotropic O vacancy formation and diffusion in LaMnO3

    KAUST Repository

    Gan, Liyong; Salawu, Omotayo Akande; Schwingenschlö gl, Udo

    2014-01-01

    Anisotropy effects in solid oxide fuel cells are typically not considered because of high operating temperatures. Focusing on the prototypical perovskite LaMnO3, we apply first-principles calculations to demonstrate that this approximation is no longer valid when the operating temperature is reduced and discuss the consequences for the material properties. In addition, we show that strain and Sr doping can be used to further increase the anisotropy. Tensile strain promotes both the O vacancy formation and diffusion in pristine and Sr doped LaMnO3, while Sr doping enhances the O vacancy formation. Both in LaMnO3 and La0.75Sr0.25MnO3 the O diffusion is found to be favorable in the [011] and [011] directions.

  3. The measurement problem on classical diffusion process: inverse method on stochastic processes

    International Nuclear Information System (INIS)

    Bigerelle, M.; Iost, A.

    2004-01-01

    In a high number of diffusive systems, measures are processed to calculate material parameters such as diffusion coefficients, or to verify the accuracy of mathematical models. However, the precision of the parameter determination or of the model relevance depends on the location of the measure itself. The aim of this paper is first to analyse, for a mono-dimensional system, the precision of the measure in relation with its location by an inverse problem algorithm and secondly to examine the physical meaning of the results. Statistical mechanic considerations show that, passing over a time-distance criterion, measurement becomes uncertain whatever the initial conditions. The criterion proves that this chaotic mode is related to the production of anti-entropy at a mesoscopique scale that is in violation to quantum theory about measurement

  4. Jigsaw puzzle metasurface for multiple functions: polarization conversion, anomalous reflection and diffusion.

    Science.gov (United States)

    Zhao, Yi; Cao, Xiangyu; Gao, Jun; Liu, Xiao; Li, Sijia

    2016-05-16

    We demonstrate a simple reconfigurable metasurface with multiple functions. Anisotropic tiles are investigated and manufactured as fundamental elements. Then, the tiles are combined in a certain sequence to construct a metasurface. Each of the tiles can be adjusted independently which is like a jigsaw puzzle and the whole metasurface can achieve diverse functions by different layouts. For demonstration purposes, we realize polarization conversion, anomalous reflection and diffusion by a jigsaw puzzle metasurface with 6 × 6 pieces of anisotropic tile. Simulated and measured results prove that our method offers a simple and effective strategy for metasurface design.

  5. Effective Elliptic Models for Efficient Wavefield Extrapolation in Anisotropic Media

    KAUST Repository

    Waheed, Umair bin

    2014-05-01

    Wavefield extrapolation operator for elliptically anisotropic media offers significant cost reduction compared to that of transversely isotropic media (TI), especially when the medium exhibits tilt in the symmetry axis (TTI). However, elliptical anisotropy does not provide accurate focusing for TI media. Therefore, we develop effective elliptically anisotropic models that correctly capture the kinematic behavior of the TTI wavefield. Specifically, we use an iterative elliptically anisotropic eikonal solver that provides the accurate traveltimes for a TI model. The resultant coefficients of the elliptical eikonal provide the effective models. These effective models allow us to use the cheaper wavefield extrapolation operator for elliptic media to obtain approximate wavefield solutions for TTI media. Despite the fact that the effective elliptic models are obtained by kinematic matching using high-frequency asymptotic, the resulting wavefield contains most of the critical wavefield components, including the frequency dependency and caustics, if present, with reasonable accuracy. The methodology developed here offers a much better cost versus accuracy tradeoff for wavefield computations in TTI media, considering the cost prohibitive nature of the problem. We demonstrate the applicability of the proposed approach on the BP TTI model.

  6. On the creation of scalar particles in some anisotropic universe

    International Nuclear Information System (INIS)

    Nariai, Hidekazu.

    1978-01-01

    Because of an importance of the particle creation (especially, its possible fulfilment of the black-body law with a definite temperature) in an early universe to various other cosmological problems we study how the creation of scalar particles occurs in the Bianchi-type I anisotropic universe adopted in our previous works on the quantized scalar field. It is shown that, as in a special isotropic case dealt with in recent papers, the creation may occur at the sacrifice of the requirement that the quantization procedure should reproduce the usual theory for a free field in the limit when the anisotropic universe changes into the Minkowski space-time. It is further shown that the creation occurs in accordance with the black-body law only in a 2-dimensional hyper-surface relating to the anisotropic cosmic expansion, provided that we fix two arbitrary constants appearing in a general expression for the Feynman propagator in terms of a procedure similar to that in the isotropic case. A speculation on the isotropization of our model-universe is also made from the standpoint of seeking for how the thermal equilibrium in the whole universe is attained. (auth.)

  7. On the creation of scalar particles in some anisotropic universe

    International Nuclear Information System (INIS)

    Nariai, Hidekazu

    1978-01-01

    Because of an importance of the particle creation (especially, its possible fulfilment of the black-body law with a definite temperature) in an early universe to various other cosmological problems, we study how the creation of scalar particles occurs in the Bianchi-type I anisotropic universe adopted in our previous works on the quantized scalar field. It is shown that, as in a special isotropic case dealt with in recent papers, the creation may occur at the sacrifice of the requirement that the quantization procedure should reproduce the usual theory for a free field in the limit when the anisotropic universe changes into the Minkowski space-time. It is further shown that the creation occurs in accordance with the black-body law only in a 2-dimensional hyper-surface relating to the anisotropic cosmic expansion, provided that we fix two arbitrary constants appearing in a general expression for the Feynman propagator in terms of a procedure similar to that in the isotropic case. A speculation on the isotropization of our model-universe is also made from the standpoint of seeking the attainment of the thermal equilibrium in the whole universe. (author)

  8. Effective Elliptic Models for Efficient Wavefield Extrapolation in Anisotropic Media

    KAUST Repository

    Waheed, Umair bin; Alkhalifah, Tariq Ali

    2014-01-01

    Wavefield extrapolation operator for elliptically anisotropic media offers significant cost reduction compared to that of transversely isotropic media (TI), especially when the medium exhibits tilt in the symmetry axis (TTI). However, elliptical anisotropy does not provide accurate focusing for TI media. Therefore, we develop effective elliptically anisotropic models that correctly capture the kinematic behavior of the TTI wavefield. Specifically, we use an iterative elliptically anisotropic eikonal solver that provides the accurate traveltimes for a TI model. The resultant coefficients of the elliptical eikonal provide the effective models. These effective models allow us to use the cheaper wavefield extrapolation operator for elliptic media to obtain approximate wavefield solutions for TTI media. Despite the fact that the effective elliptic models are obtained by kinematic matching using high-frequency asymptotic, the resulting wavefield contains most of the critical wavefield components, including the frequency dependency and caustics, if present, with reasonable accuracy. The methodology developed here offers a much better cost versus accuracy tradeoff for wavefield computations in TTI media, considering the cost prohibitive nature of the problem. We demonstrate the applicability of the proposed approach on the BP TTI model.

  9. Anisotropic evaluation of synthetic surgical meshes.

    Science.gov (United States)

    Saberski, E R; Orenstein, S B; Novitsky, Y W

    2011-02-01

    The material properties of meshes used in hernia repair contribute to the overall mechanical behavior of the repair. The anisotropic potential of synthetic meshes, representing a difference in material properties (e.g., elasticity) in different material axes, is not well defined to date. Haphazard orientation of anisotropic mesh material can contribute to inconsistent surgical outcomes. We aimed to characterize and compare anisotropic properties of commonly used synthetic meshes. Six different polypropylene (Trelex(®), ProLite™, Ultrapro™), polyester (Parietex™), and PTFE-based (Dualmesh(®), Infinit) synthetic meshes were selected. Longitudinal and transverse axes were defined for each mesh, and samples were cut in each axis orientation. Samples underwent uniaxial tensile testing, from which the elastic modulus (E) in each axis was determined. The degree of anisotropy (λ) was calculated as a logarithmic expression of the ratio between the elastic modulus in each axis. Five of six meshes displayed significant anisotropic behavior. Ultrapro™ and Infinit exhibited approximately 12- and 20-fold differences between perpendicular axes, respectively. Trelex(®), ProLite™, and Parietex™ were 2.3-2.4 times. Dualmesh(®) was the least anisotropic mesh, without marked difference between the axes. Anisotropy of synthetic meshes has been underappreciated. In this study, we found striking differences between elastic properties of perpendicular axes for most commonly used synthetic meshes. Indiscriminate orientation of anisotropic mesh may adversely affect hernia repairs. Proper labeling of all implants by manufacturers should be mandatory. Understanding the specific anisotropic behavior of synthetic meshes should allow surgeons to employ rational implant orientation to maximize outcomes of hernia repair.

  10. Cracking on anisotropic neutron stars

    Science.gov (United States)

    Setiawan, A. M.; Sulaksono, A.

    2017-07-01

    We study the effect of cracking of a local anisotropic neutron star (NS) due to small density fluctuations. It is assumed that the neutron star core consists of leptons, nucleons and hyperons. The relativistic mean field model is used to describe the core of equation of state (EOS). For the crust, we use the EOS introduced by Miyatsu et al. [1]. Furthermore, two models are used to describe pressure anisotropic in neutron star matter. One is proposed by Doneva-Yazadjiev (DY) [2] and the other is proposed by Herrera-Barreto (HB) [3]. The anisotropic parameter of DY and HB models are adjusted in order the predicted maximum mass compatible to the mass of PSR J1614-2230 [4] and PSR J0348+0432 [5]. We have found that cracking can potentially present in the region close to the neutron star surface. The instability due cracking is quite sensitive to the NS mass and anisotropic parameter used.

  11. Uniqueness for inverse problems of determining orders of multi-term time-fractional derivatives of diffusion equation

    OpenAIRE

    Li, Zhiyuan; Yamamoto, Masahiro

    2014-01-01

    This article proves the uniqueness for two kinds of inverse problems of identifying fractional orders in diffusion equations with multiple time-fractional derivatives by pointwise observation. By means of eigenfunction expansion and Laplace transform, we reduce the uniqueness for our inverse problems to the uniqueness of expansions of some special function and complete the proof.

  12. Fractional diffusion equations and anomalous diffusion

    CERN Document Server

    Evangelista, Luiz Roberto

    2018-01-01

    Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

  13. Quantitative Phase-Field Approach for Simulating Grain Growth in Anisotropic Systems with Arbitrary Inclination and Misorientation Dependence

    International Nuclear Information System (INIS)

    Moelans, N.; Blanpain, B.; Wollants, P.

    2008-01-01

    A phase-field approach for quantitative simulations of grain growth in anisotropic systems is introduced, together with a new methodology to derive appropriate model parameters that reproduce given misorientation and inclination dependent grain boundary energy and mobility in the simulations. The proposed model formulation and parameter choice guarantee a constant diffuse interface width and consequently give high controllability of the accuracy in grain growth simulations

  14. Diffusion of Zonal Variables Using Node-Centered Diffusion Solver

    Energy Technology Data Exchange (ETDEWEB)

    Yang, T B

    2007-08-06

    Tom Kaiser [1] has done some preliminary work to use the node-centered diffusion solver (originally developed by T. Palmer [2]) in Kull for diffusion of zonal variables such as electron temperature. To avoid numerical diffusion, Tom used a scheme developed by Shestakov et al. [3] and found their scheme could, in the vicinity of steep gradients, decouple nearest-neighbor zonal sub-meshes leading to 'alternating-zone' (red-black mode) errors. Tom extended their scheme to couple the sub-meshes with appropriate chosen artificial diffusion and thereby solved the 'alternating-zone' problem. Because the choice of the artificial diffusion coefficient could be very delicate, it is desirable to use a scheme that does not require the artificial diffusion but still able to avoid both numerical diffusion and the 'alternating-zone' problem. In this document we present such a scheme.

  15. Anisotropic Weyl invariance

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Nadal, Guillem [Universidad de Buenos Aires, Buenos Aires (Argentina)

    2017-07-15

    We consider a non-relativistic free scalar field theory with a type of anisotropic scale invariance in which the number of coordinates ''scaling like time'' is generically greater than one. We propose the Cartesian product of two curved spaces, the metric of each space being parameterized by the other space, as a notion of curved background to which the theory can be extended. We study this type of geometries, and find a family of extensions of the theory to curved backgrounds in which the anisotropic scale invariance is promoted to a local, Weyl-type symmetry. (orig.)

  16. Discrete maximum principle for FE solutions of the diffusion-reaction problem on prismatic meshes

    Czech Academy of Sciences Publication Activity Database

    Hannukainen, A.; Korotov, S.; Vejchodský, Tomáš

    2009-01-01

    Roč. 226, č. 2 (2009), s. 275-287 ISSN 0377-0427 R&D Projects: GA AV ČR IAA100760702 Institutional research plan: CEZ:AV0Z10190503 Keywords : diffusion-reaction problem * maximum principle * prismatic finite elements Subject RIV: BA - General Mathematics Impact factor: 1.292, year: 2009

  17. Solution of the multigroup neutron diffusion Eigenvalue problem in slab geometry by modified power method

    Energy Technology Data Exchange (ETDEWEB)

    Zanette, Rodrigo [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Programa de Pós-Graduação em Matemática Aplicada; Petersen, Claudio Z.; Tavares, Matheus G., E-mail: rodrigozanette@hotmail.com, E-mail: claudiopetersen@yahoo.com.br, E-mail: matheus.gulartetavares@gmail.com [Universidade Federal de Pelotas (UFPEL), RS (Brazil). Programa de Pós-Graduação em Modelagem Matemática

    2017-07-01

    We describe in this work the application of the modified power method for solve the multigroup neutron diffusion eigenvalue problem in slab geometry considering two-dimensions for nuclear reactor global calculations. It is well known that criticality calculations can often be best approached by solving eigenvalue problems. The criticality in nuclear reactors physics plays a relevant role since establishes the ratio between the numbers of neutrons generated in successive fission reactions. In order to solve the eigenvalue problem, a modified power method is used to obtain the dominant eigenvalue (effective multiplication factor (K{sub eff})) and its corresponding eigenfunction (scalar neutron flux), which is non-negative in every domain, that is, physically relevant. The innovation of this work is solving the neutron diffusion equation in analytical form for each new iteration of the power method. For solve this problem we propose to apply the Finite Fourier Sine Transform on one of the spatial variables obtaining a transformed problem which is resolved by well-established methods for ordinary differential equations. The inverse Fourier transform is used to reconstruct the solution for the original problem. It is known that the power method is an iterative source method in which is updated by the neutron flux expression of previous iteration. Thus, for each new iteration, the neutron flux expression becomes larger and more complex due to analytical solution what makes propose that it be reconstructed through an polynomial interpolation. The methodology is implemented to solve a homogeneous problem and the results are compared with works presents in the literature. (author)

  18. A theory for the anisotropic interaction between two substitutional magnetic impurities and the magnetic anisotropic effect in dilute magnetic alloys

    International Nuclear Information System (INIS)

    Satter, M.A.

    1990-08-01

    In this paper, a formalism for studying the anisotropic interaction between two substitutional magnetic impurities and the magnetic anisotropic effect in a dilute noble metal- transition metal magnetic alloy has been developed from relativistic scattering theory. The theoretical development and the computational techniques of this formalism are based on relativistic spin-polarized scattering theory and relativistic band structure frameworks. For studying the magnetic anisotropic effect a convenient ''working'' frame of reference with its axes oriented along the fcc crystal axes is set up. This formalism is applied to study the situation for two Fe impurities in paramagnetic Au hosts. For AuFe dilute alloy, the two impurity site interaction as a function of separation is not oscillatory and the anisotropic effect is found to be less than the two site interaction itself only by an order of magnitude. Apart from the anisotropic coupling of the two impurity spins to the separation vector, for the first time, another weak anisotropic coupling to the crystal axes is also contained in the two site interaction. These anisotropic effects are the results of the relativistic spin-orbit interaction which are incorporated into the formalism. (author). 22 refs, 5 figs

  19. A new anisotropic mesh adaptation method based upon hierarchical a posteriori error estimates

    Science.gov (United States)

    Huang, Weizhang; Kamenski, Lennard; Lang, Jens

    2010-03-01

    A new anisotropic mesh adaptation strategy for finite element solution of elliptic differential equations is presented. It generates anisotropic adaptive meshes as quasi-uniform ones in some metric space, with the metric tensor being computed based on hierarchical a posteriori error estimates. A global hierarchical error estimate is employed in this study to obtain reliable directional information of the solution. Instead of solving the global error problem exactly, which is costly in general, we solve it iteratively using the symmetric Gauß-Seidel method. Numerical results show that a few GS iterations are sufficient for obtaining a reasonably good approximation to the error for use in anisotropic mesh adaptation. The new method is compared with several strategies using local error estimators or recovered Hessians. Numerical results are presented for a selection of test examples and a mathematical model for heat conduction in a thermal battery with large orthotropic jumps in the material coefficients.

  20. Asymptotic analysis of reaction-diffusion-advection problems: Fronts with periodic motion and blow-up

    Science.gov (United States)

    Nefedov, Nikolay

    2017-02-01

    This is an extended variant of the paper presented at MURPHYS-HSFS 2016 conference in Barcelona. We discuss further development of the asymptotic method of differential inequalities to investigate existence and stability of sharp internal layers (fronts) for nonlinear singularly perturbed periodic parabolic problems and initial boundary value problems with blow-up of fronts for reaction-diffusion-advection equations. In particular, we consider periodic solutions with internal layer in the case of balanced reaction. For the initial boundary value problems we prove the existence of fronts and give their asymptotic approximation including the new case of blowing-up fronts. This case we illustrate by the generalised Burgers equation.

  1. Separation of variables in anisotropic models and non-skew-symmetric elliptic r-matrix

    Science.gov (United States)

    Skrypnyk, Taras

    2017-05-01

    We solve a problem of separation of variables for the classical integrable hamiltonian systems possessing Lax matrices satisfying linear Poisson brackets with the non-skew-symmetric, non-dynamical elliptic so(3)⊗ so(3)-valued classical r-matrix. Using the corresponding Lax matrices, we present a general form of the "separating functions" B( u) and A( u) that generate the coordinates and the momenta of separation for the associated models. We consider several examples and perform the separation of variables for the classical anisotropic Euler's top, Steklov-Lyapunov model of the motion of anisotropic rigid body in the liquid, two-spin generalized Gaudin model and "spin" generalization of Steklov-Lyapunov model.

  2. Dissipative particle dynamics of diffusion-NMR requires high Schmidt-numbers

    Energy Technology Data Exchange (ETDEWEB)

    Azhar, Mueed; Greiner, Andreas [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Korvink, Jan G., E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Department of Microstructure Technology, Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, Eggenstein-Leopoldshafen (Germany); Kauzlarić, David, E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Freiburg Institute for Advanced Studies, University of Freiburg, Albertstr. 19, 79104 Freiburg (Germany)

    2016-06-28

    We present an efficient mesoscale model to simulate the diffusion measurement with nuclear magnetic resonance (NMR). On the level of mesoscopic thermal motion of fluid particles, we couple the Bloch equations with dissipative particle dynamics (DPD). Thereby we establish a physically consistent scaling relation between the diffusion constant measured for DPD-particles and the diffusion constant of a real fluid. The latter is based on a splitting into a centre-of-mass contribution represented by DPD, and an internal contribution which is not resolved in the DPD-level of description. As a consequence, simulating the centre-of-mass contribution with DPD requires high Schmidt numbers. After a verification for fundamental pulse sequences, we apply the NMR-DPD method to NMR diffusion measurements of anisotropic fluids, and of fluids restricted by walls of microfluidic channels. For the latter, the free diffusion and the localisation regime are considered.

  3. DIFFUSION OF THE PULSED ELECTROMAGNETIC FIELD INTO THE MULTI-LAYER CORE OF INDUCTOR AT PULSED DEVICES

    Directory of Open Access Journals (Sweden)

    Volodymyr T. Chemerys

    2008-02-01

    Full Text Available  The problem of the pulsed magnetic field distribution in the cross section of the inductor core at the induction accelerator of electron beam is under consideration in this paper. Owing to multi-layer structure of the core package it has the magnetic and electric anisotropy with different speed of the field diffusion along the sheets of magnetic and across the sheets. At the pulse duration less than one microsecond the essential non-uniformity of the field along both axes of the core cross section can be found. This effect reduces the efficiency of the ferromagnetic material using with corresponding loss of the accelerator efficiency. The main conclusion of the paper consists of the necessity to check the field diffusion characteristics in the process of inductor design to be sure that the pulsed field is able to fill the cross section of the core during the pulse switching. The magnetic characteristics of the anisotropic core have been investigated in the paper by one-dimensional and two-dimensional simulation in the quasi-stationary approximation using the traditional equation of the field diffusion.

  4. Continuum mechanics of anisotropic materials

    CERN Document Server

    Cowin, Stephen C

    2013-01-01

    Continuum Mechanics of Anisotropic Materials(CMAM) presents an entirely new and unique development of material anisotropy in the context of an appropriate selection and organization of continuum mechanics topics. These features will distinguish this continuum mechanics book from other books on this subject. Textbooks on continuum mechanics are widely employed in engineering education, however, none of them deal specifically with anisotropy in materials. For the audience of Biomedical, Chemical and Civil Engineering students, these materials will be dealt with more frequently and greater accuracy in their analysis will be desired. Continuum Mechanics of Anisotropic Materials' author has been a leader in the field of developing new approaches for the understanding of anisotropic materials.

  5. Dynamics of anisotropic tissue growth

    Energy Technology Data Exchange (ETDEWEB)

    Bittig, Thomas; Juelicher, Frank [Max Planck Institute for the Physics of Complex Systems, Noethnitzer Strasse 38, 01187 Dresden (Germany); Wartlick, Ortrud; Kicheva, Anna; Gonzalez-Gaitan, Marcos [Department of Biochemistry and Department of Molecular Biology, Geneva University, Sciences II, Quai Ernest-Ansermet 30, 1211 Geneva 4 (Switzerland)], E-mail: Marcos.Gonzalez@biochem.unige.ch, E-mail: julicher@pks.mpg.de

    2008-06-15

    We study the mechanics of tissue growth via cell division and cell death (apoptosis). The rearrangements of cells can on large scales and times be captured by a continuum theory which describes the tissue as an effective viscous material with active stresses generated by cell division. We study the effects of anisotropies of cell division on cell rearrangements and show that average cellular trajectories exhibit anisotropic scaling behaviors. If cell division and apoptosis balance, there is no net growth, but for anisotropic cell division the tissue undergoes spontaneous shear deformations. Our description is relevant for the study of developing tissues such as the imaginal disks of the fruit fly Drosophila melanogaster, which grow anisotropically.

  6. Nonlinear constitutive relations for anisotropic elastic materials

    Science.gov (United States)

    Sokolova, Marina; Khristich, Dmitrii

    2018-03-01

    A general approach to constructing of nonlinear variants of connection between stresses and strains in anisotropic materials with different types of symmetry of properties is considered. This approach is based on the concept of elastic proper subspaces of anisotropic materials introduced in the mechanics of solids by J. Rychlewski and on the particular postulate of isotropy proposed by A. A. Il’yushin. The generalization of the particular postulate on the case of nonlinear anisotropic materials is formulated. Systems of invariants of deformations as lengths of projections of the strain vector into proper subspaces are developed. Some variants of nonlinear constitutive relations for anisotropic materials are offered. The analysis of these relations from the point of view of their satisfaction to general and limit forms of generalization of partial isotropy postulate on anisotropic materials is performed. The relations for particular cases of anisotropy are written.

  7. Characterization of Anisotropic Behavior for High Grade Pipes

    Science.gov (United States)

    Yang, Kun; Huo, Chunyong; Ji, Lingkang; Li, Yang; Zhang, Jiming; Ma, Qiurong

    With the developing requirement of nature gas, the property needs of steel for pipe line are higher and higher, especially in strength and toughness. It is necessary to improve the steel grade in order to ensure economic demand and safety. However, with the rise of steel grade, the differences on properties in different orientations (anisotropic behaviors) become more and more obvious after the process of hot rolling, which may affect the prediction of fracture for the pipes seriously (Thinking of isotropic mechanical properties for material in traditional predict way). In order to get the reason for anisotropic mechanics, a series of tests are carried out for high grade steel pipes, including not only mechanical properties but also microstructures. Result indicates that there are obviously anisotropic behaviors for high grade steel pipes in two orientations (rolling orientation and transverse orientation). Strength is better in T orientation because Rm is higher and Rt 0.5 rises more in T orientation, and toughness is better in L orientation because of the higher Akv and SA in L orientation under a same temperature. Banded structures are formed in T orientation, and the spatial distribution of inclusion and precipitated phases are different in T, L and S orientation. The anisotropic arrangement for the matrix in space (banded structures), which is formed after the process of hot rolling, may affect the mechanical properties in different orientation. Moreover, the elasticity modulus of particles is different from the elasticity modulus of matrix, deformation between particles and matrix may cause stress concentration, and damage forms in this place. Because of the different distribution of particles in space, the level of damage is anisotropic in different orientations, and the anisotropic mechanical properties occur finally. Therefore, the anisotropic mechanical properties are determined by the anisotropic microstructures, both the anisotropic of matrix and the

  8. Elastic waves trapped by a homogeneous anisotropic semicylinder

    Energy Technology Data Exchange (ETDEWEB)

    Nazarov, S A [Institute of Problems of Mechanical Engineering, Russian Academy of Sciences, St.-Petersburg (Russian Federation)

    2013-11-30

    It is established that the problem of elastic oscillations of a homogeneous anisotropic semicylinder (console) with traction-free lateral surface (Neumann boundary condition) has no eigenvalues when the console is clamped at one end (Dirichlet boundary condition). If the end is free, under additional requirements of elastic and geometric symmetry, simple sufficient conditions are found for the existence of an eigenvalue embedded in the continuous spectrum and generating a trapped elastic wave, that is, one which decays at infinity at an exponential rate. The results are obtained by generalizing the methods developed for scalar problems, which however require substantial modification for the vector problem in elasticity theory. Examples are given and open questions are stated. Bibliography: 53 titles.

  9. Orthonormal bases for anisotropic α-modulation spaces

    DEFF Research Database (Denmark)

    Rasmussen, Kenneth Niemann

    2012-01-01

    In this article we construct orthonormal bases for bi-variate anisotropic α-modulation spaces. The construction is based on generating a nice anisotropic α-covering and using carefully selected tensor products of univariate brushlet functions with regards to this covering. As an application, we...... show that n-term nonlinear approximation with the orthonormal bases in certain anisotropic α-modulation spaces can be completely characterized....

  10. Orthonormal bases for anisotropic α-modulation spaces

    DEFF Research Database (Denmark)

    Rasmussen, Kenneth Niemann

    In this article we construct orthonormal bases for bi-variate anisotropic α-modulation spaces. The construction is based on generating a nice anisotropic α-covering and using carefully selected tensor products of univariate brushlet functions with regards to this covering. As an application, we...... show that n-term nonlinear approximation with the orthonormal bases in certain anisotropic α-modulation spaces can be completely characterized....

  11. Application of the Laplace transform method for the albedo boundary conditions in multigroup neutron diffusion eigenvalue problems in slab geometry

    International Nuclear Information System (INIS)

    Petersen, Claudio Zen; Vilhena, Marco T.; Barros, Ricardo C.

    2009-01-01

    In this paper the application of the Laplace transform method is described in order to determine the energy-dependent albedo matrix that is used in the boundary conditions multigroup neutron diffusion eigenvalue problems in slab geometry for nuclear reactor global calculations. In slab geometry, the diffusion albedo substitutes without approximation the baffle-reflector system around the active domain. Numerical results to typical test problems are shown to illustrate the accuracy and the efficiency of the Chebysheff acceleration scheme. (orig.)

  12. An exploration into diffusion tensor imaging in the bovine ocular lens

    Directory of Open Access Journals (Sweden)

    Ehsan eVaghefi

    2013-03-01

    Full Text Available We describe our development of the diffusion tensor imaging modality for the bovine ocular lens. Diffusion gradients were added to a spin-echo pulse sequence and the relevant parameters of the sequence were refined to achieve good diffusion weighting in the lens tissue, which demonstrated heterogeneous regions of diffusive signal attenuation. Decay curves for b-value (loosely summarizes the strength of diffusion weighting and TE (determines the amount of MRI-obtained signal were used to estimate apparent diffusion coefficients (ADC and T2 in different lens regions. The ADCs varied by over an order of magnitude and revealed diffusive anisotropy in the lens. Up to 30 diffusion gradient directions, and 8 signal acquisition averages, were applied to lenses in culture in order to improve maps of diffusion tensor eigenvalues, equivalent to ADC, across the lens. From these maps, fractional anisotropy maps were calculated and compared to known spatial distributions of anisotropic molecular fluxes in the lens. This comparison suggested new hypotheses and experiments to quantitatively assess models of circulation in the avascular lens.

  13. Application of distributed point source method (DPSM) to wave propagation in anisotropic media

    Science.gov (United States)

    Fooladi, Samaneh; Kundu, Tribikram

    2017-04-01

    Distributed Point Source Method (DPSM) was developed by Placko and Kundu1, as a technique for modeling electromagnetic and elastic wave propagation problems. DPSM has been used for modeling ultrasonic, electrostatic and electromagnetic fields scattered by defects and anomalies in a structure. The modeling of such scattered field helps to extract valuable information about the location and type of defects. Therefore, DPSM can be used as an effective tool for Non-Destructive Testing (NDT). Anisotropy adds to the complexity of the problem, both mathematically and computationally. Computation of the Green's function which is used as the fundamental solution in DPSM is considerably more challenging for anisotropic media, and it cannot be reduced to a closed-form solution as is done for isotropic materials. The purpose of this study is to investigate and implement DPSM for an anisotropic medium. While the mathematical formulation and the numerical algorithm will be considered for general anisotropic media, more emphasis will be placed on transversely isotropic materials in the numerical example presented in this paper. The unidirectional fiber-reinforced composites which are widely used in today's industry are good examples of transversely isotropic materials. Development of an effective and accurate NDT method based on these modeling results can be of paramount importance for in-service monitoring of damage in composite structures.

  14. Analysis of electromagnetic scattering by uniaxial anisotropic bispheres.

    Science.gov (United States)

    Li, Zheng-Jun; Wu, Zhen-Sen; Li, Hai-Ying

    2011-02-01

    Based on the generalized multiparticle Mie theory and the Fourier transformation approach, electromagnetic (EM) scattering of two interacting homogeneous uniaxial anisotropic spheres with parallel primary optical axes is investigated. By introducing the Fourier transformation, the EM fields in the uniaxial anisotropic spheres are expanded in terms of the spherical vector wave functions. The interactive scattering coefficients and the expansion coefficients of the internal fields are derived through the continuous boundary conditions on which the interaction of the bispheres is considered. Some selected calculations on the effects of the size parameter, the uniaxial anisotropic absorbing dielectric, and the sphere separation distance are described. The backward radar cross section of two uniaxial anisotropic spheres with a complex permittivity tensor changing with the sphere separation distance is numerically studied. The authors are hopeful that the work in this paper will help provide an effective calibration for further research on the scattering characteristic of an aggregate of anisotropic spheres or other shaped anisotropic particles.

  15. Anisotropic elliptic optical fibers

    Science.gov (United States)

    Kang, Soon Ahm

    1991-05-01

    The exact characteristic equation for an anisotropic elliptic optical fiber is obtained for odd and even hybrid modes in terms of infinite determinants utilizing Mathieu and modified Mathieu functions. A simplified characteristic equation is obtained by applying the weakly guiding approximation such that the difference in the refractive indices of the core and the cladding is small. The simplified characteristic equation is used to compute the normalized guide wavelength for an elliptical fiber. When the anisotropic parameter is equal to unity, the results are compared with the previous research and they are in close agreement. For a fixed value normalized cross-section area or major axis, the normalized guide wavelength lambda/lambda(sub 0) for an anisotropic elliptic fiber is small for the larger value of anisotropy. This condition indicates that more energy is carried inside of the fiber. However, the geometry and anisotropy of the fiber have a smaller effect when the normalized cross-section area is very small or very large.

  16. Transient anisotropic magnetic field calculation

    International Nuclear Information System (INIS)

    Jesenik, Marko; Gorican, Viktor; Trlep, Mladen; Hamler, Anton; Stumberger, Bojan

    2006-01-01

    For anisotropic magnetic material, nonlinear magnetic characteristics of the material are described with magnetization curves for different magnetization directions. The paper presents transient finite element calculation of the magnetic field in the anisotropic magnetic material based on the measured magnetization curves for different magnetization directions. For the verification of the calculation method some results of the calculation are compared with the measurement

  17. Mixed-hybrid finite element method for the transport equation and diffusion approximation of transport problems

    International Nuclear Information System (INIS)

    Cartier, J.

    2006-04-01

    This thesis focuses on mathematical analysis, numerical resolution and modelling of the transport equations. First of all, we deal with numerical approximation of the solution of the transport equations by using a mixed-hybrid scheme. We derive and study a mixed formulation of the transport equation, then we analyse the related variational problem and present the discretization and the main properties of the scheme. We particularly pay attention to the behavior of the scheme and we show its efficiency in the diffusion limit (when the mean free path is small in comparison with the characteristic length of the physical domain). We present academical benchmarks in order to compare our scheme with other methods in many physical configurations and validate our method on analytical test cases. Unstructured and very distorted meshes are used to validate our scheme. The second part of this thesis deals with two transport problems. The first one is devoted to the study of diffusion due to boundary conditions in a transport problem between two plane plates. The second one consists in modelling and simulating radiative transfer phenomenon in case of the industrial context of inertial confinement fusion. (author)

  18. A fully conservative Eulerian–Lagrangian method for a convection–diffusion problem in a solenoidal field

    KAUST Repository

    Arbogast, Todd

    2010-05-01

    Tracer transport is governed by a convection-diffusion problem modeling mass conservation of both tracer and ambient fluids. Numerical methods should be fully conservative, enforcing both conservation principles on the discrete level. Locally conservative characteristics methods conserve the mass of tracer, but may not conserve the mass of the ambient fluid. In a recent paper by the authors [T. Arbogast, C. Huang, A fully mass and volume conserving implementation of a characteristic method for transport problems, SIAM J. Sci. Comput. 28 (2006) 2001-2022], a fully conservative characteristic method, the Volume Corrected Characteristics Mixed Method (VCCMM), was introduced for potential flows. Here we extend and apply the method to problems with a solenoidal (i.e., divergence-free) flow field. The modification is a computationally inexpensive simplification of the original VCCMM, requiring a simple adjustment of trace-back regions in an element-by-element traversal of the domain. Our numerical results show that the method works well in practice, is less numerically diffuse than uncorrected characteristic methods, and can use up to at least about eight times the CFL limited time step. © 2010 Elsevier Inc.

  19. A novel method for calculating the energy barriers for carbon diffusion in ferrite under heterogeneous stress

    Science.gov (United States)

    Tchitchekova, Deyana S.; Morthomas, Julien; Ribeiro, Fabienne; Ducher, Roland; Perez, Michel

    2014-07-01

    A novel method for accurate and efficient evaluation of the change in energy barriers for carbon diffusion in ferrite under heterogeneous stress is introduced. This method, called Linear Combination of Stress States, is based on the knowledge of the effects of simple stresses (uniaxial or shear) on these diffusion barriers. Then, it is assumed that the change in energy barriers under a complex stress can be expressed as a linear combination of these already known simple stress effects. The modifications of energy barriers by either uniaxial traction/compression and shear stress are determined by means of atomistic simulations with the Climbing Image-Nudge Elastic Band method and are stored as a set of functions. The results of this method are compared to the predictions of anisotropic elasticity theory. It is shown that, linear anisotropic elasticity fails to predict the correct energy barrier variation with stress (especially with shear stress) whereas the proposed method provides correct energy barrier variation for stresses up to ˜3 GPa. This study provides a basis for the development of multiscale models of diffusion under non-uniform stress.

  20. A novel method for calculating the energy barriers for carbon diffusion in ferrite under heterogeneous stress

    International Nuclear Information System (INIS)

    Tchitchekova, Deyana S.; Morthomas, Julien; Perez, Michel; Ribeiro, Fabienne; Ducher, Roland

    2014-01-01

    A novel method for accurate and efficient evaluation of the change in energy barriers for carbon diffusion in ferrite under heterogeneous stress is introduced. This method, called Linear Combination of Stress States, is based on the knowledge of the effects of simple stresses (uniaxial or shear) on these diffusion barriers. Then, it is assumed that the change in energy barriers under a complex stress can be expressed as a linear combination of these already known simple stress effects. The modifications of energy barriers by either uniaxial traction/compression and shear stress are determined by means of atomistic simulations with the Climbing Image-Nudge Elastic Band method and are stored as a set of functions. The results of this method are compared to the predictions of anisotropic elasticity theory. It is shown that, linear anisotropic elasticity fails to predict the correct energy barrier variation with stress (especially with shear stress) whereas the proposed method provides correct energy barrier variation for stresses up to ∼3 GPa. This study provides a basis for the development of multiscale models of diffusion under non-uniform stress

  1. A novel method for calculating the energy barriers for carbon diffusion in ferrite under heterogeneous stress

    Energy Technology Data Exchange (ETDEWEB)

    Tchitchekova, Deyana S. [IRSN, PSN, SEMIA, LPTM, Saint-Paul-Lez-Durance (France); Univ. Lyon, INSA Lyon, MATEIS, UMR CNRS 5510, Villeurbanne (France); Morthomas, Julien; Perez, Michel [Univ. Lyon, INSA Lyon, MATEIS, UMR CNRS 5510, Villeurbanne (France); Ribeiro, Fabienne [IRSN, PSN, SEMIA, LPTM, Saint-Paul-Lez-Durance (France); Ducher, Roland [IRSN, PSN, SAG, LETR, Saint-Paul-Lez-Durance (France)

    2014-07-21

    A novel method for accurate and efficient evaluation of the change in energy barriers for carbon diffusion in ferrite under heterogeneous stress is introduced. This method, called Linear Combination of Stress States, is based on the knowledge of the effects of simple stresses (uniaxial or shear) on these diffusion barriers. Then, it is assumed that the change in energy barriers under a complex stress can be expressed as a linear combination of these already known simple stress effects. The modifications of energy barriers by either uniaxial traction/compression and shear stress are determined by means of atomistic simulations with the Climbing Image-Nudge Elastic Band method and are stored as a set of functions. The results of this method are compared to the predictions of anisotropic elasticity theory. It is shown that, linear anisotropic elasticity fails to predict the correct energy barrier variation with stress (especially with shear stress) whereas the proposed method provides correct energy barrier variation for stresses up to ∼3 GPa. This study provides a basis for the development of multiscale models of diffusion under non-uniform stress.

  2. Development of a coarse mesh code for the solution of two group static diffusion problems

    International Nuclear Information System (INIS)

    Barros, R.C. de.

    1985-01-01

    This new coarse mesh code designed for the solution of 2 and 3 dimensional static diffusion problems, is based on an alternating direction method which consists in the solution of one dimensional problem along each coordinate direction with leakage terms for the remaining directions estimated from previous interactions. Four versions of this code have been developed: AD21 - 2D - 1/4, AD21 - 2D - 4/4, AD21 - 3D - 1/4 and AD21 - 3D - 4/4; these versions have been designed for 2 and 3 dimensional problems with or without 1/4 symmetry. (Author) [pt

  3. Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

    International Nuclear Information System (INIS)

    Bierwagen, O.

    2007-01-01

    Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

  4. Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

    Energy Technology Data Exchange (ETDEWEB)

    Bierwagen, O.

    2007-12-20

    Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the <110> directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

  5. Views on the Anisotropic Nature of Ilva Valley Region

    Directory of Open Access Journals (Sweden)

    GABRIELA-ALINA MUREŞAN

    2012-01-01

    Full Text Available There are two concepts important for the authors of this article: anisotropic region and anisotropic space. Anisotropic region is defined by A. Dauphiné, the geographer (-mathematician, as a territorial unit whose structure results from the organisation of space along one or more axes. From the point of view of a territorial system, this type of region has some characteristics which differentiate it both from the homogeneous region and from the polarised one. These specificities have been analysed for Ilva Valley. The region of Ilva Valley is formed along the morphological axis represented by the Ilva River. The aim is to identify these specificities or their absence within this region. In this way we can determine whether this region is an anisotropic one or just an anisotropic space, namely whether it can be considered as evolving towards an anisotropic region, not yet complying with all characteristics of anisotropic regions.

  6. Effective medium theory for anisotropic metamaterials

    KAUST Repository

    Zhang, Xiujuan

    2015-01-20

    Materials with anisotropic material parameters can be utilized to fabricate many fascinating devices, such as hyperlenses, metasolids, and one-way waveguides. In this study, we analyze the effects of geometric anisotropy on a two-dimensional metamaterial composed of a rectangular array of elliptic cylinders and derive an effective medium theory for such a metamaterial. We find that it is possible to obtain a closed-form analytical solution for the anisotropic effective medium parameters, provided the aspect ratio of the lattice and the eccentricity of the elliptic cylinder satisfy certain conditions. The derived effective medium theory not only recovers the well-known Maxwell-Garnett results in the quasi-static regime, but is also valid beyond the long-wavelength limit, where the wavelength in the host medium is comparable to the size of the lattice so that previous anisotropic effective medium theories fail. Such an advance greatly broadens the applicable realm of the effective medium theory and introduces many possibilities in the design of structures with desired anisotropic material characteristics. A real sample of a recently theoretically proposed anisotropic medium, with a near-zero index to control the flux, is achieved using the derived effective medium theory, and control of the electromagnetic waves in the sample is clearly demonstrated.

  7. Two-group neutron transport theory in adjacent space with lineary anisotropic scattering

    International Nuclear Information System (INIS)

    Maiorino, J.R.

    1978-01-01

    A solution method for two-group neutron transport theory with anisotropic scattering is introduced by the combination of case method (expansion method of self singular function) and the invariant imbedding (invariance principle). The numerical results for the Milne problem in light water and borated water is presented to demonstrate the avalibility of the method [pt

  8. Generalized Multiscale Finite-Element Method (GMsFEM) for elastic wave propagation in heterogeneous, anisotropic media

    KAUST Repository

    Gao, Kai; Fu, Shubin; Gibson, Richard L.; Chung, Eric T.; Efendiev, Yalchin R.

    2015-01-01

    , anisotropic media, where we construct basis functions from multiple local problems for both boundaries and the interior of a coarse node support or coarse element. The application of multiscale basis functions can capture the fine scale medium property

  9. Variation of the critical slab thickness with the degree of strongly anisotropic scattering in one-speed neutron transport theory

    International Nuclear Information System (INIS)

    Yildiz, C.

    1998-01-01

    The critical slab problem is studied in one-speed neutron transport theory using a linearly anisotropic kernel which combines forward and backward scattering. It is shown that, the recently observed non-monotonic variation of the thickness also exists in this strongly anisotropic case. In addition, the influence of the linear anisotropy on the critical thickness is analysed in detail. Numerical analysis for the critical thickness are performed using the spherical harmonics method and results are tabulated for selected illustrative cases as a function of different degrees of anisotropic scattering. Finally, some results are discussed and compared with those already obtained by other methods, the agreement is satisfactory. The spherical harmonic method gives generally accurate results in one dimensional geometry, and it is very suitable for the numerical solution of the neutron transport equation with linearly anisotropic scattering

  10. Tunneling anisotropic magnetoresistance driven by magnetic phase transition.

    Science.gov (United States)

    Chen, X Z; Feng, J F; Wang, Z C; Zhang, J; Zhong, X Y; Song, C; Jin, L; Zhang, B; Li, F; Jiang, M; Tan, Y Z; Zhou, X J; Shi, G Y; Zhou, X F; Han, X D; Mao, S C; Chen, Y H; Han, X F; Pan, F

    2017-09-06

    The independent control of two magnetic electrodes and spin-coherent transport in magnetic tunnel junctions are strictly required for tunneling magnetoresistance, while junctions with only one ferromagnetic electrode exhibit tunneling anisotropic magnetoresistance dependent on the anisotropic density of states with no room temperature performance so far. Here, we report an alternative approach to obtaining tunneling anisotropic magnetoresistance in α'-FeRh-based junctions driven by the magnetic phase transition of α'-FeRh and resultantly large variation of the density of states in the vicinity of MgO tunneling barrier, referred to as phase transition tunneling anisotropic magnetoresistance. The junctions with only one α'-FeRh magnetic electrode show a magnetoresistance ratio up to 20% at room temperature. Both the polarity and magnitude of the phase transition tunneling anisotropic magnetoresistance can be modulated by interfacial engineering at the α'-FeRh/MgO interface. Besides the fundamental significance, our finding might add a different dimension to magnetic random access memory and antiferromagnet spintronics.Tunneling anisotropic magnetoresistance is promising for next generation memory devices but limited by the low efficiency and functioning temperature. Here the authors achieved 20% tunneling anisotropic magnetoresistance at room temperature in magnetic tunnel junctions with one α'-FeRh magnetic electrode.

  11. Recent developments of the MARC/PN transport theory code including a treatment of anisotropic scatter

    International Nuclear Information System (INIS)

    Fletcher, J.K.

    1987-12-01

    The computer code MARC/PN provides a solution of the multigroup transport equation by expanding the flux in spherical harmonics. The coefficients of the series so obtained satisfy linked first order differential equations, and on eliminating terms associated with odd parity harmonics a second order system results which can be solved by established finite difference or finite element techniques. This report describes modifications incorporated in MARC/PN to allow for anisotropic scattering, and the modelling of irregular exterior boundaries in the finite element option. The latter development leads to substantial reductions in problem size, particularly for three dimensions. Also, links to an interactive graphics mesh generator (SUPERTAB) have been added. The final section of the report contains results from problems showing the effects of anisotropic scatter and the ability of the code to model irregular geometries. (author)

  12. Diffusion of graphite. The effect of cylindrical canals; Longueur de diffusion du graphite effet des canaux cylindriques

    Energy Technology Data Exchange (ETDEWEB)

    Carle, R; Clouet d' Orval, C; Martelly, J; Mazancourt, T de; Sagot, M; Lattes, R; Teste du Bailler, A [Commissariat a l' Energie Atomique, Dir. Industrielle, Saclay (France). Centre d' Etudes Nucleaires; Robert, C [Ecole Normale Superieure, 75 - Paris (France)

    1957-07-01

    Experiments on thermal neutron diffusion in the graphite used as moderator in the pile G1 have been carried out. The object of these experiments is to determine: - the intrinsic quality of this graphite, characterised by its diffusion length L or its Laplacian 1/L{sup 2} - the effect of the canals, which modifies anisotropically the macroscopic diffusion equation and is characterized by two principal diffusion regions (or two principal Laplacian), valid respectively for the diffusion in the direction of the canals and in a perpendicular direction. In order to determine them two experiments are necessary, in which the second derivatives of the flux in relation to the space coordinates are very different. These experiments form the object of the first two parts. Part 1: Diffusion along the axis of a flux coming from the pile source, and limited radially by a quasi cylindrical screen of cadmium bars. This screen, or Faraday cage is designed to give to the thermal flux produced the same radius of extrapolation to zero as that of the pile source. The determination of L (with the graphite full) has been made under the same conditions. The measurements have been interpreted in two ways. The influence of the brackets holding the detectors is discussed. Part 2: Radial diffusion in the graphite surrounding the 'long' cylindrical pile. This is well described by a sum of Bessel functions. Part 3: Results (valid for d = 1.61 t = 17 deg. C). For the graphite without cavity L = 52.7 {+-} 0.4 cm. The effect of the canals on the diffusion area and its anisotropy are in excellent agreement with the theory of Behrens: L(parallel) = 64.6 cm and L(perpendicular) 62.2 cm. Appendix: Theory of the Faraday cage. (author) [French] Des experiences de diffusion des neutrons thermiques dans le graphite constituant le moderateur de la pile G1 ont ete effectuees. Elles ont pour objet de determiner: - la qualite intrinseque de ce graphite, caracterisee par sa longueur de diffusion L ou son

  13. Nonlinear diffusion problem arising in plasma physics

    International Nuclear Information System (INIS)

    Berryman, J.G.; Holland, C.J.

    1978-01-01

    In earlier studies of plasma diffusion with Okuda-Dawson scaling (D approx. n/sup -1/2/), perturbation theory indicated that arbitrary initial data should evolve rapidly toward the separation solution of the relevant nonlinear diffusion equation. Now a Lyapunov functional has been found which is strictly decreasing in time and bounded below. The rigorous proof that arbitrary initial data evolve toeard the separable solution is summarized. Rigorous bounds on the decay time are also presented

  14. An anisotropic elastoplasticity model implemented in FLAG

    Energy Technology Data Exchange (ETDEWEB)

    Buechler, Miles Allen [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Canfield, Thomas R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-10-12

    Many metals, including Tantalum and Zirconium, exhibit anisotropic elastoplastic behavior at the single crystal level, and if components are manufactured from these metals through forming processes the polycrystal (component) may also exhibit anisotropic elastoplastic behavior. This is because the forming can induce a preferential orientation of the crystals in the polycrystal. One example is a rolled plate of Uranium where the sti /strong orientation of the crystal (c-axis) tends to align itself perpendicular to the rolling direction. If loads are applied to this plate in di erent orientations the sti ness as well as the ow strength of the material will be greater in the through thickness direction than in other directions. To better accommodate simulations of such materials, an anisotropic elastoplasticity model has been implemented in FLAG. The model includes an anisotropic elastic stress model as well as an anisotropic plasticity model. The model could represent single crystals of any symmetry, though it should not be confused with a high- delity crystal plasticity model with multiple slip planes and evolutions. The model is most appropriate for homogenized polycrystalline materials. Elastic rotation of the material due to deformation is captured, so the anisotropic models are appropriate for arbitrary large rotations, but currently they do not account for signi cant change in material texture beyond the elastic rotation of the entire polycrystal.

  15. Numerical simulation of anisotropic preheating ablative Rayleigh-Taylor instability

    International Nuclear Information System (INIS)

    Wang Lifeng; Ye Wenhua; Li Yingjun

    2010-01-01

    The linear growth rate of the anisotropic preheating ablative Rayleigh-Taylor instability (ARTI) is studied by numerical simulations. The preheating model κ(T)=κ SH [1+f(T)] is applied, where f(T) is the preheating function interpreting the preheating tongue effect in the cold plasma ahead of the ablative front. An arbitrary coefficient D is introduced in the energy equation to study the influence of transverse thermal conductivity on the growth of the ARTI. We find that enhancing diffusion in a plane transverse to the mean longitudinal flow can strongly reduce the growth of the instability. Numerical simulations exhibit a significant stabilization of the ablation front by improving the transverse thermal conduction. Our results are in general agreement with the theory analysis and numerical simulations by Masse. (authors)

  16. Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ

    KAUST Repository

    Burriel, Mónica

    2012-02-14

    Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.

  17. Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ

    KAUST Repository

    Burriel, Mó nica; Peñ a-Martí nez, Juan; Chater, Richard J.; Fearn, Sarah; Berenov, Andrey V.; Skinner, Stephen J.; Kilner, John A.

    2012-01-01

    Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.

  18. Conjugate Gradient like methods and their application to fixed source neutron diffusion problems

    International Nuclear Information System (INIS)

    Suetomi, Eiichi; Sekimoto, Hiroshi

    1989-01-01

    This paper presents a number of fast iterative methods for solving systems of linear equations appearing in fixed source problems for neutron diffusion. We employed the conjugate gradient and conjugate residual methods. In order to accelerate the conjugate residual method, we proposed the conjugate residual squared method by transforming the residual polynomial of the conjugate residual method. Since the convergence of these methods depends on the spectrum of coefficient matrix, we employed the incomplete Choleski (IC) factorization and the modified IC (MIC) factorization as preconditioners. These methods were applied to some neutron diffusion problems and compared with the successive overrelaxation (SOR) method. The results of these numerical experiments showed superior convergence characteristics of the conjugate gradient like method with MIC factorization to the SOR method, especially for a problem involving void region. The CPU time of the MICCG, MICCR and MICCRS methods showed no great difference. In order to vectorize the conjugate gradient like methods based on (M)IC factorization, the hyperplane method was used and implemented on the vector computers, the HITAC S-820/80 and ETA10-E (one processor mode). Significant decrease of the CPU times was observed on the S-820/80. Since the scaled conjugate gradient (SCG) method can be vectorized with no manipulation, it was also compared with the above methods. It turned out the SCG method was the fastest with respect to the CPU times on the ETA10-E. These results suggest that one should implement suitable algorithm for different vector computers. (author)

  19. Numerical simulation of anisotropic polymeric foams

    Directory of Open Access Journals (Sweden)

    Volnei Tita

    Full Text Available This paper shows in detail the modelling of anisotropic polymeric foam under compression and tension loadings, including discussions on isotropic material models and the entire procedure to calibrate the parameters involved. First, specimens of poly(vinyl chloride (PVC foam were investigated through experimental analyses in order to understand the mechanical behavior of this anisotropic material. Then, isotropic material models available in the commercial software AbaqusTM were investigated in order to verify their ability to model anisotropic foams and how the parameters involved can influence the results. Due to anisotropy, it is possible to obtain different values for the same parameter in the calibration process. The obtained set of parameters are used to calibrate the model according to the application of the structure. The models investigated showed minor and major limitations to simulate the mechanical behavior of anisotropic PVC foams under compression, tension and multi-axial loadings. Results show that the calibration process and the choice of the material model applied to the polymeric foam can provide good quantitative results and save project time. Results also indicate what kind and order of error one will get if certain choices are made throughout the modelling process. Finally, even though the developed calibration procedure is applied to specific PVC foam, it still outlines a very broad drill to analyze other anisotropic cellular materials.

  20. Electrical conductivity and charge diffusion in thermal QCD from the lattice

    Energy Technology Data Exchange (ETDEWEB)

    Aarts, Gert; Allton, Chris [Department of Physics, College of Science, Swansea University Swansea SA2 8PP (United Kingdom); Amato, Alessandro [Department of Physics, College of Science, Swansea University Swansea SA2 8PP (United Kingdom); Department of Physics and Helsinki Institute of Physics P.O. Box 64, FI-00014 University of Helsinki (Finland); Giudice, Pietro [Universität Münster, Institut für Theoretische Physik Wilhelm-Klemm-Str. 9, D-48149 Münster (Germany); Hands, Simon [Department of Physics, College of Science, Swansea University Swansea SA2 8PP (United Kingdom); Skullerud, Jon-Ivar [Department of Mathematical Physics, National University of Ireland Maynooth Maynooth, Co Kildare (Ireland)

    2015-02-27

    We present a lattice QCD calculation of the charge diffusion coefficient, the electrical conductivity and various susceptibilities of conserved charges, for a range of temperatures below and above the deconfinement crossover. The calculations include the contributions from up, down and strange quarks. We find that the diffusion coefficient is of the order of 1/(2πT) and has a dip around the crossover temperature. Our results are obtained with lattice simulations containing 2+1 dynamical flavours on anisotropic lattices. The Maximum Entropy Method is used to construct spectral functions from correlators of the conserved vector current.

  1. The self-similar field and its application to a diffusion problem

    International Nuclear Information System (INIS)

    Michelitsch, Thomas M

    2011-01-01

    We introduce a continuum approach which accounts for self-similarity as a symmetry property of an infinite medium. A self-similar Laplacian operator is introduced which is the source of self-similar continuous fields. In this way ‘self-similar symmetry’ appears in an analogous manner as transverse isotropy or cubic symmetry of a medium. As a consequence of the self-similarity the Laplacian is a non-local fractional operator obtained as the continuum limit of the discrete self-similar Laplacian introduced recently by Michelitsch et al (2009 Phys. Rev. E 80 011135). The dispersion relation of the Laplacian and its Green’s function is deduced in closed forms. As a physical application of the approach we analyze a self-similar diffusion problem. The statistical distributions, which constitute the solutions of this problem, turn out to be Lévi-stable distributions with infinite variances characterizing the statistics of one-dimensional Lévi flights. The self-similar continuum approach introduced in this paper has the potential to be applied on a variety of scale invariant and fractal problems in physics such as in continuum mechanics, electrodynamics and in other fields. (paper)

  2. Linear triangle finite element formulation for multigroup neutron transport analysis with anisotropic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Lillie, R.A.; Robinson, J.C.

    1976-05-01

    The discrete ordinates method is the most powerful and generally used deterministic method to obtain approximate solutions of the Boltzmann transport equation. A finite element formulation, utilizing a canonical form of the transport equation, is here developed to obtain both integral and pointwise solutions to neutron transport problems. The formulation is based on the use of linear triangles. A general treatment of anisotropic scattering is included by employing discrete ordinates-like approximations. In addition, multigroup source outer iteration techniques are employed to perform group-dependent calculations. The ability of the formulation to reduce substantially ray effects and its ability to perform streaming calculations are demonstrated by analyzing a series of test problems. The anisotropic scattering and multigroup treatments used in the development of the formulation are verified by a number of one-dimensional comparisons. These comparisons also demonstrate the relative accuracy of the formulation in predicting integral parameters. The applicability of the formulation to nonorthogonal planar geometries is demonstrated by analyzing a hexagonal-type lattice. A small, high-leakage reactor model is analyzed to investigate the effects of varying both the spatial mesh and order of angular quadrature. This analysis reveals that these effects are more pronounced in the present formulation than in other conventional formulations. However, the insignificance of these effects is demonstrated by analyzing a realistic reactor configuration. In addition, this final analysis illustrates the importance of incorporating anisotropic scattering into the finite element formulation. 8 tables, 29 figures.

  3. Linear triangle finite element formulation for multigroup neutron transport analysis with anisotropic scattering

    International Nuclear Information System (INIS)

    Lillie, R.A.; Robinson, J.C.

    1976-05-01

    The discrete ordinates method is the most powerful and generally used deterministic method to obtain approximate solutions of the Boltzmann transport equation. A finite element formulation, utilizing a canonical form of the transport equation, is here developed to obtain both integral and pointwise solutions to neutron transport problems. The formulation is based on the use of linear triangles. A general treatment of anisotropic scattering is included by employing discrete ordinates-like approximations. In addition, multigroup source outer iteration techniques are employed to perform group-dependent calculations. The ability of the formulation to reduce substantially ray effects and its ability to perform streaming calculations are demonstrated by analyzing a series of test problems. The anisotropic scattering and multigroup treatments used in the development of the formulation are verified by a number of one-dimensional comparisons. These comparisons also demonstrate the relative accuracy of the formulation in predicting integral parameters. The applicability of the formulation to nonorthogonal planar geometries is demonstrated by analyzing a hexagonal-type lattice. A small, high-leakage reactor model is analyzed to investigate the effects of varying both the spatial mesh and order of angular quadrature. This analysis reveals that these effects are more pronounced in the present formulation than in other conventional formulations. However, the insignificance of these effects is demonstrated by analyzing a realistic reactor configuration. In addition, this final analysis illustrates the importance of incorporating anisotropic scattering into the finite element formulation. 8 tables, 29 figures

  4. Investigating the Eddy Diffusivity Concept in the Coastal Ocean

    Science.gov (United States)

    Rypina, I.; Kirincich, A.; Lentz, S. J.; Sundermeyer, M. A.

    2016-12-01

    We test the validity, utility, and limitations of the lateral eddy diffusivity concept in a coastal environment through analyzing data from coupled drifter and dye releases within the footprint of a high-resolution (800 m) high-frequency radar south of Martha's Vineyard, Massachusetts. Specifically, we investigate how well a combination of radar-based velocities and drifter-derived diffusivities can reproduce observed dye spreading over an 8-h time interval. A drifter-based estimate of an anisotropic diffusivity tensor is used to parameterize small-scale motions that are unresolved and under-resolved by the radar system. This leads to a significant improvement in the ability of the radar to reproduce the observed dye spreading. Our drifter-derived diffusivity estimates are O(10 m2/s), are consistent with the diffusivity inferred from aerial images of the dye taken using the quadcopter-mounted digital camera during the dye release, and are roughly an order of magnitude larger than diffusivity estimates of Okubo (O(1 m2/s)) for similar spatial scales ( 1 km). Despite the fact that the drifter-based diffusivity approach was successful in improving the ability of the radar to reproduce the observed dye spreading, the dispersion of drifters was, for the most part, not consistent with the diffusive spreading regime.

  5. Ion and impurity transport in turbulent, anisotropic magnetic fields

    International Nuclear Information System (INIS)

    Negrea, M; Petrisor, I; Isliker, H; Vogiannou, A; Vlahos, L; Weyssow, B

    2011-01-01

    We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

  6. Ion and impurity transport in turbulent, anisotropic magnetic fields

    Energy Technology Data Exchange (ETDEWEB)

    Negrea, M; Petrisor, I [Department of Physics, Association Euratom-MEdC, Romania, University of Craiova, A.I. Cuza str. 13, Craiova (Romania); Isliker, H; Vogiannou, A; Vlahos, L [Section of Astrophysics, Astronomy and Mechanics, Department of Physics, University of Thessaloniki, Association Euratom-Hellenic Republic, 541 24 Thessaloniki (Greece); Weyssow, B [Physique Statistique-Plasmas, Association Euratom-Etat Belge, Universite Libre de Bruxelles, Campus Plaine, Bd. du Triomphe, 1050 Bruxelles (Belgium)

    2011-08-15

    We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

  7. Ion and impurity transport in turbulent, anisotropic magnetic fields

    Science.gov (United States)

    Negrea, M.; Petrisor, I.; Isliker, H.; Vogiannou, A.; Vlahos, L.; Weyssow, B.

    2011-08-01

    We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

  8. Singular problems in shell theory. Computing and asymptotics

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez-Palencia, Evariste [Institut Jean Le Rond d' Alembert, Paris (France); Millet, Olivier [La Rochelle Univ. (France). LEPTIAB; Bechet, Fabien [Metz Univ. (France). LPMM

    2010-07-01

    It is known that deformations of thin shells exhibit peculiarities such as propagation of singularities, edge and internal layers, piecewise quasi inextensional deformations, sensitive problems and others, leading in most cases to numerical locking phenomena under several forms, and very poor quality of computations for small relative thickness. Most of these phenomena have a local and often anisotropic character (elongated in some directions), so that efficient numerical schemes should take them in consideration. This book deals with various topics in this context: general geometric formalism, analysis of singularities, numerical computing of thin shell problems, estimates for finite element approximation (including non-uniform and anisotropic meshes), mathematical considerations on boundary value problems in connection with sensitive problems encountered for very thin shells; and others. Most of numerical computations presented here use an adaptive anisotropic mesh procedure which allows a good computation of the physical peculiarities on one hand, and the possibility to perform automatic computations (without a previous mathematical description of the singularities) on the other. The book is recommended for PhD students, postgraduates and researchers who want to improve their knowledge in shell theory and in particular in the areas addressed (analysis of singularities, numerical computing of thin and very thin shell problems, sensitive problems). The lecture of the book may not be continuous and the reader may refer directly to the chapters concerned. (orig.)

  9. DTF4-J, 1-D Neutron Transport with Anisotropic Scattering by Sn Method

    International Nuclear Information System (INIS)

    Nishimura, Hideo

    1971-01-01

    Nature of physical problem solved: DTF-4-J solves the one-dimensional multi-group transport equation with anisotropic scattering by Sn method. It is a FORTRAN adaptation of the Los Alamos DTF-IV program written by K.D. Lathrop, and it is combined with the JAERI SIMPLED-4 program written by H. Nishimura

  10. A model for the ultrasonic field radiated by an immersed transducer into an anisotropic and heterogeneous medium; Modelisation du champ ultrasonore rayonne dans un solide anisotrope et heterogene par un traducteur immerge

    Energy Technology Data Exchange (ETDEWEB)

    Gengembre, N

    2000-07-01

    A model for the field radiated by an ultrasonic transducer into anisotropic and heterogeneous media is developed in this thesis. This work aims at improving the settings and interpretations of non destructive tests in welded structures. Since the shape of the transducer is assumed arbitrary, its emitting surface is divided into small elementary sources. The overall field at an observation point in the medium is derived by a summation of the elementary contributions of these point sources. An accurate and numerically efficient model is developed using the Geometrical Optics approximation to evaluate these elementary contributions. Two different forms of this approximation are used: The stationary phase method and the pencil method. The first one is based on an exact formulation of the field and is used for fields into anisotropic and homogeneous media. It allows to emphasize specific configurations for which additional developments are required; this need arises for calculation points in the vicinity of caustics (zones of high intensity). This problem is solved for both harmonic and transient fields, for points laying on caustics or in their neighborhood. The pencil method is used for the calculation of fields in heterogeneous media, although it does not permit to overcome the problem of caustics. It is also advantageous for the implementation of the model. A comparison of both above-mentioned methods is drawn, and their equivalence is proved for some cases. The calculation of fields in anisotropic and heterogeneous media is performed using both methods together, and then the problem of caustics is also treated. Calculated fields into welded components are shown and compared with experiments or with a numerical model, in order to validate the developments. (author)

  11. Cell heterogeneity problems in the analysis of zero power experiments

    International Nuclear Information System (INIS)

    Grimstone, M.J.; Stevenson, J.M.

    1979-01-01

    Methods are described for treating plate and pin cell heterogeneity in the preparation of broad group cross-sections used in the analysis of zero power fast reactor experiments. Methods used at Karlsruhe and Winfrith are summarised and compared, with particular reference to the treatment of resonance shielding, the calculation of broad group spatial fine structure, the treatment of leakage and the calculation of anisotropic diffusion coefficients. The problems of cells near boundaries such as core-breeder interfaces and of singularities such as control rods are also considered briefly. Numerical studies carried out to investigate approximations in the methods are described. These include tests of the accuracy of one-dimensional cell modelling techniques, and the validation by Monte Carlo of methods for treating streaming in the calculation of diffusion coefficients. Comparisons are shown between the heterogeneity effects calculated by the Karlsruhe and Winfrith methods for typical pin and plate cells used in the BIZET experimental programme, and their effect in a whole reactor calculation is indicated. Comparisons are given with measurements which provide tests of the heterogeneity calculations. These include reaction rate scans within pin and plate cells, and reaction rate measurements across sectors of pin and plate fuel, where the flux tilt is determined by the relative reactivity of the pin and plate cells. Finally, the heterogeneity problems arising in the interpretation of reaction rate measurements are discussed. (author)

  12. Anisotropic wave-equation traveltime and waveform inversion

    KAUST Repository

    Feng, Shihang; Schuster, Gerard T.

    2016-01-01

    The wave-equation traveltime and waveform inversion (WTW) methodology is developed to invert for anisotropic parameters in a vertical transverse isotropic (VTI) meidum. The simultaneous inversion of anisotropic parameters v0, ε and δ is initially

  13. Strategies for Solving Potential Problems Associated with Laboratory Diffusion and Batch Experiments - Part 1: An Overview of Conventional Test Methods

    International Nuclear Information System (INIS)

    Zhang, M.; Takeda, M.; Nakajima, H.

    2006-01-01

    Laboratory diffusion testing as well as batch experiments are well established and widely adopted techniques for characterizing the diffusive and adsorptive properties of geological, geotechnical, and synthetic materials in both scientific and applied fields, including geological disposal of radioactive waste. Although several types of diffusion test, such as the through- diffusion test, in-diffusion test, out-diffusion test, and column test, are currently available, different methods may have different advantages and disadvantages. In addition, traditional methods may have limitations, such as the need for relatively long test times, cumbersome test procedures, and the possibility of errors due to differences between analytical assumptions and actual test conditions. Furthermore, traditional batch experiments using mineral powders are known to overestimate the sorption coefficient. In part 1 of this report, we present a brief overview of laboratory diffusion and batch experiments. The advantages, disadvantages, limitations, and/or potential problems associated with individual tests were compared and summarized. This comprehensive report will provide practical references for reviewing the results obtained from relevant experiments, especially from the viewpoint of regulation. To solve and/or eliminate the potential problems associated with conventional methods, and to obtain the diffusion coefficient and rock capacity factor from a laboratory test both rapidly and accurately, part 2 of this study discusses possible strategies involving the development of rigorous solutions to some relevant test methods, and sensitivity analyses for the related tests that may be helpful to judge the accuracy of the two parameters to be determined from individual tests. (authors)

  14. Verification of a dust transport model against theoretical solutions in multidimensional advection diffusion problems

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Z., E-mail: zhanjie.xu@kit.ed [Forschungszentrum Karlsruhe, P.O. Box 3640, 76021 Karlsruhe (Germany); Travis, J.R. [Ingenieurbuero DuBois-Pitzer-Travis, 63071 Offenbach (Germany); Breitung, W.; Jordan, T. [Forschungszentrum Karlsruhe, P.O. Box 3640, 76021 Karlsruhe (Germany)

    2010-12-15

    Potentially explosive dust aerosol mobilization in the vacuum vessel is an important safety issue of the ITER facility, especially in scenarios of loss of vacuum accidents. Therefore dust mobilization modeling is ongoing in Research Center Karlsuhe. At first the aerosol particle model in the GASFLOW computer code is introduced briefly. To verify the particle model, a series of particle diffusion problems are simulated in one-, two- and three-dimensions. In each problem a particle source is initially exposed to an advective gas flow. Then a dust cloud is formed in the down stream. To obtain the theoretical solution about the particle concentration in the dust cloud, the governing diffusion partial differential equations with an additional advection term are solved by using Green's function method. Different spatial and temporal characters about the particle sources are also considered, e.g., instantaneous or continuous sources, line, or volume sources and so forth. The GASFLOW simulation results about the particle concentrations and the corresponding Green's function solutions are compared case by case. Very good agreements are found between the theoretical solutions and the GASGLOW simulations, when the drag force between the micron-sized particles and the conveying gas flow meets the Stokes' law about resistance. This situation is corresponding to a very small Reynolds number based on the particle diameter, with a negligible inertia effect of the particles. This verification work shows that the particle model of the GASFLOW code can reproduce numerically particle transport and diffusion in a good way.

  15. Anisotropic Lithium Insertion Behavior in Silicon Nanowires: Binding Energy, Diffusion Barrier, and Strain Effect

    KAUST Repository

    Zhang, Qianfan; Cui, Yi; Wang, Enge

    2011-01-01

    Silicon nanowires (SiNWs) have recently been shown to be promising as high capacity lithium battery anodes. SiNWs can be grown with their long axis along several different crystallographic directions. Due to distinct atomic configuration and electronic structure of SiNWs with different axial orientations, their lithium insertion behavior could be different. This paper focuses on the characteristics of single Li defects, including binding energy, diffusion barriers, and dependence on uniaxial strain in [110], [100], [111], and [112] SiNWs. Our systematic ab initio study suggests that the Si-Li interaction is weaker when the Si-Li bond direction is aligned close to the SiNW long axis. This results in the [110] and [111] SiNWs having the highest and lowest Li binding energy, respectively, and it makes the diffusion barrier along the SiNW axis lower than other pathways. Under external strain, it was found that [110] and [001] SiNWs are the most and least sensitive, respectively. For diffusion along the axial direction, the barrier increases (decreases) under tension (compression). This feature results in a considerable difference in the magnitude of the energy barrier along different diffusion pathways. © 2011 American Chemical Society.

  16. Anisotropic Lithium Insertion Behavior in Silicon Nanowires: Binding Energy, Diffusion Barrier, and Strain Effect

    KAUST Repository

    Zhang, Qianfan

    2011-05-19

    Silicon nanowires (SiNWs) have recently been shown to be promising as high capacity lithium battery anodes. SiNWs can be grown with their long axis along several different crystallographic directions. Due to distinct atomic configuration and electronic structure of SiNWs with different axial orientations, their lithium insertion behavior could be different. This paper focuses on the characteristics of single Li defects, including binding energy, diffusion barriers, and dependence on uniaxial strain in [110], [100], [111], and [112] SiNWs. Our systematic ab initio study suggests that the Si-Li interaction is weaker when the Si-Li bond direction is aligned close to the SiNW long axis. This results in the [110] and [111] SiNWs having the highest and lowest Li binding energy, respectively, and it makes the diffusion barrier along the SiNW axis lower than other pathways. Under external strain, it was found that [110] and [001] SiNWs are the most and least sensitive, respectively. For diffusion along the axial direction, the barrier increases (decreases) under tension (compression). This feature results in a considerable difference in the magnitude of the energy barrier along different diffusion pathways. © 2011 American Chemical Society.

  17. Obtuse triangle suppression in anisotropic meshes

    KAUST Repository

    Sun, Feng; Choi, Yi King; Wang, Wen Ping; Yan, Dongming; Liu, Yang; Lé vy, Bruno L.

    2011-01-01

    Anisotropic triangle meshes are used for efficient approximation of surfaces and flow data in finite element analysis, and in these applications it is desirable to have as few obtuse triangles as possible to reduce the discretization error. We present a variational approach to suppressing obtuse triangles in anisotropic meshes. Specifically, we introduce a hexagonal Minkowski metric, which is sensitive to triangle orientation, to give a new formulation of the centroidal Voronoi tessellation (CVT) method. Furthermore, we prove several relevant properties of the CVT method with the newly introduced metric. Experiments show that our algorithm produces anisotropic meshes with much fewer obtuse triangles than using existing methods while maintaining mesh anisotropy. © 2011 Elsevier B.V. All rights reserved.

  18. Obtuse triangle suppression in anisotropic meshes

    KAUST Repository

    Sun, Feng

    2011-12-01

    Anisotropic triangle meshes are used for efficient approximation of surfaces and flow data in finite element analysis, and in these applications it is desirable to have as few obtuse triangles as possible to reduce the discretization error. We present a variational approach to suppressing obtuse triangles in anisotropic meshes. Specifically, we introduce a hexagonal Minkowski metric, which is sensitive to triangle orientation, to give a new formulation of the centroidal Voronoi tessellation (CVT) method. Furthermore, we prove several relevant properties of the CVT method with the newly introduced metric. Experiments show that our algorithm produces anisotropic meshes with much fewer obtuse triangles than using existing methods while maintaining mesh anisotropy. © 2011 Elsevier B.V. All rights reserved.

  19. [Outstanding problems of normal and pathological morphology of the diffuse endocrine system].

    Science.gov (United States)

    Iaglov, V V; Iaglova, N V

    2011-01-01

    The diffuse endocrine system (DES)--a mosaic-cellular endoepithelial gland--is the biggest part of the human endocrine system. Scientists used to consider cells of DES as neuroectodermal. According to modem data cells of DES are different cytogenetic types because they develop from the different embryonic blastophyllum. So that any hormone-active tumors originated from DES of the digestive, respiratory and urogenital system shouldn't be considered as neuroendocrinal tumors. The basic problems of DES morphology and pathology are the creation of scientifically substantiated histogenetic classification of DES tumors.

  20. Diffusion is capable of translating anisotropic apoptosis initiation into a homogeneous execution of cell death.

    LENUS (Irish Health Repository)

    Huber, Heinrich J

    2010-01-01

    ABSTRACT: BACKGROUND: Apoptosis is an essential cell death process throughout the entire life span of all metazoans and its deregulation in humans has been implicated in many proliferative and degenerative diseases. Mitochondrial outer membrane permeabilisation (MOMP) and activation of effector caspases are key processes during apoptosis signalling. MOMP can be subject to spatial coordination in human cancer cells, resulting in intracellular waves of cytochrome-c release. To investigate the consequences of these spatial anisotropies in mitochondrial permeabilisation on subsequent effector caspase activation, we devised a mathematical reaction-diffusion model building on a set of partial differential equations. RESULTS: Reaction-diffusion modelling suggested that even if strong spatial anisotropies existed during mitochondrial cytochrome c release, these would be eliminated by free diffusion of the cytosolic proteins that instantiate the apoptosis execution network. Experimentally, rapid sampling of mitochondrial permeabilisation and effector caspase activity in individual HeLa cervical cancer cells confirmed predictions of the reaction-diffusion model and demonstrated that the signalling network of apoptosis execution could efficiently translate spatial anisotropies in mitochondrial permeabilisation into a homogeneous effector caspase response throughout the cytosol. Further systems modelling suggested that a more than 10,000-fold impaired diffusivity would be required to maintain spatial anisotropies as observed during mitochondrial permeabilisation until the time effector caspases become activated. CONCLUSIONS: Multi-protein diffusion efficiently contributes to eliminating spatial asynchronies which are present during the initiation of apoptosis execution and thereby ensures homogeneous apoptosis execution throughout the entire cell body. For previously reported biological scenarios in which effector caspase activity was shown to be targeted selectively to

  1. Strong Maximum Principle for Multi-Term Time-Fractional Diffusion Equations and its Application to an Inverse Source Problem

    OpenAIRE

    Liu, Yikan

    2015-01-01

    In this paper, we establish a strong maximum principle for fractional diffusion equations with multiple Caputo derivatives in time, and investigate a related inverse problem of practical importance. Exploiting the solution properties and the involved multinomial Mittag-Leffler functions, we improve the weak maximum principle for the multi-term time-fractional diffusion equation to a stronger one, which is parallel to that for its single-term counterpart as expected. As a direct application, w...

  2. Axi-symmetric generalized thermoelastic diffusion problem with two-temperature and initial stress under fractional order heat conduction

    International Nuclear Information System (INIS)

    Deswal, Sunita; Kalkal, Kapil Kumar; Sheoran, Sandeep Singh

    2016-01-01

    A mathematical model of fractional order two-temperature generalized thermoelasticity with diffusion and initial stress is proposed to analyze the transient wave phenomenon in an infinite thermoelastic half-space. The governing equations are derived in cylindrical coordinates for a two dimensional axi-symmetric problem. The analytical solution is procured by employing the Laplace and Hankel transforms for time and space variables respectively. The solutions are investigated in detail for a time dependent heat source. By using numerical inversion method of integral transforms, we obtain the solutions for displacement, stress, temperature and diffusion fields in physical domain. Computations are carried out for copper material and displayed graphically. The effect of fractional order parameter, two-temperature parameter, diffusion, initial stress and time on the different thermoelastic and diffusion fields is analyzed on the basis of analytical and numerical results. Some special cases have also been deduced from the present investigation.

  3. Band gaps in periodically magnetized homogeneous anisotropic media

    Science.gov (United States)

    Merzlikin, A. M.; Levy, M.; Vinogradov, A. P.; Wu, Z.; Jalali, A. A.

    2010-11-01

    In [A. M. Merzlikin, A. P. Vinogradov, A. V. Dorofeenko, M. Inoue, M. Levy, A. B. Granovsky, Physica B 394 (2007) 277] it is shown that in anisotropic magnetophotonic crystal made of anisotropic dielectric layers and isotropic magneto-optical layers the magnetization leads to formation of additional band gaps (BG) inside the Brillouin zones. Due to the weakness of the magneto-optical effects the width of these BG is much smaller than that of usual BG forming on the boundaries of Brillouin zones. In the present communication we show that though the anisotropy suppresses magneto-optical effects. An anisotropic magnetophotonic crystal made of anisotropic dielectric layers and anisotropic magneto-optical; the width of additional BG may be much greater than the width of the usual Brillouin BG. Anisotropy tends to suppress Brillouin zone boundary band gap formation because the anisotropy suppresses magneto-optical properties, while degenerate band gap formation occurs around points of effective isotropy and is not suppressed.

  4. Performance modeling of parallel algorithms for solving neutron diffusion problems

    International Nuclear Information System (INIS)

    Azmy, Y.Y.; Kirk, B.L.

    1995-01-01

    Neutron diffusion calculations are the most common computational methods used in the design, analysis, and operation of nuclear reactors and related activities. Here, mathematical performance models are developed for the parallel algorithm used to solve the neutron diffusion equation on message passing and shared memory multiprocessors represented by the Intel iPSC/860 and the Sequent Balance 8000, respectively. The performance models are validated through several test problems, and these models are used to estimate the performance of each of the two considered architectures in situations typical of practical applications, such as fine meshes and a large number of participating processors. While message passing computers are capable of producing speedup, the parallel efficiency deteriorates rapidly as the number of processors increases. Furthermore, the speedup fails to improve appreciably for massively parallel computers so that only small- to medium-sized message passing multiprocessors offer a reasonable platform for this algorithm. In contrast, the performance model for the shared memory architecture predicts very high efficiency over a wide range of number of processors reasonable for this architecture. Furthermore, the model efficiency of the Sequent remains superior to that of the hypercube if its model parameters are adjusted to make its processors as fast as those of the iPSC/860. It is concluded that shared memory computers are better suited for this parallel algorithm than message passing computers

  5. Magnetostatics of anisotropic superconducting ellipsoid

    International Nuclear Information System (INIS)

    Saif, A.G.

    1987-09-01

    The magnetization and the magnetic field distribution inside (outside) an anisotropic type II superconducting ellipsoid, with filamentary structure, is formulated. We have shown that the magnetic field in this case is different from that of the general anisotropic one. The nucleations of the flux lines for specimens with large demagnetization factors are theoretically studied. We have shown that the nucleations of the flux lines, for specimens with large demagnetization factor, appears at a field larger than that of ellipsoidal shape. (author). 15 refs

  6. Numerical Simulation of Anisotropic Preheating Ablative Rayleigh–Taylor Instability

    International Nuclear Information System (INIS)

    Li-Feng, Wang; Wen-Hua, Ye; Ying-Jun, Li

    2010-01-01

    The linear growth rate of the anisotropic preheating ablative Rayleigh–Taylor instability (ARTI) is studied by numerical simulations. The preheating model κ(T) = κ SH [1 + f(T)] is applied, where f(T) is the preheating function interpreting the preheating tongue effect in the cold plasma ahead of the ablative front. An arbitrary coefficient D is introduced in the energy equation to study the influence of transverse thermal conductivity on the growth of the ARTI. We find that enhancing diffusion in a plane transverse to the mean longitudinal flow can strongly reduce the growth of the instability. Numerical simulations exhibit a significant stabilization of the ablation front by improving the transverse thermal conduction. Our results are in general agreement with the theory analysis and numerical simulations by Masse [Phys. Rev. Lett. 98 (2007) 245001]. (physics of gases, plasmas, and electric discharges)

  7. Transport synthetic acceleration scheme for multi-dimensional neutron transport problems

    Energy Technology Data Exchange (ETDEWEB)

    Modak, R S; Kumar, Vinod; Menon, S V.G. [Theoretical Physics Div., Bhabha Atomic Research Centre, Mumbai (India); Gupta, Anurag [Reactor Physics Design Div., Bhabha Atomic Research Centre, Mumbai (India)

    2005-09-15

    The numerical solution of linear multi-energy-group neutron transport equation is required in several analyses in nuclear reactor physics and allied areas. Computer codes based on the discrete ordinates (Sn) method are commonly used for this purpose. These codes solve external source problem and K-eigenvalue problem. The overall solution technique involves solution of source problem in each energy group as intermediate procedures. Such a single-group source problem is solved by the so-called Source Iteration (SI) method. As is well-known, the SI-method converges very slowly for optically thick and highly scattering regions, leading to large CPU times. Over last three decades, many schemes have been tried to accelerate the SI; the most prominent being the Diffusion Synthetic Acceleration (DSA) scheme. The DSA scheme, however, often fails and is also rather difficult to implement. In view of this, in 1997, Ramone and others have developed a new acceleration scheme called Transport Synthetic Acceleration (TSA) which is much more robust and easy to implement. This scheme has been recently incorporated in 2-D and 3-D in-house codes at BARC. This report presents studies on the utility of TSA scheme for fairly general test problems involving many energy groups and anisotropic scattering. The scheme is found to be useful for problems in Cartesian as well as Cylindrical geometry. (author)

  8. Transport synthetic acceleration scheme for multi-dimensional neutron transport problems

    International Nuclear Information System (INIS)

    Modak, R.S.; Vinod Kumar; Menon, S.V.G.; Gupta, Anurag

    2005-09-01

    The numerical solution of linear multi-energy-group neutron transport equation is required in several analyses in nuclear reactor physics and allied areas. Computer codes based on the discrete ordinates (Sn) method are commonly used for this purpose. These codes solve external source problem and K-eigenvalue problem. The overall solution technique involves solution of source problem in each energy group as intermediate procedures. Such a single-group source problem is solved by the so-called Source Iteration (SI) method. As is well-known, the SI-method converges very slowly for optically thick and highly scattering regions, leading to large CPU times. Over last three decades, many schemes have been tried to accelerate the SI; the most prominent being the Diffusion Synthetic Acceleration (DSA) scheme. The DSA scheme, however, often fails and is also rather difficult to implement. In view of this, in 1997, Ramone and others have developed a new acceleration scheme called Transport Synthetic Acceleration (TSA) which is much more robust and easy to implement. This scheme has been recently incorporated in 2-D and 3-D in-house codes at BARC. This report presents studies on the utility of TSA scheme for fairly general test problems involving many energy groups and anisotropic scattering. The scheme is found to be useful for problems in Cartesian as well as Cylindrical geometry. (author)

  9. Finite Element Methods On Very Large, Dynamic Tubular Grid Encoded Implicit Surfaces

    DEFF Research Database (Denmark)

    Nemitz, Oliver; Nielsen, Michael Bang; Rumpf, Martin

    2009-01-01

    dynamic tubular grid encoding format for a narrow band. A reaction diffusion model on a fixed surface and surface evolution driven by a nonlinear geometric diffusion approach, by isotropic or truly anisotropic curvature motion, are investigated as characteristic model problems. The proposed methods...

  10. Conservative image transformations with restoration and scale-space properties

    NARCIS (Netherlands)

    Weickert, J.A.; Haar Romenij, ter B.M.; Viergever, M.A.; Delogne, P.

    1996-01-01

    Many image processing applications require to solve problems such as denoising with edge enhancement, preprocessing for segmentation, or the completion of interrupted lines. This may be accomplished by applying a suitable nonlinear anisotropic diffusion process to the image. Its diffusion tensor is

  11. Gaussian beam diffraction in weakly anisotropic inhomogeneous media

    Energy Technology Data Exchange (ETDEWEB)

    Kravtsov, Yu.A., E-mail: kravtsov@am.szczecin.p [Institute of Physics, Maritime University of Szczecin, Szczecin 70-500 (Poland); Space Research Institute, Russian Academy of Science, Moscow 117 997 (Russian Federation); Berczynski, P., E-mail: pawel.berczynski@ps.p [Institute of Physics, West Pomeranian University of Technology, Szczecin 70-310 (Poland); Bieg, B., E-mail: b.bieg@am.szczecin.p [Institute of Physics, Maritime University of Szczecin, Szczecin 70-500 (Poland)

    2009-08-10

    Combination of quasi-isotropic approximation (QIA) of geometric optics with paraxial complex geometric optics (PCGO) is suggested, which allows describing both diffraction and polarization evolution of Gaussian electromagnetic beams in weakly anisotropic inhomogeneous media. Combination QIA/PCGO reduces Maxwell equations to the system of the ordinary differential equations of the first order and radically simplifies solution of various problems, related to microwave plasma diagnostics, including plasma polarimetry, interferometry and refractometry in thermonuclear reactors. Efficiency of the method is demonstrated by the example of electromagnetic beam diffraction in a linear layer of magnetized plasma with parameters, modeling tokamak plasma in the project ITER.

  12. Gaussian beam diffraction in weakly anisotropic inhomogeneous media

    International Nuclear Information System (INIS)

    Kravtsov, Yu.A.; Berczynski, P.; Bieg, B.

    2009-01-01

    Combination of quasi-isotropic approximation (QIA) of geometric optics with paraxial complex geometric optics (PCGO) is suggested, which allows describing both diffraction and polarization evolution of Gaussian electromagnetic beams in weakly anisotropic inhomogeneous media. Combination QIA/PCGO reduces Maxwell equations to the system of the ordinary differential equations of the first order and radically simplifies solution of various problems, related to microwave plasma diagnostics, including plasma polarimetry, interferometry and refractometry in thermonuclear reactors. Efficiency of the method is demonstrated by the example of electromagnetic beam diffraction in a linear layer of magnetized plasma with parameters, modeling tokamak plasma in the project ITER.

  13. Diffusion in energy materials: Governing dynamics from atomistic modelling

    Science.gov (United States)

    Parfitt, D.; Kordatos, A.; Filippatos, P. P.; Chroneos, A.

    2017-09-01

    Understanding diffusion in energy materials is critical to optimising the performance of solid oxide fuel cells (SOFCs) and batteries both of which are of great technological interest as they offer high efficiency for cleaner energy conversion and storage. In the present review, we highlight the insights offered by atomistic modelling of the ionic diffusion mechanisms in SOFCs and batteries and how the growing predictive capability of high-throughput modelling, together with our new ability to control compositions and microstructures, will produce advanced materials that are designed rather than chosen for a given application. The first part of the review focuses on the oxygen diffusion mechanisms in cathode and electrolyte materials for SOFCs and in particular, doped ceria and perovskite-related phases with anisotropic structures. The second part focuses on disordered oxides and two-dimensional materials as these are very promising systems for battery applications.

  14. Jet quenching in a strongly coupled anisotropic plasma

    Science.gov (United States)

    Chernicoff, Mariano; Fernández, Daniel; Mateos, David; Trancanelli, Diego

    2012-08-01

    The jet quenching parameter of an anisotropic plasma depends on the relative orientation between the anisotropic direction, the direction of motion of the parton, and the direction along which the momentum broadening is measured. We calculate the jet quenching parameter of an anisotropic, strongly coupled {N} = 4 plasma by means of its gravity dual. We present the results for arbitrary orientations and arbitrary values of the anisotropy. The anisotropic value can be larger or smaller than the isotropic one, and this depends on whether the comparison is made at equal temperatures or at equal entropy densities. We compare our results to analogous calculations for the real-world quark-gluon plasma and find agreement in some cases and disagreement in others.

  15. Finite element method for neutron diffusion problems in hexagonal geometry

    International Nuclear Information System (INIS)

    Wei, T.Y.C.; Hansen, K.F.

    1975-06-01

    The use of the finite element method for solving two-dimensional static neutron diffusion problems in hexagonal reactor configurations is considered. It is investigated as a possible alternative to the low-order finite difference method. Various piecewise polynomial spaces are examined for their use in hexagonal problems. The central questions which arise in the design of these spaces are the degree of incompleteness permissible and the advantages of using a low-order space fine-mesh approach over that of a high-order space coarse-mesh one. There is also the question of the degree of smoothness required. Two schemes for the construction of spaces are described and a number of specific spaces, constructed with the questions outlined above in mind, are presented. They range from a complete non-Lagrangian, non-Hermite quadratic space to an incomplete ninth order space. Results are presented for two-dimensional problems typical of a small high temperature gas-cooled reactor. From the results it is concluded that the space used should at least include the complete linear one. Complete spaces are to be preferred to totally incomplete ones. Once function continuity is imposed any additional degree of smoothness is of secondary importance. For flux shapes typical of the small high temperature gas-cooled reactor the linear space fine-mesh alternative is to be preferred to the perturbation quadratic space coarse-mesh one and the low-order finite difference method is to be preferred over both finite element schemes

  16. Diffusion tensor and diffusion weighted imaging. Pictorial mathematics

    Energy Technology Data Exchange (ETDEWEB)

    Nakada, Tsutomu [California Univ., Davis, CA (United States)

    1995-06-01

    A new imaging algorithm for the treatment of a second order apparent diffusion tensor, D{sub app}{sup {xi}} is described. The method calls for only mathematics of images (pictorial mathematics) without necessity of eigenvalues/eigenvectors estimation. Nevertheless, it is capable of extracting properties of D{sub app}{sup {xi}} invariant to observation axes. While trace image is an example of images weighted by invariance of the tensor matrix, three dimensional anisotropy (3DAC) contrast represents the imaging method making use to anisotropic direction of tensor ellipsoid producing color coded contrast of exceptionally high anatomic resolution. Contrary to intuition, the processes require only a simple algorithm directly applicable to clinical magnetic resonance imaging (MRI). As a contrast method which precisely represents physical characteristics of a target tissue, invariant D{sub app}{sup {xi}} images produced by pictorial mathematics possess significant potential for a number of biological and clinical applications. (author).

  17. Anisotropic solutions by gravitational decoupling

    Science.gov (United States)

    Ovalle, J.; Casadio, R.; da Rocha, R.; Sotomayor, A.

    2018-02-01

    We investigate the extension of isotropic interior solutions for static self-gravitating systems to include the effects of anisotropic spherically symmetric gravitational sources by means of the gravitational decoupling realised via the minimal geometric deformation approach. In particular, the matching conditions at the surface of the star with the outer Schwarzschild space-time are studied in great detail, and we describe how to generate, from a single physically acceptable isotropic solution, new families of anisotropic solutions whose physical acceptability is also inherited from their isotropic parent.

  18. Anisotropic solutions by gravitational decoupling

    Energy Technology Data Exchange (ETDEWEB)

    Ovalle, J. [Silesian University in Opava, Institute of Physics and Research Centre of Theoretical Physics and Astrophysics, Faculty of Philosophy and Science, Opava (Czech Republic); Universidad Simon Bolivar, Departamento de Fisica, Caracas (Venezuela, Bolivarian Republic of); Casadio, R. [Alma Mater Universita di Bologna, Dipartimento di Fisica e Astronomia, Bologna (Italy); Istituto Nazionale di Fisica Nucleare, Bologna (Italy); Rocha, R. da [Universidade Federal do ABC (UFABC), Centro de Matematica, Computacao e Cognicao, Santo Andre, SP (Brazil); Sotomayor, A. [Universidad de Antofagasta, Departamento de Matematicas, Antofagasta (Chile)

    2018-02-15

    We investigate the extension of isotropic interior solutions for static self-gravitating systems to include the effects of anisotropic spherically symmetric gravitational sources by means of the gravitational decoupling realised via the minimal geometric deformation approach. In particular, the matching conditions at the surface of the star with the outer Schwarzschild space-time are studied in great detail, and we describe how to generate, from a single physically acceptable isotropic solution, new families of anisotropic solutions whose physical acceptability is also inherited from their isotropic parent. (orig.)

  19. Jets in a strongly coupled anisotropic plasma

    Energy Technology Data Exchange (ETDEWEB)

    Fadafan, Kazem Bitaghsir [Shahrood University of Technology, Faculty of Physics, Shahrood (Iran, Islamic Republic of); University of Southampton, STAG Research Centre Physics and Astronomy, Southampton (United Kingdom); Morad, Razieh [University of Cape Town, Department of Physics, Rondebosch (South Africa)

    2018-01-15

    In this paper, we study the dynamics of the light quark jet moving through the static, strongly coupled N = 4, anisotropic plasma with and without charge. The light quark is presented by a 2-parameters point-like initial condition falling string in the context of the AdS/CFT. We calculate the stopping distance of the light quark in the anisotropic medium and compare it with its isotropic value. We study the dependency of the stopping distance to the both string initial conditions and background parameters such as anisotropy parameter or chemical potential. Although the typical behavior of the string in the anisotropic medium is similar to the one in the isotropic AdS-Sch background, the string falls faster to the horizon depending on the direction of moving. Particularly, the enhancement of quenching is larger in the beam direction. We find that the suppression of stopping distance is more prominent when the anisotropic plasma have the same temperature as the isotropic plasma. (orig.)

  20. Mixed-hybrid finite element method for the transport equation and diffusion approximation of transport problems; Resolution de l'equation du transport par une methode d'elements finis mixtes-hybrides et approximation par la diffusion de problemes de transport

    Energy Technology Data Exchange (ETDEWEB)

    Cartier, J

    2006-04-15

    This thesis focuses on mathematical analysis, numerical resolution and modelling of the transport equations. First of all, we deal with numerical approximation of the solution of the transport equations by using a mixed-hybrid scheme. We derive and study a mixed formulation of the transport equation, then we analyse the related variational problem and present the discretization and the main properties of the scheme. We particularly pay attention to the behavior of the scheme and we show its efficiency in the diffusion limit (when the mean free path is small in comparison with the characteristic length of the physical domain). We present academical benchmarks in order to compare our scheme with other methods in many physical configurations and validate our method on analytical test cases. Unstructured and very distorted meshes are used to validate our scheme. The second part of this thesis deals with two transport problems. The first one is devoted to the study of diffusion due to boundary conditions in a transport problem between two plane plates. The second one consists in modelling and simulating radiative transfer phenomenon in case of the industrial context of inertial confinement fusion. (author)

  1. Anisotropic Third-Order Regularization for Sparse Digital Elevation Models

    KAUST Repository

    Lellmann, Jan

    2013-01-01

    We consider the problem of interpolating a surface based on sparse data such as individual points or level lines. We derive interpolators satisfying a list of desirable properties with an emphasis on preserving the geometry and characteristic features of the contours while ensuring smoothness across level lines. We propose an anisotropic third-order model and an efficient method to adaptively estimate both the surface and the anisotropy. Our experiments show that the approach outperforms AMLE and higher-order total variation methods qualitatively and quantitatively on real-world digital elevation data. © 2013 Springer-Verlag.

  2. Weak unique continuation property and a related inverse source problem for time-fractional diffusion-advection equations

    Science.gov (United States)

    Jiang, Daijun; Li, Zhiyuan; Liu, Yikan; Yamamoto, Masahiro

    2017-05-01

    In this paper, we first establish a weak unique continuation property for time-fractional diffusion-advection equations. The proof is mainly based on the Laplace transform and the unique continuation properties for elliptic and parabolic equations. The result is weaker than its parabolic counterpart in the sense that we additionally impose the homogeneous boundary condition. As a direct application, we prove the uniqueness for an inverse problem on determining the spatial component in the source term by interior measurements. Numerically, we reformulate our inverse source problem as an optimization problem, and propose an iterative thresholding algorithm. Finally, several numerical experiments are presented to show the accuracy and efficiency of the algorithm.

  3. Antisites and anisotropic diffusion in GaAs and GaSb

    KAUST Repository

    Tahini, H. A.

    2013-10-02

    The significant diffusion of Ga under Ga-rich conditions in GaAs and GaSb is counter intuitive as the concentration of Ga vacancies should be depressed although Ga vacancies are necessary to interpret the experimental evidence for Ga transport. To reconcile the existence of Ga vacancies under Ga-rich conditions, transformation reactions have been proposed. Here, density functional theory is employed to calculate the formation energies of vacancies on both sublattices and the migration energy barriers to overcome the formation of the vacancy-antisite defect. Transformation reactions enhance the vacancy concentration in both materials and migration energy barriers indicate that Ga vacancies will dominate.

  4. Existence and uniqueness in anisotropic conductivity reconstruction with Faraday's law

    KAUST Repository

    Lee, Min-Gi

    2015-03-18

    We show that three sets of internal current densities are the right amount of data that give the existence and the uniqueness at the same time in reconstructing an anisotropic conductivity in two space dimensions. The curl free equation of Faraday’s law is taken instead of the usual divergence free equation of the electrical impedance to- mography. Boundary conditions related to given current densities are introduced which complete a well determined problem for conductivity reconstruction together with Fara- day’s law.

  5. Modelling of ultrasonic nondestructive testing in anisotropic materials - Rectangular crack

    International Nuclear Information System (INIS)

    Bostroem, A.

    2001-12-01

    Nondestructive testing with ultrasound is a standard procedure in the nuclear power industry when searching for defects, in particular cracks. To develop and qualify testing procedures extensive experimental work on test blocks is usually required. This can take a lot of time and therefore be quite costly. A good mathematical model of the testing situation is therefore of great value as it can reduce the experimental work to a great extent. A good model can be very useful for parametric studies and as a pedagogical tool. A further use of a model is as a tool in the qualification of personnel. In anisotropic materials, e.g. austenitic welds, the propagation of ultrasound becomes much more complicated as compared to isotropic materials. Therefore, modelling is even more useful for anisotropic materials, and it in particular has a greater pedagogical value. The present project has been concerned with a further development of the anisotropic capabilities of the computer program UTDefect, which has so far only contained a strip-like crack as the single defect type for anisotropic materials. To be more specific, the scattering by a rectangular crack in an anisotropic component has been studied and the result is adapted to include transmitting and receiving ultrasonic probes. The component under study is assumed to be anisotropic with arbitrary anisotropy. On the other hand, it is assumed to be homogeneous, and this in particular excludes most welds, where it is seldom an adequate approximation to assume homogeneity. The anisotropy may be arbitrarily oriented and the same is true of the rectangular crack. The crack may also be located near a backside of the component. To solve the scattering problem for the crack an integral equation method is used. The probe model has been developed in an earlier project and to compute the signal response in the receiving probe an electromechanical reciprocity argument is employed. As a rectangle is a truly 3D scatterer the sizes of the

  6. A novel anisotropic fast marching method and its application to blood flow computation in phase-contrast MRI.

    Science.gov (United States)

    Schwenke, M; Hennemuth, A; Fischer, B; Friman, O

    2012-01-01

    Phase-contrast MRI (PC MRI) can be used to assess blood flow dynamics noninvasively inside the human body. The acquired images can be reconstructed into flow vector fields. Traditionally, streamlines can be computed based on the vector fields to visualize flow patterns and particle trajectories. The traditional methods may give a false impression of precision, as they do not consider the measurement uncertainty in the PC MRI images. In our prior work, we incorporated the uncertainty of the measurement into the computation of particle trajectories. As a major part of the contribution, a novel numerical scheme for solving the anisotropic Fast Marching problem is presented. A computing time comparison to state-of-the-art methods is conducted on artificial tensor fields. A visual comparison of healthy to pathological blood flow patterns is given. The comparison shows that the novel anisotropic Fast Marching solver outperforms previous schemes in terms of computing time. The visual comparison of flow patterns directly visualizes large deviations of pathological flow from healthy flow. The novel anisotropic Fast Marching solver efficiently resolves even strongly anisotropic path costs. The visualization method enables the user to assess the uncertainty of particle trajectories derived from PC MRI images.

  7. Generalized Fractional Derivative Anisotropic Viscoelastic Characterization

    Directory of Open Access Journals (Sweden)

    Harry H. Hilton

    2012-01-01

    Full Text Available Isotropic linear and nonlinear fractional derivative constitutive relations are formulated and examined in terms of many parameter generalized Kelvin models and are analytically extended to cover general anisotropic homogeneous or non-homogeneous as well as functionally graded viscoelastic material behavior. Equivalent integral constitutive relations, which are computationally more powerful, are derived from fractional differential ones and the associated anisotropic temperature-moisture-degree-of-cure shift functions and reduced times are established. Approximate Fourier transform inversions for fractional derivative relations are formulated and their accuracy is evaluated. The efficacy of integer and fractional derivative constitutive relations is compared and the preferential use of either characterization in analyzing isotropic and anisotropic real materials must be examined on a case-by-case basis. Approximate protocols for curve fitting analytical fractional derivative results to experimental data are formulated and evaluated.

  8. Waves and discontinuities in relativistic and anisotropic magnetohydrodynamics

    International Nuclear Information System (INIS)

    Cissoko, Mahdy

    1975-01-01

    This work is devoted to the relativistic study of a non-dissipative anisotropic fluid diagram of infinite conductivity. Such a fluid diagram is constructed in part one. Starting from a macroscopic viewpoint a hydrothermodynamic study of the fluid diagram considered is carried out and the fundamental differential system of anisotropic magnetohydrodynamics is deduced. Part two concerns the study of characteristic varieties and propagation of waves for a polytropic anisotropic fluid diagram. Three types of characteristic varieties are revealed: entropy waves (or material waves), magnetosonic waves and Alfven waves. The propagation rates of Alfven and magnetosonic waves are situated with respect to each other. The study of wave cones showed up on the one hand certain special features of wave propagation in anisotropic magnetohydrodynamics and on the other hand the hyperbolic nature of differential operators associated with the various waves [fr

  9. Exact and approximate interior corner problem in neutron diffusion by integral transform methods

    International Nuclear Information System (INIS)

    Bareiss, E.H.; Chang, K.S.J.; Constatinescu, D.A.

    1976-09-01

    The mathematical solution of the neutron diffusion equation exhibits singularities in its derivatives at material corners. A mathematical treatment of the nature of these singularities and its impact on coarse network approximation methods in computational work is presented. The mathematical behavior is deduced from Green's functions, based on a generalized theory for two space dimensions, and the resulting systems of integral equations, as well as from the Kontorovich--Lebedev Transform. The effect on numerical calculations is demonstrated for finite difference and finite element methods for a two-region corner problem

  10. Anisotropic interpolation theorems of Musielak-Orlicz type

    Directory of Open Access Journals (Sweden)

    Jinxia Li

    2016-10-01

    Full Text Available Abstract Anisotropy is a common attribute of Nature, which shows different characterizations in different directions of all or part of the physical or chemical properties of an object. The anisotropic property, in mathematics, can be expressed by a fairly general discrete group of dilations { A k : k ∈ Z } $\\{A^{k}: k\\in\\mathbb{Z}\\}$ , where A is a real n × n $n\\times n$ matrix with all its eigenvalues λ satisfy | λ | > 1 $|\\lambda|>1$ . Let φ : R n × [ 0 , ∞ → [ 0 , ∞ $\\varphi: \\mathbb{R}^{n}\\times[0, \\infty\\to[0,\\infty$ be an anisotropic Musielak-Orlicz function such that φ ( x , ⋅ $\\varphi(x,\\cdot$ is an Orlicz function and φ ( ⋅ , t $\\varphi(\\cdot,t$ is a Muckenhoupt A ∞ ( A $\\mathbb {A}_{\\infty}(A$ weight. The aim of this article is to obtain two anisotropic interpolation theorems of Musielak-Orlicz type, which are weighted anisotropic extension of Marcinkiewicz interpolation theorems. The above results are new even for the isotropic weighted settings.

  11. Self-diffusion in dense granular shear flows.

    Science.gov (United States)

    Utter, Brian; Behringer, R P

    2004-03-01

    Diffusivity is a key quantity in describing velocity fluctuations in granular materials. These fluctuations are the basis of many thermodynamic and hydrodynamic models which aim to provide a statistical description of granular systems. We present experimental results on diffusivity in dense, granular shear flows in a two-dimensional Couette geometry. We find that self-diffusivities D are proportional to the local shear rate gamma; with diffusivities along the direction of the mean flow approximately twice as large as those in the perpendicular direction. The magnitude of the diffusivity is D approximately gamma;a(2), where a is the particle radius. However, the gradient in shear rate, coupling to the mean flow, and strong drag at the moving boundary lead to particle displacements that can appear subdiffusive or superdiffusive. In particular, diffusion appears to be superdiffusive along the mean flow direction due to Taylor dispersion effects and subdiffusive along the perpendicular direction due to the gradient in shear rate. The anisotropic force network leads to an additional anisotropy in the diffusivity that is a property of dense systems and has no obvious analog in rapid flows. Specifically, the diffusivity is suppressed along the direction of the strong force network. A simple random walk simulation reproduces the key features of the data, such as the apparent superdiffusive and subdiffusive behavior arising from the mean velocity field, confirming the underlying diffusive motion. The additional anisotropy is not observed in the simulation since the strong force network is not included. Examples of correlated motion, such as transient vortices, and Lévy flights are also observed. Although correlated motion creates velocity fields which are qualitatively different from collisional Brownian motion and can introduce nondiffusive effects, on average the system appears simply diffusive.

  12. Anisotropic conductivity imaging with MREIT using equipotential projection algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Degirmenci, Evren [Department of Electrical and Electronics Engineering, Mersin University, Mersin (Turkey); Eyueboglu, B Murat [Department of Electrical and Electronics Engineering, Middle East Technical University, 06531, Ankara (Turkey)

    2007-12-21

    Magnetic resonance electrical impedance tomography (MREIT) combines magnetic flux or current density measurements obtained by magnetic resonance imaging (MRI) and surface potential measurements to reconstruct images of true conductivity with high spatial resolution. Most of the biological tissues have anisotropic conductivity; therefore, anisotropy should be taken into account in conductivity image reconstruction. Almost all of the MREIT reconstruction algorithms proposed to date assume isotropic conductivity distribution. In this study, a novel MREIT image reconstruction algorithm is proposed to image anisotropic conductivity. Relative anisotropic conductivity values are reconstructed iteratively, using only current density measurements without any potential measurement. In order to obtain true conductivity values, only either one potential or conductivity measurement is sufficient to determine a scaling factor. The proposed technique is evaluated on simulated data for isotropic and anisotropic conductivity distributions, with and without measurement noise. Simulation results show that the images of both anisotropic and isotropic conductivity distributions can be reconstructed successfully.

  13. Enhanced diffusion of solute metals forming complexes with radiation defects in silica

    International Nuclear Information System (INIS)

    Pivin, J.C.; Garrido, E.; Rizza, G.; Thome, L.

    1998-01-01

    The mixing kinetics of Cu, Ag, W, Pt, and Au single layers embedded in silica when irradiated with heavy ions at temperatures (T) of 110 and 300 K was investigated by means of in situ RBS analyses in alternation with irradiations. The spreading of peaks related to the metallic species is generally anisotropic and obeys either a quadratic or a linear dependence on the ion dose according to the increasing T. The quadratic law is attributed to a control of the diffusion by the coupling of the large impurity atoms M with matrix defects, and a classical regime of radiation enhanced diffusion is observed when this coupling is made easier (higher T or mass of M). Other factors such as internal stresses affect the rates of M dissolution and diffusion. (orig.)

  14. Organization and diffusion in biological and material fabrication problems

    Science.gov (United States)

    Mangan, Niall Mari

    This thesis is composed of two problems. The first is a systems level analysis of the carbon concentrating mechanism in cyanobacteria. The second presents a theoretical analysis of femtosecond laser melting for the purpose of hyperdoping silicon with sulfur. While these systems are very distant, they are both relevant to the development of alternative energy (production of biofuels and methods for fabricating photovoltaics respectively). Both problems are approached through analysis of the underlying diffusion equations. Cyanobacteria are photosynthetic bacteria with a unique carbon concentrating mechanism (CCM) which enhances carbon fixation. A greater understanding of this mechanism would offer new insights into the basic biology and methods for bioengineering more efficient biochemical reactions. The molecular components of the CCM have been well characterized in the last decade, with genetic analysis uncovering both variation and commonalities in CCMs across cyanobacteria strains. Analysis of CCMs on a systems level, however, is based on models formulated prior to the molecular characterization. We present an updated model of the cyanobacteria CCM, and analytic solutions in terms of the various molecular components. The solutions allow us to find the parameter regime (expression levels, catalytic rates, permeability of carboxysome shell) where carbon fixation is maximized and oxygenation is minimized. Saturation of RuBisCO, maximization of the ratio of CO2 to O2, and staying below or at the saturation level for carbonic anhydrase are all needed for maximum efficacy. These constraints limit the parameter regime where the most effective carbon fixation can occur. There is an optimal non-specific carboxysome shell permeability, where trapping of CO2 is maximized, but HCO3 - is not detrimentally restricted. The shell also shields carbonic anhydrase activity and CO2 → HCO3- conversion at the thylakoid and cell membrane from one another. Co-localization of carbonic

  15. Joint eigenvector estimation from mutually anisotropic tensors improves susceptibility tensor imaging of the brain, kidney, and heart.

    Science.gov (United States)

    Dibb, Russell; Liu, Chunlei

    2017-06-01

    To develop a susceptibility-based MRI technique for probing microstructure and fiber architecture of magnetically anisotropic tissues-such as central nervous system white matter, renal tubules, and myocardial fibers-in three dimensions using susceptibility tensor imaging (STI) tools. STI can probe tissue microstructure, but is limited by reconstruction artifacts because of absent phase information outside the tissue and noise. STI accuracy may be improved by estimating a joint eigenvector from mutually anisotropic susceptibility and relaxation tensors. Gradient-recalled echo image data were simulated using a numerical phantom and acquired from the ex vivo mouse brain, kidney, and heart. Susceptibility tensor data were reconstructed using STI, regularized STI, and the proposed algorithm of mutually anisotropic and joint eigenvector STI (MAJESTI). Fiber map and tractography results from each technique were compared with diffusion tensor data. MAJESTI reduced the estimated susceptibility tensor orientation error by 30% in the phantom, 36% in brain white matter, 40% in the inner medulla of the kidney, and 45% in myocardium. This improved the continuity and consistency of susceptibility-based fiber tractography in each tissue. MAJESTI estimation of the susceptibility tensors yields lower orientation errors for susceptibility-based fiber mapping and tractography in the intact brain, kidney, and heart. Magn Reson Med 77:2331-2346, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  16. On the solution of a vectorial radiative transfer equation in an arbitrary three-dimensional turbid medium with anisotropic scattering

    International Nuclear Information System (INIS)

    Budak, Vladimir P.; Korkin, Sergey V.

    2008-01-01

    The authors developed a numerical method of the boundary-value problem solution in the vectorial radiative transfer theory applicable to the turbid media with an arbitrary three-dimensional geometry. The method is based on the solution representation as the sum of an anisotropic part that contains all the singularities of the exact solution and a smooth regular part. The regular part of the solution could be found numerically by the finite element method that enables to extend the approach to the arbitrary medium geometry. The anisotropic part of the solution is determined analytically by the special form of the small-angle approximation. The method development is performed by the examples of the boundary-value problems for the plane unidirectional and point isotropic sources in a turbid medium slab

  17. Diffusion and mass transfer

    CERN Document Server

    Vrentas, James S

    2013-01-01

    The book first covers the five elements necessary to formulate and solve mass transfer problems, that is, conservation laws and field equations, boundary conditions, constitutive equations, parameters in constitutive equations, and mathematical methods that can be used to solve the partial differential equations commonly encountered in mass transfer problems. Jump balances, Green’s function solution methods, and the free-volume theory for the prediction of self-diffusion coefficients for polymer–solvent systems are among the topics covered. The authors then use those elements to analyze a wide variety of mass transfer problems, including bubble dissolution, polymer sorption and desorption, dispersion, impurity migration in plastic containers, and utilization of polymers in drug delivery. The text offers detailed solutions, along with some theoretical aspects, for numerous processes including viscoelastic diffusion, moving boundary problems, diffusion and reaction, membrane transport, wave behavior, sedime...

  18. The numerical analysis of eigenvalue problem solutions in the multigroup diffusion theory

    International Nuclear Information System (INIS)

    Woznick, Z.I.

    1994-01-01

    In this paper a general iteration strategy for solving the discrete form of multidimensional neutron diffusion equations is described. Usually the solution method is based on the system of inner and outer iterations. The presented matrix formalism allows us to visualize clearly, how the used matrix splitting influences the structure of the matrix in an eigenvalue problem to be solved as well as the independence between inner and outer iterations within global iterations. To keep the page limit, the present version of the paper consists only with first three of five sections given in the original paper under the same title (which will be published soon). (author). 13 refs

  19. Stability conditions for the Bianchi type II anisotropically inflating universes

    International Nuclear Information System (INIS)

    Kao, W.F.; Lin, Ing-Chen

    2009-01-01

    Stability conditions for a class of anisotropically inflating solutions in the Bianchi type II background space are shown explicitly in this paper. These inflating solutions were known to break the cosmic no-hair theorem such that they do not approach the de Sitter universe at large times. It can be shown that unstable modes of the anisotropic perturbations always exist for this class of expanding solutions. As a result, we show that these set of anisotropically expanding solutions are unstable against anisotropic perturbations in the Bianchi type II space

  20. Spectral analysis of the SN approximations in a slab with quadratically anisotropic scattering

    International Nuclear Information System (INIS)

    Ourique, L.E.; Pazos, R.P.; Vilhena, M.T.; Barros, R.C.

    2003-01-01

    The spectral analysis of the S N approximations to the one-dimensional transport equation began with 3 and 4, following the studies of 1 and 2 about the discrete eigenvalues of the transport equation. In previous work about the influence of a parameter in the solutions of S N approximations, it was considered the total macroscopic cross section as a control parameter and was analyzed how its variation changes the nature of the eigenvalues of the S N transport matrix, in problems with linearly anisotropic scattering. It was showed the existence of bifurcations points, i.e., there exist some values of control parameters for which the S N transport matrix has only real eigenvalues while for other values the S N relation between the eigenvalues of S N transport matrix and control parameter, supposing quadratically anisotropic scattering. Numerical results are reported. (author)

  1. Anisotropic hydrodynamics: Motivation and methodology

    Energy Technology Data Exchange (ETDEWEB)

    Strickland, Michael

    2014-06-15

    In this proceedings contribution I review recent progress in our understanding of the bulk dynamics of relativistic systems that possess potentially large local rest frame momentum-space anisotropies. In order to deal with these momentum-space anisotropies, a reorganization of relativistic viscous hydrodynamics can be made around an anisotropic background, and the resulting dynamical framework has been dubbed “anisotropic hydrodynamics”. I also discuss expectations for the degree of momentum-space anisotropy of the quark–gluon plasma generated in relativistic heavy ion collisions at RHIC and LHC from second-order viscous hydrodynamics, strong-coupling approaches, and weak-coupling approaches.

  2. TWOTRAN-2, 2-D Multigroup Transport in X-Y, R-Z, R-Theta Geometry with Anisotropic Scattering

    International Nuclear Information System (INIS)

    Lathrop, K.D.; Brinkley, F.W.

    1995-01-01

    1 - Description of problem or function: TWOTRAN2 solves the two-dimensional multigroup transport equation in (x,y), (r,theta), and (r,z) geometries. Both regular and adjoint, inhomogeneous and homogeneous (k eff and eigenvalue searches) problems subject to vacuum, reflective, periodic, white or input-specified boundary flux conditions are solved. General anisotropic scattering is allowed and anisotropic inhomogeneous sources are permitted. 2 - Method of solution: The discrete ordinates approximation for the angular variable is used in finite difference form which is solved with the central (diamond) difference approximation. Negative fluxes are eliminated by a local set-to zero and correct algorithm. Standard inner (within-group) and outer iterative cycles are accelerated by a coarse-mesh re-balancing on a coarse mesh which may be independent of the material mesh. 3 - Restrictions on the complexity of the problem: Variable dimensioning is used so that any combination of problem parameters leading to a container array less than MAXLEN can be accommodated. On IBM machines, TWOTRAN2 will execute in the 4-byte mode so that any combination of problem parameters leading to a container array less than MAXLEN can be accommodated. MAXLEN can be several hundred thousand and most problems can be core-contained. On the CDC machines MAXLEN can be slightly greater than 40,000 words and peripheral storage is used for most group-dependent data

  3. Effect of self-interstitial diffusion anisotropy in electron-irradiated zirconium: A cluster dynamics modeling

    International Nuclear Information System (INIS)

    Christien, F.; Barbu, A.

    2005-01-01

    A model based on the cluster dynamics approach was proposed in [A. Hardouin Duparc, C. Moingeon, N. Smetniansky-de-Grande, A. Barbu, J. Nucl. Mater. 302 (2002) 143] to describe point defect agglomeration in metals under irradiation. This model is restricted to materials where point defect diffusion is isotropic and is thus not applicable to anisotropic metals such as zirconium. Following the approach proposed by Woo [C.H. Woo, J. Nucl. Mater. 159 (1988) 237], we extended in this work the model to the case where self-interstitial atoms (SIA) diffusion is anisotropic. The model was then applied to the loop microstructure evolution of a zirconium thin foil irradiated with electrons in a high-voltage microscope. First, the inputs were validated by comparing the numerical results with Hellio et al. experimental results [C. Hellio, C.H. de Novion, L. Boulanger, J. Nucl. Mater. 159 (1988) 368]. Further calculations were made to evidence the effect of the thin foil orientation on the dislocation loop microstructure under irradiation. The result is that it is possible to reproduce for certain orientations the 'unexpected' vacancy loop growth experimentally observed in electron-irradiated zirconium [M. Griffiths, M.H. Loretto, R.E. Sallmann, J. Nucl. Mater. 115 (1983) 313; J. Nucl. Mater. 115 (1983) 323; Philos. Mag. A 49 (1984) 613]. This effect is directly linked to SIA diffusion anisotropy

  4. Hydrodynamic cavitation in Stokes flow of anisotropic fluids

    Science.gov (United States)

    Stieger, Tillmann; Agha, Hakam; Schoen, Martin; Mazza, Marco G.; Sengupta, Anupam

    2017-05-01

    Cavitation, the nucleation of vapour in liquids, is ubiquitous in fluid dynamics, and is often implicated in a myriad of industrial and biomedical applications. Although extensively studied in isotropic liquids, corresponding investigations in anisotropic liquids are largely lacking. Here, by combining liquid crystal microfluidic experiments, nonequilibrium molecular dynamics simulations and theoretical arguments, we report flow-induced cavitation in an anisotropic fluid. The cavitation domain nucleates due to sudden pressure drop upon flow past a cylindrical obstacle within a microchannel. For an anisotropic fluid, the inception and growth of the cavitation domain ensued in the Stokes regime, while no cavitation was observed in isotropic liquids flowing under similar hydrodynamic parameters. Using simulations we identify a critical value of the Reynolds number for cavitation inception that scales inversely with the order parameter of the fluid. Strikingly, the critical Reynolds number for anisotropic fluids can be 50% lower than that of isotropic fluids.

  5. Solution of unidimensional problems from monoenergetics neutrons diffusion through finite differences

    International Nuclear Information System (INIS)

    Filio Lopez, Carlos.

    1979-01-01

    A calculation program (URA 6.F4) was elaborated on FORTRAN IV language, that through finite differences solves the unidimensional scalar Helmholtz equation, assuming only one energy group, in spherical cylindrical or plane geometry. The purpose is the determination of the flow distribution in a reactor of spherical cylindrical or plane geometry and the critical dimensions. Feeding as entrance datas to the program the geometry, diffusion coefficients and macroscopic transversals cross sections of absorption and fission for each region. The differential diffusion equation is converted with its boundary conditions, to one system of homogeneous algebraic linear equations using the box integration technique. The investigation on criticality is converted then in a succession of eigenvalue problems for the critical eigenvalue. In general, only is necessary to solve the first eigenvalue and its corresponding eigenvector, employing the power method. The obtained results by the program for the critical dimensions of the clean reactors are admissible, the existing error as respect to the analytic is less of 0.5%; by the analysed reactors of three regions, the relative error with respect to the semianalytic result is less of 0.2%. With this program is possible to obtain one quantitative description of one reactor if the transversal sections that appears in the monoenergetic model are adequatedly averaged by the energy group used. (author)

  6. Mixed-hybrid finite element method for the transport equation and diffusion approximation of transport problems; Resolution de l'equation du transport par une methode d'elements finis mixtes-hybrides et approximation par la diffusion de problemes de transport

    Energy Technology Data Exchange (ETDEWEB)

    Cartier, J

    2006-04-15

    This thesis focuses on mathematical analysis, numerical resolution and modelling of the transport equations. First of all, we deal with numerical approximation of the solution of the transport equations by using a mixed-hybrid scheme. We derive and study a mixed formulation of the transport equation, then we analyse the related variational problem and present the discretization and the main properties of the scheme. We particularly pay attention to the behavior of the scheme and we show its efficiency in the diffusion limit (when the mean free path is small in comparison with the characteristic length of the physical domain). We present academical benchmarks in order to compare our scheme with other methods in many physical configurations and validate our method on analytical test cases. Unstructured and very distorted meshes are used to validate our scheme. The second part of this thesis deals with two transport problems. The first one is devoted to the study of diffusion due to boundary conditions in a transport problem between two plane plates. The second one consists in modelling and simulating radiative transfer phenomenon in case of the industrial context of inertial confinement fusion. (author)

  7. Krylov Iterative Methods and the Degraded Effectiveness of Diffusion Synthetic Acceleration for Multidimensional SN Calculations in Problems with Material Discontinuities

    International Nuclear Information System (INIS)

    Warsa, James S.; Wareing, Todd A.; Morel, Jim E.

    2004-01-01

    A loss in the effectiveness of diffusion synthetic acceleration (DSA) schemes has been observed with certain S N discretizations on two-dimensional Cartesian grids in the presence of material discontinuities. We will present more evidence supporting the conjecture that DSA effectiveness will degrade for multidimensional problems with discontinuous total cross sections, regardless of the particular physical configuration or spatial discretization. Fourier analysis and numerical experiments help us identify a set of representative problems for which established DSA schemes are ineffective, focusing on diffusive problems for which DSA is most needed. We consider a lumped, linear discontinuous spatial discretization of the S N transport equation on three-dimensional, unstructured tetrahedral meshes and look at a fully consistent and a 'partially consistent' DSA method for this discretization. The effectiveness of both methods is shown to degrade significantly. A Fourier analysis of the fully consistent DSA scheme in the limit of decreasing cell optical thickness supports the view that the DSA itself is failing when material discontinuities are present in a problem. We show that a Krylov iterative method, preconditioned with DSA, is an effective remedy that can be used to efficiently compute solutions for this class of problems. We show that as a preconditioner to the Krylov method, a partially consistent DSA method is more than adequate. In fact, it is preferable to a fully consistent method because the partially consistent method is based on a continuous finite element discretization of the diffusion equation that can be solved relatively easily. The Krylov method can be implemented in terms of the original S N source iteration coding with only slight modification. Results from numerical experiments show that replacing source iteration with a preconditioned Krylov method can efficiently solve problems that are virtually intractable with accelerated source iteration

  8. A Morphing framework to couple non-local and local anisotropic continua

    KAUST Repository

    Azdoud, Yan

    2013-05-01

    In this article, we develop a method to couple anisotropic local continua with anisotropic non-local continua with central long-range forces. First, we describe anisotropic non-local models based on spherical harmonic descriptions. We then derive compatible classic continuum models. Finally, we apply the morphing method to these anisotropic non-local models and present three-dimensional numerical examples to validate the efficiency of the technique. © 2013 Elsevier Ltd. All rights reserved.

  9. Elastic properties of spherically anisotropic piezoelectric composites

    International Nuclear Information System (INIS)

    En-Bo, Wei; Guo-Qing, Gu; Ying-Ming, Poon

    2010-01-01

    Effective elastic properties of spherically anisotropic piezoelectric composites, whose spherically anisotropic piezoelectric inclusions are embedded in an infinite non-piezoelectric matrix, are theoretically investigated. Analytical solutions for the elastic displacements and the electric potentials under a uniform external strain are derived exactly. Taking into account of the coupling effects of elasticity, permittivity and piezoelectricity, the formula is derived for estimating the effective elastic properties based on the average field theory in the dilute limit. An elastic response mechanism is revealed, in which the effective elastic properties increase as inclusion piezoelectric properties increase and inclusion dielectric properties decrease. Moreover, a piezoelectric response mechanism, of which the effective piezoelectric response vanishes due to the symmetry of spherically anisotropic composite, is also disclosed. (condensed matter: structure, thermal and mechanical properties)

  10. Study of reactor analysis codes available at IPEN and their application to problems involving the diffusion theory

    International Nuclear Information System (INIS)

    Mendonca, A.G.

    1980-01-01

    Two computer codes that are available at IPEN for analyses of static neutron diffusion problems are studied and applied. The CITATION code is animed at analyses of criticality, fuel burnup, flux and power distributions etc, in one, two, and three spatial dimensions in multigroup. The EXTERMINATOR code can be used for the same purposes as for CITATION with a limitation to one or two spatial dimensions. Basic theories and numerical techniques used in the codes are studied and summarized. Benchmark problems have been solved using the codes. Comparisons of the results show that both codes can be used with confidence in the analyses of nuclear reactor problems. (author) [pt

  11. Acoustic frequency filter based on anisotropic topological phononic crystals

    KAUST Repository

    Chen, Zeguo

    2017-11-02

    We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

  12. Acoustic frequency filter based on anisotropic topological phononic crystals

    KAUST Repository

    Chen, Zeguo; Zhao, Jiajun; Mei, Jun; Wu, Ying

    2017-01-01

    We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

  13. Density functional theory study of the mechanism of Li diffusion in rutile RuO2

    International Nuclear Information System (INIS)

    Jung, Jongboo; Cho, Maenghyo; Zhou, Min

    2014-01-01

    First-principle calculations are carried out to study the diffusion of Li ions in rutile structure RuO 2 , a material for positive electrodes in rechargeable Li ion batteries. The calculations focus on migration pathways and energy barriers for diffusion in Li-poor and Li-rich phases using the Nudged Elastic Band Method. Diffusion coefficients estimated based on calculated energy barriers are in good agreement with experimental values reported in the literature. The results confirm the anisotropic nature of diffusion of Li ions in one-dimensional c channels along the [001] crystalline direction of rutile RuO 2 and show that Li diffusion in the Li-poor phase is faster than in the Li-rich phase. The findings of fast Li diffusion and feasible Li insertion at low temperatures in the host rutile RuO 2 suggest this material is a good ionic conductor for Li transport. The finding also suggests possible means for enhancing the performance of RuO 2 -based electrode materials

  14. Effective-field treatment of an anisotropic Ising ferromagnet: thermodynamical properties

    International Nuclear Information System (INIS)

    Sarmento, E.F.; Honmura, R.; Tsallis, C.

    1982-01-01

    The anisotropic square lattice spin -1/2 Ising ferromagnet is discussed. Through this system it is illustrated how all relevant thermodynamical quantities (phase diagram, magnetization, short range order parameter, specific heat and susceptibility) can be approximatively calculated within an effective-field unified procedure (which substantially improves the Mean Field Approximation). Two slightly different approximations for the susceptibility (whose exact computation is still lacking) are presented. The (square lattice) - (linear chain) crossover is exhibited. The present (mathematically simple) procedures could be useful in the study of complex Ising problems. (Author) [pt

  15. Anisotropic nanomaterials preparation, properties, and applications

    CERN Document Server

    Li, Quan

    2015-01-01

    In this book anisotropic one-dimensional and two-dimensional nanoscale building blocks and their assembly into fascinating and qualitatively new functional structures embracing both hard and soft components are explained. Contributions from leading experts regarding important aspects like synthesis, assembly, properties and applications of the above materials are compiled into a reference book. The anisotropy, i.e. the direction-dependent physical properties, of materials is fascinating and elegant and has sparked the quest for anisotropic materials with useful properties. With such a curiosi

  16. Plane-wave diffraction by periodic structures with artificial anisotropic dielectrics

    International Nuclear Information System (INIS)

    Kazerooni, Azadeh Semsar; Shahabadi, Mahmoud

    2010-01-01

    Periodic structures with artificial anisotropic dielectrics are studied. The artificial anisotropic dielectric material in this work is made of two alternating isotropic dielectric layers. By a proper choice of the dielectric constant of the layers, we can realize a uniaxial anisotropic medium with controllable anisotropy. The artificial anisotropic dielectric is then used in periodic structures. For these structures, the optical axis of the artificial dielectric is assumed to be parallel or perpendicular to the period of the structure. Diffraction of plane waves by these structures is analyzed by a fully vectorial rigorous matrix method based on a generalized transmission line (TL) formulation. The propagation constants and field distributions are computed and diffraction properties of such structures are studied to show that, by a proper choice of structural parameters, these periodic structures with artificial anisotropic dielectrics can be used as polarizers or polarizing mirrors

  17. Determination of the Pt spin diffusion length by spin-pumping and spin Hall effect

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wei; Pearson, John E.; Hoffmann, Axel [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Vlaminck, Vincent [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Colegio de Ciencias e Ingenería, Universidad San Fransciso de Quito, Quito (Ecuador); Divan, Ralu [Center for Nanoscale Materials, Argonne National Laboratory, Illinois 60439 (United States); Bader, Samuel D. [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Center for Nanoscale Materials, Argonne National Laboratory, Illinois 60439 (United States)

    2013-12-09

    The spin diffusion length of Pt at room temperature and at 8 K is experimentally determined via spin pumping and spin Hall effect in permalloy/Pt bilayers. Voltages generated during excitation of ferromagnetic resonance from the inverse spin Hall effect and anisotropic magnetoresistance effect were investigated with a broadband approach. Varying the Pt layer thickness gives rise to an evolution of the voltage line shape due to the superposition of the above two effects. By studying the ratio of the two voltage components with the Pt layer thickness, the spin diffusion length of Pt can be directly extracted. We obtain a spin diffusion length of ∼1.2 nm at room temperature and ∼1.6 nm at 8 K.

  18. A HIGH ORDER SOLUTION OF THREE DIMENSIONAL TIME DEPENDENT NONLINEAR CONVECTIVE-DIFFUSIVE PROBLEM USING MODIFIED VARIATIONAL ITERATION METHOD

    Directory of Open Access Journals (Sweden)

    Pratibha Joshi

    2014-12-01

    Full Text Available In this paper, we have achieved high order solution of a three dimensional nonlinear diffusive-convective problem using modified variational iteration method. The efficiency of this approach has been shown by solving two examples. All computational work has been performed in MATHEMATICA.

  19. Degenerate nonlinear diffusion equations

    CERN Document Server

    Favini, Angelo

    2012-01-01

    The aim of these notes is to include in a uniform presentation style several topics related to the theory of degenerate nonlinear diffusion equations, treated in the mathematical framework of evolution equations with multivalued m-accretive operators in Hilbert spaces. The problems concern nonlinear parabolic equations involving two cases of degeneracy. More precisely, one case is due to the vanishing of the time derivative coefficient and the other is provided by the vanishing of the diffusion coefficient on subsets of positive measure of the domain. From the mathematical point of view the results presented in these notes can be considered as general results in the theory of degenerate nonlinear diffusion equations. However, this work does not seek to present an exhaustive study of degenerate diffusion equations, but rather to emphasize some rigorous and efficient techniques for approaching various problems involving degenerate nonlinear diffusion equations, such as well-posedness, periodic solutions, asympt...

  20. Anisotropic Intervalley Plasmon Excitations in Graphene

    International Nuclear Information System (INIS)

    Chen Jian; Xu Huai-Zhe

    2015-01-01

    We investigate theoretically the intervalley plasmon excitations (IPEs) in graphene monolayer within the random-phase approximation. We derive an analytical expression of the real part of the dielectric function. We find a low-energy plasmon mode with a linear anisotropic dispersion which depends on the Fermi energy and the dielectric constant of substrate. The IPEs show strongly anisotropic behavior, which becomes significant around the zigzag crystallographic direction. More interestingly, the group velocity of IPE varies from negative to positive, and vanishes at special energy. (paper)

  1. Modelling of CMUTs with Anisotropic Plates

    DEFF Research Database (Denmark)

    la Cour, Mette Funding; Christiansen, Thomas Lehrmann; Jensen, Jørgen Arendt

    2012-01-01

    Traditionally, CMUTs are modelled using the isotropic plate equation and this leads to deviations between analytical calculations and FEM simulations. In this paper, the deflection profile and material parameters are calculated using the anisotropic plate equation. It is shown that the anisotropic...... calculations match perfectly with FEM while an isotropic approach causes up to 10% deviations in deflection profile. Furthermore, we show how commonly used analytic modelling methods such as static calculations of the pull-in voltage and dynamic modelling through an equivalent circuit representation can...

  2. Spin diffusion from an inhomogeneous quench in an integrable system.

    Science.gov (United States)

    Ljubotina, Marko; Žnidarič, Marko; Prosen, Tomaž

    2017-07-13

    Generalized hydrodynamics predicts universal ballistic transport in integrable lattice systems when prepared in generic inhomogeneous initial states. However, the ballistic contribution to transport can vanish in systems with additional discrete symmetries. Here we perform large scale numerical simulations of spin dynamics in the anisotropic Heisenberg XXZ spin 1/2 chain starting from an inhomogeneous mixed initial state which is symmetric with respect to a combination of spin reversal and spatial reflection. In the isotropic and easy-axis regimes we find non-ballistic spin transport which we analyse in detail in terms of scaling exponents of the transported magnetization and scaling profiles of the spin density. While in the easy-axis regime we find accurate evidence of normal diffusion, the spin transport in the isotropic case is clearly super-diffusive, with the scaling exponent very close to 2/3, but with universal scaling dynamics which obeys the diffusion equation in nonlinearly scaled time.

  3. On Pokrovskii's anisotropic gap equations in superconductivity theory

    Science.gov (United States)

    Yang, Yisong

    2003-11-01

    An existence and uniqueness theorem for Pokrovskii's zero-temperature anisotropic gap equation is proved. Furthermore, it is shown that Pokrovskii's finite-temperature equation is inconsistent with the Bardeen-Cooper-Schrieffer (BCS) theory. A reformulation of the anisotropic gap equation is presented along the line of Pokrovskii and it is shown that the new equation is consistent with the BCS theory for the whole temperature range. As an application, the Markowitz-Kadanoff model for anisotropic superconductivity is considered and a rigorous proof of the half-integer-exponent isotope effect is obtained. Furthermore, a sharp estimate of the gap solution near the transition temperature is established.

  4. Recursive recovery of Markov transition probabilities from boundary value data

    Energy Technology Data Exchange (ETDEWEB)

    Patch, Sarah Kathyrn [Univ. of California, Berkeley, CA (United States)

    1994-04-01

    In an effort to mathematically describe the anisotropic diffusion of infrared radiation in biological tissue Gruenbaum posed an anisotropic diffusion boundary value problem in 1989. In order to accommodate anisotropy, he discretized the temporal as well as the spatial domain. The probabilistic interpretation of the diffusion equation is retained; radiation is assumed to travel according to a random walk (of sorts). In this random walk the probabilities with which photons change direction depend upon their previous as well as present location. The forward problem gives boundary value data as a function of the Markov transition probabilities. The inverse problem requires finding the transition probabilities from boundary value data. Problems in the plane are studied carefully in this thesis. Consistency conditions amongst the data are derived. These conditions have two effects: they prohibit inversion of the forward map but permit smoothing of noisy data. Next, a recursive algorithm which yields a family of solutions to the inverse problem is detailed. This algorithm takes advantage of all independent data and generates a system of highly nonlinear algebraic equations. Pluecker-Grassmann relations are instrumental in simplifying the equations. The algorithm is used to solve the 4 x 4 problem. Finally, the smallest nontrivial problem in three dimensions, the 2 x 2 x 2 problem, is solved.

  5. Inverse problem in anisotropic poroelasticity: drained constants from undrained ultrasound measurements.

    Science.gov (United States)

    Berryman, James G; Nakagawa, Seiji

    2010-02-01

    Poroelastic analysis has traditionally focused on the relationship between dry and drained constants, which are assumed known, and the saturated or undrained constants, which are assumed unknown. However, there are many applications in this field of study for which the main measurements can only be made on the saturated/undrained system, and then it is uncertain what the effects of the fluids were on the system, since the drained constants remain a mystery. The work presented here shows how to deduce drained constants from undrained constants for anisotropic systems having symmetries ranging from isotropic to orthotropic. Laboratory ultrasound data are then inverted for the drained constants in three granular packings: one of glass beads, and two others for distinct types of more or less angular sand grain packings. Experiments were performed under uniaxial stress, which resulted in hexagonal (transversely isotropic) symmetry of the poroelastic response. One important conclusion from the general analysis is that the drained constants are uniquely related to the undrained constants, assuming that porosity, grain bulk modulus, and pore fluid bulk modulus are already known. Since the resulting system of equations for all the drained constants is linear, measurement error in undrained constants also propagates linearly into the computed drained constants.

  6. Inverse problem in anisotropic poroelasticity: Drained constants from undrained ultrasound measurements

    Energy Technology Data Exchange (ETDEWEB)

    Berryman, J.G.; Nakagawa, S.

    2009-11-20

    Poroelastic analysis has traditionally focused on the relationship between dry or drained constants which are assumed known and the saturated or undrained constants which are assumed unknown. However, there are many applications in this field of study for which the main measurements can only be made on the saturated/undrained system, and then it is uncertain what the eects of the uids were on the system, since the drained constants remain a mystery. The work presented here shows how to deduce drained constants from undrained constants for anisotropic systems having symmetries ranging from isotropic to orthotropic. Laboratory ultrasound data are then inverted for the drained constants in three granular packings: one of glass beads, and two others for distinct types of more or less angular sand grain packings. Experiments were performed under uniaxial stress, which resulted in hexagonal (transversely isotropic) symmetry of the poroelastic response. One important conclusion from the general analysis is that the drained constants are uniquely related to the undrained constants, assuming that porosity, grain bulk modulus, and pore uid bulk modulus are already known. Since the resulting system of equations for all the drained constants is linear, measurement error in undrained constants also propagates linearly into the computed drained constants.

  7. Anisotropy of self-diffusion and α-zirconium radiation growth problems

    International Nuclear Information System (INIS)

    Smirnov, E.A.; Subbotin, A.V.

    1996-01-01

    Temperature dependence of α-zirconium seft-diffusion anisotropy coefficients is obtained within the framework of linear extrapolation of self-diffusion anisotropy characteristics for metal HCP with c/a ration of [ru

  8. Data-driven imaging in anisotropic media

    Energy Technology Data Exchange (ETDEWEB)

    Volker, Arno; Hunter, Alan [TNO Stieltjes weg 1, 2600 AD, Delft (Netherlands)

    2012-05-17

    Anisotropic materials are being used increasingly in high performance industrial applications, particularly in the aeronautical and nuclear industries. Some important examples of these materials are composites, single-crystal and heavy-grained metals. Ultrasonic array imaging in these materials requires exact knowledge of the anisotropic material properties. Without this information, the images can be adversely affected, causing a reduction in defect detection and characterization performance. The imaging operation can be formulated in two consecutive and reciprocal focusing steps, i.e., focusing the sources and then focusing the receivers. Applying just one of these focusing steps yields an interesting intermediate domain. The resulting common focus point gather (CFP-gather) can be interpreted to determine the propagation operator. After focusing the sources, the observed travel-time in the CFP-gather describes the propagation from the focus point to the receivers. If the correct propagation operator is used, the measured travel-times should be the same as the time-reversed focusing operator due to reciprocity. This makes it possible to iteratively update the focusing operator using the data only and allows the material to be imaged without explicit knowledge of the anisotropic material parameters. Furthermore, the determined propagation operator can also be used to invert for the anisotropic medium parameters. This paper details the proposed technique and demonstrates its use on simulated array data from a specimen of Inconel single-crystal alloy commonly used in the aeronautical and nuclear industries.

  9. Quantum effects and elimination of the conformal anomaly in anisotropic space-time

    International Nuclear Information System (INIS)

    Grib, A.A.; Nesteruk, A.V.

    1988-01-01

    In homogeneous anisotropic space-time the connection between the problem of the elimination of infrared divergences and the conformal anomaly of the regularized energy-momentum tensor is studied. It is shown that removal of the infrared divergence by means of a cutoff leads to the absence of a conformal anomaly. A physical interpretation of the infrared cutoff as a shift in the particle-energy spectrum by an amount equal to the effective temperature of the gravitational field is proposed

  10. EIT forward problem parallel simulation environment with anisotropic tissue and realistic electrode models.

    Science.gov (United States)

    De Marco, Tommaso; Ries, Florian; Guermandi, Marco; Guerrieri, Roberto

    2012-05-01

    Electrical impedance tomography (EIT) is an imaging technology based on impedance measurements. To retrieve meaningful insights from these measurements, EIT relies on detailed knowledge of the underlying electrical properties of the body. This is obtained from numerical models of current flows therein. The nonhomogeneous and anisotropic electric properties of human tissues make accurate modeling and simulation very challenging, leading to a tradeoff between physical accuracy and technical feasibility, which at present severely limits the capabilities of EIT. This work presents a complete algorithmic flow for an accurate EIT modeling environment featuring high anatomical fidelity with a spatial resolution equal to that provided by an MRI and a novel realistic complete electrode model implementation. At the same time, we demonstrate that current graphics processing unit (GPU)-based platforms provide enough computational power that a domain discretized with five million voxels can be numerically modeled in about 30 s.

  11. A numerical scheme for singularly perturbed reaction-diffusion problems with a negative shift via numerov method

    Science.gov (United States)

    Dinesh Kumar, S.; Nageshwar Rao, R.; Pramod Chakravarthy, P.

    2017-11-01

    In this paper, we consider a boundary value problem for a singularly perturbed delay differential equation of reaction-diffusion type. We construct an exponentially fitted numerical method using Numerov finite difference scheme, which resolves not only the boundary layers but also the interior layers arising from the delay term. An extensive amount of computational work has been carried out to demonstrate the applicability of the proposed method.

  12. Subsurface Flow Modeling in Single and Dual Continuum Anisotropic Porous Media using the Multipoint Flux Approximation Method

    KAUST Repository

    Negara, Ardiansyah

    2015-05-01

    Anisotropy of hydraulic properties of the subsurface geologic formations is an essential feature that has been established as a consequence of the different geologic processes that undergo during the longer geologic time scale. With respect to subsurface reservoirs, in many cases, anisotropy plays significant role in dictating the direction of flow that becomes no longer dependent only on driving forces like the pressure gradient and gravity but also on the principal directions of anisotropy. Therefore, there has been a great deal of motivation to consider anisotropy into the subsurface flow and transport models. In this dissertation, we present subsurface flow modeling in single and dual continuum anisotropic porous media, which include the single-phase groundwater flow coupled with the solute transport in anisotropic porous media, the two-phase flow with gravity effect in anisotropic porous media, and the natural gas flow in anisotropic shale reservoirs. We have employed the multipoint flux approximation (MPFA) method to handle anisotropy in the flow model. The MPFA method is designed to provide correct discretization of the flow equations for general orientation of the principal directions of the permeability tensor. The implementation of MPFA method is combined with the experimenting pressure field approach, a newly developed technique that enables the solution of the global problem breaks down into the solution of multitude of local problems. The numerical results of the study demonstrate the significant effects of anisotropy of the subsurface formations. For the single-phase groundwater flow coupled with the solute transport modeling in anisotropic porous media, the results shows the strong impact of anisotropy on the pressure field and the migration of the solute concentration. For the two-phase flow modeling with gravity effect in anisotropic porous media, it is observed that the buoyancy-driven flow, which emerges due to the density differences between the

  13. A model for the ultrasonic field radiated by an immersed transducer into an anisotropic and heterogeneous medium

    International Nuclear Information System (INIS)

    Gengembre, N.

    2000-01-01

    A model for the field radiated by an ultrasonic transducer into anisotropic and heterogeneous media is developed in this thesis. This work aims at improving the settings and interpretations of non destructive tests in welded structures. Since the shape of the transducer is assumed arbitrary, its emitting surface is divided into small elementary sources. The overall field at an observation point in the medium is derived by a summation of the elementary contributions of these point sources. An accurate and numerically efficient model is developed using the Geometrical Optics approximation to evaluate these elementary contributions. Two different forms of this approximation are used: The stationary phase method and the pencil method. The first one is based on an exact formulation of the field and is used for fields into anisotropic and homogeneous media. It allows to emphasize specific configurations for which additional developments are required; this need arises for calculation points in the vicinity of caustics (zones of high intensity). This problem is solved for both harmonic and transient fields, for points laying on caustics or in their neighborhood. The pencil method is used for the calculation of fields in heterogeneous media, although it does not permit to overcome the problem of caustics. It is also advantageous for the implementation of the model. A comparison of both above-mentioned methods is drawn, and their equivalence is proved for some cases. The calculation of fields in anisotropic and heterogeneous media is performed using both methods together, and then the problem of caustics is also treated. Calculated fields into welded components are shown and compared with experiments or with a numerical model, in order to validate the developments. (author)

  14. Anisotropic characterization of magnetorheological materials

    Energy Technology Data Exchange (ETDEWEB)

    Dohmen, E., E-mail: eike.dohmen@tu-dresden.de; Modler, N.; Gude, M.

    2017-06-01

    For the development of energy efficient lightweight parts novel function integrating materials are needed. Concerning this field of application magnetorheological (MR) fluids, MR elastomers and MR composites are promising materials allowing the adjustment of mechanical properties by an external magnetic field. A key issue for operating such structures in praxis is the magneto-mechanical description. Most rheological properties are gathered at laboratory conditions for high magnetic flux densities and a single field direction, which does not correspond to real praxis conditions. Although anisotropic formation of superstructures can be observed in MR suspensions (Fig. 1) or experimenters intentionally polymerize MR elastomers with anisotropic superstructures these MR materials are usually described in an external magnetic field as uniform, isotropic materials. This is due to missing possibilities for experimentally measuring field angle dependent properties and ways of distinguishing between material properties and frictional effects. Just a few scientific works experimentally investigated the influence of different field angles (Ambacher et al., 1992; Grants et al., 1990; Kuzhir et al., 2003) or the influence of surface roughness on the shear behaviour of magnetic fluids (Tang and Conrad, 1996) . The aim of this work is the introduction of a novel field angle cell allowing the determination of anisotropic mechanical properties for various MR materials depending on the applied magnetic field angle. - Highlights: • Novel magnetic field angle testing device (MFATD) presented. • Determination of magnetic field dependent anisotropic mechanical properties. • Experimental data for different field directions shown for a commercial MR fluid. • Material description of MR fluids as transversal-isotropic solids. • Magnetic field angle dependent variations in shear stresses experimentally measured. • Determination of frictional coefficients between the MR fluid and

  15. A unified theoretical and experimental study of anisotropic hardening

    International Nuclear Information System (INIS)

    Boehler, J.P.; Raclin, J.

    1981-01-01

    The purpose of this work is to develop a consistent formulation of the constitutive relations regarding anisotropic hardening materials. Attention is focused on the appearance and the evolution of mechanical anisotropies during irreversible processes, such as plastic forming and inelastic deformation of structures. The representation theorems for anisotropic tensor functions constitute a theoretical basis, allowing to reduce arbitrariness and to obtain a unified formulation of anisotropic hardening. In this approach, a general three-dimensional constitutive law is developed for prestrained initially orthotropic materials. Introduction of the plastic behavior results in the general forms of both the flow-law and the yield criterion. The developed theory is then specialized for the case of plane stress and different modes of anisotropic hardening are analyzed. A new generalization of the Von Mises criterion is proposed, in considering a homogeneous form of order two in stress and employing the simplest combinations of the basic invariants entering the general form of the yield condition. The proposed criterion involves specific terms accounting for the initial anisotropy, the deformation induced anisotropy and correlative terms between initial and induced anisotropy. The effects of prestrainings result in both isotropic and anisotropic hardening. An adequate experimental program, consisting of uniaxial tensile tests on oriented specimens of prestrained sheet-metal, was performed, in order to determine the specific form and the evolution of the anisotropic failure criterion for soft-steel subjected to different irreversible prestrainings. (orig.)

  16. VENTURE: a code block for solving multigroup neutronics problems applying the finite-difference diffusion-theory approximation to neutron transport

    International Nuclear Information System (INIS)

    Vondy, D.R.; Fowler, T.B.; Cunningham, G.W.

    1975-10-01

    The computer code block VENTURE, designed to solve multigroup neutronics problems with application of the finite-difference diffusion-theory approximation to neutron transport (or alternatively simple P 1 ) in up to three-dimensional geometry is described. A variety of types of problems may be solved: the usual eigenvalue problem, a direct criticality search on the buckling, on a reciprocal velocity absorber (prompt mode), or on nuclide concentrations, or an indirect criticality search on nuclide concentrations, or on dimensions. First-order perturbation analysis capability is available at the macroscopic cross section level

  17. High-energy phosphate transfer in human muscle: diffusion of phosphocreatine.

    Science.gov (United States)

    Gabr, Refaat E; El-Sharkawy, Abdel-Monem M; Schär, Michael; Weiss, Robert G; Bottomley, Paul A

    2011-07-01

    The creatine kinase (CK) reaction is central to muscle energetics, buffering ATP levels during periods of intense activity via consumption of phosphocreatine (PCr). PCr is believed to serve as a spatial shuttle of high-energy phosphate between sites of energy production in the mitochondria and sites of energy utilization in the myofibrils via diffusion. Knowledge of the diffusion coefficient of PCr (D(PCr)) is thus critical for modeling and understanding energy transport in the myocyte, but D(PCr) has not been measured in humans. Using localized phosphorus magnetic resonance spectroscopy, we measured D(PCr) in the calf muscle of 11 adults as a function of direction and diffusion time. The results show that the diffusion of PCr is anisotropic, with significantly higher diffusion along the muscle fibers, and that the diffusion of PCr is restricted to a ∼28-μm pathlength assuming a cylindrical model, with an unbounded diffusion coefficient of ∼0.69 × 10(-3) mm(2)/s. This distance is comparable in size to the myofiber radius. On the basis of prior measures of CK reaction kinetics in human muscle, the expected diffusion distance of PCr during its half-life in the CK reaction is ∼66 μm. This distance is much greater than the average distances between mitochondria and myofibrils. Thus these first measurements of PCr diffusion in human muscle in vivo support the view that PCr diffusion is not a factor limiting high-energy phosphate transport between the mitochondria and the myofibrils in healthy resting myocytes.

  18. Visualization of transverse diffusion paths across fiber cells of the ocular lens by small animal MRI

    International Nuclear Information System (INIS)

    Vaghefi, Ehsan; Hunter, Peter J; Jacobs, Marc D; Pontre, Beau; Donaldson, Paul J

    2009-01-01

    The sense of vision requires that light penetrate through the ocular lens. Experiments, performed and published by many research groups, have suggested that the lens, which has no blood vessels, relies on internally directed ion and water fluxes for its circulation, survival and transparency. We investigated the internal diffusive pathways of the lens in order to better understand the constraints that may be operating on directional lens fluxes. Small animal magnetic resonance imaging, including T2-weighted and diffusion tensor imaging, was used to measure tissue properties and diffusivity throughout cultured bovine lenses. A range of concentric regions of signal intensity was distinguished inside the lens, by both T2-weighted signal and mean diffusivity. Diffusivity mapping of the lens revealed novel anisotropic polar and equatorial zones of pronounced diffusivity directed transverse to the fiber cells. In contrast, an inner zone including the lens nucleus showed isotropic and weak diffusivity. Our results lend support to models of internally directed lens micro-circulation, by placing non-structural diffusive constraints on global patterns of fluid circulation

  19. Anisotropic magnetoresistance and piezoelectric effect in GaAs Hall samples

    Science.gov (United States)

    Ciftja, Orion

    2017-02-01

    Application of a strong magnetic field perpendicular to a two-dimensional electron system leads to a variety of quantum phases ranging from incompressible quantum Hall liquid to Wigner solid, charge density wave, and exotic non-Abelian states. A few quantum phases seen in past experiments on GaAs Hall samples of electrons show pronounced anisotropic magnetoresistance values at certain weak magnetic fields. We argue that this might be due to the piezoelectric effect that is inherent in a semiconductor host such as GaAs. Such an effect has the potential to create a sufficient in-plane internal strain that will be felt by electrons and will determine the direction of high and low resistance. When Wigner solid, charge density wave, and isotropic liquid phases are very close in energy, the overall stability of the system is very sensitive to local order and, thus, can be strongly influenced even by a weak perturbation such as the piezoelectric-induced effective electron-electron interaction, which is anisotropic. In this work, we argue that an anisotropic interaction potential may stabilize anisotropic liquid phases of electrons even in a strong magnetic field regime where normally one expects to see only isotropic quantum Hall or isotropic Fermi liquid states. We use this approach to support a theoretical framework that envisions the possibility of an anisotropic liquid crystalline state of electrons in the lowest Landau level. In particular, we argue that an anisotropic liquid state of electrons may stabilize in the lowest Landau level close to the liquid-solid transition region at filling factor ν =1 /6 for a given anisotropic Coulomb interaction potential. Quantum Monte Carlo simulations for a liquid crystalline state with broken rotational symmetry indicate stability of liquid crystalline order consistent with the existence of an anisotropic liquid state of electrons stabilized by anisotropy at filling factor ν =1 /6 of the lowest Landau level.

  20. Development of laser ablation plasma by anisotropic self-radiation

    Directory of Open Access Journals (Sweden)

    Ohnishi Naofumi

    2013-11-01

    Full Text Available We have proposed a method for reproducing an accurate solution of low-density ablation plasma by properly treating anisotropic radiation. Monte-Carlo method is employed for estimating Eddington tensor with limited number of photon samples in each fluid time step. Radiation field from ablation plasma is significantly affected by the anisotropic Eddington tensor. Electron temperature around the ablation surface changes with the radiation field and is responsible for the observed emission. An accurate prediction of the light emission from the laser ablation plasma requires a careful estimation of the anisotropic radiation field.

  1. Initial-boundary value problems for multi-term time-fractional diffusion equations with x-dependent coefficients

    OpenAIRE

    Li, Zhiyuan; Huang, Xinchi; Yamamoto, Masahiro

    2018-01-01

    In this paper, we discuss an initial-boundary value problem (IBVP) for the multi-term time-fractional diffusion equation with x-dependent coefficients. By means of the Mittag-Leffler functions and the eigenfunction expansion, we reduce the IBVP to an equivalent integral equation to show the unique existence and the analyticity of the solution for the equation. Especially, in the case where all the coefficients of the time-fractional derivatives are non-negative, by the Laplace and inversion L...

  2. Anisotropic inflation with derivative couplings

    Science.gov (United States)

    Holland, Jonathan; Kanno, Sugumi; Zavala, Ivonne

    2018-05-01

    We study anisotropic power-law inflationary solutions when the inflaton and its derivative couple to a vector field. This type of coupling is motivated by D-brane inflationary models, in which the inflaton, and a vector field living on the D-brane, couple disformally (derivatively). We start by studying a phenomenological model where we show the existence of anisotropic solutions and demonstrate their stability via a dynamical system analysis. Compared to the case without a derivative coupling, the anisotropy is reduced and thus can be made consistent with current limits, while the value of the slow-roll parameter remains almost unchanged. We also discuss solutions for more general cases, including D-brane-like couplings.

  3. Anisotropic charged generalized polytropic models

    Science.gov (United States)

    Nasim, A.; Azam, M.

    2018-06-01

    In this paper, we found some new anisotropic charged models admitting generalized polytropic equation of state with spherically symmetry. An analytic solution of the Einstein-Maxwell field equations is obtained through the transformation introduced by Durgapal and Banerji (Phys. Rev. D 27:328, 1983). The physical viability of solutions corresponding to polytropic index η =1/2, 2/3, 1, 2 is analyzed graphically. For this, we plot physical quantities such as radial and tangential pressure, anisotropy, speed of sound which demonstrated that these models achieve all the considerable physical conditions required for a relativistic star. Further, it is mentioned here that previous results for anisotropic charged matter with linear, quadratic and polytropic equation of state can be retrieved.

  4. A novel 2.5D finite difference scheme for simulations of resistivity logging in anisotropic media

    Science.gov (United States)

    Zeng, Shubin; Chen, Fangzhou; Li, Dawei; Chen, Ji; Chen, Jiefu

    2018-03-01

    The objective of this study is to develop a method to model 3D resistivity well logging problems in 2D formation with anisotropy, known as 2.5D modeling. The traditional 1D forward modeling extensively used in practice lacks the capability of modeling 2D formation. A 2.5D finite difference method (FDM) solving all the electric and magnetic field components simultaneously is proposed. Compared to other previous 2.5D FDM schemes, this method is more straightforward in modeling fully anisotropic media and easy to be implemented. Fourier transform is essential to this FDM scheme, and by employing Gauss-Legendre (GL) quadrature rule the computational time of this step can be greatly reduced. In the numerical examples, we first demonstrate the validity of the FDM scheme with GL rule by comparing with 1D forward modeling for layered anisotropic problems, and then we model a complicated 2D formation case and find that the proposed 2.5D FD scheme is much more efficient than 3D numerical methods.

  5. Pulse splitting in nonlinear media with anisotropic dispersion properties

    DEFF Research Database (Denmark)

    Bergé, L.; Juul Rasmussen, J.; Schmidt, M.R.

    1998-01-01

    The nonlinear self-focusing of beams in media with anisotropic (mix-signed) dispersion is investigated. Theoretical predictions employing virial-type arguments and self-similar techniques suggest that a pulse propagating in a nonlinear medium with anisotropic dispersion will not collapse...

  6. Diffusion-weighted imaging: basic concepts and application in cerebral stroke and head trauma

    International Nuclear Information System (INIS)

    Huisman, Thierry A.G.M.

    2003-01-01

    Diffusion-weighted imaging (DWI) of the brain represents a new imaging technique that extends imaging from depiction of neuroanatomy to the level of function and physiology. DWI measures a fundamentally different physiological parameter compared with conventional MRI. Image contrast is related to differences in the diffusion rate of water molecules rather than to changes in total tissue water. DWI can reveal pathology in cases where conventional MRI remains unremarkable. DWI has proven to be highly sensitive in the early detection of acute cerebral ischemia and seems promising in the evaluation of traumatic brain injury. DWI can differentiate between lesions with decreased and increased diffusion. In addition, full-tensor DWI can evaluate the microscopic architecture of the brain, in particular white matter tracts, by measuring the degree and spatial distribution of anisotropic diffusion within the brain. This article reviews the basic concepts of DWI and its application in cerebral ischemia and traumatic brain injury. (orig.)

  7. Diffusion-weighted imaging: basic concepts and application in cerebral stroke and head trauma

    Energy Technology Data Exchange (ETDEWEB)

    Huisman, Thierry A.G.M. [Department of Radiology, Neuroradiology Section and MGH-NMR Center, Massachusetts General Hospital and Harvard Medical School, MA 02129, Boston (United States); Department of Radiology, University Children' s Hospital Zurich, Steinwiesstrasse 75, 8032, Zurich (Switzerland)

    2003-10-01

    Diffusion-weighted imaging (DWI) of the brain represents a new imaging technique that extends imaging from depiction of neuroanatomy to the level of function and physiology. DWI measures a fundamentally different physiological parameter compared with conventional MRI. Image contrast is related to differences in the diffusion rate of water molecules rather than to changes in total tissue water. DWI can reveal pathology in cases where conventional MRI remains unremarkable. DWI has proven to be highly sensitive in the early detection of acute cerebral ischemia and seems promising in the evaluation of traumatic brain injury. DWI can differentiate between lesions with decreased and increased diffusion. In addition, full-tensor DWI can evaluate the microscopic architecture of the brain, in particular white matter tracts, by measuring the degree and spatial distribution of anisotropic diffusion within the brain. This article reviews the basic concepts of DWI and its application in cerebral ischemia and traumatic brain injury. (orig.)

  8. Spin-diffusions and diffusive molecular dynamics

    Science.gov (United States)

    Farmer, Brittan; Luskin, Mitchell; Plecháč, Petr; Simpson, Gideon

    2017-12-01

    Metastable configurations in condensed matter typically fluctuate about local energy minima at the femtosecond time scale before transitioning between local minima after nanoseconds or microseconds. This vast scale separation limits the applicability of classical molecular dynamics (MD) methods and has spurned the development of a host of approximate algorithms. One recently proposed method is diffusive MD which aims at integrating a system of ordinary differential equations describing the likelihood of occupancy by one of two species, in the case of a binary alloy, while quasistatically evolving the locations of the atoms. While diffusive MD has shown itself to be efficient and provide agreement with observations, it is fundamentally a model, with unclear connections to classical MD. In this work, we formulate a spin-diffusion stochastic process and show how it can be connected to diffusive MD. The spin-diffusion model couples a classical overdamped Langevin equation to a kinetic Monte Carlo model for exchange amongst the species of a binary alloy. Under suitable assumptions and approximations, spin-diffusion can be shown to lead to diffusive MD type models. The key assumptions and approximations include a well-defined time scale separation, a choice of spin-exchange rates, a low temperature approximation, and a mean field type approximation. We derive several models from different assumptions and show their relationship to diffusive MD. Differences and similarities amongst the models are explored in a simple test problem.

  9. Anisotropic rectangular metric for polygonal surface remeshing

    KAUST Repository

    Pellenard, Bertrand

    2013-06-18

    We propose a new method for anisotropic polygonal surface remeshing. Our algorithm takes as input a surface triangle mesh. An anisotropic rectangular metric, defined at each triangle facet of the input mesh, is derived from both a user-specified normal-based tolerance error and the requirement to favor rectangle-shaped polygons. Our algorithm uses a greedy optimization procedure that adds, deletes and relocates generators so as to match two criteria related to partitioning and conformity.

  10. Anisotropic rectangular metric for polygonal surface remeshing

    KAUST Repository

    Pellenard, Bertrand; Morvan, Jean-Marie; Alliez, Pierre

    2013-01-01

    We propose a new method for anisotropic polygonal surface remeshing. Our algorithm takes as input a surface triangle mesh. An anisotropic rectangular metric, defined at each triangle facet of the input mesh, is derived from both a user-specified normal-based tolerance error and the requirement to favor rectangle-shaped polygons. Our algorithm uses a greedy optimization procedure that adds, deletes and relocates generators so as to match two criteria related to partitioning and conformity.

  11. Temperature-Responsive Anisotropic Slippery Surface for Smart Control of the Droplet Motion.

    Science.gov (United States)

    Wang, By Lili; Heng, Liping; Jiang, Lei

    2018-02-28

    Development of stimulus-responsive anisotropic slippery surfaces is important because of the high demand for such materials in the field of liquid directional-driven systems. However, current studies in the field of slippery surfaces are mainly conducted to prepare isotropic slippery surfaces. Although we have developed electric-responsive anisotropic slippery surfaces that enable smart control of the droplet motion, there remain challenges for designing temperature-responsive anisotropic slippery surfaces to control the liquid droplet motion on the surface and in the tube. In this work, temperature-responsive anisotropic slippery surfaces have been prepared by using paraffin, a thermo-responsive phase-transition material, as a lubricating fluid and directional porous polystyrene (PS) films as the substrate. The smart regulation of the droplet motion of several liquids on this surface was accomplished by tuning the substrate temperature. The uniqueness of this surface lies in the use of an anisotropic structure and temperature-responsive lubricating fluids to achieve temperature-driven smart control of the anisotropic motion of the droplets. Furthermore, this surface was used to design temperature-driven anisotropic microreactors and to manipulate liquid transfer in tubes. This work advances the understanding of the principles underlying anisotropic slippery surfaces and provides a promising material for applications in the biochip and microreactor system.

  12. Collision-induced Raman scattering and the peculiar case of neon: Anisotropic spectrum, anisotropy, and the inverse scattering problem

    International Nuclear Information System (INIS)

    Dixneuf, Sophie; Rachet, Florent; Chrysos, Michael

    2015-01-01

    Owing in part to the p orbitals of its filled L shell, neon has repeatedly come on stage for its peculiar properties. In the context of collision-induced Raman spectroscopy, in particular, we have shown, in a brief report published a few years ago [M. Chrysos et al., Phys. Rev. A 80, 054701 (2009)], that the room-temperature anisotropic Raman lineshape of Ne–Ne exhibits, in the far wing of the spectrum, a peculiar structure with an aspect other than a smooth wing (on a logarithmic plot) which contrasts with any of the existing studies, and whose explanation lies in the distinct way in which overlap and exchange interactions interfere with the classical electrostatic ones in making the polarizability anisotropy, α ∥ − α ⊥ . Here, we delve deeper into that study by reporting data for that spectrum up to 450 cm −1 and for even- and odd-order spectral moments up to M 6 , as well as quantum lineshapes, generated from SCF, CCSD, and CCSD(T) models for α ∥ − α ⊥ , which are critically compared with the experiment. On account of the knowledge of the spectrum over the augmented frequency domain, we show how the inverse scattering problem can be tackled both effectively and economically, and we report an analytic function for the anisotropy whose quantum lineshape faithfully reproduces our observations

  13. Analysis of anisotropic crack problems using coupled meshless and fractal finite element method

    International Nuclear Information System (INIS)

    Rao, B N; Rajesh, K N

    2010-01-01

    This paper presents a coupling technique for integrating the element-free Galerkin method (EFGM) with fractal the finite element method (FFEM) for analyzing homogeneous, anisotropic, and two dimensional linear-elastic cracked structures subjected to mixed-mode (modes I and II) loading conditions. FFEM is adopted for discretization of domain close to the crack tip and EFGM is adopted in the rest of the domain. In the transition region interface elements are employed. The proposed method combines the best features of EFGM and FFEM, in the sense that no structured mesh or special enriched basis functions are necessary and no post-processing (employing any path independent integrals) is needed to determine fracture parameters such as stress intensity factors (SIFs) and T-stress. The numerical results based on all four orthotropic cases show that SIFs and T-stress obtained using the proposed method are in excellent agreement with the reference solutions for the structural and crack geometries considered in the present study.

  14. Diffusion Under Geometrical Constraint

    OpenAIRE

    Ogawa, Naohisa

    2014-01-01

    Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

  15. Performance of an anisotropic Allman/DKT 3-node thin triangular flat shell element

    Science.gov (United States)

    Ertas, A.; Krafcik, J. T.; Ekwaro-Osire, S.

    1992-05-01

    A simple, explicit formulation of the stiffness matrix for an anisotropic, 3-node, thin triangular flat shell element in global coordinates is presented. An Allman triangle (AT) is used for membrane stiffness. The membrane stiffness matrix is explicitly derived by applying an Allman transformation to a Felippa 6-node linear strain triangle (LST). Bending stiffness is incorporated by the use of a discrete Kirchhoff triangle (DKT) bending element. Stiffness terms resulting from anisotropic membrane-bending coupling are included by integrating, in area coordinates, the membrane and bending strain-displacement matrices. Using the aforementioned approach, the objective of this study is to develop and test the performance of a practical 3-node flat shell element that could be used in plate problems with unsymmetrically stacked composite laminates. The performance of the latter element is tested on plates of varying aspect ratios. The developed 3-node shell element should simplify the programming task and have the potential of reducing the computational time.

  16. Composite Fermi surface in the half-filled Landau level with anisotropic electron mass

    Science.gov (United States)

    Ippoliti, Matteo; Geraedts, Scott; Bhatt, Ravindra

    We study the problem of interacting electrons in the lowest Landau level at half filling in the quantum Hall regime, when the electron dispersion is given by an anisotropic mass tensor. Based on experimental observations and theoretical arguments, the ground state of the system is expected to consist of composite Fermions filling an elliptical Fermi sea, with the anisotropy of the ellipse determined by the competing effects of the isotropic Coulomb interaction and anisotropic electron mass tensor. We test this idea quantitatively by using a numerical density matrix renormalization group method for quantum Hall systems on an infinitely long cylinder. Singularities in the structure factor allow us to map the Fermi surface of the composite Fermions. We compute the composite Fermi surface anisotropy for several values of the electron mass anisotropy which allow us to deduce the functional dependence of the former on the latter. This research was supported by Department of Energy Office of Basic Energy Sciences through Grant No. DE-SC0002140.

  17. Diffusion MRI processing for multi-compartment characterization of brain pathology

    International Nuclear Information System (INIS)

    Hedouin, Renaud

    2017-01-01

    Diffusion weighted imaging (DWI) is a specific type of MRI acquisition based on the direction of diffusion of the brain water molecules. It allows, through several acquisitions, to model the brain microstructure, as white matter, which is significantly smaller than the voxel-resolution. To acquire a large number of images in a clinical setting, very-fast acquisition techniques are required as single-shot imaging. However these acquisitions suffer locally large distortions. We propose a block-matching registration method based on the acquisition of images with opposite phase-encoding directions (PED). This technique specially designed for Echo-Planar Images (EPI) robustly correct images and provides a deformation field. This field is applicable to an entire DWI series from only one reversed EPI allowing distortion correction with a minimal acquisition time cost. This registration algorithm has been validated both on phantom and on in vivo data and is available in our source medical image processing toolbox Anima. From these diffusion images, we are able to construct multi-compartments models (MCM) which can represent complex brain microstructure. Doing registration, averaging and atlas creation on these MCM images is required to perform studies and statistic analyses. We propose a general method to interpolate MCM as a simplification problem based on spectral clustering. This technique, which is adaptable for any MCM, has been validated on both synthetic and real data. Then, from a registered dataset, we performed a patient to population analysis at a voxel-level computing statistics on MCM parameters. Specifically designed tractography can also be used to make analysis, following tracks, based on individual anisotropic compartments. All these tools are designed and used on real data and contribute to the search of bio-markers for brain diseases such as multiple sclerosis. (author)

  18. Existence results for anisotropic discrete boundary value problems

    Directory of Open Access Journals (Sweden)

    Avci Avci

    2016-06-01

    Full Text Available In this article, we prove the existence of nontrivial weak solutions for a class of discrete boundary value problems. The main tools used here are the variational principle and critical point theory.

  19. Anisotropic wave-equation traveltime and waveform inversion

    KAUST Repository

    Feng, Shihang

    2016-09-06

    The wave-equation traveltime and waveform inversion (WTW) methodology is developed to invert for anisotropic parameters in a vertical transverse isotropic (VTI) meidum. The simultaneous inversion of anisotropic parameters v0, ε and δ is initially performed using the wave-equation traveltime inversion (WT) method. The WT tomograms are then used as starting background models for VTI full waveform inversion. Preliminary numerical tests on synthetic data demonstrate the feasibility of this method for multi-parameter inversion.

  20. Anisotropic microporous supports impregnated with polymeric ion-exchange materials

    Science.gov (United States)

    Friesen, Dwayne; Babcock, Walter C.; Tuttle, Mark

    1985-05-07

    Novel ion-exchange media are disclosed, the media comprising polymeric anisotropic microporous supports containing polymeric ion-exchange or ion-complexing materials. The supports are anisotropic, having small exterior pores and larger interior pores, and are preferably in the form of beads, fibers and sheets.