WorldWideScience

Sample records for anisopliae fungal catalase

  1. Human sera IgE reacts with a Metarhizium anisopliae fungal catalase

    Science.gov (United States)

    Background: Previous studies have demonstrated that Metarhzium anisopliae extract can induce immune responses in a mouse model that are characteristic of human allergic asthma. Objectives: The objective of this study was to identify and characterize the extract proteins t...

  2. Catalase overexpression reduces the germination time and increases the pathogenicity of the fungus Metarhizium anisopliae.

    Science.gov (United States)

    Morales Hernandez, Claudia Erika; Padilla Guerrero, Israel Enrique; Gonzalez Hernandez, Gloria Angelica; Salazar Solis, Eduardo; Torres Guzman, Juan Carlos

    2010-07-01

    Catalases and peroxidases are the most important enzymes that degrade hydrogen peroxide into water and oxygen. These enzymes and superoxide dismutase are the first lines of cell defense against reactive oxygen species. Metarhizium anisopliae displays an increase in catalase-peroxidase activity during germination and growth. To determine the importance of catalase during the invasion process of M. anisopliae, we isolated the cat1 gene. cat1 cDNA expression in Escherichia coli and the subsequent purification of the protein confirmed that the cat1 gene codes for a monofunctional catalase. Expression analysis of this gene by RT-PCR from RNA isolated from fungus grown in liquid cultures showed a decrease in the expression level of the cat1 gene during germination and an increase during mycelium growth. The expression of this gene in the fungus during the infection process of the larvae of Plutella xylostella also showed a significant increase during invasive growth. Transgenic strains overexpressing the cat1 gene had twice the catalase activity of the wild-type strain. This increase in catalase activity was accompanied by a higher level of resistance to exogenous hydrogen peroxide and a reduction in the germination time. This improvement was also observed during the infection of P. xylostella larvae. M. anisopliae transgenic strains overexpressing the cat1 gene grew and spread faster in the soft tissue of the insect, reducing the time to death of the insect by 25% and the dose required to kill 50% of the population 14-fold.

  3. Altered immunity in crowded locust reduced fungal (Metarhizium anisopliae) pathogenesis.

    Science.gov (United States)

    Wang, Yundan; Yang, Pengcheng; Cui, Feng; Kang, Le

    2013-01-01

    The stress of living conditions, similar to infections, alters animal immunity. High population density is empirically considered to induce prophylactic immunity to reduce the infection risk, which was challenged by a model of low connectivity between infectious and susceptible individuals in crowded animals. The migratory locust, which exhibits polyphenism through gregarious and solitary phases in response to population density and displays different resistance to fungal biopesticide (Metarhizium anisopliae), was used to observe the prophylactic immunity of crowded animals. We applied an RNA-sequencing assay to investigate differential expression in fat body samples of gregarious and solitary locusts before and after infection. Solitary locusts devoted at least twice the number of genes for combating M. anisopliae infection than gregarious locusts. The transcription of immune molecules such as pattern recognition proteins, protease inhibitors, and anti-oxidation proteins, was increased in prophylactic immunity of gregarious locusts. The differentially expressed transcripts reducing gregarious locust susceptibility to M. anisopliae were confirmed at the transcriptional and translational level. Further investigation revealed that locust GNBP3 was susceptible to proteolysis while GNBP1, induced by M. anisopliae infection, resisted proteolysis. Silencing of gnbp3 by RNAi significantly shortened the life span of gregarious locusts but not solitary locusts. By contrast, gnbp1 silencing did not affect the life span of both gregarious and solitary locusts after M. anisopliae infection. Thus, the GNBP3-dependent immune responses were involved in the phenotypic resistance of gregarious locusts to fungal infection, but were redundant in solitary locusts. Our results indicated that gregarious locusts prophylactically activated upstream modulators of immune cascades rather than downstream effectors, preferring to quarantine rather than eliminate pathogens to conserve energy

  4. Altered immunity in crowded locust reduced fungal (Metarhizium anisopliae pathogenesis.

    Directory of Open Access Journals (Sweden)

    Yundan Wang

    2013-01-01

    Full Text Available The stress of living conditions, similar to infections, alters animal immunity. High population density is empirically considered to induce prophylactic immunity to reduce the infection risk, which was challenged by a model of low connectivity between infectious and susceptible individuals in crowded animals. The migratory locust, which exhibits polyphenism through gregarious and solitary phases in response to population density and displays different resistance to fungal biopesticide (Metarhizium anisopliae, was used to observe the prophylactic immunity of crowded animals. We applied an RNA-sequencing assay to investigate differential expression in fat body samples of gregarious and solitary locusts before and after infection. Solitary locusts devoted at least twice the number of genes for combating M. anisopliae infection than gregarious locusts. The transcription of immune molecules such as pattern recognition proteins, protease inhibitors, and anti-oxidation proteins, was increased in prophylactic immunity of gregarious locusts. The differentially expressed transcripts reducing gregarious locust susceptibility to M. anisopliae were confirmed at the transcriptional and translational level. Further investigation revealed that locust GNBP3 was susceptible to proteolysis while GNBP1, induced by M. anisopliae infection, resisted proteolysis. Silencing of gnbp3 by RNAi significantly shortened the life span of gregarious locusts but not solitary locusts. By contrast, gnbp1 silencing did not affect the life span of both gregarious and solitary locusts after M. anisopliae infection. Thus, the GNBP3-dependent immune responses were involved in the phenotypic resistance of gregarious locusts to fungal infection, but were redundant in solitary locusts. Our results indicated that gregarious locusts prophylactically activated upstream modulators of immune cascades rather than downstream effectors, preferring to quarantine rather than eliminate pathogens to

  5. Severe fungal sclerokeratitis caused by Metarhizium anisopliae: a case report and literature review.

    Science.gov (United States)

    Eguchi, Hiroshi; Toibana, Toshi; Hotta, Fumika; Miyamoto, Tatsuro; Mitamura, Yoshinori; Yaguchi, Takashi

    2015-02-01

    To date, there has been only one published report on the infectious sclerokeratitis caused by Metarhizium anisopliae, which is an entomopathogenic fungus. Regarding corneal infection, three reports have been published to date. Although the prognoses of the corneal infections are favourable, prognosis when scleral infection is involved is very poor. A 76-year-old patient presented with foreign body sensation in the left eye. Microscopic examination with Fungi Flora Y staining of the corneal scraping revealed fungal infection. The conjunctiva was melted by the infection over a wide area. Although intensive medications were administered, an emergency surgery was necessary because scleral thinning, corneal perforation and lens prolapse occurred. The fungal isolate was identified as M. anisopliae by sequencing the internal transcribed spacer region. Herein, we report the second known case worldwide of M. anisopliae sclerokeratitis, and we review the literature related to the ocular infections.

  6. ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY

    Science.gov (United States)

    ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY. M D W Ward1, M E Viana2, L B Copeland1, and MJ K Selgrade1. 1US EPA, ORD, NHEERL, RTP, NC, USA. 2NCSU, College of Veterinary Medicine, Raleigh, NC, USA. Metarhizium anisopli...

  7. evaluation of indigenous fungal isolates and metarhizium anisopliae ...

    African Journals Online (AJOL)

    preferred customer

    native fungal isolates against the lesser wax moth and assessing non target effect of one isolate of. Beauveria (IITA 18) and five ... widely distributed and devastating insect pest to ..... Non-Target. Invertebrates of Fungal Biocontrol Agents, PP.

  8. evaluation of native fungal isolates of metrahizium anisopliae var

    African Journals Online (AJOL)

    preferred customer

    isolates against GWM and assessed the non-target effect of one isolate of Beauveria (IITA 18) and five isolates of ... distributed and devastating insect pest to honey production in ..... to Non-Target. Invertebrates of Fungal Biocontrol Agents, pp.

  9. Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

    Science.gov (United States)

    Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

  10. Catalases play differentiated roles in the adaptation of a fungal entomopathogen to environmental stresses.

    Science.gov (United States)

    Wang, Zheng-Liang; Zhang, Long-Bin; Ying, Sheng-Hua; Feng, Ming-Guang

    2013-02-01

    The catalase family of Beauveria bassiana (fungal entomopathogen) consists of catA (spore-specific), catB (secreted), catP (peroxisomal), catC (cytoplasmic) and catD (secreted peroxidase/catalase), which were distinguished in phylogeny and structure and functionally characterized by constructing single-gene disrupted and rescued mutants for enzymatic and multi-phenotypic analyses. Total catalase activity decreased 89% and 56% in ΔcatB and ΔcatP, corresponding to the losses of upper and lower active bands gel-profiled for all catalases respectively, but only 9-12% in other knockout mutants. Compared with wild type and complement mutants sharing similar enzymatic and phenotypic parameters, all knockout mutants showed significant (9-56%) decreases in the antioxidant capability of their conidia (active ingredients of mycoinsecticides), followed by remarkable phenotypic defects associated with the fungal biocontrol potential. These defects included mainly the losses of 40% thermotolerance (45°C) in ΔcatA, 46-48% UV-B resistance in ΔcatA and ΔcatD, and 33-47% virulence to Spodoptera litura larvae in ΔcatA, ΔcatP and ΔcatD respectively. Moreover, the drastic transcript upregulation of some other catalase genes observed in the normal culture of each knockout mutant revealed functionally complimentary effects among some of the catalase genes, particularly between catB and catC whose knockout mutants displayed little or minor phenotypic changes. However, the five catalase genes functioned redundantly in mediating the fungal tolerance to either hyperosmotic or fungicidal stress. The differentiated roles of five catalases in regulating the B. bassiana virulence and tolerances to oxidative stress, high temperature and UV-B irradiation provide new insights into fungal adaptation to stressful environment and host invasion.

  11. Structure–Function Relationships in Fungal Large-Subunit Catalases

    Energy Technology Data Exchange (ETDEWEB)

    Diaz, A.; Valdez, V; Rudino-Pinera, E; Horjales, E; Hansberg, W

    2009-01-01

    Neurospora crassa has two large-subunit catalases, CAT-1 and CAT-3. CAT-1 is associated with non-growing cells and accumulates particularly in asexual spores; CAT-3 is associated with growing cells and is induced under different stress conditions. It is our interest to elucidate the structure-function relationships in large-subunit catalases. Here we have determined the CAT-3 crystal structure and compared it with the previously determined CAT-1 structure. Similar to CAT-1, CAT-3 hydrogen peroxide (H{sub 2}O{sub 2}) saturation kinetics exhibited two components, consistent with the existence of two active sites: one saturated in the millimolar range and the other in the molar range. In the CAT-1 structure, we found three interesting features related to its unusual kinetics: (a) a constriction in the channel that conveys H{sub 2}O{sub 2} to the active site; (b) a covalent bond between the tyrosine, which forms the fifth coordination bound to the iron of the heme, and a vicinal cysteine; (c) oxidation of the pyrrole ring III to form a cis-hydroxyl group in C5 and a cis-{gamma}-spirolactone in C6. The site of heme oxidation marks the starts of the central channel that communicates to the central cavity and the shortest way products can exit the active site. CAT-3 has a similar constriction in its major channel, which could function as a gating system regulated by the H{sub 2}O{sub 2} concentration before the gate. CAT-3 functional tyrosine is not covalently bonded, but has instead the electron relay mechanism described for the human catalase to divert electrons from it. Pyrrole ring III in CAT-3 is not oxidized as it is in other large-subunit catalases whose structure has been determined. Different in CAT-3 from these enzymes is an occupied central cavity. Results presented here indicate that CAT-3 and CAT-1 enzymes represent a functional group of catalases with distinctive structural characteristics that determine similar kinetics.

  12. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite Are Compared in a Mouse Model

    Directory of Open Access Journals (Sweden)

    Marsha D. W. Ward

    2011-01-01

    Full Text Available Biopesticides can be effective in controlling their target pest. However, research regarding allergenicity and asthma development is limited. We compared the ability of fungal biopesticide Metarhizium anisopliae (MACA and house dust mite (HDM extracts to induce allergic responses in BALB/c mice. The extracts were administered by intratracheal aspiration at doubling doses (2.5–80 g protein 4X over a four-week period. Three days after the last exposure, serum and bronchoalveolar lavage fluid (BALF were collected. The extracts' relative allergenicity was evaluated based on response robustness (lowest significant dose response compared to control (0 g. MACA induced a more robust serum total IgE response than HDM. However, in the antigen-specific IgE assay, a similar dose of both MACA and HDM was required to achieve the same response level. Our data suggest a threshold dose of MACA for allergy induction and that M. anisopliae may be similar to HDM in allergy induction potential.

  13. A protocol for determination of conidial viability of the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae from commercial products.

    Science.gov (United States)

    Oliveira, Daian Guilherme Pinto; Pauli, Giuliano; Mascarin, Gabriel Moura; Delalibera, Italo

    2015-12-01

    Techniques for directly determining conidial viability have widespread use but also have limitations for quality control assessments of formulated mycoinsecticides, especially in emulsifiable oil. This study proposes a new method based on adaptations of already established protocols that use the direct viability method to make it more economical and accurate, thus enabling its use in the evaluation of formulated products. Appropriate parameters and conditions were defined using products based on Beauveria bassiana and Metarhizium anisopliae in the forms of pure conidia, fungus-colonized rice, ground fungus-colonized rice and oil dispersion. The established protocol, named ESALQ, consists of the transfer of 150 μL of a suspension containing about 0.7 and 1 × 10(6) conidia/mL onto Rodac® plates with 5 mL of potato dextrose agar culture medium + 5 mg/L of Pentabiotic® and 10 μL/L of Derosal® (Carbendazim) and subsequent counting of germinated and non-germinated conidia. For the ground fungus-colonized rice and oil dispersion formulations, prior to transferring the fungal suspension to the medium, rice should be decanted and the oil removed, respectively. This method was compared with another direct viability method and with the Colony-forming unit (CFU) and Fluorescence viability methods, comparing the accuracy obtained using the coefficient of variation (CV) of the analysis of each method. The results showed that in addition to the ease of application, the developed method has higher accuracy than the other methods (with a CV up to seven times lower than in the Standard method and up to 32 times lower than CFU). The CFU method underestimated the concentration of viable conidia in most of the tested fungal forms, and in the emulsifiable oil products, these values were 54% lower for B. bassiana and 84% lower for M. anisopliae. The adaptations and standardizations proposed in the ESALQ method showed effective improvements for routine quality assessment of

  14. Horizontal Transmission of Metarhizium anisopliae in Fruit Flies and Effect of Fungal Infection on Egg Laying and Fertility

    Directory of Open Access Journals (Sweden)

    Nguya K. Maniania

    2013-05-01

    Full Text Available Fly-to-fly transmission of conidia of the entomopathogenic fungus Metarhizium anisopliae and the effect of fungal infection on the reproductive potential of females surviving infection were investigated in three fruit fly species, Ceratitis cosyra, C. fasciventris, and C. capitata. The number of conidia picked up by a single fruit fly was determined in C. cosyra. The initial uptake (Day 0 of conidia by a single fly was approx. 1.1 × 106 conidia after exposure to the treated substrate. However, the number of conidia dropped from 7.2 × 105 to 4.1 × 105 conidia after 2 and 8 h post-exposure, respectively. The number of conidia picked up by a single fungus-treated fly (“donor” varied between 3.8 × 105 and 1.0 × 106 in the three fruit fly species, resulting in 100% mortality 5–6 days post-exposure. When fungus-free flies of both sexes (“recipient” flies were allowed to mate with “donor” flies, the number of conidia picked up by a single fly varied between 1.0 × 105 and 2.5 × 105, resulting in a mortality of 83–100% in C. capitata, 72–85% in C. cosyra and 71–93% in C. fasciventris 10–15 days post-inoculation. There was an effect of fungal infection on female egg laying in the three species of fruit flies as control flies laid more eggs than fungus-treated females. The percentage reduction in fecundity in flies infected with M. anisopliae was 82, 73 and 37% in C. capitata, C. fasciventris and C. cosyra, respectively. The results are discussed with regard to application in autodissemination techniques.

  15. New antibacterial isocoumarin glycosides from a wetland soil derived fungal strain Metarhizium anisopliae.

    Science.gov (United States)

    Tian, Jie-Feng; Li, Peng-Ju; Li, Xiao-Xia; Sun, Ping-Hua; Gao, Hao; Liu, Xing-Zhong; Huang, Peng; Tang, Jin-Shan; Yao, Xin-Sheng

    2016-03-01

    Eight new isocoumarin glycosides (1-8) were obtained from the solid culture of the wetland soil-derived fungus Metarhizium anisopliae (No. DTH12-10). Their chemical structures were elucidated by analyses of HR ESI-TOF MS, (1)H, (13)C NMR, (1)H-(1)H COSY, HSQC, and HMBC spectra. The absolute configurations were determined by single crystal X-ray diffraction, circular dichroism (CD) spectrum, and chemical derivatization methods. In addition, inhibition of the biofilm formation and the secretion of virulence factor of the new isocoumarin glycosides against Pseudomonas aeruginosa strain PAOA (clinical isolates) were evaluated. The result revealed that compound 1 showed antibacterial activity comparable with (Z)-4-bromo-5-(bromomethylene)-2(5H)-furanone (BF).

  16. THE FUNGAL BIOPESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    Science.gov (United States)

    Background: Sensitisation to cockroaches is associated with asthma and hence, the elimination of this vermin is of interest. Metarhizium anisopliae is a parasitic fungus used as a pesticide to control cockroach infestation indoors. Previously M. anisopliae has been shown to cause...

  17. Exposure of bed bugs to metarhizium anisopliae, and the effect of defensive secretions on fungal growth in vitro

    Science.gov (United States)

    Bed bugs Cimex lectularius were treated with conidia of the entomopathogenic fungus Metarhizium anisopliae by topical, spray, and contact exposure. One week post-exposure, inconsistent mortalities were observed, averaging 30% across all treatment groups and replicates. Microscopic examination of top...

  18. CATALASE FROM A FUNGAL MICROBIAL PESTICIDE INDUCES A UNIQUE IGE RESPONSE.

    Science.gov (United States)

    BALB/c mice exposed by involuntary aspiration to Metarhizium anisopliae extract (MACA), a microbial pesticide, have shown responses characteristic of human allergic lung disease/asthma. IgE-binding proteins have been identified in MACA by Western blot analysis, 2-dimensio...

  19. Sensitive and rapid detection of the insect pathogenic fungus Metarhizium anisopliae var. anisopliae by loop-mediated isothermal amplification.

    Science.gov (United States)

    Li, Ya; Cai, Shuang-Hu

    2011-05-01

    A set of six specific primers was designed by targeting intergenic spacer region (IGS) sequences. With Bst DNA polymerase, the products could be clearly amplified for 60 min at 62 °C in a simple water bath. The sensitivity of the loop-mediated isothermal amplification (LAMP) for detecting Metarhizium anisopliae var. anisopliae was about 0.01 pg fungal DNA per reaction (equivalent to 27 conidia). LAMP products could be judged with agar gel or naked eye after addition of SYBR Green I. There were no cross reactions with other fungal isolates indicating high specificity of the LAMP. The LAMP could detect the presence of M. anisopliae var. anisopliae from soil. The detection limits for M. anisopliae var. anisopliae of LAMP reaction was 50 conidia per reaction in soil.

  20. Production of microsclerotia of the fungal entomopathogen Metarhizium anisopliae and their potential for use as a biocontrol agent for soil-inhabiting insects

    Science.gov (United States)

    Microsclerotia (MS), overwintering structures produced by many plant pathogenic fungi, have not been described for Metarhizium anisopliae. Three strains of M. anisopliae – F52, TM109, and MA1200 – formed MS in shake flask cultures using media with varying carbon concentrations and carbon-to-nitroge...

  1. Genetic diversity of Metarhizium anisopliae var. anisopliae in southwestern British Columbia.

    Science.gov (United States)

    Inglis, G Douglas; Duke, Grant M; Goettel, Mark S; Kabaluk, J Todd

    2008-05-01

    The abundance and genetic diversity of the entomopathogenic fungus, Metarhizium anisopliae var. anisopliae, in southwestern British Columbia (BC) and southern Alberta was examined. The fungus was found to be widespread in soil throughout southwestern BC, and was recovered from 56% of 85 sample sites. In contrast to southwestern BC, no M. anisopliae isolates were recovered in southern Alberta. An automated fluorescent amplified fragment length polymorphism (AFLP) method was used to examine genetic diversity. In excess of 200 isolates were characterized. The method identified 211 polymorphic amplicons, ranging in size from approximately 92 to 400 base pairs, and it was found to be reproducible with a resolution limit of 86.2% similarity. The AFLP method distinguished Metarhizium from other entomopathogenic fungal genera, and demonstrated considerable genetic diversity (25 genotypes) among the reference strains of M. anisopliae isolates examined (i.e. recovered from various substrates and geographical locations). Although 13 genotypes of M. anisopliae var. anisopliae were recovered from southwestern BC soils, the vast majority of isolates (91%) belonged to one of two closely-related genotypes. Furthermore, these two genotypes predominated in urban, agricultural and forest soils. The reasons for the limited diversity of M. anisopliae var. anisopliae in southwestern BC are uncertain. However, findings of this study are consistent with island biogeography theory, and have significant implications for the development of this fungus for microbial control of pest insects.

  2. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen)

    Science.gov (United States)

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W.; Zhang, Zehua

    2016-01-01

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca2+ disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control. PMID:27328936

  3. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen).

    Science.gov (United States)

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W; Zhang, Zehua

    2016-06-22

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca(2+) disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control.

  4. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIAE

    Science.gov (United States)

    IntroductionThe goal of this project is the identification and characterization of allergens from the fungus Metarhizium anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaer...

  5. Beauveria bassiana, Metarhizium anisopliae, and Metarhizium anisopliae var. acridum conidia: tolerance to imbibitional damage

    Science.gov (United States)

    When dry fungal cells are immersed in water, rapid imbibition (water uptake) may compromise the plasma membrane, killing the cell. This study investigated the impact of imbibitional damage (measured in terms of reduced viability) on Beauveria bassiana (Bb), Metarhizium anisopliae (Ma) and M. anisop...

  6. Beauveria bassiana and Metarhizium anisopliae endophytically colonize cassava roots following soil drench inoculation

    Science.gov (United States)

    The fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae were investigated to determine if endophytic colonization could be achieved in cassava. An inoculation method based on drenching the soil around cassava stems using conidial suspensions resulted in endophytic colonization of ca...

  7. A fungal catalase reacts selectively with the 13S fatty acid hydroperoxide products of the adjacent lipoxygenase gene and exhibits 13S-hydroperoxide-dependent peroxidase activity.

    Science.gov (United States)

    Teder, Tarvi; Boeglin, William E; Schneider, Claus; Brash, Alan R

    2017-03-28

    The genome of the fungal plant pathogen Fusarium graminearum harbors six catalases, one of which has the sequence characteristics of a fatty acid peroxide-metabolizing catalase. We cloned and expressed this hemoprotein (designated as Fg-cat) along with its immediate neighbor, a 13S-lipoxygenase (cf. Brodhun et al., PloS One, e64919, 2013) that we considered might supply a fatty acid hydroperoxide substrate. Indeed, Fg-cat reacts abruptly with the 13S-hydroperoxide of linoleic acid (13S-HPODE) with an initial rate of 700-1300s(-1). By comparison there was no reaction with 9R- or 9S-HPODEs and extremely weak reaction with 13R-HPODE (~0.5% of the rate with 13S-HPODE). Although we considered Fg-cat as a candidate for the allene oxide synthase of the jasmonate pathway in fungi, the main product formed from 13S-HPODE was identified by UV, MS, and NMR as 9-oxo-10E-12,13-cis-epoxy-octadecenoic acid (with no traces of AOS activity). The corresponding analog is formed from the 13S-hydroperoxide of α-linolenic acid along with novel diepoxy-ketones and two C13 aldehyde derivatives, the reaction mechanisms of which are proposed. In a peroxidase assay monitoring the oxidation of ABTS, Fg-cat exhibited robust activity (kcat 550s(-1)) using the 13S-hydroperoxy-C18 fatty acids as the oxidizing co-substrate. There was no detectable peroxidase activity using the corresponding 9S-hydroperoxides, nor with t-butyl hydroperoxide, and very weak activity with H2O2 or cumene hydroperoxide at micromolar concentrations of Fg-cat. Fg-cat and the associated lipoxygenase gene are present together in fungal genera Fusarium, Metarhizium and Fonsecaea and appear to constitute a partnership for oxidations in fungal metabolism or defense.

  8. IDENTIFICATION OF ALLERGENS FROM METARHIZIUM ANISOPLIAE USING MASS SPECTROMETRY

    Science.gov (United States)

    Background The U.S. EPA, under the "Children at Risk" Program, is currently addressing the problem of indoor fungal bioaerosol contamination. The fungus Metarhizium Anisopliae has been used as a bio-pesticide for insect control since the 1800's. Recent studies have shown t...

  9. Fungal Entomopathogens in the Rhizosphere

    Science.gov (United States)

    Entomopathogenic fungi are found in a wide variety of fungal groups. The order Hypocreales contains the largest number of entomogenous fungi, including two of the most widely studied, Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae) and Metarhizium anisopliae (Metchnikoff) Sorok...

  10. Laboratory and field evaluation of Metarhizium anisopliae var. anisopliae for controlling subterranean termites.

    Science.gov (United States)

    Hussain, A; Ahmed, S; Shahid, M

    2011-01-01

    The efficacy of the Metarhizium anisopliae strain ARSEF 6911 was determined in the laboratory and field against two sugarcane pests, Microtermes obesi Holmgren and Odontotermes obesus Rambur (Termitidae: Isoptera). The susceptibility of both termite species to different conidial suspensions (1 × 10(10), 1 × 10(8), 1 × 10(6) and 1 × 10(4) conidia/ml) was determined in laboratory. All conidial suspensions were able to induce mortality. Termite mortality caused by the fungal suspensions was dose dependent. There were no significant differences in the LT50 values between species. Field evaluation of M. anisopliae alone or in combination with diesel oil and thiamethoxam was carried out in two growing seasons (autumn 2005 and spring 2006) at two sites located in Punjab, Pakistan. Dipping the sugarcane setts in these suspensions was tried to determine their effects on germination and percentage of bud damage to sugarcane setts. All treatments significantly reduced termite infestation compared to the untreated control. The combined treatment of M. anisopliae and diesel oil significantly reduced insect damage by attaining higher germination > 55% and lower bud damage < 5.50% at both sites in both seasons. The results suggest that the application of M. anisopliae and diesel oil in combination might be a useful treatment option for the management of termites in sugarcane.

  11. Laboratory and field evaluation of Metarhizium anisopliae var. anisopliae for controlling subterranean termites

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, A. [South China Agricultural University, Guangzhou (China). College of Natural Resources and Environment; Ahmed, S. [South China Agricultural University, Guangzhou (China). Dept. of Agricultural Entomology; Shahid, M., E-mail: solvia_aah@yahoo.co [University of Agriculture, Faisalabad (Pakistan). Dept. of Chemistry and Biochemistry

    2011-03-15

    The efficacy of the Metarhizium anisopliae strain ARSEF 6911 was determined in the laboratory and field against two sugarcane pests, Microtermes obesi Holmgren and Odontotermes obesus Rambur (Termitidae: Isoptera). The susceptibility of both termite species to different conidial suspensions (1 x 10{sup 10}, 1 x 10{sup 8}, 1 x 10{sup 6} and 1 x 10{sup 4} conidia/ml) was determined in laboratory. All conidial suspensions were able to induce mortality. Termite mortality caused by the fungal suspensions was dose dependent. There were no significant differences in the LT{sub 50} values between species. Field evaluation of M. anisopliae alone or in combination with diesel oil and thyamethoxam was carried out in two growing seasons (autumn 2005 and spring 2006) at two sites located in Punjab, Pakistan. Dipping the sugarcane setts in these suspensions was tried to determine their effects on germination and percentage of bud damage to sugarcane setts. All treatments significantly reduced termite infestation compared to the untreated control. The combined treatment of M. anisopliae and diesel oil significantly reduced insect damage by attaining higher germination > 55% and lower bud damage < 5.50% at both sites in both seasons. The results suggest that the application of M. anisopliae and diesel oil in combination might be a useful treatment option for the management of termites in sugarcane. (author)

  12. Evaluation of Metarhizium anisopliae, Beauveria bassiana and Paecilomyces fumosoroseus as entomopathogens of the cactus moth, Cactoblastis cactorum (Lepidoptera:Pyralidae)

    Science.gov (United States)

    The fungal pathogens Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), Paecilomyces fumosoroseus (Wize) Brown & Smith (Deuteromycotina: Hyphomycetes), and Beauveria bassiana (Bals.-Criv.) Vuill. (Hypocreales: Clavicipitaceae) were evaluated as potential biological control ...

  13. Pathogenicity of a new China variety of Metarhizium anisopliae (M. Anisopliae var. Dcjhyium) to subterranean termite Odontotermes formosanus.

    Science.gov (United States)

    Dong, Changjin; Zhang, Jiamin; Huang, Hai; Chen, Wuguo; Hu, Yuanyang

    2009-01-01

    The pathogenicity of a new China variety of Metarhizium anisopliae (M. anisopliae var. dcjhyium) against the subterranean termite Odontotermes formosanus and the effect of the fungal fermented solution on hemolymph intracellular calcium were studied in laboratory. Conidia from the M. anisopliae var. dcjhyium were highly virulent for O. formosanus causing approximately 100% mortality 3 days post-inoculation in the concentration of 3x10(8) conidia/ml. The conidial clumps with conidial chains distributed on the cadavers of termite. When the termite was treated with 3x10(5) conidia/ml for 2 days, two constitutive proteins (91 and 105kDa) disappeared and a new specific protein (40kDa) appeared in the hemolymph of survivors relative to the controls. Hemolymph cells treated by the fungal fermented solution had a significantly higher level of intracellular calcium than controls 30min after treatment (x1.7). When the termite O. formosanus was infected by the entomopathogenic fungus M. anisopliae var. dcjhyium, hyphae invaded the integument and body cavity of the termite; well-developed muscles and fat tissue in the thorax of termite were decomposed and absorbed by hyphae, and formed the net structure; Hyphae seriously destroyed hemolymph, various tissues, pipelines and produced large number of conidia in the body of termite.

  14. Effects of conidial densities and spray volume of Metarhizium anisopliae and Beauveria bassiana fungal suspensions on conidial viability, droplet size and deposition coverage in bioassay using a novel bioassay spray system

    Science.gov (United States)

    Experiments were conducted to study the conidial viability during bioassay spray with different suspensions of Metarhizium anisopliae ATCC 62176 and Beauveria bassiana NI8, and to investigate the effects of conidial density and spray volume on the distribution of droplet size and deposit coverage us...

  15. Infection of two non-target grasshoppers by the biological control agent Metarhizium anisopliae var. acridum in the Sahel

    DEFF Research Database (Denmark)

    Fisker, E. N.; Eilenberg, J.; Langewald, J.;

    2006-01-01

    Fungal isolates from grasshoppers of the family Acrididae are suspected to be less virulent to grasshoppers of the family Pyrgomorphidae. The biological control agent Metarhizium anisopliae var. acridum was isolated from an acridid and is thus hypothesized to be less virulent to pyrgomorphids....... The susceptibility of two non-target pyrgomorphids, Pyrgomorpha cognata and Poekilocerus bufonius hieroglyphicus, to M. anisopliae was tested in the field. Results show that P. cognata under field conditions is as susceptible to infection by M. anisopliae as acridids, whereas P. b. hieroglyphicus is less susceptible...

  16. Pure culture of Metarhizium anisopliae LHL07 reprograms soybean to higher growth and mitigates salt stress.

    Science.gov (United States)

    Khan, Abdul Latif; Hamayun, Muhammad; Khan, Sumera Afzal; Kang, Sang-Mo; Shinwari, Zabta Khan; Kamran, Muhammad; Ur Rehman, Shafiq; Kim, Jong-Guk; Lee, In-Jung

    2012-04-01

    Little is known about the role of endophytic fungi against abiotic stresses and isoflavonoids (IF) contents of soybean. In current study, we investigated the role of fungal endophytes on the growth of soybean under salt stress conditions. Pure cultures of nine endophytic fungi were isolated from the roots of field-grown soybean plants, and their culture filtrates were screened on Waito-C and Dongjin-byeo rice cultivars; for identification of plant growth promoting fungal strains. It was observed that fungal isolate GMC-2B significantly promoted the growth of both Waito-C and Dongjin-byeo. GMC-2B was later identified as a new strain of Metarhizium anisopliae LHL07 on the basis of 18S rDNA sequences and phylogenetic analysis. Metarhizium anisopliae LHL07 inoculated soybean plants recorded significantly higher shoot length, shoot fresh and dry biomass, chlorophyll contents, transpiration rate, photosynthetic rate and leaf area; under sodium chloride induced salt stress as compared to non-inoculated control plants. An elevated proline and reduced superoxide dismutase and malondialdehyde contents in M. anisopliae LHL07 inoculated soybean plants demonstrated mitigation of salt induced oxidative stress. Furthermore, reduced abscisic acid and elevated jasmonic acid contents in soybean plants confirmed that lesser stress was convened to M. anisopliae inoculated-plants under salinity stress. We also assessed the role of M. anisopliae interaction on IF biosynthesis of soybean, and found significantly higher IF contents in M. anisopliae inoculated soybean plants. In conclusion, endophytic fungal interactions with soybean can be beneficial to improve soybean quality and quantity under salt affected agricultural systems.

  17. Exposure of Bed Bugs to Metarhizium anisopliae at Different Humidities.

    Science.gov (United States)

    Ulrich, Kevin R; Feldlaufer, Mark F; Kramer, Matthew; St Leger, Raymond J

    2014-12-01

    Bed bugs Cimex lectularius L. were exposed to conidia (spores) of the entomopathogenic fungus Metarhizium anisopliae by feeding, aerosol spray, or contact with a treated surface. Feeding experiments demonstrated that bed bugs were innately susceptible to this fungus. However, only at 98% humidity were mortality rates high, regardless of whether bed bugs were sprayed with a fungal solution or contacted a treated surface. Mortality in treated bed bugs at ambient humidity did not increase when these bed bugs were kept in aggregation with other bed bugs that had recently blood fed to repletion. Based on these laboratory studies, we conclude that M. anisopliae is a poor pathogen for use in control of bed bugs, particularly at humidities that would likely be encountered under field conditions. © 2014 Entomological Society of America.

  18. PCR-RFLP analysis of chitinase genes enables efficient genotyping of Metarhizium anisopliae var. anisopliae.

    Science.gov (United States)

    Enkerli, Jürg; Ghormade, Vandana; Oulevey, Catherine; Widmer, Franco

    2009-10-01

    A new genotyping tool has been developed and evaluated for Metarhizium anisopliae var. anisopliae. The tool is based on Restriction Fragment Length Polymorphism (RFLP) analysis of three chitinase genes that are functionally linked to insect-pathogenicity of this fungus. It allowed for discrimination of 14 genotypes among 22 M. anisopliae var. anisopliae strains of a world wide collection. Analyses revealed that the approach may also be applicable to other Metarhizium varieties. The new tool will be useful for genetic characterization of M. anisopliae var. anisopliae strains, and it is applicable for laboratories with limited access to molecular diagnostic equipment.

  19. Evaluation of Pathogenicity of the Fungi Metarhizium anisopliae and Beauveria bassiana in Hazelnut Weevil (Curculio nucum L., Coleoptera, Curculionidae) Larvae.

    Science.gov (United States)

    Cheng, Yunqing; Liu, Ting; Zhao, Yixin; Geng, Wanting; Chen, Longtao; Liu, Jianfeng

    2016-12-01

    The nut weevil (Curculio nucum) is one of the most important and widespread pests in hazelnut orchards. In order to screen entomopathogenic fungal strains with high virulence against C. nucum, the growth rate, sporulation, and cumulative mortality of different Metarhizium anisopliae and Beauveria bassiana strains were investigated, and the process by which M. anisopliae CoM 02 infects C. nucum larvae was observed using scanning electron microscopy. The results indicated that the growth rate and sporulation of different fungal strains significantly differed. Thirteen days after inoculation with M. anisopliae CoM 02, the cumulative mortality of C. nucum larvae reached 100 %, which was considerably higher than that of the other five strains. As the most virulent of the six test strains, the cadaver rate, LT50, and LT90 of M. anisopliae CoM 02 were 93.4 %, 7.05 and 11.90 days, respectively. Analysis of the infection process by scanning electron microscopy showed that the spore attachment, hyphal germination, hyphal rapid growth, and sporulation of M. anisopliae CoM 02 occurred on the 3rd, 5th, 7th, and 11th day after inoculation, respectively, indicating that the infection cycle takes approximately 11 days. This finding suggests that the highly virulent M. anisopliae plays an important role in the biocontrol of C. nucum in China.

  20. Unveiling chemical defense in the rice stalk stink bug against the entomopathogenic fungus Metarhizium anisopliae.

    Science.gov (United States)

    da Silva, Rodrigo Alves; Quintela, Eliane Dias; Mascarin, Gabriel Moura; Pedrini, Nicolás; Lião, Luciano Moraes; Ferri, Pedro Henrique

    2015-05-01

    Eggs, nymphs (1st-5th instar) and adults of Tibraca limbativentris were challenged by conidial suspensions of its major fungal pathogen Metarhizium anisopliae in order to assess their susceptibility. The role of chemical defensive compounds from exocrine secretions produced by both nymphs and adults were examined for their participation on M. anisopliae infection. Although insect susceptibility to M. anisopliae followed a dose-dependent manner, adults followed by older nymphs displayed the highest resistance. Eggs were highly susceptible showing >96% fungal infection. Crude extracts isolated from metathoracic scent gland and dorsal abdominal glands of adults and nymphs, respectively, showed fungistatic effects by impairing spore germination, vegetative growth and sporulation. Gas chromatography-mass spectrometry analysis of these extracts revealed that the major components were short-chain hydrocarbons (C10-13) and unsaturated aldehydes. In vitro tests with the corresponding synthetic standards indicated compounds with greater antifungal activity including (E)-2-hexenal, (E)-2-octenal, and (E)-2-decenal, with the latter being the most deleterious to fungal fitness. We demonstrated that differential susceptibility of the rice stalk stink bug to M. anisopliae infection is age-specific and partly mediated by fungistatic properties of aldehydes, which are produced by scent glands of both nymphs and adults.

  1. A Quick Method for Metarhizium anisopliae Isolation from Cultural Soils

    Directory of Open Access Journals (Sweden)

    M. A. Tajick Ghanbary

    2009-01-01

    Full Text Available Problem statement: Fungi are one of the most active members in biological community of cultural soils. Many saprophyte and facultative parasitic fungi live in soil. Metarhizium anisopliae, one of the most famous soil inhabitant entomopathogens has a virulence potential on plant and animal pests. Approach: Introducing a new method for its isolation from soil was an applied method to find it without any limitation. Metarhizium anisopliae shifts to saprophytic phase and remain alive within soil in absence of susceptible host. As a shortcut, we can transfer the fungus from soil to lab by culturing soil suspension. One hundred cultural soil samples from different regions of Iran were tested to finding Metarhizium isolates. Culturing 1:5000-1:10000 soil suspension on artificial medium containing necessary macro and micronutrients for fungal growth were resulted in isolation. Metarhizium anisopliae isolates were harvested seven days after culturing the suspensions. All isolates were inoculated in 50 mL PDB in destruxin production assay and 7 days later broth medium was filtrated by using filter paper. Culture filtrates were extracted and in bioassays they were sprayed on larva of citrus leaf miner. Results: Nine isolates of Metarhizium anisopliae were harvested. Microscopic studies showed that morphological features had complete coincidence with valid descriptions of the fungus. Bioassay confirmed that all harvested isolates secrete active and effective destruxin in broth. Conclusion: Isolation of Metarhizium by culturing the soil suspension, a useful method for more studies of the entomopathogen at different geographical regions. Native populations of this fungus had special importance in local biological control programs. This procedure was a costs- and time-effective method for pathogen isolation.

  2. Metarhizium anisopliae pathogenesis of mosquito larvae: a verdict of accidental death.

    Science.gov (United States)

    Butt, Tariq M; Greenfield, Bethany P J; Greig, Carolyn; Maffeis, Thierry G G; Taylor, James W D; Piasecka, Justyna; Dudley, Ed; Abdulla, Ahmed; Dubovskiy, Ivan M; Garrido-Jurado, Inmaculada; Quesada-Moraga, Enrique; Penny, Mark W; Eastwood, Daniel C

    2013-01-01

    Metarhizium anisopliae, a fungal pathogen of terrestrial arthropods, kills the aquatic larvae of Aedes aegypti, the vector of dengue and yellow fever. The fungus kills without adhering to the host cuticle. Ingested conidia also fail to germinate and are expelled in fecal pellets. This study investigates the mechanism by which this fungus adapted to terrestrial hosts kills aquatic mosquito larvae. Genes associated with the M. anisopliae early pathogenic response (proteinases Pr1 and Pr2, and adhesins, Mad1 and Mad2) are upregulated in the presence of larvae, but the established infection process observed in terrestrial hosts does not progress and insecticidal destruxins were not detected. Protease inhibitors reduce larval mortality indicating the importance of proteases in the host interaction. The Ae. aegypti immune response to M. anisopliae appears limited, whilst the oxidative stress response gene encoding for thiol peroxidase is upregulated. Cecropin and Hsp70 genes are downregulated as larval death occurs, and insect mortality appears to be linked to autolysis through caspase activity regulated by Hsp70 and inhibited, in infected larvae, by protease inhibitors. Evidence is presented that a traditional host-pathogen response does not occur as the species have not evolved to interact. M. anisopliae retains pre-formed pathogenic determinants which mediate host mortality, but unlike true aquatic fungal pathogens, does not recognise and colonise the larval host.

  3. Virulence of Entomopathogenic Fungi Metarhizium anisopliae and Paecilomyces fumosoroseus for the Microbial Control of Spodoptera exigua.

    Science.gov (United States)

    Han, Ji Hee; Jin, Byung Rae; Kim, Jeong Jun; Lee, Sang Yeob

    2014-12-01

    The beet armyworm Spodoptera exigua (Lepidoptera: Noctuidae) is difficult to control using chemical insecticides because of the development of insecticide resistance. Several pest control agents are used to control the beet armyworm. Entomopathogenic fungi are one of the candidates for eco-friendly pest control instead of chemical control agents. In this study, among various entomopathogenic fungal strains isolated from soil two isolates were selected as high virulence pathogens against larva of beet armyworm. Control efficacy of fungal conidia was influenced by conidia concentration, temperature, and relative humidity (RH). The isolates Metarhizium anisopliae FT83 showed 100% cumulative mortality against second instar larvae of S. exigua 3 days after treatment at 1 × 10(7) conidia/mL and Paecilomyces fumosoroseus FG340 caused 100% mortality 6 days after treatment at 1 × 10(4) conidia/mL. Both M. anisopliae FT83 and P. fumosoroseus FG340 effectively controlled the moth at 20~30℃. M. anisopliae FT83 was significantly affected mortality by RH: mortality was 86.7% at 85% RH and 13.4% at 45% RH. P. fumosoroseus FG340 showed high mortality as 90% at 45% RH and 100% at 75% RH 6 days after conidia treatments. These results suggest that P. fumosoroseus FG340 and M. anisopliae FT83 have high potential to develop as a biocontrol agent against the beet armyworm.

  4. Infection of Psoroptes mites with the fungus Metarhizium anisopliae.

    Science.gov (United States)

    Brooks, A J; Wall, R

    2001-01-01

    The astigmatid mite, Psoroptes ovis (Hering) (Acari: Psoroptidae), is an obligatory ectoparasite that causes psoroptic mange in a range of domesticated animals, particularly sheep, where the clinical disease is known as sheep scab. A series of laboratory assays were used to assess the use of the fungus, Metarhizium anisopliae (Metchnikoff) (Deuteromycotina: Hyphomycetes) as a biocontrol agent for P. ovis derived from rabbits (syn. P. cuniculi). The immersion of mites in a suspension of conidia of M. anisopliae resulted in the acquisition of fatal infections. The number of mites which developed infections increased significantly with the increasing concentration of the conidial suspension to which they were exposed; 77% of mites developed infections when exposed to the highest concentration used (1 x 10(8) conidia ml(-1)). Controls developed no fungal infections. Mites allowed simply to walk across a surface which had been treated with a suspension of conidia also acquired fungal infections; the number infected was again related to the concentration of conidia present. After contact for 24 h with a surface treated with 1 x 10(8) conidia ml(-1), 73% of the mites became infected. To determine whether dead infected mites could act as sources of infection, infected cadavers were placed in chambers with live uninfected mites. The uninfected mites acquired fatal infections from the cadavers; a higher ratio of infected cadavers to uninfected mites resulted in greater transmission of infection. The time after death of the infected cadaver was also an important factor influencing the number infected, 5-day-old cadavers were the most infective and 18-day-old cadavers the least infective. The results indicate that M. anisopliae is a good candidate control agent for Psoroptes mites.

  5. Potential capacity of Beauveria bassiana and Metarhizium anisopliae in the biosorption of Cd2+ and Pb2+.

    Science.gov (United States)

    Hussein, Khalid A; Hassan, Sedky H A; Joo, Jin Ho

    2011-01-01

    In this study Beauveria bassiana and Metarhizium anisopliae were used as inexpensive and efficient biosorbents for Pb(II) and Cd(II) from aqueous metal solutions. The effects of various physicochemical factors on Pb(II) and Cd(II) biosorption by B. bassiana and M. anisopliae were studied. The optimum pH for Cd(II) and Pb(II) biosorption by two fungal species was achieved at pH 6.0 for Pb(II) and 5.0 Cd(II) at a constant time of 30 min. The nature of fungal biomass and metal ion interactions was evaluated by Fourier transform infrared. The maximum adsorption capacities (q(max)) calculated from Langmuir isotherms for Pb(II), and Cd(II) uptake by B. bassiana were 83.33±0.85, and 46.27±0.12 mg/g, respectively. However, the q(max) obtained for Pb(II) uptake by M. anisopliae was 66.66±0.28 mg/g, and 44.22±0.13 mg/g for Cd(II). B. bassiana showed higher adsorption capacity compared to M. anisopliae. The data obtained imply the potential role of B. bassiana and M. anisopliae for heavy metal removal from aqueous solutions.

  6. Cover crop and conidia delivery system impacts on soil persistence of Metarhizium anisopliae (Hypocreales:Clavicipitaceae) in sugarbeet

    Science.gov (United States)

    The sugarbeet root maggot, Tetanops myopaeformis (Röder), is a major North American pest of sugarbeet, Beta vulgaris L. Previous research suggests moderate field efficacy of the fungal entomopathogen Metarhizium anisopliae (Metch.) Sorok. against T. myopaeformis larvae. We conducted three-years of f...

  7. Bioreactor and substrate selection for solid-state cultivation of the malaria mosquito control agent Metarhizium anisopliae

    NARCIS (Netherlands)

    Breukelen, van F.R.; Haemers, S.; Wijffels, R.H.; Rinzema, A.

    2011-01-01

    Metarhizium anisopliae spores are a promising alternative to chemical insecticides against malaria mosquitoes. In-house application resulting in infection of mosquitoes with the fungus can strongly contribute to reducing malaria transmission. For such application, fungal spores need to be produced i

  8. Behavioral and electrophysiological responses of Coptotermes formosanus Shiraki towards entomopathogenic fungal volatiles

    Science.gov (United States)

    Termites adjust their response to entomopathogenic fungi according to the profile of the fungal volatile organic compounds (VOCs). This study first demonstrated the pathogenicity of Metarhizium anisopliae, Beauveria bassiana and Isaria fumosorosea (=Paecilomyces fumosoroseus) towards the Formosan s...

  9. Differential expression of genes involved in entomopathogenicity of the fungi Metarhizium anisopliae var. anisopliae and M. anisopliae var. acridum (Clavicipitaceae).

    Science.gov (United States)

    Carneiro-Leão, M P; Andreote, F D; Araújo, W L; Oliveira, N T

    2011-05-03

    Expression analysis of the genes involved in germination, conidiogenisis and pathogenesis of Metarhizium anisopliae during its saprophytic and pathogenic life stages can help plan strategies to increase its efficacy as a biological control agent. We quantified relative expression levels of the nitrogen response regulator gene (nrr1) and a G-protein regulator of genes involved in conidiogenesis (cag8), using an RT-qPCR assay. Comparisons were made between M. anisopliae var. anisopliae and M. anisopliae var. acridum during germination and conidiogenesis and at different stages of pathogenesis. The cag8 gene was repressed during germination and induced during conidial development and the pathogenic phase, and the nrr1 gene was induced during germination, conidiogenesis and the pathogenic phase. Both genes were more expressed in M. anisopliae var. anisopliae, demonstrating that different varieties of M. anisopliae differ in activation of genes linked to virulence for certain environments and hosts. This suggests that differences among these varieties in the ability to adapt could be attributed not only to specific genomic regions and genes, but also to differential gene expression in this fungus, modulating its ability to respond to environmental stimuli.

  10. Potential nontarget effects of Metarhizium anisopliae (Deuteromycetes) used for biological control of ticks (Acari: Ixodidae)

    Science.gov (United States)

    Ginsberg, Howard S.; LeBrun, Roger A.; Heyer, Klaus; Zhioua, Elyes

    2002-01-01

    The potential for nontarget effects of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin, when used for biological control of ticks, was assessed in laboratory trials. Fungal pathogenicity was studied against convergent ladybird beetles, Hippodamia convergens Guérin-Méneville, house crickets, Acheta domesticus (L.), and the milkweed bugs Oncopeltus fasciatus (Dallas). Fungal spores applied with a spray tower produced significant mortality in H. convergens and A. domesticus, but effects on O. fasciatus were marginal. Placing treated insects with untreated individuals resulted in mortality from horizontal transmission to untreated beetles and crickets, but not milkweed bugs. Spread of fungal infection in the beetles resulted in mortality on days 4–10 after treatment, while in crickets mortality was on day 2 after treatment, suggesting different levels of pathogenicity and possibly different modes of transmission. Therefore, M. anisopliae varies in pathogenicity to different insects. Inundative applications can potentially affect nontarget species, but M. anisopliae is already widely distributed in North America, so applications for tick control generally would not introduce a novel pathogen into the environment. Pathogenicity in lab trials does not, by itself, demonstrate activity under natural conditions, so field trials are needed to confirm these results and to assess methods to minimize nontarget exposure.

  11. Horizontal Transmission of Beauveria bassiana (Hypocreales: Cordycipitaceae) and Metarhizium anisopliae (Hypocreales: Clavicipitaceae) in Musca domestica (Diptera: Muscidae).

    Science.gov (United States)

    Cárcamo, M C; Felchicher, F; Duarte, J P; Bernardi, E; Ribeiro, P B

    2015-08-01

    Beauveria bassiana Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin are fungi with potential for controlling Musca domestica L. However, the impact on this dipteral may vary depending on the fungal isolates and the methodology used. This study evaluated the pathogenicity of direct application and horizontal transmission of B. bassiana (CG240) and M. anisopliae (CG34) on adult M. domestica individuals. The impact of B. bassiana and M. anisopliae on M. domestica was evaluated at the concentrations 2 × 10(4), 2 × 10(5), 2 × 10(6), and 2 × 10(7) conidia/ml. Horizontal transmission was also estimated between sexes at different infection periods of the vector insect. The mortality of adult M. domestica individuals directly infected with B. bassiana was above 90%, and the mortality of those infected with M. anisopliae ranged from 25.50 to 97.78%. Horizontal transmission of B. bassiana caused the death of 100% of individuals, in turn, that of M. anisopliae killed 55% of male and 100% of female individuals. Horizontal transmission of fungi was negatively influenced by time. This study shows the potential of these fungi for controlling M. domestica, both with the direct implementation strategy and horizontal transmission. However, field studies are needed to evaluate the capacity to decrease the M. domestica population using these alternatives.

  12. EFEITO FUNGITÓXICO DO ÓLEO DE NIM SOBRE Metarhizium anisopliae var. acridum e Metarhizium anisopliae var. anisopliae

    Directory of Open Access Journals (Sweden)

    Álison Bruno da Silva Santos

    2009-01-01

    Full Text Available Plague control is based almost exclusively on application of chemical substances, however these products are toxic to men and animals and cause odd effects on environment quality. In Plague Integrated Management (PIM, the use of selected insecticides and entomopathogenic fungi should be considered as one viable strategy for plague control in agriculture. This work aimed to evaluate, in laboratory, the compatibility of the entomopathogenic fungi Metarhizium anisopliae var. acridum and Metarhizium anisopliae var. anisopliae with the oil of Nim. The addition of the product was made to the potato-dextrose-agar medium still liquid (±45°C, in a way that the final concentration obeyed 50% of the producer's recommendation. After fungi inoculation, the dishes were incubated in a cimatized room at 28°C, photophase of 12 hours and relative humidity of 75±5% for 12 day period. The number of conidia per colonie was counted with a Neubauer chamber. Statistic delineament was entirely in random, with two treatments (PDA with insecticide, and a control group (PDA without insecticide, and 9 repetitions for each treatment. The results showed that the insecticide inhibited conidial production in Metarhizium anisopliae var. anisopliae strains when compared to the control group. The diameter of Metarhizium anisopliae var. acridum colonies suffered significative reduction in its size, compared to control. The tested insecticide, in the concentration and formulation used, presented compatibility with the tested strains.

  13. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    Science.gov (United States)

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  14. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    Science.gov (United States)

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  15. Genome sequencing and comparative transcriptomics of the model entomopathogenic fungi Metarhizium anisopliae and M. acridum.

    Science.gov (United States)

    Gao, Qiang; Jin, Kai; Ying, Sheng-Hua; Zhang, Yongjun; Xiao, Guohua; Shang, Yanfang; Duan, Zhibing; Hu, Xiao; Xie, Xue-Qin; Zhou, Gang; Peng, Guoxiong; Luo, Zhibing; Huang, Wei; Wang, Bing; Fang, Weiguo; Wang, Sibao; Zhong, Yi; Ma, Li-Jun; St Leger, Raymond J; Zhao, Guo-Ping; Pei, Yan; Feng, Ming-Guang; Xia, Yuxian; Wang, Chengshu

    2011-01-06

    Metarhizium spp. are being used as environmentally friendly alternatives to chemical insecticides, as model systems for studying insect-fungus interactions, and as a resource of genes for biotechnology. We present a comparative analysis of the genome sequences of the broad-spectrum insect pathogen Metarhizium anisopliae and the acridid-specific M. acridum. Whole-genome analyses indicate that the genome structures of these two species are highly syntenic and suggest that the genus Metarhizium evolved from plant endophytes or pathogens. Both M. anisopliae and M. acridum have a strikingly larger proportion of genes encoding secreted proteins than other fungi, while ~30% of these have no functionally characterized homologs, suggesting hitherto unsuspected interactions between fungal pathogens and insects. The analysis of transposase genes provided evidence of repeat-induced point mutations occurring in M. acridum but not in M. anisopliae. With the help of pathogen-host interaction gene database, ~16% of Metarhizium genes were identified that are similar to experimentally verified genes involved in pathogenicity in other fungi, particularly plant pathogens. However, relative to M. acridum, M. anisopliae has evolved with many expanded gene families of proteases, chitinases, cytochrome P450s, polyketide synthases, and nonribosomal peptide synthetases for cuticle-degradation, detoxification, and toxin biosynthesis that may facilitate its ability to adapt to heterogeneous environments. Transcriptional analysis of both fungi during early infection processes provided further insights into the genes and pathways involved in infectivity and specificity. Of particular note, M. acridum transcribed distinct G-protein coupled receptors on cuticles from locusts (the natural hosts) and cockroaches, whereas M. anisopliae transcribed the same receptor on both hosts. This study will facilitate the identification of virulence genes and the development of improved biocontrol strains with

  16. Differential susceptibility of adults and nymphs of Blattella germanica (L.) (Blattodea: Blattellidae) to infection by Metarhizium anisopliae and assessment of delivery strategies.

    Science.gov (United States)

    Lopes, R B; Alves, S B

    2011-01-01

    Microbial insecticides for cockroach control, such as those containing entomopathogenic fungi, may be an alternative to reduce contamination by chemicals in housing and food storage environments. Virulence of isolate ESALQ1037 belonging to the Metarhizium anisopliae complex against nymphs and adults of Blattella germanica (L.), and its infectivity following exposure of insects to a contaminated surface or to M. anisopliae-bait were determined under laboratory conditions. Estimated LD50 15 d following topical inoculation was 2.69 x 10(5) conidia per adult, whereas for nymphs the maximum mortality was lower than 50%. Baits amended with M. anisopliae conidia had no repellent effect on targets; adult mortality was inferior to 25%, and nymphs were not susceptible. All conidia found in the digestive tract of M. anisopliae-bait fed cockroaches were unviable, and bait-treated insects that succumbed to fungal infection showed a typical mycelial growth on mouthparts and front legs, but not on the hind body parts. As opposed to baits, the use of a M. anisopliae powdery formulation for surface treatment was effective in attaining high mortality rates of B. germanica. Both nymphs and adults were infected when this delivery strategy was used, and mycelia growth occurred all over the body surface. Our results suggest that the development of powders or similar formulations of M. anisopliae to control B. germanica may provide faster and better results than some of the strategies based on baits currently available.

  17. Differential susceptibility of adults and nymphs of Blattella germanica (L.) (Blattodea: Blattellidae) to infection by Metarhizium anisopliae and assessment of delivery strategies

    Energy Technology Data Exchange (ETDEWEB)

    Lopes, R.B., E-mail: rblopes@cenargen.embrapa.b [EMBRAPA Recursos Geneticos e Biotecnologia, Brasilia, DF (Brazil); Alves, S.B. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia e Acarologia

    2011-05-15

    Microbial insecticides for cockroach control, such as those containing entomopathogenic fungi, may be an alternative to reduce contamination by chemicals in housing and food storage environments. Virulence of isolate ESALQ1037 belonging to the Metarhizium anisopliae complex against nymphs and adults of Blattella germanica (L.), and its infectivity following exposure of insects to a contaminated surface or to M. anisopliae-bait were determined under laboratory conditions. Estimated LD50 15 d following topical inoculation was 2.69 x 105 conidia per adult, whereas for nymphs the maximum mortality was lower than 50%. Baits amended with M. anisopliae conidia had no repellent effect on targets; adult mortality was inferior to 25%, and nymphs were not susceptible. All conidia found in the digestive tract of M. anisopliae-bait fed cockroaches were unviable, and bait-treated insects that succumbed to fungal infection showed a typical mycelial growth on mouthparts and front legs, but not on the hind body parts. As opposed to baits, the use of a M. anisopliae powdery formulation for surface treatment was effective in attaining high mortality rates of B. germanica. Both nymphs and adults were infected when this delivery strategy was used, and mycelia growth occurred all over the body surface. Our results suggest that the development of powders or similar formulations of M. anisopliae to control B. germanica may provide faster and better results than some of the strategies based on baits currently available. (author)

  18. Enzymatic activities and effects of mycovirus infection on the virulence of Metarhizium anisopliae in Rhipicephalus microplus.

    Science.gov (United States)

    Perinotto, Wendell M S; Golo, Patricia S; Coutinho Rodrigues, Caio J B; Sá, Fillipe A; Santi, Lucélia; Beys da Silva, Walter O; Junges, Angela; Vainstein, Marilene H; Schrank, Augusto; Salles, Cristiane M C; Bittencourt, Vânia R E P

    2014-06-16

    The present study aimed to evaluate the pathogenic potential of different Metarhizium anisopliae s.l. isolates and to determine whether differences in enzymatic activities of proteases, lipases and chitinases and infection with mycoviruses affect the control of Rhipicephalus microplus achieved by these fungal isolates. Engorged female ticks were exposed to fungal suspensions. The lipolytic and proteolytic activities in the isolates were evaluated using chromogenic substrates and the chitinolytic activity was determined using fluorescent substrates. A gel zymography was performed to determine the approximate size of serine proteases released by M. anisopliae isolates. To detect mycoviral infections, dsRNA was digested using both RNAse A and S1 endonuclease; samples were analyzed on an agarose gel. Four of the five isolates tested were infected with mycovirus; however, the level of control of R. microplus ticks achieved with the only isolate free of infection (isolate CG 347) was low. This finding suggests that mycoviral infection does not affect the virulence of fungi against ticks. Although all five isolates were considered pathogenic to R. microplus, the best tick control and the highest levels of enzymatic activity were achieved with the isolates CG 629 and CG 148. The in vitro activities of lipases, proteases and chitinases produced by M. anisopliae s.l. differed among isolates and may be related to their virulence.

  19. Biological insect control using Metarhizium anisopliae: morphological, molecular, and ecological aspects

    Directory of Open Access Journals (Sweden)

    Patricia Vieira Tiago

    2014-04-01

    Full Text Available Microbial control of insects is based on the rational use of pathogens to maintain environmentally balanced pest population levels, and Metarhizium anisopliae has been the most studied and most utilized fungal species for that purpose. The natural genetic variability of entomopathogenic fungi is considered one of the principal advantages of microbial insect control. The inter- and intraspecific variability and the genetic diversity and population structures of Metarhizium and other entomopathogenic fungi have been examined using ITS-RFLP, ISSR, and ISSP molecular markers. The persistence of M. anisopliae in the soil and its possible effects on the structures of resident microbial communities must be considered when selecting isolates for biological insect control.

  20. Recombinant Helicobacter pylori catalase

    Institute of Scientific and Technical Information of China (English)

    Yang Bai; Ya-Li Zhang; Jian-Feng Jin; Ji-De Wang; Zhao-Shan Zhang

    2003-01-01

    AIM: To construct a recombinant strain which highly expresses catalase of Helicobacter pylori(H.pylori) and assay the activity of H. pylori catalase.METHODS: The catalase DNA was amplified from H. pylori chromosomal DNA with PCR techniques and inserted into the prokaryotie expression vector pET-22b (+), and then was transformed into the BL21 (DE3) E. coli strain which expressed catalase recombinant protein. The activity of H.pylori catalase was assayed by the Beers & Sizers.RESULTS: DNA sequence analysis showed that the sequence of catalase DNA was the same as GenBank's research. The catalase recombinant protein amounted to 24.4 % of the total bacterial protein after induced with IPTG for 3 hours at 37 ℃ and the activity of H. pylori catalase was high in the BL21 (DE3) E. coli strain.CONCLUSION: A clone expressing high activity H. pylori catalase is obtained, laying a good foundation for further studies.

  1. Inhibition of the entomopathogenic fungus Metarhizium anisopliae in vitro by the bed bug defensive secretions (E)-2-hexenal and (E)-2-octenal

    Science.gov (United States)

    The two major aldehydes (E)-2-hexenal and (E)-2-octenal emitted as defensive secretions by bed bugs Cimex lectularius L. (Hemiptera: Cimicidae), inhibit the in vitro growth of Metarhizium anisopliae (Metsch.) Sokorin (Hypocreales: Clavicipitaceae). These chemicals inhibit fungal growth by direct con...

  2. Use of Metarhizium anisopliae chitinase genes for genotyping and virulence characterization.

    Science.gov (United States)

    Niassy, Saliou; Subramanian, Sevgan; Ekesi, Sunday; Bargul, Joel L; Villinger, Jandouwe; Maniania, Nguya K

    2013-01-01

    Virulence is the primary factor used for selection of entomopathogenic fungi (EPF) for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative "in vitro" chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates.

  3. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization

    Directory of Open Access Journals (Sweden)

    Saliou Niassy

    2013-01-01

    Full Text Available Virulence is the primary factor used for selection of entomopathogenic fungi (EPF for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates.

  4. Selection of Beauveria bassiana and Metarhizium anisopliae Isolates to Control Triatoma infestans

    Directory of Open Access Journals (Sweden)

    Luz Christian

    1998-01-01

    Full Text Available Twenty three isolates of Beauveria bassiana and 13 isolates of Metarhizium anisopliae were tested on third instar nymphs of Triatoma infestans, a serious vector of Chagas disease. Pathogenicity tests at saturated humidity showed that this insect is very susceptible to fungal infection. At lower relative humidity (50%, conditions expected in the vector microhabitat, virulence was significantly different among isolates. Cumulative mortality 15 days after treatment varied from 17.5 to 97.5%, and estimates of 50% survival time varied from 6 to 11 days. Maintaining lower relative humidity, four B. bassiana and two M. anisopliae isolates were selected for analysis of virulence at different conidial concentrations and temperatures. Lethal concentrations sufficient to kill 50% of insects (LC50 varied from 7.1x105 to 4.3x106 conidia/ml, for a B. bassiana isolate (CG 14 and a M. anisopliae isolate (CG 491 respectively. Most isolates, particularly B. bassiana isolates CG 24 and CG 306, proved to be more virulent at 25 and 30°C, compared to 15 and 20°C. The differential virulence at 50% humidity observed among some B. bassiana isolates was not correlated to phenetic groups in cluster analysis of RAPD markers. In fact, the B. bassiana isolates analyzed presented a high homogeneity (> 73% similarity.

  5. Effects of Metarhizium anisopliae conidia mixed with soil against the eggs of Aedes aegypti.

    Science.gov (United States)

    Leles, Renan Nunes; D'Alessandro, Walmirton Bezerra; Luz, Christian

    2012-04-01

    The effectiveness of Metarhizium anisopliae IP 46 conidia mixed with soil was tested against Aedes aegypti eggs. Mycelium and new conidia developed first on eggs between 4.8 and 15 days respectively after incubation of fungus-treated soils at 3.3 × 10(3) up to 3.3 × 10(5) conidia/g soil at 25°C and relative humidities close to saturation. After 15-day incubation, 53.3% of the eggs exposed to soil with 3.3 × 10(5) conidia/g showed external development of mycelium and conidia. Fungus-inoculated soils (but not untreated controls) showed some mycelial growth and sporulation apart from the eggs. Some eggs on treated soils hatched; those larvae died and eventually showed fungal development on their bodies. The cumulative relative eclosion of larvae after submersion of treated eggs in water decreased from 52.2% at 3.3 × 10(3) conidia/g to 25.3% at 3.3 × 10(5) conidia/g. These findings clearly showed that A. aegypti eggs can be infected by M. anisopliae when deposited on fungus-contaminated soil. The effectiveness of M. anisopliae against gravid females, larvae, and also eggs of A. aegypti underscored the possible usefulness of this fungus as a mycoinsecticide, whether naturally occurring or artificially applied, in the breeding sites of this mosquito.

  6. Biological control of Ixodes ricinus larvae and nymphs with Metarhizium anisopliae blastospores.

    Science.gov (United States)

    Wassermann, Marion; Selzer, Philipp; Steidle, Johannes L M; Mackenstedt, Ute

    2016-07-01

    The entomopathogenic fungus Metarhizium anisopliae is used as a biological pest control agent against various arthropod species, including ticks. However, the efficacy depends on tick species, tick stage and fungus strain. We studied the effect of M. anisopliae on engorged larvae and nymphs of Ixodes ricinus, the most abundant tick species in Europe, under laboratory and semi-field conditions. A significant reduction of engorged larvae and nymphs could be shown under laboratory as well as under semi-field conditions. Only 3.5% of the larvae treated in the lab and only 18.5% kept under semi-field conditions were able to develop into nymphs compared to the recovered nymphs of the control groups, which were regarded as 100%. Only 7.1% of nymphs were recovered as adult ticks after fungal treatment under semi-field conditions compared to the control (100%). The efficacy of blastospores of M. anisopliae against engorged larvae and nymphs of I. ricinus under semi-field conditions was demonstrated in this study, showing their high potential as a biological control agent of ticks. Further studies will have to investigate the effect of this agent against other stages of I. ricinus as well as other tick species before its value as a biological control agent against ticks can be fully assessed.

  7. Comparative analysis of the Metarhizium anisopliae secretome in response to exposure to the greyback cane grub and grub cuticles.

    Science.gov (United States)

    Manalil, Nirupama Shoby; Junior Téo, V S; Braithwaite, K; Brumbley, S; Samson, P; Helena Nevalainen, K M

    2010-08-01

    Metarhizium anisopliae is a well-characterized biocontrol agent of a wide range of insects including cane grubs. In this study, a two-dimensional (2D) electrophoresis was used to display secreted proteins of M. anisopliae strain FI-1045 growing on the whole greyback cane grubs and their isolated cuticles. Hydrolytic enzymes secreted by M. anisopliae play a key role in insect cuticle-degradation and initiation of the infection process. We have identified all the 101 protein spots displayed by cross-species identification (CSI) from the fungal kingdom. Among the identified proteins were 64-kDa serine carboxypeptidase, 1,3 beta-exoglucanase, Dynamin GTPase, THZ kinase, calcineurin like phosphoesterase, and phosphatidylinositol kinase secreted by M. ansiopliae (FI-1045) in response to exposure to the greyback cane grubs and their isolated cuticles. These proteins have not been previously identified from the culture supernatant of M. anisopliae during infection. To our knowledge, this the first proteomic map established to study the extracellular proteins secreted by M. ansiopliae (FI-1045) during infection of greyback cane grubs and its cuticles.

  8. Genome-assisted development of nuclear intergenic sequence markers for entomopathogenic fungi of the Metarhizium anisopliae species complex.

    Science.gov (United States)

    Kepler, R M; Rehner, S A

    2013-03-01

    Entomopathogenic fungi in the genus Metarhizium are useful for biological control programmes against economically important arthropod pests worldwide. However, understanding the true diversity and ecology of these organisms is hampered by convergent morphologies between species. The application of molecular techniques has enabled greater resolution of species than allowed by morphology alone. In particular, the commonly used biocontrol agent M. anisopliae was found to be a species complex composed of nine species. This prior work was conducted with commonly used markers in fungal phylogenetics (BTUB, RPB1, RPB2 and TEF), which likely under-represent diversity in the M. anisopliae complex. Using sequence data from nuclear genomes of M. acridum and M. robertsii we identified regions of conserved gene synteny and developed primers to amplify intergenic regions of seven loci. Using ex-type and authenticated tissue specimens for species in the M. anisopliae complex, we demonstrate that sequence data derived from intergenic loci is more variable and phylogenetically informative than previously available markers. These new markers will facilitate investigations at or below the species level for the M. anisopliae complex. The method of marker development employed here should be extendable to any group with sufficiently divergent genome data available.

  9. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae

    Directory of Open Access Journals (Sweden)

    Takken Willem

    2011-02-01

    Full Text Available Abstract Background The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of application as well as reducing their sensitivity to UV radiation, high temperatures and the inevitable contact with water. This study was conducted to develop formulations that facilitate the application of Metarhizium anisopliae and Beauveria bassiana spores for the control of anopheline larvae, and also improve their persistence under field conditions. Methods Laboratory bioassays were conducted to test the ability of aqueous (0.1% Tween 80, dry (organic and inorganic and oil (mineral and synthetic formulations to facilitate the spread of fungal spores over the water surface and improve the efficacy of formulated spores against anopheline larvae as well as improve spore survival after application. Field bioassays were then carried out to test the efficacy of the most promising formulation under field conditions in western Kenya. Results When formulated in a synthetic oil (ShellSol T, fungal spores of both Metarhizium anisopliae and Beauveria bassiana were easy to mix and apply to the water surface. This formulation was more effective against anopheline larvae than 0.1% Tween 80, dry powders or mineral oil formulations. ShellSol T also improved the persistence of fungal spores after application to the water. Under field conditions in Kenya, the percentage pupation of An. gambiae was significantly reduced by 39 - 50% by the ShellSol T-formulated Metarhizium anisopliae and Beauveria bassiana spores as compared to the effects of the application of unformulated spores. Conclusions ShellSol T is an effective carrier for fungal spores when targeting anopheline larvae under both laboratory and field conditions. Entomopathogenic fungi formulated with

  10. Bentonite-supported catalase

    Directory of Open Access Journals (Sweden)

    H. CEYLAN

    2005-05-01

    Full Text Available The properties of the clay bentonite as a support for enzyme immobilization were studied using the enzyme catalase. Such an immobilization does not result in enzyme inactivation and constitutes a valuable method for immobilizing catalase at high ionic strength. The bentonite-supported catalase was characterized in terms of pH and ionic strength dependencies, thermal and storage stability and kinetic parameters. These studies indicate that bentonite is a valuable support for the simple adsorption of enzymes.

  11. Genomic analyses and transcriptional profiles of the glycoside hydrolase family 18 genes of the entomopathogenic fungus Metarhizium anisopliae.

    Science.gov (United States)

    Junges, Ângela; Boldo, Juliano Tomazzoni; Souza, Bárbara Kunzler; Guedes, Rafael Lucas Muniz; Sbaraini, Nicolau; Kmetzsch, Lívia; Thompson, Claudia Elizabeth; Staats, Charley Christian; de Almeida, Luis Gonzaga Paula; de Vasconcelos, Ana Tereza Ribeiro; Vainstein, Marilene Henning; Schrank, Augusto

    2014-01-01

    Fungal chitin metabolism involves diverse processes such as metabolically active cell wall maintenance, basic nutrition, and different aspects of virulence. Chitinases are enzymes belonging to the glycoside hydrolase family 18 (GH18) and 19 (GH19) and are responsible for the hydrolysis of β-1,4-linkages in chitin. This linear homopolymer of N-acetyl-β-D-glucosamine is an essential constituent of fungal cell walls and arthropod exoskeletons. Several chitinases have been directly implicated in structural, morphogenetic, autolytic and nutritional activities of fungal cells. In the entomopathogen Metarhizium anisopliae, chitinases are also involved in virulence. Filamentous fungi genomes exhibit a higher number of chitinase-coding genes than bacteria or yeasts. The survey performed in the M. anisopliae genome has successfully identified 24 genes belonging to glycoside hydrolase family 18, including three previously experimentally determined chitinase-coding genes named chit1, chi2 and chi3. These putative chitinases were classified based on domain organization and phylogenetic analysis into the previously described A, B and C chitinase subgroups, and into a new subgroup D. Moreover, three GH18 proteins could be classified as putative endo-N-acetyl-β-D-glucosaminidases, enzymes that are associated with deglycosylation and were therefore assigned to a new subgroup E. The transcriptional profile of the GH18 genes was evaluated by qPCR with RNA extracted from eight culture conditions, representing different stages of development or different nutritional states. The transcripts from the GH18 genes were detected in at least one of the different M. anisopliae developmental stages, thus validating the proposed genes. Moreover, not all members from the same chitinase subgroup presented equal patterns of transcript expression under the eight distinct conditions studied. The determination of M. anisopliae chitinases and ENGases and a more detailed study concerning the enzymes

  12. Genomic analyses and transcriptional profiles of the glycoside hydrolase family 18 genes of the entomopathogenic fungus Metarhizium anisopliae.

    Directory of Open Access Journals (Sweden)

    Ângela Junges

    Full Text Available Fungal chitin metabolism involves diverse processes such as metabolically active cell wall maintenance, basic nutrition, and different aspects of virulence. Chitinases are enzymes belonging to the glycoside hydrolase family 18 (GH18 and 19 (GH19 and are responsible for the hydrolysis of β-1,4-linkages in chitin. This linear homopolymer of N-acetyl-β-D-glucosamine is an essential constituent of fungal cell walls and arthropod exoskeletons. Several chitinases have been directly implicated in structural, morphogenetic, autolytic and nutritional activities of fungal cells. In the entomopathogen Metarhizium anisopliae, chitinases are also involved in virulence. Filamentous fungi genomes exhibit a higher number of chitinase-coding genes than bacteria or yeasts. The survey performed in the M. anisopliae genome has successfully identified 24 genes belonging to glycoside hydrolase family 18, including three previously experimentally determined chitinase-coding genes named chit1, chi2 and chi3. These putative chitinases were classified based on domain organization and phylogenetic analysis into the previously described A, B and C chitinase subgroups, and into a new subgroup D. Moreover, three GH18 proteins could be classified as putative endo-N-acetyl-β-D-glucosaminidases, enzymes that are associated with deglycosylation and were therefore assigned to a new subgroup E. The transcriptional profile of the GH18 genes was evaluated by qPCR with RNA extracted from eight culture conditions, representing different stages of development or different nutritional states. The transcripts from the GH18 genes were detected in at least one of the different M. anisopliae developmental stages, thus validating the proposed genes. Moreover, not all members from the same chitinase subgroup presented equal patterns of transcript expression under the eight distinct conditions studied. The determination of M. anisopliae chitinases and ENGases and a more detailed study

  13. Trehalose and trehalose-hydrolyzing enzyme in the haemolymph of Locusta migratoria infected with Metarhizium anisopliae strain CQMa102

    Institute of Scientific and Technical Information of China (English)

    HUA ZHAO; ZHONG-KANG WANG; YOU-PING YIN; YAN-LING LI; ZHEN-LUN LI; GUO-XIONG PENG; YU-XIAN XIA

    2007-01-01

    Topical application of the Metarhizium anisopliae var. acridum specialist strain CQMa102 to the locust Locusta migratoria man ilensis results in changes of the concentrations of trehalose and glucose in the haemolymph. Micrographs of the locust haemolymph shows Metarhizium anisopliae can effectivly penetrate the external skeleton of locust and after 2 days infection, the hyphae body will appear in the haemolymph of infected insects. The time in decrease of trehalose concentration coincided with that in increase of trehalose-hydrolysing enzyme activity in the haemolymph of the fungus-infected insects. Overlay gel analysis indicated there was considerably more trehalose-hydrolysing activity in the haemolymph of locusts infected by fungus than in controls. A comparable isoform was identified in in vitro culture of the fungus, suggesting a fungal origin for the in vivo enzyme. Haemolymph trehalose decreased significantly during mycosis of locusts by M. anisopliae. All these results suggested that this fungus may take advantage of competing nutrient utilization against the insect by its trehalose-hydrolyzing enzyme secretion. It may provide fundamental knowledge for fungal pathogenesis.

  14. Fitness costs to Helicoverpa armigera after exposure to sub-lethal concentrations of Metarhizium anisopliae sensu lato: Study on F1 generation.

    Science.gov (United States)

    Jarrahi, Azadeh; Safavi, Seyed Ali

    2016-07-01

    The entomopathogenic fungus, Metarhizium anisopliae (Metsch.) Sorokin is a valuable biocontrol agent attacking larval stages of many lepidopteran pests including Helicoverpa armigera (Hübner). Sub-lethal effects of M. anisopliae sensu lato (s.l.) (isolate M14) were investigated on life table parameters of offspring from treated larvae of H. armigera. Duration of different life stages was significantly affected by fungal treatments. Fecundity was decreased in females derived from H. armigera larvae treated with M. anisopliae s.l. Sub-lethal concentrations of the entomopathogen reduced the net reproduction rate (R0) of F1 insects for all treatments compared with the control. Similar reductions were observed for the intrinsic and the finite rates of increase (rm and λ, respectively). The mean generation time (T) and the doubling time (DT) were statistically higher in offspring of individuals exposed to some fungal concentrations than control insects. Our results indicated that there was a significant decrease in the F1 population of H. armigera derived from larvae that were exposed to sub-lethal concentrations of M. anisopliae s.l.

  15. Compatibility of conventional agrochemicals used in rice crops with the entomopathogenic fungus Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Rodrigo Alves da Silva

    2013-06-01

    Full Text Available The toxicological impact of chemical pesticides on fungal entomopathogens and their use in tank-mixing can be directly measured through in vitro compatibility tests. This study reports the in vitro toxicity of eight insecticides, four fungicides and five herbicides in the conidial germination, vegetative growth and conidiation of Metarhizium anisopliae (strain CG 168. A conidial suspension containing the pesticide at recommended field dosage was subjected to constant agitation in a rotary shaker for 3h to simulate a tank mixing. Then, aliquots of each suspension were used to determine conidial germination, vegetative growth and conidiation on potato dextrose agar (PDA. The fungicides difenoconazole (69 mL ha-1, propiconazole (75 mL ha-1, trifloxystrobin (313 g ha-1 and azoxystrobin (56 mL ha-1 were the most harmful products to all biological stages of M. anisopliae and they should not be applied together with this fungus in tank mixing. The insecticides exhibited the least degree of toxicity to this fungal pathogen, whereas the herbicides had the greatest impact on mycelial growth. The agrochemicals compatible with M. anisopliae were the insecticides methyl parathion (240 mL ha-1, thiamethoxam (31 g ha-1, and lambda-cyhalothrin (6.3 mL ha-1 and the herbicides glyphosate (1560 mL ha-1, bentazon (720 mL ha-1, and imazapic+ imazapyr (84 g ha-1. The compatible pesticides could be simultaneously used with this bio-control agent for integrated pest management in rice production systems.

  16. Pathogenicity of three entomopathogenic fungi, Metarhizium anisopliae, Beauveria bassiana, and Paecilomyces lilacinus, to Tetranychus kanzawai infesting papaya seedlings

    Directory of Open Access Journals (Sweden)

    Yayan Sanjaya

    2016-09-01

    Full Text Available Tetranychus kanzawai is an economically important polyphagous mite species in East and South Asia. In the Philippines, it commonly infests cassava and papaya plants. The mites attack and severely damage the older leaves of papaya trees as well as seedlings. Its serious damage causes the leaves to dry up, thus, reducing the photosynthetic activity of the plant. Three entomopathogenic fungal isolates were tested on mites under greenhouse conditions using treated papaya seedlings following a completely randomized design. The mites tested were examined under a dissecting scope to determine the causal agent and to confirm mortality. The LT50 of Metarhizium anisopliae, Beauveria bassiana and Paecilomyces lilacinus on T. kanzawai were estimated. Our results indicate that among these entomopathogenic fungi, the Metarhizium anisopliae Ma6 isolate (LT50= 3.00 days has potentiality for the control of T. kanzawai.

  17. Application of Bait Treated with the Entomopathogenic Fungus Metarhizium anisopliae (Metsch. Sorokin for the Control of Microcerotermes diversus Silv.

    Directory of Open Access Journals (Sweden)

    Amir Cheraghi

    2013-01-01

    Full Text Available Microcerotermes diversus Silvestri (Isoptera, Termitidae is considered to be the most destructive termite in Khuzestan province (Iran, and its control by conventional methods is often difficult. Biological control using entomopathogenic fungi could be an alternative management strategy. Performance of a bait matrix treated with the entomopathogenic fungus Metarhizium anisopliae (Metsch. Sorokin, Strain Saravan (DEMI 001, against M. diversus was evaluated in this paper. The highest rate of mortality occurred at concentrations of 3.7 × 107 and 3.5 × 108 (conidia per mL. There was no significant difference between treatments, in the rate of feeding on the bait. The fungal pathogen was not repellent to the target termite over the conidial concentrations used. The current results suggest potential of such bait system in controlling termite. However the effectiveness of M. anisopliae as a component of integrated pest management for M. diversus still needs to be proven under field conditions.

  18. New insights on the effectiveness of Metarhizium anisopliae formulation and application against Aedes aegypti eggs.

    Science.gov (United States)

    Sousa, N A; Lobo, L S; Rodrigues, J; Luz, C

    2013-09-01

    Increasing needs for innovative control tools against the dengue vector Aedes aegypti have prompted investigations into the development of specific mycoinsecticides. The entomopathogenic fungus Metarhizium anisopliae attacks both larval and adult stages, but its ovicidal activity against A. aegypti is still little explored. This study reports important findings about the effectiveness of conidia formulated in water and oil-in-water emulsions and of direct and indirect application techniques against A. aegypti eggs. The ovicidal activity of M. anisopliae increased with higher conidial concentrations regardless of the application technique, and larvae elimination concentrations were lowest with oil-in-water-formulated conidia (LEC50 ≤ 4·8 × 10(3) conidia cm(-2) and LEC90 ≤ 1·9 × 10(5) conidia cm(-2), respectively). Conidia eventually stimulated larval eclosion. Consequently, the indirect application of oil-based fungal formulations onto substrates where oviposition will later occur appears to be a more efficient means to infect those eggs than the direct fungal application to previously deposited eggs.

  19. EFEITO ANTAGÔNICO DE Trichoderma sp. NO DESENVOLVIMENTO DE Beauveria bassiana (Bals. Vuill. e Metarhizium anisopliae (Metsch. Sorok ANTAGONISTIC EFFECT OF Trichoderma sp. ON THE DEVELOPMENT OF Beauveria bassiana (Bals. Vuill. AND Metarhizium anisopliae (Metsch. SOROK

    Directory of Open Access Journals (Sweden)

    Alcides Moino Jr.

    1999-01-01

    Full Text Available Este trabalho teve por objetivo avaliar o efeito de Trichoderma sp. no desenvolvimento de Beauveria bassiana e Metarhizium anisopliae. Trichoderma sp., B. bassiana (isolado 634 e M. anisopliae (isolado E-9 foram inoculados em meio BDA, com intervalos de 0, 48, 120 e 168 horas entre a inoculação de Trichoderma sp. e dos entomopatógenos. Avaliou-se o crescimento radial das colônias nos períodos de 48 e 120 horas após a inoculação de Trichoderma sp., sendo que este afetou o desenvolvimento dos entomopatógenos quando inoculado simultaneamente ou após 48 horas. B. bassiana e M. anisopliae desenvolveram-se normalmente quando inoculados 168 horas antes de Trichoderma sp.. Também foi avaliado o efeito de um extrato de Trichoderma sp. sobre os entomopatógenos, com a adição de 0,1; 0,5; 1,0 e 5,0 ml de extrato/100,0 ml de meio, onde foram inoculados os entomopatógenos. Foram medidos os diâmetros de colônias e o número de conídios produzidos por B. bassiana e M. anisopliae na presença do extrato. A concentração de 5,0 ml de extrato/100,0 ml de meio alterou o crescimento e a conidiogênese de B. bassiana. O fungo M. anisopliae foi afetado a partir da adição de 1,0 ml de extrato/100,0 ml de meio.The objective of this work was to evaluate the effect of Trichoderma sp. on the development of Beauveria bassiana and Metarhizium anisopliae. The fungus Trichoderma sp. was inoculated on PDA culture medium, 0, 48, 120 and 168 hours after inoculation of the same plates with either B. bassiana (isolate 634 or M. anisopliae (isolate E-9. The radial growth of fungal colonies was measured 48 and 120 hours after Trichoderma sp. inoculation. Trichoderma sp. affected the development of both entomopathogenic fungi when inoculated simultaneously or 48 hours later. B. bassiana and M. anisopliae had normal development when inoculated 168 hours before Trichoderma sp. The effect of a toxic extract from Trichoderma sp. on the entomopathogenic fungi was also

  20. Dissemination of Metarhizium anisopliae of low and high virulence by mating behavior in Aedes aegypti

    Directory of Open Access Journals (Sweden)

    Rodriguez-Perez Mario A

    2011-09-01

    Full Text Available Abstract Background Dengue is a viral disease transmitted by Aedes mosquitoes. It is a threat for public health worldwide and its primary vector Aedes aegypti is becoming resistant to chemical insecticides. These factors have encouraged studies to evaluate entomopathogenic fungi against the vector. Here we evaluated mortality, infection, insemination and fecundity rates in A. aegypti females after infection by autodissemination with two Mexican strains of Metarhizium anisopliae. Methods Two M. anisopliae strains were tested: The Ma-CBG-1 least virulent (lv, and the Ma-CBG-2 highly virulent (hv strain. The lv was tested as non mosquito-passed (NMP, and mosquito-passed (MP, while the hv was examined only as MP version, therefore including the control four treatments were used. In the first bioassay virulence of fungal strains towards female mosquitoes was determined by indirect exposure for 48 hours to conidia-impregnated paper. In the second bioassay autodissemination of fungal conidia from fungus-contaminated males to females was evaluated. Daily mortality allowed computation of survival curves and calculation of the LT50 by the Kaplan-Meier model. All combinations of fungal sporulation and mating insemination across the four treatments were analyzed by χ2. The mean fecundity was analyzed by ANOVA and means contrasted with the Ryan test. Results Indirect exposure to conidia allowed a faster rate of mortality, but exposure to a fungal-contaminated male was also an effective method of infecting female mosquitoes. All females confined with the hv strain-contaminated male died in fifteen days with a LT50 of 7.57 (± 0.45 where the control was 24.82 (± 0.92. For the lv strain, it was possible to increase fungal virulence by passing the strain through mosquitoes. 85% of females exposed to hv-contaminated males became infected and of them just 10% were inseminated; control insemination was 46%. The hv strain reduced fecundity by up to 99%, and the lv

  1. A Field Experiment to Assess the Rate of Infestation in Honey Bee Populations of Two Metarhizium anisopliae Isolates on Varroa destructor (Acari: Mesostigmata.

    Directory of Open Access Journals (Sweden)

    Khodadad Pirali-Kheirabadi

    2013-06-01

    Full Text Available The protective effect of two isolates of an entomopathogenic fungus, Metarhizium anisopliae (DEMI 002 and Iran 437C on the adult stage of Varroa destructor was evaluated in comparison with fluvalinate strips in the field.A total of 12 honey bee colonies were provided from an apiculture farm. The selected hives were divided into 4 groups (3 hives per group. The first group was the control, treated with distilled water. The other two groups were exposed to different fungi (M. anisopliae isolates DEMI 002 and Iran 437C and the last group was treated with one strip of fluvalinate per colony. The number of fallen mites was counted using sticky traps during a 6-day period, six days before and after treatments. A fungal suspension at a concentration of 5× 10(6 conidia/mL was sprayed onto the frames and the number of fallen mites was counted.Metarhizium anisopliae DEMI 002 and Iran 437C isolates were as effective (i.e., caused as much mite fall as the fluvalinate strip in controlling bee colonies than no treatment.Both M. anisopliae isolates are promising candidates as agents in the control of Varroa mites under field conditions. Isolate DEMI 002 can be considered as a possible non-chemical biocontrol agent for controlling bee infestation with V. destructor in the field. In order to substantiate this hypothesis, tests are currently being performed using larger colonies and larger doses than tested in the present study in our beekeeping.

  2. Diatomaceous earth and oil enhance effectiveness of Metarhizium anisopliae against Triatoma infestans.

    Science.gov (United States)

    Luz, Christian; Rodrigues, Juscelino; Rocha, Luiz F N

    2012-04-01

    Entomopathogenic fungi, especially Metarhizium anisopliae, have potential for integrated control of peridomestic triatomine bugs. However, the high susceptibility of these vectors to fungal infection at elevated ambient humidities decreases in the comparatively dry conditions that often prevail in their microhabitats. A formulation adapted to this target pest that induces high and quick mortality can help to overcome these drawbacks. In the present study diatomaceous earth, which is used against pests of stored grains or as an additive to mycoinsecticides, delayed but did not reduce in vitro germination of M. anisopliae s.l. IP 46 conidia after >24h agitation without affecting viability, and did not hamper the survival of Triatoma infestans nymphs exposed to treated surfaces. The settling behavior of nymphs on a treated surface in choice tests depended on the concentration of diatomaceous earth and ambient light level. Conidia formulated with diatomaceous earth and a vegetable oil synergized the insecticidal effect of the fungus in nymphs, and quickly killed all treated insects, even at 75% relative humidity (LT(90) 8.3 days) where unformulated conidia caused only 25% mortality after a 25 days exposure. The improved performance of a combined oil and desiccant dust formulation of this Metarhizium isolate raises the likelihood for its successful mycoinsecticidal use for triatomine control and, apparently, against other domestic insect pests.

  3. Horizontal Transmission of the Entomopathogen Fungus Metarhizium anisopliae in Microcerotermes diversus Groups.

    Science.gov (United States)

    Cheraghi, Amir; Habibpour, Behzad; Mossadegh, Mohammad Saied; Sharififard, Mona

    2012-08-08

    An experiment was carried out in order to investigate fungal conidia transmission of Metarhizium anisopliae (Metschnikoff) Sorokin from vector (donor) to healthy Microcerotermes diversus Silvestri (Iso.: Termitidae) and determine the best donor/concentration ratio for transmission. After preliminary trials, concentrations of 3.1 × 10⁴, 3.9 × 10⁵, 3.2 × 10⁶ and 3.5 × 10(8) conidia mL(-1) were selected for testing. The experiment was performed at three donor : Recipient ratios of 10, 30 and 50%. The highest mortality of recipient workers was observed after 14 days at the concentration of 3.5 × 10⁸ conidia mL(-1) and donor ratio of 50%. The mortality of recipient workers was less than 20% at all concentrations at a donor ratio of 10%. Our observations indicate social behavior of M. diversus, such as grooming, can be effective in promoting epizootic outbreaks in a colony. While the current results suggest good potential for efficacy, the use of M. anisopliae as a component of integrated pest management of M. diversus still needs to be proven under field conditions.

  4. Characterization of a newly discovered China variety of Metarhizium anisopliae (M. anisopliae var. dcjhyium) for virulence to termites, isoenzyme, and phylogenic analysis.

    Science.gov (United States)

    Dong, Changjin; Zhang, Jiamin; Chen, Wuguo; Huang, Hai; Hu, Yuanyang

    2007-01-01

    The efficacy of a new virulent Metarhizium anisopliae variety (M. anisopliae var. dcjhyium, DQ288247) obtained from Odontotermes formosanus in China was evaluated against the subterranean termite, O. formosanus, in the laboratory. The new variety was compared with four other virulent M. anisopliae isolates and was found to be highly infectious and virulent against termites. M. anisopliae var. dcjhyium could cause approximately 100% mortality of termites 3 days post-inoculation in the concentration of 3x10(8) conidia/ml. There were also differences in relative hyhal growth and isoenzymes. M. anisopliae var. dcjhyium showed a different isoenzyme band pattern from the four isolates of M. anisopliae (AB027337, AB099510, AB099941 and AF280631). The phylogenetic tree of the 18S rDNA sequences revealed the taxonomic and evolutionary position of M. anisopliae var. dcjhyium. M. anisopliae var. dcjhyium and four isolates of M. anisopliae formed a monophyletic group, supported by a 99% bootstrap value. M. anisopliae var. dcjhyium formed a distinct variety, which had a special characterization of unique bands of isoenzyme, high virulence and low repellency against termites when compared with four other isolates of M. anisopliae.

  5. Molecular characterization and pathogenicity of fungal isolates for use against the small hive beetle (Aethina tumida)

    Science.gov (United States)

    The analysis of DNA sequences from fungal pathogens obtained from cadavers of the small hive beetle (SHB) collected from several apiaries in Florida revealed a mixture of saprobes and two potential primary entomopathogens, Metarhizium anisopliae and Beauveria bassiana. Spray tower bioassays indicate...

  6. The searching of active catalase producers among the microscopic fungi

    Directory of Open Access Journals (Sweden)

    Tamara SIRBU

    2011-11-01

    Full Text Available The screening among 158 fungal strains from different taxonomic groups - 128 new soil strains, from plant roots and 30 NCNM strains was carried out on the criterion of catalase synthesis. It was demonstrated that some new strains were more active than those from NCNM. All tested strains from the Penicillium and Aspergillus (108 genus had catalase activity and 26 representatives of other strains did not. Penicillium funiculosum strain, isolated from selected soils of Moldova, was selected as a potential catalase producer. This strain had a catalase activity of 244 units / ml. The optimal parameters for crop cultivation were: temperature of 28 gr.C, the cultivation period - 6 days, the pH value of the nutritional medium – 6.6.

  7. In vitro interaction of Metarhizium anisopliae Ma9236 and Beauveria bassiana Bb9205 with Heterorhabditis bacteriophora HNI0100 for the control of Plutella xylostella.

    Science.gov (United States)

    Correa-Cuadros, J P; Sáenz-Aponte, A; Rodríguez-Bocanegra, M X

    2016-01-01

    The diamondback moth (Plutella xylostella) is a major pest of broccoli crops in Colombia. To control P. xylostella, we evaluated the interaction of Beauveria bassiana Bb9205 and Metarhizium anisopliae Ma9236 with Heterorhabditis bacteriophora HNI0100 and its bacterial symbiont Photorhabdus luminescens HNI0100. We used antagonism and disk diffusion assays with fungal extracts to test the interaction between symbiotic bacterium and fungi. P. luminescens inhibited the growth of B. bassiana and M. anisopliae up to 40% by the secretion of secondary metabolites, whereas fungal extracts did not inhibit P. luminescens; this explains the in vivo interactions of these biological control agents. To test the interaction between fungi and nematodes, we first inoculated the fungi followed by the nematodes on different days (0, 2, 4, and 6). We identified the type of interaction using the formula by Nishimatsu and Jackson (J Econ Entomol 91:410-418, 1998) and established that on days 0, 2 and 4 there was an antagonistic interaction, while a synergistic interaction occurred on day 6. Therefore, the use of the interaction between H. bacteriophora HNI0100 with M. anisopliae Ma9236 and B. bassiana Bb9205 is an innovative alternative for the control of P. xylostella.

  8. First unusual case of keratitis in Europe due to the rare fungus Metarhizium anisopliae.

    Science.gov (United States)

    Dorin, Josephine; Debourgogne, Anne; Zaïdi, Mohamed; Bazard, Marie-Christine; Machouart, Marie

    2015-05-01

    Metarhizium anisopliae is a fungus utilized worldwide for insect-pest biocontrol. Few M. anisopliae infections have been reported previously. Here, M. anisopliae was isolated from a corneal ulcer in a healthy man. It is the first ocular case in France and Europe of this extremely rare fungus in humans.

  9. Pyrethroid resistance in Anopheles gambiae leads to increased susceptibility to the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    Knols Bart GJ

    2010-06-01

    Full Text Available Abstract Background Entomopathogenic fungi are being investigated as a new mosquito control tool because insecticide resistance is preventing successful mosquito control in many countries, and new methods are required that can target insecticide-resistant malaria vectors. Although laboratory studies have previously examined the effects of entomopathogenic fungi against adult mosquitoes, most application methods used cannot be readily deployed in the field. Because the fungi are biological organisms it is important to test potential field application methods that will not adversely affect them. The two objectives of this study were to investigate any differences in fungal susceptibility between an insecticide-resistant and insecticide-susceptible strain of Anopheles gambiae sensu stricto, and to test a potential field application method with respect to the viability and virulence of two fungal species Methods Pieces of white polyester netting were dipped in Metarhizium anisopliae ICIPE-30 or Beauveria bassiana IMI391510 mineral oil suspensions. These were kept at 27 ± 1°C, 80 ± 10% RH and the viability of the fungal conidia was recorded at different time points. Tube bioassays were used to infect insecticide-resistant (VKPER and insecticide-susceptible (SKK strains of An. gambiae s.s., and survival analysis was used to determine effects of mosquito strain, fungus species or time since fungal treatment of the net. Results The resistant VKPER strain was significantly more susceptible to fungal infection than the insecticide-susceptible SKK strain. Furthermore, B. bassiana was significantly more virulent than M. anisopliae for both mosquito strains, although this may be linked to the different viabilities of these fungal species. The viability of both fungal species decreased significantly one day after application onto polyester netting when compared to the viability of conidia remaining in suspension. Conclusions The insecticide

  10. Fungal Sinusitis

    Science.gov (United States)

    ... Marketplace Find an ENT Doctor Near You Fungal Sinusitis Fungal Sinusitis Patient Health Information News media interested ... sinusitis results. There Are Four Types Of Fungal Sinusitis: Mycetoma Fungal Sinusitis produces clumps of spores, a " ...

  11. Identification of genes differentially expressed by Metarhizium anisopliae growing on Locusta migratoria wings using suppression subtractive hybridization.

    Science.gov (United States)

    Zhang, Chuanbo; Xia, Yuxian; Li, Zhongyuan

    2011-05-01

    Insect-pathogenic fungi penetrate their hosts directly through the cuticle. To better understand this process, we identified genes that were up-regulated by Metarhizium anisopliae germinating and differentiating on Locusta migratoria wings using suppression subtractive hybridization (SSH). A total of 78 unique expressed sequence tags (ESTs) up-regulated more than twofold during fungal growth on locust wings were identified. Among these 78 ESTs, 30 (38.5%) shared significant similarity with NCBI annotated hypothetical proteins, 16 (20.5%) shared low similarity to known or predicted genes, might represent novel genes, and 32 (41.0%) shared significant similarity with known proteins that are involved in various cell and molecular processes such as cell metabolism, protein metabolism, stress response and defense, and cell structure and function. Semi-quantitative RT-PCR analysis of six randomly selected genes confirmed the SSH results, verifying the fidelity of the SSH data. The results of this study provide novel information on genes expressed during early stages of infection with M. anisopliae, and improve current understanding of fungal pathogenesis.

  12. Cloning and Sequencing of a Candida albicans Catalase Gene and Effects of Disruption of This Gene†

    OpenAIRE

    Wysong, Deborah R.; Christin, Laurent; Sugar, Alan M.; Robbins, Phillips W.; Diamond, Richard D.

    1998-01-01

    Catalase plays a key role as an antioxidant, protecting aerobic organisms from the toxic effects of hydrogen peroxide, and in some cases has been postulated to be a virulence factor. To help elucidate the function of catalase in Candida albicans, a single C. albicans-derived catalase gene, designated CAT1, was isolated and cloned. Degenerate PCR primers based on highly conserved areas of other fungal catalase genes were used to amplify a 411-bp product from genomic DNA of C. albicans ATCC 102...

  13. Cecropins from Plutella xylostella and Their Interaction with Metarhizium anisopliae.

    Science.gov (United States)

    Ouyang, Lina; Xu, Xiaoxia; Freed, Shoaib; Gao, Yanfu; Yu, Jing; Wang, Shuang; Ju, Wenyan; Zhang, Yuqing; Jin, Fengliang

    2015-01-01

    Cecropins are the most potent induced peptides to resist invading microorganisms. In the present study, two full length cDNA encoding cecropin2 (Px-cec2) and cecropin3 (Px-cec3) were obtained from P. xylostella by integrated analysis of genome and transcriptome data. qRT-PCR analysis revealed the high levels of transcripts of Px-cecs (Px-cec1, Px-cec2 and Px-cec3) in epidermis, fat body and hemocytes after 24, 30 and 36 h induction of Metarhizium anisopliae, respectively. Silencing of Spätzle and Dorsal separately caused the low expression of cecropins in the fat body, epidermis and hemocytes, and made the P.xylostella larvae more susceptible to M. anisopliae. Antimicrobial assays demonstrated that the purified recombinant cecropins, i.e., Px-cec1, Px-cec2 and Px-cec3, exerted a broad spectrum of antimicrobial activity against fungi, as well as Gram-positive and Gram-negative bacteria. Especially, Px-cecs showed higher activity against M. anisopliae than another selected fungi isolates. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that cecropins exerted the vital morphological alterations to the spores of M. anisopliae. Based on our results, cecropins played an imperative role in resisting infection of M. anisopliae, which will provide the foundation of biological control of insect pests by using cecorpins as a target in the future.

  14. Cecropins from Plutella xylostella and Their Interaction with Metarhizium anisopliae.

    Directory of Open Access Journals (Sweden)

    Lina Ouyang

    Full Text Available Cecropins are the most potent induced peptides to resist invading microorganisms. In the present study, two full length cDNA encoding cecropin2 (Px-cec2 and cecropin3 (Px-cec3 were obtained from P. xylostella by integrated analysis of genome and transcriptome data. qRT-PCR analysis revealed the high levels of transcripts of Px-cecs (Px-cec1, Px-cec2 and Px-cec3 in epidermis, fat body and hemocytes after 24, 30 and 36 h induction of Metarhizium anisopliae, respectively. Silencing of Spätzle and Dorsal separately caused the low expression of cecropins in the fat body, epidermis and hemocytes, and made the P.xylostella larvae more susceptible to M. anisopliae. Antimicrobial assays demonstrated that the purified recombinant cecropins, i.e., Px-cec1, Px-cec2 and Px-cec3, exerted a broad spectrum of antimicrobial activity against fungi, as well as Gram-positive and Gram-negative bacteria. Especially, Px-cecs showed higher activity against M. anisopliae than another selected fungi isolates. Scanning electron microscopy (SEM and transmission electron microscopy (TEM revealed that cecropins exerted the vital morphological alterations to the spores of M. anisopliae. Based on our results, cecropins played an imperative role in resisting infection of M. anisopliae, which will provide the foundation of biological control of insect pests by using cecorpins as a target in the future.

  15. Construction and preliminary analysis of a normalized cDNA library from Locusta migratoria manilensis topically infected with Metarhizium anisopliae var. acridum.

    Science.gov (United States)

    Wang, Jie; Xia, Yuxian

    2010-08-01

    The insect immune response to fungal infection is poorly understood at the molecular level. To explore the molecular basis of this process, a novel method to analyze the gene transcripts of insects in response to pathogenic fungus was established. A normalized cDNA library based on the SMART method combined with DSN (duplex-specific nuclease) treatment was constructed using mRNA extracted from the fat body and hemocytes of Locusta migratoria manilensis 6-24h after being topically infected with Metarhizium anisopliae var. acridum. Analysis of 259 unigenes out of 303 sequenced inserts from the cDNA library revealed that the cDNA library was not contaminated with M. anisopliae transcripts and validated the presence of the immune-related genes characterized here. These results suggest that this method overcame the difficulties of contamination from a fungal source in constructing the host cDNA library from mycosed insects and proved that this method is reliable and feasible for investigation of host genes in response to fungal infection. Further studies of the expressed sequence tags from this library will provide insights into the molecular basis of insect immune response to fungal infection.

  16. Resource competition between two fungal parasites in subterranean termites

    Science.gov (United States)

    Chouvenc, Thomas; Efstathion, Caroline A.; Elliott, Monica L.; Su, Nan-Yao

    2012-11-01

    Subterranean termites live in large groups in underground nests where the pathogenic pressure of the soil environment has led to the evolution of a complex interaction among individual and social immune mechanisms in the colonies. However, groups of termites under stress can show increased susceptibility to opportunistic parasites. In this study, an isolate of Aspergillus nomius Kurtzman, Horn & Hessltine was obtained from a collapsed termite laboratory colony. We determined that it was primarily a saprophyte and, secondarily, a facultative parasite if the termite immunity is undergoing a form of stress. This was determined by stressing individuals of the Formosan subterranean termite Coptotermes formosanus Shiraki via a co-exposure to the virulent fungal parasite Metarhizium anisopliae (Metch.) Sorokin. We also examined the dynamics of a mixed infection of A. nomius and M. anisopliae in a single termite host. The virulent parasite M. anisopliae debilitated the termite immune system, but the facultative, fast growing parasite A. nomius dominated the mixed infection process. The resource utilization strategy of A. nomius during the infection resulted in successful conidia production, while the chance for M. anisopliae to complete its life cycle was reduced. Our results also suggest that the occurrence of opportunistic parasites such as A. nomius in collapsing termite laboratory colonies is the consequence of a previous stress, not the cause of the stress.

  17. Characterization of a Peruvian isolate of Metarhizium anisopliae var. acridum, a pathogen of grasshoppers

    Directory of Open Access Journals (Sweden)

    Magalhães Bonifácio Peixoto

    2003-01-01

    Full Text Available The objective of this study was to characterize the Peruvian isolate of Metarhizium anisopliae var. acridum, CG 863, obtained from the grasshopper Schistocerca interrita, a crop pest in Peru. The characterization was done by comparing this isolate with two other ones of M. anisopliae var. acridum, from Brazil and Australia, and with an isolate of M. anisopliae var. anisopliae. The three M. anisopliae var. acridum isolates had similar growth profiles in agar plates at 25°C and 37°C, and similar RAPD patterns according to the analysis of three primers. However, regarding these parameters and conidial size, these isolates were very distinct when compared to M. anisopliae var. anisopliae isolate. Bioassays indicated that the Peruvian isolate is as pathogenic as the Brazilian isolate against nymphs of Rhammatocerus schistocercoides.

  18. Total lipids and fatty acids of strains of Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Pupin Antonio Marcos

    2000-01-01

    Full Text Available Two growth stages, conidia (C and mycelium (M, and two media, minimal medium (MM and complete medium (MC, were compared in 10 strains of M. anisopliae, and two strains of M. anisopliae var. majus were similar in percentages of total lipids. Tukey test for average of lipid content in conidia (C and mycelia (M cultured on minimal (MM and complete (MC media showed significant differences between means at the 5% level for mycelia and conidia, indicating variability in total lipid production and storage during growth. Strains 5 and 7, both variety majus, did not present sizable differences from variety anisopliae. For fatty acids, C18:1 and C18:2, oleic and linoleic, respectively, the differences were all highly significant (p= 1% with the highest means being obtained for conidia for fatty acid C18:1 and for myclelia for fatty acid C18:2.

  19. Root environment is a key determinant of fungal entomopathogen endophytism following seed treatment in the common bean, Phaseolus vulgaris

    Science.gov (United States)

    The common bean is the most important food legume in the world. We examined the potential of the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae applied as seed treatments for their endophytic establishment in the common bean. Endophytic colonization in sterile sand:peat average...

  20. Secretome of the biocontrol agent metarhizium anisopliae induced by the cuticle of the cotton pest Dysdercus peruvianus reveals new insights into infection.

    Science.gov (United States)

    Beys-da-Silva, Walter O; Santi, Lucélia; Berger, Markus; Calzolari, Diego; Passos, Dario O; Guimarães, Jorge A; Moresco, James J; Yates, John R

    2014-05-02

    Metarhizium anisopliae is an entomopathogenic fungus that has evolved specialized strategies to infect insect hosts. Here we analyzed secreted proteins related to Dysdercus peruvianus infection. Using shotgun proteomics, abundance changes in 71 proteins were identified after exposure to host cuticle. Among these proteins were classical fungal effectors secreted by pathogens to degrade physical barriers and alter host physiology. These include lipolytic enzymes, Pr1A, B, C, I, and J proteases, ROS-related proteins, oxidorreductases, and signaling proteins. Protein interaction networks were generated postulating interesting candidates for further studies, including Pr1C, based on possible functional interactions. On the basis of these results, we propose that M. anisopliae is degrading host components and actively secreting proteins to manage the physiology of the host. Interestingly, the secretion of these factors occurs in the absence of a host response. The findings presented here are an important step in understanding the host-pathogen interaction and developing more efficient biocontrol of D. peruvianus by M. anisopliae.

  1. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    Science.gov (United States)

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius.

  2. Anopheline and culicine mosquitoes are not repelled by surfaces treated with the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    Mnyone Ladslaus L

    2010-08-01

    Full Text Available Abstract Background Entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana, are promising bio-pesticides for application against adult malaria mosquito vectors. An understanding of the behavioural responses of mosquitoes towards these fungi is necessary to guide development of fungi beyond the 'proof of concept' stage and to design suitable intervention tools. Methods Here we tested whether oil-formulations of the two fungi could be detected and avoided by adult Anopheles gambiae s.s., Anopheles arabiensis and Culex quinquefasciatus. The bioassays used a glass chamber divided into three compartments (each 250 × 250 × 250 mm: release, middle and stimulus compartments. Netting with or without fungus was fitted in front of the stimulus compartment. Mosquitoes were released and the proportion that entered the stimulus compartment was determined and compared between treatments. Treatments were untreated netting (control 1, netting with mineral oil (control 2 and fungal conidia formulated in mineral oil evaluated at three different dosages (2 × 1010, 4 × 1010 and 8 × 1010 conidia m-2. Results Neither fungal strain was repellent as the mean proportion of mosquitoes collected in the stimulus compartment did not differ between experiments with surfaces treated with and without fungus regardless of the fungal isolate and mosquito species tested. Conclusion Our results indicate that mineral-oil formulations of M. anisopliae and B. bassiana were not repellent against the mosquito species tested. Therefore, both fungi are suitable candidates for the further development of tools that aim to control host-seeking or resting mosquitoes using entomopathogenic fungi.

  3. Field bioassay of Metarhizium anisopliae strains to control the poultry red mite Dermanyssus gallinae.

    Science.gov (United States)

    Tavassoli, M; Allymehr, M; Pourseyed, S H; Ownag, A; Bernousi, I; Mardani, K; Ghorbanzadegan, M; Shokrpoor, S

    2011-06-10

    The poultry red mite, Dermanyssus gallinae is one of the most economically deleterious ectoparasite of laying hens worldwide. To evaluate the efficacy of three strains (V245, 3247 and 715C) of entomopathogenic fungus Metarhizium anisopliae with potential as acaricides against D. gallinae, this investigation was carried out in a commercial caged laying poultry farm in Naghedeh, West Azarbaijan of Iran. The parasite infestation already existed in the farm. Sunflower oil suspension of all fungal strains, each in two concentrations (1×10(7) and 1×10(9) conidia/ml) were used separately as spray on hens and cages, and in the control group the cages were only sprayed with sunflower oil and sterile distilled water. For estimating the population rate of mites before and after treatment, special cardboard traps were fixed to cages during a 1-month period. The traps were placed on weeks -1, 0, 1, 2 and 3 and always removed after 1 w. The results showed that the population rates post fungal treatment with the lower concentration were not significantly different compared to the control group. However, the reduction in mite numbers induced by all three strains at the concentration of 1×10(9) conidia/ml was significantly higher than the control (Pgallinae.

  4. Expression of a chitinase gene from Metarhizium anisopliae in tobacco plants confers resistance against Rhizoctonia solani.

    Science.gov (United States)

    Kern, Marcelo Fernando; Maraschin, Simone de Faria; Vom Endt, Débora; Schrank, Augusto; Vainstein, Marilene Henning; Pasquali, Giancarlo

    2010-04-01

    The chit1 gene from the entomopathogenic fungus Metarhizium anisopliae, encoding the endochitinase CHIT42, was placed under the control of the CaMV 35S promoter, and the resulting construct was transferred to tobacco. Seventeen kanamycin-resistant transgenic lines were recovered, and the presence of the transgene was confirmed by polymerase chain reactions and Southern blot hybridization. The number of chit1 copies was determined to be varying from one to four. Copy number had observable effects neither on plant growth nor development. Substantial heterogeneity concerning production of the recombinant chitinase, and both general and specific chitinolytic activities were detected in leaf extracts from primary transformants. The highest chitinase activities were found in plants harboring two copies of chit1 inserts at different loci. Progeny derived from self-pollination of the primary transgenics revealed a stable inheritance pattern, with transgene segregation following a mendelian dihybrid ratio. Two selected plants expressing high levels of CHIT42 were consistently resistant to the soilborne pathogen Rhizoctonia solani, suggesting a direct relationship between enzyme activity and reduction of foliar area affected by fungal lesions. To date, this is the first report of resistance to fungal attack in plants mediated by a recombinant chitinase from an entomopathogenic and acaricide fungus.

  5. Susceptibility of different life stages of Ornithodoros lahorensis to entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana.

    Science.gov (United States)

    Tavassoli, Mousa; Malekifard, Farnaz; Soleimanzadeh, Ali; Pourseyed, Seyed Hassan; Bernousi, Iraj; Mardani, Karim

    2012-10-01

    The use of chemicals for the control of arthropod pests can be problematic due to the potential for both environmental contamination and resistance development. As a result, there is an increasing interest in nonchemical alternatives, such as biocontrol by entomopathogenic fungi. In the present study, three strains of Metarhizium anisopliae (V245, 3247, and 4456) and one strain of Beauveria bassiana (LM 3.2) were evaluated under laboratory conditions for their virulence towards three life stages of Ornithodoros lahorensis. Groups of eggs, larvae, and adult ticks were treated by immersion in two different suspensions (10(5) and 10(7) conidia/ml) of each fungal strain. All treatment and control groups were observed during a 3-week period, and the hatchability of eggs and mortality percentage of larvae and adult ticks were assessed. The effect of fungal strains on egg hatchability and larva and adult mortality was significant and dose dependent compared to the control groups (P fungi potential biological control agents of O. lahorensis reducing the use of chemical acaricides.

  6. A Field Experiment to Assess the Rate of Infestation in Honey Bee Populations of Two Metarhizium Anisopliae Isolates on Varroa Destructor (Acari: Mesostigmata

    Directory of Open Access Journals (Sweden)

    Khodadad Pirali-kheirabadi

    2013-03-01

    Full Text Available Background: The protective effect of two isolates of an entomopathogenic fungus, Metarhizium anisopliae (DEMI 002 and Iran 437C on the adult stage of Varroa destructor was evaluated in comparison with fluvalinate strips in the field.Methods: A total of 12 honey bee colonies were provided from an apiculture farm. The selected hives were divided into 4 groups (3 hives per group. The first group was the control, treated with distilled water. The other two groups were exposed to different fungi (M. anisopliae isolates DEMI 002 and Iran 437C and the last group was treated with one strip of fluvalinate per colony. The number of fallen mites was counted using sticky traps during a 6-day period, six days before and after treatments. A fungal suspension at a concentration of 5× 106 conidia/mL was sprayed onto the frames and the number of fallen mites was counted.Results: Metarhizium anisopliae DEMI 002 and Iran 437C isolates were as effective (i.e., caused as much mite fall as the fluvalinate strip in controlling bee colonies than no treatment.Conclusion: Both M. anisopliae isolates are promising candidates as agents in the control of Varroa mites under field conditions. Isolate DEMI 002 can be considered as a possible non-chemical biocontrol agent for controlling bee infestation with V. destructor in the field. In order to substantiate this hypothesis, tests are currently being performed using larger colonies and larger doses than tested in the present study in our beekeeping.

  7. METARHIZIUM ANISOPLIAE DAN ANDROGRAPHIS PANICULATA TERHADAP SERANGGA BUKAN HAMA SASARAN

    Directory of Open Access Journals (Sweden)

    Dini Yuliani

    2016-04-01

    Full Text Available The objective of this study was to determine the effect of Metarhizium anisopliae and Andrographis paniculata to the natural enemies of Nephotettix virescens and non-target insect pests. This research was conducted in tungro endemic areas in Subang District, West Java in the wet season 2013/2014. The method of research used a split plot design with four replications. The main plot was IR66, Inpari 9, and Ciherang varieties. Subplot was the application of M. anisopliae, A. paniculata, and control. Observations were carried out five times started at nursery (2 weeks after seedling, 14, 28, 42, and 56 days after planting using insect nets, double swing 10 times on each plot observations. The results show M. anisopliae and A. paniculata not adversely affect on non-target insect pests such as Chironomid and natural enemies of N. virescens namely Lycosa pseudoannulata, Cyrtorhinus lividipennis, Sepedon sp., damselfly, Tipulidae sp., Telenomus sp., dragonfly, and Tetrastichus sp.. Efficacy of M. anisopliae and A. paniculata as one of the control strategies that are environmentally friendly and proved not harmful to non-target insect pests.

  8. Metarhizium anisopliae and Trichoderma viride control colonies of Atta cephalotes in field better than a chemical insecticide

    Directory of Open Access Journals (Sweden)

    Elkin López Arismendy

    2011-12-01

    Full Text Available The leaf-cutting ant Atta cephalotes is an economically important pest in agriculture. These ants use the material they cut to cultivate a fungus from which they fed. In this study, baits prepared with the entomopathogenic fungus Metarhizium anisopliae strain M-137, Trichoderma viride strain T-26, antagonist of the symbiont fungus of A. cephaloies, and a combination of both fungi were applied in order to control A. cephalotes colonies under field conditions. In addition, the insecticide activity of the baits was compared to a chemical product, Pirimifos Metil, which was applied with an air pump. The ants did not detect the fungal agents contained in the baits, and introduced then into their nests without awakening defensive behaviors. The mortality of the bait-treated nests was higher than 80% while the treatment with Pirimifos Metil was effective in only 60% of the nests. Additionally, a week after the application of these treatments, changes in the insects' behavior were observed, reflected mainly in the absence of foraging activity. In conclusion, M. anisopliae was effective in controlling A. cephalotes colonies, and superior to the chemical product Pirimifos Metil. 

  9. Metarhizium anisopliae chitinase CHIT30 is involved in heat-shock stress and contributes to virulence against Dysdercus peruvianus.

    Science.gov (United States)

    Staats, Charley Christian; Kmetzsch, Livia; Lubeck, Irina; Junges, Angela; Vainstein, Marilene Henning; Schrank, Augusto

    2013-02-01

    Entomopathogenic fungi are able to produce several chitinases, which serve a variety of biological functions, such as fungal cell wall organization and the degradation of exogenous chitin for nutrition or insect infection processes. In this study, we analyzed the contribution of the CHIT30 chitinase from Metarhizium anisopliae in morphogenetic development and virulence as a model of chitinase function. The analysis of chi3 gene expression revealed transcript accumulation in response to heat-shock stress conditions as well as cultivation in medium supplemented with chitin. Null chi3 mutants were constructed to determine the biological role of CHIT30. No substantial differences in the secreted chitinase activity could be detected between the wild type and the Δchi3 mutant. However, both endochitinase and exochitinase activities were diminished in the mutant strain following heat-shock treatment, suggesting that CHIT30 is involved in heat-shock adaptation. Mutants lacking CHIT30 chitinase showed reduced virulence against the cotton stainer bug Dysdercus peruvianus, indicating that the CHIT30 chitinase plays a role in the infection process of M. anisopliae.

  10. Horizontal Transmission of the Entomopathogen Fungus Metarhizium anisopliae in Microcerotermes diversus Groups

    Directory of Open Access Journals (Sweden)

    Mohammad Saied Mossadegh

    2012-08-01

    Full Text Available An experiment was carried out in order to investigate fungal conidia transmission of Metarhizium anisopliae (Metschnikoff Sorokin from vector (donor to healthy Microcerotermes diversus Silvestri (Iso.: Termitidae and determine the best donor/concentration ratio for transmission. After preliminary trials, concentrations of 3.1 × 104, 3.9 × 105, 3.2 × 106 and 3.5 × 108 conidia mL−1 were selected for testing. The experiment was performed at three donor : Recipient ratios of 10, 30 and 50%. The highest mortality of recipient workers was observed after 14 days at the concentration of 3.5 × 108 conidia mL−1 and donor ratio of 50%. The mortality of recipient workers was less than 20% at all concentrations at a donor ratio of 10%. Our observations indicate social behavior of M. diversus, such as grooming, can be effective in promoting epizootic outbreaks in a colony. While the current results suggest good potential for efficacy, the use of M. anisopliae as a component of integrated pest management of M. diversus still needs to be proven under field conditions.

  11. Cuticle Fatty Acid Composition and Differential Susceptibility of Three Species of Cockroaches to the Entomopathogenic Fungi Metarhizium anisopliae (Ascomycota, Hypocreales).

    Science.gov (United States)

    Gutierrez, Alejandra C; Gołębiowski, Marek; Pennisi, Mariana; Peterson, Graciela; García, Juan J; Manfrino, Romina G; López Lastra, Claudia C

    2015-04-01

    Differences in free fatty acids (FFAs) chemical composition of insects may be responsible for susceptibility or resistance to fungal infection. Determination of FFAs found in cuticular lipids can effectively contribute to the knowledge concerning insect defense mechanisms. In this study, we have evaluated the susceptibility of three species of cockroaches to the entomopathogenic fungi Metarhizium anisopliae (Metschnikoff) Sorokin by topical application. Mortality due to M. anisopliae was highly significant on adults and nymphs of Blattella germanica L. (Blattodea: Blattellidae). However, mortality was faster in adults than in nymphs. Adults of Blatta orientalis L. (Blattodea: Blattidae) were not susceptible to the fungus, and nymphs of Blaptica dubia Serville (Blattodea: Blaberidae) were more susceptible to the fungus than adults. The composition of cuticular FFAs in the three species of cockroaches was also studied. The analysis indicated that all of the fatty acids were mostly straight-chain, long-chain, saturated or unsaturated. Cuticular lipids of three species of cockroaches contained 19 FFAs, ranging from C14:0 to C24:0. The predominant fatty acids found in the three studied species of cockroaches were oleic, linoleic, palmitic, and stearic acid. Only in adults of Bl. orientalis, myristoleic acid, γ-linolenic acid, arachidic acid, dihomolinoleic acid, and behenic acid were identified. Lignoceric acid was detected only in nymphs of Bl. orientalis. Heneicosylic acid and docosahexaenoic acid were identified in adults of Ba. dubia.

  12. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Identification of a hybrid PKS-NRPS required for the biosynthesis of NG-391 in Metarhizium anisopliae var. anisopliae

    Science.gov (United States)

    A 19,818 kb genomic region harboring six predicted ORFs was identified in M. anisopliae ARSEF 2575. ORF4, putatively encoding a hybrid polyketide synthase-nonribosomal peptide synthetase (PKS-NRPS) was targeted using Agrobacterium-mediated gene knockout. Homologous recombinants failed to produce det...

  14. Laboratory evaluation of three strains of the entomopathogenic fungus Metarhizium anisopliae for controlling Dermanyssus gallinae.

    Science.gov (United States)

    Tavassoli, M; Ownag, A; Pourseyed, S H; Mardani, K

    2008-06-01

    The pathogenicity of three strains of the entomopathogenic fungus Metarhizium anisopliae on different life stages of Dermanyssus gallinae was evaluated in the laboratory. All the strains tested were virulent to D. gallinae but pathogenicity varied among the strains. Strain V245 induced a higher mortality rate using different concentrations than other two strains. The estimated median lethal concentration of different strains of M. anisopliae against D. gallinae varied depending on the exposure time of D. gallinae to M. anisopliae. It was concluded that the pathogenicity of the entomopathogenic fungus M. anisopliae on different life stages of D. gallinae was concentration and time dependent.

  15. Fungal biological control agents for integrated management of Culicoides spp. (Diptera: Ceratopogonidae of livestock

    Directory of Open Access Journals (Sweden)

    B. W. Narladkar

    2015-02-01

    Full Text Available Aim: Entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana had wide host range against insects and hence these are being exploited as fungal bio-pesticide on a large scale. Both fungi are proved pesticides against many crop pests and farmers are well acquainted with their use on the field. Thus, research was aimed to explore the potency of these fungal spores against larval and adult Culicoides midges, a pest of livestock. Materials and Methods: In-vitro testing of both fungal biological control agents was undertaken in Petri dishes against field collected Culicoides larvae, while in plastic beakers against field collected blood-engorged female Culicoides midges. In-vivo testing was undertaken by spraying requisite concentration of fungal spores on the drainage channel against larvae and resting sites of adult Culicoides midges in the cattle shed. Lethal concentration 50 (LC50 values and regression equations were drawn by following probit analysis using SPSS statistical computerized program. Results: The results of this study revealed LC50 values of 2692 mg and 3837 mg (108 cfu/g for B. bassiana and M. anisopliae, respectively, against Culicoides spp. larvae. Death of Culicoides larvae due to B. bassiana showed greenish coloration in the middle of the body with head and tail showed intense blackish changes, while infection of M. anisopliae resulted in death of Culicoides larvae with greenish and blackish coloration of body along with total destruction, followed by desquamation of intestinal channel. The death of adult Culicoides midges were caused by both the fungi and after death growth of fungus were very well observed on the dead cadavers proving the efficacy of the fungus. Conclusion: Preliminary trials with both funguses (M. anisopliae, B. bassiana showed encouraging results against larvae and adults of Culicoides spp. Hence, it was ascertained that, these two fungal molecules can form a part of biological control and

  16. In vitro assembly of catalase.

    Science.gov (United States)

    Baureder, Michael; Barane, Elisabeth; Hederstedt, Lars

    2014-10-10

    Most aerobic organisms contain catalase, which functions to decompose hydrogen peroxide. Typical catalases are structurally complex homo-tetrameric enzymes with one heme prosthetic group buried in each subunit. It is not known how catalase in the cell is assembled from its constituents. The bacterium Enterococcus faecalis cannot synthesize heme but can acquire it from the environment to form a cytoplasmic catalase. We have in E. faecalis monitored production of the enzyme polypeptide (KatA) depending on the availability of heme and used our findings to devise a procedure for the purification of preparative amounts of in vivo-synthesized apocatalase. We show that fully active catalase can be obtained in vitro by incubating isolated apoprotein with hemin. We have characterized features of the assembly process and describe a temperature-trapped hemylated intermediate of the enzyme maturation process. Hemylation of apocatalase does not require auxiliary cell components, but rapid assembly of active enzyme seemingly is assisted in the cell. Our findings provide insight about catalase assembly and offer new experimental possibilities for detailed studies of this process.

  17. Laboratory Trials of Metarhizium anisopliae var. acridum (Green Muscle® Against the Saxaul Locust, Dericorys albidula Serville (Orthoptera: Dericorythidae Ensayos de Laboratorio de Metarhizium anisopliae var. acridum (Green muscle® contra la Langosta de Saxaul, Dericorys albidula Serville (Orthoptera: Dericorythidae

    Directory of Open Access Journals (Sweden)

    Heydar Valizadeh

    2011-12-01

    Full Text Available The saxaul locust, Dericorys albidula Serville (Orthoptera: Dericorythidae is a major pest of saxaul plants in Qom province of Iran. During 2005-2006, different nymphal instars of bands of D. albidula were treated by aerial spraying of Metarhizium anisopliae var. acridum (Green Muscle®. The gasoline formulation of M. anisopliae var. acridum isolate IMI 330189 was applied in different conidial concentrations (10(6, 10(7, 10(8, 10(9, 10(10 and 10(13 spores mL-1 that were prepared in sterile distilled gasoline. Results showed that various concentrations significantly affected the 2nd, 3rd, 4th and 5th nymphal instars of D. albidula compared to control. In addition, there were no differences in the effects of the different concentrations in 2005, but the differences were significant in 2006. Concentration 10(10 killed 100% of tested insects 15 d after treatment. Comparing the results of the two years showed that the susceptibility of nymphs in the second year (2006 was higher than in the first year (2005. In conclusion, the results of this study indicated that the fungal insecticide M. anisopliae var. acridum, diluted in gasoline, was efficacious with the nymphal instars of locust D. albidula in 2005 and 2006.La langosta del saxaul, Dericorys albidula Serville (Orthoptera: Dericorythidae, es la principal plaga de plantas de saxaul de las provincias Qom, Irán. Durante 2005-2006, diferentes instars ninfales de D. albidula se asperjaron con Metarhizium anisopliae var. acridum (Green Muscle®. La formulación de gasolina de M. anisopliae var. acridum aislamiento IMI 330189 se aplicó en diferentes concentraciones conidiales (10(6, 10(7, 10(8, 10(9, 10(10 and 10(13 esporas mL-1 preparadas en gasolina destilada estéril. Los resultados demostraron que varias concentraciones afectaron significativamente los nstars ninfales de D. albidula comparado con el control. Además el efecto de concentraciones no fue diferente en 2005 pero sí significativamente en

  18. Effects of Fungicides on the Development of the Entomopathogenic Fungus Metarhizium anisopliae var. anisopliae Efecto de los Fungicidas sobre el Desarrollo del Hongo Entomopatógeno Metarhizium anisopliae var. anisopliae

    Directory of Open Access Journals (Sweden)

    Maribel Yáñez

    2010-09-01

    Full Text Available Metarhizium anisopliae (Metschnikoff Sorokin is an entomopathogenic fungus used for controlling different insect pests. It is most frequently applied to berry fruit crops, where fungicides are also used for disease control. Fungicides: azoxystrobin, benomyl, captan, chlorothalonil, fenhexamid, fludioxonil, iprodione, and metalaxyl in concentrations of 0.01, 0.1, 1.0, 10, and 100 mg L-1 were evaluated in this research study. Vegetative growth, conidia germination, and conidia germination tube length were measured on the Qu-M82, Qu-M151b, Qu-M253, Qu-M430, and Qu-M984 Metarhizium anisopliae var. anisopliae fungus strains. Those strains were selected because of their present use against different insect pest in bramble fruits. Vegetative growth was measured through the colony rate growth in agar media, and those reaching up to 50% of the check growth were considered compatible. Results indicate that the benomyl and fenhexamid fungicides were compatible with the five isolates whereas, azoxystrobin and fludioxonil were incompatible. Furthermore, benomyl and fludioxonil reduced conidia germination by 53 and 91%, and germination tube length by 18 and 37%, respectively.Metarhizium anisopliae (Metschnikoff Sorokin es un hongo entomopatógeno que se utiliza para el control de diferentes insectos, uno de sus usos más frecuentes es en frutales menores, donde también se utilizan fungicidas para el control de enfermedades. En este trabajo se evaluó el efecto de los fungicidas azoxystrobin, benomil, captan, chlorothalonil, fenhexamid, fludioxonil, iprodione y metalaxil, en concentraciones de 0,01; 0,1; 1; 10 y 100 mg L-1, sobre el crecimiento de la colonia, porcentaje de germinación de conidias y longitud de tubos germinativos de distintas cepas de M. anisopliae var. anisopliae. Las cepas utilizadas fueron Qu-M82, Qu-M151b, Qu-M253, Qu-M430 y Qu-M984, seleccionadas por su uso comercial para el control de diferentes insectos en frutales menores. El

  19. The influence of conidial Pr1 protease on pathogenicity potential of Metarhizium anisopliae senso latu to ticks.

    Science.gov (United States)

    Golo, Patrícia S; Santos, Huarrisson A; Perinotto, Wendell M S; Quinelato, Simone; Angelo, Isabele C; Camargo, Mariana G; Sá, Fillipe A; Massard, Carlos L; Fernandes, Éverton K K; Roberts, Donald W; Bittencourt, Vânia R E P

    2015-06-01

    Pr1 is a subtilisin-like protease produced by Metarhizium spp. entomopathogenic fungi, and it is recognized as heavily involved in the initial steps of the fungal invasion of arthropod-host cuticles. In the current study, correlation was sought between mortality of tick larvae and conidial Pr1 levels of one Metarhizium anisopliae senso latu (s.l.) isolate (CG 148). Conidia with different levels of pr1 gene expression and enzymatic activity were obtained by producing them on either artificial medium (to yield low Pr1 activity) or on Rhipicephalus microplus cadavers (to yield high Pr1 activity). Conidial proteolytic activity was assessed using N-suc-ala-ala-pro-phe-ρNA as the chromogenic substrate, and pr1 expression was profiled by qPCR using three genes (gpd, try, and tef) as reference genes. Pr1 enzymatic (proteolytic) activity on conidia obtained from tick cadavers was 36 U mg(-1) in comparison to 4 U mg(-1) on conidia from PDA medium. Also, pr1 gene expression level was ten times higher in conidia from tick cadavers compared to PDA medium. Bioassays of M. anisopliae s.l. CG 148 spores with elevated Pr1 proteolytic activity and gene expression levels did not demonstrate increased virulence (= significant change percent mortality of tick larvae). The minimal levels of Pr1 on conidia produced on artificial medium was adequate to afford high levels of virulence, and the elevated amounts of the enzyme on tick-cadaver-produced conidia did not induce elevated larval mortality. As long as some Pr1 activity was present, fungal virulence of isolate CG 148 against tick larvae was not elevated by increased levels of conidial Pr1.

  20. 7 CFR 58.432 - Catalase.

    Science.gov (United States)

    2010-01-01

    ... Material § 58.432 Catalase. The catalase preparation shall be a stable, buffered solution, neutral in pH, having a potency of not less than 100 Keil units per milliliter. The source of the catalase, its... 7 Agriculture 3 2010-01-01 2010-01-01 false Catalase. 58.432 Section 58.432...

  1. Susceptibility of adult female Aedes aegypti (Diptera: Culicidae to the entomopathogenic fungus Metarhizium anisopliae is modified following blood feeding

    Directory of Open Access Journals (Sweden)

    Samuels Richard I

    2011-05-01

    Full Text Available Abstract Background The mosquito Aedes aegypti, vector of dengue fever, is a target for control by entomopathogenic fungi. Recent studies by our group have shown the susceptibility of adult A. aegypti to fungal infection by Metarhizium anisopliae. This fungus is currently being tested under field conditions. However, it is unknown whether blood-fed A. aegypti females are equally susceptible to infection by entomopathogenic fungi as sucrose fed females. Insect populations will be composed of females in a range of nutritional states. The fungus should be equally efficient at reducing survival of insects that rest on fungus impregnated surfaces following a blood meal as those coming into contact with fungi before host feeding. This could be an important factor when considering the behavior of A. aegypti females that can blood feed on multiple hosts over a short time period. Methods Female A. aegypti of the Rockefeller strain and a wild strain were infected with two isolates of the entomopathogenic fungus M. anisopliae (LPP 133 and ESALQ 818 using an indirect contact bioassay at different times following blood feeding. Survival rates were monitored on a daily basis and one-way analysis of variance combined with Duncan's post-hoc test or Log-rank survival curve analysis were used for statistical comparisons of susceptibility to infection. Results Blood feeding rapidly reduced susceptibility to infection, determined by the difference in survival rates and survival curves, when females were exposed to either of the two M. anisopliae isolates. Following a time lag which probably coincided with digestion of the blood meal (96-120 h post-feeding, host susceptibility to infection returned to pre-blood fed (sucrose fed levels. Conclusions Reduced susceptibility of A. aegypti to fungi following a blood meal is of concern. Furthermore, engorged females seeking out intra-domicile resting places post-blood feeding, would be predicted to rest for prolonged

  2. Susceptibility of adult female Aedes aegypti (Diptera: Culicidae) to the entomopathogenic fungus Metarhizium anisopliae is modified following blood feeding.

    Science.gov (United States)

    Paula, Adriano R; Carolino, Aline T; Silva, Carlos P; Samuels, Richard I

    2011-05-26

    The mosquito Aedes aegypti, vector of dengue fever, is a target for control by entomopathogenic fungi. Recent studies by our group have shown the susceptibility of adult A. aegypti to fungal infection by Metarhizium anisopliae. This fungus is currently being tested under field conditions. However, it is unknown whether blood-fed A. aegypti females are equally susceptible to infection by entomopathogenic fungi as sucrose fed females. Insect populations will be composed of females in a range of nutritional states. The fungus should be equally efficient at reducing survival of insects that rest on fungus impregnated surfaces following a blood meal as those coming into contact with fungi before host feeding. This could be an important factor when considering the behavior of A. aegypti females that can blood feed on multiple hosts over a short time period. Female A. aegypti of the Rockefeller strain and a wild strain were infected with two isolates of the entomopathogenic fungus M. anisopliae (LPP 133 and ESALQ 818) using an indirect contact bioassay at different times following blood feeding. Survival rates were monitored on a daily basis and one-way analysis of variance combined with Duncan's post-hoc test or Log-rank survival curve analysis were used for statistical comparisons of susceptibility to infection. Blood feeding rapidly reduced susceptibility to infection, determined by the difference in survival rates and survival curves, when females were exposed to either of the two M. anisopliae isolates. Following a time lag which probably coincided with digestion of the blood meal (96-120 h post-feeding), host susceptibility to infection returned to pre-blood fed (sucrose fed) levels. Reduced susceptibility of A. aegypti to fungi following a blood meal is of concern. Furthermore, engorged females seeking out intra-domicile resting places post-blood feeding, would be predicted to rest for prolonged periods on fungus impregnated black cloths, thus optimizing infection

  3. New biotypes of Metarhizium anisopliae var. anisopliae E9 strain with altered conidial germination, obtained by exposition to gamma radiation; Novos biotipos de Metarhizium anisopliae var. anisopliae (Metsch.) Sorokin com germinacao alterada de conidios, obtidos pela exposicao a radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, M.G.; Oliveira, N.T.; Luna Alves Lima, E.A. [Pernambuco Univ., Recife, PE (Brazil). Centro de Ciencias Biologicas. Dept. de Micologia

    1997-12-31

    Conidia produced by a wild strain (E9) of the entomopathogenic fungus M. anisopliae var anisopliae were exposed to gamma radiation in order to obtain new biotypes. At the 390 Gy dose there were obtained 48 colonies (MaE). On complete medium, 5 colonies (MaE 01, MaE 10, MaE 15, MaE 40) presented morphological changes in color while the colony MaE 24 lost its esporulation capacity. Twenty six colonies presented mycelial growth significantly different from the wild strain, after 12 days of incubation. Twelve colonies showed average of conidial germination different from the wild strain, after 12 days of incubation on liquid minimum medium at 25 deg C. The colony MaE started germination precociously after 5 hours of incubation. (author) 31 refs., 1 fig., 4 tabs.

  4. African water storage pots for the delivery of the entomopathogenic fungus Metarhizium anisopliae to the malaria vectors Anopheles gambiae s.s. and Anopheles funestus.

    Science.gov (United States)

    Farenhorst, Marit; Farina, Daniela; Scholte, Ernst-Jan; Takken, Willem; Hunt, Richard H; Coetzee, Maureen; Knols, Bart G J

    2008-06-01

    We studied the use of African water storage pots for point source application of Metarhizium anisopliae against the malaria vectors Anopheles gambiae s.s. and An. funestus. Clay pots were shown to be attractive resting sites for male and female An. gambiae s.s. and were not repellent after impregnation with fungus. M. anisopliae was highly infective and virulent after spray application inside pots. At a dosage of 4 x 10(10) conidia/m(2), an average of 95 +/- 1.2% of An. gambiae s.s. obtained a fungal infection. A lower dosage of 1 x 10(10) conidia/m(2) infected an average of 91.5 +/- 0.6% of An. gambiae s.s. and 91.8 +/- 1.2% of An. funestus mosquitoes. Fungal infection significantly reduced mosquito longevity, as shown by differences between survival curves and LT(50) values. These pots are suitable for application of entomopathogenic fungi against malaria vectors and their potential for sustainable field implementation is discussed.

  5. Interference of a commercial catalase preparation in laccase and peroxidase activities

    Directory of Open Access Journals (Sweden)

    Nara Ballaminut

    2009-10-01

    Full Text Available The influence of commercial catalase preparations (fungal and bovine origin on laccase and peroxidase activity assays was evaluated using enzymatic extracts obtained from several basidiomycetes grown under different culture conditions. No hydrogen peroxide was detected in the extracts. Inhibition of laccase activity by 40 to 80% was related to the catalase source. In addition, oxidation of the substrate (ABTS by fungal catalase in the absence of the enzymatic extract from basidiomycetes was observed. The results demonstrated the need for the evaluation of interference of the commercial catalase preparation when its use was required in the reaction mixture.A influência da preparação comercial de catalase (origem fúngica e bovina nos ensaios de atividade absence and presence of a fungal or bovine de lacase e de peroxidases foi avaliada empregando-se extratos enzimáticos obtidos do crescimento de diversos basidiomicetos em diferentes condições de cultivo. Não foi detectado H2O2 nos extratos. Inibição de 40 a 80% da atividade de lacase foi relacionada à fonte de catalase. Além disso, foi observada oxidação do substrato (ABTS pela catalase fúngica, na ausência de extrato enzimático do basidiomiceto. Os resultados evidenciaram a necessidade de se proceder a uma avaliação da interferência da preparação comercial de catalase, quando o seu uso se fizer necessário na mistura reacional.

  6. Production of Microsclerotia of Metarhizium anisopliae Using Deep-Tank Liquid Fermentation

    Science.gov (United States)

    The entomopathogenic fungus Metarhizium anisopliae is a pathogen of numerous soil-dwelling insects and has been registered in the United States and other countries as a bioinsecticide. Recent studies using various strains of M. anisopliae showed that small sclerotia (microsclerotia) were produced i...

  7. Fungal arthritis

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000444.htm Fungal arthritis To use the sharing features on this page, please enable JavaScript. Fungal arthritis is swelling and irritation (inflammation) of a joint ...

  8. Fungal Meningitis

    Science.gov (United States)

    ... Schedules Preteen & Teen Vaccines Meningococcal Disease Sepsis Fungal Meningitis Language: English Español (Spanish) Recommend on Facebook Tweet ... the brain or spinal cord. Investigation of Fungal Meningitis, 2012 In September 2012, the Centers for Disease ...

  9. Control of the sheep scab mite Psoroptes ovis in vivo and in vitro using fungal pathogens.

    Science.gov (United States)

    Abolins, S; Thind, B; Jackson, V; Luke, B; Moore, D; Wall, R; Taylor, M A

    2007-09-30

    As part of a research programme designed to identify biological agents for the control of sheep scab, the pathogenicity of the fungus Metarhizium anisopliae to Psoroptes mites in the presence of sheepskin and wool was examined in the laboratory. No inhibitory effects of skin and wool were observed and high levels of infection were recorded. Subsequently the pathogenicity of formulations of both M. anisopliae and Beauveria bassiana to Psoroptes ovis was studied in vivo. For this, 36 batches of 20 adult female Psoroptes mites were confined in 25 mm diameter chambers which were attached to the backs of 6 scab-naive sheep. In some treatments, mites were exposed to the fungal pathogens for 48 h in vitro prior to being placed on the host, while other treatments involved mites with no prior exposure placed directly onto the skin of a host treated with a fungal pathogen. After 48 h on the host, mites were removed, incubated individually and all fungal infections were recorded. Fungal infection was observed in all treatments, except untreated controls. However, B. bassiana infected a significantly greater number of mites than M. anisopliae with all the formulations examined. Infection rates were highest when mites were exposed to dry conidia (>90%) and lowest with M. anisopliae in diatomaceous earth. Overall, the infection rate was not affected by whether or not the mites were given prior exposure to the conidia, before being placed on the sheep. The results demonstrate that Psoroptes mites can become infected by entomopathogenic fungi on the skin of sheep and provides a first demonstration of the potential of this technology for the control of sheep scab.

  10. Patogenicidade e viabilidade de Beauveria bassiana, Metarhizium anisopliae Var. anisopliae e Metarhizium anisopliae Var. acridium ao Anthonomus grandis (Boheman) (Coleoptera : Curculionidae)

    OpenAIRE

    2005-01-01

    Fungos entomopatogênicos Beauveria bassiana e Metarhizium anisopliae amplamente distribuídos em todas as regiões do mundo podem ser isolados de insetos, solo e de outros substratos. Essas espécies apresentam variabilidade genética e habilidades sobre diferentes insetos-praga. Patogenicidade e virulência sobre diversos artrópodes têm sido observadas com a variação de atividades enzimáticas e características genéticas dos isolados. A ação desses agentes está relacionada com as condições climáti...

  11. Pathogenicity of Metarhizium anisopliae (Deuteromycetes) and permethrin to Ixodes scapularis (Acari: Ixodidae) nymphs

    Science.gov (United States)

    Hornbostel, V.L.; Zhioua, Elyes; Benjamin, Michael A.; Ginsberg, Howard S.; Ostfeld, Richard S.

    2005-01-01

    Effectiveness of the entomopathogenic fungus Metarhizium anisopliae, for controlling nymphal Ixodes scapularis, was tested in laboratory and field trials. In the laboratory, M. anisopliae (Metschnikoff) Sorokin strain ESC1 was moderately pathogenic, with an LC50 of 107 spores/ml and induced 70% mortality at 109 spores/ml. In a field study, however, 109 spores/ml M. anisopliae did not effectively control questing I. scapularis nymphs, and significant differences were not detected in pre- and post-treatment densities. For nymphs collected and returned to the laboratory for observation, mortality was low in treatment groups, ranging from 20 to 36%. To assess whether a chemical acaricide would synergistically enhance pathogenicity of the fungus, we challenged unfed nymphal I. scapularis with combinations of M. anisopliae and permethrin, a relatively safe pyrethroid acaricide, in two separate bioassays. Significant interactions between M. anisopliae and permethrin were not observed, supporting neither synergism nor antagonism.

  12. Enhancing Growth of Vigna radiata in the Presence of Pseudomonas aeruginosa Biopolymer and Metarhizium anisopliae Spores

    Directory of Open Access Journals (Sweden)

    Bhagwan N. Rekadwad

    2016-01-01

    Full Text Available Exopolysaccharide producing Pseudomonas aeruginosa NCIM 2945 (PANCL belonging to gamma-proteobacterium and entomopathogenic fungus Metarhizium anisopliae MCC 1129 (MAMCC belonging to Ascomycota were studied for their morphological features biochemical characteristics and plant growth promotion ability. Optimum growth of PANCL was recorded after 24 h at temperature 30°C and pH 7.0. Gram-negative PANCL appeared as white in color, one mm size, circular, opaque, and nonconsistent elevated colonies with entire margin. It has utilized dextrose, fructose, maltose, and sorbitol as carbon source and produced acid in the medium. PANCL was sensitive to Polymyxin B (300 µgm/disc followed by Neomycin (30 µgm/disc, Gentamycin (10 µgm/disc, and Chloramphenicol (30 µgm/disc. PANCL has secreted extracellular lipase, amylase, protease, and exopolysaccharides (EPS. Another fungal strain MAMCC sporulated after 168 h at temperature 30°C and pH 7.0. MAMCC has septate-white mycelium and bears dirty green colored spores. Growth of MAMCC was enhanced in the presence of Neem and Karela-Amla oil (0.1 mL each. Extracellular polysaccharide produced by PANCL and spores of MAMCC promoted growth of dicotyledon Vigna radiata (Mung individually as well as in consortium. Considerable increase in dry weight of Vigna radiata was recorded. Thus, reported PANCL and MAMCC strains have promoted growth Vigna radiata and may be a solution for sustainable agriculture.

  13. Virulence and mycotoxic effects of Metarhizium anisopliae on Mahogany shoot borer, Hypsipyla robusta (Lepidoptera: Pyralidae)

    Institute of Scientific and Technical Information of China (English)

    M.Balachander; O.K.Remadevi; T.O.Sasidharan; N.Sapna Bai

    2012-01-01

    Developing appropriate control measures for the Mahogany shoot borer,Hypsipyla robusta Moore has become increasingly important due to the severe damaging effect of the pest on the establishment of the saplings of Swietenia mahagoni Jacq (Sapindales:Meliaceae).Existing management methods are largely limited to silvicultural practices and spraying of chemical insecticides.To identify a potential fungal biocontrol agent,we compared the virulence of six native and two standard ARSEF isolates of Metarhizium anisopliae Metsch.against this pest.The average survival time and conidial yield of IWST-Ma7 was higher (6.2 to 7.3 days and 4.9 to 4.7 × 105 conidia/ml) than the standards.Significant difference in sporulation on the cadavers between isolates,doses and incubation periods were substantiated for the selection of potential strain.The mycotoxic effects of crude soluble protein extract when incorporated in the artificial diet,the ARSEF 2596 and ARSEF 3603showed LD50 value of 3.7% and 5.6%.However,IWST-Ma7 was highly lethal with significant lowest LD50 value of 2.6%.The enzyme activity of IWST-Ma7 was highest for chitinase,CDA,protease and lipase viz.,1.90 U/mg,1.80 U/mg,0.98 U/mg and 0.80 U/mg respectively.However the enzyme activity of chitinase and Chitin deacetylase assay for all the isolates was significantly higher than protease and lipase activity.The ITS regions (5.8S rDNA and 28S rDNA) of seven isolates of M.anisopliae were amplified using the ITS1 and ITS4 primers which was a unique fragment of approximately 550 bp.Based on ITS regions,phylogenetic tree have been constructed and the isolates have been grouped in to 5 clades.The virulence and mycotoxic effects of different isolates could rationally be used to employ them for the management of the mahogany borer.

  14. The Mormon cricket, an old threat in modern day western USA:A search for fungal pathogens%美国西部重要害虫摩门螽斯病原真菌的研究

    Institute of Scientific and Technical Information of China (English)

    唐诺德·罗伯茨; Drauzio E N Rangel; Chad A Keyser; Helen G Bignayan; Seth J Dettenmaier; Everton K K Fernandes; Mark P Miller; Edward W Evans

    2007-01-01

    The Mormon cricket (MC),Anabrus simplex (Orthoptera:Tettigoniidae),has a long and negative history with agriculture in the western states of the USA where MC often migrates in large groups and causes significant damage to forage plants and cultivated crops.In this review, virulence to MC of isolates of the insect-pathogenic fungus Metarhizium anisopliae varieties acridum and anisopliae were compared in an effort to identify isolates with promise for use as MC biological control agents.All of the isolates tested induced 100% or nearly 100% mortality by six days post application of the fungal conidia.Searches for new Metarhizium isolates with high heat and UV-B tolerance included isolation fungi from field-caught MC and grasshopper after they died in the laboratory and culturing fungi from soil samples collected from numerous western USA sites.The survey was preceded by development of a dodine based selective medium that,at 0.002% active ingredient,permitted growth of M.anisopliae var.acridum,but inhibited most contaminating fungi.The M.anisopliae var.acridum isolates examined to date have much higher tolerance to heat and UV-B irradiation than M.anisopliae var.anisopliae isolates,and this may be critical to successful field applications.The variety acridum has not yet been found in the USA,so our search for such isolates continues.Several new M.anisopliae var.anisopliae and Beauveria spp.were found,and the Metarhizium isolates are being characterized as to stress tolerance and virulence to insects.Characterization includes comparisons of new and pre-existing Metarhizium isolates by amplified fragment-length polymorphism (AFLP) analysis.Finally, experiments on MC developmental biology were conducted to gather data needed to develop a degree day model and to establish laboratory colonies of MC.

  15. Density, Viability Conidia And Symptoms of Metarhizium anisopliae infection on Oryctes rhinoceros larvae

    Science.gov (United States)

    Indriyanti, D. R.; Putri, R. I. P.; Widiyaningrum, P.; Herlina, L.

    2017-04-01

    M. anisopliae is parasitic fungus on insect pests; it is used as a biocontrol agent. M. anisopliae can be propagated on maize or rice substrate. M. anisopliae is currently sold in the form of kaolin powder formulations. Before it is used to check the density, viability and pathogenicity of M. anisopliae. However the problem is the kaolin powder very soft, so it difficult to distinguish between kaolin and conidia. This article gives information on how to calculate conidia density, viability and symptoms of M. anisopliae infection on Oryctes rhinoceros larvae. The study was conducted in the laboratory to determine the density and viability. The pathogenicity testing was done using pots. The Pot is containing soil substrate mixed with M. Anispoliae and ten tails O. Rhinoceros larvae per pot. The results showed that the density of M. anisopliae conidia was 1.81 x 108 conidia mL-1 and the viability was 94% within 24 hours. The larval mortality began to emerge in the 1st week, and all larvae died at the sixth week. The symptom of M. anisopliae infection on Oryctes rhinoceros larvae, there was a black spot on the larval integument. The larvae movements become slow and poor appetite; it will die within 3-7 days. The larvae die hard, and the white hyphae grow on the body surface that turns green.

  16. [Fungal keratitis].

    Science.gov (United States)

    Bourcier, T; Sauer, A; Letscher-Bru, V; Candolfi, E

    2011-10-01

    Fungal keratitis (keratomycosis) is a rare but severe cause of infectious keratitis. Its incidence is constant, due to steroids or immunosuppressive treatments and contact lenses. Pathogens often invade corneas with chronic diseases of the ocular surface but fungal keratitis is also observed following injuries with plant foreign objects. The poor prognosis of these infections is related both to fungal virulence, decreased host defense, as well as delays in diagnosis. However, new antimycotic treatments allow better management and prognosis.

  17. External development of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae in the subterranean termite Heterotermes tenuis Desenvolvimento dos fungos entomopatogênicos Beauveria bassiana E Metarhizium anisopliae no cupim subterrâneo Heterotermes tenuis

    Directory of Open Access Journals (Sweden)

    Alcides Moino Jr.

    2002-06-01

    Full Text Available The subterranean termite Heterotermes tenuis is one of the main pests of sugarcane and eucalyptus in Brazil, and the use of entomopathogenic fungi, alone or associated to chemicals, is an efficient and environmentally favorable method for its control. Studies related to the fungal development on these insects are important due to the effect of insect behavior on entomopathogens. The objective of this work was to describe the external development of Beauveria bassiana and Metarhizium anisopliae on H. tenuis using Scanning Electron Microscopy (SEM, determining the duration of the different phases of fungal infection. Two fixation techniques for preparing SEM samples were also evaluated. Worker specimens of H. tenuis were inoculated with a 1 x 10(9 conidia mL-1 suspension of the fungi and maintained at 25±1ºC and 70±10% relative humidity. Insects were collected from 0 to 144 hours after inoculation and prepared on SEM stubs for each of the two fixation techniques. The results obtained with the two techniques were compared and duration of the different phases of the infection process were estimated from SEM observations and compared for three fungal isolates. B. bassiana and M. anisopliae have similar development cycles on the termite, but some important differences exist. The penetration, colonization and conidiogenesis phases are relatively faster for M. anisopliae than for B. bassiana, which results in a faster rate of insect mortality. The fixation technique with OsO4 vapor is suitable for preparation of insects to be used in SEM observation of the developmental stages of entomopathogenic fungi.O cupim subterrâneo Heterotermes tenuis , uma das principais pragas da cana-de-açúcar e eucalipto no Brasil, e o uso de fungos entomopatogênicos, isoladamente ou associados a produtos químicos, é um método eficiente e ambientalmente seguro para seu controle. Estudos relacionados ao desenvolvimento fúngico nestes insetos são importantes devido

  18. Resuscitation effects of catalase on airborne bacteria.

    OpenAIRE

    Marthi, B; Shaffer, B. T.; Lighthart, B; Ganio, L

    1991-01-01

    Catalase incorporation into enumeration media caused a significant increase (greater than 63%) in the colony-forming abilities of airborne bacteria. Incubation for 30 to 60 min of airborne bacteria in collection fluid containing catalase caused a greater than 95% increase in colony-forming ability. However, catalase did not have any effects on enumeration at high relative humidities (80 to 90%).

  19. Neem oil increases the efficiency of the entomopathogenic fungus Metarhizium anisopliae for the control of Aedes aegypti (Diptera: Culicidae) larvae.

    Science.gov (United States)

    Gomes, Simone A; Paula, Adriano R; Ribeiro, Anderson; Moraes, Catia O P; Santos, Jonathan W A B; Silva, Carlos P; Samuels, Richard I

    2015-12-30

    Entomopathogenic fungi are potential candidates for use in integrated vector management and many isolates are compatible with synthetic and natural insecticides. Neem oil was tested separately and in combination with the entomopathogenic fungus Metarhizium anisopliae against larvae of the dengue vector Aedes aegypti. Our aim was to increase the effectiveness of the fungus for the control of larval mosquito populations. Commercially available neem oil was used at concentrations ranging from 0.0001 to 1%. Larval survival rates were monitored over a 7 day period following exposure to neem. The virulence of the fungus M. anisopliae was confirmed using five conidial concentrations (1 × 10(5) to 1 × 10(9) conidia mL(-1)) and survival monitored over 7 days. Two concentrations of fungal conidia were then tested together with neem (0.001%). Survival curve comparisons were carried out using the Log-rank test and end-point survival rates were compared using one-way ANOVA. 1% neem was toxic to A. aegypti larvae reducing survival to 18% with S50 of 2 days. Neem had no effect on conidial germination or fungal vegetative growth in vitro. Larval survival rates were reduced to 24% (S50 = 3 days) when using 1 × 10(9) conidia mL(-1). Using 1 × 10(8) conidia mL(-1), 30% survival (S50 = 3 days) was observed. We tested a "sub-lethal" neem concentration (0.001%) together with these concentrations of conidia. For combinations of neem + fungus, the survival rates were significantly lower than the survival rates seen for fungus alone or for neem alone. Using a combination of 1 × 10(7) conidia mL(-1) + neem (0.001%), the survival rates were 36%, whereas exposure to the fungus alone resulted in 74% survival and exposure to neem alone resulted in 78% survival. When using 1 × 10(8) conidia mL(-1), the survival curves were modified, with a combination of the fungus + neem resulting in 12% survival, whilst the fungus alone at this concentration also

  20. DNA polymorphism and total protein in mutants of Metarhizium anisopliae var. Anisopliae (Metsch.) Sorokin strain E9 Polimorfismo de DNA e proteína total em mutantes da linhagem E9 de Metarhizium anisopliae var. anisopliae (Metsch.) Sorokin

    OpenAIRE

    Laurineide Lopes de Carvalho Freire; Ana Bolena Lima da Costa; Larissa Brandão Góes; Neiva Tinti de Oliveira

    2001-01-01

    Five mutants (MaE10, MaE27, MaE24, MaE41 e MaE49) of Metarhizium anisopliae wild strain E9 were analysed for DNA profile through the RAPD technique and for changes in total protein content by spectrophotometry, polyacrylamide gel electrophoresis and densitometry. The pattern of RAPD markers showed genetic polymorphism among the strains: out of twenty primers seven were selected, producing 113 bands. Forty seven bands were present in all strains (41.6% of monomorphic bands) and 66 showed polym...

  1. Efficacy of Metarhizium anisopliae in controlling the two-spotted spider mite Tetranychus urticae on common bean in screenhouse and field experiments.

    Science.gov (United States)

    Bugeme, David Mugisho; Knapp, Markus; Ekesi, Sunday; Chabi-Olaye, Adenirin; Boga, Hamadi Iddi; Maniania, Nguya Kalemba

    2015-02-01

    The efficacy of aqueous and emulsifiable formulations of the fungus Metarhizium anisopliae isolate ICIPE78 was evaluated on the population density of Tetranychus urticae infesting common bean plants under screenhouse and field conditions. Synthetic acaricide abamectin was included as a check. Bean plants were artificially infested with T. urticae and allowed to multiply. Three treatments were applied in the screenhouse and 1 treatment in field trials. Mite density was recorded 2 d before spraying and weekly postspraying. The number of pods per plant, number of seeds per pod, and the dry weight of seeds per plant were recorded only in the screenhouse trials. In both screenhouse and field trials, fungal formulations applied at the concentration of 10(8) conidia/mL and the acaricide reduced the population density of mites as compared to the controls. There were significant differences in T. urticae population densities between the treatments at the various post-spraying sampling dates. In the screenhouse, the mite densities were near zero from 3-week postspraying in the treated leaves. At 4-week postspraying, there were no more leaves in the untreated control (T1) and in the control water + Silwet-L77 (T2). Fungal formulations were as effective as abamectin in reducing mite densities in both screenhouse and field experiments. There were significant differences in the production parameters during the 2 screenhouse trials, with fungal and abamectin treatments generally having the highest yield. Results of this study underline the potential of the M. anisopliae isolate ICIPE78 as an alternative to acaricides for T. urticae management.

  2. DNA polymorphism and total protein in mutants of Metarhizium anisopliae var. Anisopliae (Metsch.) Sorokin strain E9

    OpenAIRE

    Freire,Laurineide Lopes de Carvalho; Costa,Ana Bolena Lima da; Góes,Larissa Brandão; Oliveira,Neiva Tinti de

    2001-01-01

    Five mutants (MaE10, MaE27, MaE24, MaE41 e MaE49) of Metarhizium anisopliae wild strain E9 were analysed for DNA profile through the RAPD technique and for changes in total protein content by spectrophotometry, polyacrylamide gel electrophoresis and densitometry. The pattern of RAPD markers showed genetic polymorphism among the strains: out of twenty primers seven were selected, producing 113 bands. Forty seven bands were present in all strains (41.6% of monomorphic bands) and 66 showed polym...

  3. Efeito de Metarhizium anisopliae (Metsch. Sorok. e Beauveria bassiana (Bals. Vuill. sobre adultos de Oomyzus sokolowskii (Kurdjumov (Hymenoptera: Eulophidae = Effect of Metarhizium anisopliae (Metsch. Sorok. and Beauveria bassiana (Bals. Vuill. on adults of Oomyzus sokolowskii (Kurdjumov (Hymenoptera: Eulophidae

    Directory of Open Access Journals (Sweden)

    Hugo José Gonçalves dos Santos Júnior

    2006-04-01

    Full Text Available Avaliou-se a seletividade dos fungos Metarhizium anisopliae (Metsch. Sorok. e Beauveria bassiana (Bals. Vuill. sobre adultos do parasitóide Oomyzus sokolowskii (Kurdjumov. Foram utilizados os isolados Esalq 447 de B. bassiana e E9 de M. anisopliae, na concentração de 107 conídios mL-1. Os resultados mostraram que B. bassiana e M. anisopliae não reduziram a longevidade média do parasitóide. B. bassiana proporcionou porcentagem de mortalidade total de 26% e porcentagem de mortalidade confirmada de 21%, já M.anisopliae causou mortalidade total de 15% e confirmada de 9%, demonstrando que M. anisopliae foi menos agressivo. Portanto, em função dos resultados apresentados, a implementação no manejo integrado de P. xylostella com M. anisopliae, B. bassiana e O.sokolowskii pode ser uma excelente alternativa para otimizar o sistema produtivo das brássicas.The selectivity of the fungi Metarhizium anisopliae (Metsch. Sorok. and Beauveria bassiana (Bals. Vuill. to adults of the parasitoid Oomyzus sokolowskii (Kurdjumov was evaluated. The isolates E9 of M. anisopliae and Esalq 447 of B. bassiana were used at the concentration of 107 conidia mL-1. The results showed that B. bassiana and M. anisopliae reduced significantly the mean longevity of the adults about 6.7 and 4.7 days respectively. B. bassiana induced 26% and 21% of total and confirmed mortalities, respectively, while M. anisopliae caused 15% and 9% of total and confirmedmortalities, showing that the isolate of M. anisopliae was less aggressive. Therefore, in function of the presented results the combination of M. anisopliae, B. bassiana, and O. sokolowskii in the integrated management of P. xylostella may be an excellent alternative for optimizing the cabbage growing system.

  4. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae

    NARCIS (Netherlands)

    Bukhari, S.T.; Takken, W.; Koenraadt, C.J.M.

    2011-01-01

    Background The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of app

  5. Patogenicidade de Metarhizium anisopliae var. anisopliae, Metarhizium flavoviride var. flavoviride e Beauveria bassiana a Nasutitermes coxipoensis (Isoptera: Termitidae) em cana-de-açúcar e compatibilidade com inseticidas químicos

    OpenAIRE

    2005-01-01

    Metarhizium anisopliae var. anisopliae, Metarhizium flavoviride var. flavoviride e Beauveria bassiana têm ação comprovada contra diversas espécies de insetos. Os cupins podem ser infectados por esses fungos naturalmente. Avaliou-se a ação desses fungos sobre Nasutitermes coxipoensis em laboratório e quantificou-se a produção de conídios nos insetos mortos. A compatibilidade de M. anisopliae var. anisopliae reisolado de N. coxipoensis com os inseticidas fipronil, imidaclopride e ensossulfan fo...

  6. Susceptibility of the tick Haemaphysalis qinghaiensis to isolates of the fungus Metarhizium anisopliae in China.

    Science.gov (United States)

    Ren, Qiaoyun; Sun, Ming; Guan, Guiquan; Liu, Zhijie; Chen, Ze; Liu, Aihong; Li, Youquan; Ma, Miling; Yang, Jifei; Niu, Qingli; Liu, Junlong; Han, Xueqing; Yin, Hong; Luo, Jianxun

    2014-10-01

    Haemaphysalis qinghaiensis, a prevalent tick species in China, causes severe economic losses. In this study, we investigated the pathogenicity of six isolates of the fungus Metarhizium anisopliae to engorged female H. qinghaiensis using concentrations of 10(6), 10(7) and 10(8) conidia ml(-1). The results indicated that M.aAT08 and M.aAT13 isolates were highly virulent against the ticks. Metarhizium anisopliae has potential for biocontrol of H. qinghaiensis.

  7. Pathogenicity of entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Zhioua, E.; Browning, M.; Johnson, P.W.; Ginsberg, H.S.; LeBrun, R.A.

    1997-01-01

    The entomopathogenic fungus Metarhizium anisopliae is highly pathogenic to the black-legged tick, Ixodes scapularis. Spore concentrations of 108/ml for engorged larvae and 107/ml for engorged females resulted in 100% tick mortality, 2 wk post-infection. The LC50 value for engorged larvae (concentration to kill 50% of ticks) was 107 spores/ml. Metarhizium anisopliae shows considerable potential as a microbial control agent for the management of Ixodes scapularis.

  8. The Role of Catalase in Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    Takigawa Tomoko

    2010-12-01

    Full Text Available Abstract Background Catalase is preferentially expressed in bronchiolar and alveolar epithelial cells, and acts as an endogenous antioxidant enzyme in normal lungs. We thus postulated epithelial damage would be associated with a functional deficiency of catalase during the development of lung fibrosis. Methods The present study evaluates the expression of catalase mRNA and protein in human interstitial pneumonias and in mouse bleomycin-induced lung injury. We examined the degree of bleomycin-induced inflammation and fibrosis in the mice with lowered catalase activity. Results In humans, catalase was decreased at the levels of activity, protein content and mRNA expression in fibrotic lungs (n = 12 compared to control lungs (n = 10. Immunohistochemistry revealed a decrease in catalase in bronchiolar epithelium and abnormal re-epithelialization in fibrotic areas. In C57BL/6J mice, catalase activity was suppressed along with downregulation of catalase mRNA in whole lung homogenates after bleomycin administration. In acatalasemic mice, neutrophilic inflammation was prolonged until 14 days, and there was a higher degree of lung fibrosis in association with a higher level of transforming growth factor-β expression and total collagen content following bleomycin treatment compared to wild-type mice. Conclusions Taken together, these findings demonstrate diminished catalase expression and activity in human pulmonary fibrosis and suggest the protective role of catalase against bleomycin-induced inflammation and subsequent fibrosis.

  9. Different Effects of Metarhizium anisopliae Strains IMI330189 and IBC200614 on Enzymes Activities and Hemocytes of Locusta migratoria L.

    Science.gov (United States)

    Cao, Guangchun; Jia, Miao; Zhao, Xia; Wang, Lei; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Zhang, Zehua

    2016-01-01

    Background Metarhizium is an important class of entomopathogenic fungi in the biocontrol of insects, but its virulence is affected by insect immunity. To clarify the mechanism in virulence of Metarhizium, we compared the immunological differences in Locusta migratoria L. when exposed to two strains of Metarhizium anisopliae (Ma). Results The virulence of Ma IMI330189 was significantly higher than that of Ma IBC200614 to locust, and IMI330189 overcame the hemocytes and began destroying the hemocytes of locust at 72 h after spray, while locust is immune to IBC200614. IMI330189 could overcome the humoral immunity of locust by inhibiting the activities of phenol oxidase (PO), esterases, multi-function oxidases (MFOs) and acetylcholinesterases in locust while increasing the activities of glutathione-S-transferases (GSTs), catalase and aryl-acylamidase (AA). However IBC200614 inhibit the activities of GSTs and AA in locust and increase the activities of MFOs, PO, superoxide dismutase, peroxidase and chitinase in locust. The changes of enzymes activities in period of infection showed that the time period between the 2nd and the 5th day after spray is critical in the pathogenic process. Conclusion These results found the phenomenon that Ma initiatively broke host hemocytes, revealed the correlation between the virulence of Ma and the changes of enzymes activities in host induced by Ma, and clarified the critical period in the infection of Ma. So, these results should provide guidance for the construction of efficient biocontrol Ma strains. PMID:27227835

  10. Different Effects of Metarhizium anisopliae Strains IMI330189 and IBC200614 on Enzymes Activities and Hemocytes of Locusta migratoria L.

    Directory of Open Access Journals (Sweden)

    Guangchun Cao

    Full Text Available Metarhizium is an important class of entomopathogenic fungi in the biocontrol of insects, but its virulence is affected by insect immunity. To clarify the mechanism in virulence of Metarhizium, we compared the immunological differences in Locusta migratoria L. when exposed to two strains of Metarhizium anisopliae (Ma.The virulence of Ma IMI330189 was significantly higher than that of Ma IBC200614 to locust, and IMI330189 overcame the hemocytes and began destroying the hemocytes of locust at 72 h after spray, while locust is immune to IBC200614. IMI330189 could overcome the humoral immunity of locust by inhibiting the activities of phenol oxidase (PO, esterases, multi-function oxidases (MFOs and acetylcholinesterases in locust while increasing the activities of glutathione-S-transferases (GSTs, catalase and aryl-acylamidase (AA. However IBC200614 inhibit the activities of GSTs and AA in locust and increase the activities of MFOs, PO, superoxide dismutase, peroxidase and chitinase in locust. The changes of enzymes activities in period of infection showed that the time period between the 2nd and the 5th day after spray is critical in the pathogenic process.These results found the phenomenon that Ma initiatively broke host hemocytes, revealed the correlation between the virulence of Ma and the changes of enzymes activities in host induced by Ma, and clarified the critical period in the infection of Ma. So, these results should provide guidance for the construction of efficient biocontrol Ma strains.

  11. Fungal rhinosinusitis.

    Science.gov (United States)

    Netkovski, J; Shirgoska, B

    2012-01-01

    Fungi are a major part of the ecosystem. In fact, over 250 fungal species have been reported to produce human infections. More than ever, fungal diseases have emerged as major challenges for physicians and clinical microbiologists. The aim of this study was to summarize the diagnostic procedures and endoscopic surgical treatment of patients with fungal rhinosinusitis. Eleven patients, i.e. 10% of all cases with chronic inflammation of paranasal sinuses, were diagnosed with fungal rhinosinusitis. Ten of them were patients with a noninvasive form, fungus ball, while only one patient was classified in the group of chronic invasive fungal rhinosinusitis which was accompanied with diabetes mellitus. All patients underwent nasal endoscopic examination, skin allergy test and had preoperative computed tomography (CT) scans of the sinuses in axial and coronal plane. Functional endoscopic sinus surgery was performed in 10 patients with fungus ball, while a combined approach, endoscopic and external, was done in the immunocompromised patient with the chronic invasive form of fungal rhinosinusitis. Most cases (9/11) had unilateral infection. In 9 cases infection was restricted to a single sinus, and here the maxillary sinus was most commonly affected (8/9) with infections in other patients being restricted to the sphenoid sinus (1/9). Two patients had infections affecting two or more sinuses. In patients with an invasive form of the fungal disease there was involvement of the periorbital and orbital tissues. In patients with fungus ball the mycelia masses were completely removed from the sinus cavities. Long-term outcome was positive in all the operated patients and no recurrence was detected. The most frequent fungal agent that caused rhinosinusitis was Aspergillus. Mucor was identified in the patient with the invasive form. Endoscopic examination of the nasal cavity and CT scanning of paranasal sinuses followed by endoscopic sinus surgery were represented as valuable

  12. Selectivity of Metarhizium anisopliae and Beauveria bassiana (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Hymenoptera: Braconidae).

    Science.gov (United States)

    Rossoni, Camila; Loureiro, Elisângela De Souza; Pereira, Fabricio Fagundes; Kassab, Samir Oliveira; Costa, Daniele Perassa; Barbosa, Rogério Hidalgo

    2014-01-01

    Understanding mortality patterns and interactions between entomopathogenic fungi and parasitoids is important to improve insect biological control programs. The aim of this study was to evaluate the effect of Metarhizium anisopliae (Metschnikoff, 1879) Sorokin, 1833 and Beauveria bassiana (Balsamo) Vuillemin, 1912 (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Cameron, 1891) (Hymenoptera: Braconidae) with biological insecticides Biometha WP Plus (M. anisopliae), Biovéria G (B. bassiana), Boverril WP (B. bassiana), Metarril WP (M. anisopliae), and Metie WP (M. anisopliae) at concentrations of 1 x 10(9) conidia (con).mL(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1). In the experimental, 10 females of C. flavipes were packed in disposable cups capped with a contact surface (filter paper, 9 cm2) treated with commercial product. The experimental design was completely randomized, with 16 treatments and five replicates of 10 females each. Mortality was assessed at 24, 48, 72, 96, and 120 hours after exposition (HAE) of the products. In general, B. bassiana and M. anisopliae in the concentrations of 1 x 10(9) con.ml(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1) can't affect C. flavipes females because the peak of mortality in treatments with bioinsecticides was similar to the control and this demonstrated the selectivity of fungi B. bassiana and M. anisopliae on C. flavipes females.

  13. Commercial formulation of Metarhizium anisopliae for the control of Rhipicephalus microplus in a pen study.

    Science.gov (United States)

    Camargo, Mariana G; Marciano, Allan F; Sá, Fillipe A; Perinotto, Wendell M S; Quinelato, Simone; Gôlo, Patrícia S; Angelo, Isabele C; Prata, Márcia C A; Bittencourt, Vânia R E P

    2014-09-15

    The present study evaluated, for the first time, the effect of the commercial formulation Metarril(®) SP Organic of Metarhizium anisopliae plus 10% mineral oil to control Rhipicephalus microplus in a pen study. Three groups were formed with six animals each: the first group was exposed to Metarril(®) plus 10% mineral oil and 1% Tween 80; the second group was exposed to sterile distilled water, mineral oil and Tween 80 (oil control group); and the third group received no treatment (control group). The fungal formulation contained 1 × 10(8)conidiaml(-1). Each animal was sprayed with 3L of formulation. Fallen ticks were counted daily and a sample of 20 engorged females per day was incubated for assessment of biological parameters. Throughout the study period, Metarril(®) oil-based formulation showed an efficacy ranging from 19.20% to 67.39% in comparison with the control group; and from 8.18% to 61.38% in comparison with the oil control group. The average efficacy of Metarril(®) oil-based formulation was 47.74% and 40.89% in comparison with control and oil control groups, respectively. Changes in the biological parameters of engorged R. microplus females were observed in the first three days after treatment, with a significant reduction in hatching percentage and egg production index. We concluded that Metarril(®) SP Organic plus 10% mineral oil was efficient against R. microplus in pen studies. However, further in vivo studies are required to increase the efficacy and to establish a protocol for the use of this product in the field against the cattle tick.

  14. Fungal allergens.

    OpenAIRE

    1995-01-01

    Airborne fungal spores occur widely and often in far greater concentrations than pollen grains. Immunoglobulin E-specific antigens (allergens) on airborne fungal spores induce type I hypersensitivity (allergic) respiratory reactions in sensitized atopic subjects, causing rhinitis and/or asthma. The prevalence of respiratory allergy to fungi is imprecisely known but is estimated at 20 to 30% of atopic (allergy-predisposed) individuals or up to 6% of the general population. Diagnosis and immuno...

  15. Interactions between isolates of the entomopathogenic fungus Metarhizium anisopliae and the entomopathogenic nematode Heterorhabditis bacteriophora JPM4 during infection of the sugar cane borer Diatraea saccharalis (Lepidoptera: Pyralidae).

    Science.gov (United States)

    Acevedo, Juan Pablo Molina; Samuels, Richard Ian; Machado, Inês Ribeiro; Dolinski, Claudia

    2007-10-01

    Interactions between the nematode Heterorhabditis bacteriophora isolate JPM4 and the fungus Metarhizium anisopliae, isolates LPP45 and LPP39, were studied during dual infections of Diatraea saccharalis. Mortality, production of infective juveniles (IJs) and production of conidia were evaluated. A positive effect was demonstrated for host mortality in duel infections of JPM4 and LPP39, causing 100% mortality with LT(50) and LT(95) values of 1.8 and 2.8 days, respectively. Higher values were seen when using the nematode or fungi individually. However, a combination of JPM4+LPP39 caused a significant reduction in IJ production. The results show that faster time to death, a moderately virulent fungal isolate could be combined with the nematode, however at the expense of IJ production.

  16. Virulence and Pre-Lethal Reproductive Effects of Metarhizium anisopliae var. anisopliae on Pseudococcus viburni (Hemiptera: Pseudococcidae Virulencia y Efectos Pre-Letales en la Reproducción de Metarhizium anisopliae var. anisopliae en Pseudococcus viburni (Hemiptera: Pseudococcidae

    Directory of Open Access Journals (Sweden)

    Aldo Pereira

    2011-12-01

    Full Text Available Obscure mealybug, Pseudococcus viburni (Signoret, is a cosmopolitan pest that causes damage by suction of vascular juices and the production of honeydew, as well as for being a quarantine insect. Within control options, entomopathogenic fungi are a good alternative, nevertheless, more research is needed. In this research, the Metarhizium anisopliae var. anisopliae (Metschnikoff isolate Qu-M984 was evaluated on P. viburni under laboratory conditions. Virulence was evaluated by lethal dose 50 (LD50 and lethal time 50 (LT50, for each of the four life stages of the female. The doses tested were 10(5, 10(6, 10(7 and 10(8 conidia mL-1. Also fecundity, egg size, fertility, and longevity of adult females were evaluated at doses of 10(5 and 10(6 conidia mL-1, the evaluations were made every 2 d throughout the insect life time. The LD50 and LT50 obtained were variable for each life stage, although without statistical differences among life stages (P > 0.05, ranging from LD50 = 7.3 x 10(5 to 4.9 x 10(9 conidia mL-1 and LT50 = 7.74 to 9.97 d at 10(8 conidia mL-1. Significant differences (P 0.05.Chanchito blanco de la vid, Pseudococcus viburni (Signoret, es una plaga cosmopolita que causa daños tanto por succión de jugos vasculares como por su producción de mielecilla, así como también por ser un insecto cuarentenario. Dentro de las opciones de control, hongos entomopatógenos son una buena alternativa, sin embargo, más investigación es necesaria. En esta investigación fue evaluado Metarhizium anisopliae var. anisopliae (Metschnikoff aislamiento Qu-M984 en P. viburni bajo condiciones de laboratorio. Fue evaluada virulencia según dosis letal 50 (LD50 y tiempo letal 50 (LT50 para cada uno de los cuatro estados de desarrollo de la hembra. Las dosis evaluadas fueron 10(5, 10(6, 10(7 y 10(8 conidias mL-1. Fecundidad, tamaño de huevos, fertilidad y longevidad de hembras adultas fueron evaluados con dosis 10(5 y 10(6 conidias mL-1, las evaluaciones fueron

  17. Cloning, characterization, and targeted disruption of cpcat1, coding for an in planta secreted catalase of Claviceps purpurea.

    Science.gov (United States)

    Garre, V; Müller, U; Tudzynski, P

    1998-08-01

    Claviceps purpurea has been shown to secrete catalases in axenic and parasitic culture. In order to determine the importance of these enzymes in the host-parasite interaction, especially their role in overcoming oxidative stress imposed on the pathogen by the plant's defense system, the catR gene from A. niger was used to isolate a putative catalase gene from a genomic library of C. purpurea, cpcat1 consists of an open reading frame of 2,148 bp that is interrupted by five introns. Its derived gene product shows significant homology to fungal catalases and contains a putative signal peptide of 19 amino acids and three putative N-glycosylation sites, which indicates that CPCAT1 is a secreted catalase. Disruption of the gene by a gene replacement approach resulted in the loss of two catalase isoforms, CATC and CATD, strongly suggesting that they are both encoded by cpcat1. CATD is the major secreted catalase of C. purpurea and is furthermore the only catalase present in the honeydew of infected rye ears. Deletion mutants of cpcat1 were inoculated on rye plants and showed no significant reduction in virulence. Ovarian tissue and honeydew of plants inoculated with the mutants lacked CATD, confirming that this catalase is not essential for colonization of the host tissue by C. purpurea.

  18. Behavioural effects of fungal infection by Metarhizium anisopliae in adult malaria mosquitoes

    NARCIS (Netherlands)

    Ondiaka, S.N.

    2012-01-01

    Malaria remains a major global health problem with the burden of disease greatest in Sub-Saharan Africa. The strategies for malaria control differ throughout the world according to levels of endemicity and the magnitude of disease but the focus remains either to control malaria parasites or vectors.

  19. Behavioural effects of fungal infection by Metarhizium anisopliae in adult malaria mosquitoes

    NARCIS (Netherlands)

    Ondiaka, S.N.

    2012-01-01

    Malaria remains a major global health problem with the burden of disease greatest in Sub-Saharan Africa. The strategies for malaria control differ throughout the world according to levels of endemicity and the magnitude of disease but the focus remains either to control malaria parasites or vectors.

  20. Fungal nail infection

    Science.gov (United States)

    Nails - fungal infection; Onychomycosis; Infection - fungal - nails; Tinea unguium ... hair, nails, and outer skin layers. Common fungal infections include: Athlete's foot Jock itch Ringworm on the ...

  1. Fungal keratitis

    Directory of Open Access Journals (Sweden)

    Sonal S Tuli

    2011-02-01

    Full Text Available Sonal S TuliUniversity of Florida, Gainesville, FL, USA  Clinical question: What is the most appropriate management of fungal keratitis?Results: Traditionally, topical Natamycin is the most commonly used medication for filamentous fungi while Amphotericin B is most commonly used for yeast. Voriconazole is rapidly becoming the drug of choice for all fungal keratitis because of its wide spectrum of coverage and increased penetration into the cornea.Implementation: Repeated debridement of the ulcer is recommended for the penetration of topical medications. While small, peripheral ulcers may be treated in the community, larger or central ulcers, especially if associated with signs suggestive of anterior chamber penetration should be referred to a tertiary center. Prolonged therapy for approximately four weeks is usually necessary.Keywords: fungal keratitis, keratomycosis, antifungal medications, debridement

  2. Heat-stressed Metarhizium anisopliae: Viability (in vitro) and virulence (in vivo) assessments against the tick Rhipicephalus sanguineus

    Science.gov (United States)

    The current study investigated the thermotolerance of Metarhizium anisopliae s.l. conidia from the commercial products Metarril® SP Organic and Metarril® WP. The efficacy of these M. anisopliae formulations against the tick Rhipicephalus sanguineus s.l. was studied in laboratory under optimum or hea...

  3. Characterization of Catalase from Psychrotolerant Psychrobacter piscatorii T-3 Exhibiting High Catalase Activity

    OpenAIRE

    Hidetoshi Matsuyma; Isao Yumoto; Hideyuki Kimoto; Kazuaki Yoshimune

    2012-01-01

    A psychrotolerant bacterium, strain T-3 (identified as Psychrobacter piscatorii), that exhibited an extraordinarily high catalase activity was isolated from the drain pool of a plant that uses H2O2 as a bleaching agent. Its cell extract exhibited a catalase activity (19,700 U·mg protein−1) that was higher than that of Micrococcus luteus used for industrial catalase production. Catalase was approximately 10% of the total proteins in the cell extract of the strain. The catalase (PktA) was purif...

  4. Selectivity of Beauveria bassiana and Metarrhizium anisopliae to Trichogramma pretiosum Riley (Hymenoptera: Trichogrammatidae); Seletividade de Beauveria bassiana e Metarhizium anisopliae a Trichogramma pretiosum Riley (Hymenoptera: Trichogrammatidae)

    Energy Technology Data Exchange (ETDEWEB)

    Potrich, Michele; Silva, Everton L. da; Neves, Pedro M.O.J. [Universidade Estadual de Londrina (UEL), PR (Brazil). Centro de Ciencias Agrarias], e-mail: profmichele@gmail.com, e-mail: evertonloz@gmail.com, e-mail: pedroneves@uel.br; Alves, Luis F.A.; Daros, Alaxsandra [Universidade do Oeste do Parana (UNIOESTE), Cascavel, PR (Brazil). Centro de Ciencias Biologicas e da Saude. Lab. de Zoologia de Invertebrados], e-mail: lfaalves@unioeste.br; Haas, Jucelaine; Pietrowski, Vanda [Universidade do Oeste do Parana (UNIOESTE), Marechal Candido Rondon, PR (Brazil). Centro de Ciencias Agrarias], e-mail: jubarth@gmail.com, e-mail: vandapietrowski@gmail.com

    2009-07-01

    Trichogramma pretiosum Riley and the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae are efficient biological control agents and are thought to be used jointly. In here, we investigated if these entomopathogens could have any side-effects on T. pretiosum. Therefore, 1 x 8 cards containing sterilized eggs of Anagasta kuehniella (Zeller) that were sprayed with 0.2 ml of B. bassiana or M. anisopliae (1.0 X 10{sup 9} conidia/ml) were offered to a T. pretiosum female for 24h (30 cards/fungus = 30 replicates). Afterwards, females were isolated in glass tubes. The control group was sprayed with sterile distillated water + Tween 80 (0.01%). In addition, 60 cards with sterilized eggs of A. kuehniella were submitted to parasitism by females of T. pretiosum for 24h. Of these cards, 30 were sprayed with B. bassiana or M. anisopliae and 30 with distillated water + Tween 80 (0.01%), and observed daily until parasitoid emergence. Metarhizium anisopliae decreased parasitoid emergence and caused confirmed mortality. Therefore, field and semi-field experiments should be conducted for a final assessment of the side-effects of these entomopathogens on Trichogramma as a ways to develop a control strategy in which both can be used. (author)

  5. Efficacy of water- and oil-in-water-formulated Metarhizium anisopliae in Rhipicephalus sanguineus eggs and eclosing larvae.

    Science.gov (United States)

    Luz, Christian; D'Alessandro, Walmirton Bezerra; Rodrigues, Juscelino; Fernandes, Éverton Kort Kamp

    2016-01-01

    Conidia of the entomopathogenic fungus Metarhizium anisopliae (Ascomycota: Clavicipitaceae) were assessed against Rhipicephalus sanguineus (Arachnida: Ixodidae) eggs under laboratory conditions. Clusters of 25 eggs were applied either directly with the fungal conidial formulations or set on previously fungus-treated filter paper. Treatments consisted of conidia formulated in water or an oil-in-water emulsion at final concentrations of 3.3 × 10(3), 10(4), 3.3 × 10(4), 10(5), or 3.3 × 10(5) conidia/cm(2). The development of mycelium and new conidia on egg clusters incubated at 25 °C and humidity close to saturation depended on conidial concentration, formulation, and application technique. No larvae eclosed from eggs after direct applications of conidia regardless of the formulation. The eclosion and survival of larvae from indirectly treated egg clusters depended on the type of formulation and conidial concentration applied. Oil-in-water formulations of conidia demonstrated the highest activity against eggs of R. sanguineus.

  6. Ethanol production from chitosan by the nematophagous fungus Pochonia chlamydosporia and the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana.

    Science.gov (United States)

    Aranda-Martinez, Almudena; Naranjo Ortiz, Miguel Ángel; Abihssira García, Isabel Sofía; Zavala-Gonzalez, Ernesto A; Lopez-Llorca, Luis Vicente

    2017-11-01

    Chitin is the second most abundant biopolymer after cellulose and virtually unexplored as raw material for bioethanol production. In this paper, we investigate chitosan, the deacetylated form of chitin which is the main component of shellfish waste, as substrate for bioethanol production by fungi. Fungal parasites of invertebrates such as the nematophagous Pochonia chlamydosporia (Pc) or the entomopathogens Beauveria bassiana (Bb) and Metarhizium anisopliae (Ma) are biocontrol agents of plant parasitic nematodes (eg. Meloidogyne spp.) or insect pests such as the red palm weevil (Rhynchophorus ferrugineus). These fungi degrade chitin-rich barriers for host penetration. We have therefore tested the chitin/chitosanolytic capabilities of Pc, Bb and Ma for generating reducing sugars using chitosan as only nutrient. Among the microorganisms used in this study, Pc is the best chitosan degrader, even under anaerobic conditions. These fungi have alcohol dehydrogenase (ADH) and pyruvate decarboxylase (PDC) encoding genes in their genomes. We have therefore analyzed their ethanol production under anaerobic conditions using chitosan as raw material. P. chlamydosporia is the largest ethanol producer from chitosan. Our studies are a starting point to develop chitin-chitosan based biofuels. Copyright © 2017 Elsevier GmbH. All rights reserved.

  7. Fungal prions.

    Science.gov (United States)

    Staniforth, Gemma L; Tuite, Mick F

    2012-01-01

    For both mammalian and fungal prion proteins, conformational templating drives the phenomenon of protein-only infectivity. The conformational conversion of a protein to its transmissible prion state is associated with changes to host cellular physiology. In mammals, this change is synonymous with disease, whereas in fungi no notable detrimental effect on the host is typically observed. Instead, fungal prions can serve as epigenetic regulators of inheritance in the form of partial loss-of-function phenotypes. In the presence of environmental challenges, the prion state [PRION(+)], with its resource for phenotypic plasticity, can be associated with a growth advantage. The growing number of yeast proteins that can switch to a heritable [PRION(+)] form represents diverse and metabolically penetrating cellular functions, suggesting that the [PRION(+)] state in yeast is a functional one, albeit rarely found in nature. In this chapter, we introduce the biochemical and genetic properties of fungal prions, many of which are shared by the mammalian prion protein PrP, and then outline the major contributions that studies on fungal prions have made to prion biology.

  8. Fungal Entomopathogens

    Science.gov (United States)

    Fungal entomopathogens are important biological control agents worldwide and have been the subject of intense research for more than100 years. They exhibit both sexual and asexual reproduction and produce different types of infective propagules. Their mode of action against insects involves attachme...

  9. Growth of catalase A and catalase T deficient mutant strains of Saccharomyces cerevisiae on ethanol and oleic acid : Growth profiles and catalase activities in relation to microbody proliferation

    NARCIS (Netherlands)

    Klei, Ida J. van der; Rytka, Joanna; Kunau, Wolf H.; Veenhuis, Marten

    1990-01-01

    The parental strain (A+T+) of Saccharomyces cerevisiae and mutants, deficient in catalase T (A+T-), catalase A (A-T+) or both catalases (A-T-), grew on ethanol and oleic acid with comparable doubling times. Specific activities of catalase were low in glucose- and ethanol-grown cells. In the two olei

  10. DNA polymorphism and total protein in mutants of Metarhizium anisopliae var. Anisopliae (Metsch. Sorokin strain E9 Polimorfismo de DNA e proteína total em mutantes da linhagem E9 de Metarhizium anisopliae var. anisopliae (Metsch. Sorokin

    Directory of Open Access Journals (Sweden)

    Laurineide Lopes de Carvalho Freire

    2001-06-01

    Full Text Available Five mutants (MaE10, MaE27, MaE24, MaE41 e MaE49 of Metarhizium anisopliae wild strain E9 were analysed for DNA profile through the RAPD technique and for changes in total protein content by spectrophotometry, polyacrylamide gel electrophoresis and densitometry. The pattern of RAPD markers showed genetic polymorphism among the strains: out of twenty primers seven were selected, producing 113 bands. Forty seven bands were present in all strains (41.6% of monomorphic bands and 66 showed polymorphism (58.4%. The mean coefficient of similarity among all strains was 0.75 (75%. The total protein content varied, staining in the interval of 6.0-8.0 µg/µl. The electrophoresis analysis, through zymogram and protein fraction profiles by densitometry, allowed the observation of seven bands for the wild strain E9 and five bands for the mutants MaE10, MaE27, MaE34, MaE41 and MaE49, evidence of variations in µg% among protein fractions. The RAPD technique was very sensitive to detect genetic differences between the wild type and the mutants obtained through gamma radiation. The total protein analysis also showed changes in quantity and pattern of bands after electrophoresis in the mutants compared to the wild type.Foram analisados cinco mutantes MaE (MaE10, MaE27, MaE34, MaE41 e MaE49 da linhagem selvagem E9 de Metarhizium anisopliae var. anisopliae quanto ao perfil de DNA pela técnica de RAPD e também quanto ao conteúdo de proteína total por espectrometria e eletroforese em gel de poliacrilamida e densitometria. O padrão de marcadores de RAPD evidenciou polimorfismo nas amostras; dos 20 primers testados foram selecionados 7 que geraram 113 bandas. Deste total, 47 estavam presentes em todas as amostras (41.6% de bandas monomórficas e 66 mostraram polimorfismo (58.4%. O coeficiente médio de similaridade foi de 75%. O conteúdo de proteína total variou de 6 a 8 µg/µl. O zimograma e perfís das frações de proteínas obtidos por densitometria

  11. The three catalases in Deinococcus radiodurans: Only two show catalase activity.

    Science.gov (United States)

    Jeong, Sun-Wook; Jung, Jong-Hyun; Kim, Min-Kyu; Seo, Ho Seong; Lim, Heon-Man; Lim, Sangyong

    2016-01-15

    Deinococcus radiodurans, which is extremely resistant to ionizing radiation and oxidative stress, is known to have three catalases (DR1998, DRA0146, and DRA0259). In this study, to investigate the role of each catalase, we constructed catalase mutants (Δdr1998, ΔdrA0146, and ΔdrA0259) of D. radiodurans. Of the three mutants, Δdr1998 exhibited the greatest decrease in hydrogen peroxide (H2O2) resistance and the highest increase in intracellular reactive oxygen species (ROS) levels following H2O2 treatments, whereas ΔdrA0146 showed no change in its H2O2 resistance or ROS level. Catalase activity was not attenuated in ΔdrA0146, and none of the three bands detected in an in-gel catalase activity assay disappeared in ΔdrA0146. The purified His-tagged recombinant DRA0146 did not show catalase activity. In addition, the phylogenetic analysis of the deinococcal catalases revealed that the DR1998-type catalase is common in the genus Deinococcus, but the DRA0146-type catalase was found in only 4 of 23 Deinococcus species. Taken together, these results indicate that DR1998 plays a critical role in the anti-oxidative system of D. radiodurans by detoxifying H2O2, but DRA0146 does not have catalase activity and is not involved in the resistance to H2O2 stress.

  12. Characterization of Catalase from Psychrotolerant Psychrobacter piscatorii T-3 Exhibiting High Catalase Activity

    Directory of Open Access Journals (Sweden)

    Hidetoshi Matsuyma

    2012-02-01

    Full Text Available A psychrotolerant bacterium, strain T-3 (identified as Psychrobacter piscatorii, that exhibited an extraordinarily high catalase activity was isolated from the drain pool of a plant that uses H2O2 as a bleaching agent. Its cell extract exhibited a catalase activity (19,700 U·mg protein−1 that was higher than that of Micrococcus luteus used for industrial catalase production. Catalase was approximately 10% of the total proteins in the cell extract of the strain. The catalase (PktA was purified homogeneously by only two purification steps, anion exchange and hydrophobic chromatographies. The purified catalase exhibited higher catalytic efficiency and higher sensitivity of activity at high temperatures than M. luteus catalase. The deduced amino acid sequence showed the highest homology with catalase of Psycrobacter cryohalolentis, a psychrotolelant bacterium obtained from Siberian permafrost. These findings suggest that the characteristics of the PktA molecule reflected the taxonomic relationship of the isolate as well as the environmental conditions (low temperatures and high concentrations of H2O2 under which the bacterium survives. Strain T-3 efficiently produces a catalase (PktA at a higher rate than Exiguobacterium oxidotolerans, which produces a very strong activity of catalase (EktA at a moderate rate, in order to adapt to high concentration of H2O2.

  13. Isolation and Classification of Fungal Whitefly Entomopathogens from Soils of Qinghai-Tibet Plateau and Gansu Corridor in China.

    Science.gov (United States)

    Dong, Tingyan; Zhang, Bowen; Jiang, Yanfang; Hu, Qiongbo

    2016-01-01

    Qinghai-Tibet Plateau and Gansu Corridor of China with distinct geographic and climatic conditions are remote and less disturbed by humans, in which are likely to find some new strains of fungal entomopathogens against B-biotype whiteflies that is a very important invading pest worldwide. In this research, nineteen strains among six species of entomogenous fungi were isolated from the soil samples collected from 32 locations in Qinghai-Tibet Plateau and Gansu Corridor. From the data of isolation rates, it was indicated that the good biodiversity of entomogenous fungi was found in the soil covered good vegetations. On the contrary, no strains were isolated from the desert areas. In addition, the dominant species, Isaria fumosorosea and Metarhizium anisopliae var. anisopliae in the Qinghai-Tibet Plateau are different from the strains of other places based on ITS genetic homology analysis. It was verified that the Qinghai-Tibet Plateau area was less disturbed by human, and the fungi in this place exchanged less compared with other regional species. All of these strains showed the pathogenicity against the B-biotype whitefly with the mortality of more than 30%. However, a few strains of Paecilomyces lilacinus, Lecanicillium psalliotae, Aspergillus ustus, I. fumosorosea and M. anisopliae var. anisopliae had better virulence with LC50s of 0.36-26.44×106 spores/mL on post-treatment day 6-7. Especially, the L. psalliotae strain LpTS01 was the greatest virulence with LC50 of 0.36×106spores/mL and LT50 of 4.23d. Our research thus presents some new insights to discover new entomopathogenic fungal strains used for B-biotype whitefly biocontrol.

  14. Isolation and Classification of Fungal Whitefly Entomopathogens from Soils of Qinghai-Tibet Plateau and Gansu Corridor in China.

    Directory of Open Access Journals (Sweden)

    Tingyan Dong

    Full Text Available Qinghai-Tibet Plateau and Gansu Corridor of China with distinct geographic and climatic conditions are remote and less disturbed by humans, in which are likely to find some new strains of fungal entomopathogens against B-biotype whiteflies that is a very important invading pest worldwide. In this research, nineteen strains among six species of entomogenous fungi were isolated from the soil samples collected from 32 locations in Qinghai-Tibet Plateau and Gansu Corridor. From the data of isolation rates, it was indicated that the good biodiversity of entomogenous fungi was found in the soil covered good vegetations. On the contrary, no strains were isolated from the desert areas. In addition, the dominant species, Isaria fumosorosea and Metarhizium anisopliae var. anisopliae in the Qinghai-Tibet Plateau are different from the strains of other places based on ITS genetic homology analysis. It was verified that the Qinghai-Tibet Plateau area was less disturbed by human, and the fungi in this place exchanged less compared with other regional species. All of these strains showed the pathogenicity against the B-biotype whitefly with the mortality of more than 30%. However, a few strains of Paecilomyces lilacinus, Lecanicillium psalliotae, Aspergillus ustus, I. fumosorosea and M. anisopliae var. anisopliae had better virulence with LC50s of 0.36-26.44×106 spores/mL on post-treatment day 6-7. Especially, the L. psalliotae strain LpTS01 was the greatest virulence with LC50 of 0.36×106spores/mL and LT50 of 4.23d. Our research thus presents some new insights to discover new entomopathogenic fungal strains used for B-biotype whitefly biocontrol.

  15. Isolation and Classification of Fungal Whitefly Entomopathogens from Soils of Qinghai-Tibet Plateau and Gansu Corridor in China

    Science.gov (United States)

    Jiang, Yanfang; Hu, Qiongbo

    2016-01-01

    Qinghai-Tibet Plateau and Gansu Corridor of China with distinct geographic and climatic conditions are remote and less disturbed by humans, in which are likely to find some new strains of fungal entomopathogens against B-biotype whiteflies that is a very important invading pest worldwide. In this research, nineteen strains among six species of entomogenous fungi were isolated from the soil samples collected from 32 locations in Qinghai-Tibet Plateau and Gansu Corridor. From the data of isolation rates, it was indicated that the good biodiversity of entomogenous fungi was found in the soil covered good vegetations. On the contrary, no strains were isolated from the desert areas. In addition, the dominant species, Isaria fumosorosea and Metarhizium anisopliae var. anisopliae in the Qinghai-Tibet Plateau are different from the strains of other places based on ITS genetic homology analysis. It was verified that the Qinghai-Tibet Plateau area was less disturbed by human, and the fungi in this place exchanged less compared with other regional species. All of these strains showed the pathogenicity against the B-biotype whitefly with the mortality of more than 30%. However, a few strains of Paecilomyces lilacinus, Lecanicillium psalliotae, Aspergillus ustus, I. fumosorosea and M. anisopliae var. anisopliae had better virulence with LC50s of 0.36–26.44×106 spores/mL on post-treatment day 6–7. Especially, the L. psalliotae strain LpTS01 was the greatest virulence with LC50 of 0.36×106spores/mL and LT50 of 4.23d. Our research thus presents some new insights to discover new entomopathogenic fungal strains used for B-biotype whitefly biocontrol. PMID:27228109

  16. Immobilization of bovine catalase onto magnetic nanoparticles.

    Science.gov (United States)

    Doğaç, Yasemin İspirli; Teke, Mustafa

    2013-01-01

    The scope of this study is to achieve carrier-bound immobilization of catalase onto magnetic particles (Fe₃O₄ and Fe₂O₃NiO₂ · H₂O) to specify the optimum conditions of immobilization. Removal of H2O2 and the properties of immobilized sets were also investigated. To that end, adsorption and then cross-linking methods onto magnetic particles were performed. The optimum immobilization conditions were found for catalase: immobilization time (15 min for Fe₃O₄; 10 min for Fe2O₃NiO₂ · H₂O), the initial enzyme concentration (1 mg/mL), amount of magnetic particles (25 mg), and glutaraldehyde concentration (3%). The activity reaction conditions (optimum temperature, optimum pH, pH stability, thermal stability, operational stability, and reusability) were characterized. Also kinetic parameters were calculated by Lineweaver-Burk plots. The optimum pH values were found to be 7.0, 7.0, and 8.0 for free enzyme, Fe₃O₄-immobilized catalases, and Fe₂O₃NiO₂ · H₂O-immobilized catalases, respectively. All immobilized catalase systems displayed the optimum temperature between 25 and 35°C. Reusability studies showed that Fe₃O₄-immobilized catalase can be used 11 times with 50% loss in original activity, while Fe2O₃NiO₂ · H₂O-immobilized catalase lost 67% of activity after the same number of uses. Furthermore, immobilized catalase systems exhibited improved thermal and pH stability. The results transparently indicate that it is possible to have binding between enzyme and magnetic nanoparticles.

  17. Differential pathogenicity of Metarhizium anisopliae and the control of the sugarcane root spittlebug Mahanarva fimbriolata

    Directory of Open Access Journals (Sweden)

    Patricia Vieira Tiago

    2011-06-01

    Full Text Available In order to assess the effectiveness of Metarhizium anisopliae var. anisopliae (Metschnikoff Sorokin isolates in controlling the sugarcane root spittlebug Mahanarva fimbriolata (Stal (Hemiptera: Cercopidae, nine isolates obtained from a single geographical region were studied. 'Confirmed cumulative' and 'corrected cumulative' spittlebug mortality rates were measured for each of the isolates. Based on the confirmed mortality curve, the isolates URM5946, URM5951 and URM6033 were considered to be potentially the most effective in a biological control program for M. fimbriolata.

  18. Variation in the electrophoretic karyotype of Brazilian strains of Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Valadares-Inglis Maria Cléria

    1998-01-01

    Full Text Available Pulsed-field gel electrophoresis (PFGE was used to separate chromosome-sized DNA molecules of four strains of Metarhizium anisopliae from Brazil. Metarhizium anisopliae isolates from Japan have been reported as possessing seven chromosomes. Variation was observed among the Brazilian strains and the chromosomal DNA was resolved into eight bands for strain CG46. Densitometric analysis of PFGE gels suggested that the other three Brazilian strains also possess eight chromosomes, with two chromosomes migrating as doublets under the electrophoretic conditions used. The genome size was estimated as varying between 23.39 to 31.88 Mb, not including possible doublet chromosomes.

  19. Secondary metabolite gene clusters in the entomopathogen fungus Metarhizium anisopliae: genome identification and patterns of expression in a cuticle infection model

    Directory of Open Access Journals (Sweden)

    Nicolau Sbaraini

    2016-10-01

    Full Text Available Abstract Background The described species from the Metarhizium genus are cosmopolitan fungi that infect arthropod hosts. Interestingly, while some species infect a wide range of hosts (host-generalists, other species infect only a few arthropods (host-specialists. This singular evolutionary trait permits unique comparisons to determine how pathogens and virulence determinants emerge. Among the several virulence determinants that have been described, secondary metabolites (SMs are suggested to play essential roles during fungal infection. Despite progress in the study of pathogen-host relationships, the majority of genes related to SM production in Metarhizium spp. are uncharacterized, and little is known about their genomic organization, expression and regulation. To better understand how infection conditions may affect SM production in Metarhizium anisopliae, we have performed a deep survey and description of SM biosynthetic gene clusters (BGCs in M. anisopliae, analyzed RNA-seq data from fungi grown on cattle-tick cuticles, evaluated the differential expression of BGCs, and assessed conservation among the Metarhizium genus. Furthermore, our analysis extended to the construction of a phylogeny for the following three BGCs: a tropolone/citrinin-related compound (MaPKS1, a pseurotin-related compound (MaNRPS-PKS2, and a putative helvolic acid (MaTERP1. Results Among 73 BGCs identified in M. anisopliae, 20 % were up-regulated during initial tick cuticle infection and presumably possess virulence-related roles. These up-regulated BGCs include known clusters, such as destruxin, NG39x and ferricrocin, together with putative helvolic acid and, pseurotin and tropolone/citrinin-related compound clusters as well as uncharacterized clusters. Furthermore, several previously characterized and putative BGCs were silent or down-regulated in initial infection conditions, indicating minor participation over the course of infection. Interestingly, several up

  20. Catalase and NO CATALASE ACTIVITY1 promote autophagy-dependent cell death in Arabidopsis

    DEFF Research Database (Denmark)

    Hackenberg, Thomas; Juul, Trine; Auzina, Aija

    2013-01-01

    Programmed cell death often depends on generation of reactive oxygen species, which can be detoxified by antioxidative enzymes, including catalases. We previously isolated catalase-deficient mutants (cat2) in a screen for resistance to hydroxyurea-induced cell death. Here, we identify...... activities and showed that they carried mutations in a gene that we named NO CATALASE ACTIVITY1 (NCA1). nca1 mutants showed severely reduced activities of all three catalase isoforms in Arabidopsis, and loss of NCA1 function led to strong suppression of RPM1-triggered cell death. Basal and starvation...

  1. The combination of the entomopathogenic fungus Metarhizium anisopliae with the insecticide Imidacloprid increases virulence against the dengue vector Aedes aegypti (Diptera: Culicidae).

    Science.gov (United States)

    Paula, Adriano R; Carolino, Aline T; Paula, Cátia O; Samuels, Richard I

    2011-01-25

    Dengue fever transmitted by the mosquito Aedes aegypti, is one of the most rapidly spreading insect borne diseases, stimulating the search for alternatives to current control measures. The dengue vector A. aegypti has received less attention than anophelene species, although more than 2.5 billion people are at risk of infection worldwide. Entomopathogenic fungi are emerging as potential candidates for the control of mosquitoes. Here we continue our studies on the pathogenicity of the entomopathogenic fungus Metarhizium anisopliae against adult A. aegypti females. With the aim of further reducing mean survival times of A. aegypti exposed to fungus impregnated surfaces, a sub-lethal concentration of the neonicotinoid insecticide Imidacloprid (IMI) was added to fungal suspensions. A sub-lethal concentration of IMI that did not significantly alter the daily survival rates or mean survival percentages of mosquitoes was identified to be 0.1 ppm. This sub-lethal concentration was combined with M. anisopliae conidia (1 × 10(9) conidia mL(-1)). Both the combined treatment and the conidia alone were able to reduce the survival of A. aegypti compared with untreated or IMI treated mosquitoes. Importantly, mosquito survival following exposure to the combined treatment for 6 and 12 hrs was significantly reduced when compared with mosquitoes exposed to conidia alone. This is the first time that a combination of an insecticide and an entomopathogenic fungus has been tested against A. aegypti. Firstly, the study showed the potential of IMI as an alternative to the currently employed pyrethroid adulticides. Secondly, as an alternative to applications of high concentrations of chemical insecticides, we suggest that adult A. aegypti could be controlled by surface application of entomopathogenic fungi and that the efficiency of these fungi could be increased by combining the fungi with ultra-low concentrations of insecticides, resulting in higher mortality following relatively short

  2. The combination of the entomopathogenic fungus Metarhizium anisopliae with the insecticide Imidacloprid increases virulence against the dengue vector Aedes aegypti (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Samuels Richard I

    2011-01-01

    Full Text Available Abstract Background Dengue fever transmitted by the mosquito Aedes aegypti, is one of the most rapidly spreading insect borne diseases, stimulating the search for alternatives to current control measures. The dengue vector A. aegypti has received less attention than anophelene species, although more than 2.5 billion people are at risk of infection worldwide. Entomopathogenic fungi are emerging as potential candidates for the control of mosquitoes. Here we continue our studies on the pathogenicity of the entomopathogenic fungus Metarhizium anisopliae against adult A. aegypti females. With the aim of further reducing mean survival times of A. aegypti exposed to fungus impregnated surfaces, a sub-lethal concentration of the neonicotinoid insecticide Imidacloprid (IMI was added to fungal suspensions. Results A sub-lethal concentration of IMI that did not significantly alter the daily survival rates or mean survival percentages of mosquitoes was identified to be 0.1 ppm. This sub-lethal concentration was combined with M. anisopliae conidia (1 × 109 conidia mL-1. Both the combined treatment and the conidia alone were able to reduce the survival of A. aegypti compared with untreated or IMI treated mosquitoes. Importantly, mosquito survival following exposure to the combined treatment for 6 and 12 hrs was significantly reduced when compared with mosquitoes exposed to conidia alone. Conclusions This is the first time that a combination of an insecticide and an entomopathogenic fungus has been tested against A. aegypti. Firstly, the study showed the potential of IMI as an alternative to the currently employed pyrethroid adulticides. Secondly, as an alternative to applications of high concentrations of chemical insecticides, we suggest that adult A. aegypti could be controlled by surface application of entomopathogenic fungi and that the efficiency of these fungi could be increased by combining the fungi with ultra-low concentrations of insecticides

  3. An extra-domiciliary method of delivering entomopathogenic fungus, Metharizium anisopliae IP 46 for controlling adult populations of the malaria vector, Anopheles arabiensis

    Directory of Open Access Journals (Sweden)

    Mnyone Ladslaus L

    2010-03-01

    Full Text Available Abstract Fungal biopesticides have the potential to significantly reduce densities of malaria vectors as well as associated malaria transmission. In previous field trials, entomopathogenic fungus was delivered from within human dwellings, where its efficacy was limited by low infection rates of target mosquitoes, high costs of spraying fungus inside houses, and potential public health concerns associated with introducing fungal conidia inside houses. Here we have demonstrated that Metarhizium anisopliae IP 46, delivered within an extra-domiciliary odor-baited station (OBS, can infect and slowly-kill a high proportion of the wild adult malaria vector, Anopheles arabiensis which entered and exited the OBS. This study, carried out in rural Tanzania, showed that by using a concentration of 3.9 × 1010 conidia/m2, more than 95% of mosquitoes that flew in and out of the OBS died within 14 days post-exposure. At least 86% infection of mosquito cadavers was recorded with a significant reduction in the probability of daily survival of exposed An. arabiensis in both treatments tested: low quantity of conidia (eave baffles plus one cotton panel; HR = 2.65, P P

  4. RESTORATION INDUCED BY CATALASE IN IRRADIATED MICROORGANISMS

    Science.gov (United States)

    Latarjet, Raymond; Caldas, Luis Renato

    1952-01-01

    1. E. coli, strain K-12, and B. megatherium 899, irradiated in strict but still undefined physiological conditions with certain heavy doses of ultraviolet light, are efficiently restored by catalase, which acts on or fixes itself upon the bacteria in a few minutes. This restoration (C. R.), different from photorestoration, is aided by a little visible light. 2. At 37° the restorability lasts for about 2 hours after UV irradiation; the restored cells begin to divide at the same time as the normal survivors. 3. C. R. is not produced after x-irradiation. 4. B. megatherium Mox and E. coli, strain B/r show little C. R.; E. coli strain B shows none. None of these three strains is lysogenic, whereas the two preceding catalase-restorable strains are. 5. Phage production in the system "K-12 infected with T2 phage" is restored by catalase after UV irradiation, whereas phage production in the system "infected B" is not. 6. With K-12, catalase does not prevent the growth of phage and the lysis induced by UV irradiation (Lwoff's phenomenon). 7. Hypotheses are discussed concerning: (a) the chemical nature of this action of catalase; (b) a possible relation between C. R. and lysogenicity of the sensitive bacteria; (c) the consequences of such chemical restorations on the general problem of cell radiosensitivity. PMID:14898028

  5. Soil Persistence of Metarhizium anisopliae Applied to Manage Sugarbeet Root Maggot in a Cover Crop Microenvironment

    Science.gov (United States)

    The sugarbeet root maggot, Tetanops myopaeformis (Röder), is a major insect pest of sugarbeet, Beta vulgaris L., in North Dakota, Minnesota, and Idaho. Three field trials using the insect pathogen Metarhizium anisopliae (Metch.) Sorok. ATCC 62176 in conjunction with cover crops were conducted in 200...

  6. THE PESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    Science.gov (United States)

    Metarhizium anisopliae is a parasitic fungus employed as a biological control agent against vermin and used in the US for indoor control of cockroaches. Sensitization to cockroach allergens is associated with development of asthma. This pesticide is non-pathogenic for humans and ...

  7. THE IDENTIFICATION AND CHARACTERIZATION OF AN IGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    Science.gov (United States)

    The Identification and Characterization of an IgE-Inducing Protein in Metarhizium anisopliae ExtractMarsha D.W. Ward1, Lisa B. Copeland1, Maura J. Donahue2, and Jody A. Shoemaker31ORD, NHEERL, US EPA, RTP, NC; 2Oak Ridge Institute for Science and Education, Cincinnati...

  8. Infection of adult Aedes aegypti and Ae. albopictus mosquitoes with the entomopathogenic fungus Metarhizium anisopliae

    NARCIS (Netherlands)

    Scholte, E.J.; Takken, W.; Knols, B.G.J.

    2007-01-01

    This study describes a laboratory investigation on the use of the insect-pathogenic fungus Metarhizium anisopliae against adult Aedes aegypti and Ae. albopictus mosquitoes. At a dosage of 1.6 × 1010 conidia/m2, applied on material that served as a mosquito resting site, an average of 87.1 ± 2.65% of

  9. Infection of adult Aedes aegypti and Ae. albopictus mosquitoes with the entomopathogenic fungus Metarhizium anisopliae

    NARCIS (Netherlands)

    Scholte, E.J.; Takken, W.; Knols, B.G.J.

    2007-01-01

    This study describes a laboratory investigation on the use of the insect-pathogenic fungus Metarhizium anisopliae against adult Aedes aegypti and Ae. albopictus mosquitoes. At a dosage of 1.6 × 1010 conidia/m2, applied on material that served as a mosquito resting site, an average of 87.1 ± 2.65% of

  10. Probing the two-domain structure of homodimeric prokaryotic and eukaryotic catalase-peroxidases.

    Science.gov (United States)

    Banerjee, Srijib; Zamocky, Marcel; Furtmüller, Paul G; Obinger, Christian

    2010-11-01

    Catalase-peroxidases (KatGs) are ancestral bifunctional heme peroxidases found in archaeons, bacteria and lower eukaryotes. In contrast to homologous cytochrome c peroxidase (CcP) and ascorbate peroxidase (APx) homodimeric KatGs have a two-domain monomeric structure with a catalytic N-terminal heme domain and a C-terminal domain of high sequence and structural similarity but without obvious function. Nevertheless, without its C-terminal counterpart the N-terminal domain exhibits neither catalase nor peroxidase activity. Except some hybrid-type proteins all other members of the peroxidase-catalase superfamily lack this C-terminal domain. In order to probe the role of the two-domain monomeric structure for conformational and thermal stability urea and temperature-dependent unfolding experiments were performed by using UV-Vis-, electronic circular dichroism- and fluorescence spectroscopy, as well as differential scanning calorimetry. Recombinant prokaryotic (cyanobacterial KatG from Synechocystis sp. PCC6803) and eukaryotic (fungal KatG from Magnaporthe grisea) were investigated. The obtained data demonstrate that the conformational and thermal stability of bifunctional KatGs is significantly lower compared to homologous monofunctional peroxidases. The N- and C-terminal domains do not unfold independently. Differences between the cyanobacterial and the fungal enzyme are relatively small. Data will be discussed with respect to known structure and function of KatG, CcP and APx.

  11. Fungal Eye Infections

    Science.gov (United States)

    ... Treatment & Outcomes Statistics More Resources Fungal Nail Infections Histoplasmosis Definition Symptoms People at Risk & Prevention Sources Diagnosis & ... CDC at Work Global Fungal Diseases Cryptococcal Meningitis Histoplasmosis ... Resistance Resources Laboratory Submission Information Reportable Fungal ...

  12. A novel dodine-free selective medium based on the use of cetyl trimethyl ammonium bromide (CTAB) to isolate Beauveria bassiana, Metarhizium anisopliae sensu lato and Paecilomyces lilacinus from soil.

    Science.gov (United States)

    Posadas, Julieta B; Comerio, Ricardo M; Mini, Jorge I; Nussenbaum, Ana L; Lecuona, Roberto E

    2012-01-01

    This study evaluated the quaternary ammonium compound cetyl trimethyl ammonium bromide (CTAB) as an alternative to the chemically related dodecylguanidine (dodine) for the selective isolation of entomopathogenic fungi. Oatmeal agar (OA) with chloramphenicol was used as basal medium, and three concentrations of CTAB (0.5, 0.6, 0.7 g/L) were evaluated and compared against OA + 0.46 g/L dodine. Selective isolation and growth studies were performed with the entomopathogens Beauveria bassiana, Metarhizium anisopliae s.l. and Paecilomyces lilacinus and five common non-entomopathogenic non-target species. The three entomopathogenic fungi sporulated earlier on OA + 0.6 g/L CTAB than on OA + 0.46 g/L dodine, while none of the non-target fungi sporulated on OA + 0.6 g/L CTAB. All entomopathogenic fungal isolates grew on OA + 0.6 g/L CTAB, despite some intra-species variation, whereas non-target fungi showed no growth or sporulation. OA + 0.6 g/L CTAB resulted in an efficient medium to isolate B. bassiana, M. anisopliae s. l. and P. lilacinus from soil samples. Results of our study suggest that OA + 0.6 g/L CTAB is a suitable, simple and inexpensive to prepare medium to replace OA + 0.46 g/L dodine for the selective isolation of these fungi.

  13. Metarhizium anisopliae var. Anisopliae Pr1A基因的克隆表达及抗血清研究%Cloning and Expressing Pr1A Gene of the Entomopathogene fungus Metarhizium anisopliae var. anisopliae and Researching Its Antiserum

    Institute of Scientific and Technical Information of China (English)

    宋妍; 张世清; 黄俊生

    2006-01-01

    采用RT-PCR方法从本实验室分离筛选到的金龟子绿僵小孢变种Metarhizium anisopliae var.anisopliae中,扩增得到Pr1A基因全长,此基因全长为1242bp,经Blastn分析此基因序列与M.anisopliae的Pr1A基因(M73795)同源率为98%.以pET-22b(+)为基础载体,构建pET-Pr1A重组表达载体,在大肠杆菌(Escherichia.coli)BL 21(DE3)中进行表达.经SDS-PAGE分析,获得了约42kDa大小的重组目的蛋白,目的蛋白占表达总蛋白含量的63.2%.将表达的Pr1A蛋白切胶回收后制备成抗原,免疫家兔4次后,采血收集抗血清,用ELISA测定效价为1/10 000.结果表明,获得的抗体可用于更进一步的研究,将有利于我们进一步了解M.anisopliaeis的侵染机理,弄清楚各Pr蛋白酶的作用方式和对寄主的选择优势,提高生防控制的有效性.

  14. PURIFICATION OF CATALASE ENZYME FROM PLEUROTUS OSTREATUS

    Directory of Open Access Journals (Sweden)

    Susmitha.S

    2014-03-01

    Full Text Available The oyster mushroom Pleurotus ostreatus is the most commonly cultivated mushroom, and are effective for antitumor, antibacterial, anti viral and hematological agents and in immune modulating treatments. Several compounds from oyster mushrooms, potentially beneficial for human health have been isolated and studied. The aim of this research is to purify an enzyme catalase from Pleurotus ostreatus through Sephadox G-75 column, its molecular weight was determined by polyacrylamide gel electrophoresis and the catalase enzyme stability were observed at various temperature and different pH condition. Under denaturing conditions, polyacrylamide gel electrophoresis revealed dissociation of a major component of molecular weight 62,000 kDa, which constituted 90% of the total protein of the stained gel, suggesting that the native enzyme is tetrameric. The optimum temperature and pH for the purified enzyme catalase from Pleurotus ostreatus enzymatic reaction were 30°C and pH 7.5.

  15. Metarhizium anisopliae lipolytic activity plays a pivotal role in Rhipicephalus (Boophilus) microplus infection.

    Science.gov (United States)

    Beys da Silva, Walter O; Santi, Lucélia; Schrank, Augusto; Vainstein, Marilene H

    2010-01-01

    Lipases secreted by Metarhizium anisopliae, an important biological control agent, could potentially be involved in the host infection process. Here, we present the activity profile during the host infection process and the effect of lipase activity inhibitor ebelactone B on infection. The previous treatment of spores with lipase activity inhibitor, ebelactone B, completely inhibited lipolytic activity and prevented the infection of the Rhipicephalus (Boophilus) microplus host. The results herein presented prove, for the first time, the importance of lipase activity in M. anisopliae host infection process. The filamentous fungus Metarhizium anisopliae is one of the most important and studied biological agents for the control of several arthropod pests, including the cattle tick Rhipicephalus (Boophilus) microplus. Lipases secreted by M. anisopliae could potentially be involved in the host infection process. This work presents the activity profile during the host infection process and the effect of lipase activity inhibitor ebelactone B on infection. During the course of tick exposure to spores (6-120 h) lipase activity increased from 0.03 ± 0.00 U to 0.312 ± 0.068 U using rho NP palmitate as substrate. In zymograms, bands of lipase activity were detected in ticks treated with spores without inhibitor. The previous treatment of spores with lipase activity inhibitor, ebelactone B, completely inhibited lipolytic activity, at all times specified, and prevented the infection of the R. microplus host. Spores treated with the inhibitor did not germinate on the tick, although this effect was not observed in the culture medium. The results herein presented prove, for the first time, the importance of lipase activity in M. anisopliae host infection process.

  16. Compatibilidade de Metarhizium anisopliae (Metschnikoff Sorokin (Hypocreales: Clavicipitaceae com Chrysoperla externa (Hagen (Neuroptera: Chrysopidae

    Directory of Open Access Journals (Sweden)

    Eunice Claúdia Souza

    2015-12-01

    Abstract. The ecoagrossistemas several biological control agents acting simultane ously on different or the same target insect. The culture of cotton presents a rich complex of natural enemies associated with pests, among which stands out the predator Chrysoperla externa (Hagen and the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff Sorokin. The objective of this study was to evaluate the compatibility of the fungus M. anisopliae on the biological aspects of the predator C. externa. The first study evaluated the development of C. externa when treated with the following suspensions of M. anisopliae: T1 water (control; T2- 105 conídios.mL-1 de M. anisopliae (M.a.; T3- 106 conídios.mL-1 de M.a.; T4- 107 conídios.mL-1 de M.a.;T5- 108 conídios.mL-1 de M.a.. The second assay measured the duration of the larval and pupal predator and larval mortality in each treatment. For this, C. externa eggswere individualized in Petri dishes and kept under laboratory conditions. When the larvae of C. externa hatched, whitefly nymphs were offered on leaf discs coming from cotton treated with: T1-water (control; T2 - 105 conídios.mL-1 de M.a. e T3 - 108 conídios.mL-1 de M.a.. The results suggest that the fungus M. anisopliae at doses of 105 e 108 conídios.mL-1 de M.a. not interfere with the biological aspects of the predator C. externa.

  17. LIQUID BIOFORMULATION OF METARHIZIUM ANISOPLIAE IS EFFECTIVE FOR THE MANAGEMENT OF COW PEA MOSAIC DISEASE

    Directory of Open Access Journals (Sweden)

    Sarodee Boruah

    2015-03-01

    Full Text Available Liquid bioformulation of Metarhizium anisopliae amended with oils and adjuvants was prepared. Six oils viz., sunflower, safflower, soybean, mustard, arachnid and coconut oils at three different concentrations, 0.1, 0.5 and 1.0 per cent and three adjuvants viz., glycerol @ 5, 8 and 10 per cent; tween-80 @ 0.02, 0.04, 0.06 and 1.0 per cent and arachnid oil @ 1, 5 and 10 per cent were tested to see their effect on growth and development of M. anisopliae in the bioformulation. Liquid bioformulation of M. anisopliae amended with Glycerol (10.0% + Sunflower oil (0.5% was found significantly effective which showed 84.33 per cent and 94.93 per cent higher surface area covered and biomass production respectively than the control. Efficacy of the bioformulation was tested against cow pea aphid, Aphis craccivora in pot as well as field condition. Liquid formulation of M. anisopliae supplemented with Glycerol (10.0% + Sunflower oil (0.5% was found to be significantly effective causing aphid mortality of 80 per cent at 30 days after spraying with protection of secondary spread of cow pea mosaic disease up to 100 per cent and 96.03 per cent in pot and field condition respectively. Spraying liquid formulation of M. anisopliae amended with Glycerol (10.0% + Sunflower oil (0.5% at 15 days interval for twice proved to be the best treatment with highest yield of 24.03 t/ha with a cost benefit ratio of 1:7.95 as compared to control (11.20 t/ha.

  18. Survival of anopheline eggs and their susceptibility to infection with Metarhizium anisopliae and Beauveria bassiana under laboratory conditions

    NARCIS (Netherlands)

    Luz, C.; Mnyone, L.L.; Russell, T.L.

    2011-01-01

    The viability of Anopheles gambiae sensu stricto and Anopheles arabiensis (Diptera: Culicidae) eggs over time and the ovicidal activity of Beauveria bassiana (Ascomycota: Cordycipitaceae) and Metarhizium anisopliae (Ascomycota: Clavicipitaceae) were investigated. Eggs were incubated in soil or leaf

  19. Anopheline and culicine mosquitoes are not repelled by surfaces treated with the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana

    NARCIS (Netherlands)

    Mnyone, L.L.; Koenraadt, C.J.M.; Lyimo, I.N.; Mpingwa, M.W.; Takken, W.; Russell, T.L.

    2010-01-01

    Background - Entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana, are promising bio-pesticides for application against adult malaria mosquito vectors. An understanding of the behavioural responses of mosquitoes towards these fungi is necessary to guide development of fungi beyond t

  20. Pathogenicity of Metarrhizium anisopliae (Metsch.) Sorokin and Beauveria bassiana (Bals.) Vuillemin isolates to Scaptocoris carvalhoi Becker (Hemiptera, Cydnidae); Patogenicidade de isolados de Metarhizium anisopliae (Metsch.) Sorokin e de Beauveria bassiana (Bals.) Vuillemin a Scaptocoris carvalhoi Becker (Hemiptera, Cydnidae)

    Energy Technology Data Exchange (ETDEWEB)

    Xavier, Luciane Modenez Saldivar [Universidade Federal da Grande Dourados (UFGD), Dourados, MS (Brazil)], e-mail: luciane_modenez@ibest.com.br; Avila, Crebio Jose [EMBRAPA Agropecuaria Oeste, Dourados, MS (Brazil)], e-mail: crebio@cpao.embrapa.br

    2006-12-15

    Pathogenicity of the fungi Metarrhizium anisopliae (Metsch.) Sorokin and Beauveria bassiana (Bals.) Vuillemin to stink bug Scaptocoris carvalhoi Becker, 1967 was evaluated under laboratory and greenhouse conditions. Experiments were carried out at EMBRAPA Agropecuaria Oeste, Dourados, Mato Grosso do Sul State, Brazil, in 2003. Ten M. anisopliae and eleven B. bassiana isolates were evaluated in laboratory using a completely randomized experimental design with five replicates (10 adults and 5 nymphs/plot). The pathogenicity of M. anisopliae isolate (Ma69) was also separately evaluated against nymphs and adults in laboratory and greenhouse. The stink bug mortality levels were higher for M. anisopliae isolates (between 73.3% and 94.7% than for B. bassiana isolates (between 10.7% and 78.7%). In greenhouse, stink bug mortality due to the M. anisopliae isolate (Ma69) was 57.3%, and there was no difference of mortality for nymphs and adults of stink bug in laboratory. However, in greenhouse, mortality levels were significantly higher (p<0,05) for nymphs (38,4%) than for adults (16,2%). From these data, we conclude that M. anisopliae isolate Ma69 was efficient to control S. carvalhoi in laboratory and in greenhouse, thus being a promising choice for use as a microbial insecticide under field conditions. (author)

  1. Hydrogen peroxide homeostasis: activation of plant catalase by calcium/calmodulin

    Science.gov (United States)

    Yang, T.; Poovaiah, B. W.

    2002-01-01

    Environmental stimuli such as UV, pathogen attack, and gravity can induce rapid changes in hydrogen peroxide (H(2)O(2)) levels, leading to a variety of physiological responses in plants. Catalase, which is involved in the degradation of H(2)O(2) into water and oxygen, is the major H(2)O(2)-scavenging enzyme in all aerobic organisms. A close interaction exists between intracellular H(2)O(2) and cytosolic calcium in response to biotic and abiotic stresses. Studies indicate that an increase in cytosolic calcium boosts the generation of H(2)O(2). Here we report that calmodulin (CaM), a ubiquitous calcium-binding protein, binds to and activates some plant catalases in the presence of calcium, but calcium/CaM does not have any effect on bacterial, fungal, bovine, or human catalase. These results document that calcium/CaM can down-regulate H(2)O(2) levels in plants by stimulating the catalytic activity of plant catalase. Furthermore, these results provide evidence indicating that calcium has dual functions in regulating H(2)O(2) homeostasis, which in turn influences redox signaling in response to environmental signals in plants.

  2. Hydrogen peroxide homeostasis: activation of plant catalase by calcium/calmodulin

    Science.gov (United States)

    Yang, T.; Poovaiah, B. W.

    2002-01-01

    Environmental stimuli such as UV, pathogen attack, and gravity can induce rapid changes in hydrogen peroxide (H(2)O(2)) levels, leading to a variety of physiological responses in plants. Catalase, which is involved in the degradation of H(2)O(2) into water and oxygen, is the major H(2)O(2)-scavenging enzyme in all aerobic organisms. A close interaction exists between intracellular H(2)O(2) and cytosolic calcium in response to biotic and abiotic stresses. Studies indicate that an increase in cytosolic calcium boosts the generation of H(2)O(2). Here we report that calmodulin (CaM), a ubiquitous calcium-binding protein, binds to and activates some plant catalases in the presence of calcium, but calcium/CaM does not have any effect on bacterial, fungal, bovine, or human catalase. These results document that calcium/CaM can down-regulate H(2)O(2) levels in plants by stimulating the catalytic activity of plant catalase. Furthermore, these results provide evidence indicating that calcium has dual functions in regulating H(2)O(2) homeostasis, which in turn influences redox signaling in response to environmental signals in plants.

  3. Impact of moisture on survival of Aedes aegypti eggs and ovicidal activity of Metarhizium anisopliae under laboratory conditions

    OpenAIRE

    C Luz; MHH Tai; AH Santos; HHG Silva

    2008-01-01

    The effect of relative humidity (43%, 75%, 86% and > 98%) on Aedes aegypti eggs treated with Metarhizium anisopliae or water only was tested for up to a six months exposure at 25ºC. Survival of larvae inside eggs was clearly affected by the lowest humidity (43%) tested, and eclosion diminished at all humidities after increasing periods of exposure. M. anisopliae showed to have a strong ovicidal activity only at humidity close to saturation. No difference of activity was found between conidia ...

  4. Kemampuan Larva Oryctes Rhinoceros (Coleoptera: Scarabaeidae) Menularkan Cendawan Metarhizium Anisopliae Ke Larva Sehat Di Pertanaman Kelapa Sawit

    OpenAIRE

    Perabu Jaya Sitepu

    2009-01-01

    Perabu Jaya Sitepu, Kemampuan larva Oryctes rhinoceros menularkan Metharizium anisopliae ke larva sehat di pertanaman kelapa sawit. Penelitian bertujuan untuk mengetahui kemampuan larva O. rhinoceros menularkan M. anisopliae ke larva O. rhinoceros yang lain di lapangan. Penelitian ini menggunakan Rancangan Acak Kelompok (RAK) Non Faktorial yang terdiri dari 4 perlakuan dan enam ulangan yaitu : L1 (kontrol), L2 (5 larva dilumuri M. anisoplioae), L3 (10 larva dilumuri M. anisoplioae), L4 (15 la...

  5. Application of the entomogenous fungus, Metarhizium anisopliae, for leafroller (Cnaphalocrocis medinalis) control and its effect on rice phyllosphere microbial diversity.

    Science.gov (United States)

    Hong, Mingsheng; Peng, Guoxiong; Keyhani, Nemat O; Xia, Yuxian

    2017-07-10

    Microbial pesticides form critical components of integrated pest management (IPM) practices. Little, however, is known regarding the impacts of these organisms on the indigenous microbial community. We show that Metarhizium anisopliae strain CQMa421 was highly effective in controlling the rice leafroller, Cnaphalocrocis medinalis Guenee. In addition, M. anisopliae distribution and its effects on phyllosphere microbial diversity after application in field trials were investigated. Phylloplane specific distribution of the fungus was observed over time, with more rapid declines of M. anisopliae CFUs (colony-forming units) seen in the top leaf layer as compared to lower layers. Application of the fungus resulted in transient changes in the endogenous microbial diversity with variations seen in the bacterial observed species and Shannon index. Notable increases in both parameters were seen at 6-day post-application of M. anisopliae, although significant variation within sample replicates for bacteria and fungi were noted. Application of M. anisopliae increased the relative distribution of bacterial species implicated in plant growth promotion and organic pollutant degradation, e.g., Methylobacterium, Sphingobium, and Deinococcus. These data show minimal impact of M. anisopliae on endogenous microbial diversity with transient changes in bacterial abundance/diversity that may result in added benefits to crops.

  6. Interactions between Entomopathogenic Fungus, Metarhizium Anisopliae and Sublethal Doses of Spinosad for Control of House Fly, Musca Domestica

    Directory of Open Access Journals (Sweden)

    M Sharififard

    2011-06-01

    Full Text Available Background: Metarhizium anisopliae strain IRAN 437C is one of the most virulent fungal isolates against house fly, Musca domestica. The objective of this study was to determine the interaction of this isolate with sublethal doses of spino­sad against housefly.Methods: In adult bioassay, conidia of entomopathogenic fungus were applied as inoculated bait at 105 and 107 spore per gram and spinosad at 0.5, 1 and 1.5 µg (A.I. per gram bait. In larval bioassay, conidia were applied as combina­tion of spore with larval bedding at 106 and 108 spore per gram and spinosad at sublethals of 0.002, 0.004 and 0.006 µg (AI per gram medium. Results: Adult mortality was 48% and 72% for fungus alone but ranged from 66–87% and 89–95% in combination treat­ments of 105 and 107 spore/g with sublethal doses of spinosad respectively. The interaction between 105 spore/g with sublethals exhibited synergistic effect, but in combination of 107 spore in spite of higher mortality, the interac­tion was additive. There was significant difference in LT50 among various treatments. LT50 values in all combination treat­ments were smaller than LT50 values in alone ones. Larval mortality was 36% and 69% for fungus alone but ranged from 58%–78% and 81%–100% in combination treatments of 106 and 108 spore/g medium with sublethals of spino­sad respectively. The interaction was synergistic in all combination treatments of larvae.Conclusion: The interaction between M. anispliae and spinosad indicated a synergetic effect that increased the house fly mortality as well as reduced the lethal time.

  7. Potential enzyme toxicity of oxytetracycline to catalase

    Energy Technology Data Exchange (ETDEWEB)

    Chi Zhenxing; Liu Rutao; Zhang Hao, E-mail: Trutaoliu@sdu.edu.cn [School of Environmental Science and Engineering, Shandong University, China-America CRC for Environment and Health, Shandong Province, 27 Shanda South Road, Jinan 250100 (China)

    2010-10-15

    Oxytetracycline (OTC) is a kind of widely used veterinary drugs. The residue of OTC in the environment is potentially harmful. In the present work, the non-covalent toxic interaction of OTC with catalase was investigated by the fluorescence spectroscopy, UV-vis absorption and circular dichroism (CD) spectroscopy at physiological pH 7.4. OTC can interact with catalase to form a complex mainly by van der Waals' interactions and hydrogen bonds with one binding site. The association constants K were determined to be K{sub 293K} = 7.09 x 10{sup 4} L mol{sup -1} and K{sub 311K} = 3.31 x 10{sup 4} L mol{sup -1}. The thermodynamic parameters ({Delta}H{sup o}, {Delta}G{sup o} and {Delta}S{sup o}) of the interaction were calculated. Based on the Foerster theory of non-radiative energy transfer, the distance between bound OTC and the tryptophan residues of catalase was determined to be 6.48 nm. The binding of OTC can result in change of the micro-environment of the tryptophan residues and the secondary structure of catalase. The activity of catalase was also inhibited for the bound OTC. This work establishes a new strategy to probe the enzyme toxicity of veterinary drug residues and is helpful for clarifying the molecular toxic mechanism of OTC in vivo. The established strategy can be used to investigate the potential enzyme toxicity of other small organic pollutants and drugs.

  8. Tools for delivering entomopathogenic fungi to malaria mosquitoes: effects of delivery surfaces on fungal efficacy and persistence

    Directory of Open Access Journals (Sweden)

    Mnyone Ladslaus L

    2010-08-01

    Full Text Available Abstract Background Entomopathogenic fungi infection on malaria vectors increases daily mortality rates and thus represents a control measure that could be used in integrated programmes alongside insecticide-treated bed nets (ITNs and indoor residual spraying (IRS. Before entomopathogenic fungi can be integrated into control programmes, an effective delivery system must be developed. Methods The efficacy of Metarhizium anisopliae ICIPE-30 and Beauveria bassiana I93-825 (IMI 391510 (2 × 1010 conidia m-2 applied on mud panels (simulating walls of traditional Tanzanian houses, black cotton cloth and polyester netting was evaluated against adult Anopheles gambiae sensu stricto. Mosquitoes were exposed to the treated surfaces 2, 14 and 28 d after conidia were applied. Survival of mosquitoes was monitored daily. Results All fungal treatments caused a significantly increased mortality in the exposed mosquitoes, descending with time since fungal application. Mosquitoes exposed to M. anisopliae conidia on mud panels had a greater daily risk of dying compared to those exposed to conidia on either netting or cotton cloth (p B. bassiana conidia on mud panels or cotton cloth had similar daily risk of death (p = 0.14, and a higher risk than those exposed to treated polyester netting (p Conclusion Both fungal isolates reduced mosquito survival on immediate exposure and up to 28 d after application. Conidia were more effective when applied on mud panels and cotton cloth compared with polyester netting. Cotton cloth and mud, therefore, represent potential substrates for delivering fungi to mosquitoes in the field.

  9. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    OpenAIRE

    Fedotov O. V.; Voloshko T.E.

    2013-01-01

    A method for obtaining of enzyme preparations of enzyme preparations (EP) of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfat...

  10. Optimization of Production Medium for Mass Culture of Metarhizium anisopliae ARS 2231

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Seung Woo [Korea University, Seoul (Korea); Moon, Ki Hyuk [Kyungwon University Technology Complex, Songnam (Korea); Yoon, Jeong Weon [Suwon University, Suwon (Korea)

    1999-11-01

    Chemical pesticides which have been commonly used for crop protection have many problems such as high production cost and environmental hazards. Entomogeneous fungi which attack living insects are very powerful means for microbiological insecticide. The purpose of this study is to investigate the culture conditions for mass production of Metarhizium anisopliae ARS 2231 which is a potential microbiological pesticide. The temperature and pH range for optimal cultivation were 28 deg. C and pH 5.0-7.0, respectively. For M. anisopliae ARS 2231, 3.0% (w/v) rice bran, 0.8% (w/v) hydrolyzed casein, and 0.3% (w/v) K{sub 2}HPO{sub 4} were found as the proper nutrients, considering cell mass, enzyme activities, and spore concentration. 16 refs., 10 tabs.

  11. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae).

    Science.gov (United States)

    Suleiman, Elham A; Shigidi, M T; Hassan, S M

    2013-12-15

    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p anisopliae to control ticks is discussed.

  12. Formation of exudate droplets by Metarhizium anisopliae and the presence of destruxins.

    Science.gov (United States)

    Hutwimmer, Stefan; Wang, Hui; Strasser, Hermann; Burgstaller, Wolfgang

    2010-01-01

    Nutritional conditions causing droplet exudation by Metarhizium anisopliae var. anisopliae were studied. Exudation in droplets occurred only on media with more than one carbon source and was highly dependent on the ratio of a well metabolized sugar such as trehalose and a nonpreferred sugar, in particular arabinose. Exuded droplets contained destruxin A, B and E in concentrations similar to those on submerged culture on Czapek Dox medium with equivalent C:N ratios but was clearly less than previously reported on standard Czapek Dox or Sabouraud dextrose broth. Destruxins also were found in agar samples from directly below mycelium and from up to 2 cm from the colony edge. Exudates retrieved from different media were proven to have Pr1 protease-related enzyme activity. Additional HPLC analysis indicated that droplets from diverse media did not differ in their sugar and acid content. A hypothesis is presented regarding the trigger for guttation in Metarhizium during growth under these conditions.

  13. Laboratory evaluation of Beauveria bassiana and Metarhizium anisopliae in the control of Haemaphysalis qinghaiensis in China.

    Science.gov (United States)

    Ren, Qiaoyun; Chen, Ze; Luo, Jin; Liu, Guangyuan; Guan, Guiquan; Liu, Zhijie; Liu, Aihong; Li, Youquan; Niu, Qingli; Liu, Junlong; Yang, Jifei; Han, Xueqing; Yin, Hong; Luo, Jianxun

    2016-06-01

    Haemaphysalis qinghaiensis, a prevalent tick species in China, is an ectoparasite that preferentially infests small ruminants and can transmit Theileria sp. and Babesia sp. In this study, we evaluated the pathogenicity of individual and mixed infections of the fungi Beauveria bassiana and Metarhizium anisopliae to H. qinghaiensis nymphs. The estimated LC50 for ticks immersed in solutions of B. bassiana, M. anisopliae and a mixture thereof were: 5.88056 × 10(4), 2.65 × 10(4), and 2.85 × 10(4) conidia mL(-1) respectively, and the nymphal mortality ranged from 52 to 100 %. Thus, these results suggest a potential approach for the biocontrol of H. qinghaiensis.

  14. 21 CFR 184.1034 - Catalase (bovine liver).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase (bovine liver). 184.1034 Section 184.1034... Listing of Specific Substances Affirmed as GRAS § 184.1034 Catalase (bovine liver). (a) Catalase (bovine liver) (CAS Reg. No. 81457-95-6) is an enzyme preparation obtained from extracts of bovine liver. It is...

  15. Bacillus subtilis Vegetative Catalase Is an Extracellular Enzyme

    OpenAIRE

    Naclerio, G; Baccigalupi, L; Caruso, C; De Felice, M; Ricca, E

    1995-01-01

    Strong catalase activity was secreted by Bacillus subtilis cells during stationary growth phase in rich medium but not in sporulation-inducing medium. N-terminal sequencing indicated that the secreted activity was due to the vegetative catalase KatA, previously considered an endocellular enzyme. Extracellular catalase protected B. subtilis cells from oxidative assault.

  16. Use of Beauveria bassiana and Metarhizium anisopliae for fruit fly control: a novel approach

    Energy Technology Data Exchange (ETDEWEB)

    Toledo, Jorge; Liedo, Pablo, E-mail: jtoledo@ecosur.m [El Colegio de la Frontera Sur, Chiapas (Mexico). Dept. de Entomologia Tropical; Flores, Salvador; Montoya, Pablo [Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Chiapas (Mexico). Subdireccion de Desarrollo de Metodos; Campos, Sergio E.; Villasenor, Antonio [Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Chiapas (Mexico). Programa Moscamed. Direccion de Operaciones de Campo

    2006-07-01

    The potential of two species of entomopathogenic fungi, Beauveria bassiana (Bals.) and Metarhizium anisopliae (Met.) Sorokin, as practical fruit fly biocontrol agents is studied. These natural inhabitants of soil are found infecting a wide range of insect species that spend at least one stage of their life cycle in the soil. Sterile flies are used as vectors of the infection. A summary of results from different laboratory and field cage experiments is presented. (MAC)

  17. Efficacy of enthomopathogenic fungus Metarhizium anisopliae against Tuta absoluta (Lepidoptera: Gelechiidae).

    Science.gov (United States)

    Contreras, J; Mendoza, J E; Martínez-Aguirre, M R; García-Vidal, L; Izquierdo, J; Bielza, P

    2014-02-01

    The tomato borer Tuta absoluta Meyrick is a serious tomato pest that has lately undergone a rapid expansion, causing severe crop losses. An integrated management is required to control this insect, within which biological control is now beginning to play a key role. In this regard, the effectiveness of a liquid formulation based on strains of the fungus Metarhizium anisopliae variety anisopliae (Metschnikoff) Sorokin (4.46 x 10(9) viable conidia per milliliter), applied together with irrigation water, has been evaluated by laboratory tests on different populations of T. absoluta. A bioassay method has been developed to test the efficacy of the product. The technique chosen has been validated and the different studied populations have been typified according to their susceptibility, determining the baseline susceptibility of the pest to the fungus. The results revealed a complete efficacy of M. anisopliae against pupae of T. absoluta at the recommended label rate (5.58 x 10(9) viable conidia per liter) for the populations assayed. Moreover, a notably lower dose was also sufficiently effective to control the tomato borer populations because values of LC90 lower than 3 x 10(9) viable conidia per liter were obtained unfailingly. The most sensitive populations were those collected in Almeria and Nijar, Spain, with LC50 values of 0.21 and 0.22 x 10(9) viable conidia per liter(-1), respectively. The average value obtained for LC50 was 0.34 x 10(9) viable conidia per liter(-1) and 2 x 10(9) for LC90. These results show the potential of M. anisopliae to control pupae of the tomato borer in integrated pest management programs.

  18. [Bahaviour of Solenopsis invicta workers to protect pupae from infection by Metarhizium anisopliae].

    Science.gov (United States)

    Qiu, Hua-Long; Lü, Li-Hua; Zhang, Chun-Yang; He, Yu-Rong

    2014-09-01

    Previous studies have focused on how ants deal with workers infected by pathogens but how pupae are protected from infection by fungi is not well understood. The behavioral mechanisms adopted by Solenopsis invicta (red imported fire ants, RIFA) adult workers to protect pupae against Metarhizium anisopliae infection were studied. We observed the behavioral changes of M. anisopliae infected adult workers in the brood chamber as well as the behavioral changes of healthy workers to fungus exposed pupae. The time of fungus infected workers spent in the pupal chamber reduced significantly from 103.4 s on the first day to 38.5 s on the third day. Moreover, the percentage of time spending on brood care in the pupal chamber reduced significantly from 13.6% on the first day to 3.5% on the third day. When pupae were infected by M. anisopliae, workers performed 5.3 times more grooming to fungus exposed pupae than controls, and the duration of each grooming bout to fungus exposed pupae was 5.2 times longer than controls. Grooming did remove many conidia on the surface of fungus exposed pupae. The mean numbers of conidia on the surface of pupae were 103.1, 51.6 and 31.3 when no workers, two workers and ten workers accompanied a pupa, respectively. The presence of workers resulted in a lower germination rate of conidia on the surface of pupae. The mean germination rates of conidia after 20 h of inoculation on the surface of pupae were 95.1%, 80.4% and 59.9%, in the treatments with no worker, two workers and ten workers respectively. There was a positive correlation between the emergence rate of pupae and the number of accompanying workers. RIFA protect their pupae from infection by M. anisopliae through social be- haviors which enable the sustainable development of their population.

  19. Sustainable control of taro beetles via scoliid wasps\\ud and Metarhizium anisopliae

    OpenAIRE

    2014-01-01

    Taro Scarab beetles (Papuana uninodis, Coleoptera: Scarabaeidae) inflict severe damage on important root crops and plants such as Taro or Cocoyam, yam, sweet potatoes, oil palm and coffee tea plants across Africa and Asia resulting in economic hardship and starvation in some nations. Scoliid wasps and Metarhizium anisopliae fungus - bio-control agents; are shown to be able to control the population of Scarab beetle adults and larvae using a newly created simulation model based on non-linear o...

  20. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O.V.

    2013-04-01

    Full Text Available A method for obtaining of enzyme preparations of enzyme preparations (EP of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfate at 40-70% saturation of peroxidases and 80% of saturation - for catalase. These solutions protein fractions was further purified by dialysis and gel filtration on Molselekt granules G-50 and G-75. The enzyme solution was subjected to freeze-drying. The individual characteristics of the enzyme preparations were found. The individual characteristics of the enzyme preparations are the activity of enzymes, the protein content and amino-acid composition of enzyme preparations. It was established that strain F. velutipes F-vv was an active producer of intracellular and strain of A. cylindracea 167 was an active producer of extracellular peroxidase. The strains of P. ostreatus P-01 and P-208 were the active producers of extracellular catalase, and the strainsof F. hepatica Fh-08 were active producers of intracellular catalase. The developed methods for producing of enzymes catalase and peroxidase preparations of extra-and intracellular origin provided new antioxidant enzymes, which have their own properties and application prospects in various sectors of industry and science research.

  1. Route of infection and hematological effect of Metarhizium anisopliae (Metsch.) Sorokin on Dysdercus cingulatus (Fab.) adult.

    Science.gov (United States)

    Sahayaraj, Kitherian; Borgio, Jesu Francis; Lucini, Luigi

    2014-01-01

    The primary objective of this work was to identify, under laboratory conditions, the route of infection and hemogram of Dysdercus cingulatus (Fab.) adults by Metarhizium anisopliae. The infection process in D. cingulatus by M. anisopliae involved the conidia adherence to the host cuticle and germination after 24 h post-infection, accompanied by falling of bristles. The subsequent step, within 24-48 h post-infection, comprised penetration of fungus through spiracles, root of bristles, hemolymph, and the three dorsal sacs. Subsequently, within 72-96 h post-infection, the fungus penetrated into trachea and sacs, then emerged on cuticular surface and was found to be maximum in hemolymph. A great decrease in hemocytes count was observed within 96 h from infection. The hemosomic index (HSI) decreased gradually as the incubation period increased. As far as we know, this is the first study to know the mechanism of action of M. anisopliae to D. cingulatus.

  2. Pengujian Toksisitas Akut Oral Dan Dermal pada Biolarvasida Metarhizium anisopliae terhadap Tikus Putih Spraque Dawley

    Directory of Open Access Journals (Sweden)

    Deni Zulfiana

    2016-03-01

    Full Text Available Acute oral and dermal toxicity test against white rats was conducted to determine the toxicity and side effects of bio-larvacide (Metarhizium anisopliae crude extract on humans. In the oral test used a maximum dose 5000 mg/kg and dermal testing used a maximum dose of 2000 mg/kg. Dose treatment and control tested to 5 Spraque Dawley male rats. The results showed that oral treatment with a dose of 5000 mg/kg did not cause mortality and did not cause changes in anatomic pathology of viceral organs. In the dermal treatment with a dose of 2000 mg/kg did not cause mortality and did not cause changes in anatomic pathology of viceral organs. Based on these results LD50 acute oral M. anisopliae biolarvacide above 5000 mg/kg and the acute dermal is above 2000 mg/kg. It was therefore concluded that the formulation of Metarhizium anisopliae biolarvasida classified as not hazardous when used in accordance with the recommendation of the class I (WHO, 2003.

  3. Proteins differentially expressed in conidia and mycelia of the entomopathogenic fungus Metarhizium anisopliae sensu stricto.

    Science.gov (United States)

    Su, Yubin; Guo, Qingfeng; Tu, Jie; Li, Xiaoxia; Meng, Lixue; Cao, Liping; Dong, Dong; Qiu, Junzhi; Guan, Xiong

    2013-07-01

    Metarhizium anisopliae is a well-characterized entomopathogenic fungus that attacks a variety of insects. Its conidia are involved in its propagation and also in its infection of host insects. To investigate the protein expression profiles and to identify the proteins related to development and pathogenesis, we performed a comparative proteomic analysis of the conidia and mycelia of an M. anisopliae strain (Ma1291). The analysis used 2-dimensional gel electrophoresis and matrix-assisted laser desorption ionization time-of-flight mass spectrometry. We detected 898 ± 37 protein spots in conidia and 1072 ± 24 in mycelia of strain Ma1291. A comparison of the 2 protein-expression profiles indicated that only 28% of protein spots were common to both developmental stages. Finally, we identified 30 proteins (19 from conidia and 11 from mycelia). The identified proteins exclusive to conidia were those involved in protective processes, appressorium formation, and degradation of the host cuticle (protease PR1H). The identified proteins exclusive to mycelia included major proteins participating in biosynthetic and energy metabolism, such as UTP-glucose-1-phosphate uridylyltransferase and heat shock protein 70. This research provides the first proteomic analysis of different developmental stages of M. anisopliae, and the results should facilitate clarification of the molecular basis of these epigenetic variations.

  4. Preservation of aerial conidia and biomasses from entomopathogenic fungi Beauveria brongniartii and Metarhizium anisopliae during lyophilization.

    Science.gov (United States)

    Toegel, Stefan; Salar-Behzadi, Sharareh; Horaczek-Clausen, Andrea; Viernstein, Helmut

    2010-09-01

    In this study, we assessed the stability provided by different formulations to aerial conidia or biomasses (conidia, blastospores, and mycelia) of Beauveria brongniartii and Metarhizium anisopliae subjected to lyophilization. First, the impact of the freezing and drying processes on spore survival was evaluated. Whereas unprotected B. brongniartii spores showed high cryosensitivity, those of M. anisopliae were markedly harmed by the drying process. Then, the protective efficiency of 14 excipients was systematically evaluated and optimized regarding required concentrations. Fructose, glucose, and saccharose significantly enhanced viabilities for B. brongniartii and M. anisopliae spores following lyophilization, especially as a result of their cryoprotective effects. In addition, the effect of various bulking agents on spore survival was studied and dextran 4 was selected to enhance the physical properties of the lyophilized products. The combination of fructose and dextran 4 was further applied to prepare lyophilized biomasses of both fungi. In comparison to freshly harvested biomasses, the lyophilized products showed similar growth rates and a comparable production of virulent secondary metabolites such as destruxin A, destruxin B, or oosporein, suggesting their applicability as biological control agents.

  5. Preparation of highly efficient manganese catalase mimics.

    Science.gov (United States)

    Triller, Michael U; Hsieh, Wen-Yuan; Pecoraro, Vincent L; Rompel, Annette; Krebs, Bernt

    2002-10-21

    The series of compounds [Mn(bpia)(mu-OAc)](2)(ClO(4))(2) (1), [Mn(2)(bpia)(2)(muO)(mu-OAc)](ClO(4))(3).CH(3)CN (2), [Mn(bpia)(mu-O)](2)(ClO(4))(2)(PF(6)).2CH(3)CN (3), [Mn(bpia)(Cl)(2)](ClO)(4) (4), and [(Mn(bpia)(Cl))(2)(mu-O)](ClO(4))(2).2CH(3)CN (5) (bpia = bis(picolyl)(N-methylimidazol-2-yl)amine) represents a structural, spectroscopic, and functional model system for manganese catalases. Compounds 3 and 5 have been synthesized from 2 via bulk electrolysis and ligand exchange, respectively. All complexes have been structurally characterized by X-ray crystallography and by UV-vis and EPR spectroscopies. The different bridging ligands including the rare mono-mu-oxo and mono-mu-oxo-mono-mu-carboxylato motifs lead to a variation of the Mn-Mn separation across the four binuclear compounds of 1.50 A (Mn(2)(II,II) = 4.128 A, Mn(2)(III,III) = 3.5326 and 3.2533 A, Mn(2)(III,IV) = 2.624 A). Complexes 1, 2, and 3 are mimics for the Mn(2)(II,II), the Mn(2)(III,III), and the Mn(2)(III,IV) oxidation states of the native enzyme. UV-vis spectra of these compounds show similarities to those of the corresponding oxidation states of manganese catalase from Thermus thermophilus and Lactobacillus plantarum. Compound 2 exhibits a rare example of a Jahn-Teller compression. While complexes 1 and 3 are efficient catalysts for the disproportionation of hydrogen peroxide and contain an N(4)O(2) donor set, 4 and 5 show no catalase activity. These complexes have an N(4)Cl(2) and N(4)OCl donor set, respectively, and serve as mimics for halide inhibited manganese catalases. Cyclovoltammetric data show that the substitution of oxygen donor atoms with chloride causes a shift of redox potentials to more positive values. To our knowledge, complex 1 is the most efficient binuclear functional manganese catalase mimic exhibiting saturation kinetics to date.

  6. A Eukaryote without Catalase-Containing Microbodies : Neurospora crassa Exhibits a Unique Cellular Distribution of Its Four Catalases

    NARCIS (Netherlands)

    Schliebs, Wolfgang; Würtz, Christian; Kunau, Wolf-Hubert; Veenhuis, Marten; Rottensteiner, Hanspeter; Wuertz, Christian

    2006-01-01

    Microbodies usually house catalase to decompose hydrogen peroxide generated within the organelle by the action of various oxidases. Here we have analyzed whether peroxisomes (i.e., catalase-containing microbodies) exist in Neurospora crassa. Three distinct catalase isoforms were identified by native

  7. Methanol teratogenicity in mutant mice with deficient catalase activity and transgenic mice expressing human catalase.

    Science.gov (United States)

    Siu, Michelle T; Wiley, Michael J; Wells, Peter G

    2013-04-01

    The role of catalase in methanol (MeOH) teratogenesis is unclear. In rodents it both detoxifies reactive oxygen species (ROS) and metabolizes MeOH and its formic acid (FA) metabolite. We treated pregnant mice expressing either high (hCat) or low catalase activity (aCat), or their wild-type (WT) controls, with either MeOH (4g/kg ip) or saline. hCat mice and WTs were similarly susceptible to MeOH-initiated ophthalmic abnormalities and cleft palates. aCat and WT mice appeared resistant, precluding assessment of the developmental impact of catalase deficiency. Catalase activity was respectively increased at least 1.5-fold, and decreased by at least 35%, in hCat and aCat embryos and maternal livers. MeOH and FA pharmacokinetic profiles were similar among hCat, aCat and WT strains. Although the hCat results imply no ROS involvement, embryo culture studies suggest this may be confounded by maternal factors and/or a requirement for higher catalase activity in the hCat mice.

  8. Eficiência de Metarhizium anisopliae no controle do Percevejo-do-Colmo Tibraca limbativentris (Heteroptera: Pentatomidae em lavoura de arroz irrigado Efficiency of Metarhizium anisopliae on rice stem bug Tibraca limbativentris (Heteroptera: Pentatomidae control in flooded rice field

    Directory of Open Access Journals (Sweden)

    José Francisco da Silva Martins

    2004-12-01

    , pode provavelmente reduzir a taxa de disseminação do fungo nos arrozais e, por conseqüência, ser desfavorável à ocorrência de epizootias.The rice stem bug, Tibraca limbativentris Stal, 1860 (Heteroptera: Pentatomidae, is an important pest of rice (Oryza sativa L. in Brazil, mainly in flooded system of cultivation. The effect of two ways of application (conidia in aqueous suspension and on rice grain of Metarhizium anisopliae strain 172 for the control of the rice stem bug, was evaluated in three experiments conducted in 1991, 1992 and 1994 in commercial irrigated rice. In 1991, the spraying of conidia suspension and manual distribution of rice grain covered with fungal material at dose of 7.2 x 10(13 conidia.ha-1, on soil and among rice stems, where the bugs were located, reduced significantly the insect natural population with control efficiencies of 52.6 and 61.8%, respectively. Studies about establishment and persistence of fungal conidia in soil, using the colony forming unity (CFU counts, indicated that the fungus persisted in the soil between two rice crop seasons, up to 216 days after application, when new rice crops were established. The number of CFU was greater in the plots treated with rice grain covered with fungal material. The linear growth of CFU in the control plots showed that the fungus spread to the untreated areas of the rice field. Significant control efficiency was obtained in 1993 for grain and aqueous fungus treatment with 48.2% and 51.8%, respectively. In 1994, the conidial suspension at dose of 5x10(13 conidia.ha-1 resulted in control efficiency of 39.5%. The level of insect mycosis, however, was low in both 1993 and 1994, reaching a maximum of 20% mycosis in 1993. The low numbers of insect with mycosis compared with the level of mortality, may probably reduce the rate of fungal dissemination in rice fields and, consequently, be detrimental to the occurrence of epizootics.

  9. Purification and characterisation of proteins secreted by the entomopathogenic fungus Metarhizium anisopliae with insecticidal activity against adults of the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Ortiz-Urquiza, Almudena; Garrido-Jurado, Inmaculada; Santiago-Alvarez, Cándido; Quesada-Moraga, Enrique

    2009-10-01

    The control of the Mediterranean fruit fly (medfly) Ceratitis capitata (Wied) is usually performed with protein bait sprays incorporating chemical insecticides that may have adverse effects on humans, non-target organisms and the environment. In recent years, scientists have sought more environmentally friendly insecticides for medfly control, such as plant- and microorganism-derived compounds. Among these compounds, entomopathogenic fungi are an unexplored source of natural insecticides. The crude soluble protein extract (CSPE) of the entomopathogenic fungus Metarhizium anisopliae (Mestch.) (strain EAMa 01/58-Su) shows chronic insecticidal activity when administered per os. Mortality in flies exhibits a dose response. The CSPE produces an antifeedant effect in adult flies, a result probably due to a progressive deterioration of the fly midgut after ingestion of the extract. Protease and temperature treatments show that insecticidal activity against C. capitata is due to proteinaceous compounds that are highly thermostable. Four monomeric proteins from this crude extract have been purified by liquid chromatography and gel electroelution. Although all four monomers seem to be involved in the insecticidal activity of the CSPE, the 15 kDa and the 11 kDa proteins appear to be mainly responsible for the observed insecticidal effect. Four new fungal proteins with insecticidal activity have been purified and identified. These proteins might be combined with insect baits for C. capitata biocontrol. Copyright 2009 Society of Chemical Industry.

  10. The rhizosphere-competent entomopathogen Metarhizium anisopliae expresses a specific subset of genes in plant root exudate.

    Science.gov (United States)

    Pava-Ripoll, Monica; Angelini, Claudia; Fang, Weiguo; Wang, Sibao; Posada, Francisco J; St Leger, Raymond

    2011-01-01

    Metarhizium anisopliae and Beauveria bassiana are ubiquitous insect pathogens and possible plant symbionts, as some strains are endophytic or colonize the rhizosphere. We evaluated 11 strains of M. anisopliae and B. bassiana, and two soil saprophytes (the non-rhizospheric Aspergillus niger and the rhizosphere-competent Trichoderma harzianum) for their ability to germinate in bean root exudates (REs). Our results showed that some generalist strains of M. anisopliae were as good at germinating in RE as T. harzianum, although germination rates of the specialized acridid pathogen Metarhizium acridum and the B. bassiana strains were significantly lower. At RE concentrations of anisopliae strain ARSEF 2575 showed higher germination rates than T. harzianum. Microarrays showed that strain 2575 upregulated 29 genes over a 12 h period in RE. A similar number of genes (21) were downregulated. Upregulated genes were involved in carbohydrate metabolism, lipid metabolism, cofactors and vitamins, energy metabolism, proteolysis, extracellular matrix/cell wall proteins, transport proteins, DNA synthesis, the sexual cycle and stress response. However, 41.3% of the upregulated genes were hypothetical or orphan sequences, indicating that many previously uncharacterized genes have functions related to saprophytic survival. Genes upregulated in response to RE included the subtilisin Pr1A, which is also involved in pathogenicity to insects. However, the upregulated Mad2 adhesin specifically mediates adhesion to plant surfaces, demonstrating that M. anisopliae has genes for rhizosphere competence that are induced by RE.

  11. Metarhizium anisopliae host-pathogen interaction: differential immunoproteomics reveals proteins involved in the infection process of arthropods.

    Science.gov (United States)

    Santi, Lucélia; Silva, Walter O B; Pinto, Antônio F M; Schrank, Augusto; Vainstein, Marilene H

    2010-04-01

    Metarhizium anisopliae is an entomopathogenic fungus well characterized for the biocontrol of a wide range of plagues. Its pathogenicity depends on the secretion of hydrolytic enzymes that degrade the host cuticle. To identify proteins involved in the infection process and in host specify, immunoproteomic analysis was performed using antiserum produced against crude extract of M. anisopliae cultured in the presence of Rhipicephalus (Boophilus) microplus and Dysdercus peruvianus cuticles. Spots detected using antisera produced against M. anisopliae cultured in cuticles and spore surface proteins, but not with antiserum against M. anisopliae cultured in glucose, were identified so as to give insights about the infection process. An MS/MS allowed the identification of proteases, like elastase, trypsin, chymotrypsin, carboxypeptidase and subtilisin (Pr1A, Pr1I and PR1J), chitinases, DNase I and proline-rich protein. Chymotrypsin and Pr1I were inferred as host specific, being recognized in D. peruvianus infection only. This research represents an important contribution to the understanding the adaptation mechanisms of M. anisopliae to different hosts.

  12. PERSISTÊNCIA DE Metarhizium anisopliae spp NO SOLO SOB DIFERENTES CONDIÇÕES DE TEMPERATURA E UMIDADE

    Directory of Open Access Journals (Sweden)

    Diana Mendonça Silva Guerra

    2009-01-01

    Full Text Available The fungi entomopathogenic are actually objects of works according to their importance in the ecological system. This work analysed the persistence of Metarhizium anisopliae var. anisopliae and M. anisopliae var. acridum, under different conditions of temperature and humidity, in the period of September to December. After inoculation on soil the fungi were submitted to four different treatments: environment temperature and 25% of humidity; environment temperature and 75% of humidity; 28º C and 25% of humidity; 28º C and 75% of humidity, during 120 days. The results show that M. anisiopliac var. anisopliae presented the most recuperation in the treatment at 28º C and 75% of humidity (P > 0,05 in 30 days and maintained a positive conditions on soil for 120 days of experiment. The same did not happen to M. anisopliae var. acridum that, during the whole process of observation and controll the colonies recuperation avoiding its persistence on soil, during the 120 days of experiment.

  13. Entomopathogenic fungal endophytes

    Science.gov (United States)

    Fungal endophytes are quite common in nature and some of them have been shown to have adverse effects against insects, nematodes, and plant pathogens. An introduction to fungal endophytes will be presented, followed by a discussion of research aimed at introducing Beauveria bassiana as a fungal endo...

  14. Manganese Oxidation State Assignment for Manganese Catalase.

    Science.gov (United States)

    Beal, Nathan J; O'Malley, Patrick J

    2016-04-06

    The oxidation state assignment of the manganese ions present in the superoxidized manganese (III/IV) catalase active site is determined by comparing experimental and broken symmetry density functional theory calculated (14)N, (17)O, and (1)H hyperfine couplings. Experimental results have been interpreted to indicate that the substrate water is coordinated to the Mn(III) ion. However, by calculating hyperfine couplings for both scenarios we show that water is coordinated to the Mn(IV) ion and that the assigned oxidation states of the two manganese ions present in the site are the opposite of that previously proposed based on experimental measurements alone.

  15. Genome-wide identification and profiling of microRNA-like RNAs from Metarhizium anisopliae during development.

    Science.gov (United States)

    Zhou, Quan; Wang, Zhangxun; Zhang, Jun; Meng, Huimin; Huang, Bo

    2012-11-01

    Metarhizium anisopliae is one of the most common species of entopathogenic fungi. It has economic and social benefits in many countries where used in agriculture as an important biological control agent of insect pests. M. anisopliae can exist as multiple cell types, which suggests that this fungus has a complex way of gene regulation. MicroRNAs (miRNAs) are endogenous small noncoding RNAs. They play a crucial role in the regulation of gene expression and cell function in plants, animals, and in fungi where they were termed miRNA-like RNAs (milRNAs). In this study, we aimed to identify potential milRNAs in M. anisopliae that may regulate the processes of mycelium growth and conidiogenesis (CO). Two small RNA (sRNA) libraries were constructed and submitted to Solexa sequencing. Fifteen milRNAs were identified using deep-sequencing and computational analysis; most of these milRNAs originated from single genes. Database searches revealed that these novel milRNAs had no homologues in other organisms and were, therefore, M. anisopliae-specific. Many of the milRNAs had differential expression profiles for either mycelium growth or CO. The expression of the selected milRNAs was validated by quantitative reverse transcription polymerase chain reaction. Seventy-eight potential target mRNAs for 14 of the milRNAs were identified successfully by computational analysis. These milRNAs may play an important role in the regulation of mycelial growth and conidiation in M. anisopliae. To our knowledge, this study is the first report of milRNA profiles of organisms in the order Hypocreales. This information could be used to study the regulation of genes and their networks in M. anisopliae.

  16. MALDI-TOF mass spectrometry applied to identifying species of insect-pathogenic fungi from the Metarhizium anisopliae complex.

    Science.gov (United States)

    Lopes, Rogério Biaggioni; Faria, Marcos; Souza, Daniela Aguiar; Bloch, Carlos; Silva, Luciano P; Humber, Richard A

    2014-01-01

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has proven to be a powerful tool for taxonomic resolution of microorganisms. In this proof-of-concept study, we assessed the effectiveness of this technique to track the current gene sequence-based phylogenetic classification of species in the Metarhizium anisopliae complex. Initially the phylogenetic analysis of 5' strains by sequencing of the 59' end of the TEF-1α gene region revealed seven species within M. anisopliae sensu lato and two varieties outside this complex. Because initial studies on MS profiles from different cell types showed that mycelial fragments or conidia produced on nutrient-poor medium may yield too much background noise, all subsequent spectrometric analyses were performed with acidhydrolyzed conidia from 10-12 d old PDA cultures. The initial MALDI-TOF reference library included protein spectral profiles from nine taxonomically distinct, molecularly identified isolates sharing high genetic homology with the ex-type or ex-epitype isolates of these taxa in Metarhizium. A second reference library added one isolate each for M. anisopliae sensu stricto and M. robertsii. The second, larger reference library (including 11 taxa) allowed nearly perfect MALDI-TOF matching of DNA-based species identification for the 40 remaining isolates molecularly recognized as M. anisopliae sensu stricto (n = 19), M. robertsii (n = 6), M. majus (n = 3), M. lepidiotae (n = 1), M. acridum (n = 3), M. flavoviride var. pemphigi (n = 1), plus seven unidentified strains (six of them phylogenetically close to M. anisopliae sensu stricto and one outside the Metarhizium pingshaense-anisopliae-robertsii-brunneum clade). Due to the increasing frequency of phylogenetically (genomically) based taxonomic revisions of fungi, this approach is especially useful for culture collections, because once the protein profiles of Metarhizium isolates are obtained taxonomic updating of MALDI

  17. In vivo interactions of entomopathogenic fungi, Beauveria spp. and Metarhizium anisopliae with selected opportunistic soil fungi of sugarcane ecosystem.

    Science.gov (United States)

    Geetha, N; Preseetha, M; Hari, K; Santhalakshmi, G; Bai, K Subadra

    2012-07-01

    In the present study, the interactions of entomopathogenic fungi viz., Beauveria bassiana, Beauveria brongniartii and Metarhizium anisopliae among themselves and three other opportunistic soil fungi from the sugarcane ecosystem namely, Fusarium saachari, Aspergillus sp. and Penecillium sp. were assayed in vivo against Galleria mellonella larvae. The tested fungi were co-applied on IV instar G. mellonella @ 1 x 10(7) ml(-1), in combinations of two, at the interval of 24 hrs either preceding or succeeding each otherto assess their efficacy and sporulation rates. Results showed that often mortality rates did not correspond to the spore harvest of the mortality agent and presence of other fungus may be antagonistic. The efficacy of B. bassiana (90%) and B. brongniartii (100%) was not enhanced further but was negatively affected in most combinations with other fungi. In case of M. anisopliae compatibility was higher, resulting in higher mortality by application of B. bassiana before (100%) or after (83.3%) M. anisopliae than when it was applied alone (70%). During sporulation, B. bassiana faced the most intense competition from M. anisopliae (2.75 x 10(6) larva(-1)) and enhancement due to F sacchari irrespective of sequence of application. In case of B. brongniartii, sporulation was lowest in the combination of B. brongniartiipreceding M. anisopliae (1.83 x10(6) larva(-1)) and B. brongniartii succeeding B. bassiana (1.58 x 10(6) larva(-1)). Of all fungi tested, except F sacchari (65.33 x 10(6) larva(-1)) all the other species affected sporulation of M. ansiopliae with the least in treatment of B. bassiana application following M. anisopliae. Similar kind of interaction was observed during sporulation of soil fungi when combined with entomopathogenic fungi, though individually they could not cause mortality of larvae.

  18. Impact of moisture on survival of Aedes aegypti eggs and ovicidal activity of Metarhizium anisopliae under laboratory conditions.

    Science.gov (United States)

    Luz, C; Tai, M H H; Santos, A H; Silva, H H G

    2008-03-01

    The effect of relative humidity (43%, 75%, 86% and > 98%) on Aedes aegypti eggs treated with Metarhizium anisopliae or water only was tested for up to a six months exposure at 25 degrees C. Survival of larvae inside eggs was clearly affected by the lowest humidity (43%) tested, and eclosion diminished at all humidities after increasing periods of exposure. M. anisopliae showed to have a strong ovicidal activity only at humidity close to saturation. No difference of activity was found between conidia and hyphal bodies tested. This fungus affected larvae inside eggs and has potential as a control agent of this important vector in breeding sites with high moisture.

  19. Impact of moisture on survival of Aedes aegypti eggs and ovicidal activity of Metarhizium anisopliae under laboratory conditions

    Directory of Open Access Journals (Sweden)

    C Luz

    2008-03-01

    Full Text Available The effect of relative humidity (43%, 75%, 86% and > 98% on Aedes aegypti eggs treated with Metarhizium anisopliae or water only was tested for up to a six months exposure at 25ºC. Survival of larvae inside eggs was clearly affected by the lowest humidity (43% tested, and eclosion diminished at all humidities after increasing periods of exposure. M. anisopliae showed to have a strong ovicidal activity only at humidity close to saturation. No difference of activity was found between conidia and hyphal bodies tested. This fungus affected larvae inside eggs and has potential as a control agent of this important vector in breeding sites with high moisture.

  20. Integrated control of an acaricide-resistant strain of the cattle tick Rhipicephalus microplus by applying Metarhizium anisopliae associated with cypermethrin and chlorpyriphos under field conditions.

    Science.gov (United States)

    Webster, Anelise; Reck, José; Santi, Lucélia; Souza, Ugo A; Dall'Agnol, Bruno; Klafke, Guilherme M; Beys-da-Silva, Walter O; Martins, João Ricardo; Schrank, Augusto

    2015-01-30

    The efficacy of the fungus Metarhizium anisopliae to control ticks has been shown in several in vitro experiments. However, few studies have been undertaken in field conditions in order to demonstrate the applicability of its use as a biological control of ticks and its combination with chemical acaricides. The aim of the present study was to evaluate the efficacy of M. anisopliae to control an acaricide-resistant strain of Rhipicephalus microplus under laboratory and field conditions. First, the compatibility of M. anisopliae strain (TIS-BR03) with commercial acaricides and its potential to control the cattle tick were evaluated in vitro. In general, acaricide treatments had mild effects on fungus viability. In the field experiment, the median of treatment efficacy with acaricide only, M. anisopliae only and combination of M. anisopliae with acaricide were 71.1%, 56.3% and 97.9%, respectively. There is no statistical difference between groups treated with M. anisopliae and acaricide alone. Thus, in this work we have demonstrated the applicability of M. anisopliae use associated or not with chemical acaricides on field conditions in order to control an acaricide-resistant strain of the cattle tick R. microplus.

  1. Selection of Beauveria bassiana (Bals. Vuill. and Metarhizium anisopliae (Metsch. Sorok. strains for control of Cornitermes cumulans (Kollar

    Directory of Open Access Journals (Sweden)

    Pedro J. Neves

    2000-01-01

    Full Text Available Fifty strains of the entomopathogenic fungi Beauveria bassiana (Bals. Vuill. and Metarhizium anisopliae (Metsch. Sorok. were tested against the termite Cornitermes cumulans. In the first phase of the experiments, several bioassays were conducted and the five best strains were selected. The criterion for strain selection during this phase was the confirmed mortality above 50% five days after application of the fungus. Three M. anisopliae and two B. bassiana strains were the most virulent. The second phase of the experiments consisted of a bioassay and a conidial production test using a rice medium. The best M. anisopliae and B. bassiana strains were selected using both the confirmed insect mortality nine days after application of the fungus and the yield of conidia. Considering results from the bioassay, M. anisopliae 1037 showed the highest confirmed (57.8% and total (89.2% mortalities after nine days. Among the B. bassiana strains, 447 was the most virulent with confirmed and total mortalities of 45.9% and 89.8%, respectively. M. anisopliae 1037 had the highest conidial yield with mean of 3.37 x 10(12 conidia/kg of rice, followed by B. bassiana strain 447 with 2.66 x 10(12 conidia/kg of rice. The M. anisopliae strain 1037 was the highest virulent followed by B. bassiana strain 447. This strains showed the greatest potential as agents to be used in biological control programs against C. cumulans.Nesta pesquisa foram testados cinqüenta isolados dos fungos entomopatogênicos Beauveria bassiana (Bals. Vuill. e Metarhizium anisopliae (Metsch. Sorok. sobre Cornitermes cumulans. Na primeira fase foram realizados vários bioensaios, selecionando-se os 5 melhores isolados. O critério usado para a seleção foi a mortalidade confirmada acima de 50%, no quinto dia após a aplicação. Três isolados de M. anisopliae e dois de B. bassiana foram os mais virulentos. A segunda fase de seleção constou de um bioensaio e um teste de produção de con

  2. Controle de larvas de Boophilus microplus por Metarhizium anisopliae em pastagens infestadas artificialmente Control of Boophilus microplus larvae by Metarhizium anisopliae in artificially infested pastures

    Directory of Open Access Journals (Sweden)

    Lúcia Mara de Souza Basso

    2005-06-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência do controle exercido por Metarhizium anisopliae na população de Boophilus microplus, em pastagens de Brachiaria brizantha, e do híbrido Tifton 85 (Cynodon spp., artificialmente infestadas com fêmeas ingurgitadas do carrapato. Trinta canteiros com 1 m² de área cada foram distribuídos aleatoriamente. Quinze foram pulverizados com esporos do fungo e quinze controles em cada forrageira, constituindo cinco repetições de cada tratamento, foram infestados com número e peso padronizados de fêmeas ingurgitadas do ácaro. Aplicou-se o fungo, na concentração de 1,8x10(8 conídios mL-1, em três situações: pulverização antes da infestação com o carrapato, após a infestação e posterioriormente à emergência das primeiras larvas nos capins. A ação do fungo foi avaliada no 35º, 38º, 41º, 48º, 55º e 61º dia pós-infestação, por meio da contagem de larvas recuperadas. Obteve-se controle de larvas do ácaro, que, nas avaliações realizadas entre o 35º e o 48º dia pós-infestação, variou entre 87% e 94%. As médias das contagens de estágios larvares do carrapato foram menores em todas as amostragens realizadas no capim-Tifton 85, indicando que houve efeito da pastagem na ação do fungo. A situação de aplicação influencia a atividade do fungo, com melhor resultado nas coletas realizadas entre o 41º e 55º dia após infestação em B. brizantha, e aplicação dos conídios logo após a emergência das primeiras larvas.The objective of this work was to evaluate the efficiency of Metarhizium anisopliae fungus against Boophilus microplus population in Brachiaria brizantha and Tifton 85 (Cynodon pastures, artificially infested with tick engorged females. Thirty plots of 1 m² each were randomly distributed in fifteen treated and fifteen control groups per type of grass, establishing five repetitions for each treatment. Pastures were infested with engorged tick females

  3. Correlation between Pr1 and Pr2 gene content and virulence in Metarhizium anisopliae strains.

    Science.gov (United States)

    Rosas-García, Ninfa M; Avalos-de-León, Osvaldo; Villegas-Mendoza, Jesús M; Mireles-Martínez, Maribel; Barboza-Corona, J E; Castañeda-Ramírez, J C

    2014-11-28

    Metarhizium anisopliae is a widely studied model to understand the virulence factors that participate in pathogenicity. Proteases such as subtilisin-like enzymes (Pr1) and trypsin-like enzymes (Pr2) are considered important factors for insect cuticle degradation. In four M. anisopliae strains (798, 6342, 6345, and 6347), the presence of pr1 and pr2 genes, as well as the enzymatic activity of these genes, was correlated with their virulence against two different insect pests. The 11 pr1 genes (A, B, C, D, E, F, G, H, I, J, and K) and pr2 gene were found in all strains. The activity of individual Pr1 and Pr2 proteases exhibited variation in time (24, 48, 72, and 96 h) and in the presence or absence of chitin as the inductor. The highest Pr1 enzymatic activity was shown by strain 798 at 48 h with chitin. The highest Pr2 enzymatic activity was exhibited by the 6342 and 6347 strains, both grown with chitin at 24 and 48 h, respectively. Highest mortality on S. exigua was caused by strain 6342 at 48 h, and strains 6342, 6345, and 6347 caused the highest mortality 7 days later. Mortality on Prosapia reached 30% without variation. The presence of subtilisin and trypsin genes and the activity of these proteases in M. anisopliae strains cannot be associated with the virulence against the two insect pests. Probably, subtilisin and trypsin enzyme production is not a vital factor for pathogenicity, but its contribution is important to the pathogenicity process.

  4. Selection of indigenous isolates of entomopathogenic soil fungus Metarhizium anisopliae under laboratory conditions.

    Science.gov (United States)

    Skalický, Aleš; Bohatá, Andrea; Šimková, Jana; Osborne, Lance S; Landa, Zdeněk

    2014-07-01

    Eight native isolates of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin were obtained by monitoring soils cultivated in a conventional manner. These isolates were compared in three areas: (a) conidial germination, (b) radial growth and sporulation and (c) ability of conidia to infect Tenebrio molitor larvae. All bioassays were carried out at constant temperatures of 10, 15, and 20 °C. Conidia of individual isolates demonstrated differences in germination after a 24-h long incubation at all evaluated temperatures. At 20 °C, the germination ranged from 67 to 100 % and at 15 °C from 5.33 to 46.67 %. At 10 °C, no germination was observed after 24 h; nevertheless, it was 8.67-44.67 % after 48 h. In terms of radial growth, the culture diameters and the associated production of spores of all isolates increased with increasing temperature. At 10 °C, sporulation was observed in three isolates while all remaining cultures appeared sterile. Three weeks post-inoculation, conidia of all assessed isolates caused 100 % cumulative mortality of treated larvae of T. molitor at 15 and 20 °C with the exception of isolate 110108 that induced 81.33 % mortality at 15 °C. At 10 °C, larval cumulative mortality ranged from 6.67 to 85.33 % depending on the isolate. Isolates 110108 and 110111 showed significantly slower outset and a much lower rate of infection at all temperatures compared to other tested isolates of M. anisopliae. The bioassays were carried out with the purpose to sort and select indigenous isolates of M. anisopliae useful as biocontrol agents in their original habitat.

  5. Properties of erythrocyte catalase from heterozygotes for Japanese type acatalasemia.

    Directory of Open Access Journals (Sweden)

    Ogata,Masana

    1979-06-01

    Full Text Available The level of blood catalase activity in heterozygotes for Japanese type acatalasemia was demonstrated to be about half of normal levels by means of titration and spectrophotometric methods. A distribution plot of catalase activities in heterozygous blood was completely separate from that of normal blood. Comparative analysis of the partially purified erythrocyte catalase preparations obtained from normal and heterozygous individuals revealed no distinct differences between them regarding stability to heat, sodium dodecyl sulfate and some enzyme inhibitors or pH dependency. The erythrocyte catalase in heterozygotes for Japanese type acatalasemia contains about half the normal specific activity and as stable as that in normal individuals.

  6. Transcriptional Repression of Catalase in Mouse Skin Tumor Progression

    Directory of Open Access Journals (Sweden)

    Kevin A. Kwei

    2004-09-01

    Full Text Available Previous studies in our laboratory have shown that the elevation of reactive oxygen species levels and the repression of the antioxidant enzyme, catalase, played a critical role in the in vitro progression of benign papilloma cells to malignant carcinoma cells. Catalase message, protein levels, and activity levels were found to be downregulated in the malignantly progressed cells. The goal of this study is to further characterize the repression of catalase in malignant progression of mouse skin tumors. To validate the in vitro observations, we examined catalase expression in tumor samples generated by the multistep chemical carcinogenesis protocol. Higher levels of catalase mRNA and protein were observed in benign papillomas versus malignant carcinomas. Nuclear run-on analysis showed that catalase repression in the cultured malignant cells was transcription-dependent. Results from luciferase reporter assays indicated that malignant cells have lower catalase promoter activities than benign papilloma cells, in part through the Wilm's tumor suppressor 1 (WT1 binding site within the proximal promoter region. The WTi protein levels were found to be inversely correlated with the observed catalase promoter activities, with higher levels observed in the malignant cells versus the benign cells. These results led us to conclude that WTi is acting as a transcription repressor in catalase gene regulation during tumor progression.

  7. Developmental expression of a catalase inhibitor in maize

    Energy Technology Data Exchange (ETDEWEB)

    Sorenson, J.C.; Scandalios, J.G.

    1976-01-01

    The expression of an endogenous catalase inhibitor has been studied during development of Zea mays. In the 3-day seedling, the inhibitor is expressed primarily in the scutellum and in the aleurone layer of the endosperm. These tissues also show the highest catalase activity at this stage. Inhibitor expression has also been studied temporally in the scutellum, roots, and shoot over the first 12 days of germination. Inhibitor expression shows an inverse relationship with catalase activity in the scutellum and in the shoot. The relationship is less rigid in the root, due probably to the low levels of inhibitor found in that tissue. The role of the inhibitor in catalase regulation is discussed.

  8. Blood superoxiddismutase and catalase: enzymes activity under oxidative stress conditions

    Directory of Open Access Journals (Sweden)

    Каріна Леонідівна Шамелашвілі

    2015-05-01

    Full Text Available The activity of catalase and superoxide dismutase depends not only on the used compounds of rhenium, and also on their dimensional structure and form of applying. It is established that the cis- and trans-isomers of complex compounds of rhenium did countervailing effect on superoxide dismutase and catalase activities. Cis-isomers of Rhenium dycarboxylats agreed increased activity of superoxide dismutase and catalase. While under the action of trans-isomers, where increased activity of superoxide dismutase, catalase activity decreased

  9. Allergic Responses Induced by a Fungal Biopesticide Metarhizium anisopliae and House Dust Mite are Compared in a Mouse Model

    Science.gov (United States)

    Biopesticides can be effective in controlling their target pest. However, research regarding mammalian health impacts of these agents has focused on toxicity and pathogenicity, with limited research regarding allergenicity and asthma development. We compared the ability of funga...

  10. Bacterial and fungal keratitis in Upper Egypt: In vitro screening of enzymes, toxins and antifungal activity

    Directory of Open Access Journals (Sweden)

    Abdullah A Gharamah

    2014-01-01

    Full Text Available Purpose: This work was conducted to study the ability of bacterial and fungal isolates from keratitis cases in Upper Egypt to produce enzymes, toxins, and to test the isolated fungal species sensitivity to some therapeutic agents. Materials and Methods: One hundred and fifteen patients clinically diagnosed to have microbial keratitis were investigated. From these cases, 37 bacterial isolates and 25 fungal isolates were screened for their ability to produce extra-cellular enzymes in solid media. In addition, the ability of fungal isolates to produce mycotoxins and their sensitivity to 4 antifungal agents were tested. Results: Protease, lipase, hemolysins, urease, phosphatase, and catalase were detected respectively in 48.65%, 37.84%, 59.46%, 43.24%, 67.57%, and 100% out of 37 bacterial isolates tested. Out of 25 fungal isolates tested during the present study, 80% were positive for protease, 84% for lipase and urease, 28% for blood hemolysis, and 100% for phosphatase and catalase enzymes. Thirteen fungal isolates were able to produce detectable amounts of 7 mycotoxins in culture medium (aflatoxins (B1, B2, G1, and G2, sterigmatocystin, fumagillin, diacetoxyscirpenol, zearalenone, T-2 toxin, and trichodermin. Among the antifungal agents tested in this study, terbinafine showed the highest effect against most isolates in vitro. Conclusion: In conclusion, the ability of bacterial and fungal isolates to produce extracellular enzymes and toxins may be aid in the invasion and destruction of eye tissues, which, in turn, lead to vision loss.

  11. Bacterial and fungal keratitis in Upper Egypt: in vitro screening of enzymes, toxins and antifungal activity.

    Science.gov (United States)

    Gharamah, Abdullah A; Moharram, Ahmed M; Ismail, Mady A; Al-Hussaini, Ashraf K

    2014-02-01

    This work was conducted to study the ability of bacterial and fungal isolates from keratitis cases in Upper Egypt to produce enzymes, toxins, and to test the isolated fungal species sensitivity to some therapeutic agents. One hundred and fifteen patients clinically diagnosed to have microbial keratitis were investigated. From these cases, 37 bacterial isolates and 25 fungal isolates were screened for their ability to produce extra-cellular enzymes in solid media. In addition, the ability of fungal isolates to produce mycotoxins and their sensitivity to 4 antifungal agents were tested. Protease, lipase, hemolysins, urease, phosphatase, and catalase were detected respectively in 48.65%, 37.84%, 59.46%, 43.24%, 67.57%, and 100% out of 37 bacterial isolates tested. Out of 25 fungal isolates tested during the present study, 80% were positive for protease, 84% for lipase and urease, 28% for blood hemolysis, and 100% for phosphatase and catalase enzymes. Thirteen fungal isolates were able to produce detectable amounts of 7 mycotoxins in culture medium (aflatoxins (B1, B2, G1, and G2), sterigmatocystin, fumagillin, diacetoxyscirpenol, zearalenone, T-2 toxin, and trichodermin). Among the antifungal agents tested in this study, terbinafine showed the highest effect against most isolates in vitro. In conclusion, the ability of bacterial and fungal isolates to produce extracellular enzymes and toxins may be aid in the invasion and destruction of eye tissues, which, in turn, lead to vision loss.

  12. Catalases are NAD(PH-dependent tellurite reductases.

    Directory of Open Access Journals (Sweden)

    Iván L Calderón

    Full Text Available Reactive oxygen species damage intracellular targets and are implicated in cancer, genetic disease, mutagenesis, and aging. Catalases are among the key enzymatic defenses against one of the most physiologically abundant reactive oxygen species, hydrogen peroxide. The well-studied, heme-dependent catalases accelerate the rate of the dismutation of peroxide to molecular oxygen and water with near kinetic perfection. Many catalases also bind the cofactors NADPH and NADH tenaciously, but, surprisingly, NAD(PH is not required for their dismutase activity. Although NAD(PH protects bovine catalase against oxidative damage by its peroxide substrate, the catalytic role of the nicotinamide cofactor in the function of this enzyme has remained a biochemical mystery to date. Anions formed by heavy metal oxides are among the most highly reactive, natural oxidizing agents. Here, we show that a natural isolate of Staphylococcus epidermidis resistant to tellurite detoxifies this anion thanks to a novel activity of its catalase, and that a subset of both bacterial and mammalian catalases carry out the NAD(PH-dependent reduction of soluble tellurite ion (TeO(3(2- to the less toxic, insoluble metal, tellurium (Te(o, in vitro. An Escherichia coli mutant defective in the KatG catalase/peroxidase is sensitive to tellurite, and expression of the S. epidermidis catalase gene in a heterologous E. coli host confers increased resistance to tellurite as well as to hydrogen peroxide in vivo, arguing that S. epidermidis catalase provides a physiological line of defense against both of these strong oxidizing agents. Kinetic studies reveal that bovine catalase reduces tellurite with a low Michaelis-Menten constant, a result suggesting that tellurite is among the natural substrates of this enzyme. The reduction of tellurite by bovine catalase occurs at the expense of producing the highly reactive superoxide radical.

  13. Freshwater Fungal Infections

    Directory of Open Access Journals (Sweden)

    Dennis J. Baumgardner

    2017-01-01

    Full Text Available Fungal infections as a result of freshwater exposure or trauma are fortunately rare. Etiologic agents are varied, but commonly include filamentous fungi and Candida. This narrative review describes various sources of potential freshwater fungal exposure and the diseases that may result, including fungal keratitis, acute otitis externa and tinea pedis, as well as rare deep soft tissue or bone infections and pulmonary or central nervous system infections following traumatic freshwater exposure during natural disasters or near-drowning episodes. Fungal etiology should be suspected in appropriate scenarios when bacterial cultures or molecular tests are normal or when the infection worsens or fails to resolve with appropriate antibacterial therapy.

  14. Laboratory mortality and mycosis of adult Curculio caryae (Coleoptera: Curculionidae) following application of Metarhizium anisopliae in the laboratory and field

    Science.gov (United States)

    The pecan weevil, Curculio caryae, is a key pest of pecans. Our objective was to determine the potential of Metarhizium anisopliae to control emerging C. caryae adults. First, a laboratory test was conducted to compare four Beauveria bassiana strains (Bb GA2, BbLA3, BbMS1, and GHA) and three M. an...

  15. Survival of anopheline eggs and their susceptibility to infection with Metarhizium anisopliae and Beauveria bassiana under laboratory conditions.

    Science.gov (United States)

    Luz, Christian; Mnyone, Ladslaus L; Russell, Tanya L

    2011-09-01

    The viability of Anopheles gambiae sensu stricto and Anopheles arabiensis (Diptera: Culicidae) eggs over time and the ovicidal activity of Beauveria bassiana (Ascomycota: Cordycipitaceae) and Metarhizium anisopliae (Ascomycota: Clavicipitaceae) were investigated. Eggs were incubated in soil or leaf litter for up to 12 weeks at 26°C and 75%, 86% or >98% relative humidity (RH). Eggs were treated topically with M. anisopliae ICIPE-30 or B. bassiana I93-825 conidia in either water or oil-in-water formulations. Survival of eggs whether treated or not with fungus was similar, and untreated eggs generally did not survive longer than 2 weeks regardless of the substrate or humidity tested. After a minimal 5-day exposure, M. anisopliae at 5 × 10(6) conidia/cm(2) clearly reduced the number of larvae. The efficacy of the fungus increased when it was oil-in-water formulated, and eclosion was completely prevented regardless of the conidial concentration (10(5)-10(7) conidia/cm(2)) after a 10-day exposure in soils at >98% RH. Treatment of eggs with B. bassiana, however, failed to reduce the number of eclosing larvae. This is the first demonstration of the ovicidal activity by M. anisopliae against either A. gambiae s. s. or A. arabiensis and the results underline the potential of this fungus against anopheline mosquitoes.

  16. Autodissemination of the entomopathogenic fungus Metarhizium anisopliae amongst adults of the malaria vector anopheles gambiae s.s.

    NARCIS (Netherlands)

    Scholte, E.J.; Knols, B.G.J.; Takken, W.

    2004-01-01

    Background - The entomopathogenic fungus Metarhizium anisopliae is being considered as a biocontrol agent for adult African malaria vectors. In the laboratory, work was carried out to assess whether horizontal transmission of the pathogen can take place during copulation, as this would enhance the i

  17. Infection of the malaria mosquito Anopheles gambiae with the entomopathogenic fungus Metarhizium anisopliae reduces blood feeding and fecundity

    NARCIS (Netherlands)

    Scholte, E.J.; Knols, B.G.J.; Takken, W.

    2006-01-01

    The entomopathogenic fungus Metarhizium anisopliae is being considered as a biocontrol agent against adult African malaria vectors. In addition to causing significant mortality, this pathogen is known to cause reductions in feeding and fecundity in a range of insects. In the present study we investi

  18. First report of Metarhizium anisopliae IP 46 pathogenicity in adult Anopheles gambiae s.s. and An. arabiensis (Diptera; Culicidae)

    NARCIS (Netherlands)

    Mnyone, L.L.; Russell, T.L.; Lyimo, I.N.; Lwetoijera, D.W.; Kirby, M.J.; Luz, C.

    2009-01-01

    The entomopathogenic fungus Metarhizium anisopliae isolate IP 46, originating from a soil sample collected in 2001 in the Cerrado of Central Brazil, was tested for its ability to reduce the survival of adult male and female Anopheles gambiae s.s. and An. arabiensis mosquitoes. A 6-h exposure to the

  19. Susceptibility of adults of the cerambycid beetle Hedypathes betulinus to the entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, and Purpureocillium lilacinum.

    Science.gov (United States)

    Schapovaloff, M E; Alves, L F A; Fanti, A L; Alzogaray, R A; López Lastra, C C

    2014-01-01

    The cerambycid beetle Hedypathes betulinus (Klug) (Coleoptera: Cerambycidae) causes severe damage to yerba mate plants (Ilex paraguariensis (St. Hilaire) (Aquifoliales: Aquifoliaceae)), which results in large losses of production. In this study, the pathogenicity of entomopathogenic fungi of the species Beauveria bassiana (Balsamo-Crivelli) Vuillemin (Hypocreales: Cordycipitaceae), Metarhizium anisopliae sensu lato (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae), and Purpureocillium lilacinum (Thom) Luangsa-ard, Hywel-Jones, Houbraken and Samson (Hypocreales: Ophiocordycipitaceae) on yerba mate were evaluated. Fifteen isolates of B. bassiana, two of M. anisopliae, and seven of P. lilacinum on H. betulinus adults were analyzed under laboratory conditions. The raw mortality rate caused by B. bassiana isolates varied from 51.1 to 86.3%, and their LT50 values varied between 8.7 and 13.6 d. The isolates of M. anisopliae caused 69.6‒81.8% mortality, and their LT50 values varied between 7.4 and 7.9 d. In contrast, isolates of P. lilacinum were not pathogenic. M. anisopliae and B. bassiana isolates were pathogenic against H. betulinus adults, suggesting that they may be useful in biological control programs for insect pests of yerba mate.

  20. Desenvolvimento dos fungos Metarhizium anisopliae (Metschnikoff, 1879 Sorokin, 1883 E Beauveria bassiana (Balsamo Vuillemin, 1912 sobre Ctenocephalides felis felis (Bouché, 1835 Development of the fungi Metarhizium anisopliae (Metschnikoff, 1879 Sorokin, 1883 and Beauveria bassiana (Balsamo Vuillemin, 1912 on the Ctenophephalides felis felis (Bouché, 1835

    Directory of Open Access Journals (Sweden)

    Denise R. De Melo

    2007-09-01

    Full Text Available A pulga Ctenocephalides felis felis é um parasita causador dermatites alérgicas e também pode transmitir diversos agentes etiológicos aos animais domésticos e aos homens. O objetivo deste trabalho foi verificar o desenvolvimento do fungo sobre a cutícula da pulga, através da microscopia eletrônica de varredura. Os isolados fúngicos testados foram o Metarhizium anisopliae 959 e Beauveria bassiana 986, ambos na concentração 10(8 conídios/ml. Após a exposição dos isolados fúngicos no período de duas, 15, 26 e 96 horas , o material foi processado para a microscopia eletrônica de varredura. Com a obtenção das micrografias, pode-se observar que com 2 horas após exposição aos fungos, os conídios estavam aderidos por toda a cutícula, situando-se preferencialmente nas membranas intersegmentais do abdome. Com 15 horas observou-se a formação do tubo de germinação e a cabeça do apressório e após 26 horas foi possível observar as ramificações e o engrossamento das hifas sobre a cutícula das pulgas. Os resultados indicam que os fungos testados foram capazes de se desenvolver sobre a cutícula de C. f. felis.The flea Ctenocephalides felis felis is a parasite that causes allergic dermatitis and also may transmit etiologic agents to domestic animals and humans. This study investigated by scanning electron microscopy the development of entomopathogenic fungi on flea cuticle. Fleas were exposed to conidia (10(8 ml-1 of Metarhizium anisopliae (isolate 959 or Beauveria bassiana (isolate 986. Following standard protocols for electron microscopy, the specimens were prepared 2, 15, 26 and 96 h after infection. The micrography revealed that 2 h after fungus exposure, conidia attachments encompassed the entire flea cuticle, especially on abdominal intersegmental membranes. The emergence of germ tubes and appressoria formation occurred at 15 h, thickening and branching of hyphae on the flea cuticle was noted at 26 h. Therefore, both of

  1. Catalase Deficiency Accelerates Diabetic Renal Injury Through Peroxisomal Dysfunction

    Science.gov (United States)

    Hwang, Inah; Lee, Jiyoun; Huh, Joo Young; Park, Jehyun; Lee, Hi Bahl; Ho, Ye-Shih; Ha, Hunjoo

    2012-01-01

    Mitochondrial reactive oxygen species (ROS) play an important role in diabetes complications, including diabetic nephropathy (DN). Plasma free fatty acids (FFAs) as well as glucose are increased in diabetes, and peroxisomes and mitochondria participate in FFA oxidation in an interconnected fashion. Therefore, we investigated whether deficiency of catalase, a major peroxisomal antioxidant, accelerates DN through peroxisomal dysfunction and abnormal renal FFA metabolism. Diabetes was induced by multiple injections of low-dose streptozotocin into catalase knock-out (CKO) and wild-type (WT) C57BL/6 mice. Murine mesangial cells (MMCs) transfected with catalase small interfering RNA followed by catalase overexpression were used to further elucidate the role of endogenous catalase. Despite equivalent hyperglycemia, parameters of DN, along with markers of oxidative stress, were more accelerated in diabetic CKO mice than in diabetic WT mice up to 10 weeks of diabetes. CKO mice and MMCs showed impaired peroxisomal/mitochondrial biogenesis and FFA oxidation. Catalase deficiency increased mitochondrial ROS and fibronectin expression in response to FFAs, which were effectively restored by catalase overexpression or N-acetylcysteine. These data provide unprecedented evidence that FFA-induced peroxisomal dysfunction exacerbates DN and that endogenous catalase plays an important role in protecting the kidney from diabetic stress through maintaining peroxisomal and mitochondrial fitness. PMID:22315314

  2. Immobilization and characterization of bovine liver catalase on eggshell

    Directory of Open Access Journals (Sweden)

    ÖZLEM ALPTEKİN

    2008-06-01

    Full Text Available Bovine liver catalase immobilized on eggshell particles was characterized and the reusability of the immobilized catalase was investigated in a batch type reactor. For immobilized catalase onto ground eggshell (ICATG, the optimum initial amount of catalase was 85 mg g-1 of eggshells, the optimum pH was 6.0 (75 mM citrate buffer and the temperature was 30 °C. The Vmax and Km values of ICATG were determined as 29.1±1.2 U/mg of protein and 41.9±2.7 mM, respectively. The reusability of ICATG was tested and the remaining activity of ICATG was found to be 73 % of the initial activity after 80 cycles of batch operation. The amount of catalase bound onto the carrier was estimated by using the results of induced coupled plasma measurements. The catalytic efficiencies (kcat/Km of free catalase and ICATG were found to be 1.4´106 and 2.8´103 dm3 s-1 mol-1, respectively. Catalase immobilization onto eggshell is economic and has good reusability. Hence, it can be concluded that eggshell is an efficient carrier for immobilizing catalase.

  3. Peroxisomal catalase deficiency modulates yeast lifespan depending on growth conditions

    NARCIS (Netherlands)

    Kawalek, Adam; Lefevre, Sophie D.; Veenhuis, Marten; van der Klei, Ida J.

    2013-01-01

    We studied the role of peroxisomal catalase in chronological aging of the yeast Hansenula polymorpha in relation to various growth substrates. Catalase-deficient (cat) cells showed a similar chronological life span (CLS) relative to the wild-type control upon growth on carbon and nitrogen sources th

  4. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Science.gov (United States)

    2010-04-01

    ... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.135 Catalase derived from... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND...

  5. Infectivity of Metarhizium anisopliae (Hypocreales: Clavicipitaceae) to Phlebotomus papatasi (Diptera: Psychodidae) under laboratory conditions.

    Science.gov (United States)

    Zayed, Alia; Soliman, Mustafa M; El-Shazly, Mohamed M

    2013-07-01

    Susceptibility of Phlebotomus papatasi Scopoli (Diptera: Psychodidae) larvae to the entomopathogenic fungus Metarhizium anisopliae (Metschinkoff) Sorokin (Ma79) (Hypocreales: Clavicipitaceae) was evaluated at two different temperatures. The ability of the fungus to reinfect healthy sand flies was followed up for approximately 20 wk and the effect of in vivo repassage on the enhancement of its virulence was assessed. The fungus reduced the adult emergence at 26 +/- 1 degrees C when applied to larval diet. Six spore concentrations were used in the bioassays ranging from 1 x 10(6) to 5 x 10(8) spores/ml. Mortality decreased significantly when the temperature was raised to 31 +/- 1 degrees C at all tested concentrations. Fungus-treated vials were assayed against sand fly larvae at different time lapses without additional reapplication of the fungus in the media to determine whether the level of inocula persisting in the media was sufficient to reinfect healthy sand flies. Twenty weeks postapplication, there were still enough infectious propagules of Ma79 to infect 40% of P. papatasi larvae. A comparison between the infectivity of 10 subsequent in vitro cultures and the host-passed inocula of the fungus against sand fly larvae was conducted. Mortalities of P. papatasi larvae changed significantly when exposed to inocula passed through different insects. Presented data can provide vector control decision makers and end users with fundamental information for the introduction and application of M. anisopliae as an effective control agent against the main cutaneous leishmaniasis old-world vector P. papatasi.

  6. Expression of chitinase genes of Metarhizium anisopliae isolates in lepidopteran pests and on synthetic media.

    Science.gov (United States)

    Bhanu Prakash, G V S; Padmaja, V; Jami, Sravan Kumar; Kirti, P B

    2012-12-01

    Pathogenecity of the well characterized entomopathogenic fungus Metarhizium anisopliae used for biocontrol of a wide range of insect pests secretes hydrolytic enzymes that degrade the host cuticle. The chitinolytic activity of high and low virulent isolates of M. anisopliae was assayed on minimal medium (MM) + colloidal chitin and MM supplemented with insect cuticles. Ex- pression pattern of four chitinase genes (chitinase (chi), chi 1, chi 2, chi 3) was profiled during pathogenic stages of the entomopathogen under in vitro and in vivo conditions. Reverse-transcription polymerase chain reaction (RT-PCR) analysis confirmed that chitinase cDNAs were expressed during the germination of fungus under nutrient-deprived conditions. RT-PCR analysis performed for the four chitinase genes on the two insect hosts Spodoptera litura and Helicoverpa armigera at six developmental stages of the pathogen displayed up-regulation in S. litura at mycosed and conidiated condition while with H. armigera there was expression only after 48 h of incubation. Differential expression of chi, chi 1 and chi 2 genes in vitro (nitrogen rich and nitrogen limiting media) and in vivo (live insect hosts S. litura and H. armigera) implicate the role of substrate differences in pathogenesis.

  7. Evaluating Toxicity of Extracted Destruxin from Metarhizium Anisopliae Against Citrus Leafminer, Phyllocnistis citrella

    Directory of Open Access Journals (Sweden)

    M. M. Sharif

    2010-01-01

    Full Text Available Problem statement: The fungus, Metarhizium anisopliae (Metschnikoff Sorokin produces some cyclic peptide toxins, destruxins, which exhibit a variety of insecticidal actions. Citrus leafminer, Phyllocnistis citrella Stainton, is a major pest of young citrus trees; therefore its effective and safe control is a important issue. Approach: Five isolates of M. anisopliae were inoculated in Potato Dextrose Broth (PDB mediums. Destruxin was extracted by adding chloroform. Citrus leafminer was bioassayed by using the leaves containing early stages larvae and the data were recorded after 1, 2, 3 and 4 days after treatment. Results: The range of mortality was between 30-65% based on the endpoint data. The minimum of three days to achieve 50% mortality was proved by probit analysis of time-mortality responses. The 10, 15 and 20 fold dilutions of extracted destruxins from isolates cause 17.2-48.5, 9.4-37.5 and 0-26.5%, respectively. Conclusion: Bioassay of destruxin by using citrus leafminer larvae shows its acceptable effect of destruxin. By considering biology of this species and calculated LT50s, destruxin seems to be an effectiveness component of IPM programs. The 10, 15 and 20 fold dilutions of extracted destruxin have a reduced amount of mortality, but in some cases it can balance the expensive production process of microbial agents and their efficacy.

  8. Virulence potential of Metarhizium anisopliae s.l. isolates on Rhipicephalus (Boophilus) microplus larvae.

    Science.gov (United States)

    Quinelato, Simone; Golo, Patrícia S; Perinotto, Wendell M S; Sá, Fillipe A; Camargo, Mariana G; Angelo, Isabele C; Moraes, Aurea M L; Bittencourt, Vânia R E P

    2012-12-21

    The use of entomopathogenic fungi to control arthropods has been reported worldwide for decades. The aim of the present study was to evaluate the virulence of 30 Metarhizium anisopliae s.l. Brazilian isolates from different geographical regions, hosts or substrates on the larvae of Rhipicephalus (Boophilus) microplus ticks under in vitro conditions to the selection of virulent isolates in order to be further used in biological control programs. The current study confirmed the lethal action of M. anisopliae s.l. isolates on R. (B.) microplus larvae with different mortality levels, usually directly proportional to the conidia concentration. No relationship was found between the origin of the isolate and its virulence potential or between the virulence potential and conidia production. Three isolates (CG 37, CG 384 and IBCB 481) caused a high percentage of larval mortality, reaching LC(50) at 10(6) conidia ml(-1), thus requiring a lower conidia concentration to cause an approximately 100% larval mortality. The results of this study suggest that these three isolates are the most promising for use in programs aimed at microbial control in the field.

  9. Isolados de Metarhizium anisopliae (Metchnikoff Sorokin (Hypocreales: Clavicipitaceae para controle de Diatraea saccharalis Fabricius (Lepidoptera: Crambidae

    Directory of Open Access Journals (Sweden)

    Eduardo Hayashida

    2014-04-01

    Abstract. The selection of entomopathogenic fungus that is a necessary to know the efficiency of different isolates and one can choose the most suitable for use in biological control programs. This study aimed to evaluate the efficiency of the isolates of Metarhizium anisopliae (Metchnikoff Sorokin (UFGD 03, UFGD 05, UFGD UFGD 07 and UFGD 22, obtained in Mato Grosso do Sul on the Diatraea saccharalis Fabricius. The experimental trial consisted of a completely randomized design with five treatments and 10 repetitions with 5 caterpillars standardized size in each repetition. In general, M. anisopliae affects the life cycle of D. saccharalis and development of this pest is affected by the fungus. The percentage of caterpillars that pupae ranged from 64.00% to 88.60%. Treatment with isolated UFGD 03 had a higher percentage of dead pupae (68.00% compared to other isolates tested and compared to the control value (11.00%. The adult emergence of D. saccharalis was 87.02% in the control. In the treatments with the fungus, there was a variation of 35.20%, 38.00%, 40.00%, 52.80% provided by isolates UFGD 22, UFGD 03, UFGD 05 and UFGD 07, respectively.

  10. Compatibility of polymers to fungi Beauveria bassiana and Metarhizium anisopliae and their formulated products stability

    Directory of Open Access Journals (Sweden)

    Inajá Marchizeli Wenzel Rodrigues

    2017-08-01

    Full Text Available Stability during storage is a limiting factor in the development and use of bioinsecticides. This study aims to evaluate the compatibility of the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana with components used in encapsulated formulations and to evaluate shelf-life in formulations with B. bassiana. Sodium alginate and maltodextrin, hemicellulose, and dimethyl sulfoxide solvents were evaluated. Compatibility was evaluated by mixing the components with PDA, and the parameters evaluated were vegetative growth, sporulation and viability. The formulations of fungi were prepared in various concentrations of sodium alginate and then added drop-wise to calcium chloride. To evaluate the stability, formulations were stored at 26.5, 4.0, and -20.0°C. Monthly, samples were taken, and the capsules were placed on Petri dishes with PDA to verify the growth after seven days of incubation. These evaluations were performed by the 12th month. Biopolymers evaluated were compatible with both fungi, exception maltodextrin at 1.5%, which was classified as moderately toxic to B. bassiana. Dimethyl sulfoxide was classified as moderately toxic to B. bassiana at 3.0% and to M. anisopliae at 2.0% and 3.0%. The formulations were stable throughout the 12 months in the conditions evaluated, while for the pure conidia of the fungus, 46% viability in the 6th month at 26.5°C was observed.

  11. Properties of catalase subfractions separated by chromatofocusing of acatalasemia hemolysates.

    Directory of Open Access Journals (Sweden)

    Ogata,Masana

    1982-02-01

    Full Text Available Erythrocyte catalase in normal and Japanese type acatalasemia hemolysates was separated by chromatofocusing into several fractions in the pH range of 6.1 to 5.7. Normal hemolysate gave a major peak of catalase activity with a pH of 6.1 to 5.5, while acatalasemia hemolysate gave several small peaks in this pH range and a main peak with a pH of 6.6 to 6.2. The main protein band in catalase active fractions separated from normal erythrocytes had a molecular weight of 60,000 by SDS polyacrylamide gel electrophoresis. A similar faint protein band having a molecular weight of 60,000 was also found in acatalasemia hemolysate in addition to a fairly intense band with a molecular weight of about 30,000. Catalase active fractions from normal erythrocytes reacted with antihuman erythrocyte catalase rabbit serum by double immunodiffusion.

  12. Evaluation of the entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, and Isaria fumosorosea for control of Sitophilus oryzae.

    Science.gov (United States)

    Kavallieratos, Nickolas G; Athanassiou, Christos G; Aountala, Maria M; Kontodimas, Demetrius C

    2014-01-01

    The entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, and Isaria fumosorosea were tested against the stored-grain pest Sitophilus oryzae. The fungi were isolated from the soil (from three locations in Attica, Greece: B. bassiana from Tatoion, M. anisopliae from Marathon, and I. fumosorosea from Aghios Stefanos) using larvae of Galleria mellonella as bait. Suspensions of 2.11 × 10(7) and 2.11 × 10(8), 1.77 × 10(7) and 1.77 × 10(8), and 1.81 × 10(7) and 1.81 × 10(8) conidia per ml of B. bassiana, M. anisopliae, and I. fumosorosea, respectively, were applied by three treatments: (i) sprayed on food and set in petri dishes with adults of S. oryzae, (ii) sprayed on adults of S. oryzae and set in petri dishes without food, and (iii) sprayed on adults of S. oryzae and set in petri dishes with food. The observed mortality of S. oryzae adults during the overall exposure period for the lowest, as well as for the highest, concentrations of B. bassiana, M. anisopliae, and I. fumosorosea ranged from 0 to 100%. Concentration was, in most of the cases tested, a critical parameter that determined the "speed of kill" of the exposed insect species for B. bassiana and M. anisopliae. Conversely, concentration was not that critical for I. fumosorosea, and survival was high in some of the combinations tested, even after 14 days of exposure. Both in the highest and the lowest concentrations of fungi, the mortality of S. oryzae adults was higher when the fungi were applied on adults than when they were applied on food. Higher mortality was observed when food was absent than when food was present, in most of the cases tested. The high efficacy levels recorded in the current study indicate that the tested fungi could be effective biocontrol agents against S. oryzae.

  13. The Impact of Culture Age, Aeration, and Agitation on the Production of Microsclerotia of the Entomopathogenic Fungus Metarhizium anisopliae Using 100-Liter Fermentors

    Science.gov (United States)

    Microsclerotia are desiccation-tolerant, compact hyphal aggregates produced by numerous fungi as overwintering structures. We recently discovered that the entomopathogenic fungus Metarhizium anisopliae produced microsclerotia during liquid culture fermentation. When air-dried microsclerotial granu...

  14. Isolation and efficacy of entomopathogenic fungus (Metarhizium anisopliae) for the control of Aedes albopictus Skuse larvae:suspected dengue vector in Pakistan

    Institute of Scientific and Technical Information of China (English)

    Hazrat Bilal; Soaib Ali Hassan; Imtinan Akram Khan

    2012-01-01

    Objective: To isolate the entomopathogenic fungus Metarhizium anisopliae (M. anisopliae) in the local environment, and evaluate its efficacy against the suspected dengue vector Aedes albopictus in Pakistan. Methods: According to the standard procedure, M. anisopliae was isolated from the dead mosquitoes which were collected from the field or dead after the collection. Bioassay was performed to determine its efficacy. Results: The results indicated that M. anisopliae had larvicidal effect with LC50 value 1.09×105 and LC90 value 1.90×1013 while it took 45.41 h to kill 50%of tested population. Conclusions: Taking long time to kill 50% population when compare with the synthetic insecticides, is the only drawback for the use of entomopathogenic fungus but these bio-pesticides are safe for the use.

  15. Optimization of compatible non-ionic surfactant for formulation development of hydrophobic conidia of entomopathogenic fungi, Beauveria bassiana (Hypocreales:Cordycipitaceae) and Metarhizium anisopliae Hypocreales:Clavicipita

    Science.gov (United States)

    Aerial conidia, especially dried conidia of entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae are hydrophobic, and therefore surfactants are needed for developing water-based formulations in laboratory studies, greenhouse bioassays, and field trials as well as commercial product ...

  16. Highly Active and Stable Large Catalase Isolated from a Hydrocarbon Degrading Aspergillus terreus MTCC 6324

    Directory of Open Access Journals (Sweden)

    Preety Vatsyayan

    2016-01-01

    Full Text Available A hydrocarbon degrading Aspergillus terreus MTCC 6324 produces a high level of extremely active and stable cellular large catalase (CAT during growth on n-hexadecane to combat the oxidative stress caused by the hydrocarbon degrading metabolic machinery inside the cell. A 160-fold purification with specific activity of around 66 × 105 U mg−1 protein was achieved. The native protein molecular mass was 368 ± 5 kDa with subunit molecular mass of nearly 90 kDa, which indicates that the native CAT protein is a homotetramer. The isoelectric pH (pI of the purified CAT was 4.2. BLAST aligned peptide mass fragments of CAT protein showed its highest similarity with the catalase B protein from other fungal sources. CAT was active in a broad range of pH 4 to 12 and temperature 25°C to 90°C. The catalytic efficiency (Kcat/Km of 4.7 × 108 M−1 s−1 within the studied substrate range and alkaline pH stability (half-life, t1/2 at pH 12~15 months of CAT are considerably higher than most of the extensively studied catalases from different sources. The storage stability (t1/2 of CAT at physiological pH 7.5 and 4°C was nearly 30 months. The haem was identified as haem b by electrospray ionization tandem mass spectroscopy (ESI-MS/MS.

  17. Regulation of catalase expression in healthy and cancerous cells.

    Science.gov (United States)

    Glorieux, Christophe; Zamocky, Marcel; Sandoval, Juan Marcelo; Verrax, Julien; Calderon, Pedro Buc

    2015-10-01

    Catalase is an important antioxidant enzyme that dismutates hydrogen peroxide into water and molecular oxygen. The catalase gene has all the characteristics of a housekeeping gene (no TATA box, no initiator element sequence, high GC content in promoter) and a core promoter that is highly conserved among species. We demonstrate in this review that within this core promoter, the presence of DNA binding sites for transcription factors, such as NF-Y and Sp1, plays an essential role in the positive regulation of catalase expression. Additional transcription factors, such as FoxO3a, are also involved in this regulatory process. There is strong evidence that the protein Akt/PKB in the PI3K signaling pathway plays a major role in the expression of catalase by modulating the activity of FoxO3a. Over the past decade, other transcription factors (PPARγ, Oct-1, etc.), as well as genetic, epigenetic, and posttranscriptional processes, have emerged as crucial contributors to the regulation of catalase expression. Altered expression levels of catalase have been reported in cancer tissues compared to their normal counterparts. Deciphering the molecular mechanisms that regulate catalase expression could, therefore, be of crucial importance for the future development of pro-oxidant cancer chemotherapy.

  18. Synergy in efficacy of fungal entomopathogens and permethrin against West African insecticide-resistant Anopheles gambiae mosquitoes.

    Directory of Open Access Journals (Sweden)

    Marit Farenhorst

    Full Text Available BACKGROUND: Increasing incidences of insecticide resistance in malaria vectors are threatening the sustainable use of contemporary chemical vector control measures. Fungal entomopathogens provide a possible additional tool for the control of insecticide-resistant malaria mosquitoes. This study investigated the compatibility of the pyrethroid insecticide permethrin and two mosquito-pathogenic fungi, Beauveria bassiana and Metarhizium anisopliae, against a laboratory colony and field population of West African insecticide-resistant Anopheles gambiae s.s. mosquitoes. METHODOLOGY/FINDINGS: A range of fungus-insecticide combinations was used to test effects of timing and sequence of exposure. Both the laboratory-reared and field-collected mosquitoes were highly resistant to permethrin but susceptible to B. bassiana and M. anisopliae infection, inducing 100% mortality within nine days. Combinations of insecticide and fungus showed synergistic effects on mosquito survival. Fungal infection increased permethrin-induced mortality rates in wild An. gambiae s.s. mosquitoes and reciprocally, exposure to permethrin increased subsequent fungal-induced mortality rates in both colonies. Simultaneous co-exposure induced the highest mortality; up to 70.3+/-2% for a combined Beauveria and permethrin exposure within a time range of one gonotrophic cycle (4 days. CONCLUSIONS/SIGNIFICANCE: Combining fungi and permethrin induced a higher impact on mosquito survival than the use of these control agents alone. The observed synergism in efficacy shows the potential for integrated fungus-insecticide control measures to dramatically reduce malaria transmission and enable control at more moderate levels of coverage even in areas where insecticide resistance has rendered pyrethroids essentially ineffective.

  19. Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor

    2012-03-12

    The JGI Fungal Genomics Program aims to scale up sequencing and analysis of fungal genomes to explore the diversity of fungi important for energy and the environment, and to promote functional studies on a system level. Combining new sequencing technologies and comparative genomics tools, JGI is now leading the world in fungal genome sequencing and analysis. Over 120 sequenced fungal genomes with analytical tools are available via MycoCosm (www.jgi.doe.gov/fungi), a web-portal for fungal biologists. Our model of interacting with user communities, unique among other sequencing centers, helps organize these communities, improves genome annotation and analysis work, and facilitates new larger-scale genomic projects. This resulted in 20 high-profile papers published in 2011 alone and contributing to the Genomics Encyclopedia of Fungi, which targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts). Our next grand challenges include larger scale exploration of fungal diversity (1000 fungal genomes), developing molecular tools for DOE-relevant model organisms, and analysis of complex systems and metagenomes.

  20. Properties of catalase subfractions separated by chromatofocusing of acatalasemia hemolysates.

    OpenAIRE

    Ogata, Masana; Mizugaki,Junko

    1982-01-01

    Erythrocyte catalase in normal and Japanese type acatalasemia hemolysates was separated by chromatofocusing into several fractions in the pH range of 6.1 to 5.7. Normal hemolysate gave a major peak of catalase activity with a pH of 6.1 to 5.5, while acatalasemia hemolysate gave several small peaks in this pH range and a main peak with a pH of 6.6 to 6.2. The main protein band in catalase active fractions separated from normal erythrocytes had a molecular weight of 60,000 by SDS polyacrylamide...

  1. Properties of catalase subfractions separated by chromatofocusing of acatalasemia hemolysates.

    OpenAIRE

    Ogata, Masana; Mizugaki, Junko

    1982-01-01

    Erythrocyte catalase in normal and Japanese type acatalasemia hemolysates was separated by chromatofocusing into several fractions in the pH range of 6.1 to 5.7. Normal hemolysate gave a major peak of catalase activity with a pH of 6.1 to 5.5, while acatalasemia hemolysate gave several small peaks in this pH range and a main peak with a pH of 6.6 to 6.2. The main protein band in catalase active fractions separated from normal erythrocytes had a molecular weight of 60,000 by SDS polyacrylamide...

  2. Catalase Enhances Growth and Biofilm Production of Mycoplasma pneumoniae.

    Science.gov (United States)

    Simmons, Warren L; Dybvig, Kevin

    2015-08-01

    Mycoplasma pneumoniae causes chronic respiratory disease in humans. Factors thought to be important for colonization include the ability of the mycoplasma to form a biofilm on epithelial surfaces and the production of hydrogen peroxide to damage host tissue. Almost all of the mycoplasmas, including M. pneumoniae, lack superoxide dismutase and catalase and a balance should exist between peroxide production and growth. We show here that the addition of catalase to cultures enhanced the formation of biofilms and altered the structure. The incorporation of catalase in agar increased the number of colony-forming units detected and hence could improve the clinical diagnosis of mycoplasmal diseases.

  3. Multiple Catalase Genes Are Differentially Regulated in Aspergillus nidulans

    OpenAIRE

    Kawasaki, Laura; Aguirre, Jesús

    2001-01-01

    Detoxification of hydrogen peroxide is a fundamental aspect of the cellular antioxidant responses in which catalases play a major role. Two differentially regulated catalase genes, catA and catB, have been studied in Aspergillus nidulans. Here we have characterized a third catalase gene, designated catC, which predicts a 475-amino-acid polypeptide containing a peroxisome-targeting signal. With a molecular mass of 54 kDa, CatC shows high similarity to other small-subunit monofunctional catalas...

  4. Fungal DNA barcoding.

    Science.gov (United States)

    Xu, Jianping

    2016-11-01

    Fungi are ubiquitous in both natural and human-made environments. They play important roles in the health of plants, animals, and humans, and in broad ecosystem functions. Thus, having an efficient species-level identification system could significantly enhance our ability to treat fungal diseases and to monitor the spatial and temporal patterns of fungal distributions and migrations. DNA barcoding is a potent approach for rapid identification of fungal specimens, generating novel species hypothesis, and guiding biodiversity and ecological studies. In this mini-review, I briefly summarize (i) the history of DNA sequence-based fungal identification; (ii) the emergence of the ITS region as the consensus primary fungal barcode; (iii) the use of the ITS barcodes to address a variety of issues on fungal diversity from local to global scales, including generating a large number of species hypothesis; and (iv) the problems with the ITS barcode region and the approaches to overcome these problems. Similar to DNA barcoding research on plants and animals, significant progress has been achieved over the last few years in terms of both the questions being addressed and the foundations being laid for future research endeavors. However, significant challenges remain. I suggest three broad areas of research to enhance the usefulness of fungal DNA barcoding to meet the current and future challenges: (i) develop a common set of primers and technologies that allow the amplification and sequencing of all fungi at both the primary and secondary barcode loci; (ii) compile a centralized reference database that includes all recognized fungal species as well as species hypothesis, and allows regular updates from the research community; and (iii) establish a consensus set of new species recognition criteria based on barcode DNA sequences that can be applied across the fungal kingdom.

  5. Fungal arthritis and osteomyelitis.

    Science.gov (United States)

    Kohli, Rakhi; Hadley, Susan

    2005-12-01

    Fungal arthritis and osteomyelitis are uncommon diseases and generally present in an indolent fashion. The incidence of fungal bone and joint dis-ease is increasing with an increase in the prevalence of factors predisposing to invasive fungal disease, such as the use of central venous catheters, broad spectrum antibiotics, immunosuppression, and abdominal surgery. Definitive diagnosis relies on bone or synovial culture or biopsy. Successful management has traditionally consisted of amphotericin B in combination with surgical debridement. Given the rarity of this disease, treatment is not well defined, but reports of success with the use of azole antifungal agents, including itraconazole, fluconazole, voriconazole, and posaconazole, are promising.

  6. Isolation of the catalase T structural gene of Saccharomyces cerevisiae by functional complementation.

    OpenAIRE

    Spevak, W; Fessl, F; Rytka, J; Traczyk, A; Skoneczny, M; Ruis, H

    1983-01-01

    The catalase T structural gene of Saccharomyces cerevisiae was cloned by functional complementation of a mutation causing specific lack of the enzyme (cttl). Catalase T-deficient mutants were obtained by UV mutagenesis of an S. cerevisiae strain bearing the cas1 mutation, which causes insensitivity of catalase T to glucose repression. Since the second catalase protein of S. cerevisiae, catalase A, is completely repressed on 10% glucose, catalase T-deficient mutant colonies could be detected u...

  7. Selection of Metarhizium anisopliae (Metsch. and Beauveria bassiana (Bals. isolates to control Alabama argillacea (Huebner caterpillars Seleção de isolados de Metarhizium anisopliae (Metsch. e Beauveria bassiana (Bals. para o controle de lagartas de Alabama argillacea (Huebner

    Directory of Open Access Journals (Sweden)

    Everardo César Filho

    2002-09-01

    Full Text Available The cotton leafworm, Alabama argillacea (Huebner, 1818 (Lepidoptera: Noctuidae, is considered to be one of the key pests in herbaceous cotton (Gossypium hirsutum L. r. latifolium Hutch cropping, with constant occurrence in all cotton-growing states of Brazil. In this study Metarhizium anisopliae and Beauveria bassiana isolates were screened and evaluated for pathogenicity against Alabama argillaceae. Initially, a screening of ten isolates of each fungus in a concentracion of 10(8 conidia mL-1, was carried out on 3rd instar larvae of A. argillacea. Further studies were conducted to determine the pathogenicity and virulence of six and seven isolates of M. anisopliae and B. bassiana, respectively, against 3rd instar larvae of A. argillacea and using the concentrations of 10(6, 10(7, 10(8, and 10(9 conidia mL-1. The experiments were carried out in Recife, PE, Brazil, at 27 ± 2ºC, RH 70 ± 5% and a photophase of 12 hours. Mortalities caused by M. anisopliae isolate at the different concentrations ranged from 4.5 to 91.2%, the highest mortality percentage being found for the isolate 1189 at 10(9 conidia mL-1. The isolate 645 of B. bassiana caused the highest mortality at the highest concentration, followed by isolates 634, 604, and IPA 198. The lowest lethal time for B. bassiana and M. anisopliae, was achieved by the isolates 483 (4.1 days and 1189 (2.0 days, respectively. The isolates 1189, 1022 e 866 of M. anisopliae and 483, IPA198 and 604 of B. bassiana, at 10(8 e 10(9 conidia mL-1 are promissing for use the integrated control of A. argillacea larvae, but M. anisopliae seems more effective.O curuquerê-do-algodoeiro (Alabama argillacea é considerado uma das principais pragas do algodoeiro herbáceio no Brasil, com ocorrência comum em vários estágios de crescimento da cultura. Este trabalho avaliou a patogenicidade e selecionou isolados dos fungos entomopatogênicos Metarhizium anisopliae e Beauveria bassiana, para lagartas do curuquer

  8. Insect pathology and fungal entomopathogens

    Science.gov (United States)

    Fungi that occur inside asymptomatic plant tissues are known as fungal endophytes. Different genera of fungal entomopathogens have been reported as naturally occurring fungal endophytes, and it has been shown that it is possible to inoculate plants with fungal entomopathogens, making them endophytic...

  9. A Laboratory Experiment of the Purification of Catalase.

    Science.gov (United States)

    Busquets, Montserrat; Franco, Rafael

    1986-01-01

    Describes a simple method for purifying catalase for the study of proteins. Procedures are systematically and diagramatically presented. Also identifies polyacrylamide gel electrophoresis, kinetic studies, and apparent molecular weight determination as possible techniques to be used in studying proteins. (ML)

  10. JGI Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.

    2011-03-14

    Genomes of energy and environment fungi are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 50 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such 'parts' suggested by comparative genomics and functional analysis in these areas are presented here

  11. The catalase activity of diiron adenine deaminase

    Energy Technology Data Exchange (ETDEWEB)

    Kamat S. S.; Swaminathan S.; Holmes-Hampton, G. P.; Bagaria, A.; Kumaran, D.; Tichy, S. E.; Gheyi, T.; Zheng, X.; Bain, K.; Groshong, C.; Emtage, S.; Sauder, J. M.; Burley, S. K.; Lindahl, P. A.; Raushel, F. M.

    2011-12-01

    Adenine deaminase (ADE) from the amidohydrolase superfamily (AHS) of enzymes catalyzes the conversion of adenine to hypoxanthine and ammonia. Enzyme isolated from Escherichia coli was largely inactive toward the deamination of adenine. Molecular weight determinations by mass spectrometry provided evidence that multiple histidine and methionine residues were oxygenated. When iron was sequestered with a metal chelator and the growth medium supplemented with Mn{sup 2+} before induction, the post-translational modifications disappeared. Enzyme expressed and purified under these conditions was substantially more active for adenine deamination. Apo-enzyme was prepared and reconstituted with two equivalents of FeSO{sub 4}. Inductively coupled plasma mass spectrometry and Moessbauer spectroscopy demonstrated that this protein contained two high-spin ferrous ions per monomer of ADE. In addition to the adenine deaminase activity, [Fe{sup II}/Fe{sup II}]-ADE catalyzed the conversion of H{sub 2}O{sub 2} to O{sub 2} and H{sub 2}O. The values of k{sub cat} and k{sub cat}/K{sub m} for the catalase activity are 200 s{sup -1} and 2.4 x 10{sup 4} M{sup -1} s{sup -1}, respectively. [Fe{sup II}/Fe{sup II}]-ADE underwent more than 100 turnovers with H{sub 2}O{sub 2} before the enzyme was inactivated due to oxygenation of histidine residues critical for metal binding. The iron in the inactive enzyme was high-spin ferric with g{sub ave} = 4.3 EPR signal and no evidence of anti-ferromagnetic spin-coupling. A model is proposed for the disproportionation of H{sub 2}O{sub 2} by [Fe{sup II}/Fe{sup II}]-ADE that involves the cycling of the binuclear metal center between the di-ferric and di-ferrous oxidation states. Oxygenation of active site residues occurs via release of hydroxyl radicals. These findings represent the first report of redox reaction catalysis by any member of the AHS.

  12. Pathogenicity of Metarhizium anisopliae (Metch Sorok and Beauveria bassiana (Bals Vuill to adult Phlebotomus duboscqi (Neveu-Lemaire in the laboratory

    Directory of Open Access Journals (Sweden)

    Philip M. Ngumbi, Lucy W. Irungu, Paul N. Ndegwa & Nguya K. Maniania

    2011-03-01

    Full Text Available Background & objectives: Biological control of sandflies using entomopathogenic fungi is a possible alternativeto the expensive synthetic chemical control. It is potentially sustainable, less hazardous, and relatively inexpensiveand merits further investigations. The objective of this study was to identify the most pathogenic fungal isolate(sto sandflies in the laboratory.Methods: Isolates of entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana were screenedfor their pathogenicity against Phlebotomus duboscqi. Adult flies were contaminated using the technique describedby Migiro et al (2010. Briefly, flies were exposed to 0.1 g of dry conidia evenly spread on a cotton velvet clothcovering the inner side of a cylindrical plastic tube (95 mm long × 48 mm diam. In all 25 sandflies weretransferred into the cylindrical tube and allowed to walk on the velvet for one minute, after which they weretransferred from the velvet into the cages in Perplex. Insects in the control treatments were exposed to fungusfree velvet cloth before being transferred into similar cages. The treatments were maintained at 25 ± 2°C,60–70% RH and 12L: 12D photoperiod. The experiment was replicated 5 times. The most pathogenic isolateswere selected for further studies.Results: A total of 19 isolates were screened against adult sandflies in the laboratory. Mortality in the controlswas approximately 16.8 ± 1.7 %. All the isolates were found to be pathogenic to P. duboscqi. Mortality rangedbetween 76.8 and 100% on all the fungal isolates tested. The lethal time taken to 50% (LT50 and 90% (LT90(mortality ranged from 3.0–7.8 days and from 5.3–16.2 days, respectively. The virulent isolates, causing mortalitiesof 97.5–100%, were selected for further studies.Interpretation & conclusion: The high susceptibility of sandflies to entomopathogenic fungi suggests that fungiare potential alternatives to chemical control methods. We conclude that application of

  13. Estimates of genetic parameters related to chitinase production by the entomopathogenic fungus Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Gilberto U.L. Braga

    1998-06-01

    Full Text Available Chitinolytic activity and dry mass production were determined in culture filtrates from 17 Metarhizium anisopliae strains grown in liquid medium containing chitin as the only carbon source. The objectives were to estimate parameters such as genetic variance among strains, heritability and expected gain from selection, as well as correlations between tested traits. Wide genotypic variability was observed among strains in chitinolytic activity, permitting the exploitation of this property in selection. The high heritability suggests that progress can be made through phenotypic selection. The genotypic correlation coefficient between dry mass production and chitinolytic activity detected in the filtrates was negative (= - 0.588. One of the isolates was also investigated for variation in the two traits as a function of culture growth time. The results showed an increase in enzyme activity up to the 8th (and last day of the experiment and a decrease in dry mass from the 4th day on.Foi determinada a atividade quitinolítica apresentada pelos filtrados de culturas de 17 genótipos de Metarhizium anisopliae crescidos em meio líquido, tendo quitina como única fonte de carbono. O objetivo foi a estimativa de parâmetros como a variância genética, a herdabilidade e o ganho esperado na seleção. Uma grande variabilidade genotípica foi verificada na atividade quitinolítica, permitindo sua exploração no melhoramento. Os altos coeficientes de herdabilidade permitem esperar um grande progresso na seleção fenotípica. Para uma das linhagens foi também determinada a variação na atividade enzimática, em função do tempo de crescimento das culturas. Os resultados mostraram um aumento na atividade enzimática até o oitavo dia da avaliação.

  14. Ionic adsorption of catalase on bioskin: kinetic and ultrastructural studies.

    Science.gov (United States)

    Solas, M T; Vicente, C; Xavier, L; Legaz, M E

    1994-03-15

    Bioskin is a natural polymer produced by Acetobacter xylinum and several yeasts in culture. It contains glucosamine and N-acetyl galactosamine which promote ionic adsorption of catalase at the adequate pH value. High values of ionic strength are required to enzyme desorption. Adsorption of catalase on bioskin fibers has been visualized by scanning electron microscopy associated to a dispersion X-ray analyzer. At low enzyme density, the affinity of the immobilized catalase for hydrogen peroxide was 30% lower than that of the free enzyme. This affinity decreased dramatically at higher density of immobilized enzyme and could not be increased by agitation of the enzyme reaction mixture. Immobilized catalase retains about 70% of its initial activity after 16 d storage, whereas soluble enzyme is completely inactivated after 3 d at room temperature. The haeme group of catalase is not protected after immobilization since it is accessible to both EDTA and phloroglucinol, chelating agents which inactivate catalase by removing the iron atom from the haeme group.

  15. [Pathogenesis of invasive fungal infections].

    Science.gov (United States)

    Garcia-Vidal, Carolina; Carratalà, Jordi

    2012-03-01

    Invasive fungal infections remain a life-threatening disease. The development of invasive fungal disease is dependent on multiple factors, such us colonization and efficient host immune response. We aimed to review the pathogenesis of invasive fungal infections, in particular, those caused by Candida and Aspergillus. For this we propose, to describe the fungal characteristics, to detail the host defence mechanisms against fungus and to analyse the host risk factors for invasive fungal infection.

  16. First report of Metarhizium anisopliae IP 46 pathogenicity in adult Anopheles gambiae s.s. and An. arabiensis (Diptera; Culicidae

    Directory of Open Access Journals (Sweden)

    Lyimo Issa N

    2009-12-01

    Full Text Available Abstract The entomopathogenic fungus Metarhizium anisopliae isolate IP 46, originating from a soil sample collected in 2001 in the Cerrado of Central Brazil, was tested for its ability to reduce the survival of adult male and female Anopheles gambiae s.s. and An. arabiensis mosquitoes. A 6-h exposure to the fungus coated on test paper at a concentration of 3.3 × 106 conidia cm-2 reduced the daily survival of both mosquito species (HR = 3.14, p An. gambiae s.s relative to An. arabiensis (HR = 1.38, p 95% of mosquito cadavers in the treatment groups. The results indicate that M. anisopliae IP 46 has the potential to be a bio-control agent for African malaria vector species, and is a suitable candidate for further research and development.

  17. Effect of Biofertilizers and Neem Oil on the Entomopathogenic Fungi Beauveria bassiana (Bals. Vuill. and Metarhizium anisopliae (Metsch. Sorok

    Directory of Open Access Journals (Sweden)

    Hirose Edson

    2001-01-01

    Full Text Available The in vitro fungitoxic effect of three biofertilizers, E.M.-4, Multibion Ô and Supermagro used in organic agriculture and the neem oil (Azadirachta indica A. Juss on the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana was studied. These products were mixed in a medium where the two fungi were inoculated, and germination, vegetative growth and conidiogenesis were assessed. The biofertilizers Supermagro and E.M.- 4 showed to be less toxic for the two fungi whereas MultibionÔ caused major inhibition on M. anisopliae, with reductions in germination (-37.74%, colony diameter (-30.26% and conidiogenesis (-42.62%. Neem oil promoted a larger negative effect on B. bassiana, inhibiting germination (-45.27%, colony diameter (-36.62% and conidiogenesis (-84.93%.

  18. Growth-Dependent Catalase Localization in Exiguobacterium oxidotolerans T-2-2T Reflected by Catalase Activity of Cells

    OpenAIRE

    Yoshiko Hanaoka; Fumihiko Takebe; Yoshinobu Nodasaka; Isao Hara; Hidetoshi Matsuyama; Isao Yumoto

    2013-01-01

    A psychrotolerant and H2O2-resistant bacterium, Exiguobacterium oxidotolerans T-2-2(T), exhibits extraordinary H2O2 resistance and produces catalase not only intracellularly but also extracellularly. The intracellular and extracellular catalases exhibited the same enzymatic characteristics, that is, they exhibited the temperature-dependent activity characteristic of a cold-adapted enzyme, their heat stabilities were similar to those of mesophilic enzymes and very high catalytic intensity. In ...

  19. Potential of two entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae (Coleoptera: Scarabaeidae), as biological control agents against the June beetle.

    Science.gov (United States)

    Erler, Fedai; Ates, A Ozgur

    2015-01-01

    The aim of this study was to evaluate the effectiveness of the entomopathogenic fungi (EPF), Beauveria bassiana (Bals.) Vuill. (Deuteromycotina: Hyphomycetes) strain PPRI 5339 [BroadBand, an emulsifiable spore concentrate (EC) formulation] and Metarhizium anisopliae (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) strain F52 [Met52, both EC and granular (GR) formulations] against the larvae of Polyphylla fullo (L.) (Coleoptera: Scarabaeidae). Larvicidal bioassays were performed in foam boxes (100 by 75 by 50 cm; length by width by height), containing moist soil medium with some humus and potato tubers as food. Although the B. bassiana product (min. 4 × 10(9) conidia/ml) was applied at 100, 150, and 200 ml/100 l water; M. anisopliae strain F52 was applied at 500, 1,000, and 1,500 g/m(3) of moist soil medium for GR (9 × 10(8) cfu/g) and 75, 100, and 125 ml/100 l water for EC (5.5 × 10(9) conidia/ml) formulation. Both fungi were pathogenic to larvae of the pest; however, young larvae (1st and 2nd instars) were more susceptible to infection than older ones (3rd instar). Mortality rates of young and older larvae varied with conidial concentration of both fungi and elapsed time after application. The B. bassiana product was more effective than both of the formulations of the M. anisopliae product, causing mortalities up to 79.8 and 71.6% in young and older larvae, respectively. The highest mortality rates of young and older larvae caused by the M. anisopliae product were 74.1 and 67.6% for the GR formulation, 70.2 and 61.8% for the EC formulation, respectively. These results may suggest that both fungi have potential to be used for management of P. fullo.

  20. Biocontrol of the Brown-banded Cockroach, Supella longipalpa F. (Blattaria: Blattellidae, with Entomopathogenic Fungus, Metharhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Mona Sharififard

    2016-01-01

    Full Text Available Background: Considering to the high distribution of cockroaches as urban pests, the efficacy of different formula­tions of Metarhizium anisopliae strain Iran 437C were assessed against the brown-banded cockroach, Supella longi­palpa F. under laboratory and field conditions.Methods: Metarhizium anisopliae isolates were screened with immersing adults of the brown-banded cockroachs in aqueous suspension of 108 conidia ml-1 followed by surface or bait treated with different doses of the most virulent isolate against the nymphs. Then formulations of conidia oil-in-water were examined versus cockroach nymphs us­ing different plant oils and paraffin. Then they were evaluated and compared with aqueous suspension and control group. On a large-scale, the sunflower oil-in-water formulation of conidia was sprayed at houses using a hand sprayer.Results: Metarhizium anisopliae IRAN 437C was the most virulent isolate against the brown-banded cockroach, causing 100% mortality in adults at seven days post-exposure. Inoculated bait with this isolate was not enough path­ogenic against the cockroach even at two weeks after treatment. Treated surface with conidia as aqueous suspension or oil-in- water formulation was more effective than the bait formulation against the cockroach caused 39.4–97.2% mortality compared with 2.5% mortality in control group after two days. Spraying the conidia formulated with sun­flower oil was an effective formulation causing 76.1% reduction in the cockroach density on the third day post treatment in the houses.Conclusion: The oil-in-water formulation of M. anisopliae IRAN 437C could be recommended as a promising al­ternative for cockroach control.  

  1. Embryonic catalase protects against ethanol-initiated DNA oxidation and teratogenesis in acatalasemic and transgenic human catalase-expressing mice.

    Science.gov (United States)

    Miller, Lutfiya; Shapiro, Aaron M; Wells, Peter G

    2013-08-01

    Reactive oxygen species (ROS) are implicated in fetal alcohol spectrum disorders (FASD) caused by alcohol (ethanol, EtOH). Although catalase detoxifies hydrogen peroxide, embryonic catalase activity is only about 5% of maternal levels. To determine the roles of ROS and embryonic catalase in FASD, pregnant mice with enhanced (expressing human catalase, hCat) or deficient (acatalasemic, aCat) catalase activity, or their respective wild-type (WT) controls, were treated ip on gestational day 9 with 4 or 6g/kg EtOH or its saline vehicle, and embryos and fetuses were, respectively, evaluated for oxidatively damaged DNA and structural anomalies. Untreated hCat and aCat dams had, respectively, more and less offspring than their WT controls. hCat progenies were protected from all EtOH fetal anomalies at the low dose (p fetal anomalies (p fetal anomalies (p teratogenesis. Endogenous embryonic catalase, despite its low level, is an important embryoprotective enzyme for EtOH teratogenesis and a likely determinant of individual risk.

  2. Production and quality of conidia by Metarhizium anisopliae var. lepidiotum: critical oxygen level and period of mycelium competence.

    Science.gov (United States)

    Garcia-Ortiz, Nohemi; Tlecuitl-Beristain, Saúl; Favela-Torres, Ernesto; Loera, Octavio

    2015-03-01

    Mycoinsecticides application within Integral Pest Management requires high quantities of conidia, with the proper quality and resistance against environmental conditions. Metarhizium anisopliae var. lepidiotum conidia were produced in normal atmospheric conditions (21 % O2) and different concentrations of oxygen pulses (16, 26, 30, and 40 %); conidia obtained under hypoxic conditions showed significantly lower viability, hydrophobicity, and virulence against Tenebrio molitor larvae or mealworm, compared with those obtained under normal atmospheric conditions. Higher concentrations of oxygen (26 and 30 %) improved conidial production. However, when a 30 % oxygen concentration was applied, maximal conidial yields were obtained at earlier times (132 h) relative to 26 % oxygen pulses (156 h); additionally, with 30 % oxygen pulses, conidia thermotolerance was improved, maintaining viability, hydrophobicity, and virulence. Although conidial production was not affected when 40 % oxygen pulses were applied, viability and virulence were diminished in those conidia. In order to find a critical time for mycelia competence to respond to these oxidant conditions, oxygen pulses were first applied either at 36, 48, 60, and 72 h. A critical time of 60 h was determined to be the best time for the M. anisopliae var. lepidiotum mycelia to respond to oxygen pulses in order to increase conidial production and also to maintain the quality features. Therefore, oxygen-enriched (30 %) pulses starting at 60 h are recommended for a high production without the impairment of quality of M. anisopliae var. lepidiotum conidia.

  3. Cloning and functional analysis of the second geranylgeranyl diphosphate synthase gene influencing helvolic acid biosynthesis in Metarhizium anisopliae.

    Science.gov (United States)

    Singkaravanit, Suthitar; Kinoshita, Hiroshi; Ihara, Fumio; Nihira, Takuya

    2010-07-01

    A gene (ggs2) having high similarity to the geranylgeranyl diphosphate synthase (GGPP synthase) gene was cloned from Metarhizium anisopliae NAFF635007. The ggs2 gene (1,239-bp open reading frame with no intron) encoded a protein of 412 amino acids, and the transcription occurred only after late log-phase during the growth. Gene disruption of ggs2, performed to clarify the function in M. anisopliae, resulted in decreased GGPP synthase activity together with a slight delay of sporulation. An high performance liquid chromatography (HPLC) comparison of compound profiles between the wild-type strain and the disruptant revealed that a compound was abolished by the ggs2 disruption. Purification and structural elucidation by 1H-NMR and mass spectrometry analyses revealed that the lost compound is helvolic acid. Furthermore, the pathogenicity assay against two species of insect larvae revealed that the ggs2-disruptant possessed much weaker toxicity than the wild-type strain. Based on these results, it was concluded that ggs2 encodes the GGPP synthase influencing the biosynthesis of secondary metabolites in various species, including helvolic acid in M. anisopliae. To the best of our knowledge, this is the first report to identify a GGPP synthase gene related to secondary metabolism in entomopathogenic fungi.

  4. Secretome Analysis of Metarhizium anisopliae Under Submerged Conditions Using Bombyx mori Chrysalis to Induce Expression of Virulence-Related Proteins.

    Science.gov (United States)

    Rustiguel, Cynthia Barbosa; Rosa, José Cesar; Jorge, João Atílio; de Oliveira, Arthur Henrique Cavalcanti; Guimarães, Luis Henrique Souza

    2016-02-01

    The entomopathogenic fungus Metarhizium anisopliae is used to control insect pests. This species is specialized for the secretion of an enzymatic complex consisting of proteases, lipases, and chitinases related to pathogenicity and virulence. In this context, the secretomes of strains IBCB 167 and IBCB 384 of M. anisopliae var. anisopliae, grown under submerged fermentation in the presence of chrysalis as an inducer, were analyzed. Analysis of two-dimensional gels showed qualitative and quantitative differences between secreted proteins in both isolates. Around 102 protein spots were analyzed, and 76 % of the corresponding proteins identified by mass spectrometry were grouped into different classes (hydrolases, oxidases, reductases, isomerases, kinases, WSC domains, and hypothetical proteins). Thirty-three per cent of all the proteins analyzed were found to be common in both strains. Several virulence-related proteins were identified as proteases and mannosidases. Endo-N-acetyl-β-D-glucosaminidase expression was observed to be 10.14-fold higher for strain IBCB 384 than for strain IBCB 167, which may be an important contributor to the high virulence of IBCB 384 in Diatraea ssaccharalis. These results are important for elucidation of the host-pathogen relationship and the differences in virulence observed between the two strains.

  5. Selection of Beauveria bassiana (Bals. Vuill. and Metarhizium anisopliae (Metsch. Sorok. for the control of the mite Mononychellus tanajoa (Bondar

    Directory of Open Access Journals (Sweden)

    Barreto Rodrigo Soares

    2004-01-01

    Full Text Available The green mite, Mononychellus tanajoa (Bondar (Acari: Tetranychidae, is considered to be one of the key pests in cassava, Manihot esculenta Crants, leading to considerable field losses. In this study, ten Beauveria bassiana (Bals. Vuill. and ten Metarhizium anisopliae (Metsch. Sorok. isolates were evaluated with regard to their potential as biological control agents against adult M. tanajoa females. The total mortality percentage of M. tanajoa caused by B. bassiana ranged from 13.0 to 97.0%, with confirmed mortality rates extending from 9.0 to 91.0% and LT50 varying from 4.2 to 17.0 days. The M. anisopliae isolates showed total mortality percentages ranging from 12.0 to 45.0% with confirmed mortality rates extending from 8.0 to 45.0%, and LT50 varying from 8.6 to 19.8 days. Lethal Concentrations (LC50 of 3.93 × 10(6 conidia mL-1 and 7.44 × 10(8 conidia mL-1 were determined for B. bassiana and M. anisopliae, respectively. B. bassiana isolate 645 was the most efficient, being an alternative for use in biological control programs against the cassava green mite.

  6. Fungal endocarditis: current challenges.

    Science.gov (United States)

    Tattevin, Pierre; Revest, Matthieu; Lefort, Agnès; Michelet, Christian; Lortholary, Olivier

    2014-10-01

    Whilst it used to affect mostly intravenous drug users and patients who underwent valvular surgery with suboptimal infection control procedures, fungal endocarditis is now mostly observed in patients with severe immunodeficiency (onco-haematology), in association with chronic central venous access and broad-spectrum antibiotic use. The incidence of fungal endocarditis has probably decreased in most developed countries with access to harm-reduction policies (i.e. needle exchange programmes) and with improved infection control procedures during cardiac surgery. Use of specific blood culture bottles for diagnosis of fungal endocarditis has decreased due to optimisation of media and automated culture systems. Meanwhile, the advent of rapid techniques, including fungal antigen detection (galactomannan, mannan/anti-mannan antibodies and β-1,3-d-glucans) and PCR (e.g. universal fungal PCR targeting 18S rRNA genes), shall improve sensitivity and reduce diagnostics delays, although limited data are available on their use for the diagnosis of fungal endocarditis. New antifungal agents available since the early 2000s may represent dramatic improvement for fungal endocarditis: (i) a new class, the echinocandins, has the potential to improve the management of Candida endocarditis owing to its fungicidal effect on yeasts as well as tolerability of increased dosages; and (ii) improved survival in patients with invasive aspergillosis with voriconazole compared with amphotericin B, and this may apply to Aspergillus sp. endocarditis as well, although its prognosis remains dismal. These achievements may allow selected patients to be cured with prolonged medical treatment alone when surgery is considered too risky.

  7. Increased microglial catalase activity in multiple sclerosis grey matter.

    Science.gov (United States)

    Gray, Elizabeth; Kemp, Kevin; Hares, Kelly; Redondo, Julianna; Rice, Claire; Scolding, Neil; Wilkins, Alastair

    2014-04-22

    Chronic demyelination, on-going inflammation, axonal loss and grey matter neuronal injury are likely pathological processes that contribute to disease progression in multiple sclerosis (MS). Although the precise contribution of each process and their aetiological substrates is not fully known, recent evidence has implicated oxidative damage as a major cause of tissue injury in MS. The degree of tissue injury caused by oxidative molecules, such as reactive oxygen species (ROS), is balanced by endogenous anti-oxidant enzymes which detoxify ROS. Understanding endogenous mechanisms which protect the brain against oxidative injury in MS is important, since enhancing anti-oxidant responses is a major therapeutic strategy for preventing irreversible tissue injury in the disease. Our aims were to determine expression and activity levels of the hydrogen peroxide-reducing enzyme catalase in MS grey matter (GM). In MS GM, a catalase enzyme activity was elevated compared to control GM. We measured catalase protein expression by immune dot-blotting and catalase mRNA by a real-time polymerase chain reaction (RT-PCR). Protein analysis studies showed a strong positive correlation between catalase and microglial marker IBA-1 in MS GM. In addition, calibration of catalase mRNA level with reference to the microglial-specific transcript AIF-1 revealed an increase in this transcript in MS. This was reflected by the extent of HLA-DR immunolabeling in MS GM which was significantly elevated compared to control GM. Collectively, these observations provide evidence that microglial catalase activity is elevated in MS grey matter and may be an important endogenous anti-oxidant defence mechanism in MS.

  8. Distribuição volumétrica de calda contendo Metarhizium anisopliae Volumetric distribution of spray containing Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Haroldo Xavier Linhares Volpe

    2012-11-01

    Full Text Available O controle microbiano de Mahanarva fimbriolata é de suma importância para o manejo dessa praga em cana-de-açúcar, porém carece de melhorias quanto à tecnologia de aplicação. O trabalho teve como objetivo definir um modelo de bico de pulverização adequado para o controle de M. fimbriolata, com base no padrão de distribuição de calda aspergida e espaçamento entre bicos. Utilizaram-se os bicos TF4, TTI e AIUB11004VS e caldas a base de fungo Metarhizium anisopliae sem adjuvante e com Agral a 2% e 4%. Avaliou-se o espaçamento entre bicos baseado na construção de curvas de deposição, considerando CV máximo de 10%; ângulo de abertura e vazão dos bicos. Os maiores espaçamentos foram de 85cm em calda com 2% de adjuvante para o bico TF4, 70cm para AIUB11004VS sem adição de adjuvante e 55cm para o bico TTI, independente da calda. Em relação ao ângulo de abertura, houve apenas diferença entre os bicos testados em uma mesma calda. A vazão foi maior para a calda com 4% de adjuvante para os bicos TF4 e TTI, sendo que AIUB11004VS apresentou menores vazões em relação aos outros modelos para calda com 2% e 4% de adjuvante. Conclui-se que o modelo AIUB11004VS é uma importante ferramenta operacional, visando o controle de M. fimbriolata, por apresentar menor consumo de calda e bons resultados de distância entre bicos.The microbial control of Mahanarva fimbriolata is very important to management of this pest in sugarcane crops, however lacks improvement in spraying technology. The work aimed to evaluate a nozzle model adequate to control M. fimbriolata, based on pattern of spray distribution and the space between nozzles. TF4, TTI and AIUB11004VS nozzles containing the fungus Metarhizium anisopliae without adjuvant, with Agral 2% and 4% were used in the assay. We evaluated spacing between nozzles by constructing deposition curves considering maximum CV of 10%, spray angle and nozzle flow for different sprays. The larger nozzle

  9. Effect of two dosages of Metarhizium anisopliae var. acridum against Rhammatocerus schistocercoides Rehn Efeito de duas dosagens de Metarhizium anisopliae var. acridum contra Rhammatocerus schistocercoides Rehn

    Directory of Open Access Journals (Sweden)

    Marcos Rodrigues de Faria

    2002-11-01

    Full Text Available The fungus Metarhizium anisopliae var. acridum, strain CG 423, was tested under field conditions against the gregarious grasshopper Rhammatocerus schistocercoides (Rehn (Orthoptera: Acrididae. Conidia formulated in a racemic mixture of soybean oil and kerosene were sprayed under field conditions using an ultralow-volume hand-held atomizer Ulva Plus adjusted to deliver 2.9 L/ha. Bands composed of 2nd instar nymphs were treated with either 5.0x10(12 or 1.0x10(13 viable conidia/ha. The number of insects in each band was estimated at day one following spraying and by the end of the field trial (15 to 16 days post-treatment. Reductions in population size reached, in average, 65.8% and 80.4% for bands treated with the higher and lower dosage, respectively. For both dosages, total mortality rates of insects collected at two days post-application, and kept in cages for 14 days under lab conditions, showed no significant differences as compared to that obtained with insects collected immediately after spraying. Healthy insects were fed to native grasses sprayed on the field with 1.0x10(13 viable conidia/ha. Mortality levels of the nymphs fed on grasses collected two and four days post-application were not affected when compared to nymphs fed on grasses collected immediately following application.O fungo Metarhizium anisopliae var. acridum, isolado CG 423, foi avaliado em condições de campo como agente de controle biológico do gafanhoto gregário Rhammatocerus schistocercoides (Rehn (Orthoptera: Acrididae. Conídios formulados em uma mistura racêmica de óleo de soja e querosene foram pulverizados no campo com a utilização de um atomizador rotativo manual Ulva Plus, calibrado para aplicação de 2,9 L/ha. Bandos com ninfas de 2º estádio foram tratados com o equivalente a 5,0x10(12 ou 1,0x10(13 conídios viáveis/ha. O número de insetos em cada bando foi estimado no 1º dia após a aplicação e ao final do experimento (15 a 16 dias ap

  10. Adulticidal and larvicidal activity of Beauveria bassiana and Metarhizium anisopliae against housefly, Musca domestica (Diptera: Muscidae), in laboratory and simulated field bioassays.

    Science.gov (United States)

    Mishra, Sapna; Kumar, Peeyush; Malik, Anushree; Satya, Santosh

    2011-06-01

    The susceptibility of the adult and larval stage of housefly, Musca domestica L. (Diptera: Muscidae), to two entomopathogenic fungi, Metarhizium anisopliae (Metsch.) Sor. and Beauveria bassiana (Bals.) Vuill., was evaluated under laboratory and simulated field bioassays. Bioassays on adult houseflies were carried out at different conidial concentrations ranging from 10(3) to 10(9) conidia/ml in petri plate and minichamber assays. Absolute mortality was observed within 4-5 days at all the concentrations tested. M. anisopliae was found to be more effective with LC(50) of 6.75 × 10(7) conidia/ml compared with 1.21 × 10(8) conidia/ml of B. bassiana in petri plate bioassay. Similar trend was observed in minichamber bioassay. Larvicidal activity evaluated through petri plate bioassay also indicated that M. anisopliae was more effective larvicide with LC(50) of 4.1 × 10(8) conidia/ml as against 3.31 × 10(9) conidia/ml of B. bassiana. Larvicidal activity was further evaluated in simulated field condition of decaying waste matrix using dry conidial formulations (10(8) conidia/g) of both the fungi. Larval mortality obtained in this assay was 43% (B. bassiana) and 63% (M. anisopliae). Remarkably better performance of M. anisopliae as an adulticidal and larvicidal agent over B. bassiana in laboratory bioassays as well as simulated field conditions suggests that it may have good potential to become part of an integrated housefly control program.

  11. Response of soil catalase activity to chromium contamination

    Institute of Scientific and Technical Information of China (English)

    Zofia St(e)pniewska; Agnieszka Woli(n)ska; Joanna Ziomek

    2009-01-01

    The impact of chromium (III) and (VI) forms on soil catalase activity is presented.The Orthic Podzol, Haplic Phaeozem and Mollic Gleysol from different depths were used in the experiment.The soil samples were amended with solution of Cr(III) using CrCl3, and with Cr(VI) using K2Cr2O7 in the concentration range from 0 to 20 mg/kg, whereas the samples without the addition of chromium served as control.Catalase activity was assayed by one of the commonly used spectrophotometric methods.As it is demonstrated in the experiment, both Cr(III) and Cr(VI) forms have ability to reduce soil catalase activity.A chromium dose of 20 mg/kg caused the inhibition of catalase activity and the corresponding contamination levels ranged from 75% to 92% for Cr(III) and 68% to 76% for Cr(VI), with relation to the control.Catalase activity reached maximum in the soil material from surface layers (0-25 cm), typically characterized by the highest content of organic matter creating favorable conditions for microorganisms.

  12. HIGHLY SENSITIVE CATALASE ELECTRODE BASED ON POLYPYRROLE FILMS WITH MICROCONTAINERS

    Institute of Scientific and Technical Information of China (English)

    Yu-ying Gao; Gao-quan Shi

    2006-01-01

    Highly sensitive catalase electrodes for sensing hydrogen peroxide have been fabricated based on polypyrrole films with microcontainers. The microcontainers have a cup-like morphology and are arranged in a density of 4000 units cm-2.Catalase was immobilized into the polypyrrole films with microcontainers (Ppy-mc), which were coated on a Pt substrate electrode. The catalase/Ppy-mc/Pt electrode showed linear response to hydrogen peroxide in the range of 0-18 mmol/L at a potential of -0.3 V (versus SCE). Its sensitivity was measured to be approximately 3.64 μA (mmol/L)-1 cm-2, which is about two times that of the electrode fabricated from a flat Ppy film (catalase/Ppy-flat/Pt electrode). The electrode is highly selective for hydrogen peroxide and its sensitivity is interfered by potential interferents such as ascorbic acid, urea and fructose. Furthermore, such catalase electrodes showed long-term storage stability of 15 days under dry conditions at 4℃.

  13. Fused-expression and characterization of catalase-TAT%Catalase-TAT的融合表达与表征

    Institute of Scientific and Technical Information of China (English)

    李仁宽; 孙立国; 吕元辉; 刘树滔; 饶平凡

    2012-01-01

    利用RT-PCR技术从人的肝细胞中克隆出成熟蛋白过氧化氢酶(catalase)的基因,通过PCR将其与TAT基因融合形成融合基因(catalase-TAT);将catalase-TAT基因构建到表达质粒pET21a(+)中,转入大肠杆菌Rosetta2 (DE3);通过IPTG诱导,转化子成功表达出catalase-TAT融合蛋白.重组菌发酵菌体破碎液经过硫酸铵沉降和Sp-5pw阳离子交换色谱,分离得到电泳纯的目的蛋白,其纯化倍数为18.51倍;经理化性质分析确定了此融合蛋白的最适pH和温度稳定性;细胞实验表明融合蛋白catalase-TAT能够明显提高胞内的过氧化氢酶活性.%Human catalase gene was amplified from liver cells via RT - PCR and fused to TAT. The catalase - TAT was cloned into the expression vector pET21a ( + ) and transformed into Rosettal ( DE3). After induction with IPTG, the recombinant catalase - TAT fusion protein was successfully expressed. The lecombinant bacteria were sonicated and the targeted protein was purified to a single band on SDS - PAGE after ammonium sulfate precipitation and Sp -5pw cation exchange chromatogra-phy, with the purification factor of 18. 51. With physical and chemical analyses, the optimum pH and thermal stability of the fusion protein was determined.

  14. Allergic Fungal Rhinosinusitis.

    Science.gov (United States)

    Hoyt, Alice E W; Borish, Larry; Gurrola, José; Payne, Spencer

    2016-01-01

    This article reviews the history of allergic fungal rhinosinusitis and the clinical, pathologic, and radiographic criteria necessary to establish its diagnosis and differentiate this disease from other types of chronic rhinosinusitis. Allergic fungal rhinosinusitis is a noninvasive fungal form of sinus inflammation characterized by an often times unilateral, expansile process in which the typical allergic "peanut-butter-like" mucin contributes to the formation of nasal polyps, hyposmia/anosmia, and structural changes of the face. IgE sensitization to fungi is a necessary, but not sufficient, pathophysiologic component of the disease process that is also defined by microscopic visualization of mucin-containing fungus and characteristic radiological imaging. This article expounds on these details and others including the key clinical and scientific distinctions of this diagnosis, the pathophysiologic mechanisms beyond IgE-mediated hypersensitivity that must be at play, and areas of current and future research.

  15. Reactions of the class II peroxidases, lignin peroxidase and Arthromyces ramosus peroxidase, with hydrogen peroxide. Catalase-like activity, compound III formation, and enzyme inactivation.

    Science.gov (United States)

    Hiner, Alexander N P; Hernández-Ruiz, Josefa; Rodríguez-López, José Neptuno; García-Cánovas, Francisco; Brisset, Nigel C; Smith, Andrew T; Arnao, Marino B; Acosta, Manuel

    2002-07-26

    The reactions of the fungal enzymes Arthromyces ramosus peroxidase (ARP) and Phanerochaete chrysosporium lignin peroxidase (LiP) with hydrogen peroxide (H(2)O(2)) have been studied. Both enzymes exhibited catalase activity with hyperbolic H(2)O(2) concentration dependence (K(m) approximately 8-10 mm, k(cat) approximately 1-3 s(-1)). The catalase and peroxidase activities of LiP were inhibited within 10 min and those of ARP in 1 h. The inactivation constants were calculated using two independent methods; LiP, k(i) approximately 19 x 10(-3) s(-1); ARP, k(i) approximately 1.6 x 10(-3) s(-1). Compound III (oxyperoxidase) was detected as the majority species after the addition of H(2)O(2) to LiP or ARP, and its formation was accompanied by loss of enzyme activity. A reaction scheme is presented which rationalizes the turnover and inactivation of LiP and ARP with H(2)O(2). A similar model is applicable to horseradish peroxidase. The scheme links catalase and compound III forming catalytic pathways and inactivation at the level of the [compound I.H(2)O(2)] complex. Inactivation does not occur from compound III. All peroxidases studied to date are sensitive to inactivation by H(2)O(2), and it is suggested that the model will be generally applicable to peroxidases of the plant, fungal, and prokaryotic superfamily.

  16. Effects of fungal infection on feeding and survival of Anopheles gambiae (Diptera: Culicidae) on plant sugars.

    Science.gov (United States)

    Ondiaka, Sopher N; Masinde, Elizabeth W; Koenraadt, Constantianus Jm; Takken, Willem; Mukabana, Wolfgang R

    2015-01-20

    The entomopathogenic fungus Metarhizium anisopliae shows great promise for the control of adult malaria vectors. A promising strategy for infection of mosquitoes is supplying the fungus at plant feeding sites. We evaluated the survival of fungus-exposed Anopheles gambiae mosquitoes (males and females) fed on 6% glucose and on sugars of Ricinus communis (Castor oil plant) and Parthenium hysterophorus (Santa Maria feverfew weed). Further, we determined the feeding propensity, quantity of sugar ingested and its digestion rate in the mosquitoes when fed on R. communis for 12 hours, one and three days post-exposure to fungus. The anthrone test was employed to detect the presence of sugar in each mosquito from which the quantity consumed and the digestion rates were estimated. Fungus-exposed mosquitoes lived for significantly shorter periods than uninfected mosquitoes when both were fed on 6% glucose (7 versus 37 days), R. communis (7 versus 18 days) and P. hysterophorus (5 versus 7 days). Significantly fewer male and female mosquitoes, one and three days post-exposure to fungus, fed on R. communis compared to uninfected controls. Although the quantity of sugar ingested was similar between the treatment groups, fewer fungus-exposed than control mosquitoes ingested small, medium and large meals. Digestion rate was significantly slower in females one day after exposure to M. anisopliae compared to controls but remained the same in males. No change in digestion rate between treatments was observed three days after exposure. These results demonstrate that (a) entomopathogenic fungi strongly impact survival and sugar-feeding propensity of both sexes of the malaria vector An. gambiae but do not affect their potential to feed and digest meals, and (b) that plant sugar sources can be targeted as fungal delivery substrates. In addition, targeting males for population reduction using entomopathogenic fungi opens up a new strategy for mosquito vector control.

  17. Metallic mercury uptake by catalase Part 1 In Vitro metallic mercury uptake by various kind of animals' erythrocytes and purified human erythrocyte catalase

    OpenAIRE

    劒持,堅志

    1980-01-01

    The uptake of metallic mercury was studied using erythrocytes with different catalase activities taken from various kind of animals. The results were: 1) The uptake of metallic mercury by erythrocytes paralleled the activity of catalase in the erythrocytes with and without hydrogen peroxide, suggesting that the erythrocyte catalase activity is related to the uptake of metallic mercury. 2) The uptake of metallic mercury occurred not only with purified human erythrocyte catalase but also with h...

  18. Embryonic catalase protects against ethanol embryopathies in acatalasemic mice and transgenic human catalase-expressing mice in embryo culture

    Energy Technology Data Exchange (ETDEWEB)

    Miller-Pinsler, Lutfiya [Department of Pharmacology and Toxicology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Wells, Peter G., E-mail: pg.wells@utoronto.ca [Division of Biomolecular Sciences, Faculty of Pharmacy, University of Toronto, Toronto, Ontario (Canada); Department of Pharmacology and Toxicology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada)

    2015-09-15

    Reactive oxygen species (ROS) have been implicated in the mechanism of ethanol (EtOH) teratogenicity, but the protective role of the embryonic antioxidative enzyme catalase is unclear, as embryonic activity is only about 5% of maternal levels. We addressed this question in a whole embryo culture model. C57BL/6 mouse embryos expressing human catalase (hCat) or their wild-type (C57BL/6 WT) controls, and C3Ga.Cg-Cat{sup b}/J catalase-deficient, acatalasemic (aCat) mouse embryos or their wild-type C3HeB/FeJ (C3H WT) controls, were explanted on gestational day (GD) 9 (plug = GD 1), exposed for 24 h to 2 or 4 mg/mL EtOH or vehicle, and evaluated for functional and morphological changes. hCat and C57BL/6 WT vehicle-exposed embryos developed normally, while EtOH was embryopathic in C57BL/6 WT embryos, evidenced by decreases in anterior neuropore closure, somites developed, turning and head length, whereas hCat embryos were protected (p < 0.001). Maternal pretreatment of C57BL/6 WT dams with 50 kU/kg PEG-catalase (PEG-cat) 8 h prior to embryo culture, which increases embryonic catalase activity, blocked all EtOH embryopathies (p < 0.001). Vehicle-exposed aCat mouse embryos had lower yolk sac diameters compared to WT controls, suggesting that endogenous ROS are embryopathic. EtOH was more embryopathic in aCat embryos than WT controls, evidenced by reduced head length and somite development (p < 0.01), and trends for reduced anterior neuropore closure, turning and crown–rump length. Maternal pretreatment of aCat dams with PEG-Cat blocked all EtOH embryopathies (p < 0.05). These data suggest that embryonic catalase is a determinant of risk for EtOH embryopathies. - Highlights: • Ethanol (EtOH) exposure causes structural embryopathies in embryo culture. • Genetically enhanced catalase (hCat) protects against EtOH embryopathies. • Genetically deficient catalase (aCat) exacerbates EtOH embryopathies. • Embryonic catalase is developmentally important. • Et

  19. Evaluation of Metarhizium anisopliae for the control of Culicoides brevitarsis Kieffer (Diptera: Ceratopogonidae), the principal vector of bluetongue virus in Australia.

    Science.gov (United States)

    Nicholas, A H; McCorkell, B

    2014-06-01

    Four isolates of the entomopathogenic fungus Metarhizium anisopliae were tested for their potential to control the biting midge Culicoides brevitarsis, the principal vector of bluetongue virus in Australia. Adult C. brevitarsis died three to eight days after walking on paper substrate treated with 0.7 g/m(2) conidia of any of the isolates, indicating that M. anisopliae has potential as a surface treatment or topical application control strategy. Incorporation of the fungus into freshly excreted cattle dung at rates of between 0.25 and 1 g conidia/kg reduced the emergence of adult midges by up to 98.5% compared to untreated dung indicating that M. anisopliae has the potential to control C. brevitarsis larvae in cattle dung. Three of the isolates produced similar mortality rates on adult and immature C. brevitarsis while the fourth isolate produced lower, but still significant, mortality rates on adult and immature stages.

  20. Recycling of textile bleaching effluents for dyeing using immobilized catalase

    OpenAIRE

    Costa, Silgia; Tzanov,Tzanko; Carneiro, Ana Filipa Gonçalves da Costa; Gübitz, Georg M.; Paulo, Artur Cavaco

    2002-01-01

    Catalase was immobilized on alumina carrier and crosslinked with glutaraldehyde. Storing stability, temperature and pH profiles of enzyme activity were studied in a column reactor with recirculation and in a batch stirred-tank reactor. The immobilized enzyme retained 44% of its activity at pH 11, 30 °C and 90% at 80 °C, pH 7. The half-life time of the immobilized catalase was increased to 2 h at pH 12, and 60 °C. Acceptable results were achieved when the residual water from the washing proces...

  1. Biocontrol Potential of Metarhizium anisopliae (Metsch. Sorokin (Deuteromycotina: Hyphomycetes against Ailanthus Defoliator, Eligma narcissus (Cram.

    Directory of Open Access Journals (Sweden)

    N.S. Bai

    2015-09-01

    Full Text Available Eligma narcissus is recognised as a serious pest of Ailanthus in Southern India and defoliation of Ailanthus by this pest causes apparent loss of growth increment. The common control methods for this pest is mostly insecticides and the concern about the environmental effects of chemical insecticides, has emphasised the use of environmentally more benign microbial agents. Among entomopathogens, Fungi are the most explored and often act as important natural control agents that limit insect populations. On this point of view, Bio efficacy of 25 isolates of Metarhizium anisopliae was assessed to establish their virulence against E. narcissus in the laboratory and effective formulations of two potent isolates were subsequently evaluated in the field. MIS7 and MIS13 were more effective among the different isolates evaluated against E. narcissus. The median lethal concentration (LC50 of all the isolates ranged from 6.46×105 conidia/ml to 628.92×105 conidia/ml. Median lethal concentration of (LT50 of 4.9 and 5.4 days were recorded for MIS7 and MIS13 respectively at a concentration of 1× 107 conidia/ml. Virulence tests of the isolates MIS7 and MIS13 and 0.5% Pongamia pinnata seed oil, individually and in different combinations, indicated improved efficacy of the isolates when used in combination and also when combined with seed oil. Formulations composed of “MIS7+MIS13+0.5% Pongamia pinnata seed oil” and “MIS7+MIS13” proved to be superior against E. narcissus, causing 76.30% and 93.93% mortality, respectively. Field evaluation of the formulation MIS7+MIS13+0.5% Pongamia pinnata seed oil recorded 5.79 larvae per plant resulting in 60.53% reduction of infestation while the formulation, MIS7+MIS13 showed 53.76% reduction of infestation with 6.56 larvae per plant. The observations from this study suggest the prospects of using the entomopathogenic fungus, M. anisopliae for the control of E. narcissus.

  2. Fungal Wound Infection

    Centers for Disease Control (CDC) Podcasts

    2016-01-28

    Dr. David Tribble, acting director of the infectious disease clinical research program at Uniformed Services University of the Health Sciences, discusses fungal wound infections after combat trauma.  Created: 1/28/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 1/28/2016.

  3. Fungal pathogens of Proteaceae

    NARCIS (Netherlands)

    Crous, P.W.; Summerell, B.A.; Swart, L.; Denman, S.; Taylor, J.E.; Bezuidenhout, C.M.; Palm, M.E.; Marincowitz, S.; Groenewald, J.Z.

    2011-01-01

    Species of Leucadendron, Leucospermum and Protea (Proteaceae) are in high demand for the international floriculture market due to their brightly coloured and textured flowers or bracts. Fungal pathogens, however, create a serious problem in cultivating flawless blooms. The aim of the present study

  4. Fungal pathogens of Proteaceae

    NARCIS (Netherlands)

    Crous, P.W.; Summerell, B.A.; Swart, L.; Denman, S.; Taylor, J.E.; Bezuidenhout, C.M.; Palm, M.E.; Marincowitz, S.; Groenewald, J.Z.

    2012-01-01

    Species of Leucadendron, Leucospermum and Protea (Proteaceae) are in high demand for the international floriculture market due to their brightly coloured and textured flowers or bracts. Fungal pathogens, however, create a serious problem in cultivating flawless blooms. The aim of the present study

  5. Synchronous production of conidial powder of several fungal ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... biocontrol candidates in three genera including Metarhizium flavoviride ARSEF 5628, M. anisopliae .... diameter PVC pipes for synchronous production. ... heavy layer of yellowish powder, conidiation was terminated by.

  6. Mecanismo de infecção do fungo Metarhizium anisopliae no carrapato Boophilus microplus em condições experimentais The penetration of the fungus Metarhizium anisopliae on Boophilus microplus in experimental conditions

    Directory of Open Access Journals (Sweden)

    Vânia Rita Elias Pinheiro Bittencourt

    1999-06-01

    Full Text Available O objetivo do presente trabalho foi avaliar o mecanismo de penetração do fungo Metarhizium anisopliae em Boophilus microplus em condições experimentais. As infecções foram realizadas utilizando amostra de M. anisopliae isolada de carrapatos. A suspensão de conídios do fungo foi preparada utilizando água destilada e espalhante adesivo Tween 80 e foi quantificada na concentração de 10(8 conídios/ml. As fêmeas ingurgitadas foram banhadas nesta suspensão durante cinco minutos e, após este período, foram levadas à câmara climatizada. Três dias após a infecção, as fêmeas foram fixadas utilizando tetróxido de ósmio e glutaraldeído, posteriormente desidratadas em bateria de álcool etílico com acetona. Após a desidratação, esse material foi levado à metalização e ao microscópio eletrônico de varredura, onde se observou a fixação dos conídios na cutícula das fêmeas, havendo germinação e a dilatação da extremidade do tubo germinativo em todas as amostras. Esta dilatação observada foi devido à formação do apressório, apesar de não ser possível observar esta estrutura sobre a cutícula das fêmeas ingurgitadas. O tetróxido de ósmio mostrou ser um excelente fixador para fungos, enquanto o glutaraldeído mostrou ser eficiente na fixação do artrópode. Conclui-se que a forma principal de penetração deste entomopatógeno em B. microplus é através da cutícula. Cabe aqui frisar que esta é a primeira vez que é descrito o mecanismo de penetração de M. anisopliae em carrapatos.The objective of the present communication has been to draw attention to the mode of penetration of the fungus Metarhizium anisopliae through the cuticle of Boophilus microplus under experimental conditions. Samples of M. anisopliae isolated from naturally infected ticks were used to prepare a suspension of 108 conidia/ml in a destilled water with 2% of Tween 80. The engorged females were submergged in this suspension for five

  7. Improving catalase-based propelled motor endurance by enzyme encapsulation

    Science.gov (United States)

    Simmchen, Juliane; Baeza, Alejandro; Ruiz-Molina, Daniel; Vallet-Regí, Maria

    2014-07-01

    Biocatalytic propulsion is expected to play an important role in the future of micromotors as it might drastically increase the number of available fuelling reactions. However, most of the enzyme-propelled micromotors so far reported still rely on the degradation of peroxide by catalase, in spite of being vulnerable to relatively high peroxide concentrations. To overcome this limitation, herein we present a strategy to encapsulate the catalase and to graft the resulting enzyme capsules on motor particles. Significant improvement of the stability in the presence of peroxide and other aggressive agents has been observed.Biocatalytic propulsion is expected to play an important role in the future of micromotors as it might drastically increase the number of available fuelling reactions. However, most of the enzyme-propelled micromotors so far reported still rely on the degradation of peroxide by catalase, in spite of being vulnerable to relatively high peroxide concentrations. To overcome this limitation, herein we present a strategy to encapsulate the catalase and to graft the resulting enzyme capsules on motor particles. Significant improvement of the stability in the presence of peroxide and other aggressive agents has been observed. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr02459a

  8. Catalases as biocatalysts in technical applications : current state and perspectives

    NARCIS (Netherlands)

    Lončar, Nikola; Fraaije, Marco W

    2015-01-01

    Catalases represent a class of enzymes which has found its place among industrially relevant biocatalysts due to their exceptional catalytic rate and high stability. Textile bleaching prior to the dyeing process is the main application and has been performed on a large scale for the past few decades

  9. POTENCIAL DE BLASTOSPOROS DE Metarhizium anisopliae PARA O CONTROLE DE ADULTOS DE Aedes aegypti

    Directory of Open Access Journals (Sweden)

    Aline Teixeira Carolino

    2017-04-01

    Full Text Available Os conídios do fungo entomopatogênico Metarhizium anisopliae são capazes de infectar desde o ovo até a fase adulta do mosquito Aedes aegypti. Em cultura líquida, fungos entomopatogênicos são capazes de produzir blastosporos, um propágulo com características hidrofílicas e às vezes mais virulento que conídios. No presente estudo foi observado pela primeira vez, que blastosporos secos quando formulados em óleo são eficientes para controle do mosquito adulto. Foi observada somente 1% de sobrevivência dos mosquitos tratados com blastosporos e 94% de sobrevivência do grupo controle. Estudos já evidenciaram que formulações em óleo podem melhorar a eficiência de fungos entomopatogênicos durante o processo de infecção, facilitando a adesão do mesmo com o tegumento dos insetos. Pelo fato dos blastosporos serem hidrofílicos, a película formada pelo óleo ao redor do fungo, favorece a interação entre o fungo e o inseto, levando à infecção dos adultos.

  10. The antileukaemic cell cycle regulatory activities of swainsonine purified from Metarhizium anisopliae fermentation broth.

    Science.gov (United States)

    Singh, Digar; Kaur, Gurvinder

    2014-01-01

    Swainsonine is a Metarhizium secondary metabolite known differentially for its specific mannosidase inhibitory, toxic and therapeutic activities. Here, the standard and purified swainsonine from Metarhizium anisopliae fermentation broth were comparatively evaluated for their in situ antileukaemic activities in human promyelocytic cell line, HL-60. Both the standard (IC50 = 6.96 μM) and purified (IC50 = 9.50 μM) compounds inhibited the leukaemic cell proliferation without inflicting cell membrane disruption at 48 h of post-treatment incubation. The DNA cell cycle analysis showed approximately 48.81% and 60.72% of the treated cells arrested in the synthetic phase (S-phase) at 36 and 48 h, respectively, upon treatment with IC50 concentration of the purified swainsonine. However, only 29.62% of cells were arrested in S-phase with standard swainsonine at 48 h, suggesting the comprehensive action of certain other metabolites sharing the similar paradigm of antiproliferative properties in Metarhizium broth extract.

  11. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    Science.gov (United States)

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (Ptebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  12. Hemocyte characterization of Nasutitermes coxipoensis (Holmgren) (Isoptera: Termitidae) workers and hemocyte evaluation after parasitism by Metarhizium anisopliae; Caracterizacao dos hemocitos de operarios de Nasutitermes coxipoensis (Holmgren) (Isoptera: Termitidae) e avaliacao hemocitaria apos parasitismo por Metarhizium anisopliae

    Energy Technology Data Exchange (ETDEWEB)

    Cunha, Franklin M.; Wanderley-Teixeira, Valeria; Albuquerque, Auristela C. [Universidade Federal Rural de Pernambuco (UFRPE), Recife, PE (Brazil). Programa de Pos-Graduacao em Entomologia Agricola], e-mail: ukento@yahoo.com.br; Teixeira, Alvaro A.C. [Universidade Federal Rural de Pernambuco (UFRPE), Recife, PE (Brazil). Dept. de Morfologia e Fisiologia Animal], e-mail: valeria@dmfa.ufrpe.br, e-mail: auritermes@yahoo.com.br; Alves, Luiz C. [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Lab. de Imunopatologia Keizo Asami (LIKA); Lima, Elza A.L.A. [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Micologia. Lab. de Controle Biologico

    2009-03-15

    We aimed to characterize the morphology and ultrastructure of hemocytes of Nasutitermes coxipoensis (Holmgren) workers and to quantify the cell types 24h, 48h and 72h after inoculation with Metarhizium anisopliae. Six hemocytes types were identified, plasmatocyte, granulocyte, spherulocyte, prohemocyte, adipohemocyte and eonocytoid Hemocytes did not present any morphological alteration at the several observation periods, but they did have a change in their abundance, as observed for spherulocytes, adipohemocytes and eonocytoids at all intervals, and for plasmatocytes and granulocytes at 48h after host inoculation. We argue on the possible reasons and implications of the observed changes. (author)

  13. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano

    2005-03-01

    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  14. Survival and mutant production induced by mutagenic agents in Metarhizium anisopliae Sobrevivência e obtenção de mutantes induzidos por agentes mutagênicos em Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    V. Kava - Cordeiro

    1995-12-01

    Full Text Available A wild strain of Metarhizium anisopliae, an entomopathogenic fungus, was submitted to three mutagenic agents: gamma radiation, ultraviolet light and nitrous acid. Survival curves were obtained and mutants were selected using different mutagenic doses which gave 1 to 5% survival. Morphological and auxotrophic mutants were isolated. Morphological mutants were grouped in a class with yellow conidia and other with pale vinaceous conidia as opposed to the green wild type conidia. Auxotrophic mutants had requirements for vitamin and aminoacid biosynthesis. More than 58% of the total auxotrophk mutants required proline/aipnine. Gamma radiation showed to be the most efficient mutagenic agent giving 0.2% of auxotrophk mutants followed by ultraviolet light (0.12% and nitrous acid (0.06%.The conidial colour and auxotrophk mutants isolated until now from M. anisopliae were reviewed.Uma linhagem selvagem do fungo entomopatogênico Metarhizium anisopliae foi submetida à ação de três agentes mutagênicos: radiação gama, luz ultravioleta e ácido nitroso. Curvas de sobrevivência foram obtidas para cada mutagênicos utilizado e mutantes foram selecionados a partir de doses dos mutagênicos que proporcionassem de 1 a 5% de sobrevivência. Mutantes morfológicos para a coloração de conídios e mutantes auxotróficos foram isolados. Mutantes para coloração de conidios foram agrupados em duas classes, uma com conídios amarelos e outra com conídios vinho pálido. Os mutantes auxotróficos obtidos foram deficientes para aminoácidos e vitaminas e mais de 58% deles eram auxotróficos para prolina/argmina. Radiação gama foi o mutagênico mais eficiente com uma porcentagem de obtenção de mulantes auxotróficos de aproximadamente 0,2%, seguido pela luz ultravioleta (0.12% e pelo ácido nitroso (0.06%.Os mulantes morfológicos e auxotróficos obtidos até o momento em Metarhizium anisopliae foram revistos.

  15. Developing fungal bands for control of Asian longhorned beetle,Anoplophora glabripennis,in the U.S.%在美国使用无纺布菌条防治光肩星天牛的前景

    Institute of Scientific and Technical Information of China (English)

    安· 哈耶克; Thomas Dubois; Jennifer Lund; Michael Smith; Leah Bauer

    2007-01-01

    An invasive long-horned beetle,Anoplophora glabripennis,was first reported in the northeastern and midwestern United States and eastern Canada between 1996 and 2004 and has been given the common name Asian longhorned beetle (ALB). This beetle has also been found in several countries in Europe.ALB is difficult to control because larvae are found within the wood of living trees and the long-lived adults often occur high in tree canopies.This species is native to China and Korea and,because it has been a major tree killer in China,government agencies in the U.S.and Canada are working to eradicate ALB from North America.Our laboratory has been developing a microbial control approach targeting ALB adults,based on the Japanese product Biolisa Kamikiri which is used to control cerambycids in orchards.Entomopathogenic fungi are grown within non-woven fiber bands (= fungal bands) and placed around tree trunks and branches where ALB adults become inoculated when walking across bands. We have conducted bioassays with Beauveria brongniartii,Beauveria bassiana and Metarhizium anisopliae against ALB larvae and adults to identify effective isolates and now focus our efforts on M.anisopliae F52 (ARSEF 7711). Caged field trials conducted in China to compare fungal sprays with fungal bands (2000, 2001) demonstrated decreased ALB longevity and fitness for both application methods but longer activity of fungi in cages treated with fungal bands compared with sprays.Uncaged field trials (2001, 2002) yielded faster ALB adult mortality in fungal-treated plots and decreased fitness. Studies in New York City testing the longevity of activity of fungal bands in the field have documented that bands retain>1×107 conidia·cm-2 (the threshold for activity of Biolisa Kamikiri) for over 3 months.In contrast, studies with unformulated conidia sprayed onto tree trunks in New York documented conidial survival of only a few days.Sublethal effects of exposure of adult female ALB to fungal bands have

  16. [Clinically documented fungal infections].

    Science.gov (United States)

    Kakeya, Hiroshi; Kohno, Shigeru

    2008-12-01

    Proven fungal infections are diagnosed by histological/microbiological evidence of fungi at the site of infection and positive blood culture (fungemia). However, invasive diagnosing examinations are not always applied for all of immunocompromised patients. Clinically documented invasive fungal infections are diagnosed by typical radiological findings such as halo sign on chest CT plus positive serological/molecular evidence of fungi. Serological tests of Aspergillus galactomannan antigen and beta-glucan for aspergillosis and cryptococcal glucuronoxylomannan antigen for cryptococcosis are useful. Hence, none of reliable serological tests for zygomycosis are available so far. In this article, risk factors, sign and symptoms, and diagnostic methods for clinically documented cases of invasive aspergillosis, pulmonary cryptococcosis, and zygomycosis with diabates, are reviewed.

  17. Embryonic catalase protects against ethanol embryopathies in acatalasemic mice and transgenic human catalase-expressing mice in embryo culture.

    Science.gov (United States)

    Miller-Pinsler, Lutfiya; Wells, Peter G

    2015-09-15

    Reactive oxygen species (ROS) have been implicated in the mechanism of ethanol (EtOH) teratogenicity, but the protective role of the embryonic antioxidative enzyme catalase is unclear, as embryonic activity is only about 5% of maternal levels. We addressed this question in a whole embryo culture model. C57BL/6 mouse embryos expressing human catalase (hCat) or their wild-type (C57BL/6 WT) controls, and C3Ga.Cg-Cat(b)/J catalase-deficient, acatalasemic (aCat) mouse embryos or their wild-type C3HeB/FeJ (C3H WT) controls, were explanted on gestational day (GD) 9 (plug=GD 1), exposed for 24h to 2 or 4mg/mL EtOH or vehicle, and evaluated for functional and morphological changes. hCat and C57BL/6 WT vehicle-exposed embryos developed normally, while EtOH was embryopathic in C57BL/6 WT embryos, evidenced by decreases in anterior neuropore closure, somites developed, turning and head length, whereas hCat embryos were protected (pcatalase (PEG-cat) 8h prior to embryo culture, which increases embryonic catalase activity, blocked all EtOH embryopathies (pcatalase is a determinant of risk for EtOH embryopathies.

  18. Eficacia del hongo entomopatógeno Metharrizium anisopliae en el control de Boophilus microplus (Acari: Ixodidae)

    OpenAIRE

    Arguedas, Miguel; Álvarez C, Víctor; Bonilla M, Roberto

    2008-01-01

    Con el objetivo de evaluar la eficacia del hongo entomopatógeno Metharrizium anisopliae en el control de Boophilus microplus, se realizó el presente ensayo, que comprendió tanto una fase in vivo como una in vitro. El trabajo se realizó entre marzo de 2003 y junio de 2004, en 2 fincas ubicadas en Sarapiquí, Heredia y en los laboratorios de Garrapatas del Ministerio de Agricultura y Ganadería y de Parasitología de la Escuela de Medicina Veterinaria de la Universidad Nacional. La fase in vitro c...

  19. 金龟子绿僵菌菌株生长环境变量的优化%Optimization of environmental factors for the growth of Metarhizium anisopliae var.anisopliae strains MA4 and Malml

    Institute of Scientific and Technical Information of China (English)

    杨腊英; 甘露; 刘丽; 文明富; 黄俊生

    2008-01-01

    金龟子绿僵菌(Metarhizium anisopliae var.anisopliae)是一种广谱的昆虫病原真菌,提高菌株的生长速率及产孢量具有重要的意义.分别对2株金龟子绿僵菌菌株MA4与MAlml的菌丝生长及次代产孢具有影响的培养温度、培养基初始pH、装液比、光照及微量元素等环境因素进行了测定.经过优化得到2菌株最佳培养条件分别为:MA4菌株在28℃、pH 7、装液比为75ml/250ml、加入微量元素Mn全光照培养时生长最好、次代产孢量最高;MAlml菌株在28℃、pH9、装液比为75ml/250ml、加入微量元素Cu、黑暗培养时生长最好、次代产孢量最高.

  20. Flutuação Populacional e Parasitismo de Ovos de Spodoptera frugiperda e Helicoverpa zea em milho pulverizado com extratos vegetais e Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Jaqueline Ramos de Freitas

    2010-10-01

    Full Text Available We evaluated the effect of plant extracts and Metarhizium anisopliae on population and parasitism of eggs of Spodoptera frugiperda and Helicoverpa zea in corn planted at two spacings. The research was conducted at the Agricultural School "Assis Chateaubriand" in Laguna Seca, PB, and Laborat6rio of Entomology at the Center for Integrated Pest Management / UEPB in Campina Grande-PB. Corn was planted in an area of 500m2, in spacing: (I 0,8 m x 0,4 m, and (II 0,4 m x 0,4 m, with one or two plants per hole, respectively. The treatments consisted of: 1 water as a control, 2 M. anisopliae (100 g 10 L-1 water, 3 Extract of Momordica charantia (50 ml L-1 water, 4 M. anisopliae (10 g L-1 water + water extract of M. charantia (50 ml L-1 water, 5 M. anisopliae (10 g L-1 water + cassava (Manihot esculenta Crantz (50 ml L-1 water. According to the results, no significant difference between treatments to control spacing I S. frugiperda egg, which was due, probably, late spraying, when 100% of the plants were attacked. The treatments also not efficient to control H zea eggs, recommending further studies to determine the concentration and dosage most appropriate for controlling these pests.

  1. Larvicidal and pupicidal properties of Acalypha alnifolia Klein ex Willd. (Euphorbiaceae) leaf extract and the microbial insecticide Metarhizium anisopliae (Metsch.) against lymphatic filarial vector, Culex quinquefasciatus..

    Science.gov (United States)

    This study was made to determine the mosquitocidal properties of Acalypha alnifolia leaf extract combined with the use of Metarizhium anisopliae spores for control of the lymphatic filariasis vector Culex quinquefasciatus. The methanolic leaf extract showed larvicidal and pupicidal effects after 24...

  2. African water storage pots for the delivery of the Entomopathogenic fungus Metarhizium anisopliae to the Malaria vectors Anopheles gambiae s.s. and Anopheles funestus

    NARCIS (Netherlands)

    Farenhorst, M.; Farina, D.; Scholte, E.J.; Takken, W.; Hunt, R.H.; Coetzee, M.; Knols, B.G.J.

    2008-01-01

    We studied the use of African water storage pots for point source application of Metarhizium anisopliae against the malaria vectors Anopheles gambiae s.s. and An. funestus. Clay pots were shown to be attractive resting sites for male and female An. gambiae s.s. and were not repellent after impregnat

  3. Larvicidal and pupicidal properties of Acalypha alnifolia Klein ex willd.(Euphorbiaceae) leaf extract and the microbial insecticide Metarhizium anisopliae (Metsch.) against lymphatic filarial vector, Culex quinquefasciatus Sa

    Science.gov (United States)

    This study was made to determine the mosquitocidal properties of Acalypha alnifolia leaf extract combined with the use of Metarizhium anisopliae spores for control of the lymphatic filariasis vector Culex quinquefasciatus. The methanolic leaf extract showed larvicidal and pupicidal effects after 24...

  4. Identification of a hybrid PKS-NRPS required for the biosynthesis of NG-391 and NG-393 metabolites in Metarhizium anisopliae

    Science.gov (United States)

    A 19,818 kb genomic region harboring six predicted ORFs was identified in M. anisopliae ARSEF 2575. The ORF4 CDS, putatively encoding a hybrid polyketide synthase/nonribosomal peptide synthetase (PKS-NRPS) was targeted using Agrobacterium-mediated gene knockout. Homologous, but not heterolog...

  5. Inhibition of ecto-phosphatase activity in conidia reduces adhesion and virulence of Metarhizium anisopliae on the host insect Dysdercus peruvianus.

    Science.gov (United States)

    Cosentino-Gomes, Daniela; Rocco-Machado, Nathália; Santi, Lucélia; Broetto, Leonardo; Vainstein, Marilene H; Meyer-Fernandes, José Roberto; Schrank, Augusto; Beys-da-Silva, Walter O

    2013-05-01

    Metarhizium anisopliae is an entomopathogenic fungus with the ability to infect a broad range of arthropods, and have evolved distinct strategies for their attachment to hosts. Here, we describe the characterisation of ecto-phosphatase activity on the conidia surface of M. anisopliae and its relevance in the host interaction process. Ecto-phosphatase activity was linear for 60 min and during this time, was linear with the increase of cell density. The optimum pH was in the acidic range and some divalent metals, such as Cu(2+), Cd(2+) and Zn(2+), inhibited ecto-phosphatase activity. The activity was also reduced by phosphatase inhibitors. Importantly, the inhibition of phosphatase activity in conidia reduced the adhesion to Dysdercus peruvianus (Hemiptera: Pyrrhocoridae) integument and, consequently and indirectly, M. anisopliae infection. The results herein presented show, for the first time, the importance of ecto-phosphatase activity in M. anisopliae conidia and provide the first evidence of its direct involvement in adhesion and host infection.

  6. African water storage pots for the delivery of the Entomopathogenic fungus Metarhizium anisopliae to the Malaria vectors Anopheles gambiae s.s. and Anopheles funestus

    NARCIS (Netherlands)

    Farenhorst, M.; Farina, D.; Scholte, E.J.; Takken, W.; Hunt, R.H.; Coetzee, M.; Knols, B.G.J.

    2008-01-01

    We studied the use of African water storage pots for point source application of Metarhizium anisopliae against the malaria vectors Anopheles gambiae s.s. and An. funestus. Clay pots were shown to be attractive resting sites for male and female An. gambiae s.s. and were not repellent after

  7. The effect of leaf biopesticide Mirabilis jalapa and fungi Metarhizium anisopliae to immune response and mortality of Spodoptera exigua instar IV

    Science.gov (United States)

    Suryani, A. Irma; Anggraeni, Tjandra

    2014-03-01

    Spodoptera exigua is one of insect causing damage in agriculture sector. This insect can be controlled by a natural biopesticide by combining two agents of biological control, biopesticides Mirabilis jalapa and entomopathogenic fungi Metarhizium anisopliae, considered to be virulent toward a wide range of insects. The objective of research was to determine the effect of biopesticides M. jalapa and fungi M. anisopliae against immune system and mortality of S. exigua. This research used a complete randomized block design with five concentrations Mirabilis jalapa and optimum dose of M. anisopliae. A high dose of M. jalapa (0.8% w/v) is the most effective one to decrease total haemocytes especially granulocyt and plasmatocyt (cellular immune) and decrease the concentration of lectin (humoral immune) from S. exigua (p < 0.05). The combination of M. jalapa (0, 8% w/v) and lethal dose of M. anisopliae 2.59 × 107 spore/ml were significant to increase mortality of S. exigua within 48 hours (p < 0.05).

  8. Virulence of Beauveria bassiana and Metarhizium anisopliae (Ascomycota: Hypocreales) commercial strains against adult Xylosandrus germanus (Coleoptera: Scolytidae) and impact on brood

    Science.gov (United States)

    The ambrosia beetle Xylosandrus germanus is an invasive pest with a wide host range and is a serious pest of orchards and nurseries in the eastern US. In this study we evaluated the potential of entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae as control agents against this beet...

  9. Fungal osteomyelitis and septic arthritis.

    Science.gov (United States)

    Bariteau, Jason T; Waryasz, Gregory R; McDonnell, Matthew; Fischer, Staci A; Hayda, Roman A; Born, Christopher T

    2014-06-01

    Management of fungal osteomyelitis and fungal septic arthritis is challenging, especially in the setting of immunodeficiency and conditions that require immunosuppression. Because fungal osteomyelitis and fungal septic arthritis are rare conditions, study of their pathophysiology and treatment has been limited. In the literature, evidence-based treatment is lacking and, historically, outcomes have been poor. The most common offending organisms are Candida and Aspergillus, which are widely distributed in humans and soil. However, some fungal pathogens, such as Histoplasma, Blastomyces, Coccidioides, Cryptococcus, and Sporothrix, have more focal areas of endemicity. Fungal bone and joint infections result from direct inoculation, contiguous infection spread, or hematogenous seeding of organisms. These infections may be difficult to diagnose and eradicate, especially in the setting of total joint arthroplasty. Although there is no clear consensus on treatment, guidelines are available for management of many of these pathogens.

  10. Development of lyophilization cycle and effect of excipients on the stability of catalase during lyophilization

    OpenAIRE

    Lale, Shantanu V; Goyal, Monu; Bansal, Arvind K.

    2011-01-01

    Introduction: The purpose of the present study was to screen excipients such as amino acids and non-aqueous solvents for their stabilizing effect on catalase, a model protein, for lyophilization. The present study also includes optimization of lyophilization cycle for catalase formulations, which is essential from the commercial point of view, since lyophilization is an extremely costly process. Materials and Methods: Activity of catalase was determined using catalase activity assay. Differen...

  11. Evaluation of Metarhizium anisopliae var. anisopliae Qu-M845 Isolate to Control Varroa destructor (Acari: Varroidae in Laboratory and Field Trials Evaluación del Aislamiento Qu-M845 de Metarhizium anisopliae var. anisopliae para el Control de Varroa destructor (Acari: Varroidae en Ensayos de Laboratorio y Terreno

    Directory of Open Access Journals (Sweden)

    Marta Rodríguez

    2009-12-01

    Full Text Available The effectiveness of the Metarhizium anisopliae (Metschinkoff Qu-M845 isolate was evaluated in laboratory and field trials. It was previously selected for thermal resistance (at 30 and 35 ºC and pathogenicity on Varroa destructor (Anderson and Trueman. In the laboratory, the first evaluations were carried out by spraying and increasing the concentration from zero to 10(8 conidia mL-1 on varroa adults. Lethal concentrations required for 50 and 90% mite mortality (LC50 and LC90 were 3.8 x 10(5 and 8 x 10(7 conidia mL-1, respectively (χ2 = 2.03. In the autumn field trials, three application methods (doses of 5 x 10(10 conidia per hive were evaluated. The treatments were: a conidia stamped on filter paper, located on every second frame inside the hive; b dry conidia sprinkled on and between frames; and c dry conidia in a dispenser path at the entrance of the hive. Furthermore, untreated hives were included as controls. After 21 days of treatment, the dry conidia sprinkled on and between frames showed 67% less bees infested by the mite than the control (p La efectividad del aislamiento Qu-M845 de Metarhizium anisopliae (Metschinkoff, seleccionado previamente por su resistencia a temperaturas de 30 y 35 ºC, y patogenicidad sobre Varroa destructor Anderson y Trueman fue evaluada en laboratorio y en ensayos de terreno. Las primeras pruebas consistieron en pulverizar concentraciones crecientes de 0 a 10(8 conidias mL-1 sobre varroas adultas. La concentración letal para matar el 50 y 90% de la población (CL50 y CL90 fueron de 3,8 x 10(5 y 8 x 10(7 conidias mL-1, respectivamente (χ² = 2,03. En otoño se evaluaron en terreno tres métodos de aplicación de una dosis de 5 x 10(10 conidias por colmena. Los tratamientos fueron: a conidias estampadas en papel filtro ubicado cada dos panales móviles al interior de la colmena; b conidias espolvoreadas sobre y entre los panales; y c dispensador de conidias ubicado en la piquera de las colmenas. Además se

  12. Direct electrochemistry of Penicillium chrysogenum catalase adsorbed on spectroscopic graphite.

    Science.gov (United States)

    Dimcheva, Nina; Horozova, Elena

    2013-04-01

    The voltammetric studies of Penicillium chrysogenum catalase (PcCAT) adsorbed on spectroscopic graphite, showed direct electron transfer (DET) between its active site and the electrode surface. Analogous tests performed with the commercially available bovine catalase revealed that mammalian enzyme is much less efficient in the DET process. Both catalases were found capable to catalyse the electrooxidation of phenol, but differed in the specifics of catalytic action. At an applied potential of 0.45V the non-linear regression showed the kinetics of the bioelectrochemical oxidation catalysed by the PcCAT obeyed the Hill equation with a binding constant K=0.034±0.002 M(2) (Hill's coefficient n=2.097±0.083, R(2)=0.997), whilst the catalytic action of the bovine catalase was described by the Michaelis-Menten kinetic model with the following parameters: V(max,app)=7.780±0.509 μA, and K(M,app)=0.068±0.070 mol L(-1). The performance of the electrode reaction was affected by the electrode potential, the pH, and temperature. Based on the effect of pH and temperature on the electrode response in presence of phenol a tentative reaction pathway of its bioelectrocatalytic oxidation has been hypothesised. The possible application of these findings in biosensing phenol up to concentration 30 mM at pHs below 7 and in absence of oxidising agents (oxygen or H(2)O(2)) was considered.

  13. Catalase-only nanoparticles prepared by shear alone: Characteristics, activity and stability evaluation.

    Science.gov (United States)

    Huang, Xiao-Nan; Du, Xin-Ying; Xing, Jin-Feng; Ge, Zhi-Qiang

    2016-09-01

    Catalase is a promising therapeutic enzyme; however, it carries risks of inactivation and rapid degradation when it is used in practical bioprocess, such as delivery in vivo. To overcome the issue, we made catalase-only nanoparticles using shear stress alone at a moderate shear rate of 217s(-1) in a coaxial cylinder flow cell. Properties of nanoparticles, including particle size, polydispersity index and zeta potential, were characterized. The conformational changes of pre- and post-sheared catalase were determined using spectroscopy techniques. The results indicated that the conformational changes of catalase and reduction in α-helical content caused by shear alone were less significant than that by desolvation method. Catalase-only nanoparticles prepared by single shear retained over 90% of its initial activity when compared with the native catalase. Catalase nanoparticles lost only 20% of the activity when stored in phosphate buffer solution for 72h at 4°C, whereas native catalase lost 53% under the same condition. Especially, the activity of nanogranulated catalase was decreased only slightly in the simulated intestinal fluid containing α-chymotrypsin during 4h incubation at 37°C, implying that the catalase nanoparticle was more resistant to the degradation of proteases than native catalase molecules. Overall, catalase-only nanoparticles offered a great potential to stabilize enzymes for various pharmaceutical applications.

  14. The relevance of the non-canonical PTS1 of peroxisomal catalase

    NARCIS (Netherlands)

    Williams, Chris; Aksam, Eda Bener; Gunkel, Katja; Veenhuis, Marten; van der Klei, Ida J.

    2012-01-01

    Catalase is sorted to peroxisomes via a C-terminal peroxisomal targeting signal 1 (PTS1), which binds to the receptor protein Pex5. Analysis of the C-terminal sequences of peroxisomal catalases from various species indicated that catalase never contains the typical C-terminal PTS1 tripeptide-SKL, bu

  15. The production relationship of destruxins and blastospores of Metarhizium anisopliae with virulence againstPlutella xylostella

    Institute of Scientific and Technical Information of China (English)

    DONG Ting-yan; ZHANG Bo-wen; WENG Qun-fang; HU Qiong-bo

    2016-01-01

    Metarhizium anisopliaeas an essential entomopathogenic fungushas been known to produce destruxins (a kind of cyclo-peptidic mycotoxins) and blastospores in submerged culture. Blastospores and destruxins are candidates for in-secticides, but the relations of both productions and the impact factors are unclear yet. In this study, we investigated the effects of inoculums, rotation, dissolved oxygen (DO) on the productions of blastospores and destruxins A and B (DA and DB) in submerged culture ofM. anisopliaestrain MaQ01. The results indicated that DO levels were regulated by inoculum amounts and rotation speeds, meanwhile, the productions of DA, DB and blastospores were also closely inlfuenced by those factors. Totaly, when DO value was more than 40%, the higher productions of destruxins and blastospores were achieved, by contrast, lower than 40% of DO values resulted in lower productions. The regression analysis suggested that the productions of DA, DB and blastospores were positively correlated with the DO levels. Meanwhile, the positive correlations between the productions of DA or DB and blastospores were also found. Brielfy, when the rotation is 150 r min–1 and the inoculum is 1.0×106 spore mL–1, the DA, DB and blastospores achieved the best production of 61.81 mg mL–1, 24.74 mg mL–1 and 5.73×106 spore mL–1, respectively. In addition, the pathogenicities of blastospores and conidia against Plutela xylostela were bioassayed. The higher mortalities of P. xylostela were totaly recorded in blastospore treatments than in conidia treatments, especialy in lower dosages and earlier periods. Our research wil give some new insights to production of destruxins and blastospores by using M. anisopliae.

  16. Mitochondrial-targeted human catalase affords neuroprotection from proton irradiation.

    Science.gov (United States)

    Liao, Alicia C; Craver, Brianna M; Tseng, Bertrand P; Tran, Katherine K; Parihar, Vipan K; Acharya, Munjal M; Limoli, Charles L

    2013-07-01

    Significant past work has linked radiation exposure of the CNS to elevated levels of oxidative stress and inflammation. These secondary reactive processes are both dynamic and persistent and are believed to compromise the functionality of the CNS, in part, by disrupting endogenous neurogenesis in the hippocampus. While evidence has shown neurogenesis to be sensitive to irradiation and redox state, the mechanistic basis underlying these effects is incompletely understood. To clarify the role of reactive oxygen species (ROS) in mediating radiation-induced changes in neurogenesis we have analyzed transgenic mice that overexpress human catalase localized to the mitochondria. With this model, we investigated the consequences of low dose and clinically relevant proton irradiation on neurogenesis, and how that process is modified in response to genetic disruption of mitochondrial ROS levels. In unirradiated animals, basal neurogenesis was improved significantly by reductions in mitochondrial ROS. In animals subjected to proton exposure, hippocampal progenitor cell proliferation was attenuated significantly by overexpression of human catalase in the mitochondria. Furthermore, expression of the MCAT transgene significantly improved neurogenesis in WT animals after low-dose proton exposure (0.5 Gy), with similar trends observed at higher dose (2 Gy). Our report documents for the first time the impact of proton irradiation on hippocampal neurogenesis, and the neuroprotective properties of reducing mitochondrial ROS through the targeted overexpression of catalase. © 2013 by Radiation Research Society

  17. Overexpression of Catalase Diminishes Oxidative Cysteine Modifications of Cardiac Proteins.

    Directory of Open Access Journals (Sweden)

    Chunxiang Yao

    Full Text Available Reactive protein cysteine thiolates are instrumental in redox regulation. Oxidants, such as hydrogen peroxide (H2O2, react with thiolates to form oxidative post-translational modifications, enabling physiological redox signaling. Cardiac disease and aging are associated with oxidative stress which can impair redox signaling by altering essential cysteine thiolates. We previously found that cardiac-specific overexpression of catalase (Cat, an enzyme that detoxifies excess H2O2, protected from oxidative stress and delayed cardiac aging in mice. Using redox proteomics and systems biology, we sought to identify the cysteines that could play a key role in cardiac disease and aging. With a 'Tandem Mass Tag' (TMT labeling strategy and mass spectrometry, we investigated differential reversible cysteine oxidation in the cardiac proteome of wild type and Cat transgenic (Tg mice. Reversible cysteine oxidation was measured as thiol occupancy, the ratio of total available versus reversibly oxidized cysteine thiols. Catalase overexpression globally decreased thiol occupancy by ≥1.3 fold in 82 proteins, including numerous mitochondrial and contractile proteins. Systems biology analysis assigned the majority of proteins with differentially modified thiols in Cat Tg mice to pathways of aging and cardiac disease, including cellular stress response, proteostasis, and apoptosis. In addition, Cat Tg mice exhibited diminished protein glutathione adducts and decreased H2O2 production from mitochondrial complex I and II, suggesting improved function of cardiac mitochondria. In conclusion, our data suggest that catalase may alleviate cardiac disease and aging by moderating global protein cysteine thiol oxidation.

  18. SUBSTRATO DE CRESCIMENTO DO FUNGO Metarhizium anisopliae INFLUENCIA NA VIRULÊNCIA CONTRA LARVAS DE Aedes aegypti

    Directory of Open Access Journals (Sweden)

    Aline Teixeira Carolino

    2016-11-01

    Full Text Available O presente estudo investigou a virulência dos isolados 4556 e ESALQ 818 do fungo M. anisopliae crescidos nos substratos arroz parboilizado e nos meios de cultivo BDA (para o isolado 4556 e SDA (para o isolado ESALQ 818. Ensaios de virulência foram realizados com larvas de Aedes aegypti provenientes de ovos coletados no campo. Os ovos foram colocados na água e deram origem as larvas que foram utilizadas nos experimentos. Os conídios de M. anisopliae (ambos isolados crescidos nos diferentes substratos foram formulados em Tween 80 e utilizados na concentração de 1x107 conídios ml-1. O estudo constatou que os dois isolados crescidos no arroz parboilizado foram mais virulentos para larvas de campo de A. aegypti. Apenas 7,5% das larvas tratadas com os conídios do isolado 4556 crescidos no arroz sobreviveram e no meio de cultivo BDA a sobrevivência das larvas foi de 65,%, após 24 horas de infecção. As larvas tratadas com conídios do isolado ESALQ 818 produzidos no arroz apresentaram 52,5% de sobrevivência e as tratadas com conídios produzidos no meio SDA apresentaram sobrevivência de 85%, após 24 horas de infecção.

  19. Comparative transcriptomic analysis of the heat stress response in the filamentous fungus Metarhizium anisopliae using RNA-Seq.

    Science.gov (United States)

    Wang, Zhang-Xun; Zhou, Xia-Zhi; Meng, Hui-Min; Liu, Yu-Jun; Zhou, Quan; Huang, Bo

    2014-06-01

    The entomopathogenic fungus Metarhizium anisopliae is widely used for biological control of a variety of insect pests. The effectiveness of the microbial pest control agent, however, is limited by poor thermotolerance. The molecular mechanism underlying the response to heat stress in the conidia of entomopathogenic fungi remains unclear. Here, we conducted high-throughput RNA-Seq to analyze the differential gene expression between control and heat treated conidia of M. anisopliae at the transcriptome level. RNA-Seq analysis generated 6,284,262 and 5,826,934 clean reads in the control and heat treated groups, respectively. A total of 2,722 up-regulated and 788 down-regulated genes, with a cutoff of twofold change, were identified by expression analysis. Among these differentially expressed genes, many were related to metabolic processes, biological regulation, cellular processes and response to stimuli. The majority of genes involved in endocytic pathways, proteosome pathways and regulation of autophagy were up-regulated, while most genes involved in the ribosome pathway were down-regulated. These results suggest that these differentially expressed genes may be involved in the heat stress response in conidia. As expected, significant changes in expression levels of genes encoding heat shock proteins and proteins involved in trehalose accumulation were observed in conditions of heat stress. These results expand our understanding of the molecular mechanisms of the heat stress response of conidia and provide a foundation for future investigations.

  20. Enhanced ovicidal activity of an oil formulation of the fungus Metarhizium anisopliae on the mosquito Aedes aegypti.

    Science.gov (United States)

    Albernaz, D A S; Tai, M H H; Luz, C

    2009-06-01

    The effect of humidity on the activity of Metarhizium anisopliae IP 46 (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) formulated in sunflower oil against Aedes aegypti (L.) (Diptera: Culicidae) eggs was examined. After exposure of eggs at 75% relative humidity (RH) for ovicidal activity was not increased by oil-in-water formulated conidia, hyphal bodies or pure-oil formulated conidia, compared with conidia or hyphal bodies prepared in water only. At optimal > 98% RH, eclosion was Ovicidal activity was still detected at 93% RH and was augmented with increasing humidity and time of exposure of eggs. Eclosion of larvae was distinctly reduced by IP 46 pure-oil formulated conidia after a minimal initial exposure of 3 days at > 98% RH, followed by: (a) a 12-day exposure at 75% RH before submersion in water; (b) a minimal 5-day exposure at > 98% RH and direct subsequent transfer of treated eggs to water, or (c) a minimal daily 20-h exposure at > 98% RH alternating with 4 h at 75% RH for 10 days. We demonstrate that oil-based formulations of conidia of M. anisopliae enhance ovicidal activity at high humidities and conclude that these formulations have potential in the integrated control of Ae. aegypti.

  1. Utilization of metarhizium anisopliae and vegetable extract for control of the spodoptera frugiperda and helicoverpa zea (lepidoptera: noctuidae in the corn

    Directory of Open Access Journals (Sweden)

    Eduardo Barbosa Beserra

    2008-05-01

    Full Text Available The potential use of the vegetable extracts and Metarhizium anisopliae about the population and damage of the Spodoptera frugiperda and Helicoverpa zea in corn, it was evaluated when planted in two spacings. The experiment was installed in the culture of corn, in the city of Lagoa Seca/PB, in two areas of 500 m2, in the spacings 0,8 x 0,4 and 0,4 x 0,4 m, with two and one plant for hole. The basis was constituited of: 1 Water as witness; 2 Metarhizium anisopliae; 3 Extracts of Mormodica charantia; 4 Metarhizium anisopliae + extracts of M. charantia; 5 M. anisopliae + manipueira. The results showed some statistical difference between the two spacings, with a larger number of collected caterpillars, 5,84, and a larger damage to the plant, 3,24, in the spacing 0,4 x 0,4 m, in relation to the spacing 0,8 x 0,4 m, within as average of 4,13 caterpillars and danificated of 2,71. There was not any significant interaction between the spacings and the products used for the control of S. frugiperda. However, there was a significant difference among the treatments, with a smaller number of caterpillars, 4,17, and a smaller medium damage to the plant, 2,81, when was used, M. anisopliae + extract of M. charantia. Considering to the control of the plaque the percentage of damage ears of corn by H. zea, weight and length of the ear of corn in corn, there wasn’t neither significant difference with regard to the spacing, neither with regard to the used treatments.

  2. Persistence of Brazilian isolates of the entomopathogenic fungi Metarhizium anisopliae and M. robertsii in strawberry crop soil after soil drench application

    DEFF Research Database (Denmark)

    Castro, Thiago; Mayerhofer, Johanna; Enkerli, Jürg

    2016-01-01

    Establishment, persistence and local dispersal of the entomopathogenic fungi Metarhizium anisopliae (ESALQ1037) and M. robertsii (ESALQ1426) (Ascomycota: Hypocreales) were investigated in the soil and rhizosphere following soil drench application in strawberries between 2012 and 2013 at a single ...

  3. Fungal biodiversity to biotechnology.

    Science.gov (United States)

    Chambergo, Felipe S; Valencia, Estela Y

    2016-03-01

    Fungal habitats include soil, water, and extreme environments. With around 100,000 fungus species already described, it is estimated that 5.1 million fungus species exist on our planet, making fungi one of the largest and most diverse kingdoms of eukaryotes. Fungi show remarkable metabolic features due to a sophisticated genomic network and are important for the production of biotechnological compounds that greatly impact our society in many ways. In this review, we present the current state of knowledge on fungal biodiversity, with special emphasis on filamentous fungi and the most recent discoveries in the field of identification and production of biotechnological compounds. More than 250 fungus species have been studied to produce these biotechnological compounds. This review focuses on three of the branches generally accepted in biotechnological applications, which have been identified by a color code: red, green, and white for pharmaceutical, agricultural, and industrial biotechnology, respectively. We also discuss future prospects for the use of filamentous fungi in biotechnology application.

  4. Antigenic role of stress-induced catalase of Salmonella typhimurium in cell-mediated immunity.

    OpenAIRE

    Kagaya, K; Miyakawa, Y; Watanabe, K; Fukazawa, Y.

    1992-01-01

    The ability of the H2O2-induced catalase of Salmonella typhimurium to induce cell-mediated immunity against S. typhimurium infection in mice was examined. When exponentially growing cells of S. typhimurium were treated with 20 microM H2O2, the cells resisted killing by 1 mM H2O2 and showed the induction of a new species of catalase in addition to the constitutively produced one. Two molecules of catalases in S. typhimurium were isolated from mutant strains: H2O2-induced catalase (catalase II,...

  5. Managing acute invasive fungal sinusitis.

    Science.gov (United States)

    Dwyhalo, Kristina M; Donald, Carrlene; Mendez, Anthony; Hoxworth, Joseph

    2016-01-01

    Acute invasive fungal sinusitis is the most aggressive form of fungal sinusitis and can be fatal, especially in patients who are immunosuppressed. Early diagnosis and intervention are crucial and potentially lifesaving, so primary care providers must maintain a high index of suspicion for this disease. Patients may need to be admitted to the hospital for IV antifungal therapy and surgical debridement.

  6. Current management of fungal infections.

    NARCIS (Netherlands)

    Meis, J.F.G.M.; Verweij, P.E.

    2001-01-01

    The management of superficial fungal infections differs significantly from the management of systemic fungal infections. Most superficial infections are treated with topical antifungal agents, the choice of agent being determined by the site and extent of the infection and by the causative organism,

  7. The evolution of fungal epiphytes

    NARCIS (Netherlands)

    Hongsanan, S.; Sánchez-Ramírez, S.; Crous, P.W.; Ariyawansa, H.A.; Zhao, R.L.; Hyde, K.D.

    2016-01-01

    Fungal epiphytes are a polyphyletic group found on the surface of plants, particularly on leaves, with a worldwide distribution. They belong in the phylum Ascomycota, which contains the largest known number of fungal genera. There has been little research dating the origins of the common ancestors o

  8. Cloning, Expression, and Characterization of a Novel Thermophilic Monofunctional Catalase from Geobacillus sp. CHB1

    Science.gov (United States)

    2016-01-01

    Catalases are widely used in many scientific areas. A catalase gene (Kat) from Geobacillus sp. CHB1 encoding a monofunctional catalase was cloned and recombinant expressed in Escherichia coli (E. coli), which was the first time to clone and express this type of catalase of genus Geobacillus strains as far as we know. This Kat gene was 1,467 bp in length and encoded a catalase with 488 amino acid residuals, which is only 81% similar to the previously studied Bacillus sp. catalase in terms of amino acid sequence. Recombinant catalase was highly soluble in E. coli and made up 30% of the total E. coli protein. Fermentation broth of the recombinant E. coli showed a high catalase activity level up to 35,831 U/mL which was only lower than recombinant Bacillus sp. WSHDZ-01 among the reported catalase production strains. The purified recombinant catalase had a specific activity of 40,526 U/mg and Km of 51.1 mM. The optimal reaction temperature of this recombinant enzyme was 60°C to 70°C, and it exhibited high activity over a wide range of reaction temperatures, ranging from 10°C to 90°C. The enzyme retained 94.7% of its residual activity after incubation at 60°C for 1 hour. High yield and excellent thermophilic properties are valuable features for this catalase in industrial applications. PMID:27579320

  9. Catalytic Properties and Immobilization Studies of Catalase from Malva sylvestris L.

    Directory of Open Access Journals (Sweden)

    G. Arabaci

    2013-01-01

    Full Text Available Catalase was partially purified from Malva sylvestris L. and immobilized onto chitosan. Then, its catalytic properties were investigated. (NH42SO4 precipitation and dialysis were performed in the extracted enzyme. Further purification was performed with sephadex G-200 column. Kinetic studies of the purified enzyme activity were measured and characterized. The inhibitory effects of KCN, NaN3, CuSO4, and EDTA on M. sylvestris L. catalase activity were observed except NaCl. Furthermore, M. sylvestris L. catalase was immobilized covalently with glutaraldehyde onto chitosan particles. The pH and temperature optima as well as the changes in the kinetics (Km, Vmax of the immobilized and free M. sylvestris L. catalase were determined. The Km value for immobilized catalase (23.4 mM was higher than that of free enzyme (17.6 mM. Optimum temperature was observed higher than that of the free enzyme. The optimum pH was the same for both free and immobilized catalases (pH 7.50. Immobilized catalase showed higher storage and thermal stabilities than free catalases. Free catalase lost all its activity within 60 days whereas immobilized catalase lost 45% of its activity during the same incubation period at 4°C. The remaining immobilized catalase activity was about 70% after 8 cycles of batch operations.

  10. Cloning, Expression, and Characterization of a Novel Thermophilic Monofunctional Catalase from Geobacillus sp. CHB1

    Directory of Open Access Journals (Sweden)

    Xianbo Jia

    2016-01-01

    Full Text Available Catalases are widely used in many scientific areas. A catalase gene (Kat from Geobacillus sp. CHB1 encoding a monofunctional catalase was cloned and recombinant expressed in Escherichia coli (E. coli, which was the first time to clone and express this type of catalase of genus Geobacillus strains as far as we know. This Kat gene was 1,467 bp in length and encoded a catalase with 488 amino acid residuals, which is only 81% similar to the previously studied Bacillus sp. catalase in terms of amino acid sequence. Recombinant catalase was highly soluble in E. coli and made up 30% of the total E. coli protein. Fermentation broth of the recombinant E. coli showed a high catalase activity level up to 35,831 U/mL which was only lower than recombinant Bacillus sp. WSHDZ-01 among the reported catalase production strains. The purified recombinant catalase had a specific activity of 40,526 U/mg and Km of 51.1 mM. The optimal reaction temperature of this recombinant enzyme was 60°C to 70°C, and it exhibited high activity over a wide range of reaction temperatures, ranging from 10°C to 90°C. The enzyme retained 94.7% of its residual activity after incubation at 60°C for 1 hour. High yield and excellent thermophilic properties are valuable features for this catalase in industrial applications.

  11. Novel insights in mammalian catalase heme maturation: effect of NO and thioredoxin-1.

    Science.gov (United States)

    Chakravarti, Ritu; Gupta, Karishma; Majors, Alana; Ruple, Lisa; Aronica, Mark; Stuehr, Dennis J

    2015-05-01

    Catalase is a tetrameric heme-containing enzyme with essential antioxidant functions in biology. Multiple factors including nitric oxide (NO) have been shown to attenuate its activity. However, the possible impact of NO in relation to the maturation of active catalase, including its heme acquisition and tetramer formation, has not been investigated. We found that NO attenuates heme insertion into catalase in both short-term and long-term incubations. The NO inhibition in catalase heme incorporation was associated with defective oligomerization of catalase, such that inactive catalase monomers and dimers accumulated in place of the mature tetrameric enzyme. We also found that GAPDH plays a key role in mediating these NO effects on the structure and activity of catalase. Moreover, the NO sensitivity of catalase maturation could be altered up or down by manipulating the cellular expression level or activity of thioredoxin-1, a known protein-SNO denitrosylase enzyme. In a mouse model of allergic inflammatory asthma, we found that lungs from allergen-challenged mice contained a greater percentage of dimeric catalase relative to tetrameric catalase in the unchallenged control, suggesting that the mechanisms described here are in play in the allergic asthma model. Together, our study shows how maturation of active catalase can be influenced by NO, S-nitrosylated GAPDH, and thioredoxin-1, and how maturation may become compromised in inflammatory conditions such as asthma.

  12. Cloning, Expression, and Characterization of a Novel Thermophilic Monofunctional Catalase from Geobacillus sp. CHB1.

    Science.gov (United States)

    Jia, Xianbo; Chen, Jichen; Lin, Chenqiang; Lin, Xinjian

    2016-01-01

    Catalases are widely used in many scientific areas. A catalase gene (Kat) from Geobacillus sp. CHB1 encoding a monofunctional catalase was cloned and recombinant expressed in Escherichia coli (E. coli), which was the first time to clone and express this type of catalase of genus Geobacillus strains as far as we know. This Kat gene was 1,467 bp in length and encoded a catalase with 488 amino acid residuals, which is only 81% similar to the previously studied Bacillus sp. catalase in terms of amino acid sequence. Recombinant catalase was highly soluble in E. coli and made up 30% of the total E. coli protein. Fermentation broth of the recombinant E. coli showed a high catalase activity level up to 35,831 U/mL which was only lower than recombinant Bacillus sp. WSHDZ-01 among the reported catalase production strains. The purified recombinant catalase had a specific activity of 40,526 U/mg and K m of 51.1 mM. The optimal reaction temperature of this recombinant enzyme was 60°C to 70°C, and it exhibited high activity over a wide range of reaction temperatures, ranging from 10°C to 90°C. The enzyme retained 94.7% of its residual activity after incubation at 60°C for 1 hour. High yield and excellent thermophilic properties are valuable features for this catalase in industrial applications.

  13. [Fermentation production of microbial catalase and its application in textile industry].

    Science.gov (United States)

    Zhang, Dongxu; Du, Guocheng; Chen, Jian

    2010-11-01

    Microbial catalase is an important industrial enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. This enzyme has great potential of application in food, textile and pharmaceutical industries. The production of microbial catalase has been significantly improved thanks to advances in bioprocess engineering and genetic engineering. In this paper, we review the progresses in fermentation production of microbial catalase and its application in textile industry. Among these progresses, we will highlight strain isolation, substrate and environment optimization, enzyme induction, construction of engineering strains and application process optimization. Meanwhile, we also address future research trends for microbial catalase production and its application in textile industry. Molecular modification (site-directed mutagenesis and directed revolution) will endue catalase with high pH and temperature stabilities. Improvement of catalase production, based on the understanding of induction mechanism and the process control of recombinant stain fermentation, will further accelerate the application of catalase in textile industry.

  14. Effect of TiO₂ nanoparticles on the structure and activity of catalase.

    Science.gov (United States)

    Zhang, Hong-Mei; Cao, Jian; Tang, Bo-Ping; Wang, Yan-Qing

    2014-08-05

    TiO₂ nanoparticles are the most widely used metal oxide nanoparticles and have oxidative toxicity. Catalase is an important antioxidant enzyme. Here the understanding of an effect of TiO₂ nanoparticles on the activity and structure of catalase is crucial to characterize the toxicity of TiO₂ nanoparticles. These experimental data revealed that TiO₂ nanoparticles could bind to catalase by the electrostatic and hydrogen bonding forces. On binding TiO₂ nanoparticles, catalase got destabilized with the decrease of α-helices content, the solvent polarity of environment around the fluorescence chromophores on catalase were also affected. In addition, TiO₂ nanoparticles also affected the activity of catalase. TiO₂ nanoparticles acted as an activator of catalase activity at a low molar concentration and as an inhibitor at a higher molar concentration. With regard to human health, the present study could provide a better understanding of the potential nanotoxicity of TiO₂ nanoparticles.

  15. Atypical refsum disease with pipecolic acidemia and abnormal catalase distribution.

    Science.gov (United States)

    Baumgartner, M R; Jansen, G A; Verhoeven, N M; Mooyer, P A; Jakobs, C; Roels, F; Espeel, M; Fourmaintraux, A; Bellet, H; Wanders, R J; Saudubray, J M

    2000-01-01

    We describe an 18-year-old patient with psychomotor retardation and abnormally short metatarsi and metacarpals but no other signs of classic Refsum disease. Molecular analysis of the phytanoyl-coenzyme A hydroxylase gene revealed a homozygous deletion causing a frameshift. Surprisingly, L-pipecolic acid was elevated in plasma, and microscopy of the liver showed a reduced number of peroxisomes per cell and a larger average peroxisome size. These abnormal peroxisomes lacked catalase as did peroxisomes in fibroblasts of this patient. Such generalized peroxisomal abnormalities are not present in classic Refsum disease.

  16. Plating isolation of various catalase-negative microorganisms from soil

    Science.gov (United States)

    Labeda, D. P.; Hunt, C. M.; Casida, L. E., Jr.

    1974-01-01

    A unique plating procedure was developed that allows isolation, but not enumeration, of representatives of the catalase-negative soil microflora. The numbers recovered, however, are low as compared to the numbers recovered when the modified dilution-to-extinction isolation procedure is used. The latter procedure provides prolonged inoculation in sealed tubes containing a nutritionally rich broth medium over small submerged agar slants. In contrast, the plating procedure utilizes nutritionally minimal media and the shorter incubations mandated by the inherent problems associated with plating.

  17. Plating isolation of various catalase-negative microorganisms from soil

    Science.gov (United States)

    Labeda, D. P.; Hunt, C. M.; Casida, L. E., Jr.

    1974-01-01

    A unique plating procedure was developed that allows isolation, but not enumeration, of representatives of the catalase-negative soil microflora. The numbers recovered, however, are low as compared to the numbers recovered when the modified dilution-to-extinction isolation procedure is used. The latter procedure provides prolonged inoculation in sealed tubes containing a nutritionally rich broth medium over small submerged agar slants. In contrast, the plating procedure utilizes nutritionally minimal media and the shorter incubations mandated by the inherent problems associated with plating.

  18. A new PANI biosensor based on catalase for cyanide determination.

    Science.gov (United States)

    Özcan, Hakkı Mevlüt; Aydin, Tuba

    2016-01-01

    Cyanide is one of the most widespread of compounds measured in environmental analysis due to their toxic effects on environment and health. We report a highly sensitive, reliable, selective amperometric sensor for determination of cyanide, using a polyaniline conductive polymer. The enzyme catalase was immobilized by electropolymerization. The steps during the immobilization were controlled by electrochemical impedance spectroscopy. Optimum pH, temperature, aniline concentration, enzyme concentration, and the number of scans obtained during electropolymerization, were investigated. In addition, the cyanide present in artificial waste water samples was determined. In the characterization studies of the biosensor, some parameters such as reproducibility and storage stability, were analyzed.

  19. Copulation Activity, Sperm Production and Conidia Transfer in Aedes aegypti Males Contaminated by Metarhizium anisopliae: A Biological Control Prospect.

    Science.gov (United States)

    Garza-Hernández, Javier A; Reyes-Villanueva, Filiberto; Russell, Tanya L; Braks, Marieta A H; Garcia-Munguia, Alberto M; Rodríguez-Pérez, Mario A

    2015-01-01

    Dengue is the most prevalent arboviral disease transmitted by Aedes aegypti worldwide, whose chemical control is difficult, expensive, and of inconsistent efficacy. Releases of Metarhizium anisopliae--exposed Ae. aegypti males to disseminate conidia among female mosquitoes by mating represents a promising biological control approach against this important vector. A better understanding of fungus virulence and impact on reproductive parameters of Ae. aegypti, is need before testing auto-dissemination strategies. Mortality, mating competitiveness, sperm production, and the capacity to auto-disseminate the fungus to females up to the 5 th copulation, were compared between Aedes aegypti males exposed to 5.96 x 10(7) conidia per cm2 of M. anisopliae and uninfected males. Half (50%) of fungus-exposed males (FEMs) died within the first 4 days post-exposure (PE). FEMs required 34% more time to successively copulate with 5 females (165 ± 3 minutes) than uninfected males (109 ± 3 minutes). Additionally, fungus infection reduced the sperm production by 87% at 5 days PE. Some beneficial impacts were observed, FEMs were able to successfully compete with uninfected males in cages, inseminating an equivalent number of females (about 25%). Under semi-field conditions, the ability of FEMs to search for and inseminate females was also equivalent to uninfected males (both inseminating about 40% females); but for the remaining females that were not inseminated, evidence of tarsal contact (transfer of fluorescent dust) was significantly greater in FEMs compared to controls. The estimated conidia load of a female exposed on the 5th copulation was 5,200 mL(-1) which was sufficient to cause mortality. Our study is the first to demonstrate auto-dissemination of M. anisopliae through transfer of fungus from males to female Ae. aegypti during mating under semi-field conditions. Our results suggest that auto-dissemination studies using releases of FEMs inside households could successfully

  20. Copulation Activity, Sperm Production and Conidia Transfer in Aedes aegypti Males Contaminated by Metarhizium anisopliae: A Biological Control Prospect.

    Directory of Open Access Journals (Sweden)

    Javier A Garza-Hernández

    Full Text Available Dengue is the most prevalent arboviral disease transmitted by Aedes aegypti worldwide, whose chemical control is difficult, expensive, and of inconsistent efficacy. Releases of Metarhizium anisopliae--exposed Ae. aegypti males to disseminate conidia among female mosquitoes by mating represents a promising biological control approach against this important vector. A better understanding of fungus virulence and impact on reproductive parameters of Ae. aegypti, is need before testing auto-dissemination strategies.Mortality, mating competitiveness, sperm production, and the capacity to auto-disseminate the fungus to females up to the 5 th copulation, were compared between Aedes aegypti males exposed to 5.96 x 10(7 conidia per cm2 of M. anisopliae and uninfected males. Half (50% of fungus-exposed males (FEMs died within the first 4 days post-exposure (PE. FEMs required 34% more time to successively copulate with 5 females (165 ± 3 minutes than uninfected males (109 ± 3 minutes. Additionally, fungus infection reduced the sperm production by 87% at 5 days PE. Some beneficial impacts were observed, FEMs were able to successfully compete with uninfected males in cages, inseminating an equivalent number of females (about 25%. Under semi-field conditions, the ability of FEMs to search for and inseminate females was also equivalent to uninfected males (both inseminating about 40% females; but for the remaining females that were not inseminated, evidence of tarsal contact (transfer of fluorescent dust was significantly greater in FEMs compared to controls. The estimated conidia load of a female exposed on the 5th copulation was 5,200 mL(-1 which was sufficient to cause mortality.Our study is the first to demonstrate auto-dissemination of M. anisopliae through transfer of fungus from males to female Ae. aegypti during mating under semi-field conditions. Our results suggest that auto-dissemination studies using releases of FEMs inside households could

  1. The Control Effect of Metarhizium anisopliae and Regent to Grasshopper%应用绿僵菌与锐劲特防治蝗虫的效果

    Institute of Scientific and Technical Information of China (English)

    董辉; 高松; 农向群; 丛斌; 张泽华

    2011-01-01

    The control test to grasshopper was conducted with oil-based suspension and bait of Metarhizium anisopliae and Regent. Investigation was taken by the methods of sample and sweeping. Results showed that the grasshopper began to die in the third day after oil-based suspension and bait of M. Anisopliae were applied. The mortality increased significantly in the 15th day, and the mortality exceeded 80% in the 50th day. The oil-based suspension of M. Anisopliae had better control effect on grasshopper than bait of M. Anisopliae. The insecticidal rate of the oil-based suspension of Regent was significantly higher than of the M. Anisopliae, but the persistence was significantly lower. The insecticidal rate and persistence of Regent bait were intermediate. In conclusion, the oil-based suspension of M. Anisopliae could be used as the preferred biological a-gents against grasshopper.%利用绿僵菌与锐劲特制备的油悬浮剂和饵剂在内蒙古草原进行了防治蝗虫试验.结果表明,利用样筐调查和扫网调查发现在施用绿僵菌油悬浮剂和饵剂后第三天蝗虫开始感病死亡,第15天死亡率显著增加,第50天死亡率超过80%,绿僵菌油悬浮剂具有比绿僵菌饵剂更好的防治效果;锐劲特油悬浮剂的杀虫速率显著高于绿僵菌,但持效性显著低于绿僵菌;锐劲特饵剂的杀虫速率和持效性居中.绿僵菌油悬浮剂可以作为防治草原蝗虫的首选生物制剂.

  2. Protease production during growth and autolysis of submerged Metarhizium anisopliae cultures Produção de protease durante o crescimento e análise de culturas submersas de Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Gilberto U.L. Braga

    1999-04-01

    Full Text Available The growth and autolysis of two strains of the entomopathogenic deuteromycete fungus Metarhizium anisopliae var. anisopliae were evaluated in medium containing casein or glucose as carbon source. Parameters such as economic coefficient and degree of autolysis were determined for each strain. Protease production was determined throughout the growth and autolysis phases of the cultures on medium under conditions of protease induction (in the presence of casein as sole source of carbon and nitrogen. The fungus was shown to utilize casein as a carbon/energy source in a more efficient manner than glucose. The autolysis shown by the strains was intense under both types of growth conditions, reaching up to 62.7% of the dry mass produced and started soon after the depletion of the exogenous carbon source. The relationship between the proteolytic activities of the two strains evaluated varied significantly (a maximum of 19.78 on the 5th day and a minimum of 2.03 on the 16th day of growth during the various growth and autolysis phases, clearly showing that the difference between the growth curves and the difference in the kinetics of enzyme production may decisively affect the process of strain selection for protease production.O crescimento e a autólise de duas linhagens do deuteromiceto entomopatogênico Metarhizium anisopliae var. anisopliae foram avaliados em meio contendo caseína ou glicose como fonte de carbono. Foram determinados parâmetros como o coeficiente econômico e o grau de autólise apresentado pelas linhagens. A produção de protease foi determinada durante todas as fases do crescimento e da autólise das culturas, em meio indutor da produção de proteases (meio contendo caseína como única fonte de carbono e de nitrogênio. Pôde-se verificar que o fungo foi capaz de utilizar a caseína como fonte de carbono/energia de maneira mais eficiente do que a glicose. A autólise apresentada pelas linhagens foi intensa em ambas as condi

  3. Experimental verification and molecular basis of active immunization against fungal pathogens in termites.

    Science.gov (United States)

    Liu, Long; Li, Ganghua; Sun, Pengdong; Lei, Chaoliang; Huang, Qiuying

    2015-10-13

    Termites are constantly exposed to many pathogens when they nest and forage in the field, so they employ various immune strategies to defend against pathogenic infections. Here, we demonstrate that the subterranean termite Reticulitermes chinensis employs active immunization to defend against the entomopathogen Metarhizium anisopliae. Our results showed that allogrooming frequency increased significantly between fungus-treated termites and their nestmates. Through active social contact, previously healthy nestmates only received small numbers of conidia from fungus-treated individuals. These nestmates experienced low-level fungal infections, resulting in low mortality and apparently improved antifungal defences. Moreover, infected nestmates promoted the activity of two antioxidant enzymes (SOD and CAT) and upregulated the expression of three immune genes (phenoloxidase, transferrin, and termicin). We found 20 differentially expressed proteins associated with active immunization in R. chinensis through iTRAQ proteomics, including 12 stress response proteins, six immune signalling proteins, and two immune effector molecules. Subsequently, two significantly upregulated (60S ribosomal protein L23 and isocitrate dehydrogenase) and three significantly downregulated (glutathione S-transferase D1, cuticle protein 19, and ubiquitin conjugating enzyme) candidate immune proteins were validated by MRM assays. These findings suggest that active immunization in termites may be regulated by different immune proteins.

  4. Screening of Metarhizium anisopliae (Metsch. Sorok. strains against Mahanarva fimbriolata (Stal, 1854 (Hemiptera: Cercopidae/ Seleção de isolados de Metarhizium anisopliae (Metsch. Sorok. a Mahanarva fimbriolata (Stal, 1854 (Hemiptera: Cercopidae

    Directory of Open Access Journals (Sweden)

    Solange Aparecida Vieira

    2006-06-01

    Full Text Available The mechanized harvest of sugarcane results in accumulation of mulch on the soil and promotes favorable temperature and moist to development of sugarcane root spittlebug, Mahanarva fimbriolata (Stal, 1854 (Hemiptera: Cercopidae. High populations of this pest causes serious damages to plants and high costs with insecticides. This research work tested strains of Metarhizium anisopliae (Metsch. Sorok. pathogenic to sugarcane root spittlebug using a new methodology. The selection was carried out in laboratory conditions. Nymphs were sprayed with 2 mL of a suspension containing 5x107 conidia/mL and maintained in roots of sugarcane. The corrected mortality was evaluated five days after pulverization and ranged from 10.5 to 60% and the more pathogenic strains caused mortality from 46.5 to 59.7%.A colheita mecanizada de cana-de-açúcar, sem a queima da palhada, proporciona acúmulo de matériaorgânica no solo tornando o ambiente favorável ao desenvolvimento da cigarrinha-da-raiz, Mahanarva fimbriolata (Stal, 1854 (Hemiptera: Cercopidae. Em elevadas infestações essa praga tem causado prejuízos devido aos grandes danos nas plantas e aos gastos com agrotóxicos. O objetivo da pesquisa foi selecionar isolados de Metarhizium anisopliae (Metsch. Sorok. patogênicos para cigarrinha-da-raiz, usando uma nova metodologia. A seleção foi feita em condições de laboratório, utilizando-se ninfas coletadas a campo que foram pulverizadas com o fungo e mantidas em raiz de mudas de cana-de-açúcar. A mortalidade corrigida ao quinto dia após a inoculação variou de 10,5 a 60%, sendo que os isolados mais patogênicos causaram mortalidades de 46,5 a 59,7%.

  5. Wood utilization is dependent on catalase activities in the filamentous fungus Podospora anserina.

    Science.gov (United States)

    Bourdais, Anne; Bidard, Frederique; Zickler, Denise; Berteaux-Lecellier, Veronique; Silar, Philippe; Espagne, Eric

    2012-01-01

    Catalases are enzymes that play critical roles in protecting cells against the toxic effects of hydrogen peroxide. They are implicated in various physiological and pathological conditions but some of their functions remain unclear. In order to decipher the role(s) of catalases during the life cycle of Podospora anserina, we analyzed the role of the four monofunctional catalases and one bifunctional catalase-peroxidase genes present in its genome. The five genes were deleted and the phenotypes of each single and all multiple mutants were investigated. Intriguingly, although the genes are differently expressed during the life cycle, catalase activity is dispensable during both vegetative growth and sexual reproduction in laboratory conditions. Catalases are also not essential for cellulose or fatty acid assimilation. In contrast, they are strictly required for efficient utilization of more complex biomass like wood shavings by allowing growth in the presence of lignin. The secreted CATB and cytosolic CAT2 are the major catalases implicated in peroxide resistance, while CAT2 is the major player during complex biomass assimilation. Our results suggest that P. anserina produces external H(2)O(2) to assimilate complex biomass and that catalases are necessary to protect the cells during this process. In addition, the phenotypes of strains lacking only one catalase gene suggest that a decrease of catalase activity improves the capacity of the fungus to degrade complex biomass.

  6. Wood utilization is dependent on catalase activities in the filamentous fungus Podospora anserina.

    Directory of Open Access Journals (Sweden)

    Anne Bourdais

    Full Text Available Catalases are enzymes that play critical roles in protecting cells against the toxic effects of hydrogen peroxide. They are implicated in various physiological and pathological conditions but some of their functions remain unclear. In order to decipher the role(s of catalases during the life cycle of Podospora anserina, we analyzed the role of the four monofunctional catalases and one bifunctional catalase-peroxidase genes present in its genome. The five genes were deleted and the phenotypes of each single and all multiple mutants were investigated. Intriguingly, although the genes are differently expressed during the life cycle, catalase activity is dispensable during both vegetative growth and sexual reproduction in laboratory conditions. Catalases are also not essential for cellulose or fatty acid assimilation. In contrast, they are strictly required for efficient utilization of more complex biomass like wood shavings by allowing growth in the presence of lignin. The secreted CATB and cytosolic CAT2 are the major catalases implicated in peroxide resistance, while CAT2 is the major player during complex biomass assimilation. Our results suggest that P. anserina produces external H(2O(2 to assimilate complex biomass and that catalases are necessary to protect the cells during this process. In addition, the phenotypes of strains lacking only one catalase gene suggest that a decrease of catalase activity improves the capacity of the fungus to degrade complex biomass.

  7. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus).

    Science.gov (United States)

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

    2015-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis.

  8. Identification of a catalase-phenol oxidase in betalain biosynthesis in red amaranth (Amaranthus cruentus

    Directory of Open Access Journals (Sweden)

    Xiao-Lu eTeng

    2016-01-01

    Full Text Available Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO, was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis.

  9. LESION SIMULATING DISEASE1 interacts with catalases to regulate hypersensitive cell death in Arabidopsis.

    Science.gov (United States)

    Li, Yansha; Chen, Lichao; Mu, Jinye; Zuo, Jianru

    2013-10-01

    LESION SIMULATING DISEASE1 (lsd1) is an important negative regulator of programmed cell death (PCD) in Arabidopsis (Arabidopsis thaliana). The loss-of-function mutations in lsd1 cause runaway cell death triggered by reactive oxygen species. lsd1 encodes a novel zinc finger protein with unknown biochemical activities. Here, we report the identification of CATALASE3 (CAT3) as an lsd1-interacting protein by affinity purification and mass spectrometry-based proteomic analysis. The Arabidopsis genome contains three homologous catalase genes (CAT1, CAT2, and CAT3). Yeast two-hybrid and coimmunoprecipitation analyses demonstrated that lsd1 interacted with all three catalases both in vitro and in vivo, and the interaction required the zinc fingers of lsd1. We found that the catalase enzymatic activity was reduced in the lsd1 mutant, indicating that the catalase enzyme activity was partially dependent on lsd1. Consistently, the lsd1 mutant was more sensitive to the catalase inhibitor 3-amino-1,2,4-triazole than the wild type, suggesting that the interaction between lsd1 and catalases is involved in the regulation of the reactive oxygen species generated in the peroxisome. Genetic studies revealed that lsd1 interacted with CATALASE genes to regulate light-dependent runaway cell death and hypersensitive-type cell death. Moreover, the accumulation of salicylic acid was required for PCD regulated by the interaction between lsd1 and catalases. These results suggest that the lsd1-catalase interaction plays an important role in regulating PCD in Arabidopsis.

  10. Purification and Characterization of Catalase from Marine Bacterium Acinetobacter sp. YS0810

    Directory of Open Access Journals (Sweden)

    Xinhua Fu

    2014-01-01

    Full Text Available The catalase from marine bacterium Acinetobacter sp. YS0810 (YS0810CAT was purified and characterized. Consecutive steps were used to achieve the purified enzyme as follows: ethanol precipitation, DEAE Sepharose ion exchange, Superdex 200 gel filtration, and Resource Q ion exchange. The active enzyme consisted of four identical subunits of 57.256 kDa. It showed a Soret peak at 405 nm, indicating the presence of iron protoporphyrin IX. The catalase was not apparently reduced by sodium dithionite but was inhibited by 3-amino-1,2,4-triazole, hydroxylamine hydrochloride, and sodium azide. Peroxidase-like activity was not found with the substrate o-phenylenediamine. So the catalase was determined to be a monofunctional catalase. N-terminal amino acid of the catalase analysis gave the sequence SQDPKKCPVTHLTTE, which showed high degree of homology with those of known catalases from bacteria. The analysis of amino acid sequence of the purified catalase by matrix-assisted laser desorption ionization time-of-flight mass spectrometry showed that it was a new catalase, in spite of its high homology with those of known catalases from other bacteria. The catalase showed high alkali stability and thermostability.

  11. Endothelin-1 stimulates catalase activity through the PKCδ-mediated phosphorylation of serine 167.

    Science.gov (United States)

    Rafikov, Ruslan; Kumar, Sanjiv; Aggarwal, Saurabh; Hou, Yali; Kangath, Archana; Pardo, Daniel; Fineman, Jeffrey R; Black, Stephen M

    2014-02-01

    Our previous studies have shown that endothelin-1 (ET-1) stimulates catalase activity in endothelial cells and in lambs with acute increases in pulmonary blood flow (PBF), without altering gene expression. The purpose of this study was to investigate the molecular mechanism by which this occurs. Exposing pulmonary arterial endothelial cells to ET-1 increased catalase activity and decreased cellular hydrogen peroxide (H2O2) levels. These changes correlated with an increase in serine-phosphorylated catalase. Using the inhibitory peptide δV1.1, this phosphorylation was shown to be protein kinase Cδ (PKCδ) dependent. Mass spectrometry identified serine 167 as the phosphorylation site. Site-directed mutagenesis was used to generate a phospho-mimic (S167D) catalase. Activity assays using recombinant protein purified from Escherichia coli or transiently transfected COS-7 cells demonstrated that S167D catalase had an increased ability to degrade H2O2 compared to the wild-type enzyme. Using a phospho-specific antibody, we were able to verify that pS167 catalase levels are modulated in lambs with acute increases in PBF in the presence and absence of the ET receptor antagonist tezosentan. S167 is located on the dimeric interface, suggesting it could be involved in regulating the formation of catalase tetramers. To evaluate this possibility we utilized analytical gel filtration to examine the multimeric structure of recombinant wild-type and S167D catalase. We found that recombinant wild-type catalase was present as a mixture of monomers and dimers, whereas S167D catalase was primarily tetrameric. Further, the incubation of wild-type catalase with PKCδ was sufficient to convert wild-type catalase into a tetrameric structure. In conclusion, this is the first report indicating that the phosphorylation of catalase regulates its multimeric structure and activity.

  12. Potential of Metarrhizium anisopliae and Beauveria bassiana isolates and Neem oil to control the aphid Lipaphis erysimi (Kalt.) (Hemiptera: Aphididae); Potencial de isolados de Metarhizium anisopliae e Beauveria bassiana e do oleo de Nim no controle do pulgao Lipaphis erysimi (Kalt.) (Hemiptera: Aphididae)

    Energy Technology Data Exchange (ETDEWEB)

    Araujo Junior, Jose M. de; Marques, Edmilson J.; Oliveira, Jose V. de [Universidade Federal Rural de Pernambuco (UFRPE), Recife, PE (Brazil). Dept. de Agronomia - Entomologia], e-mail: jma_junior@yahoo.com.br, e-mail: emar@depa.ufrpe.br, e-mail: vargasoliveira@uol.com.br

    2009-07-15

    This work aimed to determine the efficiency of the entomopathogenic fungi Metarrhizium anisopliae and Beauveria bassiana to control the aphid Lipaphis erysimi (Kalt.) (Hemiptera:Aphididae) in kale Brassica oleracea var acephala D.C., as well as their compatibility with a neem oil formulation (Neemseto{sup R}). Ten isolates of both fungi were tested and the most pathogenic ones were B. bassiana CG001 and M. anisopliae CG30 with 90% and 4.4 days, and 64% and 3.8 days of mortality and median lethal time, respectively. Bioassays with neem at concentrations of 0.5, 1.0 and 2.0% were done either by leaf discs dipping or spraying the aphids on the leaf discs. The neem spraying treatment at 2.0% provided 90% mortality. The use of B. bassiana isolate CG001 or M. anisopliae isolate CG30 with neem at 0.125, 0.25, and 0.5%, demonstrated that these isolates could have their spore viability or colony growth affected when exposed to neem concentrations higher than 0.25%. In absolute values, the isolates B. bassiana CG001 and M. anisopliae CG30 are the most virulent to L. erysimi, and could be utilized in the management of this pest. (author)

  13. Susceptibilidade de larvas de Cerotoma arcuata Olivier (Coleoptera: Chrysomelidae a Beauveria bassiana (Bals. Vuillemin, Metarhizium anisopliae (Metsch. Sorokin e Bacillus thuringiensis Berliner Susceptibility of Cerotoma arcuata Olivier (Coleoptera: Chrysomelidae larvae to Beauveria bassiana (Bals. Vuillemin, Metarhizium anisopliae (Metsch. Sorokin and Bacillus thuringiensis Berliner

    Directory of Open Access Journals (Sweden)

    Maria Lucia França Teixeira

    2007-02-01

    Full Text Available Larvas de 2° instar de Cerotoma arcuata foram avaliadas em relação à susceptibilidade aos fungos entomopatogênicos Beauveria bassiana, Metarhizium anisopliae e a bactéria Bacillus thuringiensis com as toxinas Cry3. Os insetos adultos foram mantidos em gaiolas e alimentados com plântulas de feijão (Phaseolus vulgaris L. e as larvas em "gerbox" com cotilédones de plântulas de feijão recém-germinadas. Das oito estirpes de B. bassiana avaliadas, CG 156 e CG 213 causaram 100% de mortalidade das larvas, as duas estirpes de M. anisopliae CG 210 e CG 321 foram patogênicas, eliminando 80 e 100% das larvas de C. arcuata, e, das cinco estirpes de B. thuringiensis testadas, o isolado CG 940 causou 70% de mortalidade das larvas.Second instar larvae of Cerotoma arcuata were evaluated concerning the susceptibility to fungi Beauveria bassiana and Metarhizium anisopliae and Bacillus thuringiensis strains containing Cry3 toxin. Adults of C. arcuata were kept in large cages and fed on bean seedlings and the larvae were reared in ‘gearbox’ feeding on germinated Phaseolus bean cotyledons. Strains CG 156 and CG 213 of B. bassiana killed 100% of the insect larvae and strains CG 210 and CG 321 of M. anisopliae killed 80 and 100% of the insect larvae. Strain CG 940 of B. thuringiensis killed 70% of the insect larvae.

  14. A gasometric method to determine erythrocyte catalase activity

    Directory of Open Access Journals (Sweden)

    A.J.S. Siqueira

    1999-09-01

    Full Text Available We describe a new gasometric method to determine erythrocyte catalase activity by the measurement of the volume of oxygen produced as a result of hydrogen peroxide decomposition in a system where enzyme and substrate are separated in a special reaction test tube connected to a manometer and the reagents are mixed with a motor-driven stirrer. The position of the reagents in the test tube permits the continuous measurement of oxygen evolution from the time of mixing, without the need to stop the reaction by the addition of acid after each incubation time. The enzyme activity is reported as KHb, i.e., mg hydrogen peroxide decomposed per second per gram of hemoglobin (s-1 g Hb-1. The value obtained for catalase activity in 28 samples of hemolyzed human blood was 94.4 ± 6.17 mg H2O2 s-1 g Hb-1. The results obtained were precise and consistent, indicating that this rapid, simple and inexpensive method could be useful for research and routine work.

  15. Real encoded genetic algorithm and response surface methodology to optimize production of an indolizidine alkaloid, swainsonine, from Metarhizium anisopliae.

    Science.gov (United States)

    Singh, Digar; Kaur, Gurvinder

    2013-09-01

    Response surface methodology (RSM) and artificial neural network-real encoded genetic algorithm (ANN-REGA) were employed to develop a process for fermentative swainsonine production from Metarhizium anisopliae (ARSEF 1724). The effect of finally screened process variables viz. inoculum size, oatmeal extract, glucose, and CaCl2 were investigated through central composite design and were further utilized for training sets in ANN with training and test R values of 0.99 and 0.94, respectively. ANN-REGA was finally employed to simulate the predictive swainsonine production with best evolved media composition. ANN-REGA predicted a more precise fermentation model with 103 % (shake flask) increase in alkaloid production compared to 75.62 % (shake flask) obtained with RSM model upon validation.

  16. Vectorial capacity of Aedes aegypti for dengue virus type 2 is reduced with co-infection of Metarhizium anisopliae.

    Directory of Open Access Journals (Sweden)

    Javier A Garza-Hernández

    Full Text Available BACKGROUND: Aedes aegypti, is the major dengue vector and a worldwide public health threat combated basically by chemical insecticides. In this study, the vectorial competence of Ae. aegypti co-infected with a mildly virulent Metarhizium anisopliae and fed with blood infected with the DENV-2 virus, was examined. METHODOLOGY/PRINCIPAL FINDINGS: The study encompassed three bioassays (B. In B1 the median lethal time (LT50 of Ae. aegypti exposed to M. anisopliae was determined in four treatments: co-infected (CI, single-fungus infection (SF, single-virus infection (SV and control (C. In B2, the mortality and viral infection rate in midgut and in head were registered in fifty females of CI and in SV. In B3, the same treatments as in B1 but with females separated individually were tested to evaluate the effect on fecundity and gonotrophic cycle length. Survival in CI and SF females was 70% shorter than the one of those in SV and control. Overall viral infection rate in CI and SV were 76 and 84% but the mortality at day six post-infection was 78% (54% infected and 6% respectively. Survivors with virus in head at day seven post-infection were 12 and 64% in both CI and SV mosquitoes. Fecundity and gonotrophic cycle length were reduced in 52 and 40% in CI compared to the ones in control. CONCLUSION/SIGNIFICANCE: Fungus-induced mortality for the CI group was 78%. Of the survivors, 12% (6/50 could potentially transmit DENV-2, as opposed to 64% (32/50 of the SV group, meaning a 5-fold reduction in the number of infective mosquitoes. This is the first report on a fungus that reduces the vectorial capacity of Ae. aegypti infected with the DENV-2 virus.

  17. The Adh1 gene of the fungus Metarhizium anisopliae is expressed during insect colonization and required for full virulence.

    Science.gov (United States)

    Callejas-Negrete, Olga Alicia; Torres-Guzmán, Juan Carlos; Padilla-Guerrero, Israel Enrique; Esquivel-Naranjo, Ulises; Padilla-Ballesteros, Maria Fernanda; García-Tapia, Adriana; Schrank, Augusto; Salazar-Solís, Eduardo; Gutiérrez-Corona, Félix; González-Hernández, Gloria Angélica

    2015-03-01

    Zymography of alcohol dehydrogenase (ADH) activity in the entomopathogenic fungus Metarhizium anisopliae grown under various conditions revealed that micro-aerobic growth was associated with increased ADH activity. The major ADH protein, AdhIp, was purified to homogeneity by affinity chromatography and has an estimated molecular weight of 41kDa and an isoelectric point (pI) of 6.4. Peptide mass fingerprint analysis allowed the identification and cloning of the gene that encodes this protein, Adh1, as annotated in the M. anisopliae genome database. AdhIp is related to the medium-chain dehydrogenase/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family and contains conserved ADH sequence motifs, such as the zinc-containing ADH signature, the FAD/NAD binding domain and amino acid residues that are conserved in most microbial ADHs. Semi-quantitative RT-PCR analysis revealed that Adh1 gene expression occurs at low levels during early Plutella xylostella infection and that the Adh1 gene was primarily expressed at larval death and as mycelia emerge from the insect cuticle before conidiation. Antisense-RNA experiments indicated that NAD(+)-dependent ADH activity was diminished by 20-75% in the transformants, and the transformants that had lower ADH activity showed allyl alcohol resistance, which indicates that reduction in ADH activity also occurs in vivo. Bioassays performed using antisense adh1 transformants, which have lower ADH activity, showed that LC50 values were two to five times higher than the wild-type, indicating that AdhIp is required for full capability of the fungus to penetrate and/or colonize the insect.

  18. Laboratory Bioassay of Iranian Isolates of Entomopathogenic Fungus Metarhizium anisopliae (Metsch. Sorokin (Ascomycota: Hypocreales against two Species of Storage Pest

    Directory of Open Access Journals (Sweden)

    Hamid Sakenin Chelav

    2013-03-01

    Full Text Available The susceptibility of adults of Tribolium castaneum Herbst (Coleoptera: Tenebrionidae and Oryzaephilus surinamensis L. (Coleoptera: Silvanidae to three Iranian Isolates of the entomopathogenic fungi Metarhizium anisopliae (Metsch. Sorokin was evaluated through bioassays with direct immersion under laboratory conditions. For each isolates, five aqueous suspensions were prepared in a logarithmic series in Tween 80 (0.05% v/v. Results showed that adult of both species were susceptible to all isolates of M. anisopliae. For all three isolates, mortality percentage of the two species increased with increasing conidial concentration and significant difference was observed between concentrations. The corrected cumulative mortality of adult of O. surinamensis 10 days after immersion ranged from 12.38 to 85.84%, 18.6 to 62.83% and 10.63 to 77.87% for different concentrations of DEMI001, IRAN 715C and IRAN 1018C, respectively. These amounts for T. castaneum varied from 31.07 to 74.78%, 26.02 to 75.61% and 23.33 to 89.99% for different concentrations of DEMI001, IRAN 715C and IRAN 1018C, respectively. The parameters of probit analysis demonstrated non-overlap of 95% confidence limits of LC50 and LC95 and significant difference was observed among three isolates tested against each insect. The lowest and the highest LC50 and LC95 values were observed in the isolates DEMI001 for O. surinamensis (3/1×105 and 1/5×108 and IRAN 715C for T. castaneum (6.2×108 and 6.9×1014, respectively. This observation highlights the importance and need of screening for more virulent isolates against storage pests for use in the management of these pests.

  19. Hospitalized Patients and Fungal Infections

    Science.gov (United States)

    ... These types of infections are called healthcare-associated infections (HAIs). Hospital staff and healthcare providers do everything they can ... IV tube) can increase your risk for fungal infection. During your hospital stay you may need a central venous catheter, ...

  20. Fungal genomics beyond Saccharomyces cerevisiae?

    DEFF Research Database (Denmark)

    Hofmann, Gerald; Mcintyre, Mhairi; Nielsen, Jens

    2003-01-01

    Fungi are used extensively in both fundamental research and industrial applications. Saccharomyces cerevisiae has been the model organism for fungal research for many years, particularly in functional genomics. However, considering the diversity within the fungal kingdom, it is obvious that the a......Fungi are used extensively in both fundamental research and industrial applications. Saccharomyces cerevisiae has been the model organism for fungal research for many years, particularly in functional genomics. However, considering the diversity within the fungal kingdom, it is obvious...... that the application of the existing methods of genome, transcriptome, proteome and metabolome analysis to other fungi has enormous potential, especially for the production of food and food ingredients. The developments in the past year demonstrate that we have only just started to exploit this potential....

  1. A chaperone function of NO CATALASE ACTIVITY1 is required to maintain catalase activity and for multiple stress responses in Arabidopsis.

    Science.gov (United States)

    Li, Jing; Liu, Juntao; Wang, Guoqiang; Cha, Joon-Yung; Li, Guannan; Chen, She; Li, Zhen; Guo, Jinghua; Zhang, Caiguo; Yang, Yongqing; Kim, Woe-Yeon; Yun, Dae-Jin; Schumaker, Karen S; Chen, Zhongzhou; Guo, Yan

    2015-03-01

    Catalases are key regulators of reactive oxygen species homeostasis in plant cells. However, the regulation of catalase activity is not well understood. In this study, we isolated an Arabidopsis thaliana mutant, no catalase activity1-3 (nca1-3) that is hypersensitive to many abiotic stress treatments. The mutated gene was identified by map-based cloning as NCA1, which encodes a protein containing an N-terminal RING-finger domain and a C-terminal tetratricopeptide repeat-like helical domain. NCA1 interacts with and increases catalase activity maximally in a 240-kD complex in planta. In vitro, NCA1 interacts with CATALASE2 (CAT2) in a 1:1 molar ratio, and the NCA1 C terminus is essential for this interaction. CAT2 activity increased 10-fold in the presence of NCA1, and zinc ion binding of the NCA1 N terminus is required for this increase. NCA1 has chaperone protein activity that may maintain the folding of catalase in a functional state. NCA1 is a cytosol-located protein. Expression of NCA1 in the mitochondrion of the nca1-3 mutant does not rescue the abiotic stress phenotypes of the mutant, while expression in the cytosol or peroxisome does. Our results suggest that NCA1 is essential for catalase activity.

  2. Potential of Metarhizium anisopliae (Metsch. Sorokin (Ascomycetes, hypocreales in the control of Bonagota salubricola (Meyrick (Lepidoptera, Tortricidae and its compatibility with chemical insecticides

    Directory of Open Access Journals (Sweden)

    FA. Anhalt

    Full Text Available Several insects are harmful to apples grown in Brazil, especially the leafroller Bonagota salubricola (Lepidoptera, Tortricidae, usually controlled with chemical insecticides. The purpose of the present study was to investigate the use of Metarhizium anisopliae strains in the control of the apple leafroller, by assessing their virulence to B. salubricola larvae in bioassays with suspensions of 2 x 10(5 to 2 x 10(9 conidia/mL as well as their relationship with protease expression. The most effective strain underwent a compatibility test with chemical insecticides. The M. anisopliae E6 strain showed a good performance, with up to 88% mortality and a LT50 of 1.66 days. The virulence was positively correlated with a higher enzymatic activity. The E6 strain was compatible with tebufenozide, evidencing its potential to control B. salubricola.

  3. Evaluating the virulence of Metarhizium anisopliae (Deuteromycotina: Hyphomycetes and Beauveria bassiana (Ascomycota: Hypocreales isolates to Arabian rhinoceros beetle, Oryctes agamemnon arabicus

    Directory of Open Access Journals (Sweden)

    M.W. Khudhair

    2015-12-01

    Full Text Available Virulence of entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana were tested against Arabian Rhinoceros Beetle, Oryctes agamemnon arabicus larvae. Four concentrations (1×105, 1×107, 1×109 and 1×1011 conidia/mL–1 of two locally isolated entomopathogenic fungi spore suspensions were used in this study via larval direct spraying. Results revealed that both isolates can cause high mortality rate reaching 100% after 29 days. However, Beauveria bassiana scored higher mortality rate in short time especially at the concentration of 1×1011 conidia/ mL–1 with lethal time (LT50 12.75 and LT90 20.00; while, Metarhizium anisopliae caused the higher percentage of malformed adults. Moreover, both isolates affected insect’s life cycle particularly in the pupal stage which was reduced remarkably by almost 50% in comparison with the control treatment.

  4. Comperative study of catalase immobilization on chitosan, magnetic chitosan and chitosan-clay composite beads.

    Science.gov (United States)

    Başak, Esra; Aydemir, Tülin; Dinçer, Ayşe; Becerik, Seda Çınar

    2013-12-01

    Catalase was immobilized on chitosan and modified chitosan. Studies were carried out on free-immobilized catalase concerning the determination of optimum temperature, pH, thermal, storage stability, reusability, and kinetic parameters. Optimum temperature and pH for free catalase and catalase immobilized were found as 35°C and 7.0, respectively. After 100 times of repeated tests, the immobilized catalases on chitosan-clay and magnetic chitosan maintain over 50% and 60% of the original activity, respectively. The ease of catalase immobilization on low-cost matrices and good stability upon immobilization in the present study make it a suitable product for further use in the food industry.

  5. Roles of Catalase and Trehalose in the Protection from Hydrogen Peroxide Toxicity in Saccharomyces cerevisiae.

    Science.gov (United States)

    Nishimoto, Takuto; Watanabe, Takeru; Furuta, Masakazu; Kataoka, Michihiko; Kishida, Masao

    2016-01-01

    The roles of catalase and trehalose in Saccharomyces cerevisiae subject to hydrogen peroxide (H2O2) treatment were examined by measuring the catalase activity and intracellular trehalose levels in mutants lacking catalase or trehalose synthetase. Intracellular trehalose was elevated but the survival rate after H2O2 treatment remained low in mutants with deletion of the Catalase T gene. On the other hand, deletion of the trehalose synthetase gene increased the catalase activity in mutated yeast to levels higher than those in the wild-type strain, and these mutants exhibited some degree of tolerance to H2O2 treatment. These results suggest that Catalase T is critical in the yeast response to oxidative damage caused by H2O2 treatment, but trehalose also plays a role in protection against H2O2 treatment.

  6. Fungal microbiota dysbiosis in IBD

    Science.gov (United States)

    Sokol, Harry; Leducq, Valentin; Aschard, Hugues; Pham, Hang-Phuong; Jegou, Sarah; Landman, Cecilia; Cohen, David; Liguori, Giuseppina; Bourrier, Anne; Nion-Larmurier, Isabelle; Cosnes, Jacques; Seksik, Philippe; Langella, Philippe; Skurnik, David; Richard, Mathias L; Beaugerie, Laurent

    2017-01-01

    Objective The bacterial intestinal microbiota plays major roles in human physiology and IBDs. Although some data suggest a role of the fungal microbiota in IBD pathogenesis, the available data are scarce. The aim of our study was to characterise the faecal fungal microbiota in patients with IBD. Design Bacterial and fungal composition of the faecal microbiota of 235 patients with IBD and 38 healthy subjects (HS) was determined using 16S and ITS2 sequencing, respectively. The obtained sequences were analysed using the Qiime pipeline to assess composition and diversity. Bacterial and fungal taxa associated with clinical parameters were identified using multivariate association with linear models. Correlation between bacterial and fungal microbiota was investigated using Spearman's test and distance correlation. Results We observed that fungal microbiota is skewed in IBD, with an increased Basidiomycota/Ascomycota ratio, a decreased proportion of Saccharomyces cerevisiae and an increased proportion of Candida albicans compared with HS. We also identified disease-specific alterations in diversity, indicating that a Crohn's disease-specific gut environment may favour fungi at the expense of bacteria. The concomitant analysis of bacterial and fungal microbiota showed a dense and homogenous correlation network in HS but a dramatically unbalanced network in IBD, suggesting the existence of disease-specific inter-kingdom alterations. Conclusions Besides bacterial dysbiosis, our study identifies a distinct fungal microbiota dysbiosis in IBD characterised by alterations in biodiversity and composition. Moreover, we unravel here disease-specific inter-kingdom network alterations in IBD, suggesting that, beyond bacteria, fungi might also play a role in IBD pathogenesis. PMID:26843508

  7. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  8. 绿僵菌防治蛴螬的应用研究进展%Research progress in application of Metarhizium anisopliae against white grubs

    Institute of Scientific and Technical Information of China (English)

    于永浩; 龙秀珍; 曾宪儒; 韦德卫; 曾涛

    2013-01-01

    White grub is an important global underground pest, which could be effectively controlled by Metarhizium anisopliae, a crucial entomopathogenic fungus for effective insect pest control. This paper reviewed the domestic and international researches on Metarhizium anisopliae control against white grubs and the development and application status of Metarhizium anisopliae commercial formulation; at the same time, this paper also discussed the influences of temperature, humidity, ultraviolet radiation, and other environmental factors on the effects of Metarhiziutn anisopliae on white grubs control. In conclusion, this research report pointed out studies on AIDS screening, R&D mixture preparation, strain degradation mechanism, and soil antibacterial action in order to provide research focuses and directions for Metarhizium anisoplian control against white grubs.%蛴螬是重要的世界性地下害虫,绿僵菌是防治害虫的重要昆虫病原真菌,对蛴螬有良好的防治效果.文章综述了国内外对绿僵菌防治蛴螬的研究报道及商品制剂的研制和应用现状,讨论了温湿度和紫外线等环境因素对绿僵菌防治蛴螬效果的影响;指出助剂的筛选、混合制剂的研发、菌株退化机理和土壤抑菌作用的研究等是绿僵菌防治蛴螬的研究热点和方向.

  9. Successful Treatment of Fungal Osteomyelitis with Voriconazole in a Patient with CGD

    Directory of Open Access Journals (Sweden)

    Mahsa Oaji

    2010-12-01

    Full Text Available Background:Chronic granulomatous disease (CGD is an immunodeficiency affecting phagocytic leukocytes. Defective respiratory burst mechanism renders the affected patients to be susceptible to catalase positive microorganisms. With the great successes in antibacterial prophylaxis and therapy, fungal infections are a persistent problem. Invasive aspergillosis is the most important cause of mortality in CGD. Case Presentation: We describe a nine year-old boy with CGD who presented with aspergillus induced skull osteomyelitis. He was successfully treated with voriconazole after initial failure of amphotericin B therapy. Conclusion: Currently, newer triazoles are recommended as initial therapy for invasive aspergillosis in immunodeficiency states such as CGD.

  10. Stimulation of KatG catalase activity by peroxidatic electron donors.

    Science.gov (United States)

    Ndontsa, Elizabeth N; Moore, Robert L; Goodwin, Douglas C

    2012-09-15

    Catalase-peroxidases (KatGs) use a peroxidase scaffold to support robust catalase activity, an ability no other member of its superfamily possesses. Because catalase turnover requires H(2)O(2) oxidation, whereas peroxidase turnover requires oxidation of an exogenous electron donor, it has been anticipated that the latter should inhibit catalase activity. To the contrary, we report peroxidatic electron donors stimulated catalase activity up to 14-fold, particularly under conditions favorable to peroxidase activity (i.e., acidic pH and low H(2)O(2) concentrations). We observed a "low-" and "high-K(M)" component for catalase activity at pH 5.0. Electron donors increased the apparent k(cat) for the "low-K(M)" component. During stimulated catalase activity, less than 0.008 equivalents of oxidized donor accumulated for every H(2)O(2) consumed. Several classical peroxidatic electron donors were effective stimulators of catalase activity, but pyrogallol and ascorbate showed little effect. Stopped-flow evaluation showed that a Fe(III)-O(2)(·-)-like intermediate dominated during donor-stimulated catalatic turnover, and this intermediate converted directly to the ferric state upon depletion of H(2)O(2). In this respect, the Fe(III)-O(2)(·-) -like species was more prominent and persistent than in the absence of the donor. These results point toward a much more central role for peroxidase substrates in the unusual catalase mechanism of KatG.

  11. Extracellular localization of catalase is associated with the transformed state of malignant cells.

    Science.gov (United States)

    Böhm, Britta; Heinzelmann, Sonja; Motz, Manfred; Bauer, Georg

    2015-12-01

    Oncogenic transformation is dependent on activated membrane-associated NADPH oxidase (NOX). However, the resultant extracellular superoxide anions are also driving the NO/peroxynitrite and the HOCl pathway, which eliminates NOX-expressing transformed cells through selective apoptosis induction. Tumor progression is dependent on dominant interference with intercellular apoptosis-inducing ROS signaling through membrane-associated catalase, which decomposes H2O2 and peroxynitrite and oxidizes NO. Particularly, the decomposition of extracellular peroxynitrite strictly requires membrane-associated catalase. We utilized small interfering RNA (siRNA)-mediated knockdown of catalase and neutralizing antibodies directed against the enzyme in combination with challenging H2O2 or peroxynitrite to determine activity and localization of catalase in cells from three distinct steps of multistage oncogenesis. Nontransformed cells did not generate extracellular superoxide anions and only showed intracellular catalase activity. Transformed cells showed superoxide anion-dependent intercellular apoptosis-inducing ROS signaling in the presence of suboptimal catalase activity in their membrane. Tumor cells exhibited tight control of intercellular apoptosis-inducing ROS signaling through a high local concentration of membrane-associated catalase. These data demonstrate that translocation of catalase to the outside of the cell membrane is already associated with the transformation step. A strong local increase in the concentration of membrane-associated catalase is achieved during tumor progression and is controlled by tumor cell-derived H2O2 and by transglutaminase.

  12. Sublethal effect of concentrations of Metarhizium anisopliae (Metsch.) Sorok on the larval stage and immunologic characteristics of Diatraea flavipennella (BOX) (Lepidoptera: Crambidae).

    Science.gov (United States)

    Guimarães, Jennifer; Marques, Edmilson J; Wanderley-Teixeira, Valéria; De Albuquerque, Auristela C; Dos Passos, Eliana M; Silva, Cínthia C M; Teixeira, Álvaro A C

    2014-12-01

    This work aimed to evaluate the effects of Metarhizium anisopliae on Diatraea flavipennella and investigate their immune response. Was observed the effect of M. anisopliae against larvae of D. flavipennella sprayed at concentrations of 103, 104, 105 conidia / mL, in which showed differences relative the larval period, extending up to 72.0 days in treatment and 25.0 days in the control. The results for hemocytes revealed that the most frequent cells when sprayed at the concentrations of 103, 105, 107 conidia / mL were the prohemocytes, spherulocytes, plasmatocytes and granulocytes in relation to adipohemocytes and oenocytoids. The level of nitric oxide was different between the control and the concentration 107 spores / mL (24), while the activity of phenoloxidase was similar among treatments in 24 and higher concentration 107 spores / mL (60h). In biochemical profile of hemocytes was a change in carbohydrates, lipids and proteins in response to the fungus. The results indicate that the fungus M. anisopliae can be used in the Integrated Management of D. flavipennella by presenting pathogenicity and interfere with their development even when exposed to small concentrations.

  13. Selection of Beauveria bassiana sensu lato and Metarhizium anisopliae sensu lato isolates as microbial control agents against the boll weevil (Anthonomus grandis) in Argentina.

    Science.gov (United States)

    Nussenbaum, A L; Lecuona, R E

    2012-05-01

    The boll weevil (Anthonomus grandis) is the main pest of cotton in the Americas. The aim of this work was to evaluate isolates of the entomopathogenic fungi Beauveria bassiana sensu lato and Metarhizium anisopliae sensu lato virulent against A. grandis. Screening was performed to evaluate the pathogenicity of 28 isolates of M. anisopliae s.l. and 66 isolates of B. bassiana s.l. against boll weevil adults. To select the isolates, LC(50) values of the most virulent isolates were calculated, and compatibility between the fungi and insecticides was studied. In addition, the effects of these isolates on the feeding behavior of the adults were evaluated. Isolates Ma 50 and Ma 20 were the most virulent against A. grandis and their LC(50) values were 1.13×10(7) and 1.20×10(7) conidia/ml, respectively. In addition, these isolates were compatible with pyrethroid insecticides, but none with endosulfan. On the other hand, infected females reduced the damage caused by feeding on the cotton squares and their weight gain. This shows that entomopathogenic fungi cause mortality in the insects, but also these fungi could influence the feeding behavior of the females. In summary, these results indicate the possibility of the use of M. anisopliae s.l. as a microbiological control agent against boll weevils. Also, this species could be included in an Integrated Pest Management program.

  14. Sublethal effect of concentrations of Metarhizium anisopliae (metsch. sorok on the larval stage and immunologic characteristics of Diatraea flavipennella (box (lepidoptera: crambidae

    Directory of Open Access Journals (Sweden)

    JENNIFER GUIMARÃES

    2014-12-01

    Full Text Available This work aimed to evaluate the effects of Metarhizium anisopliae on Diatraea flavipennella and investigate their immune response. Was observed the effect of M. anisopliae against larvae of D. flavipennella sprayed at concentrations of 103, 104, 105 conidia / mL, in which showed differences relative the larval period, extending up to 72.0 days in treatment and 25.0 days in the control. The results for hemocytes revealed that the most frequent cells when sprayed at the concentrations of 103, 105, 107 conidia / mL were the prohemocytes, spherulocytes, plasmatocytes and granulocytes in relation to adipohemocytes and oenocytoids. The level of nitric oxide was different between the control and the concentration 107 spores / mL (24, while the activity of phenoloxidase was similar among treatments in 24 and higher concentration 107 spores / mL (60h. In biochemical profile of hemocytes was a change in carbohydrates, lipids and proteins in response to the fungus. The results indicate that the fungus M. anisopliae can be used in the Integrated Management of D. flavipennella by presenting pathogenicity and interfere with their development even when exposed to small concentrations.

  15. Differential expression of the pr1A gene in Metarhizium anisopliae and Metarhizium acridum across different culture conditions and during pathogenesis

    Directory of Open Access Journals (Sweden)

    Mariele Porto Carneiro Leão

    2015-03-01

    Full Text Available The entomopathogenic fungi of the genus Metarhizium have several subtilisin-like proteases that are involved in pathogenesis and these have been used to investigate genes that are differentially expressed in response to different growth conditions. The identification and characterization of these proteases can provide insight into how the fungus is capable of infecting a wide variety of insects and adapt to different substrates. In addition, the pr1A gene has been used for the genetic improvement of strains used in pest control. In this study we used quantitative RT-PCR to assess the relative expression levels of the pr1A gene in M. anisopliae and M. acridum during growth in different culture conditions and during infection of the sugar cane borer, Diatraea saccharalis Fabricius. We also carried out a pathogenicity test to assess the virulence of both species against D. saccharalis and correlated the results with the pattern of pr1A gene expression. This analysis revealed that, in both species, the pr1A gene was differentially expressed under the growth conditions studied and during the pathogenic process. M. anisopliae showed higher expression of pr1A in all conditions examined, when compared to M. acridum. Furthermore, M. anisopliae showed a greater potential to control D. saccharalis. Taken together, our results suggest that these species have developed different strategies to adapt to different growing conditions.

  16. Superoxide Dismutase and Catalase Genotypes in Pediatric Migraine Patients.

    Science.gov (United States)

    Saygi, Semra; Erol, İlknur; Alehan, Füsun; Yalçın, Yaprak Yılmaz; Kubat, Gözde; Ataç, Fatma Belgin

    2015-10-01

    This study compared superoxide dismutase (SOD) and catalase (CAT) alleles in 97 consecutive children and adolescents with migraine to 96 healthy children and adolescents. Isolated genomic DNA was used as a template for SOD1 (35 A/C), SOD2 16 C/T, and CAT2 [(-262 C/T) and (-21 A/T)] allele genotyping. The SOD2 16 C/T genotype and C allele frequency differed significantly between controls and migraine (P = .047; P = .038). CAT -21 AA genotype and A allele frequency were significantly higher in both migraine with aura patients (P = .013; P = .004) and migraine without aura patients (P = .003; P = .001) compared to controls. To our knowledge, this is the first demonstration of differences in SOD and CAT genotypes between pediatric migraine patients and age-matched controls. Further studies on the functional implications of these genetic variants on neural antioxidant capacity and the use of antioxidant modulators for migraine treatment are warranted.

  17. Study of catalase electrode for organic peroxides assays.

    Science.gov (United States)

    Horozova, Elena; Dimcheva, Nina; Jordanova, Zinaida

    2002-12-01

    The catalytic activity of immobilized catalase (EC 1.11.1.6) for two model peroxide compounds (dibenzoyl peroxide and 3-chloroperoxibenzoic acid) in a non-aqueous medium was used to prepare an organic-phase enzyme electrode (OPEE). The enzyme was immobilized within a polymeric film on spectrographic graphite. The amperometric signal of the enzyme electrode in substrate solutions was found to be due to the reduction of oxygen generated in the enzyme layer. The electrode response is proportional to peroxide concentrations up to about 40 microM within the potential range from -450 to -650 mV (vs. Ag/AgCl), and the response time is at most 90 s. The enzyme electrode retains about 35% of its initial activity after a 3-week storage at room temperature.

  18. Fungal-Fungal Interactions in Leaf-Cutting Ant Agriculture

    Directory of Open Access Journals (Sweden)

    Sunshine A. Van Bael

    2011-01-01

    Full Text Available Many organisms participate in symbiotic relationships with other organisms, yet studies of symbioses typically have focused on the reciprocal costs and benefits within a particular host-symbiont pair. Recent studies indicate that many ecological interactions involve alliances of symbionts acting together as mutualistic consortia against other consortia. Such interacting consortia are likely to be widespread in nature, even if the interactions often occur in a cryptic fashion. Little theory and empirical data exist concerning how these complex interactions shape ecological outcomes in nature. Here, we review recent work on fungal-fungal interactions between two consortia: (i leaf-cutting ants and their symbiotic fungi (the latter grown as a food crop by the former and (ii tropical plants and their foliar endophytes (the cryptic symbiotic fungi within leaves of the former. Plant characteristics (e.g., secondary compounds or leaf physical properties of leaves are involved in leaf-cutting ant preferences, and a synthesis of published information suggests that these plant traits could be modified by fungal presence. We discuss potential mechanisms for how fungal-fungal interactions proceed in the leaf-cutting ant agriculture and suggest themes for future research.

  19. Serious fungal infections in Ecuador.

    Science.gov (United States)

    Zurita, J; Denning, D W; Paz-Y-Miño, A; Solís, M B; Arias, L M

    2017-06-01

    There is a dearth of data from Ecuador on the burden of life-threatening fungal disease entities; therefore, we estimated the burden of serious fungal infections in Ecuador based on the populations at risk and available epidemiological databases and publications. A full literature search was done to identify all epidemiology papers reporting fungal infection rates. WHO, ONU-AIDS, Index Mundi, Global Asthma Report, Globocan, and national data [Instituto Nacional de Estadística y Censos (INEC), Ministerio de Salud Pública (MSP), Sociedad de Lucha Contra el Cáncer (SOLCA), Instituto Nacional de Donación y Trasplante de Órganos, Tejidos y Células (INDOT)] were reviewed. When no data existed, risk populations were used to estimate frequencies of fungal infections, using previously described methodology by LIFE. Ecuador has a variety of climates from the cold of the Andes through temperate to humid hot weather at the coast and in the Amazon basin. Ecuador has a population of 15,223,680 people and an average life expectancy of 76 years. The median estimate of the human immunodeficiency virus (HIV)/acquired immune deficiency syndrome (AIDS) population at risk for fungal disease (<200 CD4 cell counts) is ∼10,000, with a rate of 11.1% (1100) of histoplasma, 7% (700) of cryptococcal meningitis, and 11% (1070) of Pneumocystis pneumonia. The burden of candidemia is 1037. Recurrent Candida vaginitis (≥4 episodes per year) affects 307,593 women aged 15-50 years. Chronic pulmonary aspergillosis probably affects ∼476 patients following tuberculosis (TB). Invasive aspergillosis is estimated to affect 748 patients (∼5.5/100,000). In addition, allergic bronchopulmonary aspergillosis (ABPA) in asthma and severe asthma with fungal sensitization (SAFS) were estimated to affect 26,642 and 45,013 people, respectively. Our estimates indicate that 433,856 (3%) of the population in Ecuador is affected by serious fungal infection.

  20. Characterization of a catalase-deficient strain of Neisseria gonorrhoeae: evidence for the significance of catalase in the biology of N. gonorrhoeae.

    Science.gov (United States)

    Johnson, S R; Steiner, B M; Cruce, D D; Perkins, G H; Arko, R J

    1993-01-01

    We obtained a catalase-deficient (Kat-) strain of Neisseria gonorrhoeae isolated from a patient who had been unsuccessfully treated with penicillin. Quantitative enzyme assays and electrophoresis of cell extracts on native polyacrylamide gels subsequently stained for catalase and peroxidase activities failed to detect both enzymes. The strain exhibited no growth anomalies or unusual requirements when grown under ordinary laboratory conditions. However, the Kat- strain proved extremely sensitive to exogenous hydrogen peroxide, and analysis of the bacterial DNA after such exposure showed extensive single-strand breakage in both chromosomal and plasmid DNAs. Partial characterization of the gonococcal catalase from a Kat+ laboratory strain revealed that the enzyme had the physical and chemical properties of both catalase and peroxidase. Images PMID:8454325

  1. Study of catalase adsorption on two mixed-mode ligands and the mechanism involved therein.

    Science.gov (United States)

    Shiva Ranjini, S; Vijayalakshmi, M A

    2012-11-01

    Mixed-mode chromatography sorbents n-hexylamine HyperCel™ (HEA) and phenylpropylamine HyperCel™ (PPA) were evaluated for the study of adsorption of catalase from two different sources. Various parameters such as buffer composition, ionic strength and pH were investigated to study the mechanism of interaction of commercially available pre-purified catalase from Bovine liver, purified catalase from black gram (Vigna mungo) and crude extract of black gram containing catalase with these mixed-mode ligands. A simple and economical screening protocol for identifying optimal buffer conditions for adsorption and desorption of catalase was established with micro volumes of the sorbent in batch mode. With HEA HyperCel, it was observed that pre-purified catalase from both bovine liver and black gram was completely retained at pH 7.0, irrespective of the presence or absence of NaCl in the adsorption buffer, whereas the catalase from crude extract of black gram was completely retained only in the presence of 0.2 M salt in the adsorption buffer. The elution of catalase from both the sources was accomplished by lowering the pH to 4.5 in absence of salt. In case of PPA HyperCel, catalase from both the sources was very strongly adsorbed under different buffer conditions studied, and elution did not yield a significant catalase activity. From the screening experiments, it could be concluded that the interaction of catalase with HEA HyperCel could be dominated by hydrophobic forces with minor contributions from ionic interaction and with PPA HyperCel, it could be a combination of different non-covalent interactions acting on different loci on the surface of the protein.

  2. Microbiological diagnostics of fungal infections

    Directory of Open Access Journals (Sweden)

    Corrado Girmenia

    2013-07-01

    Full Text Available Laboratory tests for the detection of fungal infections are easy to perform. The main obstacle to a correct diagnosis is the correlation between the laboratory findings and the clinical diagnosis. Among pediatric patients, the most common fungal pathogen is Candida. The detection of fungal colonization may be performed through the use of chromogenic culture media, which allows also the identification of Candida subspecies, from which pathogenicity depends. In neonatology, thistest often drives the decision to begin a empiric therapy; in this regard, a close cooperation between microbiologists and clinicians is highly recommended. Blood culture, if positive, is a strong confirmation of fungal infection; however, its low sensitivity results in a high percentage of false negatives, thus decreasing its reliability. Molecular diagnostics is still under evaluation, whereas the detection of some fungal antigens, such as β-D-glucan, galactomannan, mannoprotein, and cryptococcal antigen in the serum is used for adults, but still under evaluations for pediatric patients.http://dx.doi.org/10.7175/rhc.v4i1S.862

  3. Fungal artificial chromosomes for mining of the fungal secondary metabolome

    OpenAIRE

    2015-01-01

    Background With thousands of fungal genomes being sequenced, each genome containing up to 70 secondary metabolite (SM) clusters 30–80 kb in size, breakthrough techniques are needed to characterize this SM wealth. Results Here we describe a novel system-level methodology for unbiased cloning of intact large SM clusters from a single fungal genome for one-step transformation and expression in a model host. All 56 intact SM clusters from Aspergillus terreus were individually captured in self-rep...

  4. Seletividade de agrotóxicos utilizados na cultura do arroz irrigado ao fungo Metarhizium anisopliae, agente de controle microbiano de Tibraca limbativentris Selectivity of chemical pesticides used in rice irrigated crop at fungus Metarhizium anisopliae, microbial control agent of Tibraca limbativentris

    Directory of Open Access Journals (Sweden)

    Fátima Teresinha Rampelotti-Ferreira

    2010-04-01

    Full Text Available Para subsidiar a utilização de táticas de manejo integrado para o inseto-praga Tibraca limbativentris, avaliou-se a compatibilidade in vitro entre o isolado CG 891 de Metarhizium anisopliae e os agrotóxicos utilizados na cultura do arroz irrigado. Os parâmetros avaliados foram crescimento vegetativo, esporulação e germinação em pré e pós-contato do fungo, com duas doses de fipronil, tiametoxam, fenitrotiona, carbofurano, pirazossulfurom-etílico, bentazona, clomazona, glifosato e quincloraque; e uma dose de triciclazol e azoxistrobina. Reduções significativas no crescimento vegetativo e esporulação de M. anisopliae foram observadas para fenitrotiona, carbofurano e azoxistrobina. Observou-se redução na germinação em pré-contato para o agrotóxico azoxistrobina. O valor percentual da germinação alterou a classificação dos agrotóxicos com relação a sua seletividade sobre o entomopatógeno. No entanto, os resultados mostram que in vitro os agrotóxicos fenitrotiona, carbofurano, glifosato e azoxistrobina são prejudiciais ao isolado CG 891 de M. anisopliae.Searching for integrated control strategies for the insect-pest Tibraca limbativentris, the in vitro compatibility between isolated CG 891 of Metarhizium anisopliae and several pesticides used in the culture of irrigated rice was evaluated. The followings parameters were studied: vegetative growth, sporulation and the germination viability in pre- and post-contact of the fungus for two concentrations of fipronil, thiametoxan, fenitrothion, carbofuran, pyrazosulfuron-ethyl, bentazon, clomazone, glyfosate and quinclorac and one concentration of tricyclazole and azoxystrobin. Significant reductions in the vegetative growth and sporulation of M. anisopliae were observed for fenitrothion, carbofuran and azoxystrobin. The germination in pre-contact was affected by azoxystrobin. The percentage of germination changed the classification of pesticides in relation to its

  5. [Effect of protonofore 2,4-dinitrophenol on catalase activity of intact Escherichia coli bacteria].

    Science.gov (United States)

    Semchyshyn, H M; Lushchak, V I

    2004-01-01

    Catalase activity of intact E. coli bacteria had a broad pH-optimum (4.0-7.5). Addition of protonofore 2,4-dinitrophenol (200 microM) caused pH-dependency modification (6.5-7.0). Both the catalase activity and curves mode of native cells in the presence of dinitrophenol and cell-free extracts are almost identical. The loss of catalase activity at acid pH was caused by cells destruction and dinitrophenol addition, that makes it possible to suppose that this activity is connected with some membrane component functioning. The induction of "acid" catalase by oxidative stress was blocked with addition of chloramphenicol--protein synthesis inhibitor in prokaryotes. Probably this membrane complex is a part of OxyR regulon, because it is activated by hydrogen peroxide. The activation was not detected in the strain E. coli UM202, which is lacked of catalase HPI (H2O2 response). The catalase activity at acid pH was not observed in the strain E. coli AB1157, that produces both catalase forms and probably has the membrane defect. However, known genetic characteristics of AB1157 stain not let to identify a gene responsible for the "acid" catalase activity.

  6. Inhibition of catalase by tea catechins in free and cellular state: a biophysical approach.

    Science.gov (United States)

    Pal, Sandip; Dey, Subrata Kumar; Saha, Chabita

    2014-01-01

    Tea flavonoids bind to variety of enzymes and inhibit their activities. In the present study, binding and inhibition of catalase activity by catechins with respect to their structure-affinity relationship has been elucidated. Fluorimetrically determined binding constants for (-)-epigallocatechin gallate (EGCG) and (-)-epicatechin gallate (ECG) with catalase were observed to be 2.27×106 M(-1) and 1.66×106 M(-1), respectively. Thermodynamic parameters evidence exothermic and spontaneous interaction between catechins and catalase. Major forces of interaction are suggested to be through hydrogen bonding along with electrostatic contributions and conformational changes. Distinct loss of α-helical structure of catalase by interaction with EGCG was captured in circular dichroism (CD) spectra. Gallated catechins demonstrated higher binding constants and inhibition efficacy than non-gallated catechins. EGCG exhibited maximum inhibition of pure catalase. It also inhibited cellular catalase in K562 cancer cells with significant increase in cellular ROS and suppression of cell viability (IC50 54.5 µM). These results decipher the molecular mechanism by which tea catechins interact with catalase and highlight the potential of gallated catechin like EGCG as an anticancer drug. EGCG may have other non-specific targets in the cell, but its anticancer property is mainly defined by ROS accumulation due to catalase inhibition.

  7. Inhibition of catalase by tea catechins in free and cellular state: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Sandip Pal

    Full Text Available Tea flavonoids bind to variety of enzymes and inhibit their activities. In the present study, binding and inhibition of catalase activity by catechins with respect to their structure-affinity relationship has been elucidated. Fluorimetrically determined binding constants for (--epigallocatechin gallate (EGCG and (--epicatechin gallate (ECG with catalase were observed to be 2.27×106 M(-1 and 1.66×106 M(-1, respectively. Thermodynamic parameters evidence exothermic and spontaneous interaction between catechins and catalase. Major forces of interaction are suggested to be through hydrogen bonding along with electrostatic contributions and conformational changes. Distinct loss of α-helical structure of catalase by interaction with EGCG was captured in circular dichroism (CD spectra. Gallated catechins demonstrated higher binding constants and inhibition efficacy than non-gallated catechins. EGCG exhibited maximum inhibition of pure catalase. It also inhibited cellular catalase in K562 cancer cells with significant increase in cellular ROS and suppression of cell viability (IC50 54.5 µM. These results decipher the molecular mechanism by which tea catechins interact with catalase and highlight the potential of gallated catechin like EGCG as an anticancer drug. EGCG may have other non-specific targets in the cell, but its anticancer property is mainly defined by ROS accumulation due to catalase inhibition.

  8. Purification and characterization of an intracellular catalase-peroxidase from Penicillium simplicissimum

    NARCIS (Netherlands)

    Fraaije, Marco W.; Roubroeks, Hanno P.; Hagen, Wilfred R.; Berkel, Willem J.H. van

    1996-01-01

    The first dimeric catalase-peroxidase of eucaryotic origin, an intracellular hydroperoxidase from Penicillium simplicissimum which exhibited both catalase and peroxidase activities, has been isolated. The enzyme has an apparent molecular mass of about 170 kDa and is composed of two identical subunit

  9. Covalent Immobilization of Catalase onto Regenerated Silk Fibroins via Tyrosinase-Catalyzed Cross-Linking.

    Science.gov (United States)

    Wang, Ping; Qi, Chenglong; Yu, Yuanyuan; Yuan, Jiugang; Cui, Li; Tang, Gengtie; Wang, Qiang; Fan, Xuerong

    2015-09-01

    Regenerated silk fibroins could be used as medical scaffolds and carrier materials for enzyme immobilization. In the present work, tyrosinase enzyme was used for enzymatic oxidation of silk fibroins, followed by immobilization of catalase onto the fibroin surfaces through physical adsorption and covalent cross-linking as well. Spectrophotometry, SDS-PAGE, and Fourier transform infrared spectroscopy (FTIR) were used to examine the efficiency of enzymatic oxidation and catalase immobilization, respectively. The results indicate that tyrosine residues in silk fibroins could be oxidized and converted to the active o-quinones. Incubating silk fibroins with catalase and tyrosinase led to a noticeable change of molecular weight distribution, indicating the occurrence of the cross-links between silk fibroins and catalase molecules. Two different pathways were proposed for the catalase immobilizations, and the method based on grafting of catalase onto the freeze-dried fibroin membrane is more acceptable. The residual enzyme activity for the immobilized catalase exhibited higher than that of the control after repeated washing cycles. Meanwhile, the thermal stability and alkali resistance were also slightly improved as compared to free catalase. The mechanisms of enzymatic immobilization are also concerned.

  10. Effect of Catalase on Biocatalytic Synthesis of Pyruvate by Enzymes from Pseudomonas sp.

    Institute of Scientific and Technical Information of China (English)

    Jing Song GU; Yuan Xiu WANG; Qiang JIAO

    2004-01-01

    Pyruvate was produced from DL-lactate by a kind of green-chemical biocatalyst - cell-free extract from bacterial strain Pseudomonas sp. SM-6. Catalase in cell-free extract, which could stabilize the pyruvate formed by lactate oxidase, played an important role in pyruvate preparation. The effect of catalase in conversion process was evaluated.

  11. Location of catalase in crystalline peroxisomes of methanol-grown Hansenula polymorpha

    NARCIS (Netherlands)

    Keizer, Ineke; Roggenkamp, Rainer; Harder, Willem; Veenhuis, Marten

    1992-01-01

    We have studied the intraperoxisomal location of catalase in peroxisomes of methanol-grown Hansenula polymorpha by (immuno)cytochemical means. In completely crystalline peroxisomes, in which the crystalline matrix is composed of octameric alcohol oxidase (AO) molecules, most of the catalase protein

  12. Fungal infection following renal transplantation.

    Science.gov (United States)

    Gallis, H A; Berman, R A; Cate, T R; Hamilton, J D; Gunnells, J C; Stickel, D L

    1975-09-01

    Twenty-seven deep fungal infections developed in 22 of 171 patients following renal transplantation. These infections included cryptococcosis (ten), nocardiosis (seven), candidiasis (four), aspergillosis (two), phycomycosis (two), chromomycosis (one), and subcutaneous infection with Phialophora gougeroti (one). Twelve infections occurred in living-related and ten in cadaveric recipients. Nineteen of the 22 patients were male. Infections occurred from 0 to 61 months after transplantation. Complicating non-fungal infections were present concomitantly in 15 patients. Thirteen patients died, eight probably as a result of fungal infection. Appropriate diagnostic procedures yielded a diagnosis in 20 of 27 infections, and therapy was begun in 18 patients. Serologic, culture, and biopsy procedures useful in making rapid diagnoses are advocated in the hope of increasing survival.

  13. The Fungal Defensin Family Enlarged

    Directory of Open Access Journals (Sweden)

    Jiajia Wu

    2014-08-01

    Full Text Available Fungi are an emerging source of peptide antibiotics. With the availability of a large number of model fungal genome sequences, we can expect that more and more fungal defensin-like peptides (fDLPs will be discovered by sequence similarity search. Here, we report a total of 69 new fDLPs encoded by 63 genes, in which a group of fDLPs derived from dermatophytes are defined as a new family (fDEF8 according to sequence and phylogenetic analyses. In the oleaginous fungus Mortierella alpine, fDLPs have undergone extensive gene expansion. Our work further enlarges the fungal defensin family and will help characterize new peptide antibiotics with therapeutic potential.

  14. Effect of cimetidine on catalase activity of Pseudomonas aeruginosa: a suggested mechanism of action.

    Science.gov (United States)

    Masoud, Masoudeh; Ebrahimi, Farnoosh; Minai-Tehrani, Dariush

    2014-01-01

    Catalase is an important enzyme for the degradation of hydrogen peroxide in cells. Bacteria have potent catalase to deal with H2O2 in their medium culture. Any chemicals that inhibit catalase activity can be harmful for cells. Histamine H2 antagonist drugs such as cimetidine and ranitidine are used for the treatment of gastrointestinal tract disorders. The present results showed that cimetidine could inhibit the catalase activity of Pseudomonas aeruginosa in a competitive inhibition. The determination of IC50 value and Ki (6.5 μM) of cimetidine demonstrated that the enzyme binds to the drug with high affinity. Binding of the drug to the enzyme was pH-dependent and no binding was observed at basic pH (>9) and acidic pH (catalase activity.

  15. A simple method of catalase purification for the undergraduate experimental course.

    Science.gov (United States)

    Chen, Qian; Cheng, Meng; Wang, Yinnan; Yao, Ming; Chen, Yongchun; Gao, Yuan; Ding, Wenyuan

    2015-02-01

    Catalase is a characteristic enzyme of peroxisomes, of which it is the most abundant protein. This enzyme serves as a typical example of a peroxisomal enzyme and is important in the teaching of biochemistry and molecular biology. Although there is substantial information regarding catalase purification, purifying catalase for the junior‑grade undergraduate experimental course face challenges in obtaining materials and increasingly expensive purification equipment. This study presents a simple method for the purification of mouse liver catalase using ethanol‑chloroform treatment, sodium sulfate fractionation, dialysis and Sephadex G‑200 gel filtration chromatography. Catalase was purified 31.8‑fold with an 18.3% yield. The advantages of this method were its low operating environment requirements, simple procedure and reduced cost. Furthermore, the method was designed to improve students' comprehensive ability and manipulative ability and to introduce a sense of innovation in the fields of biochemistry and molecular biology during their junior year.

  16. Forchlorfenuron detection based on its inhibitory effect towards catalase immobilized on boron nitride substrate.

    Science.gov (United States)

    Xu, Qin; Cai, Lijuan; Zhao, Huijie; Tang, Jiaqian; Shen, Yuanyuan; Hu, Xiaoya; Zeng, Haibo

    2015-01-15

    An enzymatic procedure based on a catalase biosensor for the detection of forchlorfenuron (CPPU) has been reported in this work. Catalase was immobilized on boron nitride (BN) sheets dispersed in chitosan by adsorption. The immobilized catalase exhibited direct electron transfer character and excellent electrocatalytic activity towards H2O2 reduction. After introducing CPPU into the H2O2 containing phosphate buffer solution, the catalase-catalyzed H2O2 reduction current decreased. By measuring the current decrease, CPPU can be determined in the range of 0.5-10.0 µM with the detection limit of 0.07 μM. The non-competitive inhibition behavior of CPPU towards catalase was verified by the Lineweaver-Burk plots. Long stability character has been ascribed to this biosensor. Possible use of this biosensor in flow systems is illustrated. The proposed biosensor has been successfully applied to CPPU determination in fruits samples with satisfactory results.

  17. Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

    Directory of Open Access Journals (Sweden)

    Klingelhoeffer Christoph

    2012-05-01

    Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves

  18. Bacterial and fungal endophthalmitis in Upper Egypt:related species and risk factors

    Institute of Scientific and Technical Information of China (English)

    AA Gharamah; AM Moharram; MA Ismail; AK AL-Hussaini

    2012-01-01

    Objective: To study risk factors, contributing factors of bacterial and fungal endophthalmitis in Upper Egypt, test the isolated species sensitive to some therapeutic agents, and to investigate the air-borne bacteria and fungi in opthalmology operating rooms. Methods: Thirty one cases of endophthalmitis were clinically diagnosed and microbiologically studied. Indoor air-borne bacteria and fungi inside four air-conditioned operating rooms in the Ophthalmology Department at Assiut University Hospitals were also investigated. The isolated microbes from endophthalmitis cases were tested for their ability to produce some extracellular enzymes including protease, lipase, urease, phosphatase and catalase. Also the ability of 5 fungal isolates from endophthalmitis origin to produce mycotoxins and their sensitivity to some therapeutic agents were studied. Results: Results showed that bacteria and fungi were responsihle for infection in 10 and 6 cases of endophthalmitis, respectively and only 2 cases produced a mixture of bacteria and fungi. Trauma was the most prevalent risk factor of endophthalmitis where 58.1% of the 31 cases were due to trauma. In ophthalmology operating rooms, different bacterial and fungal species were isolated. 8 bacterial and 5 fungal isolates showed their ability to produce enzymes while only 3 fungal isolates were able to produce mycotoxins. Terbinafine showed the highest effect against most isolates in vitro. Conclusions: The ability of bacterial and fungal isolates to produce extracellular enzymes and mycotoxins may be aid in the invasion and destruction of eye tissues. Microbial contamination of operating rooms with air-borne bacteria and fungi in the present work may be a source of postoperative endophthalmitis.

  19. Fungal laryngitis in immunocompetent patients.

    Science.gov (United States)

    Ravikumar, A; Prasanna Kumar, S; Somu, L; Sudhir, B

    2014-01-01

    The diagnosis of fungal laryngitis is often overlooked in immunocompetent patients because it is commonly considered a disease of the immunocompromised. Further confusion is caused by clinical and histological similarity to more common conditions like Leukoplakia. Demonstration of hyperkeratosis particularly if associated with intraepithelial neutrophils on biopsy should trigger a search for fungus using specialized stains. These patients usually present with hoarseness of voice. Pain is present inconsistently along with dysphagia and odynophagia. We present three cases of fungal laryngitis in immunocompetent patients out of which one underwent microlaryngeal surgery with excision biopsy. All these patients responded well with oral antifungal therapy.

  20. Human Islet Amyloid Polypeptide Fibril Binding to Catalase: A Transmission Electron Microscopy and Microplate Study

    Directory of Open Access Journals (Sweden)

    Nathaniel G. N. Milton

    2010-01-01

    Full Text Available The diabetes-associated human islet amyloid polypeptide (IAPP is a 37-amino-acid peptide that forms fibrils in vitro and in vivo. Human IAPP fibrils are toxic in a similar manner to Alzheimer's amyloid-β (Aβ and prion protein (PrP fibrils. Previous studies have shown that catalase binds to Aβ fibrils and appears to recognize a region containing the Gly-Ala-Ile-Ile sequence that is similar to the Gly-Ala-Ile-Leu sequence found in human IAPP residues 24-27. This study presents a transmission electron microscopy (TEM—based analysis of fibril formation and the binding of human erythrocyte catalase to IAPP fibrils. The results show that human IAPP 1-37, 8-37, and 20-29 peptides form fibrils with diverse and polymorphic structures. All three forms of IAPP bound catalase, and complexes of IAPP 1-37 or 8-37 with catalase were identified by immunoassay. The binding of biotinylated IAPP to catalase was high affinity with a KD of 0.77nM, and could be inhibited by either human or rat IAPP 1-37 and 8-37 forms. Fibrils formed by the PrP 118-135 peptide with a Gly-Ala-Val-Val sequence also bound catalase. These results suggest that catalase recognizes a Gly-Ala-Ile-Leu—like sequence in amyloid fibril-forming peptides. For IAPP 1-37 and 8-37, the catalase binding was primarily directed towards fibrillar rather than ribbon-like structures, suggesting differences in the accessibility of the human IAPP 24-27 Gly-Ala-Ile-Leu region. This suggests that catalase may be able to discriminate between different structural forms of IAPP fibrils. The ability of catalase to bind IAPP, Aβ, and PrP fibrils demonstrates the presence of similar accessible structural motifs that may be targets for antiamyloid therapeutic development.

  1. Catalase inhibits ionizing radiation-induced apoptosis in hematopoietic stem and progenitor cells.

    Science.gov (United States)

    Xiao, Xia; Luo, Hongmei; Vanek, Kenneth N; LaRue, Amanda C; Schulte, Bradley A; Wang, Gavin Y

    2015-06-01

    Hematologic toxicity is a major cause of mortality in radiation emergency scenarios and a primary side effect concern in patients undergoing chemo-radiotherapy. Therefore, there is a critical need for the development of novel and more effective approaches to manage this side effect. Catalase is a potent antioxidant enzyme that coverts hydrogen peroxide into hydrogen and water. In this study, we evaluated the efficacy of catalase as a protectant against ionizing radiation (IR)-induced toxicity in hematopoietic stem and progenitor cells (HSPCs). The results revealed that catalase treatment markedly inhibits IR-induced apoptosis in murine hematopoietic stem cells and hematopoietic progenitor cells. Subsequent colony-forming cell and cobble-stone area-forming cell assays showed that catalase-treated HSPCs can not only survive irradiation-induced apoptosis but also have higher clonogenic capacity, compared with vehicle-treated cells. Moreover, transplantation of catalase-treated irradiated HSPCs results in high levels of multi-lineage and long-term engraftments, whereas vehicle-treated irradiated HSPCs exhibit very limited hematopoiesis reconstituting capacity. Mechanistically, catalase treatment attenuates IR-induced DNA double-strand breaks and inhibits reactive oxygen species. Unexpectedly, we found that the radioprotective effect of catalase is associated with activation of the signal transducer and activator of transcription 3 (STAT3) signaling pathway and pharmacological inhibition of STAT3 abolishes the protective activity of catalase, suggesting that catalase may protect HSPCs against IR-induced toxicity via promoting STAT3 activation. Collectively, these results demonstrate a previously unrecognized mechanism by which catalase inhibits IR-induced DNA damage and apoptosis in HSPCs.

  2. Inhibition of the catalase activity from Phaseolus vulgaris and Medicago sativa by sodium chloride.

    Science.gov (United States)

    Tejera García, Noel A; Iribarne, Carmen; Palma, Francisco; Lluch, Carmen

    2007-08-01

    Changes in catalase activity during the development of the Rhizobium-legume symbiosis as well as its response in salinized plants of Phaseolus vulgaris and Medicago sativa, was studied. Besides, it was examined the behavior of the enzyme, isolated from leaves and root nodules, during in vitro incubation with NaCl doses. Nodule catalase activities of both legumes were assayed with several enzyme inhibitors and also purified. Leaf catalase activity of Phaseolus vulgaris and Medicago sativa decreased and increased respectively throughout the ontogeny, but root nodule catalase kept a high and stable value. This last result suggests that both legumes require the maintenance of high nodule catalase in nitrogen-fixing nodules. Under salt stress conditions leaf and nodule catalase activity decreased in both, grain and pasture legumes. Because catalase from leaf of Medicago sativa and nodules of Phaseolus vulgaris were relatively sensitive to NaCl during in vitro experiments, the detoxifying role of this enzyme for H(2)O(2) should be limited in such conditions. Both catalases, from determinate and indeterminate nodules, were affected neither by oxygen nor superoxide radicals but showed a strong (Phaseolus vulgaris) or partial (Medicago sativa) inhibition with dithiothreitol, dithionite and beta-mercaptoethanol. Besides, cyanide was the most potent inhibitor of nodule catalases. Finally, catalases partially purified by immobilized metal ion affinity chromatography migrated at 42 (Phaseolus vulgaris) and 46kDa (Medicago sativa) on SDS-PAGE, whereas native forms on sephacryl S-300 columns exhibited a molecular mass of 59 and 48kDa (Phaseolus vulgaris) and 88 and 53kDa (Medicago sativa).

  3. Laboratory Bioassay of Iranian Isolates of Entomopathogenic Fungus Metarhizium anisopliae (Metsch. Sorokin (Ascomycota: Hypocreales against two Species of Storage Pest

    Directory of Open Access Journals (Sweden)

    Adel Khashaveh

    2013-03-01

    Full Text Available M-B 12.00 Normal 0 false false false EN-US X-NONE FA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} The susceptibility of adults of Tribolium castaneum Herbst (Coleoptera: Tenebrionidae and Oryzaephilus surinamensis L. (Coleoptera: Silvanidae to three Iranian Isolates of the entomopathogenic fungi Metarhizium anisopliae (Metsch. Sorokin was evaluated through bioassays with direct immersion under laboratory conditions. For each isolates, five aqueous suspensions were prepared in a logarithmic series in Tween 80 (0.05% v/v. Results showed that adult of both species were susceptible to all isolates of M. anisopliae. For all three isolates, mortality percentage of the two species increased with increasing conidial concentration and significant difference was observed between concentrations. The corrected cumulative mortality of adult of O. surinamensis 10 days after immersion ranged from 12.38 to 85.84%, 18.6 to 62.83% and 10.63 to 77.87% for different concentrations of DEMI001, IRAN 715C and IRAN 1018C, respectively. These amounts for T. castaneum varied from 31.07 to 74.78%, 26.02 to 75.61% and 23.33 to 89.99% for different concentrations of DEMI001, IRAN 715C and IRAN 1018C, respectively. The parameters of probit analysis demonstrated non-overlap of 95% confidence limits of LC50 and LC95 and significant difference was observed among three isolates tested against each insect. The lowest and the highest LC50 and LC95 values were observed in the isolates DEMI001 for O. surinamensis (3/1×105 and 1/5×108 and IRAN 715C for T. castaneum (6.2×108 and 6.9×1014, respectively. This

  4. A Review on Direct Electrochemistry of Catalase for Electrochemical Sensors

    Directory of Open Access Journals (Sweden)

    Periasamy Arun Prakash

    2009-03-01

    Full Text Available Catalase (CAT is a heme enzyme with a Fe(III/II prosthetic group at its redox centre. CAT is present in almost all aerobic living organisms, where it catalyzes the disproportionation of H2O2 into oxygen and water without forming free radicals. In order to study this catalytic mechanism in detail, the direct electrochemistry of CAT has been investigated at various modified electrode surfaces with and without nanomaterials. The results show that CAT immobilized on nanomaterial modified electrodes shows excellent catalytic activity, high sensitivity and the lowest detection limit for H2O2 determination. In the presence of nanomaterials, the direct electron transfer between the heme group of the enzyme and the electrode surface improved significantly. Moreover, the immobilized CAT is highly biocompatible and remains extremely stable within the nanomaterial matrices. This review discusses about the versatile approaches carried out in CAT immobilization for direct electrochemistry and electrochemical sensor development aimed as efficient H2O2 determination. The benefits of immobilizing CAT in nanomaterial matrices have also been highlighted.

  5. Oxidative stress response to menadione and cumene hydroperoxide in the opportunistic fungal pathogen Candida glabrata

    Directory of Open Access Journals (Sweden)

    Mayra Cuéllar-Cruz

    2009-07-01

    Full Text Available Candida glabrata is an opportunistic fungal pathogen that can cause severe invasive infections and can evade phagocytic cell clearance. We are interested in understanding the virulence of this fungal pathogen, in particular its oxidative stress response. Here we investigated C. glabrata, Saccharomyces cerevisiae and Candida albicans responses to two different oxidants: menadione and cumene hydroperoxide (CHP. In log-phase, in the presence of menadione, C. glabrata requires Cta1p (catalase, while in a stationary phase (SP, Cta1p is dispensable. In addition, C. glabrata is less resistant to menadione than C. albicans in SP. The S. cerevisiae laboratory reference strain is less resistant to menadione than C. glabrata and C. albicans; however S. cerevisiaeclinical isolates (CIs are more resistant than the lab reference strain. Furthermore, S. cerevisiae CIs showed an increased catalase activity. Interestingly, in SP C. glabrata and S. cerevisiae are more resistant to CHP than C. albicans and Cta1p plays no apparent role in detoxifying this oxidant.

  6. Oxidative stress response to menadione and cumene hydroperoxide in the opportunistic fungal pathogen Candida glabrata.

    Science.gov (United States)

    Cuéllar-Cruz, Mayra; Castaño, Irene; Arroyo-Helguera, Omar; De Las Peñas, Alejandro

    2009-07-01

    Candida glabrata is an opportunistic fungal pathogen that can cause severe invasive infections and can evade phagocytic cell clearance. We are interested in understanding the virulence of this fungal pathogen, in particular its oxidative stress response. Here we investigated C. glabrata, Saccharomyces cerevisiae and Candida albicans responses to two different oxidants: menadione and cumene hydroperoxide (CHP). In log-phase, in the presence of menadione, C. glabrata requires Cta1p (catalase), while in a stationary phase (SP), Cta1p is dispensable. In addition, C. glabrata is less resistant to menadione than C. albicans in SP. The S. cerevisiae laboratory reference strain is less resistant to menadione than C. glabrata and C. albicans; however S. cerevisiaeclinical isolates (CIs) are more resistant than the lab reference strain. Furthermore, S. cerevisiae CIs showed an increased catalase activity. Interestingly, in SP C. glabrata and S. cerevisiae are more resistant to CHP than C. albicans and Cta1p plays no apparent role in detoxifying this oxidant.

  7. Protective immune responses to fungal infections.

    Science.gov (United States)

    Rivera, A

    2014-09-01

    The incidence of fungal infections has been on the rise over several decades. Fungal infections threaten animals, plants and humans alike and are thus of significant concern to scientists across disciplines. Over the last decade, significant advances on fungal immunology have lead to a better understanding of important mechanisms of host protection against fungi. In this article, I review recent advances of relevant mechanisms of immune-mediated protection to fungal infections.

  8. Seletividade de Lecanicillium lecanii e Metarhizium anisopliae para larvas de primeiro ínstar de Ceraeochrysa cincta (Neuroptera: Chrysopidae em laboratório = Selectivicty of Lecanicillium lecanii and Metarhizium anisopliae for Ceraeochrysa cincta first instar larvae (Neuroptera: Chrysopidae in laboratory

    Directory of Open Access Journals (Sweden)

    Eliane Ribeiro Cardoso

    2007-10-01

    Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos fungos Lecanicillium lecanii e Metarhizium anisopliae para larvas de Ceraeochrysa cincta, utilizando-se a aplicação por imersão e aaplicação em bases de vidro, formando filme seco (IOBC modificado. Nos dois métodos, foram aplicados os tratamentos: 1 - L. lecanii; 2 - M. anisopliae - 2.1x107 conídios viáveis mL-1; 3 - solução de Tween 80® a 0,05% como testemunha. Avaliou-se a mortalidade, duração médiado período larval, fecundidade e a viabilidade dos ovos. Todos os insetos mortos foram submetidos à assepsia, para confirmação da mortalidade causada pelo fungo. Em ambos os bioensaios, as mortalidades confirmadas pelos fungos foram iguais a zero. No filme seco o efeito total dos fungos sobre o predador foi classificado como pouco nocivo de acordo com as categorias propostas pelo método IOBC. L. lecanii e M. anisopliae não afetaram a viabilidade dos ovos de C. cincta, quando aplicados por imersão. Na concentração que foi estabelecida para a realização dos bioensaios, os fungos entomopatogênicos L. lecanii e M. anisopliae foram seletivos para larvas de 1o ínstar de C. cincta.This paper aimed to evaluate the selectivity of the fungi Lecanicillium lecanii and Metarhizium anisopliae for Ceraeochrysa cincta. Two bioassays were developed: 1st application of dry filmproposed by the International Organization for Biological Control IOBC (modified - they were applied in glass bases, forming dry film. 2nd immersion application. In the two methods, the following treatments were applied: 1- watery suspension of L. lecanii; 2- the same for M. anisopliae (both at 2.1x107 viable conidia mL-1; and 3- Tween 80® 0.05% watery solution. The larvae mortality, the average duration of the larvae period, the females fecundity and the eggsviability were evaluated. All the dead insects were submitted to asepsis to confirm the mortality caused by the fungi. In both bioassays, the mortality

  9. Imaging fungal infections in children

    NARCIS (Netherlands)

    Ankrah, Alfred O.; Sathekge, Mike M; Dierckx, Rudi A.J.O.; Glaudemans, Andor W.J.M.

    2016-01-01

    Fungal infections in children rarely occur, but continue to have a high morbidity and mortality despite the development of newer antifungal agents. It is essential for these infections to be diagnosed at the earliest possible stage so appropriate treatment can be initiated promptly. The addition of

  10. Microbiology of systemic fungal infections

    Directory of Open Access Journals (Sweden)

    Chakrabarti A

    2005-01-01

    Full Text Available The increased incidence of systemic fungal infections in the past two decades has been overwhelming. Earlier, it was pathogenic dimorphic fungi, which were known to cause systemic infections. However, starting from the 1960s, opportunistic fungi started causing more number of infections, especially in the immunocompromised host. More recently, newer and less common fungal agents are being increasingly associated with infection in immunosuppressed hosts. Amongst dimorphic fungi, infections due to Histoplasma capsulatum and Penicillium marneffei are increasingly reported in patients with AIDS in India. H. capsulatum is found country wide, but P. marneffei remains restricted to Manipur state. Although both varieties of C. neoformans , C. neoformans var. neoformans (serotypes A & D, and C. neoformans var. gattii (serotypes B & C are reported in India, most of the cases reported are of serotype A. Increased incidence of cryptococcosis is reported from all centers with the emergence of AIDS. Systemic infection due to species under Candida , Aspergillus and zygomycetes is widely prevalent in nosocomial setting, and outbreaks due to unusual fungi are reported occasionally from tertiary care centers. This global change in systemic fungal infections has emphasized the need to develop good diagnostic mycology laboratories in this country and to recognize this increasingly large group of potential fungal pathogens.

  11. Fungal endophyte diversity in Sarracenia

    Science.gov (United States)

    Fungal endophytes were isolated from four species of the carnivorous pitcher plant genus Sarracenia: S. minor, S. oreophila, S. purpurea, and S. psittacina. Twelve taxa of fungi, eight within the Ascomycota and four within the Basidiomycota, were identified based on PCR amplification and sequencing ...

  12. (Post-)genomics approaches in fungal research

    NARCIS (Netherlands)

    Aguilar-Pontes, María Victoria; de Vries, Ronald P; Zhou, M.; van den Brink, J.

    2014-01-01

    To date, hundreds of fungal genomes have been sequenced and many more are in progress. This wealth of genomic information has provided new directions to study fungal biodiversity. However, to further dissect and understand the complicated biological mechanisms involved in fungal life styles, functio

  13. Do pH and flavonoids influence hypochlorous acid-induced catalase inhibition and heme modification?

    Science.gov (United States)

    Krych-Madej, Justyna; Gebicka, Lidia

    2015-09-01

    Hypochlorous acid (HOCl), highly reactive oxidizing and chlorinating species, is formed in the immune response to invading pathogens by the reaction of hydrogen peroxide with chloride catalyzed by the enzyme myeloperoxidase. Catalase, an important antioxidant enzyme, catalyzing decomposition of hydrogen peroxide to water and molecular oxygen, hampers in vitro HOCl formation, but is also one of the main targets for HOCl. In this work we have investigated HOCl-induced catalase inhibition at different pH, and the influence of flavonoids (catechin, epigallocatechin gallate and quercetin) on this process. It has been shown that HOCl-induced catalase inhibition is independent on pH in the range 6.0-7.4. Preincubation of catalase with epigallocatechin gallate and quercetin before HOCl treatment enhances the degree of catalase inhibition, whereas catechin does not affect this process. Our rapid kinetic measurements of absorption changes around the heme group have revealed that heme modification by HOCl is mainly due to secondary, intramolecular processes. The presence of flavonoids, which reduce active catalase intermediate, Compound I to inactive Compound II have not influenced the kinetics of HOCl-induced heme modification. Possible mechanisms of the reaction of hypochlorous acid with catalase are proposed and the biological consequences are discussed.

  14. The kinetic properties producing the perfunctory pH profiles of catalase-peroxidases.

    Science.gov (United States)

    Moore, Robert L; Powell, Luke J; Goodwin, Douglas C

    2008-06-01

    Many structure-function relationship studies performed on the catalase-peroxidase enzymes are based on limited kinetic data. To provide a more substantive understanding of catalase-peroxidase function, we undertook a more exhaustive evaluation of catalase-peroxidase catalysis as a function of pH. Kinetic parameters across a broad pH range for the catalase and peroxidase activities of E. coli catalase peroxidase (KatG) were obtained, including the separate analysis of the oxidizing and reducing substrates of the peroxidase catalytic cycle. This investigation identified ABTS-dependent inhibition of peroxidase activity, particularly at low pH, unveiling that previously reported pH optima are clearly skewed. We show that turnover and efficiency of peroxidase activity increases with decreasing pH until the protein unfolds. The data also suggest that the catalase pH optimum is more complex than it is often assumed to be. The apparent optimum is in fact the intersection of the optimum for binding (7.00) and the optimum for activity (5.75). We also report the apparent pK(a)s for binding and catalysis of catalase activity as well as approximate values for certain peroxidatic and catalatic steps.

  15. Monofunctional catalase P of Paracoccidioides brasiliensis: identification, characterization, molecular cloning and expression analysis.

    Science.gov (United States)

    Moreira, Sabrina F I; Bailão, Alexandre M; Barbosa, Mônica S; Jesuino, Rosalia S A; Felipe, M Sueli Soares; Pereira, Maristela; de Almeida Soares, Célia Maria

    2004-01-30

    Within the context of studies on genes from Paracoccidioides brasiliensis (Pb) potentially associated with fungus-host interaction, we isolated a 61 kDa protein, pI 6.2, that was reactive with sera of patients with paracoccidioidomycosis. This protein was identified as a peroxisomal catalase. A complete cDNA encoding this catalase was isolated from a Pb cDNA library and was designated PbcatP. The cDNA contained a 1509 bp ORF containing 502 amino acids, whose molecular mass was 57 kDa, with a pI of 6.5. The translated protein PbCATP revealed canonical motifs of monofunctional typical small subunit catalases and the peroxisome-PTS-1-targeting signal. The deduced and the native PbCATP demonstrated amino acid sequence homology to known monofunctional catalases and was most closely related to catalases from other fungi. The protein and mRNA were diminished in the mycelial saprobic phase compared to the yeast phase of infection. Protein synthesis and mRNA levels increased during the transition from mycelium to yeast. In addition, the catalase protein was induced when cells were exposed to hydrogen peroxide. The identification and characterization of the PbCATP and cloning and characterization of the cDNA are essential steps for investigating the role of catalase as a defence of P. brasiliensis against oxygen-dependent killing mechanisms. These results suggest that this protein exerts an influence in the virulence of P. brasiliensis.

  16. Catalase is a key enzyme in seed recovery from ageing during priming.

    Science.gov (United States)

    Kibinza, Serge; Bazin, Jérémie; Bailly, Christophe; Farrant, Jill M; Corbineau, Françoise; El-Maarouf-Bouteau, Hayat

    2011-09-01

    Ageing induces seed deterioration expressed as the loss of seed vigour and/or viability. Priming treatment, which consists in soaking of seeds in a solution of low water potential, has been shown to reinvigorate aged seeds. We investigate the importance of catalase in oxidation protection during accelerated ageing and repair during subsequent priming treatment of sunflower (Helianthus annuus L.) seeds. Seeds equilibrated to 0.29g H2Og(-1) dry matter (DM) were aged at 35°C for different durations and then primed by incubation for 7 days at 15°C in a solution of polyethylene glycol 8000 at -2MPa. Accelerated ageing affected seed germination and priming treatment reversed partially the ageing effect. The inhibition of catalase by the addition of aminotriazol during priming treatment reduced seed repair indicating that catalase plays a key role in protection and repair systems during ageing. Ageing was associated with H2O2 accumulation as showed by biochemical quantification and CeCl3 staining. Catalase was reduced at the level of gene expression, protein content and affinity. Interestingly, priming induced catalase synthesis by activating expression and translation of the enzyme. Immunocytolocalization of catalase showed that the enzyme co-localized with H2O2 in the cytosol. These results clearly indicate that priming induce the synthesis of catalase which is involved in seed recovery during priming.

  17. Over-Expression of Catalase in Myeloid Cells Confers Acute Protection Following Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    E. Bernadette Cabigas

    2014-05-01

    Full Text Available Cardiovascular disease is the leading cause of death in the United States and new treatment options are greatly needed. Oxidative stress is increased following myocardial infarction and levels of antioxidants decrease, causing imbalance that leads to dysfunction. Therapy involving catalase, the endogenous scavenger of hydrogen peroxide (H2O2, has been met with mixed results. When over-expressed in cardiomyocytes from birth, catalase improves function following injury. When expressed in the same cells in an inducible manner, catalase showed a time-dependent response with no acute benefit, but a chronic benefit due to altered remodeling. In myeloid cells, catalase over-expression reduced angiogenesis during hindlimb ischemia and prevented monocyte migration. In the present study, due to the large inflammatory response following infarction, we examined myeloid-specific catalase over-expression on post-infarct healing. We found a significant increase in catalase levels following infarction that led to a decrease in H2O2 levels, leading to improved acute function. This increase in function could be attributed to reduced infarct size and improved angiogenesis. Despite these initial improvements, there was no improvement in chronic function, likely due to increased fibrosis. These data combined with what has been previously shown underscore the need for temporal, cell-specific catalase delivery as a potential therapeutic option.

  18. Subseafloor basalts as fungal habitats

    Science.gov (United States)

    Ivarsson, M.

    2012-09-01

    The oceanic crust is believed to host the largest potential habitat for microbial life on Earth, yet, still we lack substantial information about the abundance, diversity, and consequence of its biosphere. The last two decades have involved major research accomplishments within this field and a change in view of the ocean crust and its potential to harbour life. Here fossilised fungal colonies in subseafloor basalts are reported from three different seamounts in the Pacific Ocean. The fungal colonies consist of various characteristic structures interpreted as fungal hyphae, fruit bodies and spores. The fungal hyphae are well preserved with morphological characteristics such as hyphal walls, septa, thallic conidiogenesis, and hyphal tips with hyphal vesicles within. The fruit bodies consist of large (∼50-200 µm in diameter) body-like structures with a defined outer membrane and an interior filled with calcite. The fruit bodies have at some stage been emptied of their contents of spores and filled by carbonate-forming fluids. A few fruit bodies not filled by calcite and with spores still within support this interpretation. Spore-like structures (ranging from a few µm to ∼20 µm in diameter) are also observed outside of the fruit bodies and in some cases concentrated to openings in the membrane of the fruit bodies. The hyphae, fruit bodies and spores are all closely associated with a crust lining the vein walls that probably represent a mineralized biofilm. The results support a fungal presence in deep subseafloor basalts and indicate that such habitats were vital between ∼81 and 48 Ma.

  19. 绿僵菌毒素的研究进展%Research Progress of Metarhizium anisopliae Destruxin

    Institute of Scientific and Technical Information of China (English)

    张秋

    2009-01-01

    With highly toxic infectivity acting on pest ,Metarhizium anisopliae destruxin has a wide application prospect in the control of agricultural pests. It can be divided into low-molecular-weight compound and high-molecular-weight protein destruxin according to its molecular weight and configuration. The article particularly expatiated its molecular structure,category,extractingMethod,biology activity and producing condition.%绿僵菌毒素是绿僵菌产生的具有杀虫活性的次生代谢物质,在农业害虫防治方面具有广阔的应用前景.根据其分子量和结构分为低分子量毒素和高分子量蛋白毒素两大类,对其分子结构、种类、提取方法、生物活性、产生条件等进行了综述.

  20. Effects of pergolide mesylate on transduction efficiency of PEP-1-catalase protein

    Energy Technology Data Exchange (ETDEWEB)

    Sohn, Eun Jeong; Kim, Dae Won; Kim, Young Nam; Kim, So Mi [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Lim, Soon Sung [Department of Food Science and Nutrition and RIC Center, Hallym University, Chunchon 200-702 (Korea, Republic of); Kang, Tae-Cheon [Department of Anatomy and Neurobiology, College of Medicine, Hallym University, Chunchon 200-702 (Korea, Republic of); Kwon, Hyeok Yil [Department of Physiology, College of Medicine, Hallym University, Chunchon 200-702 (Korea, Republic of); Kim, Duk-Soo [Department of Anatomy, College of Medicine, Soonchunhyang University, Cheonan-Si 330-090 (Korea, Republic of); Cho, Sung-Woo [Department of Biochemistry and Molecular Biology, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Hwang, Hyun Sook, E-mail: wazzup@hallym.ac.kr [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Choi, Soo Young, E-mail: sychoi@hallym.ac.kr [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of)

    2011-03-18

    Research highlights: {yields} We studied effects of pergolide mesylate (PM) on in vitro and in vivo transduction of PEP-1-catalase. {yields} PEP-1-catatase inhibited 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation. {yields} PM enhanced the transduction of PEP-1-catalase into HaCaT cells and skin tissue. {yields} PM increased anti-inflammatory activity of PEP-1-catalase. {yields} PM stimulated therapeutic action of anti-oxidant enzyme catalase in oxidative-related diseases. -- Abstract: The low transduction efficiency of various proteins is an obstacle to their therapeutic application. However, protein transduction domains (PTDs) are well-known for a highly effective tool for exogenous protein delivery to cells. We examined the effects of pergolide mesylate (PM) on the transduction of PEP-1-catalase into HaCaT human keratinocytes and mice skin and on the anti-inflammatory activity of PEP-1-catatase against 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation using Western blot and histological analysis. PM enhanced the time- and dose-dependent transduction of PEP-1-catalase into HaCaT cells without affecting the cellular toxicity. In a mouse edema model, PEP-1-catalase inhibited the increased expressions of inflammatory mediators and cytokines such as cyclooxygenase-2, inducible nitric oxide synthase, interleukin-6 and -1{beta}, and tumor necrosis factor-{alpha} induced by TPA. On the other hand, PM alone failed to exert any significant anti-inflammatory effects. However, the anti-inflammatory effect of co-treatment with PEP-1-catalase and PM was more potent than that of PEP-1-catalase alone. Our results indicate that PM may enhance the delivery of PTDs fusion therapeutic proteins to target cells and tissues and has potential to increase their therapeutic effects of such drugs against various diseases.

  1. Biochemical and Developmental Characterization of Multiple Forms of Catalase in Tobacco Leaves

    Science.gov (United States)

    Havir, Evelyn A.; McHale, Neil A.

    1987-01-01

    Leaf extracts of both Nicotiana tabacum and Nicotiana sylvestris contain multiple forms of catalase (H2O2:H2O2 oxidoreductase, EC 1.11.1.6) which are separable at different pH values by chromatofocusing columns. Marked changes in distribution of these catalases occur during seedling development and leaf maturation. The form of catalase eluting first (peak 1) was predominant during early seedling growth and present at all stages of development. Two more acidic forms (peaks 2 and 3) appeared later and comprised 29% of the total activity by 11 days postgermination. Mature leaves of N. tabacum contained peak 1 catalase, but peaks 2 and 3 represented 62% of the total activity. No interconversion of peaks 1, 2, and 3 was detected. The three forms of catalase differed in thermal stability with peak 1 > peak 2 ≫ peak 3. For N. sylvestris, t½ at 55°C was 31.5 and 3.0 min for peaks 1 and 3, respectively, and for N. tabacum, t½ was 41.5 and 3.2 min, respectively. All forms of catalase in tobacco show peroxidatic (measured as ethanol to acetaldehyde conversion) as well as catalatic activities. However, for both Nicotiana species the ratio peroxidatic/catalatic activity is at least 30-fold higher in peak 3 than in peaks 1 and 2. Chromatofocusing of extracts from spinach leaves separated at least four peaks of catalase activity, one of which had a 10-fold higher ratio of peroxidatic/catalatic activity than the others. Short-term growth (5 days) of tobacco seedlings under atmospheric conditions suppressing photorespiration (1% CO2/21% O2) reduced total catalase activity and caused a decline in peak 1 catalase and a substantial increase in the activity of peaks 2 and 3 relative to air-grown seedlings at the same stage. PMID:16665461

  2. The Molecular Mechanism of the Catalase-like Activity in Horseradish Peroxidase.

    Science.gov (United States)

    Campomanes, Pablo; Rothlisberger, Ursula; Alfonso-Prieto, Mercedes; Rovira, Carme

    2015-09-02

    Horseradish peroxidase (HRP) is one of the most relevant peroxidase enzymes, used extensively in immunochemistry and biocatalysis applications. Unlike the closely related catalase enzymes, it exhibits a low activity to disproportionate hydrogen peroxide (H2O2). The origin of this disparity remains unknown due to the lack of atomistic information on the catalase-like reaction in HRP. Using QM(DFT)/MM metadynamics simulations, we uncover the mechanism for reduction of the HRP Compound I intermediate by H2O2 at atomic detail. The reaction begins with a hydrogen atom transfer, forming a peroxyl radical and a Compound II-like species. Reorientation of the peroxyl radical in the active site, concomitant with the transfer of the second hydrogen atom, is the rate-limiting step, with a computed free energy barrier (18.7 kcal/mol, ∼ 6 kcal/mol higher than the one obtained for catalase) in good agreement with experiments. Our simulations reveal the crucial role played by the distal pocket residues in accommodating H2O2, enabling formation of a Compound II-like intermediate, similar to catalases. However, out of the two pathways for Compound II reduction found in catalases, only one is operative in HRP. Moreover, the hydrogen bond network in the distal side of HRP compensates less efficiently than in catalases for the energetic cost required to reorient the peroxyl radical at the rate-determining step. The distal Arg and a water molecule in the "wet" active site of HRP have a substantial impact on the reaction barrier, compared to the "dry" active site in catalase. Therefore, the lower catalase-like efficiency of heme peroxidases compared to catalases can be directly attributed to the different distal pocket architecture, providing hints to engineer peroxidases with a higher rate of H2O2 disproportionation.

  3. DIFFERENTIAL ALLERGIC AND NEUROTROPHIN RESPONSES TO FUNGAL COMPONENT EXTRACTS IN BALB/C MICE

    Science.gov (United States)

    Metarhizium anisopliae mycelium (MYC), conidia (CON) and inducible protease (IND) extracts were combined to produce the antigen MACA to screen for allergenic potential. Involuntary aspiration (IA) exposure to MACA in BALB/c mice has caused immune, inflammatory and physiological ...

  4. Catalase in testes and epididymidis of wistar rats fed zinc deficient diet.

    Science.gov (United States)

    Bedwal, S; Prasad, S; Nair, N; Saini, M R; Bedwal, R S

    2009-01-01

    Catalase activities have been evaluated in testes and caput and cauda epididymis of Wistar rats fed on zinc deficient diet for 2 and 4 weeks. The enzyme activity has been measured as chromic acetate formed by heating of dichromate (in acetic acid) in presence of H(2) O(2) with perchromic acid as an unstable intermediate. Observed non-significant increase in catalase activity in testes as well as in caput and cauda epididymis of 2 weeks experiments has been related to low levels of H(2) O(2) produced in two organs whereas significant (Pspermatozoa in epididymis. Thus, zinc deficiency increases catalase activity in testes and epididymis.

  5. Direct Electrochemistry of Catalase on Single Wall Carbon Nanotubes Modified Glassy Carbon Electrode

    Institute of Scientific and Technical Information of China (English)

    Qiang ZHAO; Lun Hui GUAN; Zhen Nan GU; Qian Kun ZHUANG

    2005-01-01

    Direct electrochemistry of catalase (Ct) has been studied on single wall carbon nanotubes (SWNTs) modified glassy carbon (GC) electrode. A pair of well-defined nearly reversible redox peaks is given at --0.48 V (vs. SCE) in 0.1 mol/L phosphate solution (pH 7.0).The peak current in cyclic voltammogram is proportional to the scan rate. The peak potential of catalase is shifted to more negative value when the pH increases. Catalase can adsorb on the SWNTs modified electrode.

  6. Inhititory Mechanisms of Metarhizium anisopliae Against Rhizoctonia cerealis%绿僵菌对小麦纹枯病菌的抑制作用研究

    Institute of Scientific and Technical Information of China (English)

    齐永霞; 陈方新; 李增智

    2011-01-01

    The inhibition and mechanism of Metarhizium anisopliae against Rhizoctonia cerealis was studied in vitro by applying dual-culture, cup-plate test and microscopy, respectively. The results showed that in dual-culture tests and cupplate tests, the tested M. Anisopliae had strong antagonism against the tested R. Cerealis. It suggested that the inhibitory effects of the tested M. Anisopliae on the tested R. Cerealis were significant when it was dual-cultured and when its conidia suspension was applied into the PDA media. Using metabolic liquid of Ma55, which was cultured in different time, the inhibitions to hyphal growth, sclerotium-formation number and sclerotium weight, sclerotium-germinating rate were studied, too. The results showed that the metabolic liquid cultured 25 d has significant inhibitory effect on hyphal growth, sclerotium number and sclerotium-germinating rate. The test indicated that the culture filtrates of Ma55 contained a thermal stable antifungal compound. It was also observed that the hyphal of Metarhizium anisopliae and Rhizoctonia cerealis has no hyper parasitism, but the hyphal of Rhizoctonia cerealis was lysed, broken and their cytoplasm becamethinning on dual culture. The results mentioned above indicated that the inhibitory effects of Metarhizium anisopliae against the pathogen of wheat sharp eyespot were produced mostly by nutrition competition, space competition and antibiosis.%在实验室条件下,研究了金龟子绿僵菌(Metarhizium anisopliae)对小麦纹枯病菌(Rhizoctonia cerealis)的拮抗作用及其机理.结果表明,金龟子绿僵菌与小麦纹枯病菌对峙培养以及在培养基中加入金龟子绿僵菌孢子悬浮液,对小麦纹枯病菌菌丝生长均有较好的抑制作用.测定了培养不同天数的金龟子绿僵菌Ma55发酵液对小麦纹枯病菌菌丝生长、菌核产生量及菌核萌发率的影响.结果表明,液体振荡培养25 d的金龟子绿僵菌Ma55发酵液对小麦纹枯病菌的菌丝

  7. The Chemical Basis of Fungal Bioluminescence.

    Science.gov (United States)

    Purtov, Konstantin V; Petushkov, Valentin N; Baranov, Mikhail S; Mineev, Konstantin S; Rodionova, Natalja S; Kaskova, Zinaida M; Tsarkova, Aleksandra S; Petunin, Alexei I; Bondar, Vladimir S; Rodicheva, Emma K; Medvedeva, Svetlana E; Oba, Yuichi; Oba, Yumiko; Arseniev, Alexander S; Lukyanov, Sergey; Gitelson, Josef I; Yampolsky, Ilia V

    2015-07-06

    Many species of fungi naturally produce light, a phenomenon known as bioluminescence, however, the fungal substrates used in the chemical reactions that produce light have not been reported. We identified the fungal compound luciferin 3-hydroxyhispidin, which is biosynthesized by oxidation of the precursor hispidin, a known fungal and plant secondary metabolite. The fungal luciferin does not share structural similarity with the other eight known luciferins. Furthermore, it was shown that 3-hydroxyhispidin leads to bioluminescence in extracts from four diverse genera of luminous fungi, thus suggesting a common biochemical mechanism for fungal bioluminescence.

  8. Effects of physical and nutritional stress conditions during mycelial growth on conidial germination speed, adhesion to host cuticle, and virulence of Metarhizium anisopliae, an entomopathogenic fungus.

    Science.gov (United States)

    Rangel, Drauzio E N; Alston, Diane G; Roberts, Donald W

    2008-11-01

    Growth under stress may influence pathogen virulence and other phenotypic traits. Conidia of the entomopathogenic fungus Metarhizium anisopliae var. anisopliae (isolate ARSEF 2575) were produced under different stress conditions and then examined for influences on in vitro conidial germination speed, adhesion to the insect cuticle, and virulence to an insect host, Tenebrio molitor. Conidia were produced under non-stress conditions [on potato-dextrose agar plus 1gl(-1) yeast extract (PDAY; control)], or under the following stress conditions: osmotic (PDAY+sodium chloride or potassium chloride, 0.6 or 0.8m); oxidative [(PDAY+hydrogen peroxide, 5mm) or UV-A (irradiation of mycelium on PDAY)]; heat shock (heat treatment of mycelium on PDAY at 45 degrees C, 40min); and nutritive [minimal medium (MM) with no carbon source, or on MM plus 3gl(-1) lactose (MML)]. Conidia were most virulent (based on mortality at 3d) and had the fastest germination rates when produced on MML, followed by MM. In addition, conidial adhesion to host cuticle was greatest when the conidia were produced on MML. Media with high osmolarity (0.8m) produced conidia with slightly elevated virulence and faster germination rates than conidia produced on the control medium (PDAY), but this trend did not hold for media with the lower osmolarity, (0.6m). Conidia produced from mycelium irradiated with UV-A while growing on PDAY had somewhat elevated virulence levels similar to that of conidia produced on MM, but their germination rate was not increased. Hydrogen peroxide and heat shock treatments did not alter virulence. These results demonstrate that the germination, adhesion and virulence of M. anisopliae conidia can be strongly influenced by culture conditions (including stresses) during production of the conidia.

  9. Control de Rhipicephalus microplus (Acari: Ixodidae mediante el uso del hongo entomopatógeno Metarhizium anisopliae (Hypocreales: Clavicipitaceae. Revisión

    Directory of Open Access Journals (Sweden)

    Melina Maribel Ojeda-Chi

    2011-01-01

    Full Text Available Las infestaciones de la garrapata del ganado, Rhipicephalus microplus, producen el mayor problema global de ectoparásitos en ganado de regiones tropicales y subtropicales, provocan importantes pérdidas económicas en la producción de carne, leche y pieles, además incrementan los gastos derivados de los programas de control, y son capaces de transmitir Babesia bovis, B. bigemina y Anaplasma marginale. El control de R. microplus se basa principalmente en el uso de ixodicidas, sin embargo, su uso irracional ha propiciado la aparición de garrapatas resistentes a las principales familias de ixodicidas, siendo necesario desarrollar alternativas de control no químico. Una de estas alternativas es el uso de hongos entomopatógenos, entre los que se encuentra Metarhizium anisopliae (Hypocreales, Clavicipitaceae el cual ha demostrado ser eficiente, tanto en estudios in vitro como in vivo, para el control de las diferentes fases evolutivas de R. microplus, causa disminución en la tasa de oviposición, incrementa el período de incubación y de eclosión, además produce la muerte de larvas y garrapatas adultas con porcentajes de eficiencia de hasta el 100 %. Diferentes estudios demuestran que M. anisopliae representa una alternativa no química sustentable para el control de garrapatas. La presente revisión tiene como objetivo presentar información actualizada sobre el uso de diferentes cepas de M. anisopliae en el control de la garrapata R.microplus.

  10. Catalase-negative, methicillin-resistant Staphylococcus aureus as a cause of septicemia Staphylococcus aureus catalase-negativo resistente a meticilina como causa de septicemia

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Innaco de Carvalho

    2003-01-01

    Full Text Available A catalase-negative methicillin-resistant Staphylococcus aureus (MRSA was isolated from blood, venous catheter spike and bone marrow collected from an HIV-positive man with lobar pneumonia and sepsis after ten days of hospitalization. The isolate was resistant to oxacillin (positive for penicillin-binding protein 2', ceftriaxone, clindamycin and clarithromycin, and susceptible to vancomycin. This is the first case of septicemia due to a catalase-negative S. aureus reported in Brazil, and, to our knowledge, it is the first case of catalase-negative MRSA reported in the literature. We believe that the patient acquired the S. aureus infection within the hospital environment since it was isolated ten days after hospitalization, it was isolated in a venous catheter spike, and the antibiotic resistance profile is similar to other S. aureus isolates recovered from infections in our hospital.Em um paciente HIV-positivo, com pneumonia lobar e septicemia, foi isolada, após dez dias de internação, uma cepa de Staphylococcus aureus catalase-negativa, resistente a meticilina/oxacilina (MRSA, de culturas de sangue, cateter venoso central e medula óssea. A cepa era resistente a oxacilina (PBP 2' positivo, ceftriaxona, clindamicina e claritromicina, e sensível a vancomicina. Este é o primeiro caso, reportado no Brasil, de uma septicemia por S. aureus catalase-negativo e, em nosso conhecimento, o primeiro caso de um S. aureus catalase-negativo resistente a meticilina. Nós acreditamos que o paciente tenha adquirido a infecção no ambiente hospitalar, uma vez que esta cepa foi isolada aos dez dias de internação, foi isolada em cateter venoso central e o perfil de sensibilidade aos antimicrobianos é semelhante ao dos S. aureus de infecções nosocomiais que ocorrem em nosso hospital.

  11. An oxyferrous heme/protein-based radical intermediate is catalytically competent in the catalase reaction of Mycobacterium tuberculosis catalase-peroxidase (KatG).

    Science.gov (United States)

    Suarez, Javier; Ranguelova, Kalina; Jarzecki, Andrzej A; Manzerova, Julia; Krymov, Vladimir; Zhao, Xiangbo; Yu, Shengwei; Metlitsky, Leonid; Gerfen, Gary J; Magliozzo, Richard S

    2009-03-13

    A mechanism accounting for the robust catalase activity in catalase-peroxidases (KatG) presents a new challenge in heme protein enzymology. In Mycobacterium tuberculosis, KatG is the sole catalase and is also responsible for peroxidative activation of isoniazid, an anti-tuberculosis pro-drug. Here, optical stopped-flow spectrophotometry, rapid freeze-quench EPR spectroscopy both at the X-band and at the D-band, and mutagenesis are used to identify catalase reaction intermediates in M. tuberculosis KatG. In the presence of millimolar H2O2 at neutral pH, oxyferrous heme is formed within milliseconds from ferric (resting) KatG, whereas at pH 8.5, low spin ferric heme is formed. Using rapid freeze-quench EPR at X-band under both of these conditions, a narrow doublet radical signal with an 11 G principal hyperfine splitting was detected within the first milliseconds of turnover. The radical and the unique heme intermediates persist in wild-type KatG only during the time course of turnover of excess H2O2 (1000-fold or more). Mutation of Met255, Tyr229, or Trp107, which have covalently linked side chains in a unique distal side adduct (MYW) in wild-type KatG, abolishes this radical and the catalase activity. The D-band EPR spectrum of the radical exhibits a rhombic g tensor with dual gx values (2.00550 and 2.00606) and unique gy (2.00344) and gz values (2.00186) similar to but not typical of native tyrosyl radicals. Density functional theory calculations based on a model of an MYW adduct radical built from x-ray coordinates predict experimentally observed hyperfine interactions and a shift in g values away from the native tyrosyl radical. A catalytic role for an MYW adduct radical in the catalase mechanism of KatG is proposed.

  12. Fungal rhinosinusitis: what every allergist should know.

    Science.gov (United States)

    Callejas, C A; Douglas, R G

    2013-08-01

    The interaction between fungi and the sinonasal tract results in a diverse range of diseases with an equally broad spectrum of clinical severity. The classification of these interactions has become complex, and this review seeks to rationalize and simplify the approach to fungal diseases of the nose and paranasal sinuses. These conditions may be discussed under two major headings: non-invasive disease (localized fungal colonization, fungal ball and allergic fungal rhinosinusitis) and invasive disease (acute invasive rhinosinusitis, chronic invasive rhinosinusitis and granulomatous invasive rhinosinusitis). A diagnosis of fungal rhinosinusitis is established by combining findings on history, clinical examination, laboratory testing, imaging and histopathology. The immunocompetence of the patient is of great importance, as invasive fungal rhinosinusitis is uncommon in immunocompetent patients. With the exception of localized fungal colonization, treatment of all forms of fungal rhinosinusitis relies heavily on surgery. Systemic antifungal agents are a fundamental component in the treatment of invasive forms, but are not indicated for the treatment of the non-invasive forms. Antifungal drugs may have a role as adjuvant therapy in allergic fungal rhinosinusitis, but evidence is poor to support recommendations. Randomized controlled trials need to be performed to confirm the benefit of immunotherapy in the treatment of allergic fungal rhinosinusitis. In this article, we will summarize the current literature, addressing the controversies regarding the diagnosis and management of fungal rhinosinusitis, and focussing on those aspects which are important for clinical immunologists and allergists.

  13. Immobilization of catalase on chitosan and amino acid- modified chitosan beads.

    Science.gov (United States)

    Başak, Esra; Aydemir, Tülin

    2013-08-01

    Bovine liver catalase was covalently immobilized onto amino acid-modified chitosan beads. The beads were characterized with SEM, FTIR, TGA and the effects of immobilization on optimum pH and temperature, thermostability, reusability were evaluated. Immobilized catalase showed the maximal enzyme activity at pH 7.0 at 30°C. The kinetic parameters, Km and Vmax, for immobilized catalase on alanine-chitosan beads and lysine-chitosan beads were estimated to be 25.67 mM, 27 mM and 201.39 μmol H2O2/min, 197.50 μmol H2O2/min, respectively. The activity of the immobilized catalase on Ala-CB and Lys-CB retained 40% of its high initial activity after 100 times of reuse.

  14. Isolation, Fractionation and Characterization of Catalase from Neurospora crassa (InaCC F226)

    Science.gov (United States)

    Suryani; Ambarsari, L.; Lindawati, E.

    2017-03-01

    Catalase from Indigenous isolate Neurospora crassa InaCC F226 has been isolated, fractionated and characterized. Production of catalase by Neurospora crassa was done by using PDA medium (Potato Dextrosa Agar) and fractionated with ammonium sulphate with 20-80% saturation. Fraction 60% was optimum saturation of ammonium sulphate and had highest specific activity 3339.82 U/mg with purity 6.09 times, total protein 0.920 mg and yield 88.57%. The optimum pH and temperature for catalase activity were at 40°C and pH 7.0, respectively. The metal ions that stimulated catalase activity acted were Ca2+, Mn2+ and Zn2+, and inhibitors were EDTA, Mg2+ and Cu2+. Based on Km and Vmax values were 0.2384 mM and 13.3156 s/mM.

  15. Simultaneous production of catalase, glucose oxidase and gluconic acid by Aspergillus niger mutant.

    Science.gov (United States)

    Fiedurek, J; Gromada, A; Pielecki, J

    1998-01-01

    The production of gluconic acid, extracellular glucose oxidase and catalase in submerged culture by a number of biochemical mutants has been evaluated. Optimization of stirrer speed, time cultivation and buffering action of some chemicals on glucose oxidase, catalase and gluconic acid production by the most active mutant, AM-11, grown in a 3-L glass bioreactor was investigated. Three hundred rpm appeared to be optimum to ensure good growth and best glucose oxidase production, but gluconic acid or catalase activity obtained maximal value at 500 or 900 rpm, respectively. Significant increase of dissolved oxygen concentration in culture (16-21%) and extracellular catalase activity were obtained when the traditional aeration was employed together with automatic dosed hydrogen peroxide.

  16. Catalase in testes and epididymidis of wistar rats fed zinc deficient diet

    Directory of Open Access Journals (Sweden)

    Bedwal S

    2009-01-01

    Full Text Available Catalase activities have been evaluated in testes and caput and cauda epididymis of Wistar rats fed on zinc deficient diet for 2 and 4 weeks. The enzyme activity has been measured as chromic acetate formed by heating of dichromate (in acetic acid in presence of H 2 O 2 with perchromic acid as an unstable intermediate. Observed non-significant increase in catalase activity in testes as well as in caput and cauda epididymis of 2 weeks experiments has been related to low levels of H 2 O 2 produced in two organs whereas significant (P< 0.01/0.001 increase in catalase activity in 4-weeks experiments indicate for increased oxidative stress due to phagocytotic activity of Sertoli cells in testes and damaged spermatozoa in epididymis. Thus, zinc deficiency increases catalase activity in testes and epididymis.

  17. Occurrence of High Catalase-containing Acinetobacter in Spacecraft Assembly Facilities

    Science.gov (United States)

    McCoy, K. B.; Derecho, I.; La Duc, M. T.; Vaishampayan, P.; Venkateswaran, K. J.; Mogul, R.

    2010-04-01

    In summary, the measurement of high catalase specific activity values for spacecraft-associated Acinetobacter strains is potentially the result of adaptation towards the harsh conditions of the clean rooms and assembly process.

  18. Fungal keratitis in Lattice dystrophy

    Directory of Open Access Journals (Sweden)

    Chatterjee Samrat

    2010-01-01

    Full Text Available We report a case of fungal keratitis occurring in a patient with lattice dystrophy. A 57-year-old farmer presented with a corneal ulcer following probable entry of paddy husk in the right eye, of one month duration. Corneal scraping revealed pigmented fungal filaments while culture grew Alternaria alternata. Treatment with 5% natamycin eye drops and 1% atropine healed the infection in four weeks. We would like to draw attention to the fact that the cornea in lattice dystrophy is prone to frequent erosions and is a compromised epithelial barrier to invasion by microorganisms. Patients must be made aware of this fact and should seek attention at the earliest following any trivial trauma. Management of minor corneal abrasions in them should be directed at healing the epithelium with adequate lubricants and preventing infection with topical antibiotic prophylaxis.

  19. Structural aspects of fungal allergens.

    Science.gov (United States)

    Crameri, Reto

    2015-03-01

    Despite the increasing number of solved crystal structures of allergens, the key question why some proteins are allergenic and the vast majority is not remains unanswered. The situation is not different for fungal allergens which cover a wide variety of proteins with different chemical properties and biological functions. They cover enzymes, cell wall, secreted, and intracellular proteins which, except cross-reactive allergens, does not show any evidence for structural similarities at least at the three-dimensional level. However, from a diagnostic point of view, pure allergens biotechnologically produced by recombinant technology can provide us, in contrast to fungal extracts which are hardly producible as standardized reagents, with highly pure perfectly standardized diagnostic reagents.

  20. Fungal metabolites with anticancer activity.

    Science.gov (United States)

    Evidente, Antonio; Kornienko, Alexander; Cimmino, Alessio; Andolfi, Anna; Lefranc, Florence; Mathieu, Véronique; Kiss, Robert

    2014-05-01

    Covering: 1964 to 2013. Natural products from bacteria and plants have played a leading role in cancer drug discovery resulting in a large number of clinically useful agents. In contrast, the investigations of fungal metabolites and their derivatives have not led to a clinical cancer drug in spite of significant research efforts revealing a large number of fungi-derived natural products with promising anticancer activity. Many of these natural products have displayed notable in vitro growth-inhibitory properties in human cancer cell lines and select compounds have been demonstrated to provide therapeutic benefits in mouse models of human cancer. Many of these compounds are expected to enter human clinical trials in the near future. The present review discusses the reported sources, structures and biochemical studies aimed at the elucidation of the anticancer potential of these promising fungal metabolites.

  1. Nattrassia mangiferae causing fungal keratitis

    Directory of Open Access Journals (Sweden)

    Kindo A

    2010-01-01

    Full Text Available We report a case of fungal keratitis caused by the coelomycetous fungus Nattrassia mangiferae in a 70 year old gentleman, agriculturist by occupation, with a history of injury to his right eye. The scraping showed narrow septate fungal hyphae on a KOH mount, isolation of a fast growing black mould, which demonstrated hyphae and arthroconidia of varying widths typical of the Scytalidium synanamorph (S. dimidiatum. The formation of the pycnidia, which at maturity, expressed conidia. The patient was started on topical itraconazole one hourly and topical atropine thrice a day. The patient was lost to follow up hence we are not able to comment on the final outcome of the patient.

  2. Fungal contaminants in cytopathology specimens

    Directory of Open Access Journals (Sweden)

    Prashant Sharma

    2014-02-01

    Full Text Available A pseudo-epidemic of environmental fungi, most likely by Fusarium spp., leading to inappropriate investigations for disseminated systemic mycosis is described. Subtle diagnostic clues, including the specimens affected, the nature of the host response, and the type of fungal elements noted helped to determine the nature of contaminants. The potential pitfall can be avoided by the knowledge of pertinent disease biology, prompt consultation for infectious diseases, and investigations of the potential environmental sources followed by source control.

  3. Eventos externos e internos da infecção de larvas e ninfas de Rhipicephalus sanguineus por Metarhizium anisopliae External and internal events of Rhipicephalus sanguineus larvae and nymphs infection by Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    M.V. Garcia

    2008-08-01

    Full Text Available Examinaram-se a adesão, a germinação, a penetração e a colonização de larvas e ninfas de Rhipicephalus sanguineus por Metarhizium anisopliae, assim como as lesões infringidas pelo fungo nas respectivas fases do ciclo de vida do ácaro. Realizaram-se infecções experimentais em 11 grupos contendo 250 larvas e 11 grupos contendo 75 ninfas de R. sanguineus, por meio de banho, durante três minutos sob agitação manual, em suspensão contendo 10(8 conídios/ml do fungo. Nos grupos-controles, o banho foi realizado usando o veículo da suspensão. Larvas e ninfas foram processadas para um estudo histopatológico e de microscopia eletrônica de varredura nos seguintes tempos após a infecção: uma e 18 horas, e um, dois, três, quatro, cinco, seis, sete, nove e 11 dias. A germinação dos conídios ocorreu em até 18 horas pós-inoculação, e o fungo penetrou nas larvas e ninfas através do tegumento, dois e três dias após a infecção, respectivamente. Após penetração, o fungo invadiu o corpo das larvas e ninfas, promovendo uma colonização difusa, sem preferência aparente por tecidos específicos. Lesões significativas não foram observadas. A morte das larvas e ninfas ocorreu no terceiro e quarto dias pós-infecção, e a esporulação do patógeno sobre o cadáver foi iniciada no sexto dia pós-infecção.The adhesion, germination and colonization of Rhipicephalus sanguineus larvae and nymphs by Metarhizium anisopliae as well as the lesions caused by the fungus were studied. For this purpose, 11 groups of 250 larvae each and 11 groups of 75 nymphs each were bathed during 3 minutes under manual shaking in a 10(8 conidia/ml suspension. Corresponding control groups were bathed only in the suspension vehicle. Ticks were also submitted to both conventional microscopy and scanning eletronmicrocopy analyses at several post-infection periods (1 and 18 hours and 1, 2, 3, 4, 5, 6, 7, 9, and 11 days. Conidial germination occurred in less

  4. População de Metarhizium anisopliae em diferentes tipos e graus de compactação do solo Metarhizium anisopliae population in differents soil types and compactness degrees

    Directory of Open Access Journals (Sweden)

    Lourenço Maurício Lanza

    2004-12-01

    Full Text Available Este trabalho objetivou investigar a influência do tipo e compactação do solo na sobrevivência do fungo Metarhizium anisopliae. A sobrevivência do fungo foi determinada em quatro tipos de solos: Latossolo Vermelho textura argilosa, Latossolo Vermelho textura média, Argissolo Vermelho Amarelo textura arenosa média e Argissolo Vermelho Amarelo textura areno-argilosa, com maior teor de matéria orgânica. Para determinar o efeito da compactação na sobrevivência do fungo usaram-se os três primeiros tipos de solos nas densidades de 1,12, 1,32, 1,50g cm-3; 1,22, 1,44, 1,65g cm-3; 1,30, 1,50, 1,70g cm-3, respectivamente. Por meio da contagem de unidades formadoras de colônias (UFC em placas de Petri, fizeram-se avaliações da sobrevivência do fungo, após zero, 20, 40, 60, 80, 100 e 120 dias de incubação a 27 ± 1ºC. Houve influência significativa do tipo de solo e do grau de compactação na sobrevivência do fungo, obtendo-se maior quantidade de UFC no solo textura areno-argilosa. Entre os demais solos, a maior sobrevivência ocorreu no solo textura arenosa e a menor no solo textura argilosa. O efeito da compactação foi significativo para o tipo de solo, exceto no solo textura arenosa. Independentemente do tipo de solo, a maior sobrevivência foi observada nos valores médios de densidade. A compactação teve maior impacto no solo textura média, onde ocorreu queda mais acentuada na quantidade de UFC em todas as densidades.The aim of this work was to investigate the effect of different soil types and compactness on Metarhizium anisopliae survival. The fungus survivorship was determined in four soil types: Red Latosol with clay texture, Red Latosol with medium texture, Red Yellow Podzolic with medium sand texture and Red Yellow Podzolic with sand-clay texture, with higher amount of organic material. To determine the effect of compactness on fungus survival the first three soil types were used with the following densities

  5. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

    OpenAIRE

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

    2016-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzym...

  6. Identification of a catalase-phenol oxidase in betalain biosynthesis in red amaranth (Amaranthus cruentus)

    OpenAIRE

    Xiao-Lu eTeng; Ning eChen; Xing-Guo eXiao

    2016-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzym...

  7. Immobilization of catalases from Bacillus SF on alumina for the treatment of textile bleaching effluents

    OpenAIRE

    Costa, Silgia; Tzanov,Tzanko; Paar, Andreas; Gudelj, Marinka; Gübitz, Georg M.; Paulo, Artur Cavaco

    2001-01-01

    A catalase preparation from a newly isolated Bacillus sp. was covalently immobilized on silanized alumina using glutaraldehyde as crosslinking agent. The effect of the coupling time of the enzyme-support reaction was determined in terms of protein recovery and immobilization yield and a certain balance point was found after which the activity recovery decreased. The activity profile of the immobilized catalase at high pH and temperature was investigated. The immobilized enzyme showed...

  8. A Commercial Preparation of Catalase Inhibits Nitric Oxide Production by Activated Murine Macrophages: Role of Arginase

    OpenAIRE

    Tian, Y.; Xing, Y.; Magliozzo, R.; Yu, K.; Bloom, B R; Chan, J

    2000-01-01

    Catalase is widely used as a pharmacological probe to evaluate the role of hydrogen peroxide in antimicrobial activities of phagocytic cells. This report demonstrates that the ability of a commercial preparation of catalase to inhibit concomitantly macrophage antimycobacterial activity and production of reactive nitrogen intermediates can be attributed, at least in part, to the depletion of l-arginine by contaminating arginase. In experimental systems that employ pharmacological probes, the e...

  9. Direct measurement of catalase activity in living cells and tissue biopsies

    Energy Technology Data Exchange (ETDEWEB)

    Scaglione, Christine N.; Xu, Qijin; Ramanujan, V. Krishnan, E-mail: Ramanujanv@csmc.edu

    2016-01-29

    Spatiotemporal regulation of enzyme-substrate interactions governs the decision-making steps in biological systems. Enzymes, being functional units of every living cell, contribute to the macromolecular stability of cell survival, proliferation and hence are vital windows to unraveling the biological complexity. Experimental measurements capturing this dynamics of enzyme-substrate interactions in real time add value to this understanding. Furthermore these measurements, upon validation in realistic biological specimens such as clinical biopsies – can further improve our capability in disease diagnostics and treatment monitoring. Towards this direction, we describe here a novel, high-sensitive measurement system for measuring diffusion-limited enzyme-substrate kinetics in real time. Using catalase (enzyme) and hydrogen peroxide (substrate) as the example pair, we demonstrate that this system is capable of direct measurement of catalase activity in vitro and the measured kinetics follows the classical Michaelis-Menten reaction kinetics. We further demonstrate the system performance by measuring catalase activity in living cells and in very small amounts of liver biopsies (down to 1 μg total protein). Catalase-specific enzyme activity is demonstrated by genetic and pharmacological tools. Finally we show the clinically-relevant diagnostic capability of our system by comparing the catalase activities in liver biopsies from young and old mouse (liver and serum) samples. We discuss the potential applicability of this system in clinical diagnostics as well as in intraoperative surgical settings. - Highlights: • A novel, direct measurement of Catalase enzyme activity via, oxygen sensing method. • Steady-stateprofiles of Catalase activity follow the Michaelis-Menten Kinetics. • Catalase-specific activity demonstrated using genetic and pharmacological tools. • Overcomes limitations of spectroscopic methods and indirect calorimetric approaches. • Clear

  10. Systems biology of fungal infection

    Directory of Open Access Journals (Sweden)

    Fabian eHorn

    2012-04-01

    Full Text Available Elucidation of pathogenicity mechanisms of the most important human pathogenic fungi, Aspergillus fumigatus and Candida albicans, has gained great interest in the light of the steadily increasing number of cases of invasive fungal infections.A key feature of these infections is the interaction of the different fungal morphotypes with epithelial and immune effector cells in the human host. Because of the high level of complexity, it is necessary to describe and understand invasive fungal infection by taking a systems biological approach, i.e., by a comprehensive quantitative analysis of the non-linear and selective interactions of a large number of functionally diverse, and frequently multifunctional, sets of elements, e.g., genes, proteins, metabolites, which produce coherent and emergent behaviours in time and space. The recent advances in systems biology will now make it possible to uncover the structure and dynamics of molecular and cellular cause-effect relationships within these pathogenic interactions.We review current efforts to integrate omics and image-based data of host-pathogen interactions into network and spatio-temporal models. The modelling will help to elucidate pathogenicity mechanisms and to identify diagnostic biomarkers and potential drug targets for therapy and could thus pave the way for novel intervention strategies based on novel antifungal drugs and cell therapy.

  11. Fungal genome resources at NCBI.

    Science.gov (United States)

    Robbertse, B; Tatusova, T

    2011-09-01

    The National Center for Biotechnology Information (NCBI) is well known for the nucleotide sequence archive, GenBank and sequence analysis tool BLAST. However, NCBI integrates many types of biomolecular data from variety of sources and makes it available to the scientific community as interactive web resources as well as organized releases of bulk data. These tools are available to explore and compare fungal genomes. Searching all databases with Fungi [organism] at http://www.ncbi.nlm.nih.gov/ is the quickest way to find resources of interest with fungal entries. Some tools though are resources specific and can be indirectly accessed from a particular database in the Entrez system. These include graphical viewers and comparative analysis tools such as TaxPlot, TaxMap and UniGene DDD (found via UniGene Homepage). Gene and BioProject pages also serve as portals to external data such as community annotation websites, BioGrid and UniProt. There are many different ways of accessing genomic data at NCBI. Depending on the focus and goal of research projects or the level of interest, a user would select a particular route for accessing genomic databases and resources. This review article describes methods of accessing fungal genome data and provides examples that illustrate the use of analysis tools.

  12. Fluorescence Spectrometry of the Interaction of Multi-Walled Carbon Nanotubes with Catalase

    Science.gov (United States)

    Fan, Y.; Li, Y.; Cai, H.; Li, J.; Miao, J.; Fu, D.; Yang, Q.

    2014-11-01

    The interaction of multi-walled carbon nanotubes (MWCNTs) with catalase is investigated using fluorescence and circular dichroism spectroscopic techniques. The results of the fluorescence experiments suggest that MWCNTs quench the intrinsic fluorescence of catalase via a static quenching mechanism. The circular dichroism spectral results reveal the unfolding of catalase with a significant decrease in the α-helix content in the presence of MWCNTs, which indicates that the conformation of catalase is changed in the binding process, thereby remarkably decreasing its activity. The binding constants and the number of binding sites of the MWCNT to the catalase are calculated at different temperatures. The thermodynamic parameters, such as the changes in free energy (ΔG), enthalpy (ΔH), and entropy (ΔS), are calculated using thermodynamic equations. The fact that all negative values of ΔG, ΔH, and ΔS are obtained suggests that the interaction of the MWCNTs with catalase is spontaneous, and that hydrogen bonding and van der Waals interactions play an important role in the binding process.

  13. Generation 9 polyamidoamine dendrimer encapsulated platinum nanoparticle mimics catalase size, shape, and catalytic activity.

    Science.gov (United States)

    Wang, Xinyu; Zhang, Yincong; Li, Tianfu; Tian, Wende; Zhang, Qiang; Cheng, Yiyun

    2013-04-30

    Poly(amidoamine) (PAMAM) encapsulated platinum nanoparticles were synthesized and used as catalase mimics. Acetylated generation 9 (Ac-G9) PAMAM dendrimer with a molecular size around 10 nm was used as a template to synthesize platinum nanoparticles. The feeding molar ratio of Pt(4+) and Ac-G9 is 2048, and the synthesized platinum nanoparticle (Ac-G9/Pt NP) has an average size of 3.3 nm. Ac-G9/Pt NP has a similar molecular size and globular shape with catalase (~11 nm). The catalytic activity of Ac-G9/Pt NP on the decomposition of H2O2 is approaching that of catalase at 37 °C. Ac-G9/Pt NP shows differential response to the changes of pH and temperature compared with catalase, which can be explained by different catalytic mechanisms of Ac-G9/Pt NP and catalase. Ac-G9/Pt NP also shows horseradish peroxidase activity and is able to scavenge free radicals such as di(phenyl)-(2,4,6-trinitrophenyl)iminoazanium (DPPH). Furthermore, Ac-G9/Pt NP shows excellent biocompatibility on different cell lines and can down-regulate H2O2-induced intracellular reactive oxygen species (ROS) in these cells. These results suggest that dendrimers are promising mimics of proteins with different sizes and Ac-G9/Pt NP can be used as an alternative candidate of catalase to decrease oxidation stress in cells.

  14. Reversible adsorption of catalase onto Fe(3+) chelated poly(AAm-GMA)-IDA cryogels.

    Science.gov (United States)

    Aktaş Uygun, Deniz; Uygun, Murat; Akgöl, Sinan; Denizli, Adil

    2015-05-01

    In this presented study, poly(acrylamide-glycidyl methacrylate) [poly(AAm-GMA)] cryogels were synthesized by cryopolymerization technique at sub-zero temperature. Prepared cryogels were then functionalized with iminodiacetic acid (IDA) and chelated with Fe(3+) ions in order produce the metal chelate affinity matrix. Synthesized cryogels were characterized with FTIR, ESEM and EDX analysis, and it was found that the cryogel had sponge like structure with interconnected pores and their pore diameter was about 200 μm. Fe(3+) chelated poly(AAm-GMA)-IDA cryogels were used for the adsorption of catalase and optimum adsorption conditions were determined by varying the medium pH, initial catalase concentration, temperature and ionic strength. Maximum catalase adsorption onto Fe(3+) chelated poly(AAm-GMA)-IDA cryogel was found to be 12.99 mg/g cryogel at 25 °C, by using pH 5.0 acetate buffer. Adsorbed catalase was removed from the cryogel by using 1.0M of NaCl solution and desorption yield was found to be 96%. Additionally, reusability profile of the Fe(3+) chelated poly(AAm-GMA)-IDA cryogel was also investigated and it was found that, adsorption capacity of the cryogels didn't decrease significantly at the end of the 40 reuses. Catalase activity studies were also tested and it was demonstrated that desorbed catalase retained 70% of its initial activity.

  15. Improved growth and viability of lactobacilli in the presence of Bacillus subtilis (natto), catalase, or subtilisin.

    Science.gov (United States)

    Hosoi, T; Ametani, A; Kiuchi, K; Kaminogawa, S

    2000-10-01

    In an effort to demonstrate the potential usefulness of Bacillus subtilis (natto) as a probiotic, we examined the effect of this organism on the growth of three strains of lactobacilli co-cultured aerobically in vitro. Addition of B. subtilis (natto) to the culture medium resulted in an increase in the number of viable cells of all lactobacilli tested. Since B. subtilis (natto) can produce catalase, which has been reported to exhibit a similar growth-promoting effect on lactobacilli, we also examined the effect of bovine catalase on the growth of Lactobacillus reuteri JCM 1112 and L. acidophilus JCM 1132. Both catalase and B. subtilis (natto) enhanced the growth of L. reuteri JCM 1112, whereas B. subtilis (natto) but not catalase enhanced the growth of L. acidophilus JCM 1132. In a medium containing 0.1 mM hydrogen peroxide, its toxic effect on L. reuteri JCM 1112 was abolished by catalase or B. subtilis (natto). In addition, a serine protease from B. licheniformis, subtilisin, improved the growth and viability of L. reuteri JCM 1112 and L. acidophilus JCM 1132 in the absence of hydrogen peroxide. These results indicate that B. subtilis (natto) enhances the growth and (or) viability of lactobacilli, possibly through production of catalase and subtilisin.

  16. Not so monofunctional--a case of thermostable Thermobifida fusca catalase with peroxidase activity.

    Science.gov (United States)

    Lončar, Nikola; Fraaije, Marco W

    2015-03-01

    Thermobifida fusca is a mesothermophilic organism known for its ability to degrade plant biomass and other organics, and it was demonstrated that it represents a rich resource of genes encoding for potent enzymes for biocatalysis. The thermostable catalase from T. fusca has been cloned and overexpressed in Escherichia coli with a yield of 400 mg/L. Heat treatment of disrupted cells at 60 °C for 1 h resulted in enzyme preparation of high purity; hence, no chromatography steps are needed for large-scale production. Except for catalyzing the dismutation of hydrogen peroxide, TfuCat was also found to catalyze oxidations of phenolic compounds. The catalase activity was comparable to other described catalases while peroxidase activity was quite remarkable with a k obs of nearly 1000 s(-1) for catechol. Site directed mutagenesis was used to alter the ratio of peroxidase/catalase activity. Resistance to inhibition by classic catalase inhibitors and an apparent melting temperature of 74 °C classifies this enzyme as a robust biocatalyst. As such, it could compete with other commercially available catalases while the relatively high peroxidase activity also offers new biocatalytic possibilities.

  17. Milk catalase activity as an indicator of thermization treatments used in the manufacture of cheddar cheese.

    Science.gov (United States)

    Hirvi, Y; Griffiths, M W

    1998-02-01

    Pilot-scale studies were carried out to determine the effect of different heat treatments on catalase activity during the manufacture and maturation of Cheddar cheese. Three trials were conducted to monitor catalase activity using disk flotation and polarographic methods. Cheese was manufactured from raw milk and from milk that had been treated at 60, 65 and 72 degrees C for 16 s using a high temperature, short time heat exchanger. Catalase activity was also determined in samples of commercial milk and in samples of mild, medium, sharp, and extra sharp Cheddar cheeses obtained from different manufacturers in order to verify that the enzyme could be used as an indicator of the type of heat treatment applied to cheese milk. Catalase activity was present in cheese made from raw milk but was only present at low concentrations in cheese manufactured from thermized milk. However, high catalase activity was observed in commercial samples of sharp and extra sharp Cheddar cheese that was apparently due to the growth of catalase-producing yeasts in the cheese during maturation.

  18. Inhibitory effects of a novel Val to Thr mutation on the distal heme of human catalase.

    Science.gov (United States)

    Mashhadi, Zahra; Boeglin, William E; Brash, Alan R

    2014-11-01

    True catalases efficiently breakdown hydrogen peroxide, whereas the catalase-related enzyme allene oxide synthase (cAOS) is completely unreactive and instead metabolizes a fatty acid hydroperoxide. In cAOS a Thr residue adjacent to the distal His restrains reaction with H2O2 (Tosha et al. (2006) J. Biol. Chem. 281:12610; De Luna et al. (2013) J. Phys. Chem. B 117: 14635) and its mutation to the consensus Val of true catalases permits the interaction. Here we investigated the effects of the reciprocal experiment in which the Val74 of human catalase is mutated to Thr, Ser, Met, Pro, or Ala. The Val74Thr substitution decreased catalatic activity by 3.5-fold and peroxidatic activity by 3-fold. Substitution with Ser had similar negative effects (5- and 3-fold decreases). Met decreased catalatic activity 2-fold and eliminated peroxidatic activity altogether, whereas the Val74Ala substitution was well tolerated. (The Val74Pro protein lacked heme). We conclude that the conserved Val74 of true catalases helps optimize catalysis. There are rare substitutions of Val74 with Ala, Met, or Pro, but not with Ser of Thr, possibly due their hydrogen bonding affecting the conformation of His75, the essential distal heme residue for activity in catalases.

  19. Binding of Cimetidine to Balb/C Mouse Liver Catalase; Kinetics and Conformational Studies.

    Science.gov (United States)

    Jahangirvand, Mahboubeh; Minai-Tehrani, Dariush; Yazdi, Fatemeh; Minai-Tehrani, Arash; Razmi, Nematollah

    2016-01-01

    Catalase is responsible for converting hydrogen peroxide (H2O2) into water and oxygen in cells. This enzyme has high affinity for hydrogen peroxide and can protect the cells from oxidative stress damage. Catalase is a tetramer protein and each monomer contains a heme group. Cimetidine is a histamine H2 receptor blocker which inhibits acid release from stomach and is used for gasterointestinal diseases. In this research, effect of cimetidine on the activity of liver catalase was studied and the kinetic parameters of this enzyme and its conformational changes were investigated. Cell free extract of mouse liver was used for the catalase assay. The activity of the catalase was detected in the absence and presence of cimetidine by monitoring hydrogen peroxide reduction absorbance at 240 nm. The purified enzyme was used for conformational studies by Fluorescence spectrophotometry. The data showed that cimetidine could inhibit the enzyme in a non-competitive manner. Ki and IC50 values of the drug were determined to be about 0.75 and 0.85 uM, respectively. The Arrhenius plot showed that activation energy was 6.68 and 4.77 kJ/mol in the presence and absence of the drug, respectively. Fluorescence spectrophotometry revealed that the binding of cimetidine to the purified enzyme induced hyperchromicity and red shift which determined the conformational change on the enzyme. Cimetidine could non-competitively inhibit the liver catalase with high affinity. Binding of cimetidine to the enzyme induced conformational alteration in the enzyme.

  20. Electrochemical monitoring of native catalase activity in skin using skin covered oxygen electrode.

    Science.gov (United States)

    Nocchi, Sarah; Björklund, Sebastian; Svensson, Birgitta; Engblom, Johan; Ruzgas, Tautgirdas

    2017-07-15

    A skin covered oxygen electrode, SCOE, was constructed with the aim to study the enzyme catalase, which is part of the biological antioxidative system present in skin. The electrode was exposed to different concentrations of H2O2 and the amperometric current response was recorded. The observed current is due to H2O2 penetration through the outermost skin barrier (referred to as the stratum corneum, SC) and subsequent catalytic generation of O2 by catalase present in the underlying viable epidermis and dermis. By tape-stripping the outermost skin layers we demonstrate that SC is a considerable diffusion barrier for H2O2 penetration. Our experiments also indicate that skin contains a substantial amount of catalase, which is sufficient to detoxify H2O2 that reaches the viable epidermis after exposure of skin to high concentrations of peroxide (0.5-1mM H2O2). Further, we demonstrate that the catalase activity is reduced at acidic pH, as compared with the activity at pH 7.4. Finally, experiments with often used penetration enhancer thymol shows that this compound interferes with the catalase reaction. Health aspect of this is briefly discussed. Summarizing, the results of this work show that the SCOE can be utilized to study a broad spectrum of issues involving the function of skin catalase in particular, and the native biological antioxidative system in skin in general. Copyright © 2017 Elsevier B.V. All rights reserved.