WorldWideScience

Sample records for anethum graveolens foeniculum

  1. Antibacterial and phytochemical screening of Anethum graveolens, Foeniculum vulgare and Trachyspermum ammi

    Directory of Open Access Journals (Sweden)

    Arora Daljit S

    2009-08-01

    Full Text Available Abstract Background Anethum graveolens Linn., Foeniculum vulgare Mill. and Trachyspermum ammi L. are widely used traditional medicinal plants to treat various ailments. To provide a scientific basis to traditional uses of these plants, their aqueous and organic seed extracts, as well as isolated phytoconstituents were evaluated for their antibacterial potential. Methods Antibacterial activity of aqueous and organic seed extracts was assessed using agar diffusion assay, minimum inhibitory concentration and viable cell count studies; and their antibacterial effect was compared with some standard antibiotics. The presence of major phytoconstituents was detected qualitatively and quantitatively. The isolated phytoconstituents were subjected to disc diffusion assay to ascertain their antibacterial effect. Results Hot water and acetone seed extracts showed considerably good antibacterial activity against all the bacteria except Klebsiella pneumoniae and one strain of Pseudomonas aeruginosa. Minimum inhibitory concentration for aqueous and acetone seed extracts ranged from 20–80 mg/ml and 5–15 mg/ml respectively. Viable cell count studies revealed the bactericidal nature of the seed extracts. Statistical analysis proved the better/equal efficacy of some of these seed extracts as compared to standard antibiotics. Phytochemical analysis showed the presence of 2.80 – 4.23% alkaloids, 8.58 – 15.06% flavonoids, 19.71 – 27.77% tannins, 0.55–0.70% saponins and cardiac glycosides. Conclusion Antibacterial efficacy shown by these plants provides a scientific basis and thus, validates their traditional uses as homemade remedies. Isolation and purification of different phytochemicals may further yield significant antibacterial agents.

  2. Antibacterial and phytochemical screening of Anethum graveolens, Foeniculum vulgare and Trachyspermum ammi

    OpenAIRE

    Arora Daljit S; Kaur Gurinder J

    2009-01-01

    Abstract Background Anethum graveolens Linn., Foeniculum vulgare Mill. and Trachyspermum ammi L. are widely used traditional medicinal plants to treat various ailments. To provide a scientific basis to traditional uses of these plants, their aqueous and organic seed extracts, as well as isolated phytoconstituents were evaluated for their antibacterial potential. Methods Antibacterial activity of aqueous and organic seed extracts was assessed using agar diffusion assay, minimum inhibitory conc...

  3. Anethum graveolens L. 1753 - kopr vonný

    Czech Academy of Sciences Publication Activity Database

    Sádlo, Jiří

    Praha: ČSOP, 2006 - (Mlíkovský, J.; Stýblo, P.), s. 47-47 ISBN 80-86770-17-6 Grant ostatní: GA MŽP(CZ) SM/6/37/04 Institutional research plan: CEZ:AV0Z60050516 Keywords : Anethum graveolens * aliens * invasibility Subject RIV: EF - Botanics

  4. Anethum graveolens and hyperlipidemia: A randomized clinical trial

    OpenAIRE

    Mahmoud Mirhosseini; Azar Baradaran; Mahmoud Rafieian-Kopaei

    2014-01-01

    Background: It has been established that hyperlipidemia increases the incidence and mortality associated with coronary heart disease. In this study, the effects of Dill (Anethum graveolens) were evaluated on lipid profile of hypercholesterolemic patients. Materials and Methods: In this clinical study, 91 hyperlipidemic patients were randomly designated into two groups. One group received gemfibrozil (900 mg daily) and the other group received Dill tablet (six tablets daily) for 2 months. The ...

  5. Antigiardial effect of Anethum graveolens aqueous extract in children

    Directory of Open Access Journals (Sweden)

    Ahmed Salih Sahib

    2014-06-01

    Full Text Available Background: Giardia lamblia is the most common intestinal parasite of humans identified worldwide. In spite of metronidazole is the most commonly used drug for the treatment of giardiasis in humans, low patient compliance and side effects especially in children encourage efforts to look for new and safe agent; many plants used in folk medicine thought to have antigiardial effect,Anethum graveolens(Dill is an annual herb cultivated in Iraq used both as medicinal agent and as food spice. The aim of this study was to investigate the effect of aqueous extract of Anethum graveolens leave in the treatment of giardiasis, compared with that of standard drug metronidazole. Patients and Methods:A prospective randomized clinical trial was carried out on 28 pediatric patients of both sexes with age of less than one year ranging from 3-11 months, who attend to outpatient private clinic in Baghdad for a period of six months from June 2013-December 2013, Patients participate in this study were allocated into two groups: Group A composed of 14 patients treated with Metronidazole 15 mg/kg three times a day for 5 days. Group B composed of 14 patients treated with Anethum graveolensaqueous extract 1ml three times a day for 5 days. Stool samples were collected at zero time before administration of treatment, after five days and after 14 days from starting the treatments to checkthe efficacy of treatment. Results:Administration of Anethum graveolensaqueous extract results in significant decrease in incidence of Giardia lamblia after five days of treatment indicating the efficacy of Anethum graveolensaqueous extract in the treatment of giardiasis a result that is comparable to that of metronidazole. Conclusion:This study showed that pediatric patients with giardiasis may benefit from five days treatment with Anethum graveolensaqueous extract administered as 1 ml three times daily, the improvement in the symptom with this herbal agent was comparable to the standard

  6. Anethum graveolens and hyperlipidemia: A randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Mahmoud Mirhosseini

    2014-01-01

    Full Text Available Background: It has been established that hyperlipidemia increases the incidence and mortality associated with coronary heart disease. In this study, the effects of Dill (Anethum graveolens were evaluated on lipid profile of hypercholesterolemic patients. Materials and Methods: In this clinical study, 91 hyperlipidemic patients were randomly designated into two groups. One group received gemfibrozil (900 mg daily and the other group received Dill tablet (six tablets daily for 2 months. The blood lipids including total cholesterol, triglyceride and high density lipoprotein (HDL-cholesterol from each group were assessed at the beginning and end of the trial. Results: Use of gemfibrozil brought about increased HDL-cholesterol by 3.91% (P < 0.05 and reduced triglyceride and total cholesterol by 32.7% (P < 0.05 and 9.41% (P < 0.05, respectively. Applying Dill tablet for 2 months resulted in reduction of total cholesterol up to 18% (P < 0.05 and triglyceride by 7.38% (P < 0.05. However, circulating HDL-cholesterol was not affected by this treatment. In this study, gemfibrozil decreased triglyceride and increased HDL-cholesterol more than anethum (P < 0.05. Anethum decreased total cholesterol more than gemfibrozil (P < 0.05. Patients treated with anethum did not report any side effects. Conclusion: The results of this trial indicate that Dill might be beneficial for hypercholesterolemic and hypertriglycemic patients.

  7. Aqueous Extract of Anethum Graveolens L. has Potential Antioxidant and Antiglycation Effects.

    Science.gov (United States)

    Oshaghi, Ebrahim Abbasi; Khodadadi, Iraj; Tavilani, Heidar; Goodarzi, Mohammad Taghi

    2016-07-01

    The aim of this study was to assess the antiglycation and antioxidant properties of aqueous extract of Anethum graveolens (dill). In the in vivo and in vitro experiments, antioxidant properties, blood glucose, and AGEs formation were determined. Dill extract was given orally to healthy and diabetic rats. Our results illustrated that different concentrations of dill extract (0.125, 0.25, 0.5, and 1 mg/ml) have potential antiradical and antioxidant activity. Aqueous extract of dill significantly reduced AGEs formation and fructosamine levels, protein carbonyl and also thiol group's oxidation, amyloid cross-β and fragmentation. After 2 months, blood glucose levels (P=0.006) and AGEs formation (P=0.003) significantly reduced in dill treated group compared with untreated diabetic animals. In conclusion, dill can be recommended as herbal medicine for the control and prevention of diabetic complications. PMID:27365555

  8. Aqueous Extract of Anethum Graveolens L. has Potential Antioxidant and Antiglycation Effects

    Directory of Open Access Journals (Sweden)

    Ebrahim Abbasi Oshaghi

    2016-07-01

    Full Text Available The aim of this study was to assess the antiglycation and antioxidant properties of aqueous extract of Anethum graveolens (dill. In the in vivo and in vitro experiments, antioxidant properties, blood glucose, and AGEs formation were determined. Dill extract was given orally to healthy and diabetic rats. Our results illustrated that different concentrations of dill extract (0.125, 0.25, 0.5, and 1 mg/ml have potential antiradical and antioxidant activity. Aqueous extract of dill significantly reduced AGEs formation and fructosamine levels, protein carbonyl and also thiol group’s oxidation, amyloid cross-β and fragmentation. After 2 months, blood glucose levels (P=0.006 and AGEs formation (P=0.003 significantly reduced in dill treated group compared with untreated diabetic animals. In conclusion, dill can be recommended as herbal medicine for the control and prevention of diabetic complications.

  9. The effect of radiation of LED modules on the growth of dill (Anethum graveolens L.

    Directory of Open Access Journals (Sweden)

    Frąszczak Barbara

    2016-04-01

    Full Text Available Light quality is thought to affect the growth and development of plants. We examined how light influences the growth and content of some chemical compounds in dill (Anethum graveolens L.. The plants were grown under different light quality. The share of orange and green light in the spectrum was constant and amounted to 10% for either colour. In the first combination (A, 70/10, there was 70% of red light and 10% of blue light. Other combinations had the following proportions: B 60/20, C 50/30, D 40/40 and E 30/50 of red and blue light. The PPFD was about 155 μmol m-2 s-1. Blue light inhibited the elongation growth as well as leaf area. It had positive influence on the accumulation of dry mass, glucose and fructose in the herb. In the combinations with higher percentage of red light the plants were characterised by higher content of essential oils, macronutrients and zinc. To sum up, we can say that the proportion of red and blue light has significant influence on the morphological qualities, chemical composition and dynamics of photosynthesis in these plants. On the other hand, the selection of spectral composition of LEDs will depend on the result we want to achieve.

  10. Interference of quorum sensing in urinary pathogen Serratia marcescens by Anethum graveolens.

    Science.gov (United States)

    Salini, Ramesh; Pandian, Shunmugiah Karutha

    2015-08-01

    Serratia marcescens is an opportunistic turned obligate pathogen frequently associated with urinary tract infections (UTI) and are multidrug resistant at most instances. Quorum sensing (QS) system, a population-dependent global regulatory system, controls the pathogenesis machinery of S. marcescens as it does in other pathogens. In the present study, methanol extract of a common herb and spice, Anethum graveolens (AGME) was assessed for its anti-QS potential against the clinical isolate of S. marcescens. AGME notably reduced the biofilm formation and QS-dependent virulence factors production in a concentration-dependent manner (64-1024 μg mL(-1)). The light and confocal microscopic images clearly evidenced the antibiofilm activity of AGME (256 μg mL(-1)) at its minimal biofilm inhibitory concentration. Besides, in support of biochemical assays, the expression analysis of QS-regulated genes fimC, bsmA and flhD which are crucial for initial adhesion and motility confirmed their downregulation upon exposure to AGME. LC-MS analysis of AGME revealed 3-O-methyl ellagic acid (3-O-ME) as one of its active principles having nearly similar antibiofilm activity and a reduced inhibition of prodigiosin (27%) and protease (15%) compared to AGME [prodigiosin (47%) and protease (50%)]. UFLC analysis revealed that 0.355 mg g(-1) of 3-O-ME was present in the AGME. AGME and the 3-O-ME significantly interfered the QS system of a QS model strain S. marcescens MG1 and its mutant S. marcescens MG44 which in turn corroborates the anti-QS mechanism of AGME. PMID:26013821

  11. Suppressive impact of anethum graveolens consumption on biochemical risk factors of atherosclerosis in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Mahbubeh Setorki

    2013-01-01

    Conclusions: A. graveolens might have some protective values against atherosclerosis and that it significantly affects some biochemical risk factors of this disease. Our findings also confirm the potential harmful effects of oxidized fats and the importance of dietary polyphenols in the meal.

  12. In Vitro and In Vivo Activities of Essential Oil from the Seed of Anethum graveolens L. against Candida spp.

    Directory of Open Access Journals (Sweden)

    Hong Zeng

    2011-01-01

    Full Text Available The essential oil produced from the seed of Anethum graveolens L. (Umbelliferae was tested in vitro and in vivo anti-Candida activity. The microbroth dilution method was used in the minimal inhibitory concentration (MIC, according to M27-A3 of the guidelines of the Clinical and Laboratory Standard Institute (CLSI. And then, efficacy evaluation of essential oil in the prophylaxis and treatment of experimental vaginal candidiasis was performed in immunosuppressed mice. The anti-Candida activity was analyzed by microbiological and histological techniques and was compared with that of fluconazole (FCZ. The results showed essential oil was active in vitro against all tested strains, with MICs ranging from 0.312 μL/mL (for C. tropicalis, C. parapsilosis, and C. krusei to 0.625 μL/mL (for 6 isolated C. albicans strains. Essential oil (2% v/v was highly efficacious in accelerating C. albicans 09-1555 clearance from experimentally infected mice vagina by prophylaxis and therapeutic treatments. In both therapeutic efficacy and prophylaxis studies, the histological findings confirmed the microbiological results. The experimental results revealed that the tested essential oil is effective against vulvovaginal candidiasis in immunosuppressed mice.

  13. Anethum graveolens Linn. (dill) extract enhances the mounting frequency and level of testicular tyrosine protein phosphorylation in rats

    Institute of Scientific and Technical Information of China (English)

    Sitthichai IAMSAARD; Thawatchai PRABSATTROO; Wannisa SUKHORUM; Supaporn MUCHIMAPURA; Panee SRISAARD; Nongnut UABUNDIT; Wipawee THUKHAMMEE

    2013-01-01

    Objective:To investigate the effect of Anethum graveolens (AG) extracts on the mounting frequency,histology of testis and epididymis,and sperm physiology.Methods:Male rats induced by cold immobilization before treating with vehicle or AG extracts [50,150,and 450 mg/kg body weight (BW)] via gastric tube for consecutive 1,7,and 14 d were examined for mounting frequency,testicular phosphorylation level by immunoblotting,sperm concentration,sperm acrosome reaction,and histological structures of testis and epididymis,respectively.Results:AG (50 mg/kg BW) significantly increased the mounting frequency on Days 1 and 7 compared to the control group.Additionally,rat testis treated with 50 mg/kg BW AG showed high levels of phosphorylated proteins as compared with the control group.In histological analyses,AG extract did not affect the sperm concentration,acrosome reaction,and histological structures of testis and epididymis.Conclusions:AG extract enhances the aphrodisiac activity and is not harmful to sperm and male reproductive organs.

  14. Evaluation of Safety and Protective Effect of Combined Extract of Cissampelos pareira and Anethum graveolens (PM52) against Age-Related Cognitive Impairment

    OpenAIRE

    Wipawee Thukham-mee; Jintanaporn Wattanathorn

    2012-01-01

    The present study aimed to determine acute toxicity, the protective effect, and underlying mechanism of PM52, a combined extract of Cissampelos pareira and Anethum graveolens, against age-related cognitive impairment in animal model of age-related cognitive impairment. PM52 was determined as acute toxicity according to OECD guideline. Male Wistar rats, weighing 180–220 g, were orally given PM52 at doses of 2, 10, and 50 mg/kg at a period of 14 days before and 7 days after the bilateral admini...

  15. Morfoanatomía y efecto del secado en la germinación de semillas de caléndula y eneldo Morphology, anatomy and influence of drying on germination of seeds of Calendula officinalis and Anethum graveolens

    OpenAIRE

    Jorge A Victoria T; Carmen R Bonilla C; Manuel S. Sánchez O

    2007-01-01

    En semillas de caléndula Calendula officinalis y de eneldo Anethum graveolens , se realizaron la descripción morfológica y anatómica y mediciones del contenido de humedad en equilibrio (CHE). La descripción morfológica y anatómica permitió precisar e ilustrar detalladamente los órganos y tejidos internos de la semilla, además, clarificar aspectos en la definición de semilla pura de caléndula. Se elaboraron curvas de secado y se midió el CHE en diferentes ambientes de secamiento artificial, ob...

  16. Ferrous Ion Chelating, Superoxide Anion Radical Scavenging and Tyrosinase Inhibitory Properties of Pure and Commercial Essential Oils of Anetrhum Graveolens

    Directory of Open Access Journals (Sweden)

    Sh Darvish Alipour Astaneh

    2013-04-01

    Full Text Available Introduction: Despite slight toxicities of essential oils, they are not under strict control in many countries. Anethum graveolens is widely consumed and its essential oils are at public reach. This study was designed to study essential oils of Anethum graveolens. Methods: The biological properties of pure and commercial essential oils of Anethum graveolens were investigated. In fact, Ferrous ion chelating activity, superoxide anion radical scavenging property, tyrosinase inhibition and total flavonoids of the oils were determined. Results: Chelating activity of 7.8 µg of EDTA was equivalent to 2 µg of the pure oil. The oils had superoxide anion radical scavenging activities which may be related to their total phenol and flavonoid contents. IC50 of ferrous ion chelating, antityrosiase and superoxide anion radical scavenging activities of pure and commercial oils were 1.3, 1.4, 1 and (171.6, 589, 132 µg respectively. Antityrosiase activity of 6.4 µg pure oil was equal to 1000 µg of the commercial oil. Conclusion: Anethum possesses antioxidative and free radical scavenging properties. This oil chelates ferrous ions and superoxide radicals. It is effective in formation of reactive toxic products. Anethum has good potentials regarding its applications in food and drug industries.

  17. Produção de voláteis por culturas de raízes transgénicas de Anethum graveolens:influência da regeneração e da capacidade de biotransformação

    OpenAIRE

    Faria, Jorge Miguel Silva, 1983-

    2008-01-01

    Foram usadas culturas de raízes transgénicas (r.t.) de Anthum graveolens para testar a possibilidade de regeneração e para avaliar a influência da capacidade de biotransformação dos álcoois monoterpénicos, mentol e geraniol, no crescimento e produção de voláteis. A regeneração foi ensaiada em fotoperíodo, de 24h luz em jiffy pellets e de 16h luz em caixas de Petri com 20 ml de meio MS/2. Parte destas foi suplementada com higromicina B (2 mg.l-1, 5 mg.l-1 e 7 mg.l-1) ou ácido salicílico (0,3; ...

  18. Rutin from Ruta graveolens L

    OpenAIRE

    Dj. Afshar; Delazar, A.

    1994-01-01

    Quantitative determination of rutin in Ruta Graveolens, L. which is easily cultivated in Iran, is necessary for its economic importance, diversity of specialities and their pharmacological activity in blood vessels disorders. For this purpose, the plant was cultivated in botanical garden of Tabriz University of Medical Sciences and rutin was determinated at different stages of plant growth. The extraction was done from the crude plants by ethanol, boiling water and hydroalcoholic solvents. Ru...

  19. Effect of fennel (Foeniculum vulgare on

    Directory of Open Access Journals (Sweden)

    Eman G.E. Helal,Fatma Ahmed Eid and Amira M. Salah EL-Din Ahmed El

    2011-04-01

    Full Text Available Hyperlipidemia (mainly increased level of total cholesterol (TC, triglycerides (TG and low-density lipoprotein(LDL cholesterol with a decrease in high-density lipoprotein(HDL- cholesterol is the predictor of coronary artery disease (CAD. Hyperlipidemia is an important risk factor in the initiation and progression of atherosclerotic impasse. Aim of the work: Many people have fast food that contains large amount of lipids and leads to the formation of free radicals which cause hyperlipidemia. The present study demonstrate the effect of the fennel (Foeniculum vulgare in the treatment of hyperlipidemia. Material and methods: Six groups (5rat/group of female albino rats (Rattus albinus were used. The 1st group used as control, in the 2nd group hyperlipidemia (25% fat and 2% cholesterol was induced for 3 weeks only then sacrified , the 3rd group was hyperlipidemic rats for 3 weeks then left for a further 3 weeks without any additional treatment as a recovery period, the 4th group served as hyperlipidemic group for 3 weeks then treated with Foeniculum vulgare for another 3 weeks (10 mg/100 gm b. wt., the 5th group was hyperlipidemic (25% fat and 2% cholesterol for 6 weeks and the 6th group served as hyperlipidemic rats for 6 weeks, and at the same time given Foeniculum vulgare (10 mg/100 gm b. wt. by oral administration. Results: The biochemical parameters showed highly significant increase in the body weight, serum glucose, ASAT, ALAT, GGT, LDH, total protein, albumin and total lipids in liver .Many histopathological and histochemical changes were detected in liver tissue of the hyperlipidemic rats. Meanwhile, the treatment with fennel ameliorated the biochemical parameters, histological and histochemical results. Conclusion: It is recommend to use fennel in diets for hyperlipidemic patients or those people who have hyperlipidemic family history.

  20. ANTIMICROBIAL POTENTIAL OF VOLATILE OIL ISOLATED FROM SOME TRADITIONAL INDIAN SPICES

    Directory of Open Access Journals (Sweden)

    Bhuyan Anupam

    2012-04-01

    Full Text Available In the present study the antimicrobial activity of Volatile Oils isolated from Traditional Indian Spices, Anethum Graveolens (Umbelliferae, Foeniculum Vulgare (Umbelliferae and Coriandrum Sativum (Umbelliferae were studied. The isolated Volatile Oils in varying concentrations were studied against Staphylococcus Coagulase, E.Coli, Streptococcus fecaelis and Staphylococcus aureus, by paper disc diffusion method, using Amoxicillin as standard drug.The results indicated that all the Volatile Oil samples from Anethum Graveolens (Dill, Foeniculum Vulgare (Fennel and Coriandrum Sativum (Coriender has antimicrobial potential and were active against almost all the microorganisms but in a dose dependent manner. Foeniculum Vulgare by far was the most potent volatile oil showing the highest activity against Staphylococcus Coagulase.

  1. Effects of Anethum chryseum Leaves Extracts on Gastric Irritation

    Directory of Open Access Journals (Sweden)

    Ali M. Bahrami

    2010-01-01

    Full Text Available As a folk remedy, Anethum chryseum leaves is used for some gastrointestinal ailments. We aimed to evaluate aqueous and ethanolic extracts of anti-ulcer and acute toxicity effects of the Anethum chryseum in mice. Gastric mucosal lesions were induced by oral administration of HCl (1 N and absolute ethanol in mice. The acidity and total acid content of gastric juice were measured in pylorus-ligated mice. LD50 values of the aqueous and ethanolic extracts were 3.04 g kg-1 i.p., (1.5, 6.16 and 6.98 g kg-1, i.p., (5.69, 8.56, respectively. The efficacy of high dose of extracts (p.o. was similar to sucralfate. The acidity and total acid content were reduced by the orally or intraperitoneally administration of the extracts. The results suggest that A. chryseum leaves extracts have significant mucosal protective and antisecretory effects of the gastric mucosa in mice.

  2. Antimicrobial and antiviral effects of essential oils from selected Umbelliferae and Labiatae plants and individual essential oil components

    OpenAIRE

    ORHAN, İlkay ERDOĞAN; ÖZÇELİK, Berrin; Kartal, Murat; Kan, Yüksel

    2012-01-01

    The essential oils obtained from Anethum graveolens, Foeniculum vulgare collected at fully-mature and flowering stages, Mentha piperita, Mentha spicata, Lavandula officinalis, Ocimum basilicum (green- and purple-leaf varieties), Origanum onites, O. vulgare, O. munitiflorum, O. majorana, Rosmarinus officinalis, Salvia officinalis, and Satureja cuneifolia, as well as the widely encountered components in essential oils (g-terpinene, 4-allylanisole, (-)-carvone, dihydrocarvone, D-limonene, (-)-ph...

  3. Total Phenolic, Flavonoids and Antioxidant Capacity of Some Medicinal and Aromatic Plants

    OpenAIRE

    Melinda Nagy; Maria Tofană; Sonia A. Socaci; Ana viorica Pop; Maria Doiniţa Borş; Anca Fărcaş; Ovidiu Moldovan

    2014-01-01

    Abstract: Antioxidants are substances that protect cells from the induced oxidative stress damage caused by unstable molecules known as free radicals that. Antioxidants neutralize free radicals as a natural by-product of normal cell processes. In the present study,were evaluated  the phenolic and flavonoids contents as well as the antioxidant capacity of seeds from  the Lamiaceae and Apiaceae family: fennel  (Foeniculum vulgare), dill (Anethum graveolens) and rosemary (Rosmarinus officin...

  4. Therapeutic and pharmacological potential of Foeniculum vulgare Mill: a review

    Directory of Open Access Journals (Sweden)

    Kooti Wesam

    2015-01-01

    Full Text Available Introduction: Fennel (Foeniculum vulgare Mill is one of the oldest spice plants which, due to its economic importance and significant pharmaceutical industry applications, is considered as one of the world’s most important medicinal plants. The purpose of this study is to investigate and collect scientific reports such as morphological characteristics, phytochemical compounds and evaluation of the therapeutic properties of this valuable medicinal plant that have been published. Methods: In order to gather the information the keywords Fennel and Foeniculum vulgare mill, therapeutic, and pharmacology have been searched until January 1, 2015 from journals accessible in databases such as ScienceDirect, Scopus, EBSCO, Medline, PubMed, Embase, SID and Iran Medex. Results: The results showed that this plant has various pharmacological properties including antioxidant, anti-cancer activity, anti-inflammatory, antifungal, anti-bacterial and estrogenic effects which are probably due to the presence of aromatic compounds such as anethole, estragole and fenshon. Conclusion: Fennel possesses various pharmacological properties and the fennel bioactive molecules play an important role in human health, hence, it might be used for different drug productions.

  5. Effect of Dill (Anethum graveolens on the severity of primary dysmenorrhea in compared with mefenamic acid: A randomized, double-blind trial

    Directory of Open Access Journals (Sweden)

    Reza Heidarifar

    2014-01-01

    Full Text Available Background: Dysmenorrhea has negative effects on women′s life. Due to side-effects of chemical drugs, there is growing trend toward herbal medicine. The aim of this study was to assess the effect of Dill compared to mefenamic acid on primary dysmenorrhea. Materials and Methods: This double-blind, randomized, clinical trial study was conducted on 75 single female students between 18 and 28 years old educating in Nursing and Midwifery School and Paramedical Faculty of Qom University of Medical Sciences of Iran in 2011. They were allocated randomly into one of the three groups: In Dill group, they took 1000 mg of Dill powder q12h for 5 days from 2 days before the beginning of menstruation for two cycles. Other groups received 250 mg mefenamic acid or 500 mg starch capsule as placebo, respectively. Dysmenorrhea severity was determined by a verbal multidimensional scoring system and a visual analog scale (VAS. Students with mild dysmenorrhea were excluded. Data were analyzed by SPSS using the descriptive statistic, paired-samples t-test, Wilcoxon signed-rank test, Mann-Whitney test, and Kruskal-Wallis test. Results: There were no significant differences between three groups for demographic or descriptive variables. Comprising the VAS showed that the participants of Dill and mefenamic acid groups had lower significant pain in the 1 st and the 2 nd months after treatment, whereas in the placebo group this was only significant in the 2 nd month (P < 0.05. Conclusion: Dill was as effective as mefenamic acid in reducing the pain severity in primary dysmenorrhea. Further studies regarding side-effects of Dill and its interactivity are recommended.

  6. Antiprotozoal activity of the constituents of Teloxys graveolens.

    Science.gov (United States)

    Calzada, Fernando; Velázquez, Claudia; Cedillo-Rivera, Roberto; Esquivel, Baldomero

    2003-08-01

    Antiprotozoal activity-guided fractionation of a methanol extract of the aerial parts of Teloxys graveolens led to the isolation of one coumarinic acid derivative, melilotoside, and five flavonoids, pinocembrine, pinostrobin, chrysin, narcissin and rutin. Among them, melilotoside exhibited the most potent activity toward Entamoeba histolytica and Giardia lamblia (IC(50) 12.5 and 16.8 micro g/mL, respectively). Narcissin showed selectivity against E. histolytlica (IC(50) 17.2 micro g/mL). The results support data for the traditional use of T. graveolens in some gastrointestinal diseases. PMID:12916068

  7. Foeniculum vulgare Mill: A Review of Its Botany, Phytochemistry, Pharmacology, Contemporary Application, and Toxicology

    OpenAIRE

    Shamkant B. Badgujar; Patel, Vainav V.; Bandivdekar, Atmaram H.

    2014-01-01

    Foeniculum vulgare Mill commonly called fennel has been used in traditional medicine for a wide range of ailments related to digestive, endocrine, reproductive, and respiratory systems. Additionally, it is also used as a galactagogue agent for lactating mothers. The review aims to gather the fragmented information available in the literature regarding morphology, ethnomedicinal applications, phytochemistry, pharmacology, and toxicology of Foeniculum vulgare. It also compiles available scienti...

  8. FOURIER TRANSFORM INFRA RED (FT-IR) SPECTRAL STUDIES OF FOENICULUM VULGARE

    OpenAIRE

    V. Devika; Mohandass, S.; T. Nusrath

    2013-01-01

    Plants have been used in traditional medicine for several thousand years. Medicinal plants as a group comprise approximately 8000 species and account for about 50% of all the higher flowering plant species in India. In the present study, the plant Foeniculum vulgare was subjected to FT-IR spectroscopy. FT-IR-is a vibrational spectroscopy that records absorptions of IR light by chemical bonds in all molecules incl. polymers. Foeniculum vulgare (Apiaceae) commonly known as fennel is a well know...

  9. Pharmacological evidence of hypotensive activity of Marrubium vulgare and Foeniculum vulgare in spontaneously hypertensive rat.

    Science.gov (United States)

    El Bardai, S; Lyoussi, B; Wibo, M; Morel, N

    2001-05-01

    The hypotensive effects of the water extract of Marrubium vulgare L. and Foeniculum vulgare L. were investigated in spontaneously hypertensive rats (SHR) and in normotensive Wistar-Kyoto rats (WKY). Oral administration of Marrubium or Foeniculum extract lowered the systolic blood pressure of SHR but not of WKY. In SHR, Foeniculum but not Marrubium treatment increased water, sodium and potassium excretion. Ex vivo as well as in vitro, Marrubium extract inhibited the contractile responses of rat aorta to noradrenaline and to KCl (100 mM). Inhibition was greater in aorta from SHR compared to WKY and was not affected by the NO synthase inhibitor N-nitro-L-arginine. Vascular effects of Foeniculum extract were less pronounced than those of Marrubium and were blocked by N-nitro-L-arginine. These results indicate that hypotensive activity of Marrubium and Foeniculum extracts seems to be mediated through different pathways: Foeniculum appeared to act mainly as a diuretic and a natriuretic while Marrubium displayed vascular relaxant activity. PMID:11349824

  10. Actividade antimicrobiana do óleo essencial do Foeniculum vulgare Miller Antimicrobial activity of Foeniculum vulgare Miller essential oil

    Directory of Open Access Journals (Sweden)

    M. T. Tinoco

    2007-01-01

    Full Text Available O Foeniculum vulgare Mill. subsp. vulgare é uma planta espontânea da região mediterrânea, pertencente à família Apiaceae. O seu óleo essencial, principalmente o dos frutos secos, é amplamente utilizado nas indústrias alimentar, farmacêutica, cosmética e perfumaria. Neste trabalho, pretendeu-se avaliar a actividade antimicrobiana do óleo essencial dos frutos verdes e das folhas da variedade de funcho doce colhido no Alentejo, na região de Évora, e relacionar essa actividade com a respectiva composição química. A extracção dos óleos essenciais foi efectuada por hidrodestilação e a sua análise foi feita por GC-FID e GC-MS. No óleo das folhas foram identificados como componentes maioritários os fenilpropanóides anetol, fenchona e estragol e o monoterpeno a-felandreno, enquanto que o óleo dos frutos apresentou como constituintes predominantes anetol e fenchona. A actividade antimicrobiana dos óleos foi avaliada face às estirpes Staphylococcus aureus, Escherichia coli, Saccharomyces spp., Fusarium oxysporum e Penicillium sp.. Os óleos essenciais apresentaram actividade antimicrobiana contra S. aureus, Saccharomyces spp. e Fusarium oxysporum.Foeniculum vulgare Mill. ssp. vulgare is a spontaneous plant of Mediterranean region that belongs to the Apiaceae family. Its essential oil is used as additives in food, pharmaceutical, cosmetic and perfume industries mainly that one obtained from dried seeds. The main goal of this work were to evaluate the antimicrobial activity of essential oils obtained from fresh leaves and unripe seeds of sweet fennel, collected in Évora-Alentejo, in face of their chemical composition. The extraction of the essentials oils was made by hydrodistillation. Chemical analyses were carried out by GC-FID and GCMS. Phenylpropanoides anethole, fenchone, estragole and the monoterpene aphellandrene were the most abundant compounds of leaves essential oil. Seeds essential oil showed as main components

  11. Chemical composition, therapeutic potential and perspectives of Foeniculum vulgare

    Directory of Open Access Journals (Sweden)

    Chanchal Garga

    2009-01-01

    Full Text Available Foeniculum vulgare is a widely distributed plant in most tropical and subtropical countries and have long been used in folk medicines to treat obstruction of the liver, spleen and gall bladder and for digestive complaints such as colic, indigestion, nausea and flatulence. In recent years the interest in this plant has increased considerably with substantial progress on its chemical and pharmacological properties. This review discusses the current knowledge of its chemistry, the various compounds isolated and pharamcological studies conducted. These studies carried out with the extracts and volatile oil support most of the reports of using this plant in folk medicines. However, well controlled, double-binding clinical trials are lacking. Several compounds including trans-anethole, estragole, fenchone and polyphenolics were isolated from this plant and some of these interact with potential mechanisms of the body. Together this data strongly supports the view that this plant has potential beneficial therapeutic actions in the management of bacterial and fungal infections, colic pain and lipid peroxidation.

  12. Supercritical Fluid Extraction of Botanical Pesticides from Pelargonium graveolens

    OpenAIRE

    Machalová, Z. (Zdeňka); Sajfrtová, M. (Marie); Karban, J. (Jindřich); Pavela, R.

    2013-01-01

    Supercritical fluid extraction was used for isolation of volatiles from P. graveolens to reach maximal biological aktivity of extracts. The extraction yields increased with increasing density of CO2 and the extract with high concentration of volatiles was achieved at SFE conditions 9 MPa, 50°C. The acute and chronic toxicity of isolates were tested on model organism Spodoptera littoralis. The isolate from hydrodistillation was more effective in terms of acute toxicity than other extracts due ...

  13. Supercritical Fluid Extraction of Botanical Pesticides from Pelargonium graveolens

    Czech Academy of Sciences Publication Activity Database

    Machalová, Zdeňka; Sajfrtová, Marie; Karban, Jindřich; Pavela, R.

    Salerno : Centro Stampa di Ateneo, 2013 - (Reverchon, E.; De Marco, I.), s. 133-138 ISBN 88-7897-061-1. [Conference on Supercritical Fluids and Their Applications /10./. Napoli (IT), 29.05.2013-06.05.2013] R&D Projects: GA TA ČR TA01010578 Institutional support: RVO:67985858 Keywords : supercritical fluid extraction * Pelargonium graveolens * chemical composition Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  14. Supercritical Fluid Extraction of Botanical Pesticides from Pelargonium graveolens

    Czech Academy of Sciences Publication Activity Database

    Machalová, Zdeňka; Sajfrtová, Marie; Karban, Jindřich; Pavela, R.

    Salerno: Centro Stampa di Ateneo, 2013 - (Reverchon, E.; De Marco, I.), s. 133-138 ISBN 88-7897-061-1. [Conference on Supercritical Fluids and Their Applications /10./. Napoli (IT), 29.05.2013-06.05.2013] R&D Projects: GA TA ČR TA01010578 Institutional support: RVO:67985858 Keywords : supercritical fluid extraction * Pelargonium graveolens * chemical composition Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  15. Foeniculum vulgare Mill: A Review of Its Botany, Phytochemistry, Pharmacology, Contemporary Application, and Toxicology

    Directory of Open Access Journals (Sweden)

    Shamkant B. Badgujar

    2014-01-01

    Full Text Available Foeniculum vulgare Mill commonly called fennel has been used in traditional medicine for a wide range of ailments related to digestive, endocrine, reproductive, and respiratory systems. Additionally, it is also used as a galactagogue agent for lactating mothers. The review aims to gather the fragmented information available in the literature regarding morphology, ethnomedicinal applications, phytochemistry, pharmacology, and toxicology of Foeniculum vulgare. It also compiles available scientific evidence for the ethnobotanical claims and to identify gaps required to be filled by future research. Findings based on their traditional uses and scientific evaluation indicates that Foeniculum vulgare remains to be the most widely used herbal plant. It has been used for more than forty types of disorders. Phytochemical studies have shown the presence of numerous valuable compounds, such as volatile compounds, flavonoids, phenolic compounds, fatty acids, and amino acids. Compiled data indicate their efficacy in several in vitro and in vivo pharmacological properties such as antimicrobial, antiviral, anti-inflammatory, antimutagenic, antinociceptive, antipyretic, antispasmodic, antithrombotic, apoptotic, cardiovascular, chemomodulatory, antitumor, hepatoprotective, hypoglycemic, hypolipidemic, and memory enhancing property. Foeniculum vulgare has emerged as a good source of traditional medicine and it provides a noteworthy basis in pharmaceutical biology for the development/formulation of new drugs and future clinical uses.

  16. Foeniculum vulgare Mill: a review of its botany, phytochemistry, pharmacology, contemporary application, and toxicology.

    Science.gov (United States)

    Badgujar, Shamkant B; Patel, Vainav V; Bandivdekar, Atmaram H

    2014-01-01

    Foeniculum vulgare Mill commonly called fennel has been used in traditional medicine for a wide range of ailments related to digestive, endocrine, reproductive, and respiratory systems. Additionally, it is also used as a galactagogue agent for lactating mothers. The review aims to gather the fragmented information available in the literature regarding morphology, ethnomedicinal applications, phytochemistry, pharmacology, and toxicology of Foeniculum vulgare. It also compiles available scientific evidence for the ethnobotanical claims and to identify gaps required to be filled by future research. Findings based on their traditional uses and scientific evaluation indicates that Foeniculum vulgare remains to be the most widely used herbal plant. It has been used for more than forty types of disorders. Phytochemical studies have shown the presence of numerous valuable compounds, such as volatile compounds, flavonoids, phenolic compounds, fatty acids, and amino acids. Compiled data indicate their efficacy in several in vitro and in vivo pharmacological properties such as antimicrobial, antiviral, anti-inflammatory, antimutagenic, antinociceptive, antipyretic, antispasmodic, antithrombotic, apoptotic, cardiovascular, chemomodulatory, antitumor, hepatoprotective, hypoglycemic, hypolipidemic, and memory enhancing property. Foeniculum vulgare has emerged as a good source of traditional medicine and it provides a noteworthy basis in pharmaceutical biology for the development/formulation of new drugs and future clinical uses. PMID:25162032

  17. Antioxidant and antiangiogenic activity of Astronium graveolens Jacq. leaves.

    Science.gov (United States)

    Hernández, Vanessa; Malafronte, Nicola; Mora, Flor; Pesca, Maria S; Aquino, Rita P; Mencherini, Teresa

    2014-01-01

    Angiogenesis is involved in many physiological and pathological conditions. Natural compounds with antioxidant activity have also been reported to possess potent antiangiogenic properties by regulating angiogenesis modulators such as vascular endothelial growth factor (VEGF). Based on this, we screened the antioxidant and antiangiogenic activities of Astronium graveolens leaf extracts by a DPPH test and a competitive enzyme-linked immunosorbent assay, respectively. MeOH extract expressed a significant free radical-scavenging activity (EC₅₀ = 37.65 μg/mL) and it was able to inhibit the interaction between placental growth factor (PlGF) (placental growth factor), a VEGF family member, and its receptor Flt-1 by more than 50% at 1 mg/mL. 1,2,3,4,6-Penta-O-galloyl-d-glucopyranose, 6 is the most active compound of the extract. It exhibited a high potency in scavenging DPPH (EC₅₀ = 2.16 μg/mL) and reduced by 58% the PlGF/Flt-1 interaction at a concentration of 50 μM. Moreover, the known compounds (1-6) have been isolated for the first time in A. graveolens. PMID:24588321

  18. FOURIER TRANSFORM INFRA RED (FT-IR SPECTRAL STUDIES OF FOENICULUM VULGARE

    Directory of Open Access Journals (Sweden)

    V. Devika

    2013-03-01

    Full Text Available Plants have been used in traditional medicine for several thousand years. Medicinal plants as a group comprise approximately 8000 species and account for about 50% of all the higher flowering plant species in India. In the present study, the plant Foeniculum vulgare was subjected to FT-IR spectroscopy. FT-IR-is a vibrational spectroscopy that records absorptions of IR light by chemical bonds in all molecules incl. polymers. Foeniculum vulgare (Apiaceae commonly known as fennel is a well known and important medicinal and aromatic plant widely used as carminative, digestive, lactogogue and diuretic and in treating respiratory and gastrointestinal disorders. The results showed the detections of the bands in organic molecules. Thus the study became evident that the plant posses some bioactive compounds at various bands obtained after FT-IR.

  19. PROMOTIVE EFFECT OF IRRADIATED SODIUM ALGINATE ON SEED GERMINATION CHARACTERISTICS OF FENNEL (FOENICULUM VULGARE MILL.)

    OpenAIRE

    Mohd. Idrees; M. Naeem; Tariq Aftab; Nadeem Hashmi; M. Masroor A. Khan; Moinuddin; Lalit Varshney

    2012-01-01

    Radiolytically derived oligomers of sodium alginate are considered to act as signal molecules, affecting growth, development and defense mechanisms of plants through gene regulation. Since germination is a critical stage in the life cycle of plants, the objective of this study was to determine the effect of irradiated sodium alginate (ISA) on the characteristics of seed germination of Foeniculum vulgare Mill. Soaking the seeds in an aqueous solution of ISA showed significant improvement in va...

  20. 5-Lipoxygenase Inhibition of the Fructus of Foeniculum vulgare and Its Constituents

    OpenAIRE

    Lee, Je Hyeong; Lee, Dong Ung; Kim, Yeong Shik; Kim, Hyun Pyo

    2012-01-01

    The fruits of Foeniculum vulgare (Foeniculi Fructus) have been widely used in Chinese medicine as an antiemetic, ameliorating stomach ailments and as an analgesic. In order to establish its potential for antiallergic use, inhibitory actions of the fruiton 5-lipoxgenase (5-LOX) and β-hexosaminidase release were evaluated. The 70% ethanol extract of this plant material (FR) considerably inhibited 5-LOX-catalyzed leukotriene production from A23187-induced rat basophilic leukemia (RBL)-1 cells. T...

  1. EFFECT OF FOENICULUM VULGARE SEED EXTRACT ON MAMMARY GLANDS AND OVIDUCTS OF OVARIECTOMISED RATS

    OpenAIRE

    Devi, K; Vanithakumari, G.; Anusya, S; Mekala, N.; Malini, T.; Elango, V.

    1985-01-01

    The effect of acetone extracts of Foeniculum vulgare Mill., seeds at different dose levels (50/ug, 150/ug and 250/ug/100gm body wt.) on mammary glands and oviducts of castrated rats was investigated. The extract was found to increase nucleic acids and protein concentration as well as the organ weights in both the tissues. The medium and high doses were very effective. The results confirm the estrogenic nature of the seed extract.

  2. A PROMISING TREND IN THE PROCESSING OF FENNEL (FOENICULUM VULGARE MILL.) WHOLE PLANTS

    OpenAIRE

    Timasheva, Lidiya; Gorbunova, Elena

    2014-01-01

    Aromatic plants are a valuable source of biologically active substances. The use of aromatic plant processing products in the pharmaceutical, perfume and cosmetic, and food industries is of great interest. The search for new plant sources of biologically active substances and the study of their composition and properties are still topical. Fennel ( Foeniculum vulgare Mill. ) is a promising aromatic raw material containing a number of biologically active substances. Until now, essential oils w...

  3. Susceptibility of Two Sitophilus species (Coleoptera: Curculionidae) to Essential Oils from Foeniculum vulgare and Satureja hortensis

    OpenAIRE

    Asgar Ebadollahi

    2011-01-01

    This study was conducted to determine the insecticidal activity of essential oils from Fennel, Foeniculum vulgare (Apiaceae), and Summer savory, Satureja hortensis (Lamiaceae), against two stored-product insects. Essential oils from two species of plants were obtained by Clevenger-type water distillation and their fumigant toxicities were tested against adults of the wheat weevil, Sitophilus granarius and rice weevil, Sitophilus oryzae (Curculionidae). The mortality was determined after 24 an...

  4. Standardization of Fennel (Foeniculum vulgare, Its Oleoresin and Marketed Ayurvedic Dosage Forms

    Directory of Open Access Journals (Sweden)

    Pasrija Anubhuti

    2011-07-01

    Full Text Available Fennel, Foeniculum vulgare, one of the most common use in India kitchen as a spice and as well as in traditional medicine for its estrogenic, lactagouge, diuretic, antioxidant, immune booster and its usefulness in dyspepsia. The use of medicinal plants by the general population is an old and still widespread practice that makes studies of their correct identification are very essential. In the present study the fruit of the plant, raw materials, their oleo resins and marketed formulations was subjected to Standardization parameter viz macro-microscopic, physico-chemical, microbial, heavy metals and Thin Layer Chromatography to fix the quality standards of this drug. Anethole, an active compound of Foeniculum vulgare, was also analyzed in different samples of Foeniculum vulgare. The result shown that physicochemical parameters evaluated are useful in standardization, Heavy metals and microbial load for raw materials, oleoresins and finished formulations are found to be within the limit of WHO guidelines, indicating that they are free from pathogens and they are safe to be used in Indian System of medicine. The data obtained from the study would be useful in the identification of the fruits of Fennel and serve as standards. The above parameters studied, may be used as a tool for the correct identification and standardization of the plant also to test the adulterants if any.

  5. Fototoxicidad tras exposición a ruta graveolens

    Directory of Open Access Journals (Sweden)

    P. Zayas-Pinedo

    2014-12-01

    Full Text Available La fototoxicidad es un tipo de reacción cutánea inflamatoria que se produce como consecuencia de la exposición a una sustancia química en combinación con la exposición a radiaciones lumínicas. Ruta graveolens, comúnmente llamada ruda, ha sido descrita en numerosas publicaciones como sustancia causante de reacciones de fototoxicidad. Presentamos el caso de una pareja que sufrió una reacción de fototoxicidad que requirió ingreso en la Unidad de Quemados como consecuencia del contacto con una infusión de ruda y posterior exposición solar. Consideramos que todo profesional que se ocupa del tratamiento de quemaduras debe incluir las fitofotodermatitis dentro del diagnóstico diferencial de las pérdidas cutáneas de espesor parcial.

  6. Potential allelochemicals from the essential oil of Ruta graveolens.

    Science.gov (United States)

    De Feo, Vincenzo; De Simone, Francesco; Senatore, Felice

    2002-11-01

    The essential oil of aerial parts of Ruta graveolens was obtained by hydrodistillation with a 0.74% yield on a dry weight basis. Thirty-eight components were identified by GC and GC-MS analyses. 2-Ketones predominated in the essential oil, with undecan-2-one (46.8%) and nonan-2-one (18.8%) as the main constituents. The essential oil and some of its constituents were tested for their allelopathic activity in vitro on radish germination and radicle growth in light and darkness. The essential oil and some of its minor constituents were effective and dose-dependent inhibitors of both the germination and radicle growth; 2-ketones are not active. The possible allelopathic activity of rue essential oil and some its isolated constituents is reported. PMID:12409025

  7. Total Phenolic, Flavonoids and Antioxidant Capacity of Some Medicinal and Aromatic Plants

    Directory of Open Access Journals (Sweden)

    Melinda Nagy

    2014-11-01

    Full Text Available Abstract: Antioxidants are substances that protect cells from the induced oxidative stress damage caused by unstable molecules known as free radicals that. Antioxidants neutralize free radicals as a natural by-product of normal cell processes. In the present study,were evaluated  the phenolic and flavonoids contents as well as the antioxidant capacity of seeds from  the Lamiaceae and Apiaceae family: fennel  (Foeniculum vulgare, dill (Anethum graveolens and rosemary (Rosmarinus officinalis . (Sreemoyee Ch. et. al., 2012 The main objective of the study was the comparative assessment of the phenolic and flavonoid compounds from dill, rosemary and fennel methanolic extracts correlated with their  antioxidant activity. Both total phenolic content and flavonoids content of the seeds samples were measured spectrophotometrically using the Folin-Ciocalteu assay and a chromogenic system of NaNO2–Al(NO33–NaOH, respectively.. Antioxidant capacity was determined by 2,2-DPPH method. Results strongly showed that Rosmarinus officinalis extract has the most effective antioxidant capacity in scavenging DPPH radicals, while Foeniculum vulgare and Anethum graveolens were less active. The total phenolic content was within 773,14 and 3367,24mg GAE/ 100g while the concentration in flavonoids was between 231,84 and 1325,53 QEg/100g dry seeds.  

  8. Infraspecific morphological variations in Acinos graveolens (M.B. Link

    Directory of Open Access Journals (Sweden)

    Seyed M. Talebi

    2015-05-01

    Full Text Available This study compares the effect of ecological factors on phenotype plasticity in the natural populations of Acinos graveolens in Iran. In total, twenty six quantitative and qualitative morphological traits were examined in the sixteen populations at two sections: inter- and intrapopulation. In the interpopulation section, averages amounts of morphological characteristics of populations were examined, while in the intrapopulation, morphological features of the seventy six plant samples of the populations were investigated. The obtained data showed that these characteristics differed between and within the populations and the analysis of variance test and one-sample test have shown significant differences of all quantitative characteristics. The biplot Principal Correspondence Analysis (PCA-biplot of traits showed some populations had indicator morphological characteristic(s which were useful in detecting of these populations. Significant correlations were found between some quantitative characteristics with ecological factors. The studied populations were separated from each other in the PCA and Principal Coordinate Analysis (PCO plots and the Unweighted Paired Group using Average method (UPGMA tree. The PCA plot of morphological features showed that some characteristics separated from others and the rest ones were together and had overlapping. The individuals of the studied populations were separated from others in the PCA and PCO plots and the UPGMA tree of the morphological characteristics. Individuals of some populations arranged separately and placed far from others, but this condition was reverse in the rest populations and most of individuals placed near each other. The obtained data confirmed high variations within some populations.

  9. Hypolipidemic Effects of Seed Extract of Celery (Apium graveolens in Rats

    Directory of Open Access Journals (Sweden)

    Kamal Mansi

    2009-01-01

    Full Text Available The hypolipidemic effects of ethanol extract of A. graveolens L. (Apiaceae were investigated. Forty adult male albino rats weighing about 260 g each, were divided into four groups (n = 10. Experimental animals were gavaged at doses of 213 and 425 mg/kg body wt. for sixty consecutive days. Extract showed a significant decrease (p< 0.05 of serum total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-c, and significant increase (p< 0.05 in high-density lipoprotein cholesterol (HDL-c in the treated groups. The oral administration of ethanol extract of A. graveolens revealed good hypolipideamic effects in adult male albino rats. The results have given a considerable agreement to the traditional use of A. graveolens in the treatment of hyperlipidemia; it could possibly lead to appropriate changes in blood lipid profiles.

  10. Extraction, characterization and evaluation of antibacterial activity of essential oil of Senecio graveolens Wedd (Wiskataya)

    OpenAIRE

    Kiev Ochoa Pumaylle; Luis Ricardo Paredes Quiroz; Dagnith Liz Bejarano Luján; Reynaldo Justino Silva Paz

    2012-01-01

    The aim of this work was extract, characterize and evaluate the antibacterial activity of the essential oil of Senecio graveolens Wedd (Wiskataya) against Escherichia coli and Staphylococcus aureus ATCC 29923. The leaves and stems of S. graveolens were collected in the district of Puquio 3800 m.s.n.m., Lucanas province, and department of Ayacucho. The essential oil was obtained by steam water destilation dried leaves and stems with yield 1.26% (w/w) to which physical testing were performed. T...

  11. COMPARATIVE STUDY OF IN VITRO ANTIMICROBIAL ACTIVITIES OF FOENICULUM VULGARE MILL. (UMBELLIFERAE EXTRACT

    Directory of Open Access Journals (Sweden)

    Khadija Dahak

    2013-01-01

    Full Text Available The importance to push scientifically the investigations on the organic extracts of the plants aromatic as potential source of new antimicrobial compounds comes from the traditional use of the plants. However, the consumption of these natural products requires à thorough research in this field. The antimicrobial effect of organic and aqueous leaves extracts of Foeniculum vulgare Mill., However, which makes difficult this antimicrobial activity, is the insolubility of organic extracts in water. The standard M27-T technique is basically used to cure this problem. The microorganisms under examination were Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus hirea, Escherichia coli and Candida albicans. The M27-T technique allowed us to determine the Minimum Inhibitory Concentrations (MICs of different extracts. Therefore, the test’s results showed that the all samples were clearly different in terms of antimicrobial activities. All extracts of Foeniculum vulgare showed the most activity on all the microorganisms tested. The most significant and active extract under study were methanol and ethyl acetate on all the bacteria tested in comparaison to the hexane and aqueous extracts. On the other hand, the results of antimicrobial activity of aqueous extract were more compelling than the hexane and dichloromethane extracts when used on Candida albicans (ATCC and CBS (MIC = 0,78 mg mL-1. It then appear that C. albicans ATCC is the least susceptible microorganisms to the ethyl acetate extract. The chloramphenicol, amoxicillin and amphotericin B were used as standard antibiotics to carry this study."

  12. Evaluation of Salt Stress at Gerimination and Seedling Stages of Foeniculum vulgare Mill. in Hydroponic Condition

    Directory of Open Access Journals (Sweden)

    2015-11-01

    Full Text Available Identification of medicinal plants with tolerance to salinity stress has an economical importance in Iran. This study was carried out to evaluate the effects of salinity stress on different Morpho-Physiological traits of Foeniculum vulgare Mill in germination and seedling stage in hydroponic condition. The experiment was conducted as a split plot based on a Randomized Complete Block Design (RCBD with four (in first experiment and three (in second experiment replications. Salinity effects of NaCl [0, 50, 100, 150 200 (Mm] was evaluated on three genotypes of  Foeniculum vulgare (Estahban, Isfahan, Shiraz. Analysis of variance showed that salinity levels reduced the percentage of germination, seed vigor index, rootlenght, stem length, root dry weight, shoot dry weight, biomass, the ratio of shoot to root, chlorophyll index, chlorophyll a and b and caroteniod content. Significant variation was observed between different genotypes on different levels of salinity. Tolerance to salinity in seedling was more than germination. In two experiments, the genotype of Shiraz showed superiority in view point of tolerance.

  13. Extraction, characterization and evaluation of antibacterial activity of essential oil of Senecio graveolens Wedd (Wiskataya

    Directory of Open Access Journals (Sweden)

    Kiev Ochoa Pumaylle

    2012-12-01

    Full Text Available The aim of this work was extract, characterize and evaluate the antibacterial activity of the essential oil of Senecio graveolens Wedd (Wiskataya against Escherichia coli and Staphylococcus aureus ATCC 29923. The leaves and stems of S. graveolens were collected in the district of Puquio 3800 m.s.n.m., Lucanas province, and department of Ayacucho. The essential oil was obtained by steam water destilation dried leaves and stems with yield 1.26% (w/w to which physical testing were performed. The chemical composition was evaluated by gas chromatography with mass detector (GC-MS. Antibacterial activity of S. graveolens oil was tested by agar diffusion method in wells against Gram positive strains such as S. aureus ATCC 29923 and Gram negative as E. coli. The density a 20 ºC was 0.8755 g/ml; the index refraction was 1.4726 and the rate rotation was 102° 85' and the solubility miscible in ethanol. The GC-MS showed the main components sabinene (52.39 %, (+-4-carene (8.20 %, τ-terpinen (7.11 %, β-myrcene (6.74 %, 4-terpinenol (3.78 % and pulegone (3.67 %. The results showing activity strong antibacterial activity and moderate, respectively, for the strains tested, observing formation of inhibition halos for essential oil concentrations at 80, 90 and 100 % in both strains. The essential oil of S. graveolens presented with promising antibacterial activity.

  14. Apium graveolens accentuates urinary Ca +2 excretions in experimental model of nephrocalcinosis

    Directory of Open Access Journals (Sweden)

    Faruk H Al Jawad

    2011-01-01

    Full Text Available Nephrocalcinosis (NC is a state characterised by deposition of calcium phosphate or oxalate in the renal parenchyma due to different clinical conditions. Apium graveolens (Celery is a popular vegetable added to salads and many cooked dishes, used in Chinese medicine to reduce high blood pressure and in Arabic medicine to relieve renal pains. To evaluate the effect of A. graveolens in reducing calcium deposits from renal parenchyma in rabbit models with induced NC by a large dose of oxalic acid. A. graveolens produced a significant reduction of blood urea nitrogen (5.7±0.05 vs 7.3±0.2 mmol/l, serum creatinine (87.2±0.63 vs 97.3±0.5 mmol/l and serum Na + levels (136.8±0.2 vs 142.16±0.7 mmol/l with non-significant reduction in serum K + (3.3±0.8 vs 3.8±0.03. There is a significant reduction in calcium deposition in renal parenchyma in comparison to the control group after ten days of treatment. A. graveolens showed a significant diuretic effect that accentuates the excretion of urinary calcium.

  15. Parameters of Cs 137 and Sr 90 transition from soil into salad crops

    International Nuclear Information System (INIS)

    Transition coefficients of Cs 137 and Sr 90 from soil into plants for potherb of bulb onion (Allium cepa), parsley (Petroselinum crispum), dill (Anethum graveolens), celery (Apium graveolens) and coriander (Coriandrum sativum) have been defined. (authors)

  16. Effect of Ruta graveolens and Cannabis sativa alcoholic extract on spermatogenesis in the adult wistar male rats

    OpenAIRE

    Sailani, M. R.; Moeini, H.

    2007-01-01

    Objective: The present study was undertaken to evaluate the effects of alcohol extracts of Ruta graveolens and Cannabis sativa that were used traditionally in medieval Persian medicine as male contraceptive drugs, on spermatogenesis in the adult male rats. Materials and Methods: Ethanol extracts of these plants were obtained by the maceration method. The male rats were injected intraperitionaly with C. sativa and R. graveolens 5% ethanol extracts at dose of 20 mg/day for 20 consecutive days, ...

  17. Avaliação biológica de Foeniculum vulgare (Mill. (Umbelliferae/Apiaceae Biological evaluation of Foeniculum vulgare (Mill. (Umbelliferae/Apiaceae

    Directory of Open Access Journals (Sweden)

    O. Araujo R

    2013-01-01

    Full Text Available Foeniculum vulgare Mill. é espécie herbácea da família Umbelliferae, nativa da região do Mediterrâneo e da Ásia Menor, amplamente distribuída em todo o território brasileiro. É conhecida popularmente como funcho ou erva-doce e usada na medicina como analgésico, digestivo, carminativo, diurético, expectorante, lactígeno, anti-inflamatório, e antiespasmódico. O extrato bruto etanólico para a verificação das atividades biológicas foi preparado a partir de sementes compradas no comércio. Para a realização do perfil fitoquímico foi utilizada a cromatografia em camada delgada analítica; a atividade antimicrobiana foi determinada pelo teste de difusão em disco de papel e da concentração inibitória mínima (CIM; a atividade antinociceptiva foi realizada pelo método de contorções abdominais em cobaias. Os micro-organismos testados foram isolados clínicos multirresistentes obtidos do Setor de Bacteriologia do Hospital das Clínicas de Pernambuco. O estudo fitoquímico identificou a maioria dos compostos secundários presentes na fração metanólica das sementes, sendo eles: triterpenos, glicosídeos de flavanóides, terpenos menores (monoterpenóides, sesquiterpenóide e diterpenóides, e açúcares redutores. Os resultados obtidos mostraram que o extrato etanólico apresentou maior atividade frente à Micrococcus spp. (CIM=250µg/mL. Os resultados da avaliação da atividade antinociceptiva demonstraram que apenas a dosagem de 298 mg/Kg quando comparado com o padrão indometacina conseguiu uma redução significativa no número de contorções abdominais dos animais. Estudos posteriores deverão ser realizados para a identificação e isolamento de alguns compostos secundários, bem como a realização de outros protocolos de analgesia.Foeniculum vulgare Mill. (Umbelliferae is a herbaceous plant of the family Umbelliferae, native to the Mediterranean and Asia Minor region and widely distributed all over the Brazilian

  18. Chemical composition of the essential oil from Microlicia graveolens growing wild in Minas Gerais

    OpenAIRE

    Anja B. Toudahl; Sidney A. V. Filho; Gustavo H. B. Souza; Luisa D. Morais; Orlando D. H. dos Santos; Anna K. Jäger

    2012-01-01

    The chemical composition of the essential oil of the aerial parts of Microlicia graveolens DC., Melastomataceae, growing wild in the mountains of Minas Gerais, Brazil, was investigated for the first time. A pale orange to colourless oil was obtained in a yield of 4.8%. The oil was analyzed by GC-MS. The main components were (+)-trans-pinocarvyl acetate (78.9%), (-)-trans-pinocarvyl acetate (5.5%) and β-pinene (3.8%).

  19. Preliminar toxicological assesement of Ruta graveolens, Origanum vulgare and Persea americana on the preimplantational mouse embryos

    OpenAIRE

    Benavides, V; Trujillo, G; G. D'Arrigo; U. Paredes; J. Pino

    2014-01-01

    The growing interest in natural medicine makes it necessary to study plant properties as well as their possible secondary effects. In recent years the toxic effects of many medicinal plants on the preimplantational mouse embryo development have been studied. Many of them produce malformations and alterations in the embryonic development. Ruta graveolens "ruda", Origanum vulgare "oregano" and Persea americana "palta" are used in rural areas to menstrual colic and to provoke abortion (estrella,...

  20. Triterpenos aislados de corteza de Bursera graveolens (Burseraceae y su actividad biologica

    Directory of Open Access Journals (Sweden)

    Jorge Robles

    2005-12-01

    Full Text Available Bursera graveolens (Burseraceae, known in Colombia as "sasafrás", is useful for its medicinal properties and is rich in secondary metabolites. In our research, we carried out antimicrobial tests of several fractions and ethanolic extracts from aerial parts against Bacillus subtilis and Staphylococcus aureus, that showed growth inhibitory activity when applied at 250 mg/mL for extracts and 150 mg/mL for fractions. We carried out an antiinflamatory assay also, that showed 71% of inhibition by extracts (81% of Indomethacin and 70% of inhibition by fractions (78% of Indomethacin. Phytochemical investigation of the bark of Bursera graveolens (Burseraceae yielded three tetracyclic triterpene acids that have oxygenation in C-3, carboxylic acid in C-21 and unsaturation in C-24 and have been identified as 3-oxotirucalla-8,24-dien-21-oic acid (b-elemonic acid, 3a-hydroxytirucalla-8,24-dien-21-oic acid (a-elemolic acid and 3a-hydroxytirucalla-7,24-dien-21-oic acid. The isolated compounds were identified using spectroscopic methods including one and two-dimensional Nuclear Magnetic Resonance (COSY, HMQC, HMBC, NOESY experiments and comparison with published data. This is the first report of the isolated compounds in Bursera graveolens and they have a very important chemotaxonomic significance within the Burseraceae family and related families from the order Rutales.

  1. Lippia graveolens and Carya illinoensis Organic Extracts and there in vitro Effect Against Rhizoctonia Solani Kuhn

    Directory of Open Access Journals (Sweden)

    Francisco D. Hernandez-Castillo

    2010-01-01

    Full Text Available Problem statement: Plant extracts with polyphenolic compounds obtained with different solvents have been evaluated against plant pathogens. However, most of these extract have been obtained using solvents no allowed under an organic production context. Approach: In the present research was to evaluate the inhibitory effect of polyphenolic extracts from L. graveolens and C. illinoensis, obtained with alternative organic solvents (lanolin and cocoa butter, water and ethanol against R. solani in order to determine the Inhibitory Concentration (IC50 of each extract. Results: The results showed that extracts of both L. graveolens and C. illinoensis obtained with lanolin and ethanol (200 and 3000 ppm of total tannins, respectively inhibited at 100% growth of R. solani. The IC50 for each extract was highly variable, low IC50 values were obtained with L. graveolens (4.50×101 and C. illinoensis (4.33×102 extract using lanolin and ethanol respectively. Tannins extraction was strongly dependent on plant species and in the solvent used. Conclusion: The alternative organic solvents lanolin and cocoa butter allowed the recovery of polyphenols compounds with antifungal activity against R. solani.

  2. Study of Foeniculum vulgare (Fennel Seed Extract Effects on Serum Level of Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Sadeghpour Nahid

    2015-04-01

    Full Text Available Objective: The Foeniculum vulgare (FVE, known as fennel, has a long history of herbal uses as both food and medicine. The seed of this plant has been used to promote menstruation, alleviate the symptoms of female climacteric, and increase the number of ovarian follicles. The aim of this study was to evaluate the fennel extract effects on serum level of oxidative stress in female mice. Materials and Methods: Totally, 28 virgin female albino mice were divided into four groups (n = 7. Groups 1 and 2 (experimental groups were administered FVE at 100 and at a concentration of 100 and 200 mg/kg for 5 days, interaperitoneally. Group 3 (negative control received ethanol and Group 4 (positive control received normal saline. Animals were scarified at 6th day, sera were collected and the level of oxidative stress was determination of using total antioxidant status kit. Results: Data analysis revealed that there is a significant difference in the mean level of serum oxidative stress between four different groups. P value in experimental groups compared to the control group was (P < 0.0001. Conclusion: Fennel extract can decrease the serum level of oxidative factors in female mice; it can be introduced as a novel medicine for treatment of infertility

  3. BIOREACTIVE COMPOUNDS AND ANTIOXIDANT PROPERTIES OF METHANOLIC EXTRACT OF FENNEL (FOENICULUM VULGARE MILLER

    Directory of Open Access Journals (Sweden)

    Anita Dua

    2013-06-01

    Full Text Available Methanolic extract of dried Fennel (Foeniculum vulgare Miller seeds was analyzed for the presence of bioreactive compounds: ascorbate, riboflavin, tocopherol and polyphenols with potential antioxidant properties. The extract had low ascorbate (197.12+1.82µg, riboflavin (11.97+0.35µg and tocopherol (280.33+5.67µg/g dry seeds content. However the extract had high polyphenol content (16.506+0.32mg/g dry seeds. Antioxidant activity of the extract was determined by various mechanisms including DPPH free radical scavenging, metal induced protein and lipid oxidation inhibition and protection of DNA against H2O2 induced damage. Fennel had excellent free radical scavenging activity with IC50 2.1mg dry seed weight. IC50 observed for protection of proteins and lipids against metal ion induced oxidation is 2.1 and 2.5mg dry seed weight respectively. Extract equivalent to 0.5µg seeds is enough to protect DNA against H2O2 induced oxidation. The results suggest that polyphenols are the principal components responsible for high antioxidant potential of methanolic extract of fennel.

  4. Antifungal properties of Foeniculum vulgare, Carum carvi and Eucalyptus sp. essential oils against Candida albicans strains

    Directory of Open Access Journals (Sweden)

    Skrobonja Jelica M.

    2013-01-01

    Full Text Available Aromatic plants are among the most important sources of biologically active secondary metabolites, with high antimicrobal potential. This study was carried out to examine in vitro antifungal activity of Foeniculum vulgare (Apiaceae, Carum carvi (Apiaceae and Eucalyptus sp.(Myrtaceae essential oils against three Candida albicans strains of different origin (laboratory-CAL, human pulmonary-CAH and ATCC10231-CAR. The essential oils were screened on C. albicans using disc and well-diffusion and microdilution method, and compared to Nystatine and Fluconazole as standard anti-mycotics. The activity of tested oils was expressed by inhibition zone diameter (mm, minimum inhibitory concentration (MIC and minimum fungicidal concentration (MFC (mg/ml. The results indicated that studied essential oils show antifungal activity against all three isolates of C. albicans. It was observed that each oil exhibits different degree of antifungal activity depending on the oil concentration applied as well as on analyzed strain of C. albicans. Carum carvi demonstrated the strongest antifungal effect to all tested strains, showing the lowest MIC values (0.03mg/ml for CAL, 0.06mg/ml for CAH, and 0.11mg/ml for CAR, respectively. Eucalyptus sp. exhibited the lowest antifungal activity, with MIC values ranging from 0.11 mg/ml for CAL to 0.45 mg/ml for both CAH and CAR. [Projekat Ministarstva nauke Republike Srbije, br. 172058

  5. Effect of gamma - irradiation on the volatile flavor profile of fennel (foeniculum vulgare mill.) from Pakistan

    International Nuclear Information System (INIS)

    The volatile flavor compounds of non-irradiated and 1, 5, 10 and 20 kGy gamma-irradiated seeds of fennel (Foeniculum vulgare Mill.) from Pakistan were isolated by simultaneous distillation-extraction (SDE) and were analyzed by gas chromatography-mass spectrometry (GC-MS). A total of 82 compounds were identified in the non irradiated fennel, with EAnethole (36.74 percentage), Estragole (26.31 percentage), and β-Limonene (15.99 percentage) as the major compounds. The irradiation doses caused slight variations in the number and contents of the volatile components. Though several volatile compounds showed increase after Υ-irradiation, the contents of major compounds such as beta-Limonene and estrgole were decreased. The overall number of the volatile compounds showed increase up to the recommended irradiation doses of 10 kGy but their contents decreased. In general no major change was noted in the overall major flavor compounds of the subject spice. Therefore the application of Υ--irradiation is feasible without any significant qualitative or quantitative loss of volatile flavor compounds when exposed to 10 kGy Υ--irradiation. (author)

  6. Vasorelaxant activity of extracts obtained from Apium graveolens:Possible source for vasorelaxant molecules isolation with potential antihypertensive effect

    Institute of Scientific and Technical Information of China (English)

    Vergara-Galicia Jorge; Jimenez-Ramirez Luis ngel; Tun-Suarez Adrin; Aguirre-Crespo Francisco; Salazar-Gmez Anuar; Estrada-Soto Samuel; Sierra-Ovando ngel; Hernandez-Nuez Emmanuel

    2013-01-01

    Objective:To investigate the vasorelaxant effect of organic extracts from Apium graveolens (A. graveolens) which is a part of a group of plants subjected to pharmacological and phytochemical study with the purpose of offering it as an ideal source for obtaining lead compounds for designing new therapeutic agents with potential vasorelaxant and antihypertensive effects. Methods:An ex vivo method was employed to assess the vasorelaxant activity. This consisted of using rat aortic rings with and without endothelium precontracted with norepinephrine. Results:All extracts caused concentration-dependent relaxation in precontracted aortic rings with and without endothelium;the most active extracts were Dichloromethane and Ethyl Acetate extracts from A. graveolens. These results suggested that secondary metabolites responsible for the vasorelaxant activity belong to a group of compounds of medium polarity. Also, our evidence showed that effect induced by dichloromethane and ethyl acetate extracts from A. graveolens is mediated probably by calcium antagonism. Conclusions: A. graveolens represents an ideal source for obtaining lead compounds for designing new therapeutic agents with potential vasorelaxant and antihypertensive effects.

  7. The Possible Protective Role of Foeniculum vulgare Mill. Against Radiation-Induced Certain Biochemical Changes in Albino Rats

    International Nuclear Information System (INIS)

    This study was conducted to evaluate the modulating efficacy of prolonged oral administration of Foeniculum vulgare Mill. essential oil (FEO) against gamma irradiation-induced biochemical changes in male rats. Essential oil of Foeniculum vulgare Mill. was orally administrated at dose level of 250 mg/kg body wt/day for 21 days before irradiation and 7 days post exposure (6.5 Gy single dose). Rats exposed to ionizing radiation exhibited a potential elevation of serum aspartate aminotransferase (AST) and alkaline phosphatase (ALP) activities, bilirubin, urea and creatinine levels, lipid abnormalities, and an increase in tissue lipid peroxidation (LPO) and metallothioneins (MTs). On the other hand, noticeable drop in liver and kidney glutathione content and serum total protein, albumin and testosterone levels were recorded. Tissue organs displayed some changes in trace element concentrations, which may be due to the radiation ability to induce oxidative stress. The data obtained from rats treated with fennel oil before and after whole body gamma irradiation revealed significant modulation in the biochemical tested parameters and profound improvement in the activity of antioxidant status, glutathione and metallothioneins. The treatment of irradiated rats with fennel oil also appeared to be effective in minimizing the radiation-induced increase in lipid peroxidation as well as changes in essential trace elements in some tissue organs. In addition to its containing many chemical antioxidant constituents such as polyphenols, fennel was found to contain detectable concentrations of essential trace elements (Zn, Cu, Fe, Se, Mg, Mn and Ca) which may be involved in multiple biological processes as constituents of enzymes system including superoxide dismutase (Cu, Zn, Mn, SODs), oxide reductase, glutathione (GSP, GSH, GST), metallothionein MTs, etc. Overall, it could be concluded that Foeniculum vulgare Mill. essential oil exerts beneficial protective role against radiation

  8. Insecticide effects of Ruta graveolens, Copaifera langsdorffii and Chenopodium ambrosioides against pests and natural enemies in commercial tomato plantation = Ação inseticida de Ruta graveolens, Copaifera langsdorffii e Chenopodium ambrosioides sobre pragas de tomate

    Directory of Open Access Journals (Sweden)

    Flávia Silva Barbosa

    2011-01-01

    Full Text Available The aim of this study was to evaluate the insecticide effect of watery leaf extracts of Ruta graveolens (Rutaceae, alcoholic leaf extracts of Copaifera langsdorffii (Caesalpinaceae and Chenopodium ambrosioides (Chenopodiaceae in the concentration of 5% under field conditions. The experiment design was randomized blocks with six replications. The parcels treated with plant extracts showed reduction in the population of pests when compared with the controlparcels. The extract elaborated with C. langsdorffii presented greater insecticidal effect under Bemisia tabaci (Hemiptera: Aleyrodidae and sum of pests. It was verified that after 24 hours ofspraying, the parcels treated with the extract of C. ambrosioides presented minor numbers of adults of Tuta absoluta (Lepidoptera: Gelechiidae, followed by the parcels treated with extract of R.graveolens. There were smaller numbers of parasitoid eggs of epidopterans Trichogramma sp. (Hymenoptera: Trichogrammatidae and sum of natural enemies (predators + parasitoids in the parcels that had received spraying with extracts from the plants of C. langsdorffii and C. ambrosioides, followed by R. graveolens, compared to the control. There were a smaller number of parasitoids from the family Eulophidae (Hymenoptera attacking caterpillars of T. absoluta in plants treated with R. graveolens, followed by C. langsdorffii and C. ambrosioides than in the control.O objetivo deste trabalho foi avaliar o efeito inseticida dos extratos aquosos de folhas de Ruta graveolens (Rutaceae e alcoólicos de folhas de Copaifera langsdorffii (Caesalpinaceae e de folhas de Chenopodium ambrosioides (Chenopodiaceae a 5%. O experimento foi em blocos casualizados com seis repetições. As parcelas tratadas tiveram redução na população de pragas, quando comparadas às parcelas sem nenhum tratamento. O extrato elaborado com C. langsdorffii apresentou maior efeito inseticida em Bemisia tabaci (Hemiptera: Aleyrodidae e soma das pragas

  9. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  10. Micropropagação e aclimatização de gerânio (Pelargonium graveolens L.) Micropropagation and acclimatization of geranium (Pelargonium graveolens L.)

    OpenAIRE

    M.F Arrigoni-Blank; S.A. Almeida; A.C.L Oliveira; A.F Blank

    2011-01-01

    O gerânio (Pelargonium graveolens L.) é uma planta medicinal e aromática nativa do sul da África, cujo óleo essencial é amplamente empregado nas indústrias de perfumaria e cosmético, além de ser usado como terapêutico. Avaliou-se o efeito da luminosidade e dos reguladores de crescimento BAP e ANA na multiplicação in vitro e o uso de diferentes substratos na aclimatização de mudas micropropagadas. Foram avaliadas as concentrações 0; 0,5; 1,0 e 2,0 mg L-1 de BAP, 0; 0,1 e 0,5 mg L-1 de ANA e du...

  11. Hypolipidemic Effects of Seed Extract of Celery (Apium graveolens ) in Rats

    OpenAIRE

    Kamal Mansi; Adel M Abushoffa; Ahmad Disi; Talal Aburjai

    2009-01-01

    The hypolipidemic effects of ethanol extract of A. graveolens L. (Apiaceae) were investigated. Forty adult male albino rats weighing about 260 g each, were divided into four groups (n = 10). Experimental animals were gavaged at doses of 213 and 425 mg/kg body wt. for sixty consecutive days. Extract showed a significant decrease (p< 0.05) of serum total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-c), and significant increase (p< 0.05) in high-density lipoprotein choles...

  12. Effect of the aqueous extract of Foeniculum vulgare (fennel on the kidney in experimental PCOS female rats

    Directory of Open Access Journals (Sweden)

    Somayyeh Sadrefozalayi

    2014-02-01

    Full Text Available Objective: Foeniculum vulgare seed (F. vulgare is a herbal plant which is used with phytoestrogene compounds for polycystic ovary syndrome (PCOS treatment. In this research, renoprotective effect of the aqueous extract of Foeniculum vulgare (AEF in experimental PCOS female rats is studied. Materials and Methods: Forty female rats were randomly divided into five groups. The first group served as control,was injected with an equivalent volume (0.2 ml of normal saline, and received normal diet. Animals in the second group were non poly cystic ovary syndrome (PCOS rats which were treated with intragastric administration of aqueous extract of F. vulgare (150 mg/kg b.w.. In the third group, the rats were treated with intraperitoneal injection of estradiolvalerate (EV (4 mg in 0.2 ml of sesame oil. The fourth groups were treated with EV and AEF (150mg/kg bw with the same route.  The fifth groups were treated with EV and AEF (100mg/kg bw. After 4 weeks of study, all of the rats were sacrificed, their kidneys tissues were processed for light microscopy, and some biochemical parameters of serum were measured. Results: The mean values of blood urea nitrogen in PCOS rats treated with low dose of AEF and EV and non-treated, was significantly (p

  13. New knowledge for yield, composition and insecticidal activity ofessential oils obtained from the aerial parts or seeds of fennel(Foeniculum vulgare Mill.)

    Czech Academy of Sciences Publication Activity Database

    Pavela, R.; Žabka, M.; Bednář, Jan; Tříska, Jan; Vrchotová, Naděžda

    2016-01-01

    Roč. 83, may (2016), s. 275-282. ISSN 0926-6690 Grant ostatní: GA MZe(CZ) QJ1510160 Institutional support: RVO:67179843 Keywords : foeniculum vulgare * botanical insecticides * essential oils * medicinal plants * aromatic plants Subject RIV: EH - Ecology, Behaviour Impact factor: 2.837, year: 2014

  14. Effects of aqueous extract of celery (Apium graveolens L. leaves on spermatogenesis in healthy male rats

    Directory of Open Access Journals (Sweden)

    Ameneh Hardani

    2015-02-01

    Full Text Available Objectives: Nowadays, a lot of attention has been paid to the therapeutic properties of herbs, including evaluation of the effects of these plants on fertility in laboratory animals. Apium graveolens L. (celery has been widely used in traditional medicine for treatment of various disorders including impotency. Therefore, this study was designed to investigate the effects of aqueous extract of A. graveolens on testicular tissue and spermatogenesis in healthy male rats. Materials and Methods: In this research, 24 apparently healthy male rats were divided into three groups, including eight rats in each. The first group as control received only distilled water 1 ml/animal/day. The second and third groups orally received 100 and 200 mg/kg b.w. of the extract, respectively, for 30 days. The day after the last administration of the extract, the rats were sacrificed, the testes were removed entirely, and the morphometric studies were carried out. Epididymal sperm count and histological studies of testicular tissue were conducted. Results: The comparison between the treated and control groups revealed a remarkable increase in the seminiferous tubules diameter, testes volume (p≤0.001, and the number of spermatogonia, primary spermatocytes and spermatozoa. Furthermore, the increase in the number of spermatids and epididymal weight were only significant at high doses of the extract (p≤ 0.05. Conclusions: The results from this study indicated that administration of celery leaf extract may improve spermatogenesis process and also be useful for some sperm fertility parameters.

  15. Cysticidal activity of extracts and isolated compounds from Teloxys graveolens: In vitro and in vivo studies.

    Science.gov (United States)

    Palomares-Alonso, Francisca; Rojas-Tomé, Irma Susana; Juárez Rocha, Victorino; Palencia Hernández, Guadalupe; González-Maciel, Angélica; Ramos-Morales, Andrea; Santiago-Reyes, Rosalba; González-Hernández, Iliana Elvira; Jung-Cook, Helgi

    2015-09-01

    In the search of new alternatives for neurocysticercosis treatment, the cysticidal activity of organic extracts of Teloxys graveolens was evaluated. The in vitro activity of hexane, ethyl acetate and methanol extracts against Taenia crassiceps cysts was tested and the selectivity index relative to human fibroblasts was determined. Subsequently, the in vivo efficacy of the methanolic extract at doses of 200 and 500 mg/kg in the murine cysticercosis model was evaluated. The ultrastructural effects in vitro and in vivo of the methanolic extract were also investigated using scanning electron microscopy. Additionally, a bioassay-guided fractionation for the isolation of the cysticidal components was performed. Our in vitro findings revealed that all extracts exhibited good cysticidal activity with EC50 values from 44.8 to 67.1 µg/mL. Although the ethyl acetate and methanolic extracts displayed low cytotoxicity, the methanolic extract was the most selective. The methanolic extract also showed in vivo efficacy which was similar to that obtained with ABZ. Significant alterations were found on the germinal layer of the cysts, with a high accumulation of granules of glycogen and vacuoles. The bioguided fractionation of methanolic extract led to the isolation of three flavonoids: chrysin, pinocembrin and pinostrobin; among them, pinocembrin was the compound that displayed cysticidal activity. This is the first study which reveals that T. graveolens could be a potential source for cysticidal and non-toxic compounds. PMID:26072200

  16. Phenolic compounds from Foeniculum vulgare (Subsp. Piperitum (Apiaceae herb and evaluation of hepatoprotective antioxidant activity

    Directory of Open Access Journals (Sweden)

    Mona T. M. Ghanem

    2012-01-01

    Full Text Available Objective: The study was designed to evaluate the antioxidant and hepatoprotective activities of the 80% methanolic extract as well as the ethyl acetate (EtOAc and butanol (BuOH fractions of the wild fennel (Foeniculum vulgare (Subsp; Piperitum and cultivated fennel (F. vulgare var. azoricum. In addition, quantification of the total phenolic content in the 80% methanol extract of fennel wild and cultivated herbs is measured. Materials and Methods: An amount of 400 g of air dried powdered herb of wild and cultivated fennel were sonicated with aqueous methanol (80%, successively extracted with Hexane, EtOAc, and n-BuOH. The EtOAc and n-BuOH were subjected to repeated column chromatography on silica gel and Sephadex LH-20. The antioxidant effect was determined in vitro using 1,1-diphenyl-2-picrylhydrazyl (DPPH· . Hepatoprotective activity was carried out using a Wistar male rat (250-300 g. Total phenolic and flavonoid contents were determined as chlorogenic acid and rutin equivalents, respectively. Results: Two phenolic compounds, i.e., 3,4-dihydroxy-phenethylalchohol-6-O-caffeoyl-β-d-glucopyranoside and 3?,8?-binaringenin were isolated from the fennel wild herb, their structures were elucidated by spectral methods including 1D NMR, 2D NMR, and UV. The EtOAc and BuOH fractions of wild fennel were found to exhibit a radical scavenging activity higher than those of cultivated fennel. An in vitro method of rat hepatocytes monolayer culture was used for the investigation of hepatotoxic effects of the 80% methanol extract on the wild and cultivated fennel, which were >1000 and 1000 ΅g/mL, respectively. As well as, their hepatoprotective effect against the toxic effect of paracetamol (25 mM was exerted at 12.5 ΅g/mL concentration. Conclusions: Fennel (F. Vulgare is a widespread plant species commonly used as a spice and flavoring. The results obtained in this study indicated that the fennel (F. vulgare herb is a potential source of natural

  17. PHENOLIC PROFILE, ANTIOXIDANT AND ANTIMICROBIAL ACTIVITIES FROM THE Apiaceae FAMILY (DRY SEEDS

    Directory of Open Access Journals (Sweden)

    Valentina Lubomirova Christova-Bagdassarian

    2013-11-01

    Full Text Available Objective: In the present study, a comparative evaluation of the phenolic compounds antioxidant capacity and antibacterial activity to several kinds of seeds from the Apiacea family, to which belong: Foeniculum vulgare (Fennel, Anethum graveolens (Dill, Pimpinella anisum (Anise, Carum carvi (Caraway and Coriandrum sativum (Coriander were carried out. Methods: The total phenolic content of seeds was measured spectrophotometrically by using the Folin-Ciocalteu assay, the total flavonoids was measured spectrophotometrically by using the aluminum chloride colorimetric. Antioxidant capacity was analysed by 2,2-Diphenyl-1-picrylhydrazyl (DPPH radical scavenging effect of the seeds and was determined also spectrophotometrically. Antibacterial activity was analysed by ISO standards. Results: The total phenolic and flavonoid contents of the Foeniculum vulgare (Fennel varied between 115.96 mg GAE/100g and 68.10 mg CE/100g .The Coriandrum sativum (Coriander content is lower (from 17.04 mg GAE/100g to 11.10 mg CE/100g, respecively. The highest radical scavanging effect was observed in the Foeniculum vulgare (Fennel with IC50 of 113.19 ml/L. In our study, the methanol extract of seeds didn’t have any antimicrobial activity. Conclusions: An original data for total phenolic and total flavonoid contents are present in this study. They are a basis for assessment of the role of Apiaceae family dry seeds against free radicals effect and antibacterial activity. The results show that methanolic extract has the highest of total phenolic and total flavonoid contents, high potential of antioxidant activity of dry seeds from Apiaceae family, to which belong: Fennel (Foeniculum vulgare, Dill (Anethum graveolens, Anise (Pimpinella anisum, Caraway (Carum carvi and Coriander (Coriandrum sativum. From all results, the solvent extracts of dry seeds are rich in phytochemical contents, which possessed high antioxidant and antimicrobial activities. Therefore the data found in

  18. Micropropagação e aclimatização de gerânio (Pelargonium graveolens L. Micropropagation and acclimatization of geranium (Pelargonium graveolens L.

    Directory of Open Access Journals (Sweden)

    M.F Arrigoni-Blank

    2011-01-01

    Full Text Available O gerânio (Pelargonium graveolens L. é uma planta medicinal e aromática nativa do sul da África, cujo óleo essencial é amplamente empregado nas indústrias de perfumaria e cosmético, além de ser usado como terapêutico. Avaliou-se o efeito da luminosidade e dos reguladores de crescimento BAP e ANA na multiplicação in vitro e o uso de diferentes substratos na aclimatização de mudas micropropagadas. Foram avaliadas as concentrações 0; 0,5; 1,0 e 2,0 mg L-1 de BAP, 0; 0,1 e 0,5 mg L-1 de ANA e duas condições de luminosidade (ausência e presença de luz, em esquema fatorial 4x3x2; para a aclimatização foram utilizados quatro substratos, pó de coco + Biosafra® (3-12-6 (12 g L-1 + calcário (1 g L-1 (PCBC; pó de coco + Biosafra® (3-12-6 (12 g L-1 + calcário (1 g L-1 + vermiculita (1:1 (PCBCV 1:1; pó de coco + Biosafra® (3-12-6 (12 g L­-1 + calcário (1 g L-1 + vermiculita (PCBCV 2:1 e vermiculita e adição semanal de sais MS (VS. Para a micropropagação de P. graveolens a utilização de 1,3 mg L-1 de BAP e 0,5 mg L-1 de ANA é eficiente na regeneração direta de plantas de gerânio, sendo a condição de escuro a mais indicada por proporcionar o maior número de brotos por explante. Para a aclimatização das mudas de gerânio, os melhores resultados foram obtidos em mudas aclimatizadas no substrato vermiculita com adição semanal de sais de MS seguido do substrato PCBCV 1:1.Geranium (Pelargonium graveolens L. is a medicinal and aromatic plant native to the south of Africa and whose essential oil is widely used by perfume and cosmetic industries, as well as in therapeutics. The effect of luminosity and growth regulators BAP and NAA on in vitro multiplication was evaluated, together with the use of different substrates on the acclimatization of micropropagated seedlings. The evaluated concentrations were 0, 0.5, 1.0 and 2.0 mg L-1 BAP; 0, 0.1 and 0.5 mg L-1 NAA; and two luminosity conditions (absence and presence of

  19. Studies on gamma irradiated medicinal plants and spices (1): Myristica argentea, Myristica fragrans, Coriandrum sativum and Foeniculum vulgare

    International Nuclear Information System (INIS)

    Medicinal plants i.e. dried seeds of myristica argentea, myristica fragrans, coriandrum sativum and foeniculum vulgare were stored for 0 and 6 months, with and without gamma irradiation at 5 kGy. No detectable changes were seen in infrared and UV spectra, GLC chromatograms and refraction indeces of steam distilled, essential oils from the irradiated medicinal plants. The same results were also obtained from irradiated samples stored for 6 months at ambient conditions. Storage for 6 months caused significant changes in the gas liquid chromatograms and UV spectra of all samples compared to non-stored samples. The moisture content of all samples packed in polyethylene bags seems to be constant after 6 months of storage. No measurable changes were found in the amount of essential oil content caused by irradiation. (author)

  20. The effect of celery (Apium graveolens L. on reproductive parameters in male wistar rat

    Directory of Open Access Journals (Sweden)

    Wesam Kooti

    2016-04-01

    Full Text Available Dear editor In recent years, the number of scientific research papers of Iranian scientists has substantially grown in national and international journals that indicates particular attitude of Iranian scientific community to the development of knowledge in different fields. Moreover, improvement of quality of scientific papers is necessary. For this purpose, criticism of published studies is a way to increase the quality of articles and make them clear. In Avicenna Journal of Phytomedicine, volume (5, issue (2, year 2015, an article entitled “Effects of aqueous extract of celery (Apium graveolens L. leaves on spermatogenesis in healthy male rats” was published and the papers like this should be appreciated. However, the paper has some drawbacks which if not resolve, could be misleading for researchers who tend to use it or do research in its direction. So, with all due respect to the research team, we decided to evaluate the paper ambiguities in order to improve the quality of future articles.

  1. The Effect of Drought Stress on the Essential Oil Content and Some of the Biochemical Characteristics of Anise Hyssop (Agastache foeniculum [Pursh] Kuntze)

    OpenAIRE

    Sajedeh Saeedfar; Marzieh Negahban; Mohammad Mahmoodi Soorestani

    2015-01-01

    Plot trials were carried out in a research field in Tehran (Iran) to determine the effect of drought stress on the essential oil content and some of the plant biochemical characteristics of Anise Hyssop (Agastache foeniculum [Pursh] Kuntze), which is a valuable medicinal plant. Drought stress was conducted at different levels including: well-water (100% FC), mild drought stress (85% FC), moderate drought stress (70% FC), severe drought stress (55% FC), 100% FC (vegetative stage) 85% FC (repro...

  2. The insecticidal potential of Foeniculum vulgareMill., Pimpinella anisum L. and Caryophillus aromaticus L. to control aphid on kale plants

    OpenAIRE

    P.S.R Lucca; L. H. P. NÓBREGA; Alves, L. F. A.; C. T. A. CRUZ-SILVA; F. P. PACHECO

    2015-01-01

    ABSTRACTThe use of natural substances for pest control in agriculture is, economically, a viable option and has benefits for both the humanbeing and the environment, due to its low persistence and toxicity. Thus, this trial aimed on determining the insecticidal potential of the extracts and essential oils of fennel (Foeniculum vulgare Mill.), anise (Pimpinella anisum L.) and clove (Caryophillus aromaticus L.) to control Brevicoryne brassicae L. in kale (Brassica oleracea var. acephala DC.). T...

  3. Chemical Composition and Acaricidal Effects of Essential Oils of Foeniculum vulgare Mill. (Apiales: Apiaceae) and Lavandula angustifolia Miller (Lamiales: Lamiaceae) against Tetranychus urticae Koch (Acari: Tetranychidae)

    OpenAIRE

    Asgar Ebadollahi; Jalal Jalali Sendi; Alireza Aliakbar; Jabraeil Razmjou

    2014-01-01

    Utilization of synthetic acaricides causes negative side-effects on nontarget organisms and environment and most of the mite species such as two spotted spider mite, Tetranychus urticae Koch, are becoming resistant to these chemicals. In the present study, essential oils of fennel, Foeniculum vulgare Mill., and lavender, Lavandula angustifolia Miller, were hydrodistilled using Clevenger apparatus and chemical composition of these oils was analyzed by GC-MS. Anethole (46.73%), limonene (13.65%...

  4. Hoya thuathienhuensis and Hoya graveolens (Apocynaceae, Asclepiadoideae), a new species and a new record for the Flora of Vietnam

    OpenAIRE

    Rodda, M.; Trân, Thê Bách; Simonsson Juhonewe, N.; Sâm, Lý Ngọc

    2012-01-01

    A new species from the Annamite mountain range of central Vietnam, Hoya thuathienhuensis, is here described and illustrated. Its flowers bear similarity with Hoya lockii, a taxon recently described from the same area with which it shares the reflexed corolla and the thin coriaceous laves. Hoya lockii is an epiphytic shrub, whereas H. thuathienhuensis is a strong climbing liana. We also report the noteworthy extension into southern Vietnam of Hoya graveolens, a taxon previously considered to b...

  5. Genetic variation for silvicultural traits in open-pollinated progenies of Astronium graveolens Jacq. (Anacardiaceae

    Directory of Open Access Journals (Sweden)

    Daniela Araújo

    2014-03-01

    Full Text Available This study has investigated the genetic variation for silvicultural traits in an open-pollinated progeny test of Astronium graveolens Jacq., established at Luiz Antônio Experimental Station (State of São Paulo, Brazil. The trial was planted in a random block experimental design, containing 23 families, six replications and five plants per plot. The traits measured were diameter at breast height (DBH, total height and stem form. The assessments were taken at the age of 19 years. Significant differences were not detected by the analysis of variance, suggesting that the genetic variation was low, as well as the probability to raising genetic gains through selection among progenies. The coefficient of genetic variation was moderate for the traits height (8.2% and DBH (21.2% and low to stem form (4.0%. However, the average coefficient of heritability among progenies was low for all studied traits (ranging from 0.02 to 0.15, confirming the low probability of genetic improvement of this population by selection among progenies.

  6. Triterpenoid Saponins from Clematis graveolens and Evaluation of their Insecticidal Activities.

    Science.gov (United States)

    Rattan, Rajeev; Reddy, S G Eswara; Dolma, Shudh Kirti; Fozdar, Bharat Inder; Gautam, Veena; Sharma, Ritika; Sharma, Upendra

    2015-09-01

    A new hederagenin based triterpenoid saponin, clematograveolenoside A (1), along with three known saponins, tomentoside A (2), huzhangoside D (3) and clematoside S (4), were isolated from the roots and rhizomes of Clematis graveolens. The structure of new compound was elucidated on the basis of detailed analysis of chemical and spectroscopic data including 1D- and 2D NMR spectra. Compound 2 was found the most effective against aphid (Aphis craccivora) with an LC50 of 1.2 and 0.5 mg/mL after treatment for 72 and 96 h, respectively and was followed by compound 4 (LC50 = 2.3 and 1.9 mg/mL) and 1 (LC50 = 3.2 and 2.6 mg/mL). In case of termite (Coptotermis homii), compound 1 was found more toxic with an LC50 of 0.1 mg/L after 24 h of treatment followed by compound 2, 3 and 4 (LC50 = 0.1, 0.2 and 0.2 mg/mL, respectively). PMID:26594749

  7. Biogenic synthesis of zinc oxide nanoparticles using Ruta graveolens (L.) and their antibacterial and antioxidant activities

    Science.gov (United States)

    Lingaraju, K.; Raja Naika, H.; Manjunath, K.; Basavaraj, R. B.; Nagabhushana, H.; Nagaraju, G.; Suresh, D.

    2015-08-01

    In the present investigation, green synthesis of zinc oxide nanoparticles were successfully synthesized by biological method using aqueous stem extract of Ruta graveolens act as reducing agent. Formation of ZnO nanoparticles were characterized by powder X-ray diffraction (PXRD), UV-visible spectroscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) techniques. Zinc oxide nanoparticles were subjected to biological properties such as antibacterial and antioxidant studies. The PXRD pattern reveals that ZnO sample belongs to hexagonal phase with Wurtzite structure. The UV-vis absorption spectrum shows an absorption band at 355 nm due to ZnO nanoparticles. SEM images show that the particles have spherical like structure with large surface area and the average crystallite sizes were found to be in the range ~28 nm. These observations were confirmed by TEM analysis. The ZnO nanoparticles are found to inhibit the antioxidant activity of 1,1-diphenyl-2-picrylhydrazyl free radicals effectively. ZnO Nps exhibit significant bactericidal activity against Gram -ve bacterial strains such as Klebsiella aerogenes, Pseudomonas aeruginosa, Escherichia coli and Gram +ve Staphylococcus aureus by agar well diffusion method.

  8. IMPROVED PLANT REGENERATION AND IN VITRO SOMATIC EMBRYOGENESIS IN Ruta graveolens

    Directory of Open Access Journals (Sweden)

    Zuraida AR

    2014-07-01

    Full Text Available In vitro callus cultures initiated from stem segments of Ruta graveolen which later on differentiated into somatic embryoids and subsequently regenerated whole plants. Callus formation was observed in culture medium containing low concentrations of the plant growth regulators, 2,4-dichlorophenoxyacetic acid (2,4-D and/or α-naphthalene acetic acid (NAA. At 0.2 mg/L NAA was showing the highest rate (85% of callus induction. The callus appeared watery, but showed no sign of browning after a month of culture. Sub-culturing the callus on to medium with 0.2 mg/L 2,4-D showed enhanced the callus proliferation rate up to 95%. Somatic embryogenesis from callus was most successful on MS medium containing either 6 g/L agar and supplemented with 0.5 mg/L benzylaminopurine (BAP, or with 9 g/L agar, supplemented with 0.5 mg/L kinetin (KIN. The former medium was more successful in plantlet regeneration when the embryoids were subsequently transferred to regeneration medium with 3 g/L agar and 0.5 mg/L BAP.

  9. Biogenic synthesis of zinc oxide nanoparticles using Ruta graveolens (L.) and their antibacterial and antioxidant activities

    Science.gov (United States)

    Lingaraju, K.; Raja Naika, H.; Manjunath, K.; Basavaraj, R. B.; Nagabhushana, H.; Nagaraju, G.; Suresh, D.

    2016-06-01

    In the present investigation, green synthesis of zinc oxide nanoparticles were successfully synthesized by biological method using aqueous stem extract of Ruta graveolens act as reducing agent. Formation of ZnO nanoparticles were characterized by powder X-ray diffraction (PXRD), UV-visible spectroscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) techniques. Zinc oxide nanoparticles were subjected to biological properties such as antibacterial and antioxidant studies. The PXRD pattern reveals that ZnO sample belongs to hexagonal phase with Wurtzite structure. The UV-vis absorption spectrum shows an absorption band at 355 nm due to ZnO nanoparticles. SEM images show that the particles have spherical like structure with large surface area and the average crystallite sizes were found to be in the range ~28 nm. These observations were confirmed by TEM analysis. The ZnO nanoparticles are found to inhibit the antioxidant activity of 1,1-diphenyl-2-picrylhydrazyl free radicals effectively. ZnO Nps exhibit significant bactericidal activity against Gram -ve bacterial strains such as Klebsiella aerogenes, Pseudomonas aeruginosa, Escherichia coli and Gram +ve Staphylococcus aureus by agar well diffusion method.

  10. The toxicological effect of Ruta graveolens extract in Siamese fighting fish: a behavioral and histopathological approach.

    Science.gov (United States)

    Forsatkar, Mohammad Navid; Nematollahi, Mohammad Ali; Brown, Culum

    2016-05-01

    The effects of pharmacological waste on aquatic ecosystems are increasingly highlighted in ecotoxicology research. Many of these products are designed for human physiology but owing to the conservative nature of vertebrate evolution they also tend to have effects on aquatic organisms and fishes in particular when they find their way into aquatic systems via wastewater effluent. One area of research has focused on reproductive control and the associated hormone treatments. Many of these hormones affect the reproductive physiology of fishes and may cause feminization of male reproductive traits. Alternative medicines have also been widely used particularly in traditional cultures but few of these alternative treatments have been assessed with respect to their potential impact on aquatic ecosystems. Rue (Ruta graveolens) has been used as a male contraceptive in traditional medicines but its effects on fish behavior and reproductive anatomy have yet to be established. Here we show that treating Siamese fighting fish, Betta splendens, with extract of rue has a significant effect on key aggressive/reproductive behaviors and the propensity to explore novel objects (boldness). In all cases the respective behaviors were reduced relative to controls and sham injected fish. Histological analysis of the testes revealed that rue exposure reduced the number of spermatozoa but increased the number of spermatocytes relative to controls. PMID:26924199

  11. Antifungal efficacy of Punica granatum, Acacia nilotica, Cuminum cyminum and Foeniculum vulgare on Candida albicans: An in vitro study

    Directory of Open Access Journals (Sweden)

    Pai Mithun

    2010-01-01

    Full Text Available Background: The establishment and maintenance of oral microbiota is related not only to interbacterial coaggregations but also to interactions of these bacteria with yeasts. Hence, it is important for agents used in the treatment of oral diseases to have antifungal properties for effective therapy. Objective: The main purpose of this study was to evaluate the in vitro antifungal efficacy of Punica granatum, Acacia nilotica, Cuminum cyminum and Foeniculum vulgare on Candida albicans. Materials and Methods: The pomegranate peel is separated, dried and powdered. Fennel, cumin and acacia bark obtained from the tree are powdered. Candida is inoculated at 37˚C and seeded on Sabourauds agar medium. Sterilized filter papers saturated with 30 μl of the extracts are placed on the seeded plates and inoculated at 24 and 48 h. Zones of inhibition on all four sides are measured around the filter paper with a vernier caliper. The experiments were repeated on four plates, with four samples of each extract on one plate for all of the extracts. Results: All the above-mentioned ingredients showed antifungal property, with Punica granatum showing the highest inhibition of Candida albicans with a mean zone of inhibition of 22 mm. P-values <0.05 were obtained for Punica granatum when compared with the other extracts. Conclusion: The results showed the potential use of these products as cheap and convenient adjuvants to pharmaceutical antifungal products.

  12. Randomized clinical trial of a phytotherapic compound containing Pimpinella anisum, Foeniculum vulgare, Sambucus nigra, and Cassia augustifolia for chronic constipation

    Directory of Open Access Journals (Sweden)

    Amaral Karine M

    2010-04-01

    Full Text Available Abstract Background A phytotherapic compound containing Pimpinella anisum L., Foeniculum vulgare Miller, Sambucus nigra L., and Cassia augustifolia is largely used in Brazil for the treatment of constipation. However, the laxative efficacy of the compound has never been tested in a randomized clinical trial. The aim of this study was to evaluate the efficacy and safety of the product. Methods This randomized, crossover, placebo-controlled, single-blinded trial included 20 patients presenting with chronic constipation according to the criteria of the American Association of Gastroenterology. The order of treatments was counterbalanced across subjects: half of the subjects received the phytotherapic compound for a 5-day period, whereas the other half received placebo for the same period. Both treatment periods were separated by a 9-day washout period followed by the reverse treatment for another 5-day period. The primary endpoint was colonic transit time (CTT, measured radiologically. Secondary endpoints included number of evacuations per day, perception of bowel function, adverse effects, and quality of life. Results Mean CTT assessed by X ray was 15.7 hours (95%CI 11.1-20.2 in the active treatment period and 42.3 hours (95%CI 33.5-51.1 during the placebo treatment (p Conclusions The findings of this randomized controlled trial allow to conclude that the phytotherapic compound assessed has laxative efficacy and is a safe alternative option for the treatment of constipation. Trial registration ClinicalTrial.gov NCT00872430

  13. Antifungal Activity of the Essential Oils of Two Verbenaceae: Lantana achyranthifolia and Lippia graveolens of Zapotitlán de las Salinas, Puebla (México)

    OpenAIRE

    Tzasna Hernández; Margarita Canales; Ana Maria García; Ángel Duran; Samuel Meráz; Patricia Dávila; J. Guillermo Ávila

    2008-01-01

    Se documenta la actividad antifúngica de los aceites esenciales de Lantana achyranthifolia y Lippia graveolens. Los aceites esenciales de la parte aérea de L. achyranthifolia y L. graveolens fueron obtenidos mediante arrastre de vapor y examinados por GC y GC-MS. La actividad antifúngica fue evaluada frente a cinco cepas de hongos con el método de difusión en agar. La concentración inhibitoria media (IC50) se determinó mediante el método de inhibición del crecimiento radial. Los acei...

  14. Actividad antioxidante de flavonoides del tallo de orégano mexicano (Lippia graveolens HBK var. berlandieri Schauer)

    OpenAIRE

    Martha Celina González Güereca; Marcos Soto Hernández; Geoffrey Kite; Mariano Martínez Vázquez

    2007-01-01

    México es el principal exportador a nivel mundial de orégano mexicano (Lippia graveolens), con 35 – 40 % del mercado internacional; su alta demanda se debe al contenido de aceite esencial de calidad en la hoja. Su recolección es complementaria a la agricultura de temporal o secano en zonas áridas y semiáridas. El desaprovechamiento del tallo y los escasos estudios fitoquímicos y farmacológicos reportados, indujeron esta investigación en la que determinó el tipo de flavonoides y se evaluó la...

  15. [The production of furocumarin in Apium graveolens L. and Pastinaca sativa L. after infection with Sclerotinia slcerotiorum].

    Science.gov (United States)

    Uecker, S; Jira, T; Beyrich, T

    1991-08-01

    Roots of celery (Apium graveolens) and parsnip (Pastinaca sativa) were inoculated with Sclerotinia sclerotiorum. At the beginning of the infection it is recognized that the level of furocoumarins rises but decreasing in the further time. Trimethylpsoralene was detected neither dc nor hplc. Sclerotinia grows poorly in parsnip. In this the high level of furocoumarins prevents the growth of the fungus because the furocoumarins are fungistatic. Obvious Sclerotinia is able to stimulate the origin of furocumarins in genetic predestinated plants first at time which can explained as reaction against the infection. The infection cannot avail to arise the technical useful yield. PMID:1798717

  16. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses

    OpenAIRE

    Pilau, Marciele Ribas; Alves, Sydney Hartz; Weiblen, Rudi; Arenhart, Sandra; Cueto, Ana Paula; Lovato, Luciane Teresinha

    2011-01-01

    Mexican oregano (Lippia graveolens) is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3–4,5-dimethythiazol-2yl)-2,5-diphenyl tetrazolium bromide) was conducted to determine the selectivity index (SI) of the essential oil, which was equal to 13.1, 7.4, 10.8,...

  17. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses

    OpenAIRE

    Marciele Ribas Pilau; Sydney Hartz Alves; Rudi Weiblen; Sandra Arenhart; Ana Paula Cueto; Luciane Teresinha Lovato

    2011-01-01

    Mexican oregano (Lippia graveolens) is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3-4,5-dimethythiazol-2yl)-2,5-diphenyl tetrazolium bromide) was conducted to determine the selectivity index (SI) of the essential oil, which was equal to 13.1, 7.4, 10.8,...

  18. The selective cytotoxicity elicited by phytochemical extract from Senecio graveolens (Asteraceae) on breast cancer cells is enhanced by hypoxia.

    Science.gov (United States)

    Echiburú-Chau, Carlos; Alfaro-Lira, Susana; Brown, Nelson; Salas, Cristian O; Cuellar, Mauricio; Santander, Javier; Ogalde, Juan Pablo; Rothhammer, Francisco

    2014-04-01

    Breast cancer is the second cause of cancer‑related deaths in woman and the incidence of the disease has increased worldwide, in part due to improvements in early detection. Several drugs with anticancer effects have been extracted from plants in the last 20 years, many of which are particularly effective against breast cancer cells. In particular, we have become interested in the ethanolic extract from Senecio graveolens (synonym of S. nutans), a plant commonly called Chachacoma, in an effort to isolate compounds that could demonstrate cytotoxic effects on breast cancer cells. Senecio (Asteraceae) is the largest gender in Chile comprising approximatly 200 species. These herbs inhabit areas over 3,500 meters above the sea level in the Andes Mountains. S. graveolens is commonly used by local communities for its medicinal properties, particularly its capacity to ameliorate high-altitude-associated sickness. The cytotoxic effect of the alcoholic extract from S. graveolens, as well as its most abundant compound 4-hydroxy-3-(3-methyl-2-butenyl)acetophenone, were tested in the breast cancer cell lines ZR-75-1, MCF-7 and MDA-MB‑231, and non-tumorigenic MCF-10F cells. We show that the phytochemical extract was able to induce cytotoxicity in cancer cells but not in MCF-10F. Importantly, this effect was enhanced under hypoxic conditions. However, 4-hydroxy-3-(3-methyl-2-butenyl)acetophenone, the main compound, did not by itself show an effective anticarcinogenic activity in comparison to the whole extract. Interestingly, the cytotoxic effect of the phytochemical extract was dependent on the basal MnSOD protein expression. Thus, cytotoxicity was increased when MnSOD levels were low, but resistance was evident when protein levels were high. Additionally, the crude extract seems to trigger cell death by a variety of processes, including autophagy, apoptosis and necrosis, in MCF-7 cells. In summary, S. graveolens extract possess anticancer activity displaying a specific

  19. Antibacterial Activity and Composition of Essential Oils from Pelargonium Graveolens L’Her and Vitex Agnus-Castus L

    Directory of Open Access Journals (Sweden)

    Alireza Ghannadi

    2012-12-01

    Full Text Available Background and Objectives: Essential oils are volatile compounds that have been used since Middle Ages as antimicrobial, anti-inflammatory, sedative, local anesthetic and food flavoring agents. In the current study, essential oils of Pelargonium graveolens L’Her and Vitex agnus-castus L. were analyzed for their antibacterial activities.Materials and Methods: The chemical compositions of essential oils were characterized by GC-MS. Disc diffusion method was used to study antimicrobial activity.Results and Conclusion: Inhibition zones showed that the essential oils of the two plants were active against all of the studied bacteria (except Listeria monocytogenes. The susceptibility of the strains changed with the dilution of essential oils in DMSO. The pure essential oils showed the most extensive inhibition zones and they were very effective antimicrobial compounds compared to chloramphenicol and amoxicillin. The most susceptible strain against these two essential oils was Staphylococcus aureus. It seems that β-citronellol is a prominent part of P. graveolens volatile oil and caryophyllene oxide is a famous and important part of V. agnus-castus volatile oil and their probable synergistic effect with other constituents are responsible for the antibacterial effects of these oils. However further studies must be performed to confirm the safety of these oils for use as antimicrobial agents and natural preservatives in different products.

  20. Effects of Apium graveolens Extract on the Oxidative Stress in the Liver of Adjuvant-Induced Arthritic Rats.

    Science.gov (United States)

    Sukketsiri, Wanida; Chonpathompikunlert, Pennapa; Tanasawet, Supita; Choosri, Nutjanat; Wongtawatchai, Tulaporn

    2016-06-01

    Apium graveolens Linn. (Apiaceae) is an indigenous plant of the North and South Americas, Southern Europe, and Asia and has been widely used as a food or a traditional medicine for treatment of inflammation and arthritis. The purpose of this study was to investigate the antioxidant effects of a methanolic extract of A. graveolens (AGE) against liver oxidative stress in an adjuvant-induced arthritic rat model. The AGE (250, 500, and 1,000 mg/kg) was given orally for 24 consecutive days after induction by injecting complete Freund's adjuvant. Liver and spleen weights were recorded. The superoxide anion level, total peroxide (TP), glutathione peroxidase (GPx) activity, superoxide dismutase (SOD) activity, total antioxidant status, and oxidative stress index (OSI) were also measured. AGE treatment significantly decreased the levels of the superoxide anion, TP, and OSI whereas the GPx and SOD activities significantly increased in the liver of the arthritic rats. These results indicated that AGE showed an ameliorative effect against liver oxidative stress in adjuvant-induced arthritic rats by reducing the generation of liver free radicals and increasing the liver antioxidant enzyme activity. PMID:27390722

  1. Effects of Apium graveolens Extract on the Oxidative Stress in the Liver of Adjuvant-Induced Arthritic Rats

    Science.gov (United States)

    Sukketsiri, Wanida; Chonpathompikunlert, Pennapa; Tanasawet, Supita; Choosri, Nutjanat; Wongtawatchai, Tulaporn

    2016-01-01

    Apium graveolens Linn. (Apiaceae) is an indigenous plant of the North and South Americas, Southern Europe, and Asia and has been widely used as a food or a traditional medicine for treatment of inflammation and arthritis. The purpose of this study was to investigate the antioxidant effects of a methanolic extract of A. graveolens (AGE) against liver oxidative stress in an adjuvant-induced arthritic rat model. The AGE (250, 500, and 1,000 mg/kg) was given orally for 24 consecutive days after induction by injecting complete Freund’s adjuvant. Liver and spleen weights were recorded. The superoxide anion level, total peroxide (TP), glutathione peroxidase (GPx) activity, superoxide dismutase (SOD) activity, total antioxidant status, and oxidative stress index (OSI) were also measured. AGE treatment significantly decreased the levels of the superoxide anion, TP, and OSI whereas the GPx and SOD activities significantly increased in the liver of the arthritic rats. These results indicated that AGE showed an ameliorative effect against liver oxidative stress in adjuvant-induced arthritic rats by reducing the generation of liver free radicals and increasing the liver antioxidant enzyme activity. PMID:27390722

  2. First report of a 16SrI-C phytoplasma infecting celery (|Apium graveolens) with stunting, bushy top and phyllody in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Fránová, Jana; Špak, Josef

    2013-01-01

    Roč. 161, č. 9 (2013), s. 666-670. ISSN 0931-1785 R&D Projects: GA MŠk LD12074 Institutional support: RVO:60077344 Keywords : Apium graveolens * PCR/RFLP * sequencing Subject RIV: EE - Microbiology, Virology Impact factor: 0.921, year: 2013

  3. Chemical constituents and toxicity of Agastache foeniculum (Pursh kuntze essential oil against two stored-product insect pests Componentes químicos y toxicidad del aceite esencial de Agastachefoeniculum (Pursh Kuntze contra dos plagas de insectos de productos almacenados

    Directory of Open Access Journals (Sweden)

    Asgar Ebadollahi

    2011-06-01

    Full Text Available The uncontrolled use of synthetic insecticides is a great hazard for the environment and consumers. Essential oils were introduced as low toxic agents against mammals and non-targeted insects. In this study, essential oil from aerial parts of blue giant hyssop (Agastache foeniculum [Pursh] Kuntze (Lamiaceae was isolated by the water steam distillation method with a Clevenger apparatus, and its chemical composition was studied by gas chromatography mass spectrometry. The toxicity of A. foeniculum essential oil against red flour beetle, Tribolium castaneum (Herbst, and lesser grain borer Rhyzopertha dominica (F. was evaluated by fumigation at 24, 48, and 72 h exposure times. Estragole and 1,8-cineole were identified as major constituents of the A. foeniculum oil. Fumigation bioassays revealed that A.foeniculum oil had strong insecticidal activity on experimental insects. Rhyzopertha dominica was more susceptible than T. castaneum for all exposure times. Insecticidal activity varied with essential oil concentration and exposure time. Probit analysis showed that increased exposure time and essential oil concentration increased mortality. These results indicated that A. foeniculum essential oil can be applied in the management of stored-product insects to decrease the detrimental effects of synthetic insecticides.El uso incontrolado de los insecticidas sintéticos causa gran peligro para el medio ambiente y los consumidores. Los aceites esenciales se presentan como agentes tóxicos leves contra mamíferos e insectos no objetivo. En el presente estudio, el aceite esencial de las partes aéreas del hisopo gigante azul (Agastache Foeniculum [Pursh] Kuntze (Lamiaceae se aisló por el método de destilación al vapor de agua, utilizando un aparato de Clevenger y se estudió su composición química mediante cromatografía de gases y espectrometría de masas. La toxicidad del aceite esencial de A. foeniculum se evaluó por métodos de fumigación a las 24

  4. Estudio de las asociaciones áfidos-entomófagos sobre Foeniculum vulgare (Umbelliferae) y Conyza bonariensis (Asteraceae) en la región central de Santa Fe, Argentina Study of the associations of aphids-entomophagous in Foeniculum vulgare (Umbelliferae) and Conyza bonariensis (Asteraceae) in the central region of Santa Fe, Argentina

    OpenAIRE

    Romina G. Manfrino; César E. Salto; Leticia Zumoffen

    2011-01-01

    El objetivo del presente trabajo fue estudiar las asociaciones áfidos-entomófagos en Foeniculum vulgare (Miller) y Conyza bonariensis L, a fin de implementar el Control Biológico Conservativo (CBC) en agroecosistemas de la región central de la provincia de Santa Fe. Se realizaron estudios, a campo, de la entomofauna presente mediante la observación directa de las plantas; las mismas se llevaron a cabo con una frecuencia semanal. En invernáculo, se procedió a la identificación de las especies ...

  5. Phytochemicals from Ruta graveolens Activate TAS2R Bitter Taste Receptors and TRP Channels Involved in Gustation and Nociception.

    Science.gov (United States)

    Mancuso, Giuseppe; Borgonovo, Gigliola; Scaglioni, Leonardo; Bassoli, Angela

    2015-01-01

    Ruta graveolens (rue) is a spontaneous plant in the Mediterranean area with a strong aroma and a very intense bitter taste, used in gastronomy and in folk medicine. From the leaves, stems and fruits of rue, we isolated rutin, rutamarin, three furanocoumarins, two quinolinic alkaloids, a dicoumarin and two long chain ketones. Bitter taste and chemesthetic properties have been evaluated by in vitro assays with twenty receptors of the TAS2R family and four TRP ion channels involved in gustation and nociception. Among the alkaloids, skimmianine was active as a specific agonist of T2R14, whereas kokusaginin did not activate any of the tested receptors. The furanocoumarins activates TAS2R10, 14, and 49 with different degrees of selectivity, as well as the TRPA1 somatosensory ion channel. Rutamarin is an agonist of TRPM5 and TRPV1 and a strong antagonist of TRPM8 ion channels. PMID:26501253

  6. Phytochemicals from Ruta graveolens Activate TAS2R Bitter Taste Receptors and TRP Channels Involved in Gustation and Nociception

    Directory of Open Access Journals (Sweden)

    Giuseppe Mancuso

    2015-10-01

    Full Text Available Ruta graveolens (rue is a spontaneous plant in the Mediterranean area with a strong aroma and a very intense bitter taste, used in gastronomy and in folk medicine. From the leaves, stems and fruits of rue, we isolated rutin, rutamarin, three furanocoumarins, two quinolinic alkaloids, a dicoumarin and two long chain ketones. Bitter taste and chemesthetic properties have been evaluated by in vitro assays with twenty receptors of the TAS2R family and four TRP ion channels involved in gustation and nociception. Among the alkaloids, skimmianine was active as a specific agonist of T2R14, whereas kokusaginin did not activate any of the tested receptors. The furanocoumarins activates TAS2R10, 14, and 49 with different degrees of selectivity, as well as the TRPA1 somatosensory ion channel. Rutamarin is an agonist of TRPM5 and TRPV1 and a strong antagonist of TRPM8 ion channels.

  7. The effects of chrysin and pinostrobin, two flavonoids isolated from Teloxys graveolens leaves, on isolated guinea-pig ileum.

    Science.gov (United States)

    Meckes, M; Paz, D; Acosta, J; Mata, R

    1998-12-01

    The pharmacological effects of pinostrobin and chrysin obtained from the aerial parts of Teloxys graveolens (Chenopodiaceae) were evaluated using isolated in vitro guinea-pig ileal smooth muscle. Both flavonoids inhibited the contractions evoked by high concentrations of potassium. The potency of the relaxant effect was determined by measuring the capacity of each product in reducing the phasic and the slower sustained tonic contractile responses induced by depolarization with 60 mM K(+). Concentrations up to 5 × 10(-7) M of pinostrobin and 1 × 10(-7) M of chrysin induced a non-competitive depression of responses to Ca(2+) in ileum preparations bathed in a Ca(2+)-free, high K(+) medium. Both compounds produced a rightward displacement of the concentration-response curves to Ca(2+) with a concentration-dependant increase of EC(50) and a decrease of the maximal response. Examination of the inhibitory effect produced by these flavonoids on the phasic component of contractile response evoked with K(+) and on the contraction induced with caffeine, led to propose a different intracellular mechanism of action used by these compounds. The results obtained led us to conclude that the previously detected relaxant effect of Teloxys graveolens crude extract is due in part, to the presence of chrysin and pinostrobin, which inhibit intestinal smooth muscle contractions by means of a calcium-mediated mechanism. Since the modulation of calcium fluxes in the mucosal epithelium may play a role in antidiarrheal drug action, the observed effects in vitro could in the same way explain the popular use of the plant for the treatment of diarrhea. PMID:23196029

  8. Caracterização da produtividade do funcho (Foeniculum vulgare Mill. no sertão de Sergipe Characterization of the of fennel's (Foeniculum vulgare Mill. yield semi-arid areas of Sergipe state

    Directory of Open Access Journals (Sweden)

    L.M. Carvalho

    2011-01-01

    Full Text Available Com o objetivo de avaliar a produtividade e qualidade do funcho (Foeniculum vulgare Mill. produzido nas condições edafoclimáticas de Sergipe, foi conduzido cultivo orgânico de funcho em Frei Paulo-SE. Em junho de 2008 e de 2009, início do período de chuvas, foram instalados plantios por meio de mudas. Adicionalmente, em dezembro de 2010 foi realizada colheita de frutos a partir de plantas obtidas após poda drástica e rebrota. Foi realizada colheita de frutos e determinação da produtividade de dezembro a janeiro de 2008, 2009 e em dezembro de 2010. Verificou-se produtividade de 720 Kg.ha-1, no primeiro plantio e de 349 Kg.ha-1 no plantio de 2009. As plantas obtidas por rebrota em 2010 resultaram em produtividade de 589 Kg.ha-1. Sugere-se que a maior produtividade verificada no primeiro ano seja decorrente da maior precipitação média e conseqüente maior disponibilidade de água. A produtividade verificada nas plantas que rebrotaram em 2010 foi também superior a verificada em 2009, o que pode ser explicado tanto em função da maior precipitação, quanto em função do provável maior desenvolvimento das raízes e maior número de ramos após poda, devido à quebra da dominância apical. Esses dados sugerem importância da disponibilidade hídrica na determinação da produtividade na região e explicam a variação na produtividade verificada. A massa seca dos frutos (5, 29 g para 1000 frutos e o alto teor de óleo essencial verificado (3,2%, assim como a composição do óleo, revelam a alta qualidade dos frutos produzidos na região.Aiming to evaluate the productivity and quality of fennel fruits produced in the countryside of Sergipe, with no irrigation, they were evaluated organic crops in Frei Paulo-SE. They were installed crops in 2008 and 2009 from seeds, on beginning rainy time. Seedlings obtained from seeds were transplanted in June 2008 and 2009. Besides, after the last harvest of the plants, grown in 2009, it was done a

  9. Sublethal Effects of Essential Oils From Eucalyptus staigeriana (Myrtales: Myrtaceae), Ocimum gratissimum (Lamiales: Laminaceae), and Foeniculum vulgare (Apiales: Apiaceae) on the Biology of Spodoptera frugiperda (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Cruz, G S; Wanderley-Teixeira, V; Oliveira, J V; Lopes, F S C; Barbosa, D R S; Breda, M O; Dutra, K A; Guedes, C A; Navarro, D M A F; Teixeira, A A C

    2016-04-01

    Spodoptera frugiperda (Smith 1797) (Lepidoptera: Noctuidae) is a major pest of maize, Zea mays L. Its control is often achieved through repeated applications per season of insecticides, which may lead to adverse effects on the ecosystem. Thus, the study of alternative methods with less environmental impact has expanded to include the use of essential oils. These oils are products of the secondary metabolism in plants, and their insecticidal activity has been widely demonstrated in populations of many pest insects. This study evaluated the insecticidal activities of essential oils from Eucalyptus staigeriana, Ocimum gratissimum, and Foeniculum vulgare on Spodoptera frugiperda. Gas chromatography–mass spectrometry profiles and contact toxicity of these oils as well as their sublethal effects on larvae and reproductive parameters in adults were evaluated. All three oils had sublethal effects on S. frugiperda; however, the oil of O. gratissimum showed the best results at all doses tested. These essential oils may have promise for control of S. frugiperda. PMID:26868417

  10. Lippia graveolens and Carya illinoensis Organic Extracts and there in vitro Effect Against Rhizoctonia Solani Kuhn

    OpenAIRE

    Francisco D. Hernandez-Castillo; Francisco Castillo-Reyes; Gabriel Gallegos-Morales; Raul Rodriguez-Herrera; AGUILAR-GONZALEZ, CRISTOBAL N.

    2010-01-01

    Problem statement: Plant extracts with polyphenolic compounds obtained with different solvents have been evaluated against plant pathogens. However, most of these extract have been obtained using solvents no allowed under an organic production context. Approach: In the present research was to evaluate the inhibitory effect of polyphenolic extracts from L. graveolens and C. illinoensis, obtained with alternative organic solvents (lanolin and cocoa butter), water and ethanol against R. solani i...

  11. UJI IRITASI DAN AKTIVITAS PERTUMBUHAN RAMBUT TIKUS PUTIH: EFEK SEDIAAN GEL APIGENIN DAN PERASAN HERBA SELEDRI (Apium graveolens L.

    Directory of Open Access Journals (Sweden)

    Emma Sri Kuncari

    2015-05-01

    Full Text Available AbstrakPerasan seledri (Apium graveolens L. biasa dipergunakan untuk memacu pertumbuhan rambut. Salah satu senyawa utama yang terkandung di dalam seledri adalah apigenin. Penelitian ini membahas tentang pengaruh pemakaian gel yang mengandung apigenin dan perasan herba seledri sebagai penumbuh rambut, meliputi uji iritasi dan aktivitas pertumbuhan rambut pada tikus putih jantan galur Spraque-Dawley. Uji iritasi menggunakan metode Kamkaen dan Rao, sedangkan uji aktivitas penumbuh rambut menggunakan metode Hattori-Ogawa dan Suzuki-Hamada. Berdasarkan indeks iritasi primer, semua formulasi gel tidak potensial menyebabkan iritasi pada kulit tikus putih (p>0,05. Gel yang mengandung apigenin dan perasan herba seledri menunjukkan aktivitas lebih baik dalam memacu pertumbuhan rambut (p<0,05 dibandingkan kontrol tanpa perlakuan. Apigenin menunjukkan aktivitas lebih baik (p<0,05 dalam meningkatkan ketebalan rambut dibandingkan kontrol tanpa perlakuan.Namun perlakuan perasan herba seledri tidak nyata (p>0,05 meningkatkan ketebalan rambut. Dapat disimpulkan bahwa gel yang mengandung apigenin dan perasan herba seledri dapat meningkatkan pertumbuhan rambut pada tikus putih dibandingkan kontrol tanpa perlakuan.Kata kunci : seledri, apigenin, gel, iritasi kulit, penumbuh rambutAbstractCelery (Apium graveolens L. juice is widely used for promoting hair growth. One of the main compounds in celery is apigenin. This research discusses about the effect of gel containing apigenin and celery juice application as hair growth in term of skin irritation and its hair growth activity on Spraque-Dawley male mice. The irritation test was Kamkaen and Rao methods, while hair growth activity was HattoriOgawa and Suzuki-Hamada methods. Based on primary index irritation, all of the gel formulations did not signifiantly potential in resulting skin irritation on the mice (p>0,05. Gel containing apigenin andcelery juice showed better activity in promoting hair growth (p<0,05 than

  12. Relation between growth stages and synthesis of flavonoids and essential oils affected by irradiation in Ruta graveolens seeds

    International Nuclear Information System (INIS)

    Ruta graveolens plants are radio-adaptive up to 8 Krad gamma radiation. Flavonoids and essential oils were remarkably increased as function of irradiation doses from 2 up to 8 Krad. Doses of 4 and 8 Krad were the most effective ones. Concerning flavonoids, 4 and 8 Krad treatments exerted the following percent increase over control plants: 76, 77% (leaves), 137, 100% (stems), 153, 80% (flowers) and 77, 61% (fruits). The distribution pattern of flavonoids was in the following order: Leaves > flowers > fruits > stems. Treated plants with 4 or 8 Krad resulted in an increase in essential oil yield by 65-67% over control plants. Chemical constitution of oil: ketones and esters did not seem to be affected by seed irradiation (0-8 Krad). Similarly, physical properties ''refractive index, solubility and specific gravity'' did not materially affect. However, chemical properties ''acid value, ester value and saponification value'' were increased by 24% over control treatment as a function of 4 Krad. Yet higher doses had the capacity of increasing the acid value but not of both ester or saponification value

  13. Ozone stomatal flux and O3 concentration-based metrics for Astronium graveolens Jacq., a Brazilian native forest tree species.

    Science.gov (United States)

    Cassimiro, Jéssica C; Moura, Bárbara B; Alonso, Rocio; Meirelles, Sérgio T; Moraes, Regina M

    2016-06-01

    The current levels of surface ozone (O3) are high enough to negatively affect trees in large regions of São Paulo State, southeastern Brazil, where standards for the protection of vegetation against the adverse effects of O3 do not exist. We evaluated three O3 metrics - phytotoxic ozone dose (POD), accumulated ozone exposure over the threshold of 40 ppb h (AOT40), and the sum of all hourly average concentrations (SUM00) - for the Brazilian native tropical tree species Astronium graveolens Jacq. We used the DO3SE (Deposition of Ozone for Stomatal Exchange) model and calculated PODY for different thresholds (from 0 to 6 mmol O3 m(-2) PLA s(-1)), evaluating the model's performance through the relationship between measured and modelled conductance. The response parameters were: visible foliar injury, considered as incidence (% injured plants), severity (% injured leaves in relation to the number of leaves on injured plants), and leaf abscission. The model performance was suitable and significant (R(2) = 0.58; p < 0.001). POD0 was better correlated to incidence and leaf abscission, and SUM00 was better correlated to severity. The highest values of O3 concentration-based metrics (AOT40 and SUM00) did not coincide with those of POD0. Further investigation may improve the model and contribute to the proposition of a national standard for the protection of native species. PMID:26805742

  14. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses.

    Science.gov (United States)

    Pilau, Marciele Ribas; Alves, Sydney Hartz; Weiblen, Rudi; Arenhart, Sandra; Cueto, Ana Paula; Lovato, Luciane Teresinha

    2011-10-01

    Mexican oregano (Lippia graveolens) is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3-4,5-dimethythiazol-2yl)-2,5-diphenyl tetrazolium bromide) was conducted to determine the selectivity index (SI) of the essential oil, which was equal to 13.1, 7.4, 10.8, 9.7, and 7.2 for acyclovir-resistant herpes simplex virus type 1 (ACVR-HHV-1), acyclovir-sensitive HHV-1, human respiratory syncytial virus (HRSV), bovine herpesvirus type 2 (BoHV-2), and bovine viral diarrhoea virus (BVDV), respectively. The human rotavirus (RV) and BoHV-1 and 5 were not inhibited by the essential oil. Carvacrol alone exhibited high antiviral activity against RV with a SI of 33, but it was less efficient than the oil for the other viruses. Thus, Mexican oregano oil and its main component, carvacrol, are able to inhibit different human and animal viruses in vitro. Specifically, the antiviral effects of Mexican oregano oil on ACVR-HHV-1 and HRSV and of carvacrol on RV justify more detailed studies. PMID:24031796

  15. Antiviral activity of the Lippia graveolens (Mexican oregano essential oil and its main compound carvacrol against human and animal viruses

    Directory of Open Access Journals (Sweden)

    Marciele Ribas Pilau

    2011-12-01

    Full Text Available Mexican oregano (Lippia graveolens is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3-4,5-dimethythiazol-2yl-2,5-diphenyl tetrazolium bromide was conducted to determine the selectivity index (SI of the essential oil, which was equal to 13.1, 7.4, 10.8, 9.7, and 7.2 for acyclovir-resistant herpes simplex virus type 1 (ACVR-HHV-1, acyclovir-sensitive HHV-1, human respiratory syncytial virus (HRSV, bovine herpesvirus type 2 (BoHV-2, and bovine viral diarrhoea virus (BVDV, respectively. The human rotavirus (RV and BoHV-1 and 5 were not inhibited by the essential oil. Carvacrol alone exhibited high antiviral activity against RV with a SI of 33, but it was less efficient than the oil for the other viruses. Thus, Mexican oregano oil and its main component, carvacrol, are able to inhibit different human and animal viruses in vitro. Specifically, the antiviral effects of Mexican oregano oil on ACVR-HHV-1 and HRSV and of carvacrol on RV justify more detailed studies.

  16. Improvement Seedling Growth Of Celery (Apium graveolens L.) Using Humic Acid, Potassium Silicate And Low Gamma Irradiation Doses

    International Nuclear Information System (INIS)

    The effects of different priming treatments either at room temperature or at 5 degree C in an incubator for 16 hours were studied. An experiment of pots was planted using hydro priming celery ( Apium graveolens L.) seeds for comparison with those primed in different solutions. Seeds were soaked in Petri dishes containing: tap water, different concentrations of potassium silicate (2, 4, 8, 16 mM Si) and humic acid concentrations (5, 20,100, 200 mM ) at room temperature and 5 degree C in an incubator before planting for 16 hours. Also, some dry seeds we re exposed to gamma rays at different low doses (20, 40, 60 Gy) before priming in tap water. This work aimed to improve the tolerance of celery seeds subjected to chilling stress by priming seeds in different concentrations of humic acid and potassium silicate in addition to use low doses of ionizing radiation to accelerate plants proliferation, growth, and leaves yield. Humic acid and potassium silicate were effective as priming solutions for alleviating the chilling stress, stimulating celery growth, and proliferation. In addition, using of low doses of ionizing radiation had a stimulant effect on plants after 120 days from planting

  17. Performance of rose scented geranium (Pelargonium graveolens) in heavy metal polluted soil vis-à-vis phytoaccumulation of metals.

    Science.gov (United States)

    Chand, Sukhmal; Singh, Geetu; Patra, D D

    2016-08-01

    An investigation was carried out to evaluate the effect of heavy metal toxicity on growth, herb, oil yield and quality and metal accumulation in rose scented geranium (Pelargonium graveolens) grown in heavy metal enriched soils. Four heavy metals (Cd, Ni, Cr, and Pb) each at two levels (10 and 20 mg kg-1 soil) were tested on geranium. Results indicated that Cr concentration in soil at 20 mg kg-1 reduced leaves, stem and root yield by 70, 83, and 45%, respectively, over control. Root growth was significantly affected in Cr stressed soil. Nickel, Cr, and Cd concentration and accumulation in plant increased with higher application of these metals. Chromium, nickel and cadmium uptake was observed to be higher in leaves than in stem and roots. Essential oil constituents were generally not significantly affected by heavy metals except Pb at 10 and 20 ppm, which significantly increased the content of citronellol and Ni at 20 ppm increased the content of geraniol. Looking in to the higher accumulation of toxic metals by geranium and the minimal impact of heavy metals on quality of essential oil, geranium can be commercially cultivated in heavy metal polluted soil for production of high value essential oil. PMID:26696243

  18. Molecular identification of Foeniculum vulgare and its adulterants by ITS2 sequence%ITS2序列鉴定小茴香及其常见混伪品

    Institute of Scientific and Technical Information of China (English)

    刘义梅; 罗焜; 陈科力; 陈士林

    2011-01-01

    目的 探讨基于ITS2序列鉴定小茴香及其混伪品的新方法.方法 对小茴香4份样品的ITS2序列进行PCR扩增和测序,同时从GenBank上下载小茴香及其常见混伪品共6个物种42个样本.用MEGA4.1计算其种间、种内的K-2-P距离,并分析各物种间ITS2序列二级结构的差异,最后利用ITS2序列构建其系统发育树.结果 小茴香种内最大K-2-P距离为0.0307,与混伪品的种间最小K-2-P距离为0.0405;小茴香及其混伪品的ITS2二级结构存在明显差异;构建的系统发育树显示小茴香的不同来源样本聚在一支,能很好与混伪品区分.结论 ITS2序列能够成功鉴定小茴香及其易混伪品,可以作为小茴香及其混伪品的分子鉴定方法.%Objective To explore the new method of discriminating Foeniculum vulgare from its adulterants by using ITS2 sequence. Method DNA samples were extracted from Foeniculum vulgare.ITS2 sequence was amplified by PCR and sequenced hidirectionally. Sequences were assembled hy CodonCode Aligner. The intra-specific and inter-specific K-2P distances of Foeniculum vulgare ancl its adulterants were calculated. and NJ tree was constructed by MEGA V 4. 1. ITS2 and secondary structure were predicted by the web tool established by Schultz etc. Results The maximum intra-specific K-2P distance was0. 0307 . while the minimum inter-specific K-2P distance was 0. 0405. Different samples of Foeniculum vulgare were gathered together and could be distinguished from its adulterants by NJ tree. And Foeniculum vulgare could he differentiated obviously from its adulterants by their ITS2 secondary structure. Conclusion Our study shows that ITS2 sequence is able to identify Foeniculum vulgare from its adulterants successfully and is an efficient molecular identification method for Foeniculum vulgare and its adulterants.

  19. Anti-Giardia activity of phenolic-rich essential oils: effects of Thymbra capitata, Origanum virens, Thymus zygis subsp. sylvestris, and Lippia graveolens on trophozoites growth, viability, adherence, and ultrastructure.

    Science.gov (United States)

    Machado, Marisa; Dinis, Augusto M; Salgueiro, Ligia; Cavaleiro, Carlos; Custódio, José B A; Sousa, Maria do Céu

    2010-04-01

    The present work evaluates the anti-Giardia activity of phenolic-rich essential oils obtained from Thymbra capitata, Origanum virens, Thymus zygis subsp. sylvestris chemotype thymol, and Lippia graveolens aromatic plants. The effects were evaluated on parasite growth, cell viability adherence, and morphology. The tested essential oils inhibited the growth of Giardia lamblia. T. capitata essential oil is the most active followed by O. virens, T. zygis subsp. sylvestris, and L. graveolens oils. The tested essential oils at IC50 (71-257) microg/ml inhibited parasite adherence (p capitata, O. virens, T. zygis subsp. sylvestris chemotype thymol, and L. graveolens essential oils have antigiardial activity in vitro and seem to have potential for the treatment of the parasitic disease caused by the protozoan G. lamblia. PMID:20217133

  20. 小茴香根皮化学成分研究%On the chemical constituents from the root barks of Foeniculum vulgare Mill

    Institute of Scientific and Technical Information of China (English)

    林健博; 古丽娜·沙比尔

    2014-01-01

    目的 分析新疆小茴香(Foeniculum vulgare Mill)根皮中的化学成分.方法 采用硅胶柱层析法反复分离纯化技术,通过质谱分析、核磁共振等现代波谱技术对新疆小茴香根皮中的化学成分进行结构鉴定.结果 从新疆小茴香中分离得到6种化合物:7-羟基-6-甲氧基香豆素(Scopoletin,Ⅰ).5-羟甲基糠(5-Hydroxymethylfurfural,Ⅱ)、焦谷氨酸乙酯(5-oxo-2-pyrrolidinecarboxylic acid;(±)-form,ET ester,Ⅲ)、胡萝卜苷(Daucosterol,Ⅳ)、β-谷甾醇(β-Sitosterol,V)、蔗糖(Sucrose,Ⅵ).结论 化合物Ⅰ~Ⅲ为首次从茴香属植物中分离得到,为进一步研究新疆小茴香的化学成分提供理论依据.

  1. The Effect of Drought Stress on the Essential Oil Content and Some of the Biochemical Characteristics of Anise Hyssop (Agastache foeniculum [Pursh] Kuntze

    Directory of Open Access Journals (Sweden)

    Sajedeh Saeedfar

    2015-06-01

    Full Text Available Plot trials were carried out in a research field in Tehran (Iran to determine the effect of drought stress on the essential oil content and some of the plant biochemical characteristics of Anise Hyssop (Agastache foeniculum [Pursh] Kuntze, which is a valuable medicinal plant. Drought stress was conducted at different levels including: well-water (100% FC, mild drought stress (85% FC, moderate drought stress (70% FC, severe drought stress (55% FC, 100% FC (vegetative stage 85% FC (reproductive stage, 100% FC (vegetative stage 70% FC (reproductive stage, and 85% FC (vegetative stage 100% FC (reproductive stage. The experiment was arranged as a RCBD with three replications. The output results showed that, water deficit stress significantly (P≤0.05 increased activities of antioxidant enzymes (Superoxide Dismutase, Catalase, Glutathione Peroxidase as well as Essential Oil yield and Abscisic Acid content. Lipid and protein oxidation (malondialdehyde and dityrosine contents also increased significantly under severe water deficit stress. According to the results, severe drought conduction (55% FC is the optimum level of soil moisture to plant Anise Hyssop under water deficit stress.

  2. The insecticidal potential of Foeniculum vulgareMill., Pimpinella anisum L. and Caryophillus aromaticus L. to control aphid on kale plants

    Directory of Open Access Journals (Sweden)

    P. S. R. LUCCA

    2015-12-01

    Full Text Available ABSTRACTThe use of natural substances for pest control in agriculture is, economically, a viable option and has benefits for both the humanbeing and the environment, due to its low persistence and toxicity. Thus, this trial aimed on determining the insecticidal potential of the extracts and essential oils of fennel (Foeniculum vulgare Mill., anise (Pimpinella anisum L. and clove (Caryophillus aromaticus L. to control Brevicoryne brassicae L. in kale (Brassica oleracea var. acephala DC.. The treatments were: fennel, anise, cloves extracts at 10%; fennel, anise, cloves oils at 1% and control with distilled water. The mortality tests were carried out with aphids in laboratory, with three replications, after 1, 12, 24, 48 and 72 hours. During laboratory trials , it was found out that fennel oil at 1% showed the best rate of mortality on aphid nymphs (70% at 72 h, followed by clove extract at 10% with 37% mortality. Tests in pots were only carried out only with cloves extracts at 10% and fennel oil at 1% treatment, in which such efficiency was alsoindicated on aphid nymphs.

  3. Rezene (Foeniculum dulce Miller) uçucu yağının verimine ve bileşimine partikül boyutunun etkisi

    OpenAIRE

    BALKAN, Canan

    2015-01-01

    Bu çalışmada, tatlı rezene (Foeniculum dulce Miller) tohumları öğütülerek elde edilen 5 farklı boyuttaki partiküllerin, uçucu yağın verimine ve bileşimine etkisi araştırılmıştır. Materyal olarak, Burdur’un Gölhisar ilçesinde 2010 ve 2011 yıllarında yetiştirilip hasat edilen rezene tohumları kullanılmıştır. Tohumlar öğütüldükten sonra elek analizi yapılarak beş farklı partikül boyutunda (<300μm, 300-710μm, 710μm-1mm, 1-1,4mm, >1,4mm) sınıflandırılmıştır. Öğütülmüş rezene...

  4. Estimación de la capacidad germinativa y el vigor de las semillas de diomate (astronium graveolens jacq.) sometidas a diferentes tratamientos y condiciones de almacenamiento.

    OpenAIRE

    Gómez Restrepo, Martha Ligia

    2011-01-01

    Se llevaron a cabo dos estudios con semillas de diomate (Astronium graveolens Jacq). El primero se hizo con el fin de determinar el efecto que sobre la germinación tienen el sustrato y la condición lumínica. El segundo, para evaluar la respuesta germinativa de semillas almacenadas durante varios períodos y bajo diferentes condiciones de temperatura y empaque. Las semillas de diomate sembradas a plena exposición y en las cuales se utilizó tierra como sustrato obtuvieron la mayor potencia germi...

  5. Evaluation of antioxidant activity of Ruta graveolens L. extract on inhibition of lipid peroxidation and DPPH radicals and the effects of some external factors on plant extract's potency.

    Directory of Open Access Journals (Sweden)

    S. Mohammadi- Motamed

    2014-01-01

    Full Text Available The antioxidant properties of Ruta graveolens L. were evaluated by two different methods; free radical scavenging using DPPH and inhibition of lipid peroxidation by the ferric thiocyanate method. The IC50 value of the methanol extract in DPPH inhibition was 200.5 μg/mL which was acceptable in comparison with BHT (41.8 μg/mL. In thiocyanate method, the plant extract demonstrated activity as much as BHT in prevention of lipid peroxidation. Increasing the temperature during extraction, significantly decreased the extract power in inhibition of DPPH radicals. The storage time and temperature had no effect on lipid peroxidation inhibition.

  6. Evaluation of antioxidant activity of Ruta graveolens L. extract on inhibition of lipid peroxidation and DPPH radicals and the effects of some external factors on plant extract's potency.

    OpenAIRE

    S. Mohammadi- Motamed; S. Shahidi-Motlagh; H. Bagherzadeh; S. Azad Forouz; H. Tafazoli

    2014-01-01

    The antioxidant properties of Ruta graveolens L. were evaluated by two different methods; free radical scavenging using DPPH and inhibition of lipid peroxidation by the ferric thiocyanate method. The IC50 value of the methanol extract in DPPH inhibition was 200.5 μg/mL which was acceptable in comparison with BHT (41.8 μg/mL). In thiocyanate method, the plant extract demonstrated activity as much as BHT in prevention of lipid peroxidation. Increasing the temperature during extraction, signific...

  7. The effect of chronic administration of Apium graveolens aqueous extract on learning and memory in normal and diabetic rats

    Directory of Open Access Journals (Sweden)

    Mehdad Roghani

    2009-01-01

    Full Text Available   Abstract   Introduction: Diabetes mellitus accompanies with disturbances in learning, memory, and cognitive skills in the human society and experimental animals. Considering the beneficial antidiabetic potential of Apium graveolens (AG , this research study was conducted to evaluate the effect of chronic i.p. administration of AG on learning and memory in diabetic rats using passive avoidance and Y-maze tests.   Methods: Female Wistar rats were randomly divided into control, AG-treated control, diabetic, and AG-treated diabetic groups. AG treatment continued for 4 weeks. For induction of diabetes, streptozotocin was injected i.p. at a single dose of 60 mg/kg. For evaluation of learning and memory, initial latency (IL and step-through latency (STL were determined at the end of study using passive avoidance test. Meanwhile, alternation behavior percentage was determined using Y maze. Results: There was a significant increase (p<0.05 in IL in diabetic and AG-treated diabetic groups after 4 weeks as compared to control group. In this respect, there was no significant difference between diabetic and AG-treated diabetic groups. On the other hand, STL significantly decreased (p<0.05 in diabetic group and significantly increased (p<0.05 in AG-treated diabetic group as compared to control group at the end of study. In addition, STL did not significantly change in AG-treated control group in comparison with control group. In addition, results of Y-maze test showed that there is no significant difference between diabetic and Ag-treated diabetic groups and between control and Ag-treated control group regarding alternation behavior. Discussion: In summary, chronic oral administration of AG could enhance the consolidation and recall capability of stored information only in diabetic animals and did not affect spatial memory of diabetic animals.  

  8. Review of scientific evidence of medicinal convoy plants in traditional Persian medicine

    Directory of Open Access Journals (Sweden)

    Seyede Nargess Sadati

    2016-01-01

    Full Text Available One concept used in traditional Persian medicine (TPM for multidrug therapy is that of the convoy drug (Mobadregh. According to TPM texts, convoy drugs are substances (or drugs, which facilitate the access of drugs or foods to the whole body or to specific organs. This study reviewed some convoy drugs presented in TPM, their biological effects, and their probable interactions with main drugs, considering the increased absorption through inhibition of P-glycoprotein (P-gp efflux function, bioavailability-enhancing effects, and decreased metabolism of the main drug using electronic databases including PubMed, Scopus, ScienceDirect, and Google Scholar in November and December, 2013. Recent studies have proven the beneficial effects of Crocus sativus L. (saffron and camphor on the heart and brain, the cerebral therapeutic effects of Asarum europaeum (hazelwort, the hepatoprotective effects of Cichorium intybus (chicory, and Apium graveolens (celery seeds, and the diuretic effects of Cinnamomum zeylanicum (cinnamon, and Cucumis melo (melon seeds. The effects of vinegar in targeting the liver and brain have also been demonstrated. An evaluation of the results demonstrated that the suggested convoy drugs, including Piper nigrum (black pepper, Piper longum (long pepper, red wine, Camellia sinensis (tea, hazelwort, Mentha longifolia (pennyroyal, Anethum graveolens (dill, Foeniculum vulgare (fennel, cinnamon, and Sassafras albidum (sassafras can increase the bioavailability of coadministered drugs by inhibition of P-gp or cytochrome P450s (CYP450s or both of them. This evidence could be a good basis for the use of these agents as convoys in TPM.

  9. Review of Scientific Evidence of Medicinal Convoy Plants in Traditional Persian Medicine.

    Science.gov (United States)

    Sadati, Seyede Nargess; Ardekani, Mohammad Reza Shams; Ebadi, Nastaran; Yakhchali, Maryam; Dana, Azadeh Raees; Masoomi, Fatemeh; Khanavi, Mahnaz; Ramezany, Farid

    2016-01-01

    One concept used in traditional Persian medicine (TPM) for multidrug therapy is that of the convoy drug (Mobadregh). According to TPM texts, convoy drugs are substances (or drugs), which facilitate the access of drugs or foods to the whole body or to specific organs. This study reviewed some convoy drugs presented in TPM, their biological effects, and their probable interactions with main drugs, considering the increased absorption through inhibition of P-glycoprotein (P-gp) efflux function, bioavailability-enhancing effects, and decreased metabolism of the main drug using electronic databases including PubMed, Scopus, ScienceDirect, and Google Scholar in November and December, 2013. Recent studies have proven the beneficial effects of Crocus sativus L. (saffron) and camphor on the heart and brain, the cerebral therapeutic effects of Asarum europaeum (hazelwort), the hepatoprotective effects of Cichorium intybus (chicory), and Apium graveolens (celery) seeds, and the diuretic effects of Cinnamomum zeylanicum (cinnamon), and Cucumis melo (melon) seeds. The effects of vinegar in targeting the liver and brain have also been demonstrated. An evaluation of the results demonstrated that the suggested convoy drugs, including Piper nigrum (black pepper), Piper longum (long pepper), red wine, Camellia sinensis (tea), hazelwort, Mentha longifolia (pennyroyal), Anethum graveolens (dill), Foeniculum vulgare (fennel), cinnamon, and Sassafras albidum (sassafras) can increase the bioavailability of coadministered drugs by inhibition of P-gp or cytochrome P450s (CYP450s) or both of them. This evidence could be a good basis for the use of these agents as convoys in TPM. PMID:27041871

  10. Chemical Composition and Acaricidal Effects of Essential Oils of Foeniculum vulgare Mill. (Apiales: Apiaceae and Lavandula angustifolia Miller (Lamiales: Lamiaceae against Tetranychus urticae Koch (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Asgar Ebadollahi

    2014-01-01

    Full Text Available Utilization of synthetic acaricides causes negative side-effects on nontarget organisms and environment and most of the mite species such as two spotted spider mite, Tetranychus urticae Koch, are becoming resistant to these chemicals. In the present study, essential oils of fennel, Foeniculum vulgare Mill., and lavender, Lavandula angustifolia Miller, were hydrodistilled using Clevenger apparatus and chemical composition of these oils was analyzed by GC-MS. Anethole (46.73%, limonene (13.65%, and α-fenchone (8.27% in the fennel essential oil and linalool (28.63%, 1,8-cineole (18.65%, and 1-borneol (15.94% in the lavender essential oil were found as main components. Contact and fumigant toxicity of essential oils was assessed against adult females of T. urticae after 24 h exposure time. The essential oils revealed strong toxicity in both contact and fumigant bioassays and the activity dependeds on essential oil concentrations. Lethal concentration 50% for the population of mite (LC50 was found as 0.557% (0.445–0.716 and 0.792% (0.598–1.091 in the contact toxicity and 1.876 μL/L air (1.786–1.982 and 1.971 μL/L air (1.628–2.478 in the fumigant toxicity for fennel and lavender oils, respectively. Results indicated that F. vulgare and L. angustifolia essential oils might be useful for managing of two spotted spider mite, T. urticae.

  11. Irradiated Sewage Sludge for Production of Fennel (Foeniculum vulgare L.) Plants in Sandy Soil 2- Seed production, oil content, oil constituents and heavy metals in seeds

    International Nuclear Information System (INIS)

    Field experiment was conducted to study the impact of irradiated and non-irradiated sewage sludge applied to sandy soil on fennel plants (Foeniculum vulgare L.) productivity. In this regards, four rates of sewage sludge application were used (20, 40, 60 and 80 ton/ha) in addition to the mineral fertilizer treatment (control). Sandy soil amended with sewage sludge showed a promising effect on fennel seed yield. A linear gradual increase in seeds yield was observed as the sludge application rate increases. Seeds production increased by 41% to 308% over the control at 80t/ha application rate, for non-irradiated and irradiated sewage sludge treatments, respectively. Irradiated sewage sludge treatments showed higher fennel seed yield than non-irradiated sewage sludge treatments.Volatile oil percent exhibited no observable variation due to the use of sewage sludge. A few and limited fluctuations could be observed. However, total oil content (cc/plot) increased due to the increase in seeds yield. The magnitude of increase in volatile oil production in response to the sewage sludge application was parallel to the increase in seeds yield. The GLC measurements of the fennel volatile oil reveal that, the t-anethole is the predominant fraction. However, fenchone was detected in relatively moderate concentration. The applied sewage sludge treatment induced some variations in fennel volatile oil constituents. The t.anethole is relatively higher in volatile oil obtained from plants grown on sandy soil fertilized with non-irradiated sewage sludge than the one fertilized with irradiated sewage sludge or chemical fertilizer. In the meantime, the obtained increase in t.anethole was accompanied by a decline in fenchone content. Seeds heavy metals (Zn, Fe, Pb, Cd) were determined. Under all sludge application rates iron and zinc concentrations were in the normal plant concentration range whereas, Cd concentrations were traces.

  12. Estudio de las asociaciones áfidos-entomófagos sobre Foeniculum vulgare (Umbelliferae y Conyza bonariensis (Asteraceae en la región central de Santa Fe, Argentina Study of the associations of aphids-entomophagous in Foeniculum vulgare (Umbelliferae and Conyza bonariensis (Asteraceae in the central region of Santa Fe, Argentina

    Directory of Open Access Journals (Sweden)

    Romina G. Manfrino

    2011-06-01

    Full Text Available El objetivo del presente trabajo fue estudiar las asociaciones áfidos-entomófagos en Foeniculum vulgare (Miller y Conyza bonariensis L, a fin de implementar el Control Biológico Conservativo (CBC en agroecosistemas de la región central de la provincia de Santa Fe. Se realizaron estudios, a campo, de la entomofauna presente mediante la observación directa de las plantas; las mismas se llevaron a cabo con una frecuencia semanal. En invernáculo, se procedió a la identificación de las especies cuando esta no fue posible a campo. La especie de áfido encontrada fue Hyadaphis foeniculi (Passerini (Homoptera: Aphididae, colonizando a F. vulgare y se destacó Uroleucon (Lambersius sp. (Homoptera: Aphididae enC. bonariensis. Entre los enemigos naturales, se destacaron los parasitoides y depredadores en F. vulgare y C. bonariensis, respectivamente. Para el estudio de las relaciones áfidos - enemigos naturales, se calcularon los coeficientes de correlación; los valores indicaron una relación entre H. foeniculi y Diaretiella rapae (M'Intosh (Hymenoptera: Braconidae (0,63 y entre Uroleucon (Lambersius sp. y coccinélidos (Coleoptera: Coccinellidae (0,43. Las especies vegetales estudiadas son muy importantes para mantener los distintos grupos de entomófagos en los agroecosistemas y su utilización en programas de CBC de pulgones plaga es posible, contribuyendo así a reducir las aplicaciones de insecticidas en cultivos.The objective of this work was to study the aphids-entomophagous associations in Foeniculum vulgare (Miller and Conyza bonariensis L. in order to implement Conservative Biological Control (CBC in agroecosystems of the central region of Santa Fe Province. Direct observation on plants was conducted on a weekly basis, from February to May 2008. The identification of species was carried out in the greenhouse when it was not possible to do it in the field. The aphid species identified on F. vulgare was Hyadaphis foeniculi (Passerini

  13. ESTIMACIÓN DE LA CAPACIDAD GERMINATIVA Y EL VIGOR DE LAS SEMILLAS DE diomate (Astronium graveolens Jacq.) SOMETIDAS A DIFERENTES TRATAMIENTOS Y CONDICIONES DE ALMACENAMIENTO ESTIMATE OF THE GERMINATIVE CAPACITY AND THE VIGOR OF DIOMATE SEEDS (Astronium graveolens Jacq.) SUBJECTED TO DIFFERENT TREATMENTS AND STORAGE CONDITIONS

    OpenAIRE

    Martha Ligia Gómez Restrepo

    2004-01-01

    Se llevaron a cabo dos estudios con semillas de diomate (Astronium graveolens Jacq). El primero se hizo con el fin de determinar el efecto que sobre la germinación tienen el sustrato y la condición lumínica. El segundo, para evaluar la respuesta germinativa de semillas almacenadas durante varios períodos y bajo diferentes condiciones de temperatura y empaque. Las semillas de diomate sembradas a plena exposición y en las cuales se utilizó tierra como sustrato obtuvieron la mayor potencia germi...

  14. Efectos inducidos por Ruta graveolens L., Cnidoscolus chayamansa McVaugh y Citrus aurantium L. sobre los niveles de glucosa, colesterol y triacilglicéridos en un modelo de rata diabética Efeitos induzidos por Ruta graveolens L., Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, e Citrus aurantium L., Rutaceae, nos níveis de glucose, colesterol e triacilglicerídeos num modelo do rato diabético Induced effects by Ruta graveolens L., Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, and Citrus aurantium L., Rutaceae, on glucose, cholesterol and triacylglycerides levels in a diabetic rat model

    Directory of Open Access Journals (Sweden)

    Lauro Figueroa-Valverde

    2009-12-01

    Full Text Available Varias plantas con propiedades hipoglucemicas se han utilizado en medicina popular y sistemas curativos tradicionales en todo el mundo. El propósito de este trabajo fue evaluar los efectos inducidos por Ruta graveolens L., Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, y Citrus aurantium L., Rutaceae, en un modelo de rata diabética, a la que se le cuantificaron los niveles de glucosa cada 24 horas por un mes después de la administración gástrica del extracto de las plantas. Además, el colesterol y los triglicéridos fueron evaluados usando técnicas enzimáticas. Los resultados mostraron que la administración de Cnidoscolus chayamansa a dosis de 0.5 a 1.5 g/kg induce un aumento hipoglucemico ( 200 mg/dL. Otros resultados, mostraron que Citrus aurantium ejerce cambios en la concentración de triacilglicéridos (158-172 mg/dL y colesterol (120-128 mg/dL. Finalmente, la administración de Ruta graveolens a dosis de 0.5 g/kg induce un efecto hipoglucemico (Diversas plantas com propriedades hipoglicêmicas foram usadas na medicina popular e em sistemas tradicionais de curas em torno do mundo. A finalidade deste trabalho foi avaliar os efeitos induzidos por Ruta graveolens L, Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, e Citrus aurantium L., Rutaceae, em modelo do rato diabético onde níveis da glucose foram determinados a cada 24 h em um mês antes da administração gástrica do extrato das plantas. Colesterol e triacilglicerídeos foram avaliados usando técnicas enzimáticas. Os resultados mostraram que a administração de Cnidoscolus chayamansa a dose de 0,5 a 1,5 g/kg induz um aumento hipoglicêmico ( 200 mg/dL. Outros resultados, mostraram que Citrus aurantium exerce mudanças na concentração de triacilglicerídeos (158-172 mg/dL e colesterol (120-128 mg/dL. Finalmente, a administração de Ruta graveolens na dose de 0.5 g/kg induziu um efeito hipoglicêmico (Several plants with hypoglycemic properties have

  15. Atividade in vitro de plantas condimentares (Rosmarinus officinalis L., Lippia graveolens HBK e Thymus vulgaris L.) contra o calicivírus felino

    OpenAIRE

    Thaís Felli Kubiça; Sydney Hartz Alves; Rudi Weiblen; Andréia Henzel; Mathias Martins; Luciane Terezinha Lovato

    2015-01-01

    O calicivírus felino (FCV) é um importante patógeno de gatos que causa lesões ulcerativas orais e infecções respiratórias. O vírus tem sido utilizado como modelo experimental para avaliação de agente antivirais contra norovírus (NoVs). Nesse estudo, investigou-se a ação dos óleos essenciais de alecrim (Rosmarinus officinalis L.), orégano mexicano (Lippia graveolens HBK.) e tomilho (Thymus vulgaris L.) frente ao FCV, in vitro. A toxicidade celular foi testada pelo método de MTT e os ensaios an...

  16. CYP98A22, a phenolic ester 3’-hydroxylase specialized in the synthesis of chlorogenic acid, as a new tool for enhancing the furanocoumarin concentration in Ruta graveolens

    Directory of Open Access Journals (Sweden)

    Karamat Fazeelat

    2012-08-01

    Full Text Available Abstract Background Furanocoumarins are molecules with proven therapeutic properties and are produced in only a small number of medicinal plant species such as Ruta graveolens. In vivo, these molecules play a protective role against phytophageous insect attack. Furanocoumarins are members of the phenylpropanoids family, and their biosynthetic pathway is initiated from p-coumaroyl coA. The enzymes belonging to the CYP98A cytochrome P450 family have been widely described as being aromatic meta-hydroxylases of various substrates, such as p-coumaroyl ester derivatives, and are involved in the synthesis of coumarins such as scopoletin. In furanocoumarin-producing plants, these enzymes catalyze the step directly downstream of the junction with the furanocoumarin biosynthetic pathway and might indirectly impact their synthesis. Results In this work, we describe the cloning and functional characterization of the first CYP98A encoding gene isolated from R. graveolens. Using Nicotiana benthamiana as a heterologous expression system, we have demonstrated that this enzyme adds a 3-OH to p-coumaroyl ester derivatives but is more efficient to convert p-coumaroyl quinate into chlorogenic acid than to metabolize p-coumaroyl shikimate. Plants exposed to UV-B stress showed an enhanced expression level of the corresponding gene. The R. graveolens cyp98a22 open reading frame and the orthologous Arabidopsis thaliana cyp98a3 open reading frame were overexpressed in stable transgenic Ruta plants. Both plant series were analyzed for their production of scopoletin and furanocoumarin. A detailed analysis indicates that both genes enhance the production of furanocoumarins but that CYP98A22, unlike CYP98A3, doesn’t affect the synthesis of scopoletin. Conclusions The overexpression of CYP98A22 positively impacts the concentration of furanocoumarins in R. graveolens. This gene is therefore a valuable tool to engineer plants with improved therapeutical values that might

  17. Agactache foeniculum L. eterinių aliejų ekstrakcija superkritiniu CO2 ir jų dujų chromatografinė – masių spektrometrinė analizė

    OpenAIRE

    Vanagaitė, Margarita

    2012-01-01

    Anyžinis lofantas (Agastache foeniculum (Pursh) Kuntze) – tai vaistinis, prieskoninis daugiametis augalas. Vienas iš notrelinių šeimos dekoratyvus, daugiametis žolinis augalas, kilęs iš Šiaurės Amerikos. Lietuvoje kol kas dar mažai paplitęs. Auginamas botanikos soduose ir darželiuose, vertinamas kaip labai kvapnus, medingas ir vaistinis augalas. Anyžinis lofantas dirvai mažai reiklus, turi gerai išvystytą šaknų sistemą, todėl nebijo sausros. Geriau auga derlingesnėje žemėje, nepiktžolėtose pr...

  18. STUDY OF DRUG LIKENESS ACTIVITY OF PHYTOCHEMICALS IN MEDICINAL PLANTS

    OpenAIRE

    V. Sathya; Gopalakrishnan, V. K.

    2012-01-01

    Phytochemicals in medicinal plants can deliver potential therapeutic drugs such as anticancer, antiviral, antioxidant etc. The plant kingdom is a treasure house of potential drugs and each phytochemical cannot be tested in the wetlab preparations. Hence the main aim of the study is the drug likeness activity of phytochemicals in medicinal plants such as Anethum graveolens, Apium graveolens against hepatocellular carcinoma. These plants have anticancer, antilivercancer, hepatoprotective, antiv...

  19. A densidade básica e característica anatômicas variam radialmente na madeira de Astronium graveolens Jacq. (Anacardiaceae. Basic density and anatomical features vary in the radial direction in the wood of Astronium graveolens Jacq. (Anacardiaceae.

    Directory of Open Access Journals (Sweden)

    Camila Moura SANTOS

    2011-12-01

    Full Text Available Estudos sobre variações nas dimensões celulares de espécies arbóreas de clima tropical são escassos. Sendo assim, o objetivo deste trabalho foi caracterizar a variação da densidade básica e da anatomia no sentido radial da madeira de Astronium graveolens Jacq. Coletaram-se cinco indivíduos da espécie, provenientes da Estação Experimental Luiz Antônio (SP. Os métodos empregados nas análises foram os usualmente utilizados em pesquisas de densidade e anatomia de madeira. De acordo com os resultados foram constatadas altas correlações entre densidade básica, comprimento de fibra, espessura da parede da fibra, diâmetro de vaso e frequência de vaso com a distância da medula. A densidade básica da madeira é altamente dependente do comprimento das fibras, espessura da parede das fibras e diâmetro dos vasos, ocorrendo aumento no sentido da medula para a casca.Studies on variations in cell sizes of tree species in tropical climate are scarce. Thus, the aim was characterize the radial variation of basic density and wood anatomy of Astronium graveolens Jacq. Five specimens were collected at the Luiz Antônio Experimental Station,(SP. Sstandard methods for studying the density and wood anatomy were employed. According to the results we observed high correlation among basic density,fiber length, fiber wall thickness, vessel diameter and vessel frequency with distance fromthe pith. The wood density is highly dependent on fiber length, fiber wall thicknessand vessel diameter, there was an increase towards the pith to bark.

  20. Genotype variations in accumulation of cadmium and lead in celery (Apium graveolens L.) and screening for low Cd and Pb accumulative cultivars

    Institute of Scientific and Technical Information of China (English)

    Kun ZHANG; Jianbing WANG; Zhongyi YANG; Guorong XIN; Jiangang YUAN; Junliang XIN; Charlie HUANG

    2013-01-01

    To help reduce risks of heavy metal pollution, two pot experiments were conducted to investigate the variations, transfer potential, and stability of Cadmium (Cd) and Lead (Pb) accumulations in celery (Apium graveolens L.) and to screen for low Cd and Pb accumulative cultivars. The maximum differences in shoot Cd concentration were 4.7-fold under low-Cd exposure and 3.3-fold under high-Cd exposure. These genotype variations in Cd accumulation are sufficiently large to help reduce Cd contamination risk in soil by using the Low-Cd-Accumulative genotypes. Cd accumulation of the Low-Cd-Accumulative genotypes is significantly positive correlated with Pb accumulation. Evidence obtained proves that Cd and Pb accumulations in celery are stable and genotype-dependent at the cultivar level. The presence of high-Pb contamination in soil promoted Cd accumulation in shoots of celery. Celery is considered a species with high risks in Cd pollution and low risks in Pb pollution. Among the tested cultivars, cv. Shuanggang- kangbing (SGKB) had the lowest shoot Cd and Pb accumulating abilities, and thus is the most important material for breeding of pollution-safe cultivars (PSCs) to minimize Cd and Pb accumulations in celery.

  1. Observation on Meiosis of Pollen Mother Cells in Apium graveolens%芹菜花粉母细胞减数分裂观察

    Institute of Scientific and Technical Information of China (English)

    赵冬; 张蜀宁; 张宇; 李俊星; 刘惠吉

    2011-01-01

    The flower buds of celery (Apium graveolens ) were used to study the mitosis in pollen mother cells with enzyme - dye -squash technique.The results showed that the pollen mother cells carried on their meiosis and cytokinesis simultaneously and their tetrads were tetrahedral or decussate type; at metaphases Ⅰ and Ⅱ there showed a small number of chromosomes scattered outside their equatorial plate; at anaphases Ⅰ and Ⅱ there appeared chromosome bridges and lagged chromosomes in some pollen mother cells.%以中国芹品种铁杆芹花蕾为材料,采用改良卡宝染色压片法对芹菜花粉母细胞减数分裂进行了细胞学研究.结果表明:花粉母细胞减数分裂为胞质同时型,四分体为正四面体型或十字交叉型,中期Ⅰ和中期Ⅱ细胞可见赤道板外染色体,后期Ⅰ和后期Ⅱ部分细胞出现染色体桥及落后染色体.

  2. Antiprotozoal Activity against Entamoeba histolytica of Plants Used in Northeast Mexican Traditional Medicine. Bioactive Compounds from Lippia graveolens and Ruta chalepensis

    Directory of Open Access Journals (Sweden)

    Ramiro Quintanilla-Licea

    2014-12-01

    Full Text Available Amoebiasis caused by Entamoeba histolytica is associated with high morbidity and mortality is becoming a major public health problem worldwide, especially in developing countries. Because of the side-effects and the resistance that pathogenic protozoa build against the standard antiparasitic drugs, e.g., metronidazole, much recent attention has been paid to plants used in traditional medicine around the world in order to find new antiprotozoal agents. We collected 32 plants used in Northeast Mexican traditional medicine and the methanolic extracts of these species were screened for antiprotozoal activity against E. histolytica trophozoites using in vitro tests. Only 18 extracts showed a significant inhibiting activity and among them six plant extracts showed more than 80% growth inhibition against E. histolytica at a concentration of 150 µg/mL and the IC50 values of these extracts were determined. Lippia graveolens Kunth and Ruta chalepensis Pers. showed the more significant antiprotozoal activity (91.54% and 90.50% growth inhibition at a concentration of 150 µg/mL with IC50 values of 59.14 and 60.07 µg/mL, respectively. Bioassay-guided fractionation of the methanolic extracts from these two plants afforded carvacrol (1 and chalepensin (2, respectively, as bioactive compounds with antiprotozoal activity.

  3. Effect of Vermicompost on Chemical and Biological Properties of an Alkaline Soil with High Lime Content during Celery (Apium graveolens L. var. dulce Mill. Production

    Directory of Open Access Journals (Sweden)

    Ilker UZ

    2016-06-01

    Full Text Available The aim of this study was to investigate impact of vermicompost on chemical and biological properties of an alkaline soil with high lime content in the presence of plant under the open field conditions in semiarid Mediterranean region of Turkey. The study also included farmyard manure and chemical fertilizers for comparison and was conducted in two consecutive growth seasons in the same plots to observe any cumulative effect. Plots were amended with fertilizers in different rates and celery (Apium graveolens L. var. dulce Mill. was grown as the test plant. In general, vermicompost appeared to be more effective to increase organic matter, N, P, and Ca compared to farmyard manure. Soil alkaline phosphatase and β-glucosidase activities, especially in the second growth season, were significantly elevated by the vermicompost application. Urease activity, however, appeared not to be influenced by the type of organic fertilizer. A slight but statistically significant difference was detected between organic amendments in terms of number of aerobic mesophilic bacteria with vermicompost giving the lower values. Results showed that, in general, vermicompost significantly alters chemical and biological properties of the alkaline soil with high lime content during celery production under field conditions compared to farmyard manure and that it has a high potential to be used as an alternative to conventional organic fertilizers in agricultural production in the Mediterranean region of Turkey.

  4. An appropriate method for extracting the insect repellent citronellol from an indigenous plant (Pelargonium graveolens L'Her for potential use by resource-limited animal owners

    Directory of Open Access Journals (Sweden)

    B.M. Botha

    2000-07-01

    Full Text Available Veterinary needs appraisals in rural, peri-urban and urban areas have indicated a need for affordable and accessible veterinary health care. It was also found that farmers and animal owners used indigenous plants for treating animals. In Africa, insects such as Culex, Culicoides and Stomoxys may transmit diseases, cause irritation to animals or prevent wound healing. Insect repellents used topically are generally safer and cheaper than insecticides. Using readily available commercial sources of ethanol 43 %v/v (brandy and cane spirits, it was shown that citronellol could be extracted from uncrushed leaves of the indigenous shrub Pelargonium graveolens L'Hér. Efficacy of extraction was compared to that using reagent grade absolute ethanol. The peak concentration of citronellol was achieved within 7 days of extraction and thereafter remained constant for 4 months. Extraction methods using tap water and cooking oil were not successful. The extraction was also less successful when the leaves were crushed or macerated before being placed into ethanol. Gas chromatography was used to monitor the concentration of citronellol in the different extracts.

  5. Microencapsulation, chemical characterization, and antimicrobial activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) oregano essential oils.

    Science.gov (United States)

    Hernández-Hernández, Elvia; Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E

    2014-01-01

    The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano. PMID:25177730

  6. Antimicrobial Effect of Escherichia Coli on Essential Oils Derived from Romanian Aromatic Plants

    OpenAIRE

    Şandru Daniela Maria

    2015-01-01

    This paper investigates the antimicrobial action of Escherichia coli ATCCR CRM-8739TM on the following essential oils: Teucrium marum, Pinus sylwestris, Thymus vulgaris, Salviae aethedaroleum, Cinnamomum aromaticum, Hippophae rhamnoides, Lavandula angustifolia, Abies alba, Zingiber officinale, Anethum graveolens, Coriandrum sativum, Origanum vulgare, extracted industrialy from romanian plants, using the diffusion disc method. The most intense activity was observed at the essential oil of Cinn...

  7. Análise e discriminação de quimiotipos de Lippia graveolens H.B.K. da Guatemala por microextração em fase sólida, CG-EM e análise multivariada

    Directory of Open Access Journals (Sweden)

    Juan Francisco Pérez Sabino

    2012-01-01

    Full Text Available SPME-GC-MS, PCA and HCA multivariate techniques were used in order to evaluate their applicability to discriminate the three chemotypes (thymol, carvacrol and mixed described for L. graveolens of Guatemala. The leaves of L. graveolens are used for treatment of colds, bronchitis, and as seasoning for food preparations, yielding essential oil up to 4.34 %. Leaves of 35 individuals from eight populations, and eight composite samples were analyzed using a DVB/Carboxen/PDMS fiber and GC-MS. PCA and HCA were carried out using eight markers (p-cymene, cis-sabinene hydrate, linalool, terpinen-4-ol, thymol, carvacrol, (E-caryophyllene and caryophyllene oxide. The three chemotypes of L. graveolens were satisfactorily discriminated.

  8. Ethnopharmacology, Antibacterial and Antioxidant Activity of Dittrichia graveolens (L. W. Greuter. Which Has Been Used as Remedies Antirheumatic, Anti-inflammation and Antiinfection against Leishmaniasis in the Traditional Medicine of Gorgan, Iran

    Directory of Open Access Journals (Sweden)

    Mazandarani Masoumeh

    2014-10-01

    Full Text Available Objective: This study was survey to investigate of ethnopharmacology, antibacterial and antioxidant capacity of Dittrichia graveolens (L. W. Greuter extract in in vitro from waste ground region of Gorgan, Iran, which has been used in traditional as a strong anti-inflammation, antirheumatism, antitumor, antipathogene, and antiinfection. Materials and Methods: Ethnopharmacological data were obtained among well-known indigenous herbal practitioner (70 ages in Gorgan, Iran. Aerial parts of plant in blooming were collected from Gorgan waste ground (80 m in October 2013. Methanol and acetone extracts were obtained by maceration, antioxidant activity were evaluated spectrophotometrically by 1,1-diphenyl-2-picryl hydrazyl (DPPH, total antioxidant capacity and reducing power to compare of butylated hydroxytoluene and butylated hydroxyanisole antioxidant standard and antibacterial activity were determined by disc diffusion and minimal inhibitory concentrations (MICs method against tree Gram-positive and negative pathogenic bacteria. Results: D. graveolens (L. W. Greuteris is usually wild grow in Golestan Province and has been used in traditional medicine as a strong anti-inflammation, antirheumatism, antitumor, antipathogene and antiinfection specially in treat of leishmaniosis metanolic extract of plant has strong antioxidant activity against free radical scavenging specially in DPPH methode than aceton extract with IC50 (6.2 ± 0.13 μg/ml and Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis and Bacillus cereus with inhibition zone 35, 30, 26, 21 mm were the most sensitive bacteria, with MIC ranging from 12.6 to 112 μg/ml, respectively. Escherichia coli and Salmonella typhimurium have moderate sensitivity and other bacteria were resistant to the plant extract. Conclusion: Results demonstrate that the methanolic extract of D. graveolens can become good potential antioxidant and antibacterial activity for controlling certain Gram

  9. Estudio comparativo de la composición química y actividad antibacteriana del aceite esencial de Ruta graveolens L. recolectada en los estados Mérida y Miranda, Venezuela.

    Directory of Open Access Journals (Sweden)

    Janne Rojas

    2011-12-01

    Full Text Available Essential oil from two R. graveolens samples collected from Mérida and Miranda states, Venezuela, were analyzed by GC/MS identifying as major components: 2-undecanone, 2-nonanonae and pregeijerene. On the other hand, the antibacterial activity assays showed the wide range of activity of the oils that inhibited the bacterial strains grow not only for the Gram positive (S. aureus and E. faecalis but the Gram negative (E. coli and K. pneumonie as well, displaying MIC values between 100 μg/mL and 200 μg/mL.

  10. Activity of essential oils and individual components against acetyl- and butyrylcholinesterase.

    Science.gov (United States)

    Orhan, Ilkay; Kartal, Murat; Kan, Yüksel; Sener, Bilge

    2008-01-01

    We have tested acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitory activities of nineteen essential oils obtained from cultivated plants, namely one from Anethum graveolens L. (organic fertilizer), two from Foeniculum vulgare Mill. collected at fully-mature and flowering stages (organic fertilizer), two from Melissa officinalis L. (cultivated using organic and chemical fertilizers), two from Mentha piperita L. and M. spicata L. (organic fertilizer), two from Lavandula officinalis Chaix ex Villars (cultivated using organic and chemical fertilizers), two from Ocimum basilicum L. (green and purple-leaf varieties cultivated using only organic fertilizer), four from Origanum onites L., O. vulgare L., O. munitiflorum Hausskn., and O. majorana L. (cultivated using organic fertilizer), two from Salvia sclarea L. (organic and chemical fertilizers), one from S. officinalis L. (organic fertilizer), and one from Satureja cuneifolia Ten. (organic fertilizer) by a spectrophotometric method of Ellman using ELISA microplate-reader at 1 mg/ml concentration. In addition, a number of single components widely encountered in most of the essential oils [gamma-terpinene, 4-allyl anisole, (-)-carvone, dihydrocarvone, (-)-phencone, cuminyl alcohol, cumol, 4-isopropyl benzaldehyde, trans-anethole, camphene, iso-borneol, (-)-borneol, L-bornyl acetate, 2-decanol, 2-heptanol, methyl-heptanol, farnesol, nerol, iso-pulegol, 1,8-cineole, citral, citronellal, citronellol, geraniol, linalool, alpha-pinene, beta-pinene, piperitone, iso-menthone, menthofurane, linalyl oxide, linalyl ester, geranyl ester, carvacrol, thymol, menthol, vanilline, and eugenol] was also screened for the same activity in the same manner. Almost all of the essential oils showed a very high inhibitory activity (over 80%) against both enzymes, whereas the single components were not as active as the essential oils. PMID:18810999

  11. Atividade in vitro de plantas condimentares (Rosmarinus officinalis L., Lippia graveolens HBK e Thymus vulgaris L. contra o calicivírus felino

    Directory of Open Access Journals (Sweden)

    Thaís Felli Kubiça

    2015-09-01

    Full Text Available O calicivírus felino (FCV é um importante patógeno de gatos que causa lesões ulcerativas orais e infecções respiratórias. O vírus tem sido utilizado como modelo experimental para avaliação de agente antivirais contra norovírus (NoVs. Nesse estudo, investigou-se a ação dos óleos essenciais de alecrim (Rosmarinus officinalis L., orégano mexicano (Lippia graveolens HBK. e tomilho (Thymus vulgaris L. frente ao FCV, in vitro. A toxicidade celular foi testada pelo método de MTT e os ensaios antivirais pelo teste de redução de placas. Três protocolos foram aplicados: a diferentes concentrações não tóxicas dos óleos essenciais (CNTOE foram incubadas com o vírus por 1 hora antes da inoculação (ensaio virucida; b CNTOE foram adicionadas às células CRFK e incubadas por 1 hora antes da adsorção viral (ensaio de pré-tratamento; c CNTOE foram adicionadas às células após a inoculação do FCV e mantidas por 18 horas (ensaio de pós-tratamento. A CC50 para os óleos de alecrim, orégano mexicano e tomilho foram: 1300,21 μg mL-1; 435,92 μg mL-1 e 675,34 μg mL-1; respectivamente. O óleo essencial de tomilho apresentou índice de seletividade [IS=CC50/CI50] de 8,57 para o ensaio de pré-tratamento e 6,2 no ensaio virucida. O óleo de alecrim mostrou atividade antiviral no ensaio virucida (IS=6,54 e de pós-tratamento (IS=6,86. O orégano mexicano apresentou IS de 5,75 no ensaio virucida e 5,59 no de pós-tratamento. Conclui-se que os óleos essenciais de tomilho e alecrim apresentaram atividade frente ao FCV em diferentes momentos da infecção viral.Palavras-chave: Norovírus. FCV. óleos essenciais. Citotoxicidade. MTT. ensaio de placa. ABSTRACTIn vitro activity of plants used as condiments (Rosmarinus officinalis L., Lippia graveolens HBK e Thymus vulgaris L. against the feline calicivirusThe feline calicivirus (FCV is an important pathogen of feline causing oral ulcerative lesions and respiratory disease. This virus

  12. ESTIMACIÓN DE LA CAPACIDAD GERMINATIVA Y EL VIGOR DE LAS SEMILLAS DE diomate (Astronium graveolens Jacq. SOMETIDAS A DIFERENTES TRATAMIENTOS Y CONDICIONES DE ALMACENAMIENTO ESTIMATE OF THE GERMINATIVE CAPACITY AND THE VIGOR OF DIOMATE SEEDS (Astronium graveolens Jacq. SUBJECTED TO DIFFERENT TREATMENTS AND STORAGE CONDITIONS

    Directory of Open Access Journals (Sweden)

    Martha Ligia Gómez Restrepo

    2004-06-01

    Full Text Available Se llevaron a cabo dos estudios con semillas de diomate (Astronium graveolens Jacq. El primero se hizo con el fin de determinar el efecto que sobre la germinación tienen el sustrato y la condición lumínica. El segundo, para evaluar la respuesta germinativa de semillas almacenadas durante varios períodos y bajo diferentes condiciones de temperatura y empaque. Las semillas de diomate sembradas a plena exposición y en las cuales se utilizó tierra como sustrato obtuvieron la mayor potencia germinativa, los menores tiempos de germinación y el vigor más alto. La pérdida total de vigor en las semillas varió según el tiempo y la temperatura de almacenamiento así: al cabo de un mes de almacenamiento a temperaturas entre 7 y 10ºC, al sexto mes de almacenamiento a temperaturas entre 20 y 33ºC y al undécimo mes cuando fueron almacenadas a temperatura ambiente entre 12 y 18ºC. El tipo de empaque no influyó significativamente en los resultados finales.Two studies of diomate seeds (Astronium graveolens Jacq were conducted. The first was conducted to determine the effect that substrate and light condition has on germination. The second was to evaluate the germinative response of seeds stored over differing time periods and under temperature and packaging conditions. The diomate seeds sowed in full exposure in soil substrate had the greatest germinative potential, the fastest germination times and the highest vigor. The total loss of vigor in the seeds varied according to time and temperature of storage, as follows: after a month of storage at temperatures between 7 and 10ºC, after six months of storage at temperatures between 20 and 33ºC and after eleven months of storage at ambient temperatures between 12 and 18ºC. The type of packing did not significantly influence the final results.

  13. Larvicidal, Repellent and Irritant Potential of the Seed-derived Essential oil of Apium graveolens against Dengue Vector, Aedes aegypti L. (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Sarita eKumar

    2014-09-01

    Full Text Available Aedes aegypti L., the primary carrier for viruses causing dengue, chikungunya and yellow fever is widespread over large areas of the tropics and subtropics. Keeping in view the adverse effects of chemical insecticides-based intervention measures; the eco-friendly, bio-degradable essential oil extracted from the seeds of celery, Apium graveolens; was investigated for anti-mosquito potential against Ae. aegypti. Evaluation of larvicidal potential of celery seed oil against early fourth instars of Ae. aegypti resulted in LC50 and LC90 values of 16.10 ppm and 29.08 ppm, respectively, after an exposure to 24 h; the toxic effect of the oil increasing by 1.2 fold with an LC50 value of 13.22 ppm after an exposure to 48h. Interestingly, the seed oil did not cause rapid mortality, suggesting a delayed type of larval killing effect. The remarkable finding of the present study was effective repellency of the essential oil leading to 100% protection till 165 min as compared to control that did not show any repellency against mosquitoes. Only 1 bite was recorded in the 165th minute after which only 2 bites were scored until 180 min of exposure of the oil to the adult mosquitoes. An exciting observation was the knocked-down of mosquitoes caused by the exposure to 10% oil-impregnated papers. The exposure to 1% oil resulted in first flight only after 4 sec and a total of 63.66 average flights during 15 min exposure revealing the relative irritability of 26.97.The qualitative phytochemical study of the oil showed the presence of terpenoids, lactones and flavonoids as the major constituents suggesting their possible role in the toxicity. Present investigations proved celery seed essential oil to be an efficient larvicide and repellent against dengue vector. Further studies are needed to identify the active principles involved, their mode of action, formulated preparations for enhancing potency and stability, toxicity and effects on non-target organisms and the

  14. Accurate Mass GC/LC-Quadrupole Time of Flight Mass Spectrometry Analysis of Fatty Acids and Triacylglycerols of Spicy Fruits from the Apiaceae Family

    Directory of Open Access Journals (Sweden)

    Thao Nguyen

    2015-12-01

    Full Text Available The triacylglycerol (TAG structure and the regio-stereospecific distribution of fatty acids (FA of seed oils from most of the Apiaceae family are not well documented. The TAG structure ultimately determines the final physical properties of the oils and the position of FAs in the TAG molecule affects the digestion; absorption and metabolism; and physical and technological properties of TAGs. Fixed oils from the fruits of dill (Anethum graveolens, caraway (Carum carvi, cumin (Cuminum cyminum, coriander (Coriandrum sativum, anise (Pimpinella anisum, carrot (Daucus carota, celery (Apium graveolens, fennel (Foeniculum vulgare, and Khella (Ammi visnaga, all from the Apiaceae family, were extracted at room temperature in chloroform/methanol (2:1 v/v using percolators. Crude lipids were fractionated by solid phase extraction to separate neutral triacylglycerols (TAGs from other lipids components. Neutral TAGs were subjected to transesterification process to convert them to their corresponding fatty acids methyl esters (FAMES using 1% boron trifluoride (BF3 in methanol. FAMES were analyzed by gas chromatography-quadrupole time of flight (GC-QTOF mass spectrometry. Triglycerides were analyzed using high performance liquid chromatography-quadrupole time of flight (LC-QTOF mass spectrometry. Petroselinic acid was the major fatty acid in all samples ranging from 57% of the total fatty acids in caraway up to 82% in fennel. All samples contained palmitic (16:0, palmitoleic (C16:1n-9, stearic (C18:0, petroselinic (C18:1n-12, linoleic (C18:2n-6, linolinic (18:3n-3, and arachidic (C20:0 acids. TAG were analyzed using LC-QTOF for accurate mass identification and mass spectrometry/mass spectrometry (MS/MS techniques for regiospesific elucidation of the identified TAGs. Five major TAGs were detected in all samples but with different relative concentrations in all of the tested samples. Several other TAGs were detected as minor components and were present in some

  15. Accurate Mass GC/LC-Quadrupole Time of Flight Mass Spectrometry Analysis of Fatty Acids and Triacylglycerols of Spicy Fruits from the Apiaceae Family.

    Science.gov (United States)

    Nguyen, Thao; Aparicio, Mario; Saleh, Mahmoud A

    2015-01-01

    The triacylglycerol (TAG) structure and the regio-stereospecific distribution of fatty acids (FA) of seed oils from most of the Apiaceae family are not well documented. The TAG structure ultimately determines the final physical properties of the oils and the position of FAs in the TAG molecule affects the digestion; absorption and metabolism; and physical and technological properties of TAGs. Fixed oils from the fruits of dill (Anethum graveolens), caraway (Carum carvi), cumin (Cuminum cyminum), coriander (Coriandrum sativum), anise (Pimpinella anisum), carrot (Daucus carota), celery (Apium graveolens), fennel (Foeniculum vulgare), and Khella (Ammi visnaga), all from the Apiaceae family, were extracted at room temperature in chloroform/methanol (2:1 v/v) using percolators. Crude lipids were fractionated by solid phase extraction to separate neutral triacylglycerols (TAGs) from other lipids components. Neutral TAGs were subjected to transesterification process to convert them to their corresponding fatty acids methyl esters (FAMES) using 1% boron trifluoride (BF₃) in methanol. FAMES were analyzed by gas chromatography-quadrupole time of flight (GC-QTOF) mass spectrometry. Triglycerides were analyzed using high performance liquid chromatography-quadrupole time of flight (LC-QTOF) mass spectrometry. Petroselinic acid was the major fatty acid in all samples ranging from 57% of the total fatty acids in caraway up to 82% in fennel. All samples contained palmitic (16:0), palmitoleic (C16:1n-9), stearic (C18:0), petroselinic (C18:1n-12), linoleic (C18:2n-6), linolinic (18:3n-3), and arachidic (C20:0) acids. TAG were analyzed using LC-QTOF for accurate mass identification and mass spectrometry/mass spectrometry (MS/MS) techniques for regiospesific elucidation of the identified TAGs. Five major TAGs were detected in all samples but with different relative concentrations in all of the tested samples. Several other TAGs were detected as minor components and were present in

  16. Accurate Mass GC/LC-Quadrupole Time of Flight Mass Spectrometry Analysis of Fatty Acids and Triacylglycerols of Spicy Fruits from the Apiaceae Family

    Science.gov (United States)

    Nguyen, Thao; Aparicio, Mario; Saleh, Mahmoud A.

    2016-01-01

    The triacylglycerol (TAG) structure and the regio-stereospecific distribution of fatty acids (FA) of seed oils from most of the Apiaceae family are not well documented. The TAG structure ultimately determines the final physical properties of the oils and the position of FAs in the TAG molecule affects the digestion; absorption and metabolism; and physical and technological properties of TAGs. Fixed oils from the fruits of dill (Anethum graveolens), caraway (Carum carvi), cumin (Cuminum cyminum), coriander (Coriandrum sativum), anise (Pimpinella anisum), carrot (Daucus carota), celery (Apium graveolens), fennel (Foeniculum vulgare), and Khella (Ammi visnaga), all from the Apiaceae family, were extracted at room temperature in chloroform/methanol (2:1 v/v) using percolators. Crude lipids were fractionated by solid phase extraction to separate neutral triacylglycerols (TAGs) from other lipids components. Neutral TAGs were subjected to transesterification process to convert them to their corresponding fatty acids methyl esters (FAMES) using 1% boron trifluoride (BF3) in methanol. FAMES were analyzed by gas chromatography-quadrupole time of flight (GC-QTOF) mass spectrometry. Triglycerides were analyzed using high performance liquid chromatography-quadrupole time of flight (LC-QTOF) mass spectrometry. Petroselinic acid was the major fatty acid in all samples ranging from 57% of the total fatty acids in caraway up to 82% in fennel. All samples contained palmitic (16:0), palmitoleic (C16:1n-9), stearic (C18:0), petroselinic (C18:1n-12), linoleic (C18:2n-6), linolinic (18:3n-3), and arachidic (C20:0) acids. TAG were analyzed using LC-QTOF for accurate mass identification and mass spectrometry/mass spectrometry (MS/MS) techniques for regiospesific elucidation of the identified TAGs. Five major TAGs were detected in all samples but with different relative concentrations in all of the tested samples. Several other TAGs were detected as minor components and were present in

  17. Evaluation of the Antitoxic Effect of Phthalides from Apium graveolens in Acrylamide Intoxication I. Evolution of the Hepatic Cytolysis and Proteosynthetic Parameters in Acrylamide Intoxication on the Background of Phthalide Protection

    Directory of Open Access Journals (Sweden)

    Cornelia PRISACARU

    2009-11-01

    Full Text Available Acrylamide is a toxic compound formed during thermical processing of foods that contain amino acids, mainly asparagine, and reducing sugars. The toxicodynamics of acrylamide, exerted mainly by its major metabolite glycidamide, is expressed by mutagenic, carcinogenic and imunosupressive effects. Due to its toxicity and its high prevalence in aliments, the present paper approaches a possible way of reducing the toxic effects of acrylamide by using phytotherapeutical means. In this direction, the antitoxic potential of some phytopreparates obtained from Apium graveolens (Apii aetheroleum, extractive solutions from A. radix, A. folium and A. semen were monitorized on the background of acrylamide intoxication. The antitoxic potential of phthalides has been evaluated by determining biochemical parameters: hepatic cytolysis parameters (aspartate aminotransferase, alanil aminotransferase, lactate dehydrogenase and protesosynthesis parameters (colinesterase, total poteins, albumins. The biochemical investigation confirmed the antitoxic potential fo phthalides from celery, the highest protection being obtained for the phytopreparate from Apii semen.

  18. Alternativní způsoby ochrany zeleniny proti houbovým patogenům

    OpenAIRE

    Zusková, Eva

    2014-01-01

    This thesis is focused on assessment of the effectiveness of 12 selected essential oils originaly from the following plants Thymus vulgaris, Mentha spicata, Rosmarinus officinalis, Pelargonium graveolens, Citrus sinensis, Eucalypthus citriodora, Litsea cubeba, Pelargonium odoratissimum, Cymbopogon citratus, Pimpinella anisum, Foeniculum vulgare, Artemisia dracunculus, against selected pathogens Botrytis cinerea, Alternaria solani and Alternaria brassicae. The first chapter of literature re...

  19. 芹菜黄酮合成酶Ⅰ基因的克隆与序列分析%Cloning and sequence analysis of flavone synthase I gene in Apium graveo-lens

    Institute of Scientific and Technical Information of China (English)

    陈逸云; 王枫; 徐志胜; 谭国飞; 李梦瑶; 熊爱生

    2014-01-01

    The flavone synthase I gene (AgFS I), the key gene for flavonoids synthesis, was cloned from Apium graveolens cultivars Liuhehuangxinqin, Jinnanshiqin and Meiguoxiqin, respectively. The length of AgFS I gene was 1 616 bp, containing 359-bp intronⅠ and 190-bp intronⅡ. The AgFS I gene encodes 355 amino acids, belonging to the 20G-FeII Oxy superfamily. There were differences in 5 nucleotide sites and 5 amino acid sites among the three cultivars of Api-um graveolens. Multiple sequence alignment of AgFS Is with FSIs from other plants showed that FSⅠs were highly conser-vative. Phylogenetic tree revealed the AgFS Is had the closest relationship to Daucus carota and Cuminum cyminum, which belong to the Apiaceae. Amino acid sequence analyses indicate that AgFS I belong to the hydrophobic protein. The AgFS Is from three cultivars of Apium graveolens are similar in three dimentional structure.%选用3个芹菜材料六合黄心芹、津南实芹和美国西芹,分别从中克隆了合成黄酮类化合物的关键酶基因---芹菜黄酮合成酶I基因( AgFS I)。该基因全长均为1616 bp,含有359 bp的内含子I和190 bp的内含子II。芹菜AgFS I基因编码355个氨基酸,属于20G-FeII Oxy超级家族。序列分析结果显示,3种芹菜中AgFS I基因在核苷酸水平上有5个碱基的差异,编码的氨基酸有5个位点的差异。芹菜黄酮合成酶I( AgFS I)与其他来源植物的FSI氨基酸多重序列比对分析结果表明,该酶具有高度保守性。对AgFS I进行进化树分析,氨基酸序列的疏水性/亲水性分析,三级结构预测与分析,结果显示AgFS I与同属于伞形科的胡萝卜和孜然芹的FSI进化关系最近, AgFS I属于疏水性蛋白质,3种芹菜AgFS I的空间结构相似。

  20. Antimicrobial Effect of Escherichia Coli on Essential Oils Derived from Romanian Aromatic Plants

    Directory of Open Access Journals (Sweden)

    Şandru Daniela Maria

    2015-07-01

    Full Text Available This paper investigates the antimicrobial action of Escherichia coli ATCCR CRM-8739TM on the following essential oils: Teucrium marum, Pinus sylwestris, Thymus vulgaris, Salviae aethedaroleum, Cinnamomum aromaticum, Hippophae rhamnoides, Lavandula angustifolia, Abies alba, Zingiber officinale, Anethum graveolens, Coriandrum sativum, Origanum vulgare, extracted industrialy from romanian plants, using the diffusion disc method. The most intense activity was observed at the essential oil of Cinnamomum aromaticum (cinnamon and the mildest activity was observed at Zingiber officinale (ginger. Many of the essential oils tested exhibited moderate antimicrobial activity, as Teucrium marum, Thymus vulgaris, Hippophae rhamnoides, Lavandula angustifolia,Coriandrum sativum. The lowest antibacterial activity was exhibited on Pinus sylwestris, Salviae aethedaroleum, Zingiber officinale and Anethum graveolens.

  1. Effects of aqueous extract of Ruta graveolens and its ingredients on cytochrome P450, uridine diphosphate (UDP-glucuronosyltransferase, and reduced nicotinamide adenine dinucleotide (phosphate (NAD(PH-quinone oxidoreductase in mice

    Directory of Open Access Journals (Sweden)

    Yune-Fang Ueng

    2015-09-01

    Full Text Available Ruta graveolens (the common rue has been used for various therapeutic purposes, including relief of rheumatism and treatment of circulatory disorder. To elucidate the effects of rue on main drug-metabolizing enzymes, effects of an aqueous extract of the aerial part of rue and its ingredients on cytochrome P450 (P450/CYP, uridine diphosphate (UDP-glucuronosyltransferase, and reduced nicotinamide adenine dinucleotide (phosphate (NAD(PH:quinone oxidoreductase were studied in C57BL/6JNarl mice. Oral administration of rue extract to males increased hepatic Cyp1a and Cyp2b activities in a dose-dependent manner. Under a 7-day treatment regimen, rue extract (0.5 g/kg induced hepatic Cyp1a and Cyp2b activities and protein levels in males and females. This treatment increased hepatic UDP-glucuronosyltransferase activity only in males. However, NAD(PH:quinone oxidoreductase activity remained unchanged. Based on the contents of rutin and furanocoumarins of mouse dose of rue extract, rutin increased hepatic Cyp1a activity and the mixture of furanocoumarins (Fmix increased Cyp2b activities in males. The mixture of rutin and Fmix increased Cyp1a and Cyp2b activities. These results revealed that rutin and Fmix contributed at least in part to the P450 induction by rue.

  2. Morphology, anatomy and influence of drying on germination of seeds of Calendula officinalis Morfoanatomía y efecto del secado en la germinación de semillas de caléndula y eneldo

    OpenAIRE

    Victoria T. Jorge A.; Sánchez O Manuel Salvador; Bonilla C Carmen Rosa

    2007-01-01

    Laboratory tests with seed of Calendula officinalis and Anethum graveolens to describe morphology and anatomy components such as humidity content in balance (CHB) in different atmospheres to get appropriate conservation of the germsplasm to determine physiological behavior in short seed storage to evaluate and to stablish an appropriate methodology for germination, were carried out. The morphological and anatomical description allowed to specify and to illustrate the organs and internal struc...

  3. Green corrosion inhibitors for carbon steel by green leafy vegetables extracts in 1 M HCl

    OpenAIRE

    Ghadah M. Al-Senani; Sameerah I. Al-Saeedi; Rasmiah Almufarij

    2015-01-01

    The effect of some Green Leafy Vegetables (GLV) extracts namely Lactuca sativa (Lactuca), Eruca Sativa (Arugula), Petroselinum crispum (Parsley), and Anethum Graveolens (Dill) were investigated on inhibition of corrosion carbon steel in 1 M HCl solution using gravimetric (weight loss) method. The inhibition efficiency has increased as concentration of the extract increased. The inhibition efficiency has decreased as the temperature increased. The results obtained showed that GLV extracts inh...

  4. Beslenme ve Halk Sağlığı Yönünden Önemli Bazı Sebzeler I: Sarımsak (Allium sativum L.), Enginar (Cynara scolymus L.), Kereviz (Apium graveolens L.) ve Lahana (Brassica oleraceae)

    OpenAIRE

    Altıniğne, Nejat; Gönül, Meral

    1988-01-01

    Karbonhidrat, mineral madde ve vitamin gibi önemli bazı besin ögelerini çok miktarda içeren sebzeler, beslenme amacıyla kullanıldıkları gibi, içerdikleri bazı ilaç etken maddeleri nedeniyle halk sağlığında tedavi amacıylada kullanılmaktadırlar. Bu makalede genel özellikleri, besin içerikleri ve halk sağlığında kullanılma amaçları yönünden sarımsak (A. sativum), enginar (C. scolymus), kereviz (A. graveolens) ve lahana (B. oleraceae) sebzeleri ele alınarak incelenmiştir.   ...

  5. Potential of the Combined use of Inherited Sterility and Four Botanical Extracts for the Control of Sitotroga cerealella (Olivier)

    International Nuclear Information System (INIS)

    Newly hatched larvae of the Angoumois grain moth, Sitotroga cerealella (Lepidoptera: Gelechiidae) were used to evaluate the effect of four aqueous plant extracts on the percentages of penetration, pupation, emergence, sex ratio, developmental period and reproduction of resulting adults from maize kernel. Nerium oleander and Azadirachta indica, were completely reduced infestation of larvae and induce high sterility for resulting adults at concentration 50%. The other extracts, Anethum graveolens and Lantana camara succeeded to minimize the damage and viability of larvae. The persistence of the toxicity of aqueous plant extracts of N. oleander and A. graveolens was better within three weeks but L. camara and A. indica was lost rapidly up to two week. The combined effect of four plant extracts and F1 progeny of S. cerealella, descending from irradiated male pupae with gamma radiation at 175 Gy it could increase the efficacy of F-1 sterility technique

  6. Determination of the contents of monosaccharide components in non-starch polysaccharides of aerial part of Apium graveolens L. By pre-column derivatization GC%柱前衍生化GC法测定旱芹非淀粉多糖中各单糖组分含量

    Institute of Scientific and Technical Information of China (English)

    谭亮; 杨洋; 张琦; 霍鑫; 毕开顺; 贾英

    2011-01-01

    Objective To establish pre-column derivatization GC method for determination of monosaccharide component of non-starch polysaccharides of the aerial part of Apium graveolens L. Methods The derivatives were determined by GC and DB-17 column(30 m ×0. 25 mm,0. 25 μm)was used. The inlet temperature was maintained for 270 ℃. The column oven was begun at 180 ℃ ,then programmed from 180 ℃ to 225℃ at 3 ℃- min -1, hold for 2 min, then programmed from 225 ℃ to 260 ℃ at 6 ℃· min -1, and finally, hold for 7 min. Manner of sample injection was splitless. Detector temperature was maintained at 270 ℃. Sample amount was I. 0 μL. Results Seven monosaccharides L-( + )-rhamnose,L-( + )-arabinose,D-( + )-fucose, D-( + )-xylose,D-( + )-mannose,D-( + )-glucose and D-( + )-galactose were determined in INSP. Except D-( + )-fucose,other six monosaccharides were the same as from INSP in SNSP. Conclusions The method is accurate and reproducible,which is suitable for the determination of monosaccharide component in soluble and insoluble non-starch polysaccharides in Apium graveolens L.%目的 建立测定旱芹非淀粉多糖中各单糖组分含量的柱前衍生化GC法.方法 非淀粉多糖经衍生化生成糖腈乙酯,采用GC法进行分析.色谱柱:DB-17柱(30 m×0.25 mm,0.25 μm);柱温:程序升温;载气:N2;进样温度:270℃;进样方式:不分流;检测器温度:270℃;进样量:1.0μL.结果 水不溶性非淀粉多糖(insoluble non-starch polysaccharides,INSP)水解后得到7种单糖,分别是:L-(+)-鼠李糖、L-(+)-阿拉伯糖、D-(+)-岩藻糖、D-(+)-木糖、D-(+)-甘露糖、D-(+)-葡萄糖和D-(+)-半乳糖;水溶性非淀粉多糖(soluble non-starch polysaccharides,SNSP)水解后得到6种单糖,除无D-(+)-岩藻糖外,其余均同INSP水解后单糖.结论 本方法准确度高,重现性好,可用于测定旱芹水溶性和水不溶性非淀粉多糖中各单糖组分的含量.

  7. Efficient surface functionalization of wound dressings by a phytoactive nanocoating refractory to Candida albicans biofilm development.

    Science.gov (United States)

    Anghel, Ion; Holban, Alina Maria; Andronescu, Ecaterina; Grumezescu, Alexandru Mihai; Chifiriuc, Mariana Carmen

    2013-12-01

    The present study reports the fabrication and characterization of a novel nanostructured phyto-bioactive coated rayon/polyester wound dressing (WD) surface refractory to Candida albicans adhesion, colonization and biofilm formation, based on functionalized magnetite nanoparticles and Anethum graveolens (AG) and Salvia officinalis (SO) essential oils (EOs). TEM, XRD, TGA, FT-IR were used for the characterization of the fabricated nanobiocoated WDs. Using magnetic nanoparticles for the stabilization and controlled release of EOs, the activity of natural volatile compounds is significantly enhanced and their effect is stable during time. For this reason the nanobiocoated surfaces exhibited a longer term anti-biofilm effect, maintained for at least 72 h. Besides their excellent anti- adherence properties, the proposed solutions exhibit the advantage of using vegetal natural compounds, which are less toxic and easily biodegradable in comparison with synthetic antifungal drugs, representing thus promising approaches for the development of successful ways to control and prevent fungal biofilms associated infections. PMID:24706124

  8. Antimicrobial activity of individual and mixed fractions of dill, cilantro, coriander and eucalyptus essential oils.

    Science.gov (United States)

    Delaquis, Pascal J; Stanich, Kareen; Girard, Benoit; Mazza, G

    2002-03-25

    Essential oils from dill (Anethum graveolens L.), coriander (seeds of Coriandrum sativum L.), cilantro (leaves of immature C. sativum L.) and eucalyptus (Eucalyptus dives) were separated into heterogeneous mixtures of components by fractional distillation and were analyzed by gas chromatography-mass spectroscopy. Minimum inhibitory concentrations against gram-positive bacteria, gram-negative bacteria and Saccharomyces cerevisiae were determined for the crude oils and their fractions. Essential oil of cilantro was particularly effective against Listeria monocytogenes, likely due to the presence of long chain (C6-C10) alcohols and aldehydes. The strength and spectrum of inhibition for the fractions often exceeded those determined in the crude oils. Mixing of fractions resulted in additive, synergistic or antagonistic effects against individual test microorganisms. PMID:11929164

  9. Spectrophotometric Determination of Cu2+ and Monitoring of Hg2+ and Ni2+ in some Iranian Vegetables Using 6-(2-Naphthyl)-2, 3-Dihydro-as-triazine-3-thione

    Science.gov (United States)

    Shamsa, Fazel; Barazande Tehrani, Malehe; Mehravar, Hamid; Mohammadi, Elaheh

    2013-01-01

    Recently, 6-(2-naphthyl)-2, 3-dihydro-as-triazine-3-thione (NDTT) was synthesized in laboratory and used successfully for the spectrophotometric determination of nanogram levels of Cu2+ in aqueous solution. This reagent forms a specific red complex with Cu2+ ions after the extraction by chloroform at alkaline pH. The absorption of the complex in the UV region (313 nm) is about 8 times as strong as in the visible one (510 nm). Mercury and nickel ions form yellow complexes with NDTT under the same conditions which interfere in the UV region and without effect on Cu (II) absorbance in the visible region. The studied vegetables include Mentha pipereta L., Anethum graveolens L., Beta vulgaris L., Coriandrum sativum, Petroselinum hortense H., Ocimum basilicum L., Spinacia oleracea L., Lactuca sativa L., and Brassica oleracea L. PMID:24250566

  10. Spectrophotometric Determination of Cu(2+) and Monitoring of Hg(2+) and Ni(2+) in some Iranian Vegetables Using 6-(2-Naphthyl)-2, 3-Dihydro-as-triazine-3-thione.

    Science.gov (United States)

    Shamsa, Fazel; Barazande Tehrani, Malehe; Mehravar, Hamid; Mohammadi, Elaheh

    2013-01-01

    Recently, 6-(2-naphthyl)-2, 3-dihydro-as-triazine-3-thione (NDTT) was synthesized in laboratory and used successfully for the spectrophotometric determination of nanogram levels of Cu(2+) in aqueous solution. This reagent forms a specific red complex with Cu(2+) ions after the extraction by chloroform at alkaline pH. The absorption of the complex in the UV region (313 nm) is about 8 times as strong as in the visible one (510 nm). Mercury and nickel ions form yellow complexes with NDTT under the same conditions which interfere in the UV region and without effect on Cu (II) absorbance in the visible region. The studied vegetables include Mentha pipereta L., Anethum graveolens L., Beta vulgaris L., Coriandrum sativum, Petroselinum hortense H., Ocimum basilicum L., Spinacia oleracea L., Lactuca sativa L., and Brassica oleracea L. PMID:24250566

  11. Green corrosion inhibitors for carbon steel by green leafy vegetables extracts in 1 M HCl

    Directory of Open Access Journals (Sweden)

    Ghadah M. Al-Senani

    2015-12-01

    Full Text Available The effect of some Green Leafy Vegetables (GLV extracts namely Lactuca sativa (Lactuca, Eruca Sativa (Arugula, Petroselinum crispum (Parsley, and Anethum Graveolens (Dill were investigated on inhibition of corrosion carbon steel in 1 M HCl solution using gravimetric (weight loss method. The inhibition efficiency has increased as concentration of the extract increased. The inhibition efficiency has decreased as the temperature increased. The results obtained showed that GLV extracts inhibited the corrosion process by a physical adsorption mechanism that followed the Langmuir, Freundlich, and Temkin adsorption isotherm models. The adsorption thermodynamic parameters that were calculated include, free energy of adsorption (∆G°ads, activation energy (Ea, enthalpy of adsorption (ΔH°ads, and entropy of adsorption (ΔS°ads are proposed for the corrosion of carbon steel in 1 M HCl in the absence and presence of GLV extract.

  12. Chemical Composition of Different Botanical Origin Honeys Produced by Sicilian Black Honeybees (Apis mellifera ssp. sicula).

    Science.gov (United States)

    Mannina, Luisa; Sobolev, Anatoly P; Di Lorenzo, Arianna; Vista, Silvia; Tenore, Gian Carlo; Daglia, Maria

    2015-07-01

    In 2008 a Slow Food Presidium was launched in Sicily (Italy) for an early warning of the risk of extinction of the Sicilian native breed of black honeybee (Apis mellifera L. ssp sicula). Today, the honey produced by these honeybees is the only Sicilian honey produced entirely by the black honeybees. In view of few available data regarding the chemical composition of A. mellifera ssp. sicula honeys, in the present investigation the chemical compositions of sulla honey (Hedysarum coronarium L.) and dill honey (Anethum graveolens L.) were studied with a multimethodological approach, which consists of HPLC-PDA-ESI-MSn and NMR spectroscopy. Moreover, three unifloral honeys (lemon honey (obtained from Citrus limon (L.) Osbeck), orange honey (Citrus arantium L.), and medlar honey (Eriobotrya japonica (Thunb.) Lindl)), with known phenol and polyphenol compositions, were studied with NMR spectroscopy to deepen the knowledge about sugar and amino acid compositions. PMID:25730368

  13. Extraction and GC determination of volatile aroma compounds from extracts of three plant species of the Apiaceae family

    Science.gov (United States)

    Stan, M.; Soran, M. L.; Varodi, C.; Lung, I.; Copolovici, L.; MǎruÅ£oiu, C.

    2013-11-01

    Parsley (Petroselinum crispum), dill (Anethum graveolens) and celery (Apium graveolens), three aromatic plants belonging to the Apiaceae (Umbelliferae) botanical family, were selected as sources of essential or volatile oils. Essential oils are composed of a large diversity of volatile aroma compounds. Plant-derived essential oils and extracts have long been used as natural agents in food preservation, pharmaceuticals and medicinal therapies. In the present study, the plant extracts from leaves of parsley, dill and celery, were obtained by maceration, ultrasound-assisted extraction and microwave-assisted extraction. All extractions were performed at 30°C, using different solvents (ethanol, diethyl ether, n-hexane) and solvent mixtures (1:1, v/v). The most effective solvent system for the extraction of volatile aroma compounds was diethyl ether - n-hexane (1:1, v/v). Extraction efficiency and determination of aroma volatiles were performed by GC-FID and GC-MS, respectively. The major volatile compounds present in plant extracts were myristicin, α-phellandrene, β-phellandrene, 1,3,8-p-menthatriene, apiol, dill ether and allyl phenoxyacetate.

  14. Effects of host plants on digestive enzymatic activities and some components involved in intermediary metabolism of Chrysodeixis chalcites (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    M. Mardani-Talaee

    2014-12-01

    Full Text Available Chrysodeixis chalcites (Esper is a serious pest that causes devastating damages in infested areas to many fruits, vegetables, ornamental crops and weeds. In the current study, effects of three host plants including lemon balm (Melissa officinalis L.; corn (Zea mays L. and dill (Anethum graveolens L. were determined on digestive enzyme activities and intermediary metabolism of C. chalcites larvae. The highest activities of α-amylase, glucosidases and specific proteases were observed in the larvae fed on dill. Our results showed that C. chalcites larvae had the highest TAG-lipase activity on corn in comparison with other host plants. Significant differences were found among enzymatic activities of acid (ACP and alkaline phosphatases, aspartate aminotransferases and lactate dehydrogenase (LDH in the haemolymph of C. chalcites larvae reared on lemon balm, corn and dill, respectively, although activity of alanine aminotransferase showed no statistically significant differences among different host plants. The enzymatic activity of ACP significantly decreased on dill in comparison with lemon balm and corn. The activity of LDH significantly increased on dill compared with other host plants. These results revealed that dill (A. graveolens is the most appropriate host plant for larvae of C. chalcites as evidenced by the highest digestive enzyme activities and intermediary metabolism.

  15. Influence of microwave frequency electromagnetic radiation on terpene emission and content in aromatic plants.

    Science.gov (United States)

    Soran, Maria-Loredana; Stan, Manuela; Niinemets, Ülo; Copolovici, Lucian

    2014-09-15

    Influence of environmental stress factors on both crop and wild plants of nutritional value is an important research topic. The past research has focused on rising temperatures, drought, soil salinity and toxicity, but the potential effects of increased environmental contamination by human-generated electromagnetic radiation on plants have little been studied. Here we studied the influence of microwave irradiation at bands corresponding to wireless router (WLAN) and mobile devices (GSM) on leaf anatomy, essential oil content and volatile emissions in Petroselinum crispum, Apium graveolens and Anethum graveolens. Microwave irradiation resulted in thinner cell walls, smaller chloroplasts and mitochondria, and enhanced emissions of volatile compounds, in particular, monoterpenes and green leaf volatiles (GLV). These effects were stronger for WLAN-frequency microwaves. Essential oil content was enhanced by GSM-frequency microwaves, but the effect of WLAN-frequency microwaves was inhibitory. There was a direct relationship between microwave-induced structural and chemical modifications of the three plant species studied. These data collectively demonstrate that human-generated microwave pollution can potentially constitute a stress to the plants. PMID:25050479

  16. Essential Oil Extraction of Fennel Seed (Foeniculum vulgare Using Steam Distillation

    Directory of Open Access Journals (Sweden)

    Astrilia Damayanti

    2012-10-01

    Full Text Available Indonesia is a potential country in developing essential oils which is each part of the plants produce essential oils such as leaf, seed, fruit, and root. One of the potential plants is fennel. Fennel oil distillation used fennel seed from Cepogo District, Boyolali Regency. The characteristics of the seed are; the color is black and the length is 0,2 centimeters. The condition operation to exctract of the fennel seed are 1 atm and 7,5 hours. The calculation of the time started when the first fennel oil dropped into the decanter. It finished when the fennel oil was not dropped anymore. The color is bright and muddy. The last process is add 1% (m/m Na2SO4 anhidrous into fennel oil to absorp remain water in it. The distillation process produce fennel oil102,125 grams. Sample of fennel oil tested which are density test, solubility on 90% alcohol, GC-MS test, and AAS test. The result shows that fennel oil from the fennel seed is 2,0425%. The tested samples contain the brightest and the muddies sample. The density of 0,9500 and 0,949 g/cc respectively that is not fulfill to  the Food Chemical Codex (FCC. Samples solubility in 90% alcohol (1:3 is fulfill to the the Food Chemical Codex (FCC.  Three main components of the brightest sample are anethole (47,51%, estragole (22,41%, and  α-fensone (21,92% while the muddiest sample’s components are anethole (52,38%, estragole (21,37%,and α-fensone (15,74%. The AAS test shows that fennel oil contains 65,1473 ppm which does not fulfill the Indonesian National Standards of  patchouli and clove leaf oil. [Keywords— essential oil; extraction; fennel seed; steam distillation

  17. Larvicidal activity against Aedes aegypti of Foeniculum vulgare essential oils from Portugal and Cape Verde.

    Science.gov (United States)

    Rocha, Diara Kady; Matosc, Olivia; Novoa, Maria Teresa; Figueiredo, Ana Cristina; Delgado, Manuel; Moiteiro, Cristina

    2015-04-01

    Dengue is a potentially fatal mosquito-borne infection with 50 million cases per year and 2.5 billion people vulnerable to the disease. This major public health problem has recurrent epidemics in Latin America and occurred recently in Cape Verde and Madeira Island. The lack of anti-viral treatment or vaccine makes the control of mosquito vectors a high option to prevent virus transmission. Essential oil (EO) constituents can affect insect's behaviour, being potentially effective in pest control. The present study evaluated the potential use of Foenicultm vulgare (fennel) EO in the control of the dengue vector Aedes aegypti. EOs isolated from fennel aerial parts collected in Cape Verde and from a commercial fennel EO of Portugal were analysed by NMR, GC and GC-MS. trans-Anethole (32 and 30%, respectively), limonene (28 and 18%, respectively) and fenchone (10% in both cases) were the main compounds identified in the EOs isolated from fennel from Cape Verde and Portugal, respectively. The larvicidal activity of the EOs and its major constituents were evaluated, using WHO procedures, against third instar larvae ofAe. aegypti for 24 h. Pure compounds, such as limonene isomers, were also assayed. The lethal concentrations LC50, C90 and LC99 were determined by probit analysis using mortality rates of bioassays. A 99% mortality of Ae. aegypti larvae was estimated at 37.1 and 52.4 µL L-1 of fennel EOs from Cape Verde and Portugal, respectively. Bioassays showed that fennel EOs from both countries displayed strong larvicidal effect against Ae. aegypti, the Cape Verde EO being as active as one of its major constituents, (-)-limonene. PMID:25973508

  18. Extraction of Fennel (Foeniculum vulgare) Seeds: Process Optimization and Antioxidant Capacity of the Extracts

    OpenAIRE

    Angelov, G.; Boyadzhieva, S.

    2016-01-01

    This paper presents the study on the extraction of bioactive substances from fennel seeds. The impact of the main process variables (solvent composition, liquid-to-solid ratio, temperature, contact time) on the concentration of the target substances (polyphenols and flavonoids) in the extracts is studied resulting in the selection of a set of operating parameters, at which their content is maximized. Extracts with higher concentration of target compounds demonstrate higher antioxidant capacit...

  19. Susceptibility of Microsporum canis arthrospores to a mixture of chemically defined essential oils: a perspective for environmental decontamination.

    Science.gov (United States)

    Nardoni, Simona; Tortorano, Annamaria; Mugnaini, Linda; Profili, Greta; Pistelli, Luisa; Giovanelli, Silvia; Pisseri, Francesca; Papini, Roberto; Mancianti, Francesca

    2015-01-01

    The zoophilic dermatophyte Microsporum canis has cats as natural reservoir, but it is able to infect a wide range of hosts, including humans, where different clinical features of the so-called ringworm dermatophytosis have been described. Human infections are increasingly been reported in Mediterranean countries. A reliable control program against M. canis infection in cats should include an antifungal treatment of both the infected animals and their living environment. In this article, a herbal mixture composed of chemically defined essential oils (EOs) of Litsea cubeba (1%), Illicium verum, Foeniculum vulgare, and Pelargonium graveolens (0.5% each) was formulated and its antifungal activity assessed against M. canis arthrospores which represent the infective environmental stage of M. canis. Single compounds present in higher amounts in the mixture were also separately tested in vitro. Litsea cubeba and P. graveolens EOs were most effective (minimum inhibitory concentration (MIC) 0.5%), followed by EOs of I. verum (MIC 2%) and F. vulgare (MIC 2.5%). Minimum fungicidal concentrations (MFC) values were 0.75% (L. cubeba), 1.5% (P. graveolens), 2.5% (I. verum) and 3% (F. vulgare). MIC and MFC values of the mixture were 0.25% and 0.5%, respectively. The daily spray of the mixture (200 μL) directly onto infected hairs inhibited fungal growth from the fourth day onwards. The compounds present in higher amounts exhibited variable antimycotic activity, with MIC values ranging from >10% (limonene) to 0.1% (geranial and neral). Thus, the mixture showed a good antifungal activity against arthrospores present in infected hairs. These results are promising for a further application of the mixture as an alternative tool or as an adjuvant in the environmental control of feline microsporosis. PMID:25854840

  20. Acaricidal and Insecticidal Activities of Essential Oils against a Stored-Food Mite and Stored-Grain Insects.

    Science.gov (United States)

    Song, Ja-Eun; Kim, Jeong-Moon; Lee, Na-Hyun; Yang, Ji-Yeon; Lee, Hoi-Seon

    2016-01-01

    Twenty plant-derived oils were evaluated for their acaricidal and insecticidal activities against Sitotroga cerealella, Sitophilus oryzae, Sitophilus zeamais, and Tyrophagus putrescentiae adults, by using the fumigant and filter paper diffusion methods. Responses varied with bioassay systems, insect or mite species, plant oils, and exposure time. Based on the 50% lethal dose (LD50) values against S. oryzae and S. zeamais in the fumigant bioassay, Anethum graveolens oil (4.12 and 1.12 μg/cm(3), respectively) induced the highest mortality, followed by Achillea millefolium (21.92 and 14.91 μg/cm(3)) and Eucalyptus dives (28.02 and 24.02 μg/cm(3)) oils, respectively. The most toxic oil based on the 50% lethal concentration values against T. putrescentiae was E. dives (3.13 μg/cm(3)), followed by Melaleuca leucadendron (3.93 μg/cm(3)) and Leptospermum pertersonii (4.41 μg/cm(3)). Neroli birgard oil (1.70 μg/cm(3)) was the most toxic based on the LD50 values against S. cerealella, followed by Citrus aurantium (1.80 μg/cm(3)) and Artemisia vulgaris (1.81 μg/cm(3)). The insecticidal and acaricidal activities of the plant oils in the filter paper diffusion bioassay were similar to those in the fumigant bioassay. In comparison, A. millefolium, A. graveolens, and E. dives oils were more effective against S. oryzae and S. zeamais in the fumigant bioassay than in the contact bioassay. These results indicate that the insecticidal activity of the three plant oils against S. oryzae and S. zeamais may be due to their fumigant action. Acaricidal activities of the A. millefolium, A. graveolens, and E. dives oils against T. putrescentiae were 2.62, 1.11, and 122 times higher than that of benzyl benzoate in the contact bioassay. These results indicate that A. millefolium, A. graveolens, and E. dives oils have potential for development as agents to control stored-grain insects and mites. PMID:26735047

  1. Ethnoveterinary medicines used for ruminants in British Columbia, Canada

    Directory of Open Access Journals (Sweden)

    Brauer Gerhard

    2007-02-01

    Full Text Available Abstract Background The use of medicinal plants is an option for livestock farmers who are not allowed to use allopathic drugs under certified organic programs or cannot afford to use allopathic drugs for minor health problems of livestock. Methods In 2003 we conducted semi-structured interviews with 60 participants obtained using a purposive sample. Medicinal plants are used to treat a range of conditions. A draft manual prepared from the data was then evaluated by participants at a participatory workshop. Results There are 128 plants used for ruminant health and diets, representing several plant families. The following plants are used for abscesses: Berberis aquifolium/Mahonia aquifolium Echinacea purpurea, Symphytum officinale, Bovista pila, Bovista plumbea, Achillea millefolium and Usnea longissima. Curcuma longa L., Salix scouleriana and Salix lucida are used for caprine arthritis and caprine arthritis encephalitis.Euphrasia officinalis and Matricaria chamomilla are used for eye problems. Wounds and injuries are treated with Bovista spp., Usnea longissima, Calendula officinalis, Arnica sp., Malva sp., Prunella vulgaris, Echinacea purpurea, Berberis aquifolium/Mahonia aquifolium, Achillea millefolium, Capsella bursa-pastoris, Hypericum perforatum, Lavandula officinalis, Symphytum officinale and Curcuma longa. Syzygium aromaticum and Pseudotsuga menziesii are used for coccidiosis. The following plants are used for diarrhea and scours: Plantago major, Calendula officinalis, Urtica dioica, Symphytum officinale, Pinus ponderosa, Potentilla pacifica, Althaea officinalis, Anethum graveolens, Salix alba and Ulmus fulva. Mastitis is treated with Achillea millefolium, Arctium lappa, Salix alba, Teucrium scorodonia and Galium aparine. Anethum graveolens and Rubus sp., are given for increased milk production.Taraxacum officinale, Zea mays, and Symphytum officinale are used for udder edema. Ketosis is treated with Gaultheria shallon, Vaccinium sp., and

  2. Mannitol utilisation by celery (Apium graveolens) plants grown under different conditions in vitro

    Czech Academy of Sciences Publication Activity Database

    Vítová, Lenka; Stodůlková, E.; Bartoníčková, A.; Lipavská, H.

    2002-01-01

    Roč. 163, - (2002), s. 907-916. ISSN 0168-9452 R&D Projects: GA MŠk LN00A081 Institutional research plan: CEZ:AV0Z5038910; CEZ:MSM 113100003 Keywords : Carbohydrates * Osmotic stress * Sugar alcohol Subject RIV: EF - Botanics Impact factor: 1.556, year: 2002

  3. Extraction of Botanical Pesticides from Pelargonium graveolens using Supercritical Carbon Dioxide

    Czech Academy of Sciences Publication Activity Database

    Machalová, Zdeňka; Sajfrtová, Marie; Pavela, R.; Topiař, Martin

    2015-01-01

    Roč. 67, MAY (2015), s. 310-317. ISSN 0926-6690 R&D Projects: GA TA ČR TA01010578 Institutional support: RVO:67985858 Keywords : botanical pesticides * geranium oil * supercritical fluid extraction Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.837, year: 2014

  4. The effect of celery (Apium graveolens L.) on reproductive parameters in male wistar rat

    OpenAIRE

    Wesam Kooti; Najmeh Kafash-Farkhad; Ali Ghorbani-Ranjbari; Naim Sharafi-Ahvazi

    2016-01-01

    Dear editor In recent years, the number of scientific research papers of Iranian scientists has substantially grown in national and international journals that indicates particular attitude of Iranian scientific community to the development of knowledge in different fields. Moreover, improvement of quality of scientific papers is necessary. For this purpose, criticism of published studies is a way to increase the quality of articles and make them clear. In Avicenna Journal of Phytomedicine, v...

  5. Chemistry, technology, and nutraceutical functions of celery (Apium graveolens L.): an overview.

    Science.gov (United States)

    Sowbhagya, H B

    2014-01-01

    Celery is a commercially important seed spice belonging to the family Umbelliferrae. Celery is used in various forms such as fresh herb, stalk, seeds, oil, and oleoresin for flavoring of foods and for medicinal purposes. Celery seed contains 2% volatile oil that finds application for flavoring of foods and also in perfumery industry. Limonene and selinene form about 60% and 20% of the oil, respectively. However, the important flavor constituents of the oil responsible for the typical aroma are 3-n-butyl-4-5-dihydrophthalide (sedanenolide), 3-n-butyl phthalide, sedanolide, and sedanonic anhydride present in very low levels (1-3%). Celery contains 15% fatty oil with the fatty acids: petroselenic (64.3%), oleic (8.1%), linoleic (18%), linolenic (0.6%), and palmitic acids. Phthalides especially sedanenaloide possess many health benefits. Celery extracts are reported to possess many nutraceutical properties, viz., antioxidant, hypolipidemic, hypoglycemic, and anti-platelet aggregation. In the present review, the chemistry, processing, and biological activities of celery and the components responsible are discussed. PMID:24188309

  6. АЛЛЕЛОПАТИЧЕСКАЯ АКТИВНОСТЬ У СЕМЯН ОВОЩНЫХ СЕЛЬДЕРЕЙНЫХ КУЛЬТУР

    OpenAIRE

    Бухаров, А.; Балеев, Д.

    2014-01-01

    Исследовали стабильность проявления аллелопатической активности у овощных сельдерейных культур. Объектами-донорами служили семена сельдерея корневого ( Apium graveolens ) сорта Купидон, петрушки корневой ( Petroselinum crispum ) сорта Любаша, пастернака ( Pastinaca sativa ) сорта Кулинар и укропа ( Anethum graveolens ) сорта Кентавр; объекты-тестеры семена редиса ( Raphanus sativus ), салата ( Lactuca sativa ), капусты японской ( Brassica chinesis var. japonica ), кресс-салата ( Lepidium sati...

  7. Larvicidal and acetylcholinesterase inhibitory activities of apiaceae plant essential oils and their constituents against aedes albopictus and formulation development.

    Science.gov (United States)

    Seo, Seon-Mi; Jung, Chan-Sik; Kang, Jaesoon; Lee, Hyo-Rim; Kim, Sung-Woong; Hyun, Jinho; Park, Il-Kwon

    2015-11-18

    This study evaluated the larvicidal activity of 12 Apiaceae plant essential oils and their components against the Asian tiger mosquito, Aedes albopictus, and the inhibition of acetylcholine esterase with their components. Of the 12 plant essential oils tested, ajowan (Trachyspermum ammi), caraway seed (Carum carvi), carrot seed (Daucus carota), celery (Apium graveolens), cumin (Cuminum cyminum), dill (Anethum graveolens), and parsley (Petroselinum sativum) resulted in >90% larval mortality when used at 0.1 mg/mL. Of the compounds identified, α-phellandrene, α-terpinene, p-cymene, (-)-limonene, (+)-limonene, γ-terpinene, cuminaldehyde, neral, (S)-+-carvone, trans-anethole, thymol, carvacrol, myristicin, apiol, and carotol resulted in >80% larval mortality when used at 0.1 mg/mL. Two days after treatment, 24.69, 3.64, and 12.43% of the original amounts of the celery, cumin, and parsley oils, respectively, remained in the water. Less than 50% of the original amounts of α-phellandrene, 1,8-cineole, terpinen-4-ol, cuminaldehyde, and trans-antheole were detected in the water at 2 days after treatment. Carvacrol, α-pinene, and β-pinene inhibited the activity of Ae. albopictus acetylcholinesterase with IC50 values of 0.057, 0.062, and 0.190 mg/mL, respectively. A spherical microemulsion of parsley essential oil-loaded poly(vinyl alcohol) (PVA) was prepared, and the larvicidal activity of this formulation was shown to be similar to that of parsley oil. PMID:26500081

  8. Chemical Composition and Zootechnical Effects of Essebtial Oil of Fennel (Foeniculum Vulgare Mill and Anise (Pimpinella Anisum L. on Turkey

    Directory of Open Access Journals (Sweden)

    Ould sidi moctar Yacoub

    2015-04-01

    Full Text Available The main aim of this study was to investigate the effects of the dietary oils from fennel and anise on the zootechnical performances of Turkey. The essential oils were analyzed by gas chromatography coupled to mass spectrometry. One Hundred turkey males meat strain BUT 10 (Meleagris gallopavo, of one day old, were weighed and randomly allotted into 5 groups of 20 turkeys each. These groups were fed, for 35 days, the basal diet (Control or the basal diet supplemented with 0.2 g/kg of fennel oil (EOFVD1, 0.5 g/kg of fennel oil (EOFVD2, 0.2 g/kg of anise oil (EOPAD1 and 0.5 g/kg of anise oil (EOPAD2. The mean body weight of EOFVD2 group (807.85 g was higher than other groups at the end of the treatment (P<0.05. Likewise, mean body weight of the EOPAD1 group (782.45 g was different from those of EOFVD1 (769.89 g, EOPAD2 (756.77 g and Control group (768.35 g (P<0.01. The results related to the average day weight gain (ADG indicated that subjects belonging to the batches treated with EOFVD2, EOPAD1 and EOFVD1, expressed the best performance with ADG respective of 79.46±4.03 g/d, 51.12±27.88 g/d, 50.47±26.94 g/d, followed by control group (49.76±26.67 g/d, against 49.98 ±28.46 g/d for the EOPAD2 group with a difference which is statistically significant (P<0.05. These results concluded that supplementing diets with essential oils of fennel and anise, which improved body weight, could be interesting feed additives for growth promotion turkey.

  9. Inhibition of grey mould in vitro and in vivo with essential oil of fennel (Foeniculum vulgare L.

    Directory of Open Access Journals (Sweden)

    Samane MOHAMMADI

    2013-03-01

    Full Text Available The aim of the study was to determine the antifungal effects of the fennel essential oil against fungal pathogen Botrytis cinerea the causal agent of grey mould disease of tomato fruit under in vitro and in vivo conditions. Treatments consisted of five concentrations (0, 200, 400, 600 and 800 lL-1.The fennel oil had a remarkable effect on spore germination of grey mould. The growth of grey mould was completely inhibited by fennel oil at 600 and 800 lL-1.The results in vivo showed that fennel oil increased the shelf life and decreased decay rate of tomato fruits. Also, fennel essential oil positively affected on postharvest quality factors. Treated fruits with fennel oil had significantly higher titrable acidity, total soluble solids, ascorbic acid, and lycopene and -carotene content comparison to control. Thus, these results showed that fennel essential oil has impact on postharvest decay and fruit quality of tomato.

  10. Effects of organic and biological fertilizers on fruit yield and essential oil of sweet fennel (Foeniculum vulgare var. dulce)

    Energy Technology Data Exchange (ETDEWEB)

    Moradi, R.; Rezvani Moghaddam, P.; Nasiri Mahallati, M.; Nezhadali, A.

    2011-07-01

    In order to evaluate the effects of different organic and biological fertilizers on quantity and quality of fennel essential oil, an experiment was conducted in a completely randomized block design with three replications. The experimental treatments included two organic (compost and vermicompost) and two biological (Pseudomonas putida and Azotobacter chroococcum) fertilizers, their all twin combinations (Ps. putida + A. chroococcum, Ps. putida + compost, Ps. putida + vermicompost, A. chroococcum + compost, A. chroococcum + vermicompost and compost + vermicompost) and control (non fertilized). There were significant differences between treatments in terms of seed essential oil percentage, essential oil yield; anethole, fenchone, limonene and straggle content in seed essential oil. Results showed that the highest and the lowest percentages of essential oil were obtained in control (2.9%) and A. chroococcum + vermicompost (2.2%) treatments, respectively. The highest essential oil yield (29.9 L ha{sup -}1) and anethole content of essential oil (69.7%) and the lowest contents of fenchone (6.14%), limonene (4.84%) and estragole (2.78%) in essential oil were obtained in compost + vermicompost treatment. It seems that compost + vermicompost treatment compared to other treatments supplied the highest equilibrium of nutrients and water in the root zone of sweet fennel which is led to increasing the anethole content, there upon, decreasing other compounds. Essential oil yield and percentage of anethole content in essential oil were significantly higher in all organic and biological treatments compared with control. (Author) 43 refs.

  11. Effect of mineral vs. biofertilizer on growth, yield, and essential oil content of fennel (Foeniculum vulgare Mill.)

    OpenAIRE

    M.A. Sharaf-Eldin; S.A. Mahfouz

    2007-01-01

    In field experiments during two successive seasons (2003-2004 and 2004-2005), the effects of biofertilization on growth, fruit yield, and oil composition of fennel plants were investigated. Application of biofertilizer, which was a mixture of Azotobacter chroococcum, Azospirillum liboferum, and Bacillus megatherium applied with chemical fertilizers (only 50% of the recommended dosage of NPK) increased vegetative growth (plant height, number of branches, and herb fresh and dry weight per plant...

  12. Improved growth, seed yield and quality of fennel (foeniculum vulgare mill.) through soil applied nitrogen and phosphorus

    International Nuclear Information System (INIS)

    In Pakistan, fennel is conventionally grown without fertilizer. A field experiment, was conducted to study the effects of nitrogen and phosphorus fertilizer treatments (NP in ratio of 0:0, 30:0,/sub -1/ 0:30, 30:15, 30:30, 60:30, 60:60, 90:45 and 90:90 kg ha ) on growth, seed yield and quality of fennel during 2011-2012. Fertilizer NP dose (90:45 kg -1 ha ) increased plant height by 44%, number of leaves per plant by 76%, 1000 seed weight by 44%, biological yield by 50%, seed yield by 296%, harvest index by 162% and protein content by 6%. However, fertilizer NP/sub -1/ (90:45 kg ha ) decreased oil content by 26%. Therefore, addition of NP fertilizer had the potential to increase fennel seed yield, but reduce oil content, under Faisalabad conditions. (author)

  13. Effect of mineral vs. biofertilizer on growth, yield, and essential oil content of fennel (Foeniculum vulgare Mill.

    Directory of Open Access Journals (Sweden)

    M.A. Sharaf-Eldin

    2007-12-01

    Full Text Available In field experiments during two successive seasons (2003-2004 and 2004-2005, the effects of biofertilization on growth, fruit yield, and oil composition of fennel plants were investigated. Application of biofertilizer, which was a mixture of Azotobacter chroococcum, Azospirillum liboferum, and Bacillus megatherium applied with chemical fertilizers (only 50% of the recommended dosage of NPK increased vegetative growth (plant height, number of branches, and herb fresh and dry weight per plant compared to chemical fertilizer treatments only. The tallest plants, the highest number of branches per plant, and the highest fresh and dry weights of plants were obtained from the treatment of biofertilizer plus a half dose of chemical fertilizer (357 kg ammonium sulphate + 238 kg calcium super phosphate + 60 kg potassium sulphate ha-1. The lowest fresh and dry weights of plants occurred with the 50% NPK. Also, addition of biofertilizer with the chemical fertilizer increased these characters more than the half dose of chemical fertilizer alone. Total carbohydrates in the dry plant material were influenced by the biofertilizer. The highest values of total carbohydrates were found in the treatment with biofertilizer plus a half dose of nitrogen and phosphorus. Nitrogen, phosphorus, and potassium levels in the plant tissue increased when soil was inoculated by nitrogen-fixing bacteria, phosphate-dissolving bacteria, and a mixture of all strains, respectively. The least amount of N, P and K in the plant tissue occurred with the half dose of chemical fertilizer. Essential oil content in the fennel fruits was increased due to inoculation compared to the half dose of chemical fertilizer. The highest oil yield per plant was observed with the treatment of biofertilizer plus a half dose of nitrogen and phosphorus. The lowest amount of essential oil yield was obtained with the half dose of chemical fertilizer. Oxygenated compounds were increased as a result of using biofertilizer. The highest anethol (trans-1-methoxy-4-(prop-1-enylbenzeen; C10H12O in fennel essential oil occurred with the half dose of N, P, and K and inoculation with Bacillus megatherium.

  14. Carotenoid content of commonly consumed herbs and assessment of their bioaccessibility using an in vitro digestion model.

    Science.gov (United States)

    Daly, Trevor; Jiwan, Marvin A; O'Brien, Nora M; Aherne, S Aisling

    2010-06-01

    Herbs are a rich source of bioactive phytochemicals such as carotenoids, which are known to exert various positive biological effects. However, there is very limited information in the literature regarding the content and bioavailability of carotenoids from commonly consumed herbs. Therefore, the objectives of the present study were first, to determine the carotenoid content of eight herbs namely basil (Ocimum basilicum), coriander (Coriandrum sativum), dill (Anethum graveolens), mint (Metha L.), parsley (Petroselinum crispum), rosemary (Rosmarinus officinalis), sage (Salvia officinalis), and tarragon (Artemisia dracunculus L.); and second, to assess carotenoid bioaccessibility from these herbs using a simulated human in vitro digestion model. Carotenoid bioaccessibility is defined as the amount of carotenoids transferred to micelles after digestion when compared with the original amount present in the food. The content of individual carotenoids varied significantly among the herbs tested. Carotenoid bioaccessibility varied from 0 to 42.8%. Basil and coriander, and their respective micelles, contained the highest levels of beta-carotene, beta-cryptoxanthin, and lutein + zeaxanthin. Our findings show that herbs are rich sources of carotenoids and that these foods can significantly contribute to the intake of bioaccessible carotenoids. PMID:20443063

  15. Ethno-gynecological knowledge of medicinal plants used by Baluch tribes, southeast of Baluchistan, Iran

    Directory of Open Access Journals (Sweden)

    Zahra Sadeghi

    2014-12-01

    Full Text Available The objective of this study was to establish a regional profile of the indigenous knowledge on the treatment of various gynaecological disorders by Baluch Tribes of Iran. The ethical guidelines adopted by the International Society of Ethnobiology were strictly followed during the field survey. Data were collected during 2013-2014 based on interviews, group conversations and close consultation with local informants. Participants were selected using the snowball sampling technique. Secondary methods of data collection were also used for triangulation. A quantitative analysis including the informant consensus factor and use value was performed to evaluate the medicinal plants. A total of 33.3% Baluch women reported high affiliation with herbal remedies for gynaecological problems, while others attribute was also positive for medicinal plants. A total of eighty plant species belonging to 43 botanical families were documented. Levels of Relative frequency of citation decreased as follows: Nigella sativa (0.92, Pistacia atlantica (0.91, Anethum graveolens (0.88, Carum carvi (0.87 and Trigonella foenum-graecum (0.85. Results of the informant consensus factor showed that menstrual problems (0.87 and vaginal infection (0.74 were the most common problems of women in the studied area. The use value and informant consensus factor validated that the relative importance of plant species and shared knowledge of herbal therapies between Baluch womenfolk of this area is still rich.

  16. Effect of normal/dehydrated greens on the rheological, microstructural, nutritional and quality characteristics of paratha-an Indian flat bread.

    Science.gov (United States)

    Sudha, M L; Eipson, Sushma W; Khanum, Hafeeza; Naidu, M Madhava; Venkateswara Rao, G

    2015-02-01

    The leaves of dill (Anethum graveolens) and fenugreek (Trigonella foenum-graecum L. Leguminosae) were dehydrated using low temperature low humidity dryer, packed in polypropylene bags and stored at refrigerated conditions. Dehydration process marginally reduced the chlorophyll, carotenoid and ascorbic acid contents. Replacement of whole wheat flour with dehydrated leaves (dill-DDL, fenugreek leaves DFL) at 0, 5, 7.5 and 10 % increased the water absorption (68.5 to 70.2 %), dough development time (3.5 to 5.9 min) and mixing tolerance index values (78 to 98 BU). Pasting temperature increased (69 to 74.1 °C), whereas the hot paste viscosity (255 to 210 BU) and cold paste viscosity values (355 to 295 BU) decreased with increase in the DDL/DFL content in the blend. Sensory evaluation of parathas prepared with either normal dill/fenugreek leaves (NDL/NFL) at 0, 12.5, 25 and 37.5 % or dehydrated leaves at 0, 5, and 7.5 % showed that parathas with 25 % of normal leaves and 7.5 % of dehydrated leaves were acceptable. Microstructure of the fenugreek leaves had more porous structure on dehydration. Parathas enriched with either of leaves were rich in dietary fiber, chlorophyll and carotenoid content. PMID:25694692

  17. Phytoavailability and fractionation of copper, manganese, and zinc in soil following application of two composts to four crops

    Energy Technology Data Exchange (ETDEWEB)

    Zheljazkov, Valtcho D.; Warman, Phil R

    2004-09-01

    Two experiments were conducted to evaluate the effect of compost addition to soil on fractionation and bioavailability of Cu, Mn, and Zn to four crops. Soils growing Swiss chard (Beta vulgaris var. cicla L.) and basil (Ocimum basilicum L.) were amended (by volume) with 0, 20, 40, and 60% Source-Separated Municipal Solid Waste (SS-MSW) compost, and dill (Anethum graveolens L.) and peppermint (Mentha X piperita L.) were amended with 0, 20, 40, and 60% of high-Cu manure compost (by volume). The SS-MSW compost applications increased the concentration of Cu and Zn in all fractions, increased Mn in acid extractable (ACID), iron and manganese oxides (FeMnOX), and organic matter (OM) fractions, but decreased slightly exchangeable-Mn. Addition of 60% high-Cu manure compost to the soil increased Cu EXCH, ACID, FeMnOX, and OM fractions, but decreased EXCH-Mn, and did not change EXCH-Zn. Addition of both composts to soil reduced bioavailability and transfer factors for Cu and Zn. Our results suggest that mature SS-MSW and manure composts with excess Cu and Zn could be safely used as soil conditioners for agricultural crops.

  18. Potencial toxicológico frente Artemia Salina em plantas condimentares comercializadas no município de Campina Grande-PB

    Directory of Open Access Journals (Sweden)

    Emmanuel Moreira Pereira

    2015-03-01

    Full Text Available O conhecimento do potencial toxicológico das plantas é um fator primordial para estipular o limite consumível. Objetivou-se nesse trabalho avaliar o potencial toxicológico de plantas condimentares frente Artemia salina, expostas às concentrações dos extratos das plantas erva-doce (Pimpinella anisum L., pimenta malagueta (Capsicum frutescens, endro (Anethum graveolens L. e alecrim (Rosmarinus officinalis L.. O trabalho foi desenvolvido no Laboratório de Engenharia de Alimentos - LEA pertencente ao Centro de Tecnologia e Recursos Naturais da Universidade Federal de Campina Grande-PB. A erva doce apresentou uma baixa toxicidade, atingindo uma DL50 de 428ppm do extrato. Já a pimenta malagueta exibiu um comportamento similar, atingindo o seu potencial toxicológico máximo na terceira diluição com DL50 716,1ppm. Para o endro, observou-se uma baixa taxa de mortalidade, consequentemente foi considerada não toxica, apresentando a DL50, com 2.624,5ppm. O alecrim apresentou baixos percentuais de mortalidade em náuplios de Artemia, sendo a DL50 com 3.720,6ppm, sendo considerado não toxico. No entanto necessita-se de estudos mais aprofundados para caracterizar a composição química das plantas estudadas e um teste in vivo para as que apresentaram baixa toxicidade.

  19. Antimicrobial Activity of Essential Oils of some Medicinal Plants from Saudi Arabia

    International Nuclear Information System (INIS)

    Antibacterial and anticandidal activities of essential oils obtained from of dill (Anethum graveolens) and fennel (Feoniculum vulgare) were studied by agar dilution technique. Test organisms were inoculated by radial streaking onto agar plates and incubated for 16-20 hours at 35 degree C. Antibacterial activity of dill and fennel was evaluated against Mycobacterium spp, Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa and Candida albicans. Our results showed that the volatile oils extracted by steam distillation method from roots, stem and leaves of dill and fennel plants did not show antibacterial or anticandidal activities. However, seed extracts from both dill and fennel exhibited varying degrees of growth inhibition of C. albicans, C. tropicalis and C.glabrata. Extracts of dill and fennel seeds prepared by simple solvent extraction method, using acetone, petroleum ether, methanol and chloroform, did not show any antimicrobial activity against common bacterial or fungal pathogens. On the other hand, growth of some Mycobacterium species was inhibited by the seed extracts of both fennel and dill. Our results suggest that the anticandidal and antimycobacterial properties of these two herbs may be further investigated to explore the possibility of using them in the treatment of candidal or mycobacterial infections. (author)

  20. In Vitro Activity of Twenty Commercially Available, Plant-Derived Essential Oils against Selected Dermatophyte Species.

    Science.gov (United States)

    Nardoni, Simona; Giovanelli, Silvia; Pistelli, Luisa; Mugnaini, Linda; Profili, Greta; Pisseri, Francesca; Mancianti, Francesca

    2015-08-01

    The in vitro activity of twenty chemically defined essential oils (EOs) obtained from Boswellia sacra, Citrus bergamia, C. limon, C. medica, Cinnamomum zeylanicum, Eucalyptus globulus, Foeniculum vulgare, Helichrysum italicum, Illicium verum, Litsea cubeba, Mentha spicata, Myrtus communis, Ocimum basilicum, Origanum majorana, O. vulgare, Pelargonium graveolens, Rosmarinus officinalis, Santalum album, Satureja montana, and Thymus serpyllum was assayed against clinical animal isolates of Microsporum canis, Trichophyton mentagrophytes, T. erinacei, T. terrestre and Microsporum gypseum, main causative agents of zoonotic and/or environmental dermatophytoses in humans. Single main components present in high amounts in such EOs were also tested. Different dermatophyte species showed remarkable differences in sensitivity. In general, more effective EOs were T. serpyllum (MIC range 0.025%-0.25%), O. vulgare (MIC range 0.025%-0.5%) and L. cubeba (MIC range 0.025%-1.5%). F. vulgare showed a moderate efficacy against geophilic species such as M gypseum and T terrestre. Among single main components tested, neral was the most active (MIC and MFC values 5 0.25%). The results of the present study seem to be promising for an in vivo use of some assayed EOs. PMID:26434145

  1. Comparative structure of the osmophores in the flowers of Stanhopea graveolens Lindley and Cycnoches chlorochilon Klotzsch (Orchidaceae

    Directory of Open Access Journals (Sweden)

    Mirosława Chwil

    2012-12-01

    Full Text Available The genus Tradescantia comprises about 70 species. In Poland Tradescantia x andersoniana is basically grown as an ornamental plant that is recommended for borders and to be planted around garden ponds. The present study investigated flowering as well as the micromorphological and anatomical features of some floral elements of Tradescantia x andersoniana W. Ludw. Rohweder 'Karin'. The macro- and micromorphology of the flowers was examined using stereoscopic, light, and scanning electron microscopy (SEM. Spiderwort produces flowers with a diameter of 4.6-5 cm, which open early in the morning and close at noon. Non-glandular and glandular hairs grow on the abaxial surface of the calyx and on the apical part of the ovary. The glandular hairs develop a several-celled stalk and a unicellular spherical or elongated head. The staminal filaments produce chain-shaped trichomes. Striate cuticular ornamentation is found on their surface and on the epidermis covering the perianth. The striae on the cells of the stamen hairs run to the two poles of the cell. The pistil develops a wet stigma with unfused unicellular papillae. The cuticle on their surface is smooth, whereas on the style near the stigma it forms dense folds.

  2. De novo assembly, gene annotation and marker development using Illumina paired-end transcriptome sequences in celery (Apium graveolens L..

    Directory of Open Access Journals (Sweden)

    Nan Fu

    Full Text Available BACKGROUND: Celery is an increasing popular vegetable species, but limited transcriptome and genomic data hinder the research to it. In addition, a lack of celery molecular markers limits the process of molecular genetic breeding. High-throughput transcriptome sequencing is an efficient method to generate a large transcriptome sequence dataset for gene discovery, molecular marker development and marker-assisted selection breeding. PRINCIPAL FINDINGS: Celery transcriptomes from four tissues were sequenced using Illumina paired-end sequencing technology. De novo assembling was performed to generate a collection of 42,280 unigenes (average length of 502.6 bp that represent the first transcriptome of the species. 78.43% and 48.93% of the unigenes had significant similarity with proteins in the National Center for Biotechnology Information (NCBI non-redundant protein database (Nr and Swiss-Prot database respectively, and 10,473 (24.77% unigenes were assigned to Clusters of Orthologous Groups (COG. 21,126 (49.97% unigenes harboring Interpro domains were annotated, in which 15,409 (36.45% were assigned to Gene Ontology(GO categories. Additionally, 7,478 unigenes were mapped onto 228 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG. Large numbers of simple sequence repeats (SSRs were indentified, and then the rate of successful amplication and polymorphism were investigated among 31 celery accessions. CONCLUSIONS: This study demonstrates the feasibility of generating a large scale of sequence information by Illumina paired-end sequencing and efficient assembling. Our results provide a valuable resource for celery research. The developed molecular markers are the foundation of further genetic linkage analysis and gene localization, and they will be essential to accelerate the process of breeding.

  3. EVALUASI, UJI STABILITAS FISIK DAN SINERESIS SEDIAAN GEL YANG MENGANDUNG MINOKSIDIL, APIGENIN DAN PERASAN HERBA SELEDRI (Apium graveolens L.

    Directory of Open Access Journals (Sweden)

    Emma Sri Kuncari

    2015-01-01

    Full Text Available AbstractMinoxidil, apigenin and celery are believed to have the same bioactivity as a vasodilator that can widen blood vessels. This study discusses about the gel formulation in the scope of evaluation of gel preparation, using carbomer as a gelling agent each containing minoxidil, apigenin and celery juice. The method used in gel evaluation were organoleptic observation, homogeneity, pH, consistency and viscosity; physical stability at 40±2 °C, 28±2 °C, 4±2 °C and syneresis. Based on the result, all gel formulations showed their consistency and viscosity were higher after 8 weeks of storage at room temperature. The rheogram of three gel formulations in term of flow properties remain unchanged after 8 weeks of storage. It was indicated that the flow properties of gel formulation was pseudoplastis tixotropic. The gel containing minoxidil, apigenin and celery juice showed good physical stability at 28±2 °C and 40±2 °C, but less stable at 4±2 °C after 14 weeks of storage. The highest number of syneresis was found in a gel containing celery juice.Keywords : Celery, Apigenin, Gel, StabilityAbstrakMinoksidil, apigenin dan seledri memiliki aktivitas biologi yang sama sebagai vasodilator yang dapat memperlebar pembuluh darah. Penelitian ini sebagai evaluasi sediaan gel, menggunakan karbomer sebagai gelling agentyang mengandung masing-masing minoksidil, apigenin dan perasan herba seledri. Metode yang digunakan dalam evaluasi gel adalah pengamatan organoleptis, homogenitas, pH, konsistensi dan viskositas; stabilitas fisik pada suhu 40±2 °C, 28±2 °C, 4±2 °C dan sineresis. Berdasarkan hasil penelitian, ketiga formula gel menunjukkan konsistensi dan viskositas yang lebih tinggi setelah 8  minggu  penyimpanan  pada  temperatur  ruang.  Hasil  rheogram  dari  ketiga  formula gel  menunjukkan  sifat  alir  yang  tetap  tidak  berubah  setelah  8  minggu  penyimpanan, yaitu pseudoplastis tiksotropik. Gel yang mengandung minoxidil, apigenin dan perasan herba seledri menunjukkan stabil fisik pada penyimpanan suhu 28±2 °C dan 40±2 °C, tetapi kurang stabil pada suhu 4±2 °C setelah 14 minggu penyimpanan. Angka sineresis tertinggi terdapat pada gel yang mengandung perasan herba seledri.Kata kunci : Seledri, Apigenin, Gel, Stabilitas

  4. Evaluations of larvicidal activity of medicinal plant extracts to Aedes aegypti (Diptera: Culicidae) and other effects on a non target fish

    Institute of Scientific and Technical Information of China (English)

    SUWANNEE PROMSIRI; AMARA NAKSATHIT; MALEEYA KRUATRACHUE; USAVADEE THAVARA

    2006-01-01

    A preliminary study was conducted to investigate the effects of the extracts of 112 medicinal plant species, collected from the southern part of Thailand, on Aedes aegypti. Studies on larvicidal properties of plant extracts against the fourth instar larvae revealed that extracts of 14 species showed evidence of larvicidal activity. Eight out of the 14 plant species showed 100% mosquito larvae mortality. The LC50 values were less than 100μg/mL (4.1μg/ mL-89.4μg/mL). Six plant species were comparatively more effective against the fourth instar larvae at very low concentrations. These extracts demonstrated no or very low toxicity to guppy fish (Poecilia reticulata), which was selected to represent most common non-target organism found in habitats of Ae. aegypti, at concentrations active to mosquito larvae. Three medicinal plants with promising larvicidal activity, having LC50 and LC90 values being 4.1 and 16.4μg/mL for Mammea siamensis, 20.2 and 34.7μg/mL for Anethum graveolens and 67.4 and 110.3 μg/mL for Annona muricata, respectively, were used to study the impact of the extracts on the life cycle of Ae. aegypti. These plants affected pupal and adult mortality and also affected the reproductive potential of surviving adults by reducing the number of eggs laid and the percentage of egg hatchability. When each larval stage was treated with successive extracts at the LC50 value, the first instar larvae were found to be very susceptible to A. muricata and the second instar larvae were found to be susceptible to A. graveolens, while the third and fourth instar larvae were found to be susceptible to M. siamensis. These extracts delayed larval development and inhibited adult emergence and had no adverse effects on P.reticulata at LC50 and LC90 values, except for the M. siamensis extract at its LC50 value.

  5. Influence of Oregano (Origanum vulgare L.), Fennel (Foeniculum vulgare L.) and Hop cones (Humulus lupulus L.) on biogas and methane production

    OpenAIRE

    Mohamed, Shamseldin Daffallah Yousif

    2014-01-01

    A high demand for agricultural biomass production in Germany was attributed to the increasing number of biogas plants every year. The value of a crop as a substrate for biogas production via anaerobic digestion depends on its biomass yield capacity compared to the effort for cultivation and on its ability to produce biogas with high methane content. After the EEG 2012 amendment which determined the amount of maize that should be used in biogas production farmers searching for alternative s...

  6. Inhibitory effect of different fennel (Foeniculum vulgare) samples and their phenolic compounds on formation of advanced glycation products and comparison of antimicrobial and antioxidant activities.

    Science.gov (United States)

    Salami, Maryam; Rahimmalek, Mehdi; Ehtemam, Mohammad Hossein

    2016-12-15

    In this study, antioxidant, antibacterial and antiglycation properties of methanolic extracts of 23 fennel samples were evaluated and their major compounds were determined using HPLC analysis. The anti-glycative activity of extracts was evaluated in the bovine serum albumin (BSA)/glucose system. The level of glycation, conformational alterations and protein binding to RAGE receptors were assessed by Congo red binding assay and a brown staining method. Among samples, Kh1 from Iran possessed the highest TFC (14.8mgQUEg(-1)), TPC (262mg/g DW) and antioxidant activity (IC50=76μg/ml). The HPLC results revealed high variation in 23 fennel samples according to their major flavonoid (quercetin, apigenin and rutin) and phenolic (chlorogenic, caffeic and 1,5-dicaffeoylquinic acid) compounds. The antibacterial activity of methanolic extracts against four food-borne pathogens was also assessed. The seed extracts of Kh1 and En samples showed moderate to good inhibitory activities (MICs=62.5-125μg/ml) against three bacteria, as well as high anti-glycative activity. PMID:27451172

  7. Distribution of Trans-Anethole and Estragole in Fennel (Foeniculum vulgare Mill of Callus Induced from Different Seedling Parts and Fruits

    Directory of Open Access Journals (Sweden)

    Abd El-Moneim Mohamed Radwan AFIFY

    2011-03-01

    Full Text Available In the present study, seeds from local cultivar of fennel were germinated on Murashige and Skoog medium (MS without plant growth regulators. Different types of explants from the growing seedling such as cotyledonal leaves, hypocotyls, epicotyls and roots were cultured on MS medium, contained different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D either alone or with kinetin. Differential responses in the essential oil constituents were observed in the induction and development of callus. The major components of essential oils includes estragole, trans-anethole, limonene and fenchone were studied under different conditions to find out the best methods which could be used to reduce the amount of estragole (not favorite for human consumption and increase the amount of trans-anethole.

  8. Perfil dos consumidores de plantas medicinais e condimentares do município de Pato Branco (PR The profile of consumers medicinal plants and spices of Pato Branco city, Paraná State, Brazil

    Directory of Open Access Journals (Sweden)

    José Abramo Marchese

    2004-06-01

    Full Text Available Diagnosticou-se o perfil dos consumidores de supermercados em Pato Branco (PR, com relação às suas preferências pelas plantas medicinais e condimentares, como subsídio à produção por pequenos produtores rurais. Os consumidores preferem produtos orgânicos, observam a aparência e o preço do produto, e vão ao mercado uma vez por semana, preferencialmente aos sábados. As dez plantas medicinais preferidas, em ordem decrescente, são camomila, anis, boldo, carqueja, guaco, malva, poejo, espinheira-santa, menta e sálvia. As dez plantas condimentares preferidas, em ordem decrescente, são cebola, cravo, canela, orégano, alho, nóz-moscada, pimentão, cebolinha, endro e salsinha.The profile of supermarket users in Pato Branco city, Paraná State, Brazil, was obtained, related to their preference for medicinal and spice plants, as a subsidy to production by small farmers. The consumers prefer organic products observing the appearance and price of the product, and they go once a week to the market, preferably on Saturdays. The ten favorite medicinal plants are Chamomilla recutita, Pimpinella anisum, Vernonia condensata, Baccharis sp., Mikania sp., Malva sp., Cunilla sp., Maytenus sp., Mentha sp. and Salvia officinalis. The ten favorite spices are: Allium cepa, Eugenia caryophyllata, Cinnamomum zeylanicum, Origanum vulgaris, Allium sativum, Myristicia fragans, Capsicum annuum, Allium schoenoprasum, Anethum graveolens and Petroselinum crispum.

  9. Evaluation of plant aqueous extracts, added into the soil, on Meloidogyne javanica (Treub, 1885 Chitwood, 1949 / Avaliação de extratos aquosos de várias espécies vegetais, aplicados ao solo, sobre Meloidogyne javanica (Treub, 1885 Chitwood, 1949

    Directory of Open Access Journals (Sweden)

    Leandro Grassi de Freitas

    2009-10-01

    Full Text Available The use of plant extracts with nematicidal properties to control plant nematodes can be a useful alternative to small farmers, regarding its low cost and non-toxic effects. The effect of the addition into the soil of aqueous extracts of 20 plant species on Meloidogyne javanica in plants of tomato was studied at greenhouse conditions. These were divided into two groups and evaluated in two separate experiments.The soil in the 2.0 L pots was infested with 5,000 eggs and, in the same day, it was applied 20 mL of aqueous extracts of the 20 plant species (Chrysanthemum parthenium, Arctium lappa, Cymbopogon citratus, Bacharis trimera, Equisetum sp., Melia azedarach, Mentha sp., Ricinus communis, Ocimum basilicum, Momordica charantia, Ruta graveolens, Coleus barbatus, Symphitum officinalis, Polygonum acre, Canavalia ensiformis, Foeniculum vulgare, Petiveria alliacea, Ageratum conyzoides, Mucuna pruriens and Azadirachta indica. Distilled water was used as control. Sixty days later, were evaluated for plant height, the fresh weight of shoot and root and the numbers of galls and eggs per root system. The extracts of Mentha sp., Arctium lappa and Ricinus communis reduced the number of galls of M. javanica in 75.6%; 65.7% and 54.4%; and the number of eggs in 81.7%, 75.9% and 56.6%, respectively.O uso de extratos vegetais com propriedades nematicidas no controle de fitonematóides representa mais uma alternativa para os pequenos produtores, com valor prático e econômico, e sem riscos de contaminação do ambiente. A adição ao solo dos extratos aquosos de 20 espécies de plantas foi avaliada sobre a população de Meloidogyne javanica em plantas de tomateiro, em casa de vegetação. Estas foram divididas em dois grupos e avaliadas em dois experimentos separados. No mesmo dia em que se infestou o solo com 5.000 ovos do nematóide, adicionou-se 20 mL dos extratos aquosos obtidos de folhas de artemísia (Chrysanthemum parthenium, bardana (Arctium lappa

  10. Dinámica de impregnación al vacío en apio (Apium graveolens L. y pepino (Cucumis sativus L.

    Directory of Open Access Journals (Sweden)

    Yisell Martelo C.

    2011-05-01

    Full Text Available Objetivo. Evaluar la respuesta a la impregnación al vacio (IV en apio y pepino, con soluciones isotónicas de NaCl. Materiales y métodos. Se determinaron variables de impregnación en troncos de apio y rodajas de pepino (3 posiciones diferentes a lo largo de su estructura, considerando, fracción y deformación volumétrica en la etapa de vacío (X1 y g1 y atmosférica (X y g, y la porosidad disponible (Ee al proceso IV. Resultados. El apio y pepino no presentaron diferencias estadísticas por efecto de la posición. En las etapas de proceso se obtuvieron para el apio y el pepino valores de X1 (-14.32 ± 2.75 y -5.51±1.76%, g1 (-0.587±0.69 y -0.079±0.99%, X(13.49±2.32 y 6.72±2.72%, g (-1.40±1.042% y -2.33±1.26% y Ee (15.73±2.31 y 9.35±2.57%, respectivamente. Estos resultados indicaron una salida de líquido nativo (X1<0 y una ligera contracción volumétrica de las estructuras (g y g1<0, lo cual se evidenció microestructuralmente. Conclusiones. La respuesta a la IV en apio y pepino, permite identificar estas matrices alimentarias, como aptas para la incorporación de componentes que le proporcionen un valor agregado a estos productos.

  11. An appropriate method for extracting the insect repellent citronellol from an indigenous plant (Pelargonium graveolens L'Her) for potential use by resource-limited animal owners

    OpenAIRE

    Botha, B. M.; C.M.E. McCrindle

    2000-01-01

    Veterinary needs appraisals in rural, peri-urban and urban areas have indicated a need for affordable and accessible veterinary health care. It was also found that farmers and animal owners used indigenous plants for treating animals. In Africa, insects such as Culex, Culicoides and Stomoxys may transmit diseases, cause irritation to animals or prevent wound healing. Insect repellents used topically are generally safer and cheaper than insecticides. Using readily available commercial sources ...

  12. Antioxidant properties of Pelargonium graveolens L’Her essential oil on the reproductive damage induced by deltamethrin in mice as compared to alpha-tocopherol

    Science.gov (United States)

    2013-01-01

    Background Exposure to the pyrethroid pesticide deltamethrin has been demonstrated to exert a wide range of effects on non-targeted organisms. The beneficial effects of geranuim essential oil (EO) as an antioxidant has been assessed in deltamethrin (DL) orally administered mice by studying whether the reprotoxicity caused by deltamethrin can be effectively combated with the geranium oil and the effects were compared to vitamin E, as the standard reference drug. Result Sixty male albino mice were divided into six equal groups: a control group, a group of mice was given deltamethrin (5 mg/kg b.w.), two groups were administered deltamethrin after having given geranium essential oil (67 mg/kg b.w.) or vitamin E (Vit E) (100 mg/kg b.w.), and two groups received only EO of geranium or Vit E. When compared to control, a dose of deltamethrin 5 mg/kg/day causes a decrease in the epididymal sperm count motility and viability and an increase in the number of abnormal morphology in spermatozoa. DL-exposed mice showed a significant increase of lipid peroxidation (LPP) in the testis compared to control animals. Conclusion Essential oil of geranium prevented testicular oxidative damage explored by reduced LPP and improved total sperm motility, viability and morphology in mice spermatozoa. Our study showed a positive influence of geranium essential oil in the animal male reproductive system similar than that of Vit E. PMID:23496944

  13. Examining food additives and spices for their anti-oxidant ability to counteract oxidative damage due to chronic exposure to free radicals from environmental pollutants

    Science.gov (United States)

    Martinez, Raul A., III

    The main objective of this work was to examine food additives and spices (from the Apiaceae family) to determine their antioxidant properties to counteract oxidative stress (damage) caused by Environmental pollutants. Environmental pollutants generate Reactive Oxygen species and Reactive Nitrogen species. Star anise essential oil showed lower antioxidant activity than extracts using DPPH scavenging. Dill Seed -- Anethum Graveolens -the monoterpene components of dill showed to activate the enzyme glutathione-S-transferase , which helped attach the antioxidant molecule glutathione to oxidized molecules that would otherwise do damage in the body. The antioxidant activity of extracts of dill was comparable with ascorbic acid, alpha-tocopherol, and quercetin in in-vitro systems. Black Cumin -- Nigella Sativa: was evaluated the method 1,1-diphenyl2-picrylhhydrazyl (DPPH) radical scavenging activity. Positive correlations were found between the total phenolic content in the black cumin extracts and their antioxidant activities. Caraway -- Carum Carvi: The antioxidant activity was evaluated by the scavenging effects of 1,1'-diphenyl-2-picrylhydrazyl (DPPH). Caraway showed strong antioxidant activity. Cumin -- Cuminum Cyminum - the major polyphenolic were extracted and separated by HPTLC. The antioxidant activity of the cumin extract was tested on 1,1'-diphenyl-2- picrylhydrazyl (DPPH) free radical scavenging. Coriander -- Coriandrum Sativum - the antioxidant and free-radical-scavenging property of the seeds was studied and also investigated whether the administration of seeds curtails oxidative stress. Coriander seed powder not only inhibited the process of Peroxidative damage, but also significantly reactivated the antioxidant enzymes and antioxidant levels. The seeds also showed scavenging activity against superoxides and hydroxyl radicals. The total polyphenolic content of the seeds was found to be 12.2 galic acid equivalents (GAE)/g while the total flavonoid content

  14. Produtividade do tomateiro em cultivo solteiro e consorciado com espécies aromáticas e medicinais Yield of tomato in monocrop and intercropping with aromatics plants

    Directory of Open Access Journals (Sweden)

    Luciana M de Carvalho

    2009-12-01

    Full Text Available O tomateiro é cultivado, principalmente em monocultivos, com uso intensivo de defensivos químicos, atividade de risco econômico, social e ambiental. O consórcio vem sendo praticado como forma de reduzir os riscos. O objetivo deste trabalho foi avaliar a produção do tomateiro solteiro e em consórcio com as espécies medicinais e aromáticas Foeniculum vulgare, Mentha piperita, Ocimum basilicum e Ruta graveolens. O delineamento experimental foi de blocos ao acaso com quatro repetições e cinco tratamentos. Avaliou-se altura, área do dossel, produção, produtividade e eficiência do uso da terra. Nos consórcios, verificou-se que, na densidade de plantio adotada, o funcho teve maior altura e área de dossel e causou redução significativa na produção total de tomates: de 12,23 kg, no cultivo solteiro, para 7,88 kg, no consórcio com funcho. No entanto, contribuiu com a menor porcentagem de perda de tomates por broqueamento (24%. As maiores perdas por broqueamento ocorreram no monocultivo e no consórcio com hortelã-pimenta. A arruda favoreceu aumento significativo na produção comercial de tomates, em média 26%. A produtividade relativa do tomateiro foi maior no consórcio com arruda (13,6 t ha-1, seguido pelo consórcio com hortelã-pimenta (9,8 t ha-1 e manjericão (9,1 t ha-1, e menor no consórcio com funcho (6,4 t ha-1, o que indicou que o consórcio com arruda foi mais vantajoso para a produção de tomates. Dentre as aromáticas estudadas, o manjericão teve maior produtividade (96,5 t ha-1. Concluindo, os consórcios permitiram maior aproveitamento no uso da terra, com aumento na produtividade dos tomateiros na presença da arruda e redução na presença do funcho. As demais plantas não reduziram significativamente a produção e portanto podem ser empregadas como fonte alternativa de renda.Tomato is mainly cultivated in monocrops, by intensive use of chemical products. It is an activity with economic, social and

  15. 21 CFR 172.510 - Natural flavoring substances and natural substances used in conjunction with flavors.

    Science.gov (United States)

    2010-04-01

    ... Do. Costus root Saussurea lappa Clarke Cubeb Piper cubeba L. f Currant, black, buds and leaves Ribes nigrum L Damiana leaves Turnera diffusa Willd Davana Artemisia pallens Wall Dill, Indian Anethum...

  16. Efecto de la aplicación de aceite esencial de orégano mexicano (Lippia graveolens y tomillo (Thymus vulgaris en factores de calidad de rodajas de manzana (Malus domestica

    Directory of Open Access Journals (Sweden)

    Carlos Enrique Ochoa Velasco

    2012-12-01

    Full Text Available El objetivo de este estudio fue evaluar algunos factores de calidad de rodajas de manzana sumergidas en soluciones de aceite esencial (AE de orégano y tomillo. Rodajas de manzana fueron sumergidas en diferentes soluciones de AE: 100 ppm de AE de orégano (T1, 100 ppm de AE de tomillo (T2, 75:25 ppm de AE de orégano:tomillo (T3, 50:50 ppm de AE de orégano:tomillo (T4, 25:75 ppm de AE de orégano:tomillo (T5; 100 ppm de ácido ascórbico (T6 y agua destilada estéril (T7 que se utilizó como control. Las rodajas de manzana fueron empacadas y almacenadas a 5 ºC. Se evaluó el pH, sólidos solubles totales, acidez titulable, color, actividad de la polifenoloxidasa, compuestos fenólicos, actividad antioxidante, bacterias aerobias mesófilas, mohos y levaduras durante 9 días y atributos sensoriales. Después de 9 días de almacenamiento las rodajas de manzana sumergidas en los tratamientos T1 y T3 presentaron menor valor de pH y menos oscurecimiento. T1 y T5 mostraron el menor cambio neto de color, esto se vio reflejado en una baja actividad de la polifenoloxidasa. La aplicación de AE incrementó significativamente (p < 0,05 los compuestos fenólicos y la actividad antioxidante en los tratamientos T2, T3, T4, T5 y T6. Sin embargo, este incremento se redujo drásticamente después de 9 días de almacenamiento, obteniéndose una actividad antioxidante del 32,1 y 35,2 % (respecto al inicio en los tratamientos T6 y T4, respectivamente. Las bacterias aerobias mesófilas se inhibieron durante 3 días en las rodajas de manzana sumergidas en solución T1, mientras que después de 9 días las que presentaron la menor carga de bacterias fueron las rodajas de manzana sumergidas en T2 y T5. Los mohos y levaduras se inhibieron en los tratamientos T1, T2 y T5. Las rodajas de manzana con mayor aceptación sensorial por parte de los jueces fueron las de los tratamientos T4, T6 y T7 al inicio del almacenamiento y de los tratamientos T4, T5 y T6 después de 6 días.

  17. Most Common Herbal Medicines in the Treatment of Iranian Children: A Systematic Review

    OpenAIRE

    Masoumeh Ghazanfarpour; Ramin Sadeghi; Mohammad Ali Kiani; Imaneh Khorsand; Masumeh Saeidi

    2014-01-01

    Introduction: To assess the efficacy of foeniculum Vulgar, menthe longifolia and Garlic in Iranian children. Methods and Matherials: Nine databases such as MEDLINE, Scopus and the Cochrane Central Register of Controlled Trials as well as domestic  database (Persian) such as SID, Iranmedex, Magiran, Medlib, Irandoc, and Google Scholar were searched using keywords such as  “child” and “complementary treatments or alternative treatments or herbal treatments or Anthum Foeniculum or Capillaceum or...

  18. Most Common Herbal Medicines in the Treatment of Iranian Children: A Systematic Review

    Directory of Open Access Journals (Sweden)

    Masoumeh Ghazanfarpour

    2014-12-01

    Full Text Available Introduction: To assess the efficacy of foeniculum Vulgar, menthe longifolia and Garlic in Iranian children. Methods and Matherials: Nine databases such as MEDLINE, Scopus and the Cochrane Central Register of Controlled Trials as well as domestic  database (Persian such as SID, Iranmedex, Magiran, Medlib, Irandoc, and Google Scholar were searched using keywords such as  “child” and “complementary treatments or alternative treatments or herbal treatments or Anthum Foeniculum or Capillaceum or Foeniculum Officinale or Foeniculum vulgare or menthe longifolia or Garlic in June 2014 Result: Five studies were included in the systematic review. Our systematic review showed beneficial effect of Foeniculum Vulgare on redacting of infant colic and also led to significant increase on prolactin levels in lactating mothers.  Base on only study, comparison between two groups (Shirafza and placebo Drops did not show any significant difference in regarding infant weight gain. Menthe longifolia combined with ORS improved frequency of defecation, Volume and consistency of stool. Also Review Systematic showed that Garlic significantly decreased fever, frequency and duration of diarrhea, leukocyte in stool.   Conclusion: herbals medicine (foeniculum Vulgar, menthe longifolia and Garlic had beneficial effect on Women's serum prolactin levels, infantile colic, frequency of defecation, Volume, consistency of stool. However, this result should be interpreted with caution which low number of sample and methodological quality.

  19. Evaluation of the riparian forest state program in Pitangueiras county, Parana / Avaliação do programa estadual “Mata Ciliar” no município de Pitangueiras, Paraná

    Directory of Open Access Journals (Sweden)

    Cristovon Videira Ripol

    2009-10-01

    ão (Ocimum basilicum, melão-de-São-Caetano (Momordica charantia, arruda (Ruta graveolens, falso-boldo (Coleus barbatus, confrei (Symphitum officinalis, erva-de-bicho (Polygonum acre, feijão-de-porco (Canavalia ensiformis, funcho (Foeniculum vulgare, guiné (Petiveria alliacea, mentrasto (Ageratum conyzoides, mucuna-cinza (Mucuna pruriens e nim (Azadirachta indica. Água destilada foi adicionada ao solo como tratamento testemunha. Após 60 dias, avaliou-se a altura das plantas, o peso fresco da parte aérea e da raiz e os números de galhas e de ovos por sistema radicular. Os extratos de hortelã, bardana e mamona reduziram o número de galhas em 75,6%, 65,7% e 54,4%, e o número de ovos em 81,7%, 75,9% e 56,6%, respectivamente.

  20. COMPARATIVE STUDY ON THE EFFECT OF DIFFERENT METHODS OF DRYING ON PHENOLICS CONTENT AND ANTIOXIDANT ACTIVITY OF SOME EDIBLE PLANTS

    Directory of Open Access Journals (Sweden)

    M. Hamzeloo Moghadam et al

    2012-10-01

    Full Text Available Antioxidants have important role in prevention and treatment of disorders and plants are considered as rich sources of radical scavenging compounds. Nowadays, many herbs are used in dried form which is possible to affect their antioxidant activity. In the present investigation, the effects of different drying methods on the antioxidant capacity and total phenolics content of some culinary plant species have been studied. Leaves of Mentha piperita, Mentha spicata, Thymus vulgaris and Anethum graveolense were dried in sun, shade, oven and microwave and extracted with methanol. Antioxidant activity of each extract was determined by DPPH free radicals and total phenolics content was measured by folin cio-calteus reagent. The results revealed that drying process reduced the antioxidant activity of Anethum graveolense whereas sun-drying and shade-drying increased the antioxidant activity of Mentha piperita, Mentha spicata and Thymus vulgaris (Lamiaceae. During sun-drying and shade-drying, total phenolics content increased for the three plants of Lamiaceae while oven- and microwave-drying reduced the phenolics content. Drying also declined the phenolics content of Anethum graveolense which gives the conclusion that some kind of correlation could be established between total phenolics content and antioxidant behavior for the three Lamiaceae and Anethum graveolense. Our study brought the view that diversity in the methods of drying could lead to different phenolics content and antioxidant behavior, suggesting that each plant needs a special drying method.

  1. Notas sobre fanerógamas de la flora argentina

    OpenAIRE

    Raúl Martínez Crovetto

    2010-01-01

    Se informa la existencia en Argentina de ocho especies de pastos marinos no catalogados. Ellos son Bromus inermis, Melinis minutiflora, Pennisetum purpureum, Melia azedarach, Anethum graueolens, Costus pilgeri, Desmodium arechaualetae  e Ipomoea morongii. Se menciona también el cultivo de Gymnopogon biflorus y Heteropterys angustifolia.

  2. Notas sobre fanerógamas de la flora argentina

    Directory of Open Access Journals (Sweden)

    Raúl Martínez Crovetto

    2010-11-01

    Full Text Available Se informa la existencia en Argentina de ocho especies de pastos marinos no catalogados. Ellos son Bromus inermis, Melinis minutiflora, Pennisetum purpureum, Melia azedarach, Anethum graueolens, Costus pilgeri, Desmodium arechaualetae  e Ipomoea morongii. Se menciona también el cultivo de Gymnopogon biflorus y Heteropterys angustifolia.

  3. Impact of plant growth promoting Pseudomonas monteilii PsF84 and Pseudomonas plecoglossicida PsF610 on metal uptake and production of secondary metabolite (monoterpenes) by rose-scented geranium (Pelargonium graveolens cv. bourbon) grown on tannery sludge amended soil.

    Science.gov (United States)

    Dharni, Seema; Srivastava, Atul Kumar; Samad, Abdul; Patra, Dharani Dhar

    2014-12-01

    Bacterial strains PsF84 and PsF610 were isolated from tannery sludge polluted soil, Jajmau, Kanpur, India. 16S rRNA gene sequence and phylogenetic analysis confirmed the taxonomic affiliation of PsF84 as Pseudomonas monteilii and PsF610 as Pseudomonas plecoglossicida. A greenhouse study was carried out with rose-scented geranium (Pelargonium graveolenscv. bourbon) grown in soil treated with tannery sludge in different proportions viz. soil: sludge ratio of 100:0, 25:75, 50:50, 75:25 and 0:100 to evaluate the effects of bacterial inoculation on the heavy metal uptake. The isolates solubilized inorganic phosphorus and were capable of producing indole acetic acid (IAA) and siderophore. The isolate PsF84 increased the dry biomass of shoot by 44%, root by 48%, essential oil yield 43% and chlorophyll by 31% respectively over uninoculated control. The corresponding increase with the isolate PsF610 were 38%, 40%, 39% and 28%, respectively. Scanning electron microscopic (SEM) studies reveal that the Cr(VI) accumulation resulted in breakdown of vascular bundles and sequesters Cr(VI) in roots. The glandular trichomes (GT) were investigated using SEM studies as these glands are probably the main site of essential oil synthesis. Owing to its wide action spectrum, these isolates could serve as an effective metal sequestering and bioinoculants due to the production of IAA, siderophore and solubilization of phosphate for geranium in metal-stressed soil. The present study has provided a new insight into the phytoremediation of metal-contaminated soil. PMID:25194330

  4. НОВЫЕ ВИДЫ ПЛАСТОВОГО МАРМЕЛАДА С ИСПОЛЬЗОВАНИЕМ СЕЛЬДЕРЕЯ (APIUM GRAVEOLENS)

    OpenAIRE

    ИВАНОВА Г.В.; АНИКИН И.С.; КОЛЬМАН О.Я.

    2015-01-01

    В статье с помощью пакета программ Microsoft Office Excel 2007 проведен регрессионный анализ экспериментальных данных. На основании полученных результатов разработана рецептура и технологическая схема производства пластового сельдерейно-лимонного мармелада.

  5. COMPARATIVE STUDY ON THE EFFECT OF DIFFERENT METHODS OF DRYING ON PHENOLICS CONTENT AND ANTIOXIDANT ACTIVITY OF SOME EDIBLE PLANTS

    OpenAIRE

    M. Hamzeloo Moghadam et al

    2012-01-01

    Antioxidants have important role in prevention and treatment of disorders and plants are considered as rich sources of radical scavenging compounds. Nowadays, many herbs are used in dried form which is possible to affect their antioxidant activity. In the present investigation, the effects of different drying methods on the antioxidant capacity and total phenolics content of some culinary plant species have been studied. Leaves of Mentha piperita, Mentha spicata, Thymus vulgaris and Anethum g...

  6. Antibacterial activity and Chemical Composition of Essential Oils of Ten Aromatic Plants against selected Bacteria

    OpenAIRE

    Pooja Bharti; Sheema Bai; Leena Seasotiya; Anupma Malik; Sunita Dalal

    2012-01-01

    The antibacterial activity of essential oils from ten aromatic plants Thymus vulgaris, Melaleuca alternifolia, Zanthoxylum rhetsa, Coriandrum sativum, Nardostachys jatamansi, Eucalyptus globules, Cyperus scariosus, Cinnamomum cecidodaphne, Olea europea, Foeniculum vulgare have been determined against nine selected bacteria. Essential oils from Thymus vulgaris, Melaleuca alternifolia and Eucalyptus globulus were found to possess maximum antibacterial activity. The GC-MS analyses of these oils ...

  7. 神奈川県大磯町で見つかる局方生薬の基原植物

    OpenAIRE

    石井, 竹夫||イシイ, タケオ||Ishii, Takeo

    2012-01-01

    Geographic distribution of original plants of Japanese Pharamacopoeia (JP; Sixteenth Edition) crude drugs was surveyed in Oiso town in Kanagawa Prefecture. In hilly country, Mallototus japonicas, Akebia quinata, Pharbitis nill, Foeniculum vulgare, Plantago asiatica, Atractylodes japonica, Pinellia ternate, Artemisia capillaries, Trichosanthes kirilowii var. japonicum, Chrysanthemum morifolium, Magnolia kobus, Phellodendron amurense, Lycium chinense, Pueraria lobata, Geranium nepalense, Cimici...

  8. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils

    OpenAIRE

    Valéria Maria Lara; Adriano Bonfim Carregaro; Deise Flores Santurio; Mariangela Facco de Sá; Janio Moraes Santurio; Sydney Hartz Alves

    2016-01-01

    This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano), Origanum vulgaris (oregano), Thymus vulgaris (thyme), Rosmarinus officinalis (rosemary), Cymbopogon nardus (citronella), Cymbopogon citratus (lemongrass), and Eucalyptus citriodora (eucalyptus) against Escherichia coli (n = 22) strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined for each ...

  9. First Report of Apium Virus Y on Cilantro, Celery, and Parsley in California.

    Science.gov (United States)

    Recently Apium virus Y (ApVY) was detected in field grown cilantro (Coriandrum sativum), celery (Apium graveolens), and parsley (Petroselinum crispum) in California. Previously, in 2003, cilantro plants from 3 different fields in California showed symptoms of mosaic, vein clearing and stunting. Whe...

  10. Effect of Gamma Irradiation And Some Plant Oils on Mating Competitiveness of Phthorimaea operculella (Zeller)(Lepidoptera: Gelechiidae)

    International Nuclear Information System (INIS)

    This study was carried out to investigate the effect of gamma radiation and plant oils on mating competitiveness of Phthorimaea operculella. When full grown pupae were irradiated with two sub-sterilizing doses and sterilizing dose (650 Gy) separately or combined with LC50 of 2% conc. Menth pepirita or Pelargonium graveolens. The fecundity and fertility were decreased by increasing the radiation dose. When males of Ph. operculella (Zeller) were sub-sterilized with gamma irradiation (150 or 200 Gy) or sterilized by 650 Gy and caged with non-irradiated pairs of adults at ratios of 1:1:1 and 5:1:1 (I male : U male : U female), the calculated degree of competitiveness showed that males irradiated with the lowest dose (150 Gy and 150 Gy + 2% conc. of M. pepirita or P. graveolens) were more competitive than males irradiated with the highest dose (650Gy). However, increasing the ratio of irradiated males with 650 Gy + 2% conc. M. pepirita to 10 increased the competitiveness value (CV), and the irradiated males were full competitive. The CV was more high among the irradiated males with 200 Gy while males were full competitive when irradiated and treated with 200 Gy + 2% conc. P. graveolens. The irradiated males with 150 Gy separately or combined with plant oil could be used in an effective sterile male release program at the ratio 1:1 (I male:N male) after suppression the field population with LC50 2% of plant oils M. pepirita or P. graveolens

  11. EST data: 8680 [RED

    Lifescience Database Archive (English)

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  12. EST data: 8002 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  13. EST data: 8329 [RED

    Lifescience Database Archive (English)

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  14. Probe data: 5652 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. fRNAdb Summary: FR183814 [

    Lifescience Database Archive (English)

    Full Text Available FR183814 AF110534,AF110535,AF110536,AF110537,AF110539,AF110540,AF110542,AF110543,AF110545,AF1105 ... ium graveolens,Conium maculatum,Pseudorlaya pumila,Laser pitium siler,Scandix pecten-veneris,Crithmum mariti ... lica sylvestris,Bifora radians,Cymopterus globosus,Laser pitium hispidum,Lomatium californicum,Thaspium trif ...

  16. Major Cytogenetic Landmarks and Karyotype analysis in Carrot and Other Apiaceace

    Science.gov (United States)

    Chromosome localization of the rDNA gene clusters was determined for the first time in several Apiaceae using double-color fluorescence in situ hybridization (FISH). Twenty-one Apioideae species including taxa of economic importance (e.g. Apium graveolens, Coriandrum sativum, Cumin cyminum, Daucus c...

  17. Comparing effects of washing, thermal treatments and gamma irradiation on quality of spices

    International Nuclear Information System (INIS)

    Samples of 5 selected spices, black pepper (Piper nigrum), fennel (Foeniculum vulgare), coriander (Coriandrum sativum) and anise (Pimpinella anisum) seeds, and turmeric (Curcuma longa) rhizomes, obtained from the local market, were washed with pure tap water then dried at room temperature, subjected to a thermal treatment at 70 degrees C for 15 minutes or exposed to a gamma radiation source (5.0 or 10 kGy). The treatments were evaluated using microbiological and chemical studies

  18. Can Estragole in Fennel Seed Decoctions Really Be Considered a Danger for Human Health? A Fennel Safety Update

    OpenAIRE

    Gori, L.; Gallo, E.; V. Mascherini; Mugelli, A; Vannacci, A; Firenzuoli, F.

    2012-01-01

    Fennel (Foeniculum vulgare Mill.) mature fruit (commonly known as seeds) and essential oil of fennel are widely used as flavoring agents in food products such as liqueurs, bread, cheese, and an ingredient of cosmetics and pharmaceutical products. Moreover fennel infusions are the classical decoction for nursing babies to prevent flatulence and colic spasm. Traditionally in Europe and Mediterranean areas fennel is used as antispasmodic, diuretic, anti-inflammatory, analgesic, secretomotor, sec...

  19. CHEMICAL COMPOSITION, ANTIOXIDANT AND ANTIMICROBIAL PROPERTIES OF THREE ESSENTIAL OILS FROM PORTUGUESE FLORA

    OpenAIRE

    Martins, M. Rosário; Tinoco, M. Teresa; Almeida, A. S.; J. Cruz-Morais

    2012-01-01

    The present work reports on the evaluation of chemical composition and antioxidant and antimicrobial activities of essential oils of three aromatic herbs, growing wild in the south of Portugal, used in traditional food preparations: Foeniculum vulgare, Mentha spicata and Rosmarinus officinalis. The principal components of essential oils were anethole (41.2%) for F. vulgare, carvone (41.1%) for M. spicata and myrcene (23.7%) for R. officinalis. Essential oils showed antioxidant activity eit...

  20. Effects of oral dosage form and storage period on the antioxidant properties of four species used in traditional herbal medicine.

    OpenAIRE

    Guimarães, Rafaela; Barreira, João C.M.; Barros, Lillian; Carvalho, Ana Maria; Ferreira, Isabel C.F.R.

    2011-01-01

    Herbal infusions and decoctions in water are some of the most commonly consumed beverages in the world. Although water is not a good solvent for many of the active components in herbs, liquid preparations are rich in several bioactive compounds. Most of them have powerful antioxidant activity and have been related to medicinal herbs’ properties. Herein, decoctions and infusions in water of lemon-verbena (Aloysia citrodora) aerial parts and leaves, fennel (Foeniculum vulgare), pennyroyal (Ment...

  1. Production of Low Calorie Bakery Product with Pleasant Flavour, Antioxidant and Antimicrobial Activities

    OpenAIRE

    Hussein Ahmed M.S.; Shaheen Mohamed S.; Abdel-Kalek Hanan H.; El-Nor S.A.H. Abo

    2014-01-01

    Aromatic plants are considered sources of antioxidants, antimicrobial and favouring agents. Four aromatic plants (Thymus vulgaris L., Foeniculum vulgare, Pimpinella anisum L. and Trigonellafoenum-graecum L.) were analysed in the study. Yoghurt was used to produce a low calorie pie. Chemical and rheological parameters, baking performance, staling rate and sensory properties of the pie were investigated. Volatile aroma compounds were anal-ysed with GC and GC/ MS, and antioxidant activity was ev...

  2. Allelopathy in some spontaneous and cultivated species

    OpenAIRE

    A. S. Dias; Dias, L. S.

    1984-01-01

    Cucumber growth was inhibited by volatile and water soluble compounds occurring in leaves of Cistus salvifolius, Foeniculum vulgare, Myrtus communis and Rosmarinus officinalis but germination was never affected. R. officinalis shows some evidence of being the strongest inhibitor with both water soluble and volatile components while F. vulgare seems to contain more volatile-compounds. It is suggested that water soluble compounds are more inhibitory than volatiles and can play an important role...

  3. Phytoactivity of secondary compounds in aromatic plants by volatile and water-soluble ways of release

    OpenAIRE

    A. S. Dias; Dias, L. S.

    2005-01-01

    Phytoactivity should be expected as a generalized trait of secondary plant compounds if their primary role is defence against co-occurring plants, and volatilization should be their predominant way of release in dry climates while in wet climates water leaching should prevail. Bioassays were designed to compare the ability of volatiles and water-solubles of four aromatic species thriving in dry environments (Cistus salvifolius L., Foeniculum vulgare Miller, Myrtus communis L., and Rosmarinus ...

  4. Antioxidant, Anti-5-lipoxygenase and Antiacetylcholinesterase Activities of Essential Oils and Decoction Waters of Some Aromatic Plants

    OpenAIRE

    Sílvia M. Albano; A. Sofia Lima; M. Graça Miguel; Luis G. Pedro; Barroso, José G.; A. Cristina Figueiredo

    2012-01-01

    The scavenging of free radicals and superoxide anion, the inhibition of 5-lipoxygenase and the antiacetylcholinesterase activities of essential oils and decoction waters of eight aromatic plants (Dittrichia viscosa, Foeniculum vulgare, Origanum vulgare, Salvia officinalis, Thymbra capitata, Thymus camphoratus, Thymus carnosus and Thymus mastichina) were studied. The essential oils were dominated by 1,8-cineole in S. officinalis (59%), T. mastichina (49%) and T. camphoratus (21%); borneol (20%...

  5. Antioxidant and Antiacetylcholinesterase Activities of Some Commercial Essential Oils and Their Major Compounds

    OpenAIRE

    Smail Aazza; Badiâ Lyoussi; Maria G. Miguel

    2011-01-01

    The commercial essential oils of Citrus aurantium L., Cupressus sempervirens L., Eucalyptus globulus Labill., Foeniculum vulgare Mill. and Thymus vulgaris L., isolated by steam distillation by a company of Morocco were evaluated in terms of in vitro antioxidant activity through several methods. In vitro acetylcholinesterase inhibitory activity was also determined. Citrus limon (L.) Burm. f. oil was also studied, but it was obtained by peel expression. The best antioxidant was T. vulgaris oil,...

  6. Microencapsulation of fennel and chamomile aqueous extracts for application in cottage cheese

    OpenAIRE

    Caleja, Cristina; Ribeiro, Andreia; Ferreira, Isabel C.F.R.; Barreiro, M.F.

    2015-01-01

    Nowadays, there is an increasing concern among consumers to choose “natural foods” or foods in which synthetic additives were replaced by natural ingredients. Some of these ingredients possess antioxidant and antimicrobial properties making them suitable to be used as natural preservers, bringing also health benefits in the prevention of several diseases [1]. Foeniculum vulgare Mill. (Fennel) and Matricaria recutita L. (Chamomile) are examples of plants that showed both antioxi...

  7. Mechanism-based inhibition of CYP3A4 and CYP2D6 by Indonesian medicinal plants.

    Science.gov (United States)

    Subehan; Usia, Tepy; Iwata, Hiroshi; Kadota, Shigetoshi; Tezuka, Yasuhiro

    2006-05-24

    Thirty samples of Indonesian medicinal plants were tested for their mechanism-based inhibition on cytochrome P450 3A4 (CYP3A4) and CYP2D6 via erythromycin N-demethylation and dextromethorphan O-demethylation activities in human liver microsomes. From screening with 0 and 20min preincubation at 0.5mg/ml of methanol extracts, five plants (Cinnamomum burmani bark, Foeniculum vulgare seed, Strychnos ligustrina wood, Tinospora crispa stem, and Zingiber cassumunar rhizome) showed more than 30% increase of CYP3A4 inhibition, while three (Alpinia galanga rhizome, Melaleuca leucadendron leaf, and Piper nigrum fruit) showed more than 30% increase of CYP2D6 inhibition. In these eight plants, Foeniculum vulgare seed, Cinnamomum burmani bark, and Strychnos ligustrina wood showed time-dependent inhibition on CYP3A4 and Piper nigrum fruit and Melaleuca leucadendron leaf on CYP2D6. Among these, four plants other than Melaleuca leucadendron revealed NADPH-dependent inhibition. Thus, Foeniculum vulgare, Cinnamomum burmani, and Strychnos ligustrina should contain mechanism-based inhibitors on CYP3A4 and Piper nigrum contain that on CYP2D6. PMID:16414224

  8. Responses of a tropical tree species to ozone: visible leaf injury, growth, and lipid peroxidation.

    Science.gov (United States)

    Cassimiro, Jéssica C; Moraes, Regina M

    2016-04-01

    The Brazilian native tree species Astronium graveolens was indicated as sensitive to ozone in a fumigation experiment. Thus, the objective of this study was to evaluate how sensitive A. graveolens is to ozone under realistic conditions in the field. Eighteen saplings were exposed to ozone in a contaminated area and in a greenhouse with filtered air during two exposure periods of approximately 63 days each (March-May 2012 and September-October 2012). Leaf injury was analyzed by means of its incidence and severity, the leaf injury index (LII) and the progression of leaf abscission. These variables were monitored weekly, whereas growth and lipid peroxidation were monitored monthly. Plants exposed to ozone showed significant growth decrease and visible leaf injury increase, but lipid peroxidation and leaf abscission remained unchanged. These results indicated that plants subjected to ozone possibly diverted energy from growth to the production of antioxidants necessary to cope with ozone-induced oxidative stress. PMID:26780049

  9. Repellent activity of plant-derived compounds against Amblyomma cajennense (Acari: Ixodidae) nymphs.

    Science.gov (United States)

    Soares, Sara Fernandes; Borges, Lígia Miranda Ferreira; de Sousa Braga, Raquel; Ferreira, Lorena Lopes; Louly, Carla Cristina Braz; Tresvenzol, Leonice Manrique Faustino; de Paula, José Realino; Ferri, Pedro Henrique

    2010-01-20

    Repellence responses of Amblyomma cajennense nymphs to callicarpenal, intermedeol, Hyptis suaveolens essential oil, extract of Melia azedarach, Cymbopogon nardus, Spiranthera odoratissima, Chenopodium ambrosioides, Ageratum conyzoides, Mentha pulegium, Ruta graveolens, and Memora nodosa were studied. Among these the extract of C. nardus stood out because of the long-lasting repellence, maintaining, in the highest concentration, 35h of protection against 90% of the nymphs. The essential oil of H. suaveolens and the extracts of C. ambrosioides and A. conyzoides showed good repellence index (66%) when applied in high concentrations. However, greater protection could be obtained at higher concentrations but with a shorter repellence time. Callicarpenal, intermedeol, extract of M. Pulegium, and M. nodosa leaves showed moderate repellence in high concentrations. Extracts from M. azedarach, R. graveolens, S. odoratissima, and M. nodosa roots showed little or no repellent effect. These results show that some plant extracts may represent a promising alternative in the control of infestations by A. cajennense. PMID:19897309

  10. Characterization of rue extract and its potential for controlling rice blast

    OpenAIRE

    Karinna Bannach Reis; Marcio Vinicius de Carvalho Barros Côrtes; Frederico Severino Martins; Marta Cristina Corsi de Filippi; José Realino de Paula; Edemilson Cardoso da Conceição

    2015-01-01

    Abstract: The objective of this work was to purify and standardize the rue (Ruta graveolens) extract and evaluate its effect on Magnaporthe oryzae as an alternative to the integrated management of rice blast. The drug was characterized, the liquid extract was obtained, and the methodology for quantifying the standard markers psoralen and bergapten was validated. Rue extract and the markers, solely or in combination, were assayed in vitro, as well as in greenhouse conditions, for their ability...

  11. USE OF BOTANICAL INSECTICIDES AS AN ALTERNATIVE FOR THE MANAGEMENT OF THE MEXICAN BEAN WEEVIL

    Directory of Open Access Journals (Sweden)

    KAREN FERREIRA DA SILVA

    2016-01-01

    Full Text Available This study aimed to evaluate the insecticidal activity of eight botanical species in the behavior and biological development of Zabrotes subfasciatus (Coleoptera: Chrysomelidae: Bruchinae under laboratory conditions. The botanical species were applied on bean grains (Phaseolus vulgaris Linnaeus directly as powder or indirectly within TNT bags. Three laboratory assays were performed. First, a repellent activity test was performed by exposing twenty couples of Z. subfasciatus adults in a choice-test arena. Second, a mortality test was performed for seven days after infestation. Finally, the oviposition and emergency rates of adults (% and the development from egg to adult (in days were evaluated in seven couples (males and females for seven days inside of a vial containing 0.3g of the powder from each botanical species and 10 g of bean grains (3% w.w-1. The study was conducted in a completely randomized design, and the treatments were arranged as a factorial design (2 x 9 with two factors (factor 1= powder and TNT bag application forms and factor 2= eight botanical species and control with eight replications. The powder application form was more efficient in controlling Z. subfasciatus. Azadirachta indica (powder application, Ruta graveolens (powder application, and Piper aduncum (TNT bag reduced the infestation of adults. The species A. inidica, Piper tuberculatum, Trichilia catigua, Pfaffia glomerata, R. graveolens, and Mentha pulegium inhibited the oviposition of the insects regardless of the formulation applied. R. graveolens (powder application caused 100% of mortality. The powder application of R. graveolens and M. pulegium reduced egg viability and insect emergence; therefore, they are very promising alternatives to control Z. subfasciatus in stored grains.

  12. ANALYSIS OF SOME ESSENTIAL ELEMENTS IN MEDICINAL PLANTS USED IN AYURVEDA

    OpenAIRE

    Om Prakash Rout; Rabinarayan Acharya; Rakshapal Gupta; Sagar Kumar Mishra; Rashmibala Sahoo

    2013-01-01

    This study presents a preliminary data of occurrence of elemental concentration in medicinal plants i.e Apium graveolens (seed), Sida cordifolia (root), Solanum surattense (whole plant), Tribulus terrestris(fruit) and Withania somnifera (root) used in Ayurveda, using Atomic absorption spectrometer (AAS) following standard procedures. The elemental concentration i.e. Mn, Na, K, Cl, Ca, Cr, Co, Cu, Fe, Pb, Zn, Ni, Cd and Hg were found in various proportions. The data obtained from the study can...

  13. Slope variation and population structure of tree species from different ecological groups in South Brazil

    OpenAIRE

    Edmilson Bianchini; Garcia, Cristina C.; José A. Pimenta; José M.D. Torezan

    2010-01-01

    Size structure and spatial arrangement of 13 abundant tree species were determined in a riparian forest fragment inParaná State, South Brazil (23"16'S and 51"01'W). The studied species were Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. and Gallesia integrifolia (Spreng) Harms (emergent species); Alseis floribunda Schott, Ruprechtia laxiflora Meisn. and Bougainvillea spectabilis Willd. (shade-intolerant canopy species); Machaerium paraguariense Hassl, Myroxylum peruiferum L. a...

  14. Apuntes sobre la flora gallega, XVII

    OpenAIRE

    Amigo Vázquez, Javier; Pulgar Sañudo, Íñigo

    2005-01-01

    Presentamos un nuevo capítulo dentro de la serie de contribuciones al conocimiento actualizado de la Flora de Galicia, aportando información de interés corológico sobre 11 taxa recolectados: Bidens frondosa L., Crypsis alopecuroides (Piller & Mitterp.) Schrad., Cyperus fuscus L., Cyperus michelianus (L.) Link, Dittrichia graveolens (L.) Desf., Echinochloa crus-galli (L.) P. Beauv. subsp. hispidula (Retz.) Honda, Eragrostis curvula (Schrad.) Nees, Hypericum hirsutum L., Lindernia dubia (L.) Pe...

  15. Sviluppo di fertilizzanti azotati con inibitore della nitrificazione di origine vegetale

    OpenAIRE

    Di Cillo, Pardo

    2012-01-01

    Le proprietà di inibizione della nitrificazione di sostanze naturali offrono potenziali benefici per l’agricoltura e l’ambiente. Al fine di valutare le performance di oli estratti da Mentha spicata e Artemisia annua e di Acque di Vegetazione delle Olive come inibitori della nitrificazione per regolare la trasformazione dell’azoto dal Solfato Ammonico. Questi effetti sull’efficienza dell’uso dell’azoto sono stati testati su sedano (Apium graveolens). I risultati di questa ricerca suggeriscono ...

  16. Searching for native tree species and respective potential biomarkers for future assessment of pollution effects on the highly diverse Atlantic Forest in SE-Brazil

    International Nuclear Information System (INIS)

    This study summarizes the first effort to search for bioindicator tree species and respective potential biomarkers for future assessment of potential mixed pollution effects on the highly diverse Atlantic Forest in SE-Brazil. Leaves of the three most abundant species inventoried in a phytosociological survey (Croton floribundus, Piptadenia gonoacantha and Astronium graveolens) were collected in four forest remnants during winter and summer (2012). Their potential bioindicator attributes were highlighted using a screening of morphological, chemical and biochemical markers. The leaf surface structure and/or epicuticular wax composition pointed the accumulator properties of C. floribundus and P. gonoacantha. C. floribundus is a candidate for assessing potential accumulation of Cu, Cd, Mn, Ni, S and Zn. P. gonoacantha is a candidate to monitor polycyclic aromatic hydrocarbons. Increased levels of secondary metabolites and decreased antioxidant capacity in leaves of A. graveolens may support its value as a bioindicator for oxidative pollutants by visible dark stipplings. - Highlights: • We searched for tree species from Atlantic Forest for future air pollution monitoring in Brazil. • Croton floribundus, Astronium graveolens and Piptadenia gonoacantha were possible bioindicators. • P. gonoachanta was a potential bioindicator of polycyclic aromatic hydrocarbons. • C. floribundus was a potential bioindicator of heavy metals and sulfur. • A. graveolens may be used for monitoring oxidative pollutants, due to its biochemical leaf traits. - Inherent characteristics of the most abundant native tree species were potential biomarkers for assessing pollution effects on the highly diverse Atlantic Forest in SE-Brazil

  17. Efecto de la incorporación de plantas antagónicas sobre la actividad parasítica del nematodo del nudo de la raíz meloidogyne hapla en un cultivo de zanahoria bajo condiciones de invernadero

    OpenAIRE

    Alvarez, César G.; Torres, Enrique; de Vis, Raf

    2011-01-01

    En el Centro de Investigaciones y Asesorías Agroindustriales (CIAA) de la Universidad Jorge Tadeo Lozano, localidad de Chía (Cundinamarca), se llevó a cabo un ensayo bajo condiciones de invernadero para evaluar el efecto de la incorporación de material vegetal fresco proveniente de siete especies de plantas (Tagetes zipaquirensis, T. erecta, Brassica cempestris, Bidens pilosa, Ruta graveolens, Taraxacum officinale y Ricinus communis) sobre el rendimiento y calidad comercial de un cultivo de z...

  18. Hepatoprotective activity of two plants belonging to the Apiaceae and the Euphorbiaceae family.

    Science.gov (United States)

    Ahmed, Bahar; Alam, Tanveer; Varshney, Manoj; Khan, Shah Alam

    2002-03-01

    The different extracts of Apium graveolens Linn. (Apiaceae) and Croton oblongifolius Roxb. (Euphorbiaceae) were tested for their hepatoprotective activity against CCl(4) induced hepatotoxicity in albino rats. The degree of protection was measured by using biochemical parameters like serum transaminases (SGOT and SGPT), alkaline phosphatase, total protein and albumin. The methanolic extracts showed the most significant hepatoprotective activity comparable with standard drug silymarin. Other extracts namely petroleum ether and acetone also exhibited a potent activity. PMID:11849834

  19. Antidiabetic and Cytotoxicity Screening of Five Medicinal Plants Used by Traditional African Health Practitioners in the Nelson Mandela Metropole, South Africa

    OpenAIRE

    van Huyssteen, Mea; Milne, Pieter J; Campbell, Eileen E; VAN DE VENTER, MARYNA

    2010-01-01

    Diabetes mellitus is a growing problem in South Africa and of concern to traditional African health practitioners in the Nelson Mandela Metropole, because they experience a high incidence of diabetic cases in their practices. A collaborative research project with these practitioners focused on the screening of Bulbine frutescens, Ornithogalum longibracteatum, Ruta graveolens, Tarchonanthus camphoratus and Tulbaghia violacea for antidiabetic and cytotoxic potential. In vitro glucose utilisatio...

  20. The socio-economic importance of the Apiales

    OpenAIRE

    Heywood, Vernon H.

    2015-01-01

    Within the Apiales, the Apiaceae (Umbelliferae) is by far the most important family, both economically and socially. Although it includes the carrot (Daucus carota), one of the world’s leading root crops, and other widely consumed vegetables such as parsnip (Pastinaca sativa), celery and celeriac (Apium graveolens), the family is perhaps best known for its remarkable diversity of culinary herbs, flavourings, condiments and spices, such as parsley, dill, coriander, anise, chervil, caraway, and...

  1. EST data: 731 [RED

    Lifescience Database Archive (English)

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  2. Massage with aromatherapy: effectiveness on anxiety of users with personality disorders in psychiatric hospitalization

    OpenAIRE

    Thiago da Silva Domingos; Eliana Mara Braga

    2015-01-01

    OBJECTIVE To investigate the effectiveness of aromatherapy massage using the essential oils (0.5%) of Lavandula angustifolia and Pelargonium graveolens for anxiety reduction in patients with personality disorders during psychiatric hospitalization. METHOD Uncontrolled clinical trial with 50 subjects submitted to six massages with aromatherapy, performed on alternate days, on the cervical and the posterior thoracic regions. Vital data (heart and respiratory rate) were collected before and afte...

  3. Stinkwort is rapidly expanding its range in California

    OpenAIRE

    Brownsey, Rachel; Kyser, Guy B; DiTomaso, Joseph M.

    2013-01-01

    Stinkwort (Dittrichia graveolens) is a Mediterranean native that has become a weed in areas of Europe as well as in Australia. This strongly aromatic weed was first reported in California in 1984 in Santa Clara County, and it had spread to 36 of the 58 California counties by 2012. Stinkwort is not palatable to animals, and can be poisonous to livestock and cause contact allergic dermatitis in humans. In California, this weed is found primarily along roadsides. However, the biology of t...

  4. Plant-Derived Chemicals as Tick Repellents

    OpenAIRE

    Sadek Garboui, Samira

    2008-01-01

    Ixodes ricinus is the main vector of Lyme borreliosis and Tick-borne encephalitis in Europe. Repellents provide a practical means of protection against tick bites and can therefore reduce transmission of tick-borne diseases. In laboratory tests, pieces of cloth treated with MyggA Natural® (a commercial insect repellent) or with the essential oils of Corymbia citriodora (30%), Lavandula angustifolia (1 and 30%), Pelargonium graveolens (1 and 30%), Hyptis suaveolens (10%), Salvadora persica, Pi...

  5. Plant compounds insecticide activity against Coleoptera pests of stored products Compostos de plantas com atividade inseticida a coleópteros-praga de produtos armazenados

    OpenAIRE

    Márcio Dionizio Moreira; Marcelo Coutinho Picanço; Luiz Cláudio de Almeida Barbosa; Raul Narciso Carvalho Guedes; Mateus Ribeiro de Campos; Gerson Adriano Silva; Júlio Cláudio Martins

    2007-01-01

    The objective of this work was to screen plants with insecticide activity, in order to isolate, identify and assess the bioactivity of insecticide compounds present in these plants, against Coleoptera pests of stored products: Oryzaephilus surinamensis L. (Silvanidae), Rhyzopertha dominica F. (Bostrichidae) and Sitophilus zeamais Mots. (Curculionidae). The plant species used were: basil (Ocimum selloi Benth.), rue (Ruta graveolens L.), lion's ear (Leonotis nepetifolia (L.) R.Br.), jimson weed...

  6. Response of Brazilian native trees to acute ozone dose.

    Science.gov (United States)

    Moura, Bárbara Baêsso; de Souza, Sílvia Ribeiro; Alves, Edenise Segala

    2014-03-01

    Ozone (O3) is a toxic secondary pollutant able to cause an intense oxidative stress that induces visual symptoms on sensitive plant species. Controlled fumigation experiment was conducted with the aim to verify the O3 sensibility of three tropical species: Piptadenia gonoachanta (Mart.) Macbr. (Fabaceae), Astronium graveolens Jacq. (Anacardiaceae), and Croton floribundus Spreng. (Euphorbiaceae). The microscopical features involved in the oxidative stress were recognized based on specific histochemical analysis. The three species showed visual symptoms, characterized as necrosis and stippling between the veins, mostly visible on the adaxial leaf surface. All the studied species presented hypersensitive-like response (HR-like), and peroxide hydrogen accumulation (H2O2) followed by cell death and proanthocyanidin oxidation in P. gonoachanta and A. graveolens. In P. gonoachanta, a decrease in chlorophyll autofluorescence occurred on symptomatic tissues, and in A. graveolens and C. floribundus, a polyphenol compound accumulation occurred. The responses of Brazilian native species were similar to those described for sensitive species from temperate climate, and microscopical markers may be useful for the detection of ozone symptoms in future studies in the field. PMID:24297466

  7. Phytotoxic Activities of Mediterranean Essential Oils

    Directory of Open Access Journals (Sweden)

    Luiz Fernando Rolim de Almeida

    2010-06-01

    Full Text Available Twelve essential oils from Mediterranean aromatic plants were tested for their phytotoxic activity, at different doses, against the germination and the initial radicle growth of seeds of Raphanus sativus, Lactuca sativa and Lepidium sativum. The essential oils were obtained from Hyssopus officinalis, Lavandula angustifolia, Majorana hortensis, Melissa officinalis, Ocimum basilicum, Origanum vulgare, Salvia officinalis and Thymus vulgaris (Lamiaceae, Verbena officinalis (Verbenaceae, Pimpinella anisum, Foeniculum vulgare and Carum carvi (Apiaceae. The germination and radicle growth of tested seeds were affected in different ways by the oils. Thyme, balm, vervain and caraway essential oils were more active against both germination and radicle elongation.

  8. Plantas medicinales utilizadas en la salud infantil

    OpenAIRE

    Souza, ADZ.; Ceolin, T.; Vargas, NRC.; Heck, RM.; Vasconcellos, CL.; Borges, AM.; Mendieta, MC.

    2011-01-01

    Identificar las plantas medicinales utilizadas en la salud infantil por familias de agricultores de base ecológica de la región Sur de Río Grande do Sul, Brasil. El enfoque de investigación es cualitativo, exploratorio y descriptivo, con datos recogidos de enero a mayo de 2009. Los sujetos fueron ocho familias de agricultores, residentes en los municipios de Pelotas, Morro Redondo, Canguçu y Arroio do Padre. Seis plantas fueron citadas (Chrysanthemun cinerariifolium, Foeniculum vulgare, Acca ...

  9. Control of Ralstonia Solanacearum The Causal Agent of Brown Rot in Potato Using Essential Oils

    International Nuclear Information System (INIS)

    Five essential oils, namely peppermint (Mentha piperita L.), caraway (Carium carvum L.), fennel (Foeniculum vulgare Mill.), lemongrass (Cymbopogon citratus Staph.) and thyme (Thymus vulgaris), were used separately against Ralstonia solanacearum; the causal agent of brown rot in potato. The most two effective oils (peppermint and thyme) were used in vitro and in vivo after testing their effects on potato tubers buds germination. Peppermint inhibited buds germination but thyme have no effects on buds germination. In vivo, the control of brown rot using thyme oil in glass house experiment reduced the percentage of brown rot infection to 30.6% and reduced the severity of disease from 5 to 3.

  10. Composición y capacidad antioxidante in-vitro de aceites esenciales ricos en Timol, Carvacrol, trans-Anetol o Estragol Composition and in-vitro antioxidant capacity of essential oils rich in Thymol, Carvacrol, trans-Anethole or Estragole

    OpenAIRE

    Amner Muñoz-Acevedo; Kouznetsov, Vladimir V.; Elena E. Stashenko

    2009-01-01

    Se determinó por cromatografía de gases acoplada a espectrometría de masas (GC-MS) la composición química de aceites esenciales (AE), aislados por hidrodestilación asistida por la radiación de microondas (MWHD), de las especies vegetales aromáticas Artemisia dracunculus, Foeniculum vulgare, Illicium verum, Lippia micromera, Lippia origanoides, Ocimum spp., Plectranthus amboinicus, Tagetes filifolia, Tagetes lucida y Thymus vulgaris. Los valores de capacidades antioxidantes in vitro de estos a...

  11. Effect of bio-fertilizers and gamma radiation on the essential oil of dill at the vegetative, flowering, fruiting stages and their antimicrobial activities

    International Nuclear Information System (INIS)

    This study was carried out to investigate the response of dill plants to gamma radiation and bio- fertilizers on the essential oils and their constituents during vegetative, flowering and fruiting stages. The results showed that the most effective treatment on the volatile oil content in the three stages was 2 k -rad + bio- fertilizers. The major compounds were found to be α -phellandrene, limonene, β -phellandrene and p- cymene (vegetative stage). In the flowering stage, p- cymene, carvone, dillether and dillapiole. Whereas, carvone, dillapiole and limonene were major compounds (fruiting stage). The results showed those dill volatile oils at different developing stages exhibited strong and a variable degree of antimicrobial activity. Key words: dill (Anethum graveoleus L.) essential oil, gamma radiation, biofertilizer, anti -microbial

  12. Effect of essential oils on Aspergillus spore germination, growth and mycotoxin production:a potential source of botanical food preservative

    Institute of Scientific and Technical Information of China (English)

    Negero Gemeda; Yimtubezinash Woldeamanuel; Daniel Asrat; Asfaw Debella

    2014-01-01

    Objective: To investigate effect of essential oils on Aspergillus spore germination, growth and mycotoxin production.Method: In vitro antifungal and antiaflatoxigenic activity of essential oils was carried out using poisoned food techniques, spore germination assay, agar dilution assay, and aflatoxin arresting assay on toxigenic strains of Aspergillus species.Results: Cymbopogon martinii, Foeniculum vulgare and Trachyspermum ammi (T. ammi) essential oils were tested against toxicogenic isolates of Aspergillus species. T. ammi oil showed highest antifungal activity. Absolute mycelial inhibition was recorded at 1 µl/mL by essential oils of T. ammi. The oil also showed, complete inhibition of spore germination at a concentration of 2 µl/mL. In addition, T. ammi oil showed significant antiaflatoxigenic potency by totally inhibiting aflatoxin production from Aspergillus niger and Aspergillus flavus at 0.5 and 0.75 µl/mL, respectively. Cymbopogon martinii, Foeniculum vulgare and T. ammi oils as antifungal were found superior over synthetic preservative. Moreover, a concentration of 5 336.297 µl/kg body weight was recorded for LC50 on mice indicating the low mammalian toxicity and strengthening its traditional reputations.Conclusions:In conclusion, the essential oils from T. ammi can be a potential source of safe natural food preservative for food commodities contamination by storage fungi.

  13. Atividade antimicrobiana in vitro de produtos vegetais em otite externa aguda In vitro antimicrobial activity of plants in Acute Otitis Externa

    Directory of Open Access Journals (Sweden)

    Janaina Cândida Rodrigues Nogueira

    2008-02-01

    Full Text Available Otite externa aguda é a inflamação do conduto auditivo externo, e plantas medicinais podem ser utilizadas, na cultura popular, para seu tratamento. OBJETIVO: Avaliar atividade antimicrobiana in vitro de Aleolanthus suaveolens, Caryophyllus aromaticus, Cymbopogon citratus, Matricaria chamomila, Pithecellobium avaremotemo, Plectranthus amboinicus e Ruta graveolens sobre agentes etiológicos de otite externa. CASUÍSTICA E MÉTODOS: A concentração inibitória mínima de extratos e óleos destas plantas foi obtida em amostras de otite externa. RESULTADOS: Staphylococcus aureus em 10 culturas, Pseudomonas aeruginosa em 8, Pseudomonas aeruginosa e Staphylococcus aureus, em associação, em 5 culturas e Candida albicans e Candida krusei em 4 culturas. P. aeruginosa foi resistente a todos os extratos e óleos essenciais testados; os extratos de A. suaveolens, P. avaremotemo e de R. graveolens foram inativos, o óleo essencial de C. aromaticus e M. chamomila foram ativos contra 3 cepas de S. aureus e as cepas de Candida; Sete das cepas de S. aureus foram sensíveis ao extrato de P. amboinicus, mas o óleo não mostrou atividade, 4 cepas de S.aureus e as cepas de Candida foram sensíveis ao óleo essencial de R. graveolens. CONCLUSÃO: Algumas plantas apresentaram resultados satisfatórios, dependendo do agente etiológico, porém se faz necessário estudos mais detalhados, para melhorar o aproveitamento destas plantas.Acute Otitis Externa is an inflammation of the outer auditory meatus, and according to popular saying, medicinal plant extracts can be used in its treatment. AIM: to assess the in vitro antimicrobial activity of the following plants: Aleolanthus suaveolens; Caryophyllus aromaticus; Cymbopogon citratus; Matricaria chamomila; Pithecellobium avaremotemo; Plectranthus amboinicus and Ruta graveolens on the germs that cause otitis externa. MATERIALS AND METHODS: the minimum inhibitory concentration of extracts and oils from these plants was

  14. Efeitos de extratos de plantas na biologia de Spodoptera frugiperda (J. E. Smith, 1797 (Lepidoptera: Noctuidae mantida em dieta artificial Effects of plant extracts on the biology of Spodoptera frugiperda (J. E. Smith, 1797 (Lepidoptera: Noctuidae maintained under artificial diet

    Directory of Open Access Journals (Sweden)

    Gilberto Pedreira Santiago

    2008-06-01

    Full Text Available Avaliaram-se os efeitos dos extratos aquosos a 10% de folhas e ramos de arruda (Ruta graveolens L., folhas e ramos de melão-de-são-caetano (Momordica charantia L., folhas do alecrim-pimenta (Lippia sidoides Cham. e fruto verde de mamona (Ricinus communis L., sobre a biologia da lagarta-do-cartucho do milho (Spodoptera frugiperda, mantida em dieta artificial. Os parâmetros avaliados foram duração e viabilidade das fases larval e pupal, peso de pupa, fecundidade, fertilidade e longevidade de adultos. Larvas de S. frugiperda recém-eclodidas foram colocadas em tubos de ensaio com dieta artificial, contendo os extratos de cada material testado. O extrato aquoso do fruto verde de R. communis apresentou bioatividade, nos parâmetros duração larval e pupal e peso de pupa. O extrato aquoso de R. graveolens reduziu o peso de pupa. A dieta contendo extrato de folhas e ramos de M. charantia reduziu a viabilidade larval e o peso de pupa. O extrato aquoso de folhas de L. sidoides não afetou as fases larval e pupal, reduziu a postura e a viabilidade de ovos e aumentou a longevidade de adultos de S. frugiperda. A viabilidade de pupa não foi afetada pelos extratos testados.The effects of aqueous extracts, at 10% concentration of leaves and branches of Ruta graveolens L., leaves and branches of Momordica charantia L., leaves of Lippia sidoides Cham. and green fruits of Ricinus communis L. were evaluated on the biology of fall armyworm (Spodoptera frugiperda maintained under artificial diet. The evaluated parameters were: duration and viability of the larval and pupal phases, pupa weight, fecundity, fertility and longevity of adults. Just-hatched larvae of S. frugiperda was placed in test tube with artificial diet containing extracts of each tested material. The aqueous extract of the green fruits of R. communis presented bioactivity upon duration and weight of larval and pupal phases. The aqueous extract of R. graveolens reduced weight of pupa. The diet

  15. Atividade antimicrobiana de óleos essenciais de condimentos frente a Staphylococcus spp isolados de mastite caprina Antimicrobial activities of essential oils extracted from spices against Staphylococcus spp isolated from goat mastitis

    OpenAIRE

    Marcelo Dal Pozzo; Julio Viégas; Deise Flores Santurio; Luana Rossatto; Isaura Helena Soares; Sydney Hartz Alves; Mateus Matiuzzi da Costa

    2011-01-01

    Avaliou-se a atividade antimicrobiana dos óleos essenciais (OEs) de Origanum vulgare (orégano), Thymus vulgaris (tomilho), Lippia graveolens (lípia), Zingiber officinale (gengibre), Salvia officinalis (sálvia), Rosmarinus officinalis (alecrim) e Ocimum basilicum (manjericão), bem como de frações majoritárias carvacrol, timol, cinamaldeído e cineol frente a 33 isolados de Staphylococcus spp oriundos de rebanhos leiteiros caprinos. A concentração inibitória mínima (CIM) e a concentração bacteri...

  16. ANALYSIS OF SOME ESSENTIAL ELEMENTS IN MEDICINAL PLANTS USED IN AYURVEDA

    Directory of Open Access Journals (Sweden)

    Om Prakash Rout

    2013-02-01

    Full Text Available This study presents a preliminary data of occurrence of elemental concentration in medicinal plants i.e Apium graveolens (seed, Sida cordifolia (root, Solanum surattense (whole plant, Tribulus terrestris(fruit and Withania somnifera (root used in Ayurveda, using Atomic absorption spectrometer (AAS following standard procedures. The elemental concentration i.e. Mn, Na, K, Cl, Ca, Cr, Co, Cu, Fe, Pb, Zn, Ni, Cd and Hg were found in various proportions. The data obtained from the study can be used to evaluate the potentiality of these plants in their used for Ayurvedic drugs

  17. Root development of beetroot, sweet corn and celeriac, and soil N content after incorporation of green manure

    OpenAIRE

    Christiansen, J.S.; Thorup-Kristensen, K.; Kristensen, H.L.

    2006-01-01

    Root development in beetroot (Beta vulgaris L. ssp vulgaris var. conditiva Alef.), sweet corn (Zea mays L. convar. Saccharata Koern.) and celeriac (Apium graveolens L. var. rapaceum Gaud.) was followed during two growing seasons with the aim of describing the root systems and nitrogen (N) utilisation of the three vegetables. The crops were grown after incorporation of green manure either in the preceding Autumn or Spring. Beetroot reached a final root depth of 1.55 – 1.8 m. For sweet corn, th...

  18. Revisión de la producción, composición fitoquímica y propiedades nutracéuticas del orégano mexicano Revision of the production, phytochemical composition, and nutraceutical properties of Mexican oregano

    Directory of Open Access Journals (Sweden)

    Enrique García-Pérez

    2012-04-01

    Full Text Available El orégano es una planta de distribución mundial, el cual está representado principalmente por dos especies: Origanum vulgare (Lamiaceace nativo de Europa, y Lippia graveolens (Verbenaceae, originaria de América. México ocupa el segundo lugar como productor mundial de orégano con la especie L. graveolens H. B. K. Sin embargo, la mayoría de las especies explotadas son silvestres y su cultivo es aún tradicional y limitado. En este trabajo se presenta un análisis de las estrategias de propagación, composición química y propiedades nutracéuticas del orégano. Los fitoquímicos presentes pueden clasificarse en tres categorías: compuestos volátiles, lípidos y fenólicos. Estos componentes presentan diversas propiedades nutracéuticas entre las que destacan la actividad antioxidante, hipoglucémica, hipotensiva, hipolipidémica y anticancerígena. Los avances en el estudio de la composición fitoquímica y su relación con nuevas propiedades nutracéuticas hacen del orégano un producto de alto valor comercial con amplias aplicaciones quimioterapéuticas.The oregano plant is distributed worldwide, and represented mainly by two species: Origanum vulgare (Lamiaceace native of Europa, and Lippia graveolens (Verbenaceae, native of America. Mexico is the second largest producer of oregano in the world, with the species L. graveolens H. B. K. However, most of the species used are wild, and raising them is done in a traditional and limited way. In this study we present an analysis of the dissemination strategies, chemical composition and nutraceutical properties of oregano. Phytochemicals present can be classified into three categories: volatile, lipids and phenolic compounds. These components present diverse neutraceutical properties, the most important of which are antioxidant activities, hypoglycemic, hypotensive, hypolypidemic and anti-carcinogenic. The advances in the study of the phytochemical composition and its relationship with new

  19. Avaliação in vitro da atividade antifúngica de extratos de plantas e óleo de eucalipto sobre Trichophyton mentagrophytes In vitro evaluation of the antifungal activity of plant extracts and eucalyptus oil on Trichophyton mentagrophytes

    OpenAIRE

    D.F.R. Frias; D.I. Kozusny-Andreani

    2009-01-01

    O presente estudo teve como objetivo determinar a ação antifúngica de extratos de plantas medicinais e óleo de eucalipto frente ao dermatófito Trichophyton mentagropytes, visando a utilização da fitoterapia no controle. As plantas utilizadas na obtenção dos extratos foram arruda (Ruta graveolens), citronela (Cymbopogon nardus), cravo de defunto (Tagetes minuta), eucalipto (Eucalyptus spp), graviola (Annona muricata), fruta do conde (Annona spp), manga (Mangifera indica), romã (Punica granatum...

  20. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas Evaluation of cuban hemp, nut sedge, johnson grass and herb of grace extracts in weed control

    OpenAIRE

    Liliana Osorio Salazar; Francisco Antonio Valverde; Carmen Rosa Bonilla Correa; Manuel Salvador Sánchez Orozco; Carmen Elena Mier Barona

    2009-01-01

    En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique), Cyperus rotundus L (coquito), Sorghum bicolor L (sorgo), y Ruta graveolens L (ruda) sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga) y Amaranthus dubius Mart (bledo) y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo co...

  1. Effect of plant and fungous metabolites on Meloidogyne exigua Efeito de metabólitos vegetais e fúngicos sobre Meloidogyne exigua

    Directory of Open Access Journals (Sweden)

    Daniel Rufino Amaral

    2009-01-01

    Full Text Available As nematodes cause great damage to Brazilian coffee production, effective methods to control these parasites are necessary. In a previous work Allium cepa L., Cajanus cajan (L. Mill., Crotalaria juncea L., Ficus elastica Roxb., Ruta graveolens L., Stylosanthes guianensis Aubl., Leucaena leucocephala (Lam. Dewit., Brachiaria decumbens Stapf., Catharanthus roseus G. Don, Tagetes minuta L., Ricinus communis L. and Coffea arabica L. produced active substances against Meloidogyne exigua Goeldi, a nematode widely disseminated through Brazilian coffee fields. Thus, aqueous extracts of such plants, collected in a different season from that of the previous work, as well as crude metabolites produced in liquid medium by Fusarium moniliforme Shelden and Cylindrocarpon magnusianum (Sacc. Woll., were submitted to in vitro assays with M. exigua second-stage juveniles (J2. All plants and fungi produced active substances against J2. Therefore, their metabolites were applied to six-month-old coffee plants inoculated with M. exigua. After 90 days in a greenhouse, those samples obtained from A. cepa, L. leucocephala, R. graveolens and F. moniliforme inhibited the production of galls and eggs by M. exigua, demonstrating potential to control such parasite.Os nematóides acarretam grandes perdas aos produtores brasileiros de café, sendo necessário o desenvolvimento de métodos eficientes para o seu controle. Em trabalho anterior, Allium cepa L., Cajanus cajan (L. Mill., Crotalaria juncea L., Ficus elastica Roxb., Ruta graveolens L., Stylosanthes guianensis Aubl., Leucaena leucocephala (Lam. Dewit., Brachiaria decumbens Stapf., Catharanthus roseus G. Don, Tagetes minuta L., Ricinus communis L. e Coffea arabica L. produziram substâncias ativas contra o nematóide Meloidogyne exigua Goeldi, que é amplamente disseminado pelos cafezais brasileiros. Dando continuidade a esse trabalho, extratos aquosos das plantas mencionadas, coletadas em época diferente daquela

  2. Atividade antimicrobiana in vitro de produtos vegetais em otite externa aguda In vitro antimicrobial activity of plants in Acute Otitis Externa

    OpenAIRE

    Janaina Cândida Rodrigues Nogueira; Margareth de Fátima Melo Diniz; Edeltrudes de O. Lima

    2008-01-01

    Otite externa aguda é a inflamação do conduto auditivo externo, e plantas medicinais podem ser utilizadas, na cultura popular, para seu tratamento. OBJETIVO: Avaliar atividade antimicrobiana in vitro de Aleolanthus suaveolens, Caryophyllus aromaticus, Cymbopogon citratus, Matricaria chamomila, Pithecellobium avaremotemo, Plectranthus amboinicus e Ruta graveolens sobre agentes etiológicos de otite externa. CASUÍSTICA E MÉTODOS: A concentração inibitória mínima de extratos e óleos destas planta...

  3. Sensitization Prevalence, Antibody Cross-Reactivity and Immunogenic Peptide Profile of Api g 2, the Non-Specific Lipid Transfer Protein 1 of Celery

    OpenAIRE

    Gadermaier, G.; Hauser, M.; Egger, M.; Ferrara, R; Briza, P.; Santos, K.S.; Zennaro, D.; Girbl, T.; Zuidmeer-Jongejan, L.; Mari, A.; F. Ferreira

    2011-01-01

    Background: Celery (Apium graveolens) represents a relevant allergen source that can elicit severe reactions in the adult population. To investigate the sensitization prevalence and cross-reactivity of Api g 2 from celery stalks in a Mediterranean population and in a mouse model. Methodology: 786 non-randomized subjects from Italy were screened for IgE reactivity to rApi g 2, rArt v 3 (mugwort pollen LTP) and nPru p 3 (peach LTP) using an allergen microarray. Clinical data of 32 selected pati...

  4. Atividade antimicrobiana de óleos essenciais de condimentos frente a amostras de Escherichia coli isoladas de aves e bovinos Antimicrobial activity of spice essential oils against Escherichia coli strains isolated from poultry and cattle

    OpenAIRE

    Deise Flores Santurio; Mateus Matiuzzi da Costa; Grazieli Maboni; Carlos Pasqualin Cavalheiro; Mariangela Facco de Sá; Marcelo Dal Pozzo; Sydney Hartz Alves; Leadir Lucy Martins Fries

    2011-01-01

    A discutida questão da substituição do uso de antibacterianos em rações (promotores de crescimento) requer urgentes alternativas. Face às necessidades de inibidores microbianos nesses alimentos, os óleos essenciais (OES) se constituem em alternativa, sob avaliação. Neste estudo, avaliou-se a atividade antimicrobiana dos OES de Origanum vulgare (orégano), Thymus vulgaris (tomilho), Cinnamomum zeylanicum (canela), Lippia graveolens (orégano mexicano), Zingiber officinale (gengibre), Salvia offi...

  5. Óleos essenciais para aromaterapia

    OpenAIRE

    Coelho, Meirilane Gonçalves

    2009-01-01

    Dissertação de mestrado em Biotecnologia e Bio-empreendedorismo em Plantas Aromáticas e Medicinais O potencial terapêutico de óleos essenciais de Salvia sclarea, Salvia officinalis cv. ‘purpurascens’, Rosmarinus officinalis (Lamiaceae) em doenças neurodegenerativas e de óleos essenciais de Pelargonium graveolens (Geraniaceae) como ansiolítico, muitas vezes utilizados em Aromaterapia sugerem o papel relevante da regulamentação deste sector, designadamente quanto a critérios d...

  6. Green synthesis of gold nanoparticles using plant extracts as reducing agents

    Directory of Open Access Journals (Sweden)

    Elia P

    2014-08-01

    Full Text Available Paz Elia,1 Raya Zach,1 Sharon Hazan,2 Sofiya Kolusheva,2 Ze’ev Porat,1,3 Yehuda Zeiri1,3 1Department of Biomedical Engineering, 2Ilse Katz Institute of Nanotechnology, Ben-Gurion University of the Negev, 3Division of Chemistry, Negev Nuclear Research Center Beersheba, Israel Abstract: Gold nanoparticles (GNPs were prepared using four different plant extracts as reducing and stabilizing agents. The extracts were obtained from the following plants: Salvia officinalis, Lippia citriodora, Pelargonium graveolens and Punica granatum. The size distributions of the GNPs were measured using three different methods: dynamic light scattering, nanoparticle-tracking analysis and analysis of scanning electron microscopy images. The three methods yielded similar size distributions. Biocompatibility was examined by correlation of L-cell growth in the presence of different amounts of GNPs. All GNPs showed good biocompatibility and good stability for over 3 weeks. Therefore, they can be used for imaging and drug-delivery applications in the human body. High-resolution transmission electron microscopy was used to view the shapes of the larger GNPs, while infrared spectroscopy was employed to characterize the various functional groups in the organic layer that stabilize the particles. Finally, active ingredients in the plant extract that might be involved in the formation of GNPs are proposed, based on experiments with pure antioxidants that are known to exist in that plant. Keywords: gold nanoparticles, Lippia citriodora, Salvia officinalis, Pelargonium graveolens, Punica granatum, antioxidants, size distribution, zeta potential

  7. Slope variation and population structure of tree species from different ecological groups in South Brazil.

    Science.gov (United States)

    Bianchini, Edmilson; Garcia, Cristina C; Pimenta, José A; Torezan, José M D

    2010-09-01

    Size structure and spatial arrangement of 13 abundant tree species were determined in a riparian forest fragment in Paraná State, South Brazil (23°16'S and 51°01'W). The studied species were Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. and Gallesia integrifolia (Spreng) Harms (emergent species); Alseis floribunda Schott, Ruprechtia laxiflora Meisn. and Bougainvillea spectabilis Willd. (shade-intolerant canopy species); Machaerium paraguariense Hassl, Myroxylum peruiferum L. and Chrysophyllum gonocarpum (Mart. & Eichler ex Miq.) Engl. (shade-tolerant canopy species); Sorocea bonplandii (Baill.) Bürger, Trichilia casaretti C. Dc, Trichilia catigua A. Juss. and Actinostemon concolor (Spreng.) Müll. Arg. (understory small trees species). Height and diameter structures and basal area of species were analyzed. Spatial patterns and slope correlation were analyzed by Moran's / spatial autocorrelation coefficient and partial Mantel test, respectively. The emergent and small understory species showed the highest and the lowest variations in height, diameter and basal area. Size distribution differed among emergent species and also among canopy shade-intolerant species. The spatial pattern ranged among species in all groups, except in understory small tree species. The slope was correlated with spatial pattern for A. polyneuron, A. graveolens, A. floribunda, R. laxiflora, M. peruiferum and T. casaretti. The results indicated that most species occurred in specific places, suggesting that niche differentiation can be an important factor in structuring the tree community. PMID:21562693

  8. Leaf and whole-tree water use relations of Australian rainforest species

    Science.gov (United States)

    Ishida, Yoko; Laurance, Susan; Liddell, Michael; Lloyd, Jonathan

    2015-04-01

    Climate change induces drought events and may therefore cause significant impact on tropical rainforests, where most plants are reliant on high water availability - potentially affecting the distribution, composition and abundance of plant species. Using an experimental approach, we are studying the effects of a simulated drought on lowland rainforest plants at the Daintree Rainforest Observatory (DRO), in tropical northern Australia. Before to build up the rainout infrastructure, we installed sap flow meters (HRM) on 62 rainforest trees. Eight tree species were selected with diverse ecological strategies including wood density values ranging from 0.34 to 0.88 g/cm3 and could be replicated within a 1ha plot: Alstonia scholaris (Apocynaceae), Argyrondendron peralatum (Malvaceae), Elaeocarpus angustifolius (Elaeocarpaceae), Endiandra microneura (Lauraceae), Myristica globosa (Myristicaceae), Syzygium graveolens (Myrtaceae), Normanbya normanbyi (Arecaceae), and Castanospermum australe (Fabaceae). Our preliminary results from sap flow data obtained from October 2013 to December of 2014 showed differences in the amount of water used by our trees varied in response to species, size and climate. For example Syzygium graveolens has used a maximum of 60 litres/day while Argyrondendrum peralatum used 13 litres/day. Other potential causes for differential water-use between species and the implications of our research will be discussed. We will continue to monitor sap flow during the rainfall exclusion (2014 to 2016) to determine the effects of plant physiological traits on water use strategies.

  9. Searching for native tree species and respective potential biomarkers for future assessment of pollution effects on the highly diverse Atlantic Forest in SE-Brazil.

    Science.gov (United States)

    Domingos, Marisa; Bulbovas, Patricia; Camargo, Carla Z S; Aguiar-Silva, Cristiane; Brandão, Solange E; Dafré-Martinelli, Marcelle; Dias, Ana Paula L; Engela, Marcela R G S; Gagliano, Janayne; Moura, Barbara B; Alves, Edenise S; Rinaldi, Mirian C S; Gomes, Eduardo P C; Furlan, Claudia M; Figueiredo, Ana Maria G

    2015-07-01

    This study summarizes the first effort to search for bioindicator tree species and respective potential biomarkers for future assessment of potential mixed pollution effects on the highly diverse Atlantic Forest in SE-Brazil. Leaves of the three most abundant species inventoried in a phytosociological survey (Croton floribundus, Piptadenia gonoacantha and Astronium graveolens) were collected in four forest remnants during winter and summer (2012). Their potential bioindicator attributes were highlighted using a screening of morphological, chemical and biochemical markers. The leaf surface structure and/or epicuticular wax composition pointed the accumulator properties of C. floribundus and P. gonoacantha. C. floribundus is a candidate for assessing potential accumulation of Cu, Cd, Mn, Ni, S and Zn. P. gonoacantha is a candidate to monitor polycyclic aromatic hydrocarbons. Increased levels of secondary metabolites and decreased antioxidant capacity in leaves of A. graveolens may support its value as a bioindicator for oxidative pollutants by visible dark stipplings. PMID:25818087

  10. Antileishmanial activity of medicinal plants used in endemic areas in northeastern Brazil.

    Science.gov (United States)

    De Queiroz, Aline Cavalcanti; Dias, Thays de Lima Matos Freire; Da Matta, Carolina Barbosa Brito; Cavalcante Silva, Luiz Henrique Agra; de Araújo-Júnior, João Xavier; de Araújo, Givanildo Bernardino; Moura, Flávia de Barros Prado; Alexandre-Moreira, Magna Suzana

    2014-01-01

    This study investigates the leishmanicidal activity of five species of plants used in folk medicine in endemic areas of the state of Alagoas, Brazil. Data were collected in the cities of Colonia Leopoldina, Novo Lino, and União dos Palmares, Alagoas state, from patients with cutaneous leishmaniasis (Leishmania amazonensis) who use medicinal plants to treat this disease. Plants extracts were tested at a concentration of 1-100 μg/mL in all experiments, except in an assay to evaluate activity against amastigotes, when 10 μg/mL was used. All plants extracts did not show deleterious activity to the host cell evidenced by LDH assay at 100, 10, and 1 μg/mL after 48 h of incubation. The plants extracts Hyptis pectinata (L.) Poit, Aloe vera L., Ruta graveolens L., Pfaffia glomerata (Spreng.) Pedersen, and Chenopodium ambrosioides L. exhibited direct activity against extracellular forms at 100 μg/mL; these extracts inhibited growth by 81.9%, 82.9%, 74.4%, 88.7%, and 87.4%, respectively, when compared with promastigotes. The plants extracts H. pectinata, A. vera, and R. graveolens also significantly diminished the number of amastigotes at 10 μg/mL, inhibiting growth by 85.0%, 40.4%, 94.2%, and 97.4%, respectively, when compared with control. Based on these data, we conclude that the five plants exhibited considerable leishmanicidal activity. PMID:25126099

  11. Elemental characterization of wild edible plants from countryside and urban areas.

    Science.gov (United States)

    Renna, Massimiliano; Cocozza, Claudio; Gonnella, Maria; Abdelrahman, Hamada; Santamaria, Pietro

    2015-06-15

    Thirteen elements (Na, K, Ca, Mg, Fe, Mn, Cu, Zn, Cr, Co, Cd, Ni and Pb) in 11 different wild edible plants (WEP) (Amaranthus retroflexus, Foeniculum vulgare, Cichorium intybus, Glebionis coronaria, Sonchus spp., Borago officinalis, Diplotaxis tenuifolia, Sinapis arvensis, Papaver rhoeas, Plantago lagopus and Portulaca oleracea) collected from countryside and urban areas of Bari (Italy) were determined. B.officinalis and P.rhoeas could represent good nutritional sources of Mn and Fe, respectively, as well as A.retroflexus and S.arvensis for Ca. High intake of Pb and Cd could come from P.lagopus and A.retroflexus (1.40 and 0.13 mg kg(-1) FW, respectively). WEP may give a substantial contribution to the elements intake for consumers, but in some cases they may supply high level of elements potentially toxic for human health. Anyway, both ANOVA and PCA analyses have highlighted the low influence of the harvesting site on the elements content. PMID:25660854

  12. 香精香料信息17则

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    1.不同氮肥剂量对小茴香农学和化学性质的影响 土耳其YuzuncuYil大学农学院学者M.Tuncturk在“Asian Journal of Chemistry”杂志2008,20(4),3209~3217页上用英文发表的文章报道作者以四种不同的氮肥(0、20、40和60kg/公顷)来研究对小茴香(Foeniculum vulgare Mill.)得率和质量的影响。

  13. The effect of essential oils of sweet fennel and pignut on mortality and learning in africanized honeybees (Apis mellifera L.) (Hymenoptera: Apidae)

    Energy Technology Data Exchange (ETDEWEB)

    Abramson, Charles I.; Michaluk, Lynnette M. [Oklahoma State University, Stillwater, OK (United States). Depts. of Psychology and Zoology. Lab. Comparative Psychology and Behavioral Biology]. E-mail: charles.abramson@okstate.edu; Wanderley, Paulo A.; Wanderley, Maria J.A.; Silva, Jose C.R. [Universidade Federal da Paraiba (UFPB), Bananeiras, PB (Brazil). Dept. de Agricultura

    2007-11-15

    It was recently discovered that exposure to small concentrations of the essential oils of sweet fennel (Foeniculum vulgare Mill) or pignut [Hyptis suaveolens (L.) Poit] can be used to control aphids. What is not known is whether these oils also influence honeybee behavior. Experiments using both harnessed and free-flying foragers at concentrations used to control aphids showed that bees readily associated the odors with a reward, discriminated between them, and were not repelled. Honeybees, however, would not consume the oils when mixed with sucrose to create an unconditioned stimulus. An experiment in which harnessed bees consumed various concentrations showed that concentrations greater than 50% were detrimental. The experiments reported here provide further evidence supporting the use of conditioning techniques to evaluate the use of essential oils on honey bee behavior. (author)

  14. The effect of essential oils of sweet fennel and pignut on mortality and learning in africanized honeybees (Apis mellifera L.) (Hymenoptera: Apidae)

    International Nuclear Information System (INIS)

    It was recently discovered that exposure to small concentrations of the essential oils of sweet fennel (Foeniculum vulgare Mill) or pignut [Hyptis suaveolens (L.) Poit] can be used to control aphids. What is not known is whether these oils also influence honeybee behavior. Experiments using both harnessed and free-flying foragers at concentrations used to control aphids showed that bees readily associated the odors with a reward, discriminated between them, and were not repelled. Honeybees, however, would not consume the oils when mixed with sucrose to create an unconditioned stimulus. An experiment in which harnessed bees consumed various concentrations showed that concentrations greater than 50% were detrimental. The experiments reported here provide further evidence supporting the use of conditioning techniques to evaluate the use of essential oils on honey bee behavior. (author)

  15. Simultaneous Determination of Essential Oil Components and Fatty Acids in Fennel using Gas Chromatography with a Polar Capillary Column.

    Science.gov (United States)

    Najdoska-Bogdanov, Menče; Bogdanov, Jane B; Stefova, Marina

    2015-09-01

    Cultivated and wild growing samples of fennel (Foeniculum vulgare Mill., Apiaceae) from R. Macedonia were studied for their volatiles and fatty acid composition. The main essential oil components isolated via hydrodistillation were: trans-anethole (>80%), estragole (hexane and dichloromethane (3:1, v/v) in a Soxhlet extraction followed by transesterification. The obtained extracts were then characterized and the dominant fatty acid was 18:1 (petroselinic and oleic acid) 75.0-82.8%, followed by 18:2 (linoleic acid) 10.8-16.2% and other fatty acids: palmitic (4.3-6.9%), stearic (1.2-1.7%) and myristic (0-2.9%). The results for the volatile fraction after Soxhlet extraction and transesterification did not significantly differ from results obtained after hydrodistillation, especially for the main components (trans-anethole, estragole, fenchone and limonene), implying that the developed method can be used for simultaneous determination of volatiles and fatty acids. PMID:26594773

  16. Gamma radiation (Co60) effects on active substances and microbe burden of medicinal plants

    International Nuclear Information System (INIS)

    In order to evaluate the effects of radioactivity on active vegetal substances, samples of Fennel (Foeniculum vulgare Miller., fructus), Guarana (Paulinia cupana, Kunth, semen), Gingko (gingko biloba, L., folium), and Kawa-Kawa (Piper methysticum G. Forst, rhizoma), were treated with scaling doses (0 to 25 KGy) of gamma radiation (Co60). The 'blind test' methodology was used. The active substances from each sample were analysed by qualitative and quantitative methods after radiation. There were no significant differences seen between the control sample (0 KGy) and the irradiated samples. Microbe contamination was significantly reduced, about 10000 CFU/g, with the initial 5 KGy dose. It was concluded that gamma radiation can be used as an alternative procedure to reduce microbiologic contamination in medicinal plants. Before this procedure can be extended to other medicinal plants, more specific analytical methods are recommended to verify possible structural alterations in active vegetal molecules. (author)

  17. Gamma radiation (Co{sup 60}) effects on active substances and microbe burden of medicinal plants; Avaliacao dos efeitos da radiacao gama (Co{sup 60}) sobre principios ativos e carga microbiana de plantas medicinais

    Energy Technology Data Exchange (ETDEWEB)

    Dall' Agnol, L. [Herbarium Laboratorio Botanico Ltda, Colombo, PR (Brazil). Dept. de Garantia da Qualidade

    2001-04-01

    In order to evaluate the effects of radioactivity on active vegetal substances, samples of Fennel (Foeniculum vulgare Miller., fructus), Guarana (Paulinia cupana, Kunth, semen), Gingko (gingko biloba, L., folium), and Kawa-Kawa (Piper methysticum G. Forst, rhizoma), were treated with scaling doses (0 to 25 KGy) of gamma radiation (Co{sup 60}). The 'blind test' methodology was used. The active substances from each sample were analysed by qualitative and quantitative methods after radiation. There were no significant differences seen between the control sample (0 KGy) and the irradiated samples. Microbe contamination was significantly reduced, about 10000 CFU/g, with the initial 5 KGy dose. It was concluded that gamma radiation can be used as an alternative procedure to reduce microbiologic contamination in medicinal plants. Before this procedure can be extended to other medicinal plants, more specific analytical methods are recommended to verify possible structural alterations in active vegetal molecules. (author)

  18. Fortification of yogurts with different antioxidant preservatives: A comparative study between natural and synthetic additives.

    Science.gov (United States)

    Caleja, Cristina; Barros, Lillian; Antonio, Amilcar L; Carocho, Márcio; Oliveira, M Beatriz P P; Ferreira, Isabel C F R

    2016-11-01

    Consumers demand more and more so-called "natural" products and, therefore, the aim of this work was to compare the effects of natural versus synthetic antioxidant preservatives in yogurts. Matricaria recutita L. (chamomile) and Foeniculum vulgare Mill. (fennel) decoctions were tested as natural additives, while potassium sorbate (E202) was used as a synthetic additive. The fortification of yogurts with natural and synthetic antioxidants did not cause significant changes in the yoghurt pH and nutritional value, in comparison with control samples (yogurt without any additive). However, the fortified yogurts showed higher antioxidant activity, mainly the yogurts with natural additives (and among these, the ones with chamomile decoction). Overall, it can be concluded that plant decoctions can be used to develop novel yogurts, by replacing synthetic preservatives and improving the antioxidant properties of the final product, without changing the nutritional profile. PMID:27211646

  19. Cottage cheeses functionalized with fennel and chamomile extracts: Comparative performance between free and microencapsulated forms.

    Science.gov (United States)

    Caleja, Cristina; Ribeiro, Andreia; Barros, Lillian; Barreira, João C M; Antonio, Amilcar L; Beatriz P P Oliveira, M; Barreiro, Maria Filomena; Ferreira, Isabel C F R

    2016-05-15

    Globally, there is a trend for healthy food products, preferably incorporating natural bioactive ingredients, replacing synthetic additives. From previous screening studies, extracts of Foeniculum vulgare Mill. (fennel) and Matricaria recutita L. (chamomile) maintained nutritional properties and improved the antioxidant activity of cottage cheese. Nevertheless, this effect was limited to 7 days. Accordingly, aqueous extracts of these plants were microencapsulated in alginate and incorporated into cottage cheese to achieve an extended bioactivity. Plain cottage cheese, and cheese functionalized by direct addition of free decoctions, were prepared and compared. Independently of plant species, "functionalization type" factor did not show a significant effect on the nutritional parameters, as also confirmed in the linear discriminant analysis, where these parameters were not selected as discriminating variables. Furthermore, samples functionalized with microencapsulated extracts showed higher antioxidant activity after the 7th day, thereby demonstrating that the main purpose of this experimental work was achieved. PMID:26776029

  20. Wild food plants used on the Dubrovnik coast (south-eastern Croatia

    Directory of Open Access Journals (Sweden)

    Katija Dolina

    2014-09-01

    Full Text Available Croatia’s versatile plant use traditions are still not sufficiently documented. The aim of this study was to record local traditions of wild food plant use on the Dubrovnik coast. We interviewed 40 inhabitants of 23 villages, mainly knowledgeable informants. On average 19 species were listed, which in total produced an inventory of 95 food plant species (including species whose leaves or inflorescences are used as recreational teas. The most commonly collected are: Sonchus oleraceus and S. asper, Asparagus acutifolius, Dioscorea communis, Cichorium intybus, Crepis zacintha, Allium ampeloprasum, Picris echioides and Foeniculum vulgare (all of them used as vegetables, the fruits of Rubus ulmifolius (mainly eaten raw, the fruits of roses (Rosa sempervirens and R. canina and the leaves of Salvia officinalis (both roses and salvia are used for making recreational teas. A particular feature of the local gastronomy is the collection of young Ruscus aculeatus shoots.

  1. Insecticidal effects of essential oils extracted from aromatic plants on Ceratitis capitata (Wied.) in Lebanon

    International Nuclear Information System (INIS)

    Full text: The excessive use of chemical pesticides to control agricultural pests is becoming alarming. The objective of this study is to search for biopesticides of plant origin that could be used to control one of the major pest of fruit production; the Mediterranean fruit fly (Ceratitis capitata Wied.). A colony of the Lebanese wild strain of this insect was reared under laboratory condition to provide biological material. The insecticidal activity of the essential oils extracted from aromatic plants in Lebanon was assessed. The tested plants are: Foeniculum vulgare, Thymbra spicata, Artemisia herba alba, Origanum syriacum, Ruta chalepensis, Lavandula stoechas, Salvia fruticosa, Mentha microphylla, Juniperus oxycedrus, Rosmarinus officinalis, Myrtus communis, Laurus nobilis and Ocimum gratissimum. Results show that essential oils isolated from F. vulgare, T. spicata, A. herba alba, O. syriacum and R. chalepensis have promising insecticidal potential. (author)

  2. Wild food plants used in the villages of the Lake Vrana Nature Park (northern Dalmatia, Croatia

    Directory of Open Access Journals (Sweden)

    Łukasz Łuczaj

    2013-12-01

    Full Text Available Croatia is a country of diverse plant use traditions, which are still insufficiently documented. The aim of this study was to document local traditions of using wild food plants around Lake Vrana (northern Dalmatia, Zadar region.  We interviewed 43 inhabitants of six traditional villages north of Lake Vrana. On average 12 species were listed, which in total produced an inventory of 55 food plants and 3 fungi taxa. Wild vegetables were most widely collected, particularly by older women who gathered the plants mainly when herding their flocks of sheep. Wild fruits and mushrooms were rarely collected. The former used to be an important supplementary food for children, or for everyone during times of food shortage, and the latter were relatively rare due to the dry climate and shortage of woods. The most commonly collected plants are wild vegetables: Cichorium intybus, Foeniculum vulgare, Sonchus oleraceus, Asparagus acutifolius, Papaver rhoeas, Rumex pulcher, Daucus carota, Allium ampeloprasum and Silene latifolia.

  3. Antioxidant and Antiacetylcholinesterase Activities of Some Commercial Essential Oils and Their Major Compounds

    Directory of Open Access Journals (Sweden)

    Smail Aazza

    2011-09-01

    Full Text Available The commercial essential oils of Citrus aurantium L., Cupressus sempervirens L., Eucalyptus globulus Labill., Foeniculum vulgare Mill. and Thymus vulgaris L., isolated by steam distillation by a company of Morocco were evaluated in terms of in vitro antioxidant activity through several methods. In vitro acetylcholinesterase inhibitory activity was also determined. Citrus limon (L. Burm. f. oil was also studied, but it was obtained by peel expression. The best antioxidant was T. vulgaris oil, independent of the method used, mainly due to the presence of the phenolic monoterpenes thymol and carvacrol, which when studied as single compounds also presented the best activities. Concerning the acetylcholinesterase inhibition activity, E. globulus was the most effective. Nevertheless its main components 1,8-cineole and limonene were not the most active, a feature that corresponded to d-3-carene.

  4. Inhibitory effects of various essential oils and individual components against extended-spectrum beta-lactamase (ESBL) produced by Klebsiella pneumoniae and their chemical compositions.

    Science.gov (United States)

    Orhan, Ilkay Erdogan; Ozcelik, Berrin; Kan, Yüksel; Kartal, Murat

    2011-10-01

    In the current study, in vitro inhibitory activity of several essential oils obtained from the cultivated plants, Foeniculum vulgare, Mentha piperita and M. spicata, Ocimum basilicum, Origanum majorana, O. onites, O. vulgare, Satureja cuneifolia, and a number of individual essential oil components of terpene and aromatic types were screened against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme, which makes this microorganism quite resistant against the antibiotics: trimetoprime-sulfametoksazol, sulbactam-ampicilin, clavulonate-amoxicilin, ceftriaxon, cefepime, imipenem, ceftazidime, tobramicine, gentamisine, ofloxacin, and ciprofloksasin. All of the essential oils and the components exerted a remarkable inhibition ranging between 32 and 64 μg/mL against all of these strains as strong as the references (ampicilin and oflaxocin) inhibiting at 32 μg/mL. Besides, chemical compositions of the essential oils were elucidated by gas chromatography-mass spectrometry (GC-MS). The essential oils and the pure components widely found in essential oils screened herein have shown remarkable inhibition against ESBL-producing K. pneumoniae strains, which leads to the suggestion that they may be used as food preservatives for this purpose. Practical Application:  The essential oils obtained from Foeniculum vulgare, Mentha piperita and M. spicata, O.cimum basilicum, Origanum majorana, O. onites, O. vulgare, and Satureja cuneifolia as well as common essential oil components have shown notable inhibitory effects against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme and they might be used as food preservative or ingredient. PMID:22417594

  5. Empleo de aceites esenciales como antioxidantes naturales

    Directory of Open Access Journals (Sweden)

    Zydgalo, J. A.

    1995-10-01

    Full Text Available The aims of this study were to determine and compare the antioxidant effect of essential oils from Thymus vulgaris, Laurus nobilis, Foeniculum vulgare, Eucalyptus globules, Tagetes minuta, Satureja parvifolia and Lippia polystachya in soybean oil. The concentrations of volatile oils in soybean oil were 0.1% and 0.02%. The antioxidant activity was measured by peroxide values. Thymus vulgaris and L. nobilis essential oils exhibited a significant antioxidant activity, followed by F. vulgare and E. globules in a decreasing order. Tagetes minuta, S. parvifolia and L. polystachya had not effect, and their contribution to the stability of soybean oil was negligible.

    Los objetivos de este estudio fueron determinar y comparar el efecto antioxidante de los aceites esenciales de Thymus vulgaris, Laurus nobilis, Foeniculum vulgare, Eucalyptus globulus, Tagetes minuta, Satureja parvifolia y Lippia polystachya en el aceite de soja. Las concentraciones de las esencias en el aceite de soja fueron 0.1% y 0.02%. La actividad antioxidante fue medida por los valores de peróxido. Los aceites esenciales de T. vulgaris y L nobilis exhibieron una significativa acción antioxidante seguidos, en orden decreciente, por F. vulgare y E. globulus. Las esencias de T. minuta, S. parvifolia y L polystachya no mostraron efecto antioxidante y su contribución a la estabilidad oxidativa del aceite de soja fue despreciable.

  6. Zinc and Liming Effects on the Development of Cerrado Forest Species

    Science.gov (United States)

    Casagrande, J. C.; Soares, M. R.; Moraes, M. I. M.

    2012-04-01

    The Brazilian Cerrado is considered priority area for conservation of biodiversity. The biome has covered approximately 33% of the territory of the State of São Paulo, but, currently, there are isolated fragments of Cerrado that correspond to less than 7% of its original area. One of the consequences of the natural vegetation removal and soil degradation is the loss of fertility, reduction the nutrient content. There is limited knowledge of the nutritional requirements of native forest species from Cerrado, especially about micronutrients. The aims of this work are: (i) verify the influence of four levels of Zn in soil and three levels of liming on development of six forest species native to the Cerrado biome; (ii) assess Zn deficiency symptoms in native species of Savannah. The treatments were four levels of Zn (0.0; 2.0; 4.0;-1 6.0 kg ha of Zn) and three levels of base saturation (V% = natural, V% = 50% and V% = 70%), cultivated in green house. The forest species studied have different responses to soil correction and fertilization, and were not observed responses regarding biometric parameters (growth in height and dry matter) with respect to the correction of base saturation and soil fertilization with Zn, for seedlings of Tabebuia aurea, Eugenia dysenterica and Astronium graveolens, showing that these species are highly adapted to the conditions of low fertility and showing efficient physiology for Zn absorption, since there was satisfactory growth in conditions of low base saturation (36%), very low content of Zn in soil (0.3 mg dm-3 ) and ideal supply of other nutrients. The species Andira cuyabensis and Anacardium giganteum responded well to fertilization and soil remediation. The omission of Zn resulted in visual symptoms of nutritional deficiency only for the species Tabebuia aurea, Astronium graveolens and Anacardium giganteum. The content of Zn presented significance interaction between Zn doses and V% for species Hymenaea courbaril, Tabebuia aurea and

  7. [Plasma levels of psoralens after celery ingestion].

    Science.gov (United States)

    Gral, N; Beani, J C; Bonnot, D; Mariotte, A M; Reymond, J L; Amblard, P

    1993-01-01

    Psoralens are photosensitizing substances present in many vegetables, some of which are routinely consumed. These vegetables are responsible for contact phytophotodermatitis, but it was agreed that they did not produce photodermatitis when taken orally. Ljunggren has recently questioned this concept by reporting a case of phototoxic accident which occurred after ingestion of 450 grams of celery roots (Apium graveolens). In a study in healthy volunteers we looked for psoralens in blood and analyzed the cutaneous photosensitivity by the minimal phototoxic doses (MPD) method, after ingestion of celery in large amounts (500 grams and more). Plasma concentrations of psoralens were inexistant in all subjects and at all sampling times, and no phototoxic reaction was detected by MPD. Celery roots, therefore, do not seem to be photosensitizing, even after ingestion in large amounts, but they might increase the risk of phototoxicity in PUVA-therapy. The same applies to fennel and parsnip. PMID:8161113

  8. The effect of celery and parsley juices on pharmacodynamic activity of drugs involving cytochrome P450 in their metabolism.

    Science.gov (United States)

    Jakovljevic, V; Raskovic, A; Popovic, M; Sabo, J

    2002-01-01

    Celery (Apium graveolens) and parsley (Petroselinum sativum), plants used worldwide in human nutrition, are the natural sources of methoxsalen. In this study we investigated the effect of mice pretreatment with juices of this plants on the hypnotic action of pentobarbital and analgesic action of paracetamol and aminopyrine, the drugs involving cytochrome P450 superfamily in their metabolism. In mice pretreated with celery and parsley juices a prolonged action of pentobarbital with respect to control was observed, statistical significance being attained only with parsley-pretreated animals. Both pretreatments increased and prolonged the analgesic action of aminopyrine and paracetamol, pretreatment with parsley being again more effective. Celery and parsley juices given to animals two hours before their decapitation caused a significant decrease of cytochrome P450 in the liver homogenate as compared to control. PMID:12365194

  9. Mėsos gaminių su augalų ekstraktais mikrobiologinių rodiklių kitimas laikymo metu ir juslinės savybės

    OpenAIRE

    Šarkinas, A.; Šipailienė, A.; Venskutonis, P. R.; Čypienė, V.; Mieželienė, A.; Alenčikienė, G.

    2005-01-01

    Augalų ekstraktų antimikrobinės savybės išbandytos modelinėje maltos kiaulienos ir jautienos sistemoje, laikant produktą 4–6 C temperatūroje. Įvertintas gelsvės (Levisticum officinale WDJ Koch), petražolių (Petroselinum sativum Hoffm), salierų (Apium graveolens L), rozmarino (Rozmarinus officinalis L), raudonėlio (Origanum vulgare L) 0,2; 0,4; 0,6 % ekstrakto priedo poveikis. Vertinant bendro mikroorganizmų skaičiaus, koliforminių bakterijų, stafilokokų, salmonelių skaičiaus pokyčius nustaty...

  10. Slope variation and population structure of tree species from different ecological groups in South Brazil

    Directory of Open Access Journals (Sweden)

    Edmilson Bianchini

    2010-09-01

    Full Text Available Size structure and spatial arrangement of 13 abundant tree species were determined in a riparian forest fragment inParaná State, South Brazil (23"16'S and 51"01'W. The studied species were Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. and Gallesia integrifolia (Spreng Harms (emergent species; Alseis floribunda Schott, Ruprechtia laxiflora Meisn. and Bougainvillea spectabilis Willd. (shade-intolerant canopy species; Machaerium paraguariense Hassl, Myroxylum peruiferum L. and Chrysophyllum gonocarpum (Mart. & Eichler ex Miq. Engl. (shade-tolerant canopy species; Sorocea bonplandii (Baill. Bürger, Trichilia casaretti C. Dc, Trichilia catigua A. Juss. and Actinostemon concolor (Spreng. Müll. Arg. (understory small trees species. Height and diameter structures and basal area of species were analyzed. Spatial patterns and slope correlation were analyzed by Moran's / spatial autocorrelation coefficient and partial Mantel test, respectively. The emergent and small understory species showed the highest and the lowest variations in height, diameter and basal area. Size distribution differed among emergent species and also among canopy shade-intolerant species. The spatial pattern ranged among species in all groups, except in understory small tree species. The slope was correlated with spatial pattern for A. polyneuron, A. graveolens, A. floribunda, R. laxiflora, M. peruiferum and T. casaretti. The results indicated that most species occurredin specific places, suggesting that niche differentiation can be an important factor in structuring the tree community.Visando contribuir para o conhecimento das estratégias devida de espécies em fragmentos florestais, foram determinadas as estruturas de tamanho e espacial de 13 espécies arbóreas do remanescente de floresta ciliar no Estado do Paraná, no Sul do Brasil (23"16'S e 51"01'W. Foram analisadas as espécies: Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. e Gallesia

  11. Antiinflammatory Effect of Several Umbelliferae Species

    Directory of Open Access Journals (Sweden)

    SUWIJIYO PRAMONO

    2005-03-01

    Full Text Available A screening for antiinflammatory effects was performed on several Indonesian Umbelliferae plants based on the contents of saponins and flavonoids. They were compared with Bupleurum falcatum L. as an introduced antiinflammatory plant. Roots and grains of each plant were collected, dried, and extracted with ethanol. The ethanolic extracts were then analyzed for their saponin and flavonoid contents by gravimetric and UV-vis spectrophotometric method. Antiinflammatory activity test was conducted on carragenin induced rat paw oedema. The results showed that the highest contents of saponin and flavonoid were found in the grains of Apium graveolens L. and showed antiinflammatory effect that was equivalent to that of the root of B. falcatum.

  12. Desarrollo de apio mínimamente procesado fortificado con vitamina e, utilizando la ingeniería de matrices. / Development of minimally processed celery fortified with vitamin E, by matrix engineering.

    OpenAIRE

    MARTELO CASTAÑO, YISELL JOHAN; Cortés Rodríguez, Misael; Suárez Mahecha, Héctor

    2011-01-01

    El objetivo de este trabajo fue desarrollar un producto mínimamente procesado fortificado con vitamina E, a partir de apio (Apium graveolens L. var.dulce), utilizando la ingeniería de matrices como metodología de obtención de alimentos funcionales. Trozos de apio impregnados al vacío con dlαtocoferol acetato emulsificado en una solución isotónica al vegetal de NaCl, 1,2%, fueron evaluados en función del tiempo de almacenamiento y el envasado (con y sin vacío), en términos de la cuantificación...

  13. AcEST: DK951819 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST38A01NGRL0012_G16 539 Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0012_G16. 5' end seq ... aucus carota PE=... 39 0.016 sp|Q93VR4|ML423_ARATH MLP -like protein 423 OS=Arabidopsis thalia... 38 0.028 ... protein ABR18 OS=Pisum sativu... 32 1.5 sp|Q9SSK7|MLP 34_ARATH MLP -like protein 34 OS=Arabidopsis thalian ... ion protein tnsB O... 31 4.4 sp|Q9C7I7|ML165_ARATH MLP -like protein 165 OS=Arabidopsis thalia... 31 4.4 s ... n Api g 2 OS=Apium graveolens ... 31 4.4 sp|Q9SSK9|MLP 28_ARATH MLP -like protein 28 OS=Arabidopsis thalian ...

  14. Use of Medical Plants in Schools Communities from Sinop, Mato Grosso.

    Directory of Open Access Journals (Sweden)

    A. C. M. Urtado

    2013-03-01

    Full Text Available Abstract: This study was conducted in Sinop, Mato Grosso, on two school communities. It was applied semi-structured questionnaires with questions focused on socioeconomic and the use of medicinal plants. It has as finality proved the effective use of medicinal plants on the everyday and a levy of the most used plant. The general profile of the respondents has shown that the women detain the major part of the knowledge, and that pass this uses to the future generations and friends, and find these plants on specialty stores, backyards, supermarket, root stores, bush and fairs. The plants that were found more frequently was (Ruta graveolens L., Babosa (Aloe vera L., Erva-Cidreira (Lippia alba Mill., Erva-Santa-Maria (Chenopodium ambrosioides L., Boldo (Plectranthus amboinicus Spreng., Hortel(Menta x vilosa Huds. e Terramicina (Alternanthera dentata Moench..Keywords: medical plants, Sinop, school.

  15. Anti-Trypanosoma cruzi activity of 10 medicinal plants used in northeast Mexico.

    Science.gov (United States)

    Molina-Garza, Zinnia Judith; Bazaldúa-Rodríguez, Aldo Fabio; Quintanilla-Licea, Ramiro; Galaviz-Silva, Lucio

    2014-08-01

    The aim of this study was to screen the trypanocidal activity of plants used in traditional Mexican medicine for the treatment of various diseases related to parasitic infections. Cultured Trypanosoma cruzi epimastigotes were incubated for 96h with different concentrations of methanolic extracts obtained from Artemisia mexicana, Castela texana, Cymbopogon citratus, Eryngium heterophyllum, Haematoxylum brasiletto, Lippia graveolens, Marrubium vulgare, Persea americana, Ruta chalepensis and Schinus molle. The inhibitory concentration (IC50) was determined for each extract via a colorimetric method. Among the evaluated species, the methanolic extracts of E. heterophyllum, H. brasiletto, M. vulgare and S. molle exhibited the highest trypanocidal activity, showing percentages of growth inhibition between 88 and 100% at a concentration of 150μg/ml. These medicinal plants may represent a valuable source of new bioactive compounds for the therapeutic treatment of trypanosomiasis. PMID:24742906

  16. Morpho-histological studies in the aromatic species of Chenopodium from Argentina.

    Science.gov (United States)

    Bonzani, N E; Barboza, G E; Bugatti, M A; Ariza Espinar, L

    2003-04-01

    A morpho-histological study of the vegetative organs (stem and leaf) of the aromatic species of Chenopodium L. from Argentina [C. ambrosioides L., C. burkartii (Aellen) Vorosch., C. carinatum R. Br., C. chilense Schrad., C. graveolens Willd. var. bangii (Murr) Aellen, C. haumanii Ulbr., C. multifidum L., C. oblanceolatum (Speg.) Giusti, C. pumilio R. Br., C. retusum (Moq.) Moq., and C. venturii (Aellen) Cabrera] was carried out. Classifications for the glandular and non-glandular trichomes are established and their presence among species is presented. A variant in both the dorsiventral and isobilateral mesophyll is reported; some data are valuable for systematic purposes and for the identification of dried and smashed material used as vegetal drug. PMID:12727484

  17. Plants used as abortifacients and emmenagogues by Spanish New Mexicans.

    Science.gov (United States)

    Conway, G A; Slocumb, J C

    1979-10-01

    Individuals of Spanish and Mexican descent in New Mexico have used a number of plants as emmenagogues and abortifacients. Of the plants used, cotton root bark (Gossypium sp.), inmortal ((Asclepias capricornu Woodson), poleo chino (Hedeoma oblongifolia (Gray) Heller), rue Ruta graveolens L.), wormseed (Chenopodium ambrosioides L.), and three species of Artemesia seem to be used most widely. Of these, the cotton root bark, when used as an abortifacient, seems to exhibit the lowest toxicity. Rue is notable because of its use independently within different cultures, but may exhibit toxic side effects when used as an abortifacient. Seven other plants are outlined on the basis of anecdotal and folkloric reports. Investigations are underway to look at use effectiveness, side effects, impact on fertility, and acceptance among cultures of the Southwestern United States. PMID:232204

  18. Bioactivity against Bursaphelenchus xylophilus: Nematotoxics from essential oils, essential oils fractions and decoction waters.

    Science.gov (United States)

    Faria, Jorge M S; Barbosa, Pedro; Bennett, Richard N; Mota, Manuel; Figueiredo, A Cristina

    2013-10-01

    The Portuguese pine forest has become dangerously threatened by pine wilt disease (PWD), caused by the pinewood nematode (PWN), Bursaphelenchus xylophilus. Synthetic chemicals are the most common pesticides used against phytoparasitic nematodes but its use has negative ecological impacts. Phytochemicals may prove to be environmentally friendly alternatives. Essential oils (EOs) and decoction waters, isolated from 84 plant samples, were tested against B. xylophilus, in direct contact assays. Some successful EOs were fractionated and the fractions containing hydrocarbons or oxygen-containing molecules tested separately. Twenty EOs showed corrected mortalities ⩾96% at 2 μL/mL. These were further tested at lower concentrations. Ruta graveolens, Satureja montana and Thymbra capitata EOs showed lethal concentrations (LC100)capitata EOs are potential environmentally friendly alternatives for B. xylophilus control given their high nematotoxic properties. Nematotoxic activity of an EO should be taken in its entirety, as its different components may contribute, in distinct ways, to the overall EO activity. PMID:23829930

  19. From traditional European medicine to discovery of new drug candidates for the treatment of dementia and Alzheimer's disease: acetylcholinesterase inhibitors.

    Science.gov (United States)

    Russo, P; Frustaci, A; Del Bufalo, A; Fini, M; Cesario, A

    2013-01-01

    The leading Alzheimer's disease (AD) therapeutics to date involves inhibitors of acetylcholinesterase (AChE), which should, in principle, elevate cholinergic signaling and limit inflammation. In spite of the effectiveness in 20%-30% of AD patients, more attention has been paid to find new anti-AChE agents from medicinal plants. Galanthamine, contained in the bulbs and flowers of Galanthus and related genera like Narcissus, represents a good example. The aim of this study is to review the role of possible AChE inhibitors (AChEI) present in plants traditionally used in European medicine for improving memory. Starting from Galanthamine, properties of Melissa species, Salvia officinalis, Arnica chamissonis and Ruta graveolens are discussed to point to the role of these plants as potential sources for the development of therapeutic agents for AD. PMID:23210783

  20. Massage with aromatherapy: effectiveness on anxiety of users with personality disorders in psychiatric hospitalization

    Directory of Open Access Journals (Sweden)

    Thiago da Silva Domingos

    2015-06-01

    Full Text Available OBJECTIVE To investigate the effectiveness of aromatherapy massage using the essential oils (0.5% of Lavandula angustifolia and Pelargonium graveolens for anxiety reduction in patients with personality disorders during psychiatric hospitalization. METHOD Uncontrolled clinical trial with 50 subjects submitted to six massages with aromatherapy, performed on alternate days, on the cervical and the posterior thoracic regions. Vital data (heart and respiratory rate were collected before and after each session and an anxiety scale (Trait Anxiety Inventory-State was applied at the beginning and end of the intervention. The results were statistically analyzed with the chi square test and paired t test. RESULTS There was a statistically significant decrease (p < 0.001 of the heart and respiratory mean rates after each intervention session, as well as in the inventory score. CONCLUSION Aromatherapy has demonstrated effectiveness in anxiety relief, considering the decrease of heart and respiratory rates in patients diagnosed with personality disorders during psychiatric hospitalization.

  1. Ensaios preliminares em laboratório para verificar a ação moluscicida de algumas espécies da flora brasileira Preliminary laboratory tests of the molluscicide activity of some species of Brazilian flora

    Directory of Open Access Journals (Sweden)

    Nelymar Martineli Mendes

    1984-10-01

    Full Text Available Estudou-se em laboratório a atividade moluscicida de 68 extratos de 23 plantas brasileiras. As soluções em água desclorada dos extratos hexânicos e etanólico, nas concentrações de 1, 10 e 100 ppm, foram testadas sobre caramujos adultos e desovas de Biomphalaria glabrata, criados em laboratório. As plantas que demonstraram ação moluscicida na concentração de 100 ppm foram: Arthemisia verlotorum Lamotte, Caesalpinia peltophoroides Benth, Cassia rugosa G.Don., Eclipta alba Hassk, Euphorbia pulcherrima Willd, Euphorbia splendens Bojer, Joannesia princeps Vell, Leonorus sibiricus L.,Macrosiphonia guaranitica Muell,Nerium oleander L., Palicourea nicotianaefolia Cham, e Schlech., Panicum maximum M., Rumex crispus L., Ruta graveolens L., e Stryphnodendron barbatiman M.The molluscicide activity of sixty-eight extracts from twenty-three Brazilian plants was studied in the laboratory. The solutions, in dechlorinated water, of hexanic and ethylic extracts at 1, 10 and 100 ppm concentrations, were tested on adult snails and egg masses of Biomphalaria glabrata, reared in the laboratory. The plants with molluscicide activity on adult snails and/or egg masses at 100 ppm concentration were: Arthemisia verlotorum Lamotte, Caesalpinia peltophoroides Benth, Cassia rugosa G. Don, Eclipta alba Hassk, Euphorbia pulcherrima Willd, Euphorbia splendens Bojer, Joannesia princeps Vell, Leonorus sibiricus L., Macrosiphonia guaranitica Muell, Nerium oleander L., Palicourea nicotianaefolia Cham. and Schlech., Panicum maximum M., Rumex crispus L., Ruta graveolens L. and Stryphnodendron barbatiman M.

  2. Avaliação in vitro da atividade antifúngica de extratos de plantas e óleo de eucalipto sobre Trichophyton mentagrophytes In vitro evaluation of the antifungal activity of plant extracts and eucalyptus oil on Trichophyton mentagrophytes

    Directory of Open Access Journals (Sweden)

    D.F.R. Frias

    2009-01-01

    Full Text Available O presente estudo teve como objetivo determinar a ação antifúngica de extratos de plantas medicinais e óleo de eucalipto frente ao dermatófito Trichophyton mentagropytes, visando a utilização da fitoterapia no controle. As plantas utilizadas na obtenção dos extratos foram arruda (Ruta graveolens, citronela (Cymbopogon nardus, cravo de defunto (Tagetes minuta, eucalipto (Eucalyptus spp, graviola (Annona muricata, fruta do conde (Annona spp, manga (Mangifera indica, romã (Punica granatum, flores e folhas de primavera (Bougainvillea spectabilis. Verificou-se que uso de 0,5% óleo de eucalipto no combate ao T. mentagropytes foi eficaz, já os extratos de citronela (4% eucalipto (5% e romã (8% atuaram como fungistáticos e os restantes não devem ser usados contra este dermatófito porque não causaram nenhum efeito.The aim of this study was to assess the antifungal action of medicinal plant extracts and eucalyptus oil against the dermatophyte Trichophyton mentagrophytes in order to employ phytotherapy for its control. The plants used for extract production were common rue (Ruta graveolens, citronella (Cymbopogon nardus, wild marigold (Tagetes minuta, eucalyptus (Eucalyptus spp, sweetsop (Annona muricata, custard apple (Annona spp, mango (Mangifera indica, pomegranate (Punica granatum, besides flowers and leaves of bougainvillea (Bougainvillea spectabilis. The use of 0.5% eucalyptus oil was effective in controlling Trichophyton mentagrophytes; however, citronella (4%, eucalyptus (5% and pomegranate (8% extracts acted as fungistatic, and the remaining extracts should not be used against this dermatophyte since they did not have any effect.

  3. Methylhexanamine is not detectable in Pelargonium or Geranium species and their essential oils: A multi-centre investigation.

    Science.gov (United States)

    ElSohly, Mahmoud A; Gul, Waseem; Tolbert, Candice; ElSohly, Kareem M; Murphy, Timothy P; Avula, Bharathi; Chittiboyina, Amar G; Wang, Mei; Khan, Ikhlas A; Yang, Min; Guo, Dean; Zhang, Wei-Dong; Su, Juan

    2015-07-01

    In an earlier study, we developed two sensitive and reliable procedures for gas chromatography-mass spectrometry (GC-MS) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis of methylhexaneamine (MHA) in P. graveolens plant materials and volatile oils. None of the analyzed plant materials or oils showed any detectable levels of MHA which was further substantiated by high resolution liquid chromatography-quantum time of flight-mass spectrometry (LC-QTOF-MS) analysis with a limit of detection of 10 ppb. However, other laboratories (two studies) reported the presence of MHA in some samples of P. graveolens and pelargonium oil acquired by the investigators from China. Because of the controversy of whether Pelargonium species or pelargonium oil contains MHA, it was recommended that splits of multiple samples be analyzed by different laboratories. In this investigation, multiple plant materials and oil samples were collected from around the world. These samples were submitted to four different sites for analysis. All sites adopted a similar extraction method. All the analysis sites used LC-MS/MS or LC-QTOF-MS and detection limit was set close to the 10 ng/mL as previously reported. A total of 18 plant samples belonging to 6 different Pelargonium species and 9 oils from different locations around the world were split among 4 different analytical laboratories for analysis (each lab received the same samples). None of the laboratories detected MHA in any of the samples at or around the 10 ppb detection level of the procedure used. PMID:25346500

  4. Impact of aqueous extracts from six flavoring materials on rats' gut Lactobacilli%六种香辛料水提取物对大鼠肠道乳酸菌影响的研究

    Institute of Scientific and Technical Information of China (English)

    张志超; 黄丽珠; 王聪; 张宁; 刘柳; 彭喜春

    2013-01-01

    Objective: Six flavoring materials of Cinnamomum cassia, Zingiber officinale Rose, Syzygium aromatieum, Foeniculum vulgare Mill, Piper nigrum L. and Zanthoxylum bungeanum were examined whether to have positive effects on dysfunction of digestive system such as gastrointestinal dysfunction and diarrhea. Methods: The amount, diversity and composition of Lactobacilli in rat colon and rectum were analyzed with Ribotype abundance ( S) , Shannon diversity index ( H) , Evenness index and Jacaard similarity index by using the technique of terminal- restriction fragment length polymorphism after the aqueous extracts of six materials were orally administrated into rats for one month. Results : The results showed that the aqueous extracts of six materials had different effects on Lactobaciili in rat colon,but presented to inhibit them in rectum. However, all of these extracts enhanced the diversity and distribution evenness of Lactobacilli in colon except for that of Syzygium aromatieum and Foeniculum vulg are Mill. Foeniculum vulgare Mill reduced the diversity and distribution evenness of Lactobacilli in rectum. Conclusion : These extracts exerted a heavy impact on the composition of Lactobacilli in both colon and rectum. The functional mechanism of these materials on the dysfunction of digestive system might be relative with the shared and different effects on gut Lactobacilli.%目的:观察肉桂、干姜、丁香、小茴香、胡椒和花椒等六种香辛料水提取物对消化系统功能紊乱的积极作用.方法:本研究采用末端限制性片段长度多态性分析技术,再用总峰面积、Ribotype丰富度(S)、Shannon多样性指数(H)、均匀度指数(E)以及Jacaard相似性指数等指标,针对六种常见香辛料的水提取物对大鼠结肠和直肠中乳酸菌群的数量、多样性及结构进行了分析. 结果:六种香辛料的水提取物对结肠中乳酸菌群生长的影响存在差异,但均抑制了直肠中乳酸菌的生长;然

  5. 18种食用香料中的硒含量特征%The Selenium Content in 18 Kinds of Edible Spices

    Institute of Scientific and Technical Information of China (English)

    苟体忠; 张文华; 唐文华; 蒋天智; 孙大方; 彭章美; 毛仕焦; 梁文涛

    2014-01-01

    研究食用香料中硒含量,以便为富硒食用香料的选择提供重要参考。采用氢化物发生-原子荧光光谱法测定18种食用香料中的硒含量。结果表明:18种食用香料中的硒含量变化较大,其含量变化在0.002~0.849 mg/kg之间。千里香、小茴香、香果、孜然、鱼香菜和鱼蓼中的硒含量较高,其含量分别为0.849,0.719,0.669,0.560,0.435,0.149 mg/kg。分析认为千里香、小茴香、香果、孜然、鱼香菜和鱼蓼已达到富硒调味品标准。%To study the selenium content in edible spices,which may provide important reference for picking selenium-enriched edible spices.The content of selenium in 18 kinds of edible spices is analyzed by hydride generation-atomic fluorescence spectrometry.The results show that there are major changes in the selenium content in 18 kinds of edible spices,ranging from 0.002 mg/kg to 0.849 mg/kg.Murraya paniculata (L.)Jack.,Foeniculum vulgare Mill.,Ligusticum chuanxiong Hort.,Cuminum cyminum L.,Mentha spicata Linn.and Polygonum lapathifolium L.have higher selenium content,which is 0.849,0.719,0.669,0.560,0.435,0.149 mg/kg.Analysts believe that Murraya paniculata(L.)Jack.,Foeniculum vulgare Mill.,Ligusticum chuanxiong Hort.,Cuminum cyminum L.,Mentha spicata Linn.and Polygonum lapathifolium L.have reached the standard of selenium-enriched condiment.

  6. Estudo da concordância das citações de uso e importância das espécies e famílias utilizadas como medicinais pela comunidade do bairro Ponta Grossa, Porto Alegre, RS, Brasil

    Directory of Open Access Journals (Sweden)

    Giovana Secretti Vendruscolo

    2006-06-01

    Full Text Available Ferramentas para quantificar dados etnobotânicos estão sendo usadas como complementares aos levantamentos sobre a utilização de plantas por populações. Neste trabalho são utilizadas técnicas para avaliar a concordância das citações de uso e a importância das espécies e famílias para as 51 pessoas entrevistadas no bairro Ponta Grossa, Porto Alegre, Rio Grande do Sul. Para tal, foram utilizados os cálculos de Valor de Uso (UV e a porcentagem corrigida de Concordância quanto aos Usos Principais (CUPc para as 142 espécies mencionadas no levantamento. As espécies Aloe arborescens Mill., Citrus × aurantium L., Achyrocline satureioides (Lam. DC., Foeniculum vulgare Mill, Eugenia uniflora L., Cunila microcephala Benth., Citrus limon (L. Osveck, Plectranthus barbatus Andrews, Cymbopogon citratus (DC. Stapf, Psidium guajava L., Artemisia absinthium L., Ocimum basilicum L., Plantago tomentosa Lam., Rosmarinus officinalis L., Persea americana Mill., Aloysia citrodora Palau, Sambucus australis Cham. & Schltdl., Cuphea carthagenensis (Jacq. J.F. Macbr., Petroselinum crispum (Mill. Nyman ex A.W. Hill, Ocimum selloi Benth. e Tanacetum vulgare L., nesta ordem de Valor de Uso, foram consideradas como as mais importantes para a população estudada. As famílias mais importantes foram Asphodelaceae, Caprifoliaceae, Rutaceae e Lythraceae. Para o cálculo da porcentagem a corrigida de Concordância quanto aos Usos Principais (CUPc foram consideradas como espécies principais as que apresentaram valores acima de 24%: Eugenia uniflora, Achyrocline satureioides, Psidium guajava, Cunila microcephala, Plectranthus barbatus, Citrus × aurantium, Citrus limon, Cymbopogon citratus, Punica granatum L., Sechium edule (Jacq. Sw., Sphagneticola trilobata (L. Pruski, Aloysia citrodora, Foeniculum vulgare, Plectranthus neochilus Schltr., Artemisia absinthium, Lippia alba (Mill. N.E. Br., Mikania laevigata Sch. Bip ex Baker, Aloe arborescens e Petroselinum

  7. Anti-Aging Potential of Phytoextract Loaded-Pharmaceutical Creams for Human Skin Cell Longetivity.

    Science.gov (United States)

    Jadoon, Saima; Karim, Sabiha; Bin Asad, Muhammad Hassham Hassan; Akram, Muhammad Rouf; Khan, Abida Kalsoom; Malik, Arif; Chen, Chunye; Murtaza, Ghulam

    2015-01-01

    The exposure to ultraviolet radiations (UVR) is the key source of skin sunburn; it may produce harmful entities, reactive oxygen species (ROS), leading to aging. The skin can be treated and protected from the injurious effects of ROS by using various pharmaceutical formulations, such as cream. Cream can be loaded with antioxidants to quench ROS leading to photo-protective effects. Moreover, modern medicines depend on ethnobotanicals for protection or treatment of human diseases. This review article summarizes various in vivo antioxidant studies on herbal creams loaded with phyto-extracts. These formulations may serve as cosmeceuticals to protect skin against injurious effects of UVR. The botanicals studied for dermatologic use in cream form include Acacia nilotica, Benincasa hispida, Calendula officinalis, Camellia sinensis, Camellia sinensis, Nelumbo nucifera, Capparis decidua, Castanea sativa, Coffea arabica, Crocus sativus, Emblica officinalis Gaertn, Foeniculum vulgare, Hippophae rhamnoides, Lithospermum erythrorhizon, Malus domestica, Matricaria chamomilla L., Moringa oleifera, Morus alba, Ocimum basilicum, Oryza sativa, Polygonum minus, Punica granatum, Silybum marianum, Tagetes erecta Linn., Terminalia chebula, Trigonella foenum-graecum, and Vitis vinifera. The observed anti-aging effects of cream formulations could be an outcome of a coordinating action of multiple constituents. Of numerous botanicals, the phenolic acids and flavonoids appear effective against UVR-induced damage; however the evidence-based studies for their anti-aging effects are still needed. PMID:26448818

  8. Report of some Fungi From of the Condiments of Daily Use in Storage

    Directory of Open Access Journals (Sweden)

    C. B. Lal

    1975-10-01

    Full Text Available The isolation of fungi associated with the condiments of daily storage has been done. Fourteen species of fungi viz; Circinella mucoroides, C. muscae, Aspergillus candidus, A. nidulans, A. niger, A. niveus, Aspergillus species, Penicillium Frequentans, Alternaria humicola, Curvalaria tetramera, Monilia geophila, Fusarium species and Rhizoctonia species have been isolated from five important condiments Coriandrum sativum L.(Dhania, Cuminum eyminum L(Jeera, Curcuma longa L(Haldi, Foeniculum vulgare Miller (Saunf and Trigonella foenum graecum L.(Menthi in storage have been isolated Penicillium frequentans and Curvularia tetramera could be isolated from only one source Coriandrum sativum and Trigonella foenumgraecum respectively. Circinella mucoroides and C. muscae are the first record from these sources in our country. Monilia geophila and Rhizoctonia species too have been reported for the first time from curcuma longa and Trigonella foenumgraecum respectively. It may be added that the fungi found in association with the condiments may be pathogenic to the plants but if the condiments are thoroughly dried, exposed to bright sunlight and and cleaned before utilization, they can be rendered safe for human consumption.

  9. Effects of Herbal Essential Oil Mixture as a Dietary Supplement on Egg Production in Quail

    Directory of Open Access Journals (Sweden)

    Metin Çabuk

    2014-01-01

    Full Text Available One hundred and eighty 7-week-old laying quail were fed various diets over a 12-week period. The diets included a control diet (without essential oil mixture (EOM or antibiotics (ANTs, a basal diet including EOM (24 mg/kg feed, and a basal diet including an ANT (avilamycin, 10 mg/kg feed. Each treatment comprised 4 replications with 4 cages (15 quail per cage, amounting to 60 quail per treatment group. Diets (in mash form and water were provided for ad libitum consumption. EOM consisted of 6 different essential oils derived from the following herbs: oregano (Origanum sp., laurel leaf (Laurus nobilis L., sage leaf (Salvia triloba L., myrtle leaf (Myrtus communis, fennel seeds (Foeniculum vulgare, and citrus peel (Citrus sp.. In comparison with the control diet, adding supplements such as EOM and ANTs to the basal diet increased egg production in quail (P<0.001. However, egg production was similar between EOM and ANT treatment groups. Moreover, there were no differences between the treatment groups with regard to egg weight. Feed intake was not affected by EOM or ANT supplementation, whereas feed conversion ratio was significantly improved by EOM and ANT supplementation. Thus, we concluded that EOM has beneficial effects as a dietary supplement on egg production and feed conversion ratio.

  10. External Nursing Applications in the Supportive Management of Prolonged Postoperative Ileus: Description of Interventions and Case Report.

    Science.gov (United States)

    Deckers, Bernhard; von Schoen-Angerer, Tido; Voggenreiter, Bernd; Vagedes, Jan

    2016-01-01

    Prolonged postoperative ileus is a common but clinically challenging problem that leads to patient discomfort and prolonged hospitalization; the condition is managed through a multimodular program of supportive measures. In anthroposophic nursing, the management of prolonged postoperative ileus involves additional tools, including external abdominal compresses and massages with plant or silver-containing oils and ointments. We describe 3 typical techniques: Oxalis tincture compresses, Thuja/Argentum ointment compresses, and massage with "Wala Melissenöl" (containing Melissa officinalis, Carvum cari, Foeniculum amari, and Origanum majorana). A 61-year-old man with chronic pain from adhesions after multiple abdominal surgical procedures developed a prolonged postoperative ileus after an elective ileostomy reversal. Following slow recovery during the first postoperative days, he began vomiting. A nasogastric tube was inserted, and daily Oxalis tincture compresses and massage with "Wala Melissenöl" and Thuja/Argentum ointment compresses were applied on the abdomen. The patient's symptoms gradually improved over the next 10 days. No prokinetic medications were needed to manage this episode. External abdominal nursing applications with plant substances and silver can be an additional tool in the management of prolonged postoperative ileus. PMID:27309410

  11. Empirical prediction and validation of antibacterial inhibitory effects of various plant essential oils on common pathogenic bacteria.

    Science.gov (United States)

    Akdemir Evrendilek, Gulsun

    2015-06-01

    In this study, fractional compound composition, antioxidant capacity, and phenolic substance content of 14 plant essential oils-anise (Pimpinella anisum), bay leaves (Laurus nobilis), cinnamon bark (Cinnamomum verum), clove (Eugenia caryophyllata), fennel (Foeniculum vulgare), hop (Humulus lupulus), Istanbul oregano (Origanum vulgare subsp. hirtum), Izmir oregano (Origanum onites), mint (Mentha piperita), myrtus (Myrtus communis), orange peel (Citrus sinensis), sage (Salvia officinalis), thyme (Thymbra spicata), and Turkish oregano (Origanum minutiflorum)--were related to inhibition of 10 bacteria through multiple linear or non-linear (M(N)LR) models-four Gram-positive bacteria of Listeria innocua, coagulase-negative staphylococci, Staphylococcus aureus, and Bacillus subtilis, and six Gram-negative bacteria of Yersinia enterocolitica, Salmonella Enteritidis, Salmonella Typhimurium, Proteus mirabilis, Escherichia coli O157:H7, and Klebsiella oxytoca. A total of 65 compounds with different antioxidant capacity, phenolic substance content and antibacterial properties were detected with 14 plant essential oils. The best-fit M(N)LR models indicated that relative to anise essential oil, the essential oils of oreganos, cinnamon, and thyme had consistently high inhibitory effects, while orange peel essential oil had consistently a low inhibitory effect. Regression analysis indicated that beta-bisabolene (Turkish and Istanbul oreganos), and terpinolene (thyme) were found to be the most inhibitory compounds regardless of the bacteria type tested. PMID:25764982

  12. Can estragole in fennel seed decoctions really be considered a danger for human health? A fennel safety update.

    Science.gov (United States)

    Gori, L; Gallo, E; Mascherini, V; Mugelli, A; Vannacci, A; Firenzuoli, F

    2012-01-01

    Fennel (Foeniculum vulgare Mill.) mature fruit (commonly known as seeds) and essential oil of fennel are widely used as flavoring agents in food products such as liqueurs, bread, cheese, and an ingredient of cosmetics and pharmaceutical products. Moreover fennel infusions are the classical decoction for nursing babies to prevent flatulence and colic spasm. Traditionally in Europe and Mediterranean areas fennel is used as antispasmodic, diuretic, anti-inflammatory, analgesic, secretomotor, secretolytic, galactagogue, eye lotion, and antioxidant remedy and integrator. Topically, fennel powder is used as a poultice for snake bites. In Asian cultures fennel was ingested to speed the elimination of poisons. As one of the ancient Saxon people's nine sacred herbs, fennel was credited with the power to cure. Fennel was also valued as a magic herb: in the Middle Ages it was draped over doorways on Midsummer's Eve to protect the household from evil spirits. Recently because of estragole carcinogenicity, fennel has been charged to be dangerous for humans especially if used as decoction for babies. But this allegation do not consider the remedy is prepared as a matrix of substances, and recent researches confirm that pure estragole is inactivated by many substance contained in the decoction. PMID:22899959

  13. Can Estragole in Fennel Seed Decoctions Really Be Considered a Danger for Human Health? A Fennel Safety Update

    Directory of Open Access Journals (Sweden)

    L. Gori

    2012-01-01

    Full Text Available Fennel (Foeniculum vulgare Mill. mature fruit (commonly known as seeds and essential oil of fennel are widely used as flavoring agents in food products such as liqueurs, bread, cheese, and an ingredient of cosmetics and pharmaceutical products. Moreover fennel infusions are the classical decoction for nursing babies to prevent flatulence and colic spasm. Traditionally in Europe and Mediterranean areas fennel is used as antispasmodic, diuretic, anti-inflammatory, analgesic, secretomotor, secretolytic, galactagogue, eye lotion, and antioxidant remedy and integrator. Topically, fennel powder is used as a poultice for snake bites. In Asian cultures fennel was ingested to speed the elimination of poisons. As one of the ancient Saxon people's nine sacred herbs, fennel was credited with the power to cure. Fennel was also valued as a magic herb: in the Middle Ages it was draped over doorways on Midsummer's Eve to protect the household from evil spirits. Recently because of estragole carcinogenicity, fennel has been charged to be dangerous for humans especially if used as decoction for babies. But this allegation do not consider the remedy is prepared as a matrix of substances, and recent researches confirm that pure estragole is inactivated by many substance contained in the decoction.

  14. An overview of amenorrhea and respective remedies in Traditional Persian Medicine

    Directory of Open Access Journals (Sweden)

    Abdolmajid Elahi

    2016-03-01

    Full Text Available Amenorrhea is described as complete absence or cessation of menstruation. Besides conventional treatment approaches, traditional and complementary medical systems have suggested numerous natural medications for management of amenorrhea. Current study aimed to compile the pharmacological reports on amenorrhea from the standpoints of early Persian scholars. Medical and pharmaceutical manuscripts of Persian medicine from 9th to 18th centuries A.D. have been reviewed to extract the critical points and natural remedies. Based on Traditional Persian Medicine (TPM, impairment in uterus, brain and circulation are main causes of amenorrhea. Any obstruction, either anatomical or functional, in uterus and allied organs or tissues may lead the body to this disorder. Concerning herbal therapy of amenorrhea in TPM, 71 medicinal plants related to 35 families were found. The most prevalent families were Apiaceae, Asteraceae, Lamiaceae and Fabaceae, respectively. Usual routes of administration were oral, vaginal and topical. However, there was one report on a medicament, spoken to be effective nasally. Traditionally, emmenagogue medicines should possess diuretic activity to be effective for amenorrhea. All reported remedies were known as diuretic agents. However, this description is not corresponded with what is now accepted as diuretic. On the other hand, only Foeniculum vulgare showed therapeutic effects on amenorrhea in a randomized placebo-controlled trial. Despite lack of novel information on emmenagogue activity of these remedies, design and conducting evidence-based animal or human studies may be beneficial for new drug discovery from traditional knowledge.

  15. Spasmolytic effect of traditional herbal formulation on guinea pig ileum

    Directory of Open Access Journals (Sweden)

    Dushyant Kumar

    2015-01-01

    Full Text Available Background: The herbal formulation consisting of Andrographis paniculata Nees., Cassia fistula L., Foeniculum vulgare Mill. and Cuminum cyminum L. is widely used by the local traditional practitioners in rural Northern Karnataka for spasmodic abdominal pain. Objective: The present study was undertaken to evaluate safety and spasmolytic effect of poly-herbal formulation. Materials and Methods: Acute toxicity studies were carried out in Swiss mice, as per the Organization for Economic Co-operation and Development (OECD guidelines. The spasmolytic activity of the formulation was studied in isolated guinea pig ileum model using histamine and acetylcholine as agonists. The data were analyzed by one-way ANOVA, followed by Dunnetts post-hoc test and P ≤ 0.05 was considered as significant. Results: The formulation did not show any adverse toxic effects and found to be safe. It also showed significant (P < 0.05 relaxation in different agonist like histamine and acetylcholine-induced contractions in guinea pig ileum. Conclusions: Antispasmodic activity of the herbal formulation can be attributed to its atropine-like activity. The present findings, therefore, support its utility in spasmodic abdominal pain.

  16. Chemical Composition, Antioxidant and Antimicrobial Activity of Essential Oils from Organic Fennel, Parsley, and Lavender from Spain

    Directory of Open Access Journals (Sweden)

    Irene Marín

    2016-03-01

    Full Text Available The aim of this work was to (i determine the chemical composition of the essential oils of three spices widely cultivated in Spain from organic growth: Foeniculum vulgare, Petroselium crispum, and Lavandula officinalis; (ii determine the total phenolic content; (iii determine the antioxidant activity of the essentials oils by means of three different antioxidant tests and (iv determine the effectiveness of these essentials oils on the inhibition of Listeria innocua CECT 910 and Pseudomonas fluorescens CECT 844. There is a great variability in the chemical composition of the essential oils. Parsley had the highest phenolic content. Overall, parsley presented the best antioxidant profile, given its highest % of inhibition of DPPH radical (64.28% and FRAP (0.93 mmol/L Trolox, but had a pro-oxidative behavior by TBARS. Lavender essential oil showed the highest antibacterial activity against L. innocua (>13 mm of inhibition at 20–40 μL oil in the discs, followed by parsley with an inhibition zone of 10 mm (when more than 5 μL oil in the discs, and fennel 10 mm (when more than 40 μL oil in the discs. P. fluorescens was not inhibited by the tested essential oils.

  17. Laūq: A Sustained-Release Dosage Form for Respiratory Disorders in Traditional Persian Medicine.

    Science.gov (United States)

    Karegar-Borzi, Hossein; Salehi, Mehdi; Rahimi, Roja

    2016-01-01

    Laūq is a pharmaceutical dosage form that had been mainly used for the treatment of various respiratory disorders in traditional Persian medicine. It is important from 2 aspects: a dosage form with efficient and optimum delivery of drugs to the respiratory tract and biological effects of its ingredients. Natural medicine in laūq has been demonstrated to act in respiratory disorders by their antitussive, antiallergic, anti-inflammatory, antioxidant, spasmolytic, and antibacterial activities. Some of these natural remedies act by most of the mentioned mechanisms such as Cydonia oblonga, Glycyrrhiza glabra, Crocus sativus, Hyssopus officinalis, Foeniculum vulgare, and honey. However, the evidence is limited including Cassia fistula, Papaver somniferum, and Drimia maritima. According to positive pharmacokinetic and pharmacodynamic aspects of laūqs, they may be considered as efficient dosage forms for delivery of drugs to the respiratory tract. For better compatibility of patients, it could be substituted laūqs with newer drug delivery systems like lozenges. PMID:26008751

  18. Anti-Aging Potential of Phytoextract Loaded-Pharmaceutical Creams for Human Skin Cell Longetivity

    Science.gov (United States)

    Jadoon, Saima; Karim, Sabiha; Asad, Muhammad Hassham Hassan Bin; Akram, Muhammad Rouf; Kalsoom Khan, Abida; Malik, Arif; Chen, Chunye; Murtaza, Ghulam

    2015-01-01

    The exposure to ultraviolet radiations (UVR) is the key source of skin sunburn; it may produce harmful entities, reactive oxygen species (ROS), leading to aging. The skin can be treated and protected from the injurious effects of ROS by using various pharmaceutical formulations, such as cream. Cream can be loaded with antioxidants to quench ROS leading to photo-protective effects. Moreover, modern medicines depend on ethnobotanicals for protection or treatment of human diseases. This review article summarizes various in vivo antioxidant studies on herbal creams loaded with phyto-extracts. These formulations may serve as cosmeceuticals to protect skin against injurious effects of UVR. The botanicals studied for dermatologic use in cream form include Acacia nilotica, Benincasa hispida, Calendula officinalis, Camellia sinensis, Camellia sinensis, Nelumbo nucifera, Capparis decidua, Castanea sativa, Coffea arabica, Crocus sativus, Emblica officinalis Gaertn, Foeniculum vulgare, Hippophae rhamnoides, Lithospermum erythrorhizon, Malus domestica, Matricaria chamomilla L., Moringa oleifera, Morus alba, Ocimum basilicum, Oryza sativa, Polygonum minus, Punica granatum, Silybum marianum, Tagetes erecta Linn., Terminalia chebula, Trigonella foenum-graecum, and Vitis vinifera. The observed anti-aging effects of cream formulations could be an outcome of a coordinating action of multiple constituents. Of numerous botanicals, the phenolic acids and flavonoids appear effective against UVR-induced damage; however the evidence-based studies for their anti-aging effects are still needed. PMID:26448818

  19. Evaluation of antifungal activity of essential oils against potentially mycotoxigenic Aspergillus flavus and Aspergillus parasiticus

    Directory of Open Access Journals (Sweden)

    Fernanda C. da Silva

    2012-10-01

    Full Text Available The antifungal activity of essential oils of fennel (Foeniculum vulgare Mill., Apiaceae, ginger (Zingiber officinale Roscoe, Zingiberaceae, mint (Mentha piperita L., Lamiaceae and thyme (Thymus vulgaris L., Lamiaceae was evaluated against mycotoxin producers Aspergillus flavus and A. parasiticus. High Resolution Gas Chromatography was applied to analyze chemical constituents of essential oils. The effect of different concentrations of essential oils was determined by solid medium diffusion assay. Mycelial growth and sporulation were determined for each essential oil at the concentrations established by solid medium diffusion assay. At the fifth, seventh and ninth days the mycelial diameter (Ø mm and spore production were also determined. FUN-1 staining was performed to assess cell viability after broth macrodilution assay. Trans-anethole, zingiberene, menthol and thymol are the major component of essential oils of fennel, ginger, mint and thyme, respectively. The effective concentrations for fennel, ginger, mint and thyme were 50, 80, 50 and 50% (oil/DMSO; v/v, respectively. The four essential oils analysed in this study showed antifungal effect. Additionally, FUN-1 staining showed to be a suitable method to evaluate cell viability of potential mycotoxigenic fungi A. flavus and A. parasiticus after treatment with essential oils.

  20. Intercropping garlic plants reduces Tetranychus urticae in strawberry crop.

    Science.gov (United States)

    Hata, Fernando T; Ventura, Maurício U; Carvalho, Mateus G; Miguel, André L A; Souza, Mariana S J; Paula, Maria T; Zawadneak, Maria A C

    2016-07-01

    The effect of aromatic plants on number of twospotted spider mite (TSSM), Tetranychus urticae Koch, when intercropped with strawberry were assessed in the field. During the first year, chives (Allium schoenoprasum L.), coriander (Coriandrum sativum L.), fennel (Foeniculum vulgare Mill.), garlic (Allium sativum L.), oregano (Origanum vulgare L.), or sweet marjoram (Origanum majorana L.) were intercropped with strawberry. Assessments were performed on TSSM populations by taking six samples from July 20 to September 20, 2012. During the second year, garlic plants were intercropped between rows of strawberry at three densities in greenhouse and field. Mobile forms and eggs numbers (only in field) of TSSM were evaluated from April 18 to June 05 (greenhouse) and June 06 to August 14, 2013 (field). It was found that intercropping with garlic caused a greater reduction of TSSM (up to 52 %) in strawberry plants when higher populations of TSSM occurred in the field. TSSM reduction was found in one sample when fennel and chives were intercropped with strawberries (42 and 50 % reduction, respectively); this also occurred when populations of TSSM were higher. The three densities of garlic plants (one, two and three rows among the strawberry rows) reduced TSSM mobile forms by 49, 53 and 60 % (greenhouse) and 44, 51 and 65 % (field), and eggs by 38, 43 and 64 % (field), respectively. The results suggest that intercropping garlic plants between strawberry rows is a promising strategy to reduce TSSM populations. PMID:27085718

  1. Effects of oral dosage form and storage period on the antioxidant properties of four species used in traditional herbal medicine.

    Science.gov (United States)

    Guimarães, Rafaela; Barreira, João C M; Barros, Lillian; Carvalho, Ana Maria; Ferreira, Isabel C F R

    2011-04-01

    Herbal infusions and decoctions in water are some of the most commonly consumed beverages in the world. Although water is not a good solvent for many of the active components in herbs, liquid preparations are rich in several bioactive compounds. Most of them have powerful antioxidant activity and have been related to medicinal herbs' properties. Herein, decoctions and infusions in water of lemon-verbena (Aloysia citrodora) aerial parts and leaves, fennel (Foeniculum vulgare), pennyroyal (Mentha pulegium) and spearmint (Mentha spicata) aerial parts with different periods of storage (0, 30, 60 and 120 days), were prepared. The effects of the method of preparation and storage period on their antioxidant properties were analysed. For all the analysed species, infusions gave better results than the corresponding decoctions. Spearmint infusions showed the highest antioxidant properties, at all the storage periods, probably due to the highest levels and synergy between phenolics, flavonoids and ascorbic acid found in this sample. Linear discriminant analysis confirmed that the length of storage period has a significant influence on the antioxidant activity and antioxidant content. Flavonoids and reducing sugars proved to be the parameters that most highly contributed to cluster individual groups according to different periods of storage. PMID:20740475

  2. Infusions and decoctions of mixed herbs used in folk medicine: synergism in antioxidant potential.

    Science.gov (United States)

    Guimarães, Rafaela; Barros, Lillian; Carvalho, Ana Maria; Ferreira, Isabel C F R

    2011-08-01

    Infusions (herbal teas) and decoctions are used frequently to administer oral doses of herbs. Although some herbs are used as single ingredients, they are often prepared as mixtures, as reported by numerous ethnobotanical surveys. The present work was carried out to identify the different types of interaction (synergistic, additive and antagonistic effects) which may be found in the antioxidant activity of preparations from mixtures of the popular herbs Aloysia citrodora (lemon verbena), Foeniculum vulgare (fennel) and Mentha spicata (spearmint). Herbs were prepared using traditional methods, and the effects after different periods of storage, up to 120 days, were also evaluated. Antioxidant activity was evaluated using DPPH radical scavenging activity, reducing power and inhibition of lipid peroxidation by the β-carotene - linoleate system and the TBARS assay. Known antioxidant compounds such as total phenolics, flavonoids, ascorbic acid and reducing sugars were also determined. Spearmint was found to be present in the herb mixtures with the greatest antioxidant activity and these also had the highest flavonoid content. The most potent antioxidant activity was found in combinations of different herbs, suggesting synergistic effects. PMID:21308820

  3. Anti-oxidant, anti-inflammatory and anti-proliferative activities of Moroccan commercial essential oils.

    Science.gov (United States)

    Aazza, Smail; Lyoussi, Badiaa; Megías, Cristina; Cortés-Giraldo, Isabel; Vioque, Javier; Figueiredo, A Cristina; Miguel, Maria G

    2014-04-01

    Essential oils (EO) possess antimicrobial, anti-inflammatory, insect repellent, anti-cancer, and antioxidant properties, among others. In the present work, the antioxidant, anti-inflammatory and anti-proliferative activities of Moroccan commercial EOs (Citrus aurantium, C. limon, Cupressus sempervirens, Eucalyptus globulus, Foeniculum vulgare and Thymus vulgaris) were evaluated and compared with their main constituents. T. vulgaris EO showed the best free radicals scavenging capacity. This EO was also the most effective against lipid peroxidation along with C. limon and F. vulgare EOs. C. sempervirens EO was the most effective in scavenging NO free radicals, whereas C. limon EO showed the best chelating power. Not all of the major compounds of the EO were responsible for the whole activity of the EOs. T. vulgaris EO showed the best anti-proliferative activity against THP-1 cells in contrast to that of F. vulgare. The antioxidant and anti-inflammatory activities of the EOs were plant species dependent and not always attributable to the EOs main components. Nevertheless, the EOs anti-proliferative activities were more related to their main components, as with T. vulgaris, C. limon, E. globulus and C. sempervirens. PMID:24868891

  4. Extraction of Volatile Oil from Aromatic Plants with Supercritical Carbon Dioxide: Experiments and Modeling

    Directory of Open Access Journals (Sweden)

    Helena Sovová

    2012-09-01

    Full Text Available An overview of the studies carried out in our laboratories on supercritical fluid extraction (SFE of volatile oils from seven aromatic plants: pennyroyal (Mentha pulegium L., fennel seeds (Foeniculum vulgare Mill., coriander (Coriandrum sativum L., savory (Satureja fruticosa Béguinot, winter savory (Satureja montana L., cotton lavender (Santolina chamaecyparisus and thyme (Thymus vulgaris, is presented. A flow apparatus with a 1 L extractor and two 0.27 L separators was built to perform studies at temperatures ranging from 298 to 353 K and pressures up to 30.0 MPa. The best compromise between yield and composition compared with hydrodistillation (HD was achieved selecting the optimum experimental conditions of extraction and fractionation. The major differences between HD and SFE oils is the presence of a small percentage of cuticular waxes and the relative amount of thymoquinone, an oxygenated monoterpene with important biological properties, which is present in the oils from thyme and winter savory. On the other hand, the modeling of our data on supercritical extraction of volatile oil from pennyroyal is discussed using Sovová’s models. These models have been applied successfully to the other volatile oil extractions. Furthermore, other experimental studies involving supercritical CO2 carried out in our laboratories are also mentioned.

  5. Fungal Control of Pathogenic Fungi Isolated From Some Wild Plants in Taif Governorate, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Abou-Zeid, A. M.

    2008-01-01

    Full Text Available Twenty two plants were collected from Taif Governorate and identified as: Aerva lanata, Arnebia hispidissima, Artemisia judaica, Artemisia monosperma, Asphodelus aestives, Avena barbata, Capparis dcidua, Eucalyptus globulus, Euphorbia glomerifera, Foeniculum vulgare, Forsskaolea tenacissima, Juniperus procera, Launaea mucronata, Launaea sonchoides, Medicago sativa, Opuntia ficus, Phagnalon sinaicum, Prunus persica, Pulicaria crispa, Punica granatum, Rumex dentatus and Trichodesma calathiforme. Pathogenic fungi were isolated from some of these plants and identified as Alternaria alternata, Cephalosporium madurae, Cladosporium herbarum, Fusarium oxysporum, Humicola grisea, Penicillium chrysogenum and Ulocladium botrytis. Four antagonistic isolates were tested, 2 from Gliocladium fungus and 2 from Trichoderma fungus. We found that all the four antagonistic isolates (G. deliquescens, G. virens, T. viride and T. hamatum significantly inhibited the radial growth of the pathogenic fungi tested, with different ratios. The results indicated that the antibiotics produced by the antagonists were more effective than the fungus itself and differ with different fungi. Coating plant stems with antagonists or with antagonist extracts reduce the severity of the disease but not prevent it in all tested pathogens.

  6. Anti-Aging Potential of Phytoextract Loaded-Pharmaceutical Creams for Human Skin Cell Longetivity

    Directory of Open Access Journals (Sweden)

    Saima Jadoon

    2015-01-01

    Full Text Available The exposure to ultraviolet radiations (UVR is the key source of skin sunburn; it may produce harmful entities, reactive oxygen species (ROS, leading to aging. The skin can be treated and protected from the injurious effects of ROS by using various pharmaceutical formulations, such as cream. Cream can be loaded with antioxidants to quench ROS leading to photo-protective effects. Moreover, modern medicines depend on ethnobotanicals for protection or treatment of human diseases. This review article summarizes various in vivo antioxidant studies on herbal creams loaded with phyto-extracts. These formulations may serve as cosmeceuticals to protect skin against injurious effects of UVR. The botanicals studied for dermatologic use in cream form include Acacia nilotica, Benincasa hispida, Calendula officinalis, Camellia sinensis, Camellia sinensis, Nelumbo nucifera, Capparis decidua, Castanea sativa, Coffea arabica, Crocus sativus, Emblica officinalis Gaertn, Foeniculum vulgare, Hippophae rhamnoides, Lithospermum erythrorhizon, Malus domestica, Matricaria chamomilla L., Moringa oleifera, Morus alba, Ocimum basilicum, Oryza sativa, Polygonum minus, Punica granatum, Silybum marianum, Tagetes erecta Linn., Terminalia chebula, Trigonella foenum-graecum, and Vitis vinifera. The observed anti-aging effects of cream formulations could be an outcome of a coordinating action of multiple constituents. Of numerous botanicals, the phenolic acids and flavonoids appear effective against UVR-induced damage; however the evidence-based studies for their anti-aging effects are still needed.

  7. Chemical compositions and antioxidant properties of essential oils from nine species of Turkish plants obtained by supercritical carbon dioxide extraction and steam distillation.

    Science.gov (United States)

    Topal, Ummihan; Sasaki, Mitsuru; Goto, Motonobu; Otles, Semih

    2008-01-01

    Chemical compositions and antioxidant activities of essential oils from nine different species of Turkish plants, namely Melissa officinalis L., Rosmarinus officinalis L., Cuminum cyminum L., Piper nigrum L., Lavandula stoechas spp., Foeniculum vulgare, Pimpinella anisum L., Thymus serpyllum and Liquidamber orientalis Mill., were studied. Essential oils were obtained by supercritical carbon dioxide (SCCO2) extraction and steam distillation, and were analyzed by gas chromatography-mass spectrometry. The antioxidant activities of SCCO2 extraction and steam distillation extracts were tested by means of the 1,1-diphenyl-2-picrylhydrazyl (DPPH) assay. Essential oils extracted by SCCO2 and steam distillation showed different compositions in different species. In the DPPH assay, R. officinalis, C. cyminum, P. anisum, T. serpyllum and L. orientalis essential oils obtained by SCCO2 extraction showed higher antioxidant activity than steam distillation extracts, with radical scavenging activities ranging from 87.1 +/- 0.23% to 92.0 +/- 0.34% compared with the butylated hydroxytoluene positive control (91.4 +/- 0.21%). PMID:19382349

  8. Effects of herbal essential oil mixture as a dietary supplement on egg production in quail.

    Science.gov (United States)

    Çabuk, Metin; Eratak, Serdar; Alçicek, Ahmet; Bozkurt, Mehmet

    2014-01-01

    One hundred and eighty 7-week-old laying quail were fed various diets over a 12-week period. The diets included a control diet (without essential oil mixture (EOM) or antibiotics (ANTs)), a basal diet including EOM (24 mg/kg feed), and a basal diet including an ANT (avilamycin, 10 mg/kg feed). Each treatment comprised 4 replications with 4 cages (15 quail per cage), amounting to 60 quail per treatment group. Diets (in mash form) and water were provided for ad libitum consumption. EOM consisted of 6 different essential oils derived from the following herbs: oregano (Origanum sp.), laurel leaf (Laurus nobilis L.), sage leaf (Salvia triloba L.), myrtle leaf (Myrtus communis), fennel seeds (Foeniculum vulgare), and citrus peel (Citrus sp.). In comparison with the control diet, adding supplements such as EOM and ANTs to the basal diet increased egg production in quail (P < 0.001). However, egg production was similar between EOM and ANT treatment groups. Moreover, there were no differences between the treatment groups with regard to egg weight. Feed intake was not affected by EOM or ANT supplementation, whereas feed conversion ratio was significantly improved by EOM and ANT supplementation. Thus, we concluded that EOM has beneficial effects as a dietary supplement on egg production and feed conversion ratio. PMID:24587729

  9. Uso de Plantas Medicinais por Famílias do Vale do Jequitinhonha, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Maria Jesus Barreto CRUZ

    2015-01-01

    Full Text Available O objetivo do estudo foi investigar a utilização de plantas medicinais pelas famílias residentes no Vale do Jequitinhonha, Minas Gerais. Foi realizado um estudo descritivo tipo inquérito populacional domiciliar, amostra constituída por 555 domicílios selecionados de maneira aleatória simples por meio de amostragem por conglomerado de 137 setores censitários. Dos participantes, 73,51% relataram a utilização de plantas medicinais, sendo Mentha x piperita L., Mentha pulegium L. e Foeniculum vulgare Mill as mais citadas. Dos que utilizaram plantas medicinais, 48% preparavam por decocção, 46,8% por infusão, 77% aprenderam com os pais como utilizar e preparar. Foi observado que 90,7% obtiveram as plantas dos próprios quintais, 90,9% consumiam frescas e 94,4% achavam que não fazia mal. A utiliza- ção de plantas medicinais é comum nos municípios estudados. Assim, nota-se a necessidade de realização de pesquisa etnobotânica e capacitação dos profissionais de saúde para promover o uso racional de plantas medicinais.

  10. Investigations into the antiadhesive activity of herbal extracts against Campylobacter jejuni.

    Science.gov (United States)

    Bensch, K; Tiralongo, J; Schmidt, K; Matthias, A; Bone, K M; Lehmann, R; Tiralongo, E

    2011-08-01

    Campylobacter jejuni is one of the most common bacterial causes of diarrhoea in the industrialized world, being associated with the occurrence of Guillain-Barré Syndrome, and inducing diseases partially through intestinal adherence. With increasing reports of C. jejuni drug resistance against standard antibiotics, investigations into antiadhesive agents for the prevention of bacterial infection are highly significant. Given the consumer-driven development towards holistic and integrative healthcare, research into additional anti-Campylobacter effects of herbal medicines that are already used for their beneficial effects on bowel and digestive functions is important. Twenty-one herbal extracts were screened for antiadhesive activity against C. jejuni using modifications of previously published antiadhesion assays. Antiadhesion effects with IC(50) values 35 mg/mL) was found for Agrimonia eupatoria (agrimony), Andrographis paniculata (andrographis), Matricaria recutita (chamomile), Foeniculum vulgare (fennel), Filipendula ulmaria (meadowsweet) and Artemisia absinthium (wormwood) extracts. This study provides evidence for additional beneficial effects of marketed herbal medicines in gastrointestinal disorders. PMID:21280113

  11. Investigations into the antibacterial activities of phytotherapeutics against Helicobacter pylori and Campylobacter jejuni.

    Science.gov (United States)

    Cwikla, C; Schmidt, K; Matthias, A; Bone, K M; Lehmann, R; Tiralongo, E

    2010-05-01

    The prevalence of gastric diseases is increasing with H. pylori, the causative agent of acute and chronic gastritis, being a major predisposing factor for peptic ulcer disease and gastric carcinoma. C. jejuni is the most common cause of enteric infections, particularly among children, resulting in severe diarrhoea. Increasing drug resistance of these bacteria against standard antibiotics, and the more widespread use of herbal medicines, favours investigations into additional anti-Helicobacter and anti-Campylobacter effects of phytotherapeutics that are already used for their beneficial effects on bowel and digestive functions. Twenty-one hydroethanol herbal extracts and four essential oils were screened for antibacterial activity using a modification of a previously described micro-dilution assay and compared with the inhibitory effects of antibiotics. The herbal extracts showing the highest growth inhibition of C. jejuni were Calendula officinalis, Matricaria recutita, Zingiber officinale, Salvia officinalis, Foeniculum vulgare and Silybum marianum. Agrimonia eupatoria, Hydrastis canadensis, Filipendula ulmaria and Salvia officinalis were the most active herbal extracts in inhibiting the growth of H. pylori. This study provides evidence for additional beneficial effects of phytotherapeutics marketed for their gastrointestinal effects and identifies new beneficial antibacterial effects for some herbal medicines not currently recommended for gastrointestinal problems. PMID:19653313

  12. Evaluation of native plant flower characteristics for conservation biological control of Prays oleae.

    Science.gov (United States)

    Nave, A; Gonçalves, F; Crespí, A L; Campos, M; Torres, L

    2016-04-01

    Several studies have shown that manipulating flowering weeds within an agroecosystem can have an important role in pest control by natural enemies, by providing them nectar and pollen, which are significant sources of nutrition for adults. The aim of this study was to assess if the olive moth, Prays oleae (Bernard, 1788) (Lepidoptera: Praydidae), and five of its main natural enemies, the parasitoid species Chelonus elaeaphilus Silvestri (Hymenoptera: Braconidae), Apanteles xanthostigma (Haliday) (Hymenoptera: Braconidae), Ageniaspis fuscicollis (Dalman) (Hymenoptera: Encyrtidae) and Elasmus flabellatus (Fonscolombe) (Hymenoptera: Eulophidae), as well as the predator Chrysoperla carnea (Stephens) (Neuroptera: Chrysopidae), can theoretically access the nectar from 21 flowering weeds that naturally occur in olive groves. Thus, the architecture of the flowers as well as the mouthpart structure and/or the head and thorax width of the pest and its enemies were analyzed. The results suggested that all beneficial insects were able to reach nectar of the plant species from Apiaceae family, i.e. Conopodium majus (Gouan) Loret, Daucus carota L. and Foeniculum vulgare Mill., as well as Asparagus acutifolius L., Echium plantagineum L., Capsella bursa-pastoris (L.) Medik., Raphanus raphanistrum L., Lonicera hispanica Boiss. et Reut., Silene gallica L., Spergula arvensis L., Hypericum perforatum L., Calamintha baetica Boiss. et Reut, Malva neglecta Wallr. and Linaria saxatilis (L.) Chaz. P. oleae was not able to access nectar from five plant species, namely: Andryala integrifolia L., Chondrilla juncea L., Dittrichia viscosa (L.) Greuter, Sonchus asper (L.) Hill and Lavandula stoechas L. PMID:26780918

  13. Indigenous traditional medicine: in vitro anti-giardial activity of plants used in the treatment of diarrhea.

    Science.gov (United States)

    Brandelli, Clara Lia Costa; Giordani, Raquel Brandt; De Carli, Geraldo Attilio; Tasca, Tiana

    2009-06-01

    The ethnopharmacology for treatment of parasitic infections facilitates and directs the search for new chemical entities. In this direction, this study evaluated the cytotoxicity in vitro, against trophozoites of Giardia lamblia, of aqueous extracts of leaves Achyrocline satureioides (Lam.) DC., barks of Eugenia uniflora L., aerial parts of Foeniculum vulgare Miller, and barks of Psidium guajava L. These plants are traditionally used for the treatment of diarrhea by the indigenous population Mbyá-Guarani, located at the Lomba do Pinheiro, Porto Alegre, Rio Grande do Sul, Brazil. The in vitro susceptibility qualitative analysis of G. lamblia to aqueous extracts was performed in serial dilutions from 2.5 to 0.02 mg/mL. Results revealed the minimal inhibitory concentrations: 0.313 mg/mL for A. satureioides and E. uniflora, 0.02 mg/mL for P. guajava, and F. vulgare did not present any cytotoxic effect. Quantitative assays of viable trophozoites, showed that A. satureioides presented the highest cytotoxic effect (93.5%), followed by P. guajava (82.2%), and E. uniflora (67.3%). Indigenous Guarani use mainly A. satureioides for the treatment of diarrhea, revealing the conformity with results obtained in vitro. Bioguided assays are necessary to identify the compounds responsible for the activity of the aqueous extract of A. satureioides. PMID:19153765

  14. Evaluation of irradiated essential oils to control of Sitophilus zeamais Mots. (Coleoptera: Curculionidae) and Blatella germanica (L.) (Dictyopera: Blattellidae); Avaliacao de produtos naturais irradiados para o controle de Sitophilus zeamais Mots. (Coleoptera: Curculionidae) e Blatella germanica (L.) (Dictyopera: Blattellidae)

    Energy Technology Data Exchange (ETDEWEB)

    Potenza, Marcos Roberto

    2004-07-01

    This work aimed to evaluate the effect of irradiated essential oils of Eucalyptus citriodora, Eucalyptus globulus, Pinus sp., Azadirachta indica, Cymbopogon nardus, Cupressus sempervirens, Cymbopogons citratus and Juniperus communis and aqueous, hexanic and ethanolic irradiated extracts of Solanum paniculatum, Dahlia pinnata, Lycopersicon esculentum, Nephrolepis pectinata, Ruta graveolens, Ficus elastica, Lavandula angustifolia, Rhododendron simsii, Agave angustifolia, Ocimum basilicum, Allamanda cathartica, Dieffenbachia brasiliensis, Pennisetum purpureum, Annona squamosa, Coffea arabica and Hibiscus rosa-sinensis, in order to identify new substances to integrated pest management (IPM) and to observe possible effects of gamma radiation about extracts and essential oils efficiency such as increase, reduction, activation and inactivation of the same to the pest control. It evaluated the effect of contact on Sitophilus zeamais and by ingestion in Blattella germanica. To irradiation was used an experimental irradiator of Cobalt-60, type Gammacell 220. The essential oils were submitted increasing doses of gamma radiation: 2.5; 5.0; 7.5 and 10.0 kGy. The bioassay with B. germanica demonstrated efficiency between 22.0 e 30.0% and between 30.0 and 42.0%, respectively, to irradiated essential oils of E. citriodora and E. globulus and they demonstrated too repellency to the nymphs. The gamma radiation used promoted changes in essential oils of E. citriodora e E. globulus that they began to show efficiency on B. germanica nymphs besides a significant reduction of repellency. Essential oils of Pinus sp., A. indica, C. sempervirens and J. communis did not display efficiency. The essential oils of C. nardus, and C. citratus had low efficiency. The gamma radiation increased the efficiency of ethanolic extract of D. Pinnata with dose of 7.5 kGy, showing 48.0% of efficiency on B. germanica nymphs. The gamma radiation showed adverse effect on the aqueous extract of R. Graveolens

  15. Evaluation of irradiated essential oils to control of Sitophilus zeamais Mots. (Coleoptera: Curculionidae) and Blatella germanica (L.) (Dictyopera: Blattellidae)

    International Nuclear Information System (INIS)

    This work aimed to evaluate the effect of irradiated essential oils of Eucalyptus citriodora, Eucalyptus globulus, Pinus sp., Azadirachta indica, Cymbopogon nardus, Cupressus sempervirens, Cymbopogons citratus and Juniperus communis and aqueous, hexanic and ethanolic irradiated extracts of Solanum paniculatum, Dahlia pinnata, Lycopersicon esculentum, Nephrolepis pectinata, Ruta graveolens, Ficus elastica, Lavandula angustifolia, Rhododendron simsii, Agave angustifolia, Ocimum basilicum, Allamanda cathartica, Dieffenbachia brasiliensis, Pennisetum purpureum, Annona squamosa, Coffea arabica and Hibiscus rosa-sinensis, in order to identify new substances to integrated pest management (IPM) and to observe possible effects of gamma radiation about extracts and essential oils efficiency such as increase, reduction, activation and inactivation of the same to the pest control. It evaluated the effect of contact on Sitophilus zeamais and by ingestion in Blattella germanica. To irradiation was used an experimental irradiator of Cobalt-60, type Gammacell 220. The essential oils were submitted increasing doses of gamma radiation: 2.5; 5.0; 7.5 and 10.0 kGy. The bioassay with B. germanica demonstrated efficiency between 22.0 e 30.0% and between 30.0 and 42.0%, respectively, to irradiated essential oils of E. citriodora and E. globulus and they demonstrated too repellency to the nymphs. The gamma radiation used promoted changes in essential oils of E. citriodora e E. globulus that they began to show efficiency on B. germanica nymphs besides a significant reduction of repellency. Essential oils of Pinus sp., A. indica, C. sempervirens and J. communis did not display efficiency. The essential oils of C. nardus, and C. citratus had low efficiency. The gamma radiation increased the efficiency of ethanolic extract of D. Pinnata with dose of 7.5 kGy, showing 48.0% of efficiency on B. germanica nymphs. The gamma radiation showed adverse effect on the aqueous extract of R. Graveolens

  16. Evaluation of vegetable extracts for control of the pathogenic fungi in banana and strawberry in post harvest storage Evaluación de extractos vegetales para manejo de hongos patógenos en banano y fresa almacenados

    Directory of Open Access Journals (Sweden)

    Bonilla Correa Carmen Rosa

    2006-12-01

    Full Text Available

    This study was carried out get knowledge about fungicidal properties of vegetable extracts to the control of the pathogenyc fungi (Colletotrichum musae and Botrytis cinerea in banana (Musa sapientum and strawberry (Fragaria sp during the pos harvest storage, at the National University of Colombia headquarters in Palmira. Ethanolics extracts of the following vegetable species were evaluated: Plantago major L, Ruta graveolens L, Lippia alba (Mill NE BROS, Pteridium aquilinum (Kaulf Maxon. The extracts were obtained by the percolation method starting from the macerated material (100 g and 1000 ml of solvent. The fungi was isolated from the strawberry (Fragaria sp affected by B. cinerea and banana Gross mitchel affected by C. musae. To evaluate the control of the fungi C. musae and B. cinerea sixteen treatments were used (four extracts of plants, two extraction media, two dilutions and three repetitions. Three control treatments were added: absolute (PDA; solvent (PDA + ethanol or water; and chemical (PDA + chemical fungicide. The dilutions were prepared with the solvent used to obtain the extract. The evaluation in vitro was maid with ethanolics extracts diluted at 25%, because these presented the best results in the previous tests. The results indicate that the ethanolic solvent decreased the development of the fungi in 68%. The fruits in which the etanolic extract of ruda and pronto alivio was applied presented bigger incidence and grade of severity.

    Keys words: Vegetable extract; patogenic fungi; Colletotrichum musae; Botrytis cinérea; post harvest

    En la Universidad Nacional de Colombia -Sede Palmira, se obtuvieron extractos etanólicos (1.000 ml, macerados (100 g de llantén (Plantago major L, ruda (Ruta graveolens L, pronto alivio [Lippia alba (Mill NE BROS] y helecho marranero [Pteridium aquilinum (Kaulf Maxon]. Para la evaluación del control

  17. Atividade antimicrobiana de óleos essenciais de condimentos frente a Staphylococcus spp isolados de mastite caprina Antimicrobial activities of essential oils extracted from spices against Staphylococcus spp isolated from goat mastitis

    Directory of Open Access Journals (Sweden)

    Marcelo Dal Pozzo

    2011-04-01

    Full Text Available Avaliou-se a atividade antimicrobiana dos óleos essenciais (OEs de Origanum vulgare (orégano, Thymus vulgaris (tomilho, Lippia graveolens (lípia, Zingiber officinale (gengibre, Salvia officinalis (sálvia, Rosmarinus officinalis (alecrim e Ocimum basilicum (manjericão, bem como de frações majoritárias carvacrol, timol, cinamaldeído e cineol frente a 33 isolados de Staphylococcus spp oriundos de rebanhos leiteiros caprinos. A concentração inibitória mínima (CIM e a concentração bactericida mínima (CBM foram determinadas por meio da técnica de microdiluição em caldo. Observou-se atividade antimicrobiana para os OEs de orégano, lípia e tomilho, bem como para as frações majoritárias de carvacrol, timol e cinamaldeído. A ordem decrescente de atividade foi orégano = tomilho > lípia. As frações majoritárias carvacrol, timol e cinamaldeído evidenciaram melhor atividade do que os óleos essenciais e, dentre elas, carvacrol e cinamaldeído foram mais ativas que o timol.The antimicrobial activity of some essencial oils was evaluated as follows: Origanum vulgare (oregano, Thymus vulgaris (thyme, Lippia graveolens (Mexican oregano, Zingiber officinale (ginger, Salvia officinalis (sage, Rosmarinus officinalis (rosemary and Ocimum basilicum (basil, as well as the majority constituents carvacrol, thymol, cinnamaldehyde and cineole against 33 Staphylococcus spp isolates from herds of dairy goats. The minimum inhibitory concentration (MIC and the minimum bactericidal concentration (MBC were determined for each isolate by using broth microdilution method. Antimicrobial activity observed on the essencial oils of oregano, mexican oregano, thymus, well as to majoritary constituents of carvacrol, thymol and cinnamaldehyde. The descending order of antimicrobial activity were oregano = thyme > mexican oregano. The majority constituents carvacrol, thymol, cinnamaldehyde presented themselves more active than the verified by the essencial oils

  18. Ethnomedicines used in Trinidad and Tobago for reproductive problems

    Directory of Open Access Journals (Sweden)

    Lans Cheryl

    2007-03-01

    Full Text Available Abstract Background Throughout history women have tried to control or enhance their fertility using herbal remedies, with various levels of societal support. Caribbean folk medicine has been influenced by European folk medicine, either through the early Spanish and French settlers or through the continuous immigration of Spanish-speaking peoples from Venezuela. Some folk uses are ancient and were documented by Galen and Pliny the Elder. Methods Thirty respondents, ten of whom were male were interviewed from September 1996 to September 2000. The respondents were obtained by snowball sampling, and were found in thirteen different sites, 12 in Trinidad (Paramin, Talparo, Sangre Grande, Mayaro, Carapichaima, Kernahan, Newlands, Todd's Road, Arima, Guayaguayare, Santa Cruz, Port of Spain and Siparia and one in Tobago (Mason Hall. Snowball sampling was used because there was no other means of identifying respondents and to cover the entire islands. The validation of the remedies was conducted with a non-experimental method. Results Plants are used for specific problems of both genders. Clusea rosea, Urena sinuata and Catharanthus roseus are used for unspecified male problems. Richeria grandis and Parinari campestris are used for erectile dysfunction. Ageratum conyzoides, Scoparia dulcis, Cucurbita pepo, Cucurbita maxima, Gomphrena globosa and Justicia pectoralis are used for prostate problems. The following plants are used for childbirth and infertility: Mimosa pudica, Ruta graveolens, Abelmoschus moschatus, Chamaesyce hirta, Cola nitida, Ambrosia cumanenesis, Pilea microphylla, Eryngium foetidum, Aristolochia rugosa, Aristolochia trilobata, Coleus aromaticus, Laportea aestuans and Vetiveria zizanioides. The following plants are used for menstrual pain and unspecified female complaints: Achyranthes indica, Artemisia absinthium, Brownea latifolia, Eleutherine bulbosa, Hibiscus rosa-sinensis, Eupatorium macrophyllum, Justicia secunda, Parthenium

  19. Estudo fitossociológico de um trecho da floresta estacional semidecidual em Diamante do Norte, Estado do Paraná, Brasil = Phytosociology in semi-deciduous seasonal forest fragment in Diamate do Norte, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Erci Marcos Del Quiqui

    2007-04-01

    Full Text Available O presente estudo foi realizado em uma Floresta Estacional Semidecidual de 1.426 ha, localizada na Estação Ecológica do Caiuá (54° 49’W e 22° 34’S em Diamante do Norte, Estado do Paraná, Para o levantamento fitossociológico, foram locadas 29 parcelasgeoreferenciadas de 50 m x 30 m, totalizando 4,35 ha. Em cada parcela, foram amostrados todos os indivíduos com diâmetro à altura do peito (DAP > 5,0 cm, e, em subparcelas, os indivíduos com DAP £ 5 cm, totalizando 3.812 indivíduos arbóreos pertencentes a 38 famílias, 85 gêneros e 102 espécies. As famílias Myrtaceae, Rutaceae e do grupo das Leguminosaea destacaram-se pelo elevado número de espécies. Xylosma venosa, Metrodorea nigra, Chrysophyllum gonocarpum, Plinia rivularis, Eugenia uniflora, Aspidosperma polyneuron, Actinostenon concolor, Zygia cauliflora, Caesaria gossypiosperma, Blepharocalyx salicifolius, Astronium graveolens, Campomanesia xanthocarpa e Balfourodendron riedelianum destacaram-se como as espécies de maior valor de importância. O índice de diversidade de Shannon (H’ obtido foi de 3,56 e índice de similaridade de Sorensen (ISS neste trabalho foi de 75,5% entre os estratos avaliados.The aim of this work was to study a Semideciduous Seasonal Forest fragment. It was carried out at the Ecological Station Caiuá (54° 49’W and 22° 34'S, in Diamante do Norte, Paraná State, Brazil. The study covered an area of 1.426 ha. The plots were located by GPS in that fragment. The area was divided in 29 parcels with 50 x 30 m, totalizing 4.35 ha. The individuals belonging to regeneration and the ones with DBH higher than or equal to 5.0 cm were then measured, totalizing 3,812 adult individuals, gathered into 38 families, 85 genera and 102 species. The families with the highest number of species were Myrtaceae, Rutaceae and Leguminosaea groups. Xylosmavenosa, Metrodorea nigra, Chrysophyllum gonocarpum, Plinia rivularis, Eugenia uniflora, Aspidosperma polyneuron

  20. Ethnomedicines used in Trinidad and Tobago for urinary problems and diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Lans Cheryl A

    2006-10-01

    Full Text Available Abstract Background This paper is based on ethnobotanical interviews conducted from 1996–2000 in Trinidad and Tobago with thirty male and female respondents. Methods A non-experimental validation was conducted on the plants used for urinary problems and diabetes mellitus: This is a preliminary step to establish that the plants used are safe or effective, to help direct clinical trials, and to inform Caribbean physicians of the plants' known properties to avoid counter-prescribing. Results The following plants are used to treat diabetes: Antigonon leptopus, Bidens alba, Bidens pilosa, Bixa orellana, Bontia daphnoides, Carica papaya, Catharanthus roseus, Cocos nucifera, Gomphrena globosa, Laportea aestuans, Momordica charantia, Morus alba, Phyllanthus urinaria and Spiranthes acaulis. Apium graviolens is used as a heart tonic and for low blood pressure. Bixa orellana, Bontia daphnoides, Cuscuta americana and Gomphrena globosa are used for jaundice. The following plants are used for hypertension: Aloe vera, Annona muricata, Artocarpus altilis, Bixa orellana, Bidens alba, Bidens pilosa, Bonta daphnoides, Carica papaya, Cecropia peltata, Citrus paradisi, Cola nitida, Crescentia cujete, Gomphrena globosa, Hibiscus sabdariffa, Kalanchoe pinnata, Morus alba, Nopalea cochinellifera, Ocimum campechianum, Passiflora quadrangularis, Persea americana and Tamarindus indicus. The plants used for kidney problems are Theobroma cacao, Chamaesyce hirta, Flemingia strobilifera, Peperomia rotundifolia, Petiveria alliacea, Nopalea cochinellifera, Apium graveolens, Cynodon dactylon, Eleusine indica, Gomphrena globosa, Pityrogramma calomelanos and Vetiveria zizanioides. Plants are also used for gall stones and for cooling. Conclusion Chamaesyce hirta, Cissus verticillata, Kalanchoe pinnata, Peperomia spp., Portulaca oleraceae, Scoparia dulcis, and Zea mays have sufficient evidence to support their traditional use for urinary problems, "cooling" and high cholesterol

  1. Characterization of rue extract and its potential for controlling rice blast

    Directory of Open Access Journals (Sweden)

    Karinna Bannach Reis

    2015-12-01

    Full Text Available Abstract: The objective of this work was to purify and standardize the rue (Ruta graveolens extract and evaluate its effect on Magnaporthe oryzae as an alternative to the integrated management of rice blast. The drug was characterized, the liquid extract was obtained, and the methodology for quantifying the standard markers psoralen and bergapten was validated. Rue extract and the markers, solely or in combination, were assayed in vitro, as well as in greenhouse conditions, for their ability to suppress leaf blast, by the evaluation of mycelial growth, conidial germination, and appressorium formation. Rue extract inhibited M. oryzae mycelial growth (100%, conidial germination (LD50=0.237 mg, and the appressorium formation (LD50=0.121 mg; besides, the extract reduced leaf blast severity by 80.84%. Fluorescence microscopy showed that rue extract did not damage M. oryzae cell wall and plasma membrane, indicating another mode of action. Rue extract has a great potential for controlling rice leaf blast.

  2. Antifungal activity of plant-derived essential oils on Candida tropicalis planktonic and biofilms cells.

    Science.gov (United States)

    Souza, Caio Marcelo Cury; Pereira Junior, Silvio Alves; Moraes, Thaís da Silva; Damasceno, Jaqueline Lopes; Amorim Mendes, Suzana; Dias, Herbert Júnior; Stefani, Ricardo; Tavares, Denise Crispim; Martins, Carlos Henrique Gomes; Crotti, Antônio Eduardo Miller; Mendes-Giannini, Maria José Soares; Pires, Regina Helena

    2016-07-01

    Dental prosthesis supports Candida species growth and may predispose the oral cavity to lesions. C. tropicalis has emerged as a colonizer of prosthesis and has shown resistance to clinically used antifungal agents, which has increased the search for new antifungals. This work describes the effectiveness of fifteen essential oils (EOs) against C. tropicalis The EOs were obtained by hydrodistillation and were chemically characterized by gas chromatography-mass spectrometry. The antifungal activities of the EOs were evaluated by the microdilution method and showed that Pelargonium graveolens (Geraniaceae) (PG-EO) was the most effective oil. Geraniol and linalool were the major constituents of PG-EO. The 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT) assay showed that all the clinical C. tropicalis strains formed viable biofilms. Scanning electron microscopy examination of the biofilms revealed a complex architecture with basal layer of yeast cells and an upper layer of filamentous cells. Treatments with PG-EO, linalool, and geraniol significantly reduced the number of viable biofilm cells and inhibited biofilm formation after exposure for 48 h. PG-EO, geraniol, and linalool were not toxic to normal human lung fibroblasts (GM07492A) at the concentrations they were active against C. tropicalis Together, our results indicated that C. tropicalis is susceptible to treatment with PG-EO, geraniol, and linalool, which could become options to prevent or treat this infection. PMID:26868902

  3. Petroleum contamination of soil and water, and their effects on vegetables by statistically analyzing entire data set.

    Science.gov (United States)

    Zhang, Juan; Fan, Shu-kai; Yang, Jun-cheng; Du, Xiao-ming; Li, Fa-sheng; Hou, Hong

    2014-04-01

    Aliphatic hydrocarbons have been used to assess total oil concentrations, petroleum sources, and petroleum degradation. In this study, surface soil, groundwater, surface water, and vegetables were collected from the outskirts of Xi'an, the largest city in northwestern China, and the samples were analyzed for aliphatic hydrocarbon contents. The concentrations of n-alkanes were 1.06-4.01 μg/g in the soil. The concentrations and the geochemical characteristics of n-alkanes showed that the low carbon number hydrocarbons were mainly from petroleum sources, whereas the high carbon number hydrocarbons received more hydrocarbons from herbaceous plants. The concentrations of n-alkanes were 9.20-93.44 μg/L and 23.74-118.27 μg/L in the groundwater and the surface water, respectively. The water had characteristics of petroleum and submerged/floating macrophytes and was found in concentrations that would cause chronic disruption of sensitive organisms. The concentrations and geochemical characteristics of n-alkanes in Brassica chinensis L. and Apium graveolens were different, but both were contaminated by petroleum hydrocarbons. The results from principal component analysis (PCA) indicated that the sorption of n-alkanes to soil particles could not be described by linear models. The distributions of n-alkanes in vegetables were positively correlated with those in soil, and the correlation coefficient was up to 0.9310 using the constructed vectors. Therefore, the researchers should pay close attention to the effect of soil contamination on vegetables. PMID:24468500

  4. Inibição do crescimento micelial de Cercospora calendulae Sacc. por extratos de plantas medicinais

    Directory of Open Access Journals (Sweden)

    J.M. Nascimento

    2013-01-01

    Full Text Available O uso de extratos e óleos essenciais de plantas medicinais tem sido amplamente estudado no controle de doenças de plantas. O objetivo da realização do presente trabalho foi avaliar o efeito de extratos de Ruta graveolens L., Mentha x villosa, Calendula officinalis L., Momordica charantia L., Symphytum officinale L., Ageratum conyzoides L. e Ricinus comunis L., nas concentrações de 0, 250, 500, 1000, 2000, 5000 e 10000 mg L-1, sobre a inibição do crescimento micelial de Cercospora calendulae Sacc. in vitro. Os extratos foram obtidos por infusão. O experimento foi desenvolvido no Laboratório de Fitopatologia da FCA/UFGD, estado de Mato Grosso do Sul, em delineamento inteiramente casualizado, esquema fatorial 7 extratos x 7 concentrações, com seis repetições. Foi detectado efeito dos extratos e suas concentrações sobre o crescimento do fungo, sendo a interação significativa. Os extratos de calêndula, arruda, hortelã e melão de São Caetano, nas maiores concentrações resultaram em maiores porcentagens de inibição, próximas de 100%, 30%, 35% e 40%, respectivamente, a 10000 mg L-1.

  5. In vitro activity of essential oils extracted from condiments against fluconazole-resistant and -sensitive Candida glabrata.

    Science.gov (United States)

    Soares, I H; Loreto, É S; Rossato, L; Mario, D N; Venturini, T P; Baldissera, F; Santurio, J M; Alves, S H

    2015-09-01

    In the present study, the antifungal activity of essential oils obtained from Origanum vulgare (oregano), Cinnamomum zeylanicum (cinnamon), Lippia graveolens (Mexican oregano), Thymus vulgaris (thyme), Salvia officinalis (sage), Rosmarinus officinalis (rosemary), Ocimum basilicum (basil) and Zingiber officinale (ginger) were assessed against Candida glabrata isolates. One group contained 30 fluconazole-susceptible C. glabrata isolates, and the second group contained fluconazole-resistant isolates derived from the first group after the in vitro induction of fluconazole-resistance, for a total of 60 tested isolates. The broth microdilution methodology was used. Concentrations of 50μg/mL, 100μg/mL, 200μg/mL, 400μg/mL, 800μg/mL, 1600μg/mL and 3200μg/mL of the essential oils were used, and the minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) were determined. Thyme, sage, rosemary, basil and ginger essential oils showed no antifungal activity at the tested concentrations. Antimicrobial activity less than or equal to 3200μg/mL was observed for oregano, Mexican oregano and cinnamon essential oils. Both the oregano and Mexican oregano essential oils showed high levels of antifungal activity against the fluconazole-susceptible C. glabrata group, whereas the cinnamon essential oil showed the best antifungal activity against the fluconazole-resistant C. glabrata isolates. PMID:26281965

  6. Repellency of oils of lemon eucalyptus, geranium, and lavender and the mosquito repellent MyggA natural to Ixodes ricinus (Acari: Ixodidae) in the laboratory and field.

    Science.gov (United States)

    Jaenson, Thomas G T; Garboui, Samira; Palsson, Katinka

    2006-07-01

    MyggA Natural (Bioglan, Lund, Sweden) is a commercially available repellent against blood-feeding arthropods. It contains 30% of lemon-scented eucalyptus, Corymbia citriodora (Hook.) K. D. Hill & L. A. S. Johnson (Myrtaceae), oil with a minimum of 50% p-menthane-3,8-diol. MyggA Natural also contains small amounts of the essential oils of lavender, Lavandula angustifolia Mill. (Lamiaceae), and geranium, Pelargonium graveolens L'Her. (Geraniaceae). In laboratory bioassays, MyggA Natural and C. citriodora oil exhibited 100% repellency against host-seeking nymphs of Ixodes ricinus (L.) (Acari: Ixodidae). Lavender oil and geranium oil, when diluted to 1% in 1,2-propanediol, had weak repellent activities on I. ricinus nymphs, but when diluted to 30% in 1,2-propanediol had 100% repellencies. 1,2-Propanediol (100%) had no significant repellent activity in comparison with that of the control. In field tests in tick-infested areas in central Sweden, tick repellency of MyggA Natural and C. citriodora oil was tested by the blanket-dragging technique for 4 d during a 6-d period. The repellencies (74 and 85%, respectively) on day 1 are similar (89%) to that of blankets treated in a similar manner with 19% diethyl-methyl-benzamide, based on previous work. Repellencies declined significantly from day 1 to day 6 (74 to 45% for MyggA Natural; 85 to 42% for C. citriodora oil). PMID:16892632

  7. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils

    Directory of Open Access Journals (Sweden)

    Valéria Maria Lara

    2016-01-01

    Full Text Available This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano, Origanum vulgaris (oregano, Thymus vulgaris (thyme, Rosmarinus officinalis (rosemary, Cymbopogon nardus (citronella, Cymbopogon citratus (lemongrass, and Eucalyptus citriodora (eucalyptus against Escherichia coli (n=22 strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL−1; MBC mean = 2618 μg mL−1, thyme (MIC mean = 2618 μg mL−1; MBC mean = 2909 μg mL−1, and oregano (MIC mean = 3418 μg mL−1; MBC mean = 4800 μg mL−1 showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL−1. Our results confirm the antimicrobial potential of some essential oils, which deserve further research.

  8. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils

    Science.gov (United States)

    Carregaro, Adriano Bonfim; Santurio, Deise Flores; de Sá, Mariangela Facco; Santurio, Janio Moraes; Alves, Sydney Hartz

    2016-01-01

    This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano), Origanum vulgaris (oregano), Thymus vulgaris (thyme), Rosmarinus officinalis (rosemary), Cymbopogon nardus (citronella), Cymbopogon citratus (lemongrass), and Eucalyptus citriodora (eucalyptus) against Escherichia coli (n = 22) strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL−1; MBC mean = 2618 μg mL−1), thyme (MIC mean = 2618 μg mL−1; MBC mean = 2909 μg mL−1), and oregano (MIC mean = 3418 μg mL−1; MBC mean = 4800 μg mL−1) showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL−1. Our results confirm the antimicrobial potential of some essential oils, which deserve further research. PMID:27313638

  9. Ethnobotany and antibacterial activity of some plants used in traditional medicine of Zapotitlán de las Salinas, Puebla (México).

    Science.gov (United States)

    Hernández, T; Canales, M; Avila, J G; Duran, A; Caballero, J; Romo de Vivar, A; Lira, R

    2003-10-01

    The village of Zapotitlán de las Salinas is situated in the Valley of Tehuacán-Cuicatlán, Puebla, Mexico. Plant species used by the local inhabitants to treat gastrointestinal diseases were identified using ethnobotanical, ethnographic and taxonomic methods. Out of 119 interviews, 44 plant species were registered, of which the following are the most frequently used (listed in descending order): Lippia graveolens H.B. et K. (Verbenaceae), Lantana achyranthifolia Desf. (Verbenaceae), Turnera diffusa (Willd.) ex Schult. (Turneraceae), Lippia oaxacana Rob. et Greenm. (Verbenaceae), Gymnolaena oaxacana (Greenm.) Rydb. (Asteraceae), Cordia curassavica (Jacq.) Roem. et Schult. (Boraginaceae), Lantana camara L. (Verbenaceae) and Acalypha hederacea Torrey (Euphorbiaceae). From these plants, hexane, chloroform and ethanol extracts were prepared in order to assess their antibacterial activity against 14 bacterial strains causing the most common gastrointestinal diseases in Mexican population. All hexane extracts showed antibacterial activity against Gram-positive and Gram-negative bacteria. There is a correlation between the frequency of mention (of plant use) and the antibacterial activity. In conclusion, the knowledge of plants most frequently used for gastrointestinal infections in Zapotitlán de las Salinas is supported by scientific rationale. PMID:12963140

  10. Chemical composition of selected Saudi medicinal plants

    Directory of Open Access Journals (Sweden)

    Ihsanullah Daur

    2015-05-01

    Full Text Available Medicinal plants are important in traditional medicine and modern pharmaceutical drugs; therefore, the interest in the analysis of their chemical composition is increasing. In this study, selected medicinal plants including Achillea fragrantissima (Forssk Sch., Amaranthus viridis L., Asteriscus graveolens (Forssk. Less., Chenopodium album L., and Conyza bonariensis (L. Cronquist were collected from the rangeland of western regions (Bahra and Hada areas of Saudi Arabia to study their chemical composition. Eight minerals (Mg, Ca, Cr, Mn, Fe, Co, Cu, and Zn, total phenolic contents, antioxidant activity, and free-radical scavenging ability were examined in order to evaluate the medicinal potential of these plants. All the plants were found to be rich sources of minerals and antioxidants, although there were significant differences (p < 0.05 in their chemical composition, which may provide a rationale for generating custom extracts from specific plants depending on the application. The findings of this study will thus facilitate herbalists in their efforts to incorporate these plants into various formulations based on their chemical composition.

  11. Use of ionizing radiation to ensure the safety of pre-cut fresh vegetables

    International Nuclear Information System (INIS)

    The determination of D10 values for two Escherichia coli strains (an ATTC and a wild type), Listeria innocua, and a non toxigenic strain of Escherichia coli O157:H7 was carried out in different vegetal products. The studied products -celery (Apium graveolens), cabbage (Lactuca sativa var. capitata), iceberg lettuce (Lactuca sativa var. capitata), carrots (Daucus carota L.), spinach (Spinacia oleracea) and two mixed salads (Toscana, containing chopped iceberg lettuce (Lactuca sativa var. capitata), red cabbage (Brassica oleraceae var. rubra) and shredded carrot (Daucus carota L.) and Four Seasons, a mixture of chopped romaine lettuce (Lactuca sativa var. longifolia), iceberg lettuce (Lactuca sativa var. capitata), Butterhead lettuce (Lactuca sativa var. acephala) and spinach (Spinacia oleraceae) - were minimally processed. The effect of irradiation with 5 D10 doses on the natural microflora and on the sensory characteristics, during refrigerated storage, of the non inoculated products, was also studied. After irradiating with 5 D10 doses, a considerable reduction in the initial contamination of the studied vegetables was obtained. No significant variation of the microbiological counts of the irradiated products was observed during the refrigerated storage, while in the non-irradiated samples a progressive increase up to 3.5 logs in some vegetables was observed. In general, no significant changes in the sensory parameters were observed after irradiation and during seven days storage at refrigeration temperature (4 deg. C). (author)

  12. Assessment of the transfer of 137Cs in three types of vegetables consumed in Hong Kong

    International Nuclear Information System (INIS)

    A dynamic food chain model has been built for the modeling of the transfer of 137Cs in three types of vegetables consumed in Hong Kong, namely, white flowering cabbage (Brassica chinensis), head lettuce (Lactuca sativa) and celery (Apium graveolens). Some parameters have been estimated from the experimental data obtained in this work. The experimental data include the transfer factors of 137Cs from soil to the different vegetable species which are determined through high resolution gamma spectrometry, maximum crop biomasses for the vegetable species, the dry-to-fresh ratios for the vegetable species, the bulk density of soil layers and the average concentration of 137Cs in air. The derived parameters include the deposition rate and the root uptake rate, information for tillage, the logistic growth model and radionuclide concentrations in vegetables. The dynamic food chain model is solved by the Birchall-James algorithm to give the 137Cs concentration in subsurface soil, from the 0.1-25 cm soil layer, and the 137Cs concentration in harvested and unwashed vegetables. As validation of the model and parameters, the concentrations obtained experimentally and from the model are compared and are found to be in good agreement

  13. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas

    Directory of Open Access Journals (Sweden)

    Liliana Osorio Salazar

    2009-04-01

    Full Text Available En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique, Cyperus rotundus L (coquito, Sorghum bicolor L (sorgo, y Ruta graveolens L (ruda sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga y Amaranthus dubius Mart (bledo y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo como solventes. Los extractos obtenidos se evaluaron en tres diluciones (0, 5 y 10 % en pruebas de germinación de semillas de las arvenses y del cultivo. Se emplearon tres repeticiones de 50 semillas cada una y el testigo se regó con agua destilada. Los extractos etanólicos y clorofórmicos de coquito y fique en las diluciones al 5 y 10 % presentaron el mayor efecto inhibitorio en la germinación a los 21 días. El ensayo de campo demostró el efecto inhibitorio de los extractos etanólicos de fique y coquito en la emergencia de las semillas del cilantro. El análisis de metabolitos secundarios comprobó la presencia de compuestos reportados como altamente tóxicos en fique y en menor cantidad en coquito, aunque los extractos de éste fueron los que más inhibieron la germinación.

  14. Nondestructive Raman analysis of polyacetylenes in apiaceae vegetables.

    Science.gov (United States)

    Roman, Maciej; Baranski, Rafal; Baranska, Malgorzata

    2011-07-27

    Food plants from the Apiaceae family have been found to demonstrate health-promoting properties. Polyacetylenes are bioactive compounds that are considered to contribute substantially to the beneficial properties of Apiaceae plants. This study applied a Raman mapping technique in the investigation of polyacetylene spatial distribution in fresh roots of some Apiaceae species. Fresh root sections were measured directly without any preliminary preparation. For three Apiaceae species, that is, parsnip ( Pastinaca sativa L.), celeriac ( Apium graveolens var. rapaceum L.), and parsley ( Petroselinum crispum ), the presence of polyacetylenes was confirmed due to the detection of strong and well-separated Raman signals of symmetric -C ≡ C-C ≡ C- stretching vibration in the range of 2200-2300 cm(-1). The spectra were used for generation of two-dimensional maps applying the integration and cluster analysis methods. The Raman maps visualized the distribution of total polyacetylenes as well as individual compounds. Heterogeneous and tissue-specific occurrence of polyacetylenes in roots is shown. PMID:21682272

  15. Ethnoveterinary medicines used to treat endoparasites and stomach problems in pigs and pets in British Columbia, Canada.

    Science.gov (United States)

    Lans, Cheryl; Turner, Nancy; Khan, Tonya; Brauer, Gerhard

    2007-09-30

    This paper documents the medicinal plants used to treat endoparasites and stomach problems in dogs, cats and pigs in British Columbia, Canada. Ethnoveterinary data was collected over a 6-month period in 2003. The majority of the information on pets came from 2 naturopaths, 10 herbalists, 5 dog trainers, breeders and pet shop owners, 9 holistic veterinarians and 6 of 27 organic farmers. Two pig farmers joined the study in the final stages. The following plants were used as anthelmintics: Artemisia cina O. Berg and C.F. Schmidt, Artemisia vulgaris L., Artemisia annua, Calendula officinalis L., Echinacea purpurea (L.) Moench (all Asteraceae), Mentha piperita L. and Salvia officinalis L. (Lamiaceae) (Allium sativum L. (Alliaceae), Cucurbita pepo L. (Cucurbitaceae), Eugenia caryophyllata Thunb (Myrtaceae), Gentiana lutea L. (Gentianaceae), Hydrastis canadensis L. (Ranunculaceae), Juglans nigra L. (Juglandaceae), Olea europaea L. (Oleaceae) and Ruta graveolens L. (Rutaceae)). Stomach problems were treated with: Achillea millefolium L. (Asteraceae), Aloe vera (L.) Burm. f. (Asphodelaceae), Elytrigia repens (L.) Desv. ex Nevski (Poaceae), Frangula purshiana (DC.) Cooper (Rhamnaceae), Juniperus communis L. (Cupressaceae), Melissa officinalis L. and M. piperita L. (Lamiaceae), Petroselinum crispum L. (Apiaceae), Plantago major L. and Plantago ovata Forssk. (Plantaginaceae) Rumex crispus L. and Rumex obtusifolius L. (Polygonaceae), Ulmus fulva Michx. (Ulmaceae) and Zingiber officinalis Roscoe (Zingiberaceae). There is insufficient information available to assess the anthelmintic efficacies of C. officinalis, Salvia officinalis, Eugenia caryophyllata and O. europaea; the other plants have mid- to high-level validity for their ethnoveterinary uses. PMID:17628343

  16. Wet season precipitation during the past century reconstructed from tree-rings of a tropical dry forest in Southern Ecuador

    Science.gov (United States)

    Pucha-Cofrep, Darwin; Peters, Thorsten; Bräuning, Achim

    2015-10-01

    This study investigates the dendroclimatic potential of tree species in a tropical dry forest in southern Ecuador. From 10 selected tree species, Bursera graveolens and Maclura tinctoria exhibited distinct annual and cross-datable tree-rings. It was possible to synchronize individual tree-ring series and to establish two tree-ring chronologies of 203 and 87 years length, respectively. The characteristic ENSO frequency band is reflected in wavelet power spectra of both chronologies. Both species show a strong correlation between ring width and precipitation of the wet season (January-May). Strong El Niño events (1972, 1983 and 1998) lead to strong growth responses in the tree-ring chronologies, whereas 'normal' ENSO events do not trigger long-lasting growth responses. The first ring-width based wet-season precipitation reconstruction for the past 103 years was developed. Statistical and spatial correlation analysis verified the skills of the reconstructed precipitation which captures a great part of the Rainfall Index over the land area of Ecuador and the equatorial Pacific. Furthermore, teleconnections with central Pacific precipitation and SST patterns were found.

  17. Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis

    Directory of Open Access Journals (Sweden)

    Bruce Veronez

    2012-04-01

    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%; e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis.

  18. Case report: pulicosis por Ctenocephalides felis felis en ovinos y caprinos en la sabana de Bogotá, Colombia

    Directory of Open Access Journals (Sweden)

    Efraín Benavides Ortiz

    2010-06-01

    Full Text Available In Colombia the rearing of hair sheep and goats are expanding in various regions for being an alternative for meat and milk production at competitive prices due to their adaptability and easiness to digest rough fodder. Among the ectoparasites that affect small ruminants traditionally are recognized the lice and the sheep keds Melophagus ovinus (Díptera: Hippoboscidae, however fleas are not included. Here the occurrence of the common cat flea Ctenocephalides felis felis (Díptera: Siphonaptera affecting sheep and goats in a farm at the Sabana de Bogotá are described an so there was performed an epidemiological and parasitological evaluation. The barn maintained animals in rotational grazing at an approximated stocking rate of 25 head/ha, receiving additional supplements of hay and silage. The presence of the flea was confirmed in sheep and goats, young and adult, as well as in dogs. Diverse degrees of anemia were evidenced but the association between flea infestation and anemia, or the presence of other anemia producing agents could not be studied. In the farm synthetic parasiticides are not used, extracts of Ruda (Ruta graveolens are administered to mitigate parasitosis, without major efficacy. Sheep and goat breeders in the tropics should consider flea infestation as an agent causing adverse animal welfare situations in their farms. Control should start from the knowledge of the life cycle of the flea, trying to interrupt it.

  19. Characterization of gallotannins from Astronium species by flow injection analysis- electrospray ionization-ion trap-tandem mass spectrometry and matrix-assisted laser desorption/ionization time-of- flight mass spectrometry.

    Science.gov (United States)

    da Silva, Viviane Cândida; Napolitano, Assunta; Eletto, Daniela; Rodrigues, Clenilson Martins; Pizza, Cosimo; Vilegas, Wagner

    2011-01-01

    The species Astronium urundeuva (Allemao) Engl. and Astronium graveolens Jacq., which are used in Brazilian folk medicine to treat allergies, inflammation, diarrhea and ulcers, were investigated for their composition. The aim of this study was to define a rapid and reliable analytical approach, based on the flow-injection analysis-electrospray ionization-ion trap-tandem mass spectrometry (FIA-ESI-IT-MS-MS) and matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-ToF-MS), to investigate the full range of hydrolyzable tannins present in the extracts of these Astronium species. The MALDI-ToF-MS analysis allowed us to ascertain the presence of hydrolysable tannins in both Astronium species as a series of gallotannins with degrees of polymerization of 7 to 13 galloyl units. Moreover, the analysis by FIA-ESI-IT-MS-MS, as well as confirming this result and chemically defining gallotannins as galloylglucose compounds, highlighted the presence of further classes of hydrolysable tannins, such as hexahydrodiphenoyl esters of glucose and some gallic acid derivatives, providing information about their structure by a careful study of their fragmentation patterns. Finally, the evaluation of the number of positional isomers of gallotannins occurring in both Astronium species was obtained by high-performance liquid chromatography-electrospray ionization-ion trap mass spectrometry (HPLC/ESI-IT-MS). This is the first mass spectrometric evidence relating to the existence of gallotannins in Astronium genus. PMID:22006629

  20. A novel coumarin derivative, 8-methoxy chromen-2-one alleviates collagen induced arthritis by down regulating nitric oxide, NFκB and proinflammatory cytokines.

    Science.gov (United States)

    Sahu, Debasis; Raghav, Sunil Kumar; Gautam, Hemlata; Das, Hasi R

    2015-12-01

    Ruta graveolens (Rue) is a well-known medicinal plant having anti-inflammatory and other healing properties. This contains many active phytochemicals such as coumarins which possess anti-inflammatory and anti-cancer activities. The present study was carried out to evaluate the therapeutic potential of a newly isolated coumarin derivative from rue plant, 8-methoxy-chromen-2-one (MCO) in the collagen induced arthritic (CIA) rat model. MCO showed inhibition of cytokines and NF-κB in LPS stimulated J774 cells which prompted its possible use in animal. In CIA, arthritic index and arthritic score reduced markedly within 15days of MCO treatment at doses of 2mg and 20mg per kg body weight. Alleviation of joint damage in CIA animals on treatment with MCO was evident from radiographic and histological data. Behavioral studies by open field tests also showed convalescence in the MCO treated CIA rats. Further, escalated plasma levels of pro-inflammatory cytokines TNF-α, IL-1β and IL-6, and also nitric oxide reduced significantly with the treatment. All these results indicate the therapeutic efficacy of MCO and its possible use as an anti-arthritic drug. PMID:26440401

  1. Efficacy of plant derived oils and extracts against white-fly, bemisia tabaci (gennadius) on sesame crop

    International Nuclear Information System (INIS)

    Whitefly, Bemisia tabaci (Genn.) is a polyphagous pest and is reported on more than 600 host plants worldwide. Different methods are being used for its control. The present experiment was conducted to determine the effect of some plant extracts of mint (Mentha spp.) and gera-nium (Pelargonium graveolens) and soybean oil (Glycine max), mustard oil (Brassica spp.) and taramera oil (Eruca sativa) against whitefly, Bemisia tabaci on sesame crop. The data were recorded 24h before and 24h, 48h, 72h and 168h after application of each spray material. The results showed that whitefly population was significantly suppressed by both the botanical oils and extracts as compared to the control treatment but in general botanical oils showed significant results as compared to plant extracts. Soybean oil was quite effective in reducing whitefly population per leaf, while after second spray soybean oil and extract of Mentha spp. was more effective in the reducing whitefly population per leaf. The results indicated that plant derived oils and extracts have the potential to be used in plant protection strategies but still more research has to be incorporated in the pest management programmes. (author)

  2. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils.

    Science.gov (United States)

    Lara, Valéria Maria; Carregaro, Adriano Bonfim; Santurio, Deise Flores; de Sá, Mariangela Facco; Santurio, Janio Moraes; Alves, Sydney Hartz

    2016-01-01

    This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano), Origanum vulgaris (oregano), Thymus vulgaris (thyme), Rosmarinus officinalis (rosemary), Cymbopogon nardus (citronella), Cymbopogon citratus (lemongrass), and Eucalyptus citriodora (eucalyptus) against Escherichia coli (n = 22) strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL(-1); MBC mean = 2618 μg mL(-1)), thyme (MIC mean = 2618 μg mL(-1); MBC mean = 2909 μg mL(-1)), and oregano (MIC mean = 3418 μg mL(-1); MBC mean = 4800 μg mL(-1)) showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL(-1). Our results confirm the antimicrobial potential of some essential oils, which deserve further research. PMID:27313638

  3. Anticancer Effects of HESA-A:An Herbal Marine Compound

    Institute of Scientific and Technical Information of China (English)

    Amrollah Ahmadi; Gholamreza Habibi; Mehdi Farrokhnia

    2010-01-01

    @@ HESA-A,a natural biological compound,is a mixture of herbal-marine substances that includes Penaeus latisculatus (king prawn),Carum carvi and Apium graveolens with anticancer properties(1,2).Although the exact mechanism of action of HESA-A on tumor cells is not fully understood,it appears to have multiple pharmacological effects(2). The lack of selectivity for tumor cells,which is associated with conventional cancer chemotherapy,is the main cause of chemotherapy complications and failure of anticancer agents.Many complementary and alternative medicine (CAM) studies are focused on products obtained from plants,animals or other natural sources to find compounds with high therapeutic indices.HESA-A inhibits the growth of cancer cells selectively and in a dose dependent manner.At the highest concentration (5.4 mg/mL),HESA-A completely inhibits the growth of cells and this effect gradually decreases as the dose is reduced.HESA-A is not cytotoxic towards normal cell lines unlike cancer cells.A major concern in this selectivity effect is the possible interaction with the cell DNA.The apoptotic effects of HESA-A may also have a major role in its anticancer properties(3,4).

  4. Impact of UV radiation on activity of linear furanocoumarins and Bacillus thuringiensis var. kurstaki against Spodoptera exigua: Implications for tritrophic interactions

    International Nuclear Information System (INIS)

    Acidic fogs with a pH of 2.0 and duration of 2 hr did not reduce the efficacy of Bacillus thuringiensis var. kurstaki. Therefore, the impact of UV radiation was investigated on the interactions between (1) levels of the antibacterial linear furanocoumarins psoralen, bergapten, and xanthotoxin in Apium graveolens (L.) occurring following a 2.0 pH acidic fog episode, (2) the noctuid Spodoptera exigua, and (3) a sublethal dosage of the microbial pathogen B. thuringiensis var. kurstaki. Mean time to pupation in the absence of UV radiation was significantly extended by the addition of either psoralens or B. thuringiensis. Larvae developing on diets containing B. thuringiensis plus psoralens required nearly 40% longer to pupate than controls, but their effects were additive as the interaction was not significant. Mean time to mortality, a weighted average time of death, was not significantly affected by any of the treatments. In a 2 x 2 x 2 factorial analysis, all main effects reduced survival significantly, as did the three-way interaction. Thus, antagonistic interactions with psoralens that would reduce the effectiveness of B. thuringiensis in the field were not observed. When pairs of main effects were nested within the two levels of the third factor, several two-way interactions were found. Interestingly, the activity of B. thuringiensis and the psoralens, individually or in combination, was enhanced by exposure to UV radiation. Implications of this research are discussed for both natural and agricultural ecosystems

  5. Inhibitory effect of essential oils against Trichosporon ovoides causing Piedra Hair Infection

    Directory of Open Access Journals (Sweden)

    Seema Saxena

    2012-12-01

    Full Text Available Piedra, is an asymptomatic fungal infection of the hair shaft, resulting in the formation of nodules of different hardness on the infected hair. The infection also known as Trichomycosis nodularis is a superficial fungal infection arising from the pathogen being restricted to the stratum corneum with little or no tissue reaction. The nodules are a concretion of hyphae and fruiting bodies of the fungus. Two varieties of Piedra may be seen, Black Piedra and White Piedra. The fungus Trichosporon ovoides is involved in the occurrence of both types of Piedras. The purpose of this study was to examine the effectiveness of selected essential oils for the control of growth of the fungus and to determine whether the antifungal effect was due to the major compounds of the oils. Two screening methods viz. Agar well diffusion assay and Minimum Inhibitory Concentration were adopted for the study. MIC and MFC were determined by tube dilution method. Essential oils from Eucalyptus, Ocimum basilicum, Mentha piperita, Cymbopogon flexuosus, Cymbopogon winterians, Trachyspermum ammi, Zingiber officinalis, Citrus limon, Cinnamomon zeylanicum, Salvia sclarea, Citrus aurantifolia, Melaleuca alternifolia, Citrus aurantium, Citrus bergamia, Pogostemon pathchouli, Cedrus atlantica, Jasminum officinale, Juniperus communis, Abelmoschus moschatus, Cyperus scariosus, Palargonium graveolens, Boswellia carterii, Rosa damascene, Veteveria zizanoides and Commiphora myrrha were evaluated. The essential oils of Cymbopogon winterians, Mentha piperita, Cinnamomum zeylanicum, Melaleuca alternifolia and Eucalyptus globulus were proved to be most effective against the fungus Trichosporon ovoides.

  6. Comparison of the Antioxidant Capacity of an Important Hepatoprotective Plants

    Directory of Open Access Journals (Sweden)

    Vivek Kumar R

    2011-01-01

    Full Text Available Currently there has been an increased interest globally to identify antioxidant compounds that are pharmacologically potent and have low or no side effects for use in preventive medicine and the food industry. As plants produce significant amount of antioxidants to prevent the oxidative stress caused by photons and oxygen, they represent a potential source of new compounds with antioxidant activity. Commonly used medicinal plant extracts with standardized content of polyphenols were investigated for their antioxidant activity (AA. In the present paper ten plants (Picrorrhiza kurroa, Tephrosia purpurea, Terminalia arjuna, Tinospora cordifolia, Glycyrrhiza glabra, Azadirachta indica, Apium graveolens, Swertia chirata, Phyllanthus amarus, and Aloe vera and their possible constituents responsible for its antioxidant property were compared by reducing power, 2, 2-diphenyl-1-picrylhydrazyl (DPPH scavenging activity method. The plants described contain antioxidant principles that can explain and justify their use in traditional medicine (Hepatoprotective in the past as well as the present. These results suggest that AA determination is of interest for a comparative evaluation of in vitro antioxidant potential, but it needs to be combined with in vivo data for adequate assessment of the antioxidant capacity of medicinal plant extracts.

  7. Chemical composition and antimicrobial activity of the essential oils from four Ruta species growing in Algeria.

    Science.gov (United States)

    Haddouchi, Farah; Chaouche, Tarik Mohammed; Zaouali, Yosr; Ksouri, Riadh; Attou, Amina; Benmansour, Abdelhafid

    2013-11-01

    Antimicrobial properties of plants essential oils have been investigated in order to suggest them as potential tools to overcome the microbial drug resistance and the increasing incidence of food borne diseases problems. The aim of this research is to study the antibacterial and antifungal effects of four traditional plants essential oils, Ruta angustifolia, Ruta chalepensis, Ruta graveolens and Ruta tuberculata, against standard bacterial and fungal strains. The chemical compounds of the oils were examined by GC/MS. Results revealed a powerful antifungal activity against filamentous fungi. Aspergillus fumigatus and Cladosporium herbarum are the most sensitive strains to these oils with MIC values less than 3.5 μg ml(-1) for certain oils, reaching 7.8 μg ml(-1) for other. GC/MS essay exhibited ketones as the most abundant constituent of these oils except for R. tuberculata essential oil which has a completely different composition, monoterpenes alcohols being the most abundant. These compositions explain their potential antifungal activity. PMID:23768355

  8. Comparative study of the assay of Artemia salina L. and the estimate of the medium lethal dose (LD50 value) in mice, to determine oral acute toxicity of plant extracts.

    Science.gov (United States)

    Logarto Parra, A; Silva Yhebra, R; Guerra Sardiñas, I; Iglesias Buela, L

    2001-09-01

    Artemia salina L. (Artemiidae), the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemical and natural products. In this study the Medium Lethal Concentrations (LC50 value) of 20 plant extracts, Aloe vera (L.) Burm. F. (Aloeaceae), Artemisia absinthium L. (Asteraceae); Citrus aurantium L. (Rutaceae); Cymbopogon citratus (DC. Ex Nees) Stapf (Poaceae); Datura stramonium L. (Solanaceae); Justicia pectoralis Jacq. (Acanthaceae); Musa x paradisiaca L. (Musaceae); Ocimum basilicum L.; O. gratissimum L.; O. tenuiflorum L. (Lamiaceae); Pimenta dioica (L.) Merr. (Myrtaceae); Piper auritum Kunth (Piperaceae); Plantago major L. (Plantaginaceae); Plectranthus amboinicus (Lour.) Spreng. (Lamiaceae); Ruta graveolens L. (Rutaceae); Senna alata (L.) Roxb. (Fabaceae); Stachytarpheta jamaicensis (L.) Vahl (Verbenaceae); and Thuja occidentalis L. (Cupressaceae), were determined using Artemia salina L. (Artemiidae), with the objective of relating the results to the LD50 values reported in mice (tested at three concentrations: 10, 100, and 1000 microg/mL, for each extract). We found good correlation between the in vivo and the in vitro tests (r = 0.85 p < 0.05), and this method is a useful tool for predicting oral acute toxicity in plant extracts. PMID:11695884

  9. Cadmium uptake by plants

    Energy Technology Data Exchange (ETDEWEB)

    Haghiri, F.

    1973-01-01

    Absorption of /sup 115m/Cd by soybean (Gylcine max l.) plants via foliar and root systems and translocation into the seed was determined. The uptake of /sup 115m/Cd by soybeans via the root system was more efficient than that of the foliar placement. Growth and Cd concentrations of soybean and wheat (Triticum aestivum l.) tops were influenced by soil-applied Cd. In both crops, the Cd concentration of plant tops increased while yield decreased with increasing levels of applied Cd. Cadmium toxicitiy began to occur in both crops at the lowest level of soil applied Cd (2.5 ppM). With soybean plants, Cd toxicity symptoms resembled fe chlorosis. For wheat plants there were no visual symptoms other than the studied growth. The relative concentration of Cd found in several vegetable crops varied depending on the plant species. The relative Cd concentration in descending order for various vegetables was lettuce (Lactuca sativa l.) > radish top (Raphanus sativus l.) > celery stalk (Apium graveolens l.) > celery leaves greater than or equal to green pepper (Capsicum frutescens l.) > radish roots.

  10. Herbs of interest to the Brazilian Federal Government: female reproductive and developmental toxicity studies

    Directory of Open Access Journals (Sweden)

    Luiz Fernando Verissimo

    2011-12-01

    Full Text Available In 2009 the Brazilian Ministry of Health published a document named RENISUS that lists 71 herbs traditionally used in Brazil that could result in phytomedicines to be dispensed by the governmental health care program. This manuscript reviews female reproductive and/or developmental toxicity information of these herbs. More than half (35 of the herbs lack information regarding female reproductive and/or developmental effects. From the fourteen herbs used traditionally to disturb female reproduction, five present experimental data corroborating their actions as abortifacients (Maytenus ilicifolia, Momordica charantia, Plectranthus barbatus, Ruta graveolens or labour facilitator (Bidens pilosa. For 23 of the herbs evaluated experimentally for any type of female reproductive endpoint, only a single study was retrieved and at least twelve of these studies were conducted with a single dose. This scenario suggests that the scientific power of the published information is very low and that a scientifically-based risk/benefit analysis about the use of these herbs during pregnancy is not possible. Considering the appeal that phytomedicines have for pregnant women, usually aware and afraid of the risks that synthetic drugs may have in their pregnancy and progeny, well designed studies evaluating reproductive and/or developmental toxicity of these herbs urge.

  11. Fertilization and colors of plastic mulch affect biomass and essential oil of sweet-scented geranium.

    Science.gov (United States)

    Silva, Anderson de Carvalho; Blank, Arie Fitzgerald; dos Santos, Wallace Melo; Prata, Paloma Santana; Alves, Péricles Barreto; Arrigoni-Blank, Maria de Fátima

    2014-01-01

    Sweet-scented geranium (Pelargonium graveolens L'Hér), a plant belonging to the Geraniaceae family, has medicinal and aromatic properties and is widely used in the cosmetic, soap, perfume, aromatherapy, and food industries. The aim of this study was to evaluate the influence of fertilization and the use of different colors of plastic mulch on sweet-scented geranium biomass and essential oil. Three colors of plastic mulch (black, white, and silver-colored) and a control without plastic mulch were assessed along with three fertilizers (20,000 L · ha(-1) of cattle manure; 1,000 kg · ha(-1) of NPK 3-12-6; and 20,000 L · ha(-1) of cattle manure + 1,000 kg · ha(-1) of NPK 3-12-6 fertilizer) and a control without fertilizer. The absence of a soil cover negatively influenced the agronomical variables, while coverage with plastic mulch was associated with increased biomass. The use of fertilizer had no effect on the evaluated agronomic variables. When cattle manure and NPK 3-12-6 were used together, combined with white or black plastic mulch, the highest yields of essential oil were obtained. For the silver-colored plastic mulch, higher amounts of essential oil (6,9-guaiadien) were obtained with mineral fertilizer. PMID:24757440

  12. Unusual carbon partitioning during phosphate deficiency in celery, a mannitol-synthesizing species

    International Nuclear Information System (INIS)

    Mannitol and sucrose are the main photosynthetic products and translocated carbon compounds in celery (Apium graveolens L.). Carbon partitioning was studied in greenhouse-grown celery plants supplied with a nutrient solution containing or lacking phosphate (P). P-deficient plants developed new leaves at about the same rate as control plants, but showed greatly reduced growth of leaves and petioles; root growth was apparently unaffected. P-deficient leaves contained less mannitol and more sucrose than control leaves. Starch content increased with P-deficiency only in mature (the most photosynthetically-active) leaves, and then amounted to less than 10 mg/g fresh weight. Similarly, when 14CO2 was supplied to intact plants, P-deficient leaves contained less label in mannitol and more in sucrose than did control leaves; labeling of starch changed little. The P-status of celery leaves apparently affects the partitioning of carbon between mannitol and sucrose more than it affects starch accumulation. This is in marked contrast to the large increase in starch content commonly observed during P-deficiency in species that produce and translocate predominantly sucrose

  13. Arabidopsis POLYOL TRANSPORTER5, a new member of the monosaccharide transporter-like superfamily, mediates H+-Symport of numerous substrates, including myo-inositol, glycerol, and ribose.

    Science.gov (United States)

    Klepek, Yvonne-Simone; Geiger, Dietmar; Stadler, Ruth; Klebl, Franz; Landouar-Arsivaud, Lucie; Lemoine, Rémi; Hedrich, Rainer; Sauer, Norbert

    2005-01-01

    Six genes of the Arabidopsis thaliana monosaccharide transporter-like (MST-like) superfamily share significant homology with polyol transporter genes previously identified in plants translocating polyols (mannitol or sorbitol) in their phloem (celery [Apium graveolens], common plantain [Plantago major], or sour cherry [Prunus cerasus]). The physiological role and the functional properties of this group of proteins were unclear in Arabidopsis, which translocates sucrose and small amounts of raffinose rather than polyols. Here, we describe POLYOL TRANSPORTER5 (AtPLT5), the first member of this subgroup of Arabidopsis MST-like transporters. Transient expression of an AtPLT5-green fluorescent protein fusion in plant cells and functional analyses of the AtPLT5 protein in yeast and Xenopus oocytes demonstrate that AtPLT5 is located in the plasma membrane and characterize this protein as a broad-spectrum H+-symporter for linear polyols, such as sorbitol, xylitol, erythritol, or glycerol. Unexpectedly, however, AtPLT5 catalyzes also the transport of the cyclic polyol myo-inositol and of different hexoses and pentoses, including ribose, a sugar that is not transported by any of the previously characterized plant sugar transporters. RT-PCR analyses and AtPLT5 promoter-reporter gene plants revealed that AtPLT5 is most strongly expressed in Arabidopsis roots, but also in the vascular tissue of leaves and in specific floral organs. The potential physiological role of AtPLT5 is discussed. PMID:15598803

  14. Antifungal Activity of Essential Oils from Some Medicinal Plants of Iran against Alternaria alternate

    Directory of Open Access Journals (Sweden)

    I. Hadizadeh

    2009-01-01

    Full Text Available Problem statement: Increasing public concern over the level of pesticide residues in food especially fresh produce has built up adequate pressure for scientists to look for less hazardous and environmentally safer compounds for controlling post harvest diseases. Essential oils as registered food grade materials have the potential to be applied as alternative anti-fungal treatments for fresh fruits and vegetables. Approach: We present in this study, the identification of the essential oils with antifungal activity from some medicinal plants of Iran (nettle (Urtica dioica L., thyme (Thymus vulgaris L., eucalyptus (Eucalyptus spp., Rue (Ruta graveolens L. and common yarrow (Achillea millefolium L., and their potential application as "generally regarded as safe" antifungal compounds against Alternaria alternate on tomato as a model pathosystem. Results: Both the nettle and the thyme oils exhibited antifungal activity against A. alternata. The thyme oil exhibited a lower degree of inhibition 68.5 and 74.8% at 1500 and 2000 ppm, respectively. Spore germination and germ tube elongation of the pathogens in potato dextrose broth was strongly reduced in the presence of 1500 ppm of the nettle oil. The same concentration of this oil reduced the percentage of decayed tomatoes. The experiments on reducing the development of natural tomato rot gave similar results. Conclusions: Application of essential oils for postharvest disease control of fresh produce, as a novel emerging alternative to hazardous anti-fungal treatments will allow a safer and environmentally more acceptable management of postharvest diseases.

  15. Effects of essential oils on the growth of Giardia lamblia trophozoites.

    Science.gov (United States)

    Machado, Marisa; Sousa, Maria do Céu; Salgueiro, Lígia; Cavaleiro, Carlos

    2010-01-01

    Giardia lamblia is one of the most important worldwide causes of intestinal infections produced by protozoa. Current therapy for giardiasis is unsatisfactory due to high incidence of undesirable side effects and significant failure in clearing parasites from the gastrointestinal tract. In the search for new therapeutic agents, we report on the effect of several essential oils on G. lamblia growth. Among eighteen tested essential oils, those with phenolic compositions were the most active, particularly if containing high contents of carvacrol, such as Thymbra capitata and Origanum virens (IC50 values of 71 and 85 microg x mL(-1), respectively). The oils from Syzygium aromaticum and Thymus zygis subsp. sylvestris (IC50 values from 100 to 200 microg x mL(-1)), as well as, those from Mentha x piperita and Lippia graveolens (IC50 values over 200 microg x mL(-1)) were less active. Results support the concept that several essential oils or some of their constituents may be useful in the clinical management of Giardia infections. PMID:20184039

  16. Use of Monoclonal Antibodies in an ELISA for Detecting an Invasive Pest Insect, Liriomyza trifolii (Diptera: Agromyzidae).

    Science.gov (United States)

    Zhao, W C; Shang, H W; Guo, W; Xu, D; Huang, T Y; Zhu, L X

    2015-04-01

    A monoclonal antibody was prepared by the hybridoma technology. It reacted only with the protein of Liriomyza trifolii (Burgess) and not with that of Chromatomyia horticola Goureau or Liriomyza sativae Blanchard in indirect enzyme-linked immunosorbent assay. It was effective even after being diluted more than 8.192×10(6)-fold. The detection sensitivity of the antibody was 31.3 µg/ml under controlled conditions. Positive reaction was achieved with all laboratory-reared L. trifolii samples, including larvae, pupae, and adults. An indirect enzyme-linked immunosorbent assay system was successfully established to detect L. trifolii in the field. This antibody was successfully used to determine the L. trifolii collected in different locations, from different host plants, and in different seasons. More than 50% of leafminers collected on Brassica chinensis var chinensis, Apium graveolens (Miller) Persoon, Vigna unguiculata (L.) Walpers, Phaseolus vulgaris L., Lactuca sativa L., and Chrysanthemum coronarium (L.) Cassini ex Spach were L. trifolii, indicating that those six plant species might be the preference host plants of L. trifolii. Population of L. trifolii peaked in September, October, or November in Hangzhou, Zhejiang. These results suggest a great potential of using this McAb for precisely identifying L. trifolii and monitoring the population dynamics of L. trifolii in the field. PMID:26470159

  17. Plantas medicinales. Diez años de evaluaciones toxicogenéticas en el CIDEM

    Directory of Open Access Journals (Sweden)

    Janet PILOTO FERRER

    2009-01-01

    Full Text Available Se compiló toda la información de los resultados obtenidos en los ensayos toxicogenéticos, en el período de 1998 al 2008 realizados a extractos vegetales utilizados por la población cubana llevados a cabo en el laboratorio de Genética toxicológica del CIDEM. Se emplearon dos sistemas de ensayos a corto plazo, la prueba in vitro de reversión bacteriana Salmonella/microsoma y el ensayo in vivo de inducción de micronúcleos en médula ósea de ratón. Se evidencian resultados descriptivos en cuanto al % de familias y de especies evaluadas por ensayos comparados con el total de la flora cubana. Solamente se resaltan aquellos extractos que indujeron una respuesta positiva en los ensayos y de esta forma alertar a las autoridades sanitarias y a nuestra población de tales efectos. Los extractos vegetales con actividad genotóxica fueron: extracto acuoso de Ruta graveolens L., extracto acuoso de Indigophera suffructicosa Mill y extracto hidroalcohólico de Tamarindus indica L.

  18. Fertilization and Colors of Plastic Mulch Affect Biomass and Essential Oil of Sweet-Scented Geranium

    Directory of Open Access Journals (Sweden)

    Anderson de Carvalho Silva

    2014-01-01

    Full Text Available Sweet-scented geranium (Pelargonium graveolens L’Hér, a plant belonging to the Geraniaceae family, has medicinal and aromatic properties and is widely used in the cosmetic, soap, perfume, aromatherapy, and food industries. The aim of this study was to evaluate the influence of fertilization and the use of different colors of plastic mulch on sweet-scented geranium biomass and essential oil. Three colors of plastic mulch (black, white, and silver-colored and a control without plastic mulch were assessed along with three fertilizers (20,000 L·ha−1 of cattle manure; 1,000 kg·ha−1 of NPK 3-12-6; and 20,000 L·ha−1 of cattle manure + 1,000 kg·ha−1 of NPK 3-12-6 fertilizer and a control without fertilizer. The absence of a soil cover negatively influenced the agronomical variables, while coverage with plastic mulch was associated with increased biomass. The use of fertilizer had no effect on the evaluated agronomic variables. When cattle manure and NPK 3-12-6 were used together, combined with white or black plastic mulch, the highest yields of essential oil were obtained. For the silver-colored plastic mulch, higher amounts of essential oil (6,9-guaiadien were obtained with mineral fertilizer.

  19. Aplicación de un modelo experimental de valoración económica del uso y manejo de la flora colombiana. Estudio de caso: Meliaceae y Anacardiaceae

    Directory of Open Access Journals (Sweden)

    Campos Héctor Aníbal

    2006-12-01

    Full Text Available Se proponen un modelo y un indicador de valoración económica como alternativas para valorar el uso y
    manejo de la flora colombiana y se aplican a nueve especies de Meliaceae y Anacardiaceae: Swietenia macrophylla
    King (caoba, Cedrela odorata L. (cedro, Carapa guianensis Aubl. (carapa, andiroba o tangare, Guarea guidonia
    (L. Sleumer (trompillo, Anacardium occidentale L. (marañón, Anacardium giganteum Hancock ex Engler (marañón gigante, Spondias mombin L. (hobo, Camnosperma panamense Standl. (sajo y Astronium graveolens Jacq. (diomate o quiebracha. El modelo y el indicador propuestos integran todos los tópicos que se consideraron partícipes del valor económico de las especies en dos grandes aspectos: el biológico y el biocultural y socioeconómico. El indicador produce un valor aproximado de la especie valorando los aspectos contemplados en el modelo a través de cinco componentes: valor actual de uso, valor actual de importancia cultural, valor actual de los productos y servicios, valor potencial de los productos y servicios y estatus de la información. Con su aplicación en el estudio de caso se determinó a Cedrela odorata como la especie más valiosa.

  20. Activity of essential oils from spices against Staphylococcus spp. isolated from bovine mastitis

    Directory of Open Access Journals (Sweden)

    M Dal Pozzo

    2011-10-01

    Full Text Available Avaliou-se a atividade antimicrobiana dos óleos essenciais (OE de Origanum vulgare (orégano, Thymus vulgaris (tomilho, Lippia graveolens (lipia, Zingiber officinale (gengibre, Salvia officinalis (sálvia, Rosmarinus officinalis (alecrim e Ocimum basilicum (manjericão, e de suas frações majoritárias, carvacrol e timol, frente a 32 isolados de Staphylococcus spp, oriundos de rebanhos leiteiros bovinos. A concentração inibitória mínima (CIM e a concentração bactericida mínima foram determinadas por meio da técnica de microdiluição em caldo. Orégano, tomilho e lípia (Orégano Mexicano apresentaram atividade antimicrobiana similar, médias geométrica de CIM de 1600µg mL-1; 1564µg mL-1; 1562µg mL-1, respectivamente, no entanto menos ativos que carvacrol, 584µg mL-1 e thymol, 427µg mL-1. Isolados com diferentes perfis de susceptibil idade aos antimicrobianos usados no tratamento de mastite bovina, quando subagrupados, foram inibidos por concentrações semelhantes de OE . Estes resultados confirmam a atividade antimicrobiana de OE e algumas frações majoritárias.

  1. Plant compounds insecticide activity against Coleoptera pests of stored products

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Marcio Dionizio; Picanco, Marcelo Coutinho; Guedes, Raul Narciso Carvalho; Campos, Mateus Ribeiro de; Silva, Gerson Adriano; Martins, Julio Claudio [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Animal]. E-mail: marcio.dionizio@gmail.com; picanco@ufv.br; guedes@ufv.br; mateusc3@yahoo.com.br; agronomiasilva@yahoo.com.br

    2007-07-15

    The objective of this work was to screen plants with insecticide activity, in order to isolate, identify and assess the bioactivity of insecticide compounds present in these plants, against Coleoptera pests of stored products: Oryzaephilus surinamensis L. (Silvanidae), Rhyzopertha dominica F. (Bostrichidae) and Sitophilus zeamais Mots. (Curculionidae). The plant species used were: basil (Ocimum selloi Benth.), rue (Ruta graveolens L.), lion's ear (Leonotis nepetifolia (L.) R.Br.), jimson weed (Datura stramonium L.), baleeira herb (Cordia verbenacea L.), mint (Mentha piperita L.), wild balsam apple (Mormodica charantia L.), and billy goat weed or mentrasto (Ageratum conyzoides L.). The insecticide activity of hexane and ethanol extracts from those plants on R. dominica was evaluated. Among them, only hexane extract of A. conyzoides showed insecticide activity; the hexane extract of this species was successively fractionated by silica gel column chromatography, for isolation and purification of the active compounds. Compounds 5,6,7,8,3',4',5'-heptamethoxyflavone; 5,6,7,8,3'-pentamethoxy-4',5'-methilenedioxyflavone and coumarin were identified. However, only coumarin showed insecticide activity against three insect pests (LD{sub 50} from 2.72 to 39.71 mg g{sup -1} a.i.). The increasing order of insects susceptibility to coumarin was R. dominica, S. zeamais and O. surinamensis. (author)

  2. Composition, antioxidant and antimicrobial activities of methanol extracts of some Acinos Miller species.

    Science.gov (United States)

    Golubović, Tatjana; Palić, Radosav; Kitić, Dusanka; Stojanović, Gordana; Zlatković, Bojan; Ristić, Mihailo; Pavlović, Dragana

    2014-05-01

    GC and GC/MS analyses of the methanol extracts obtained from the aerial parts of six Acinos Miller species from Serbia and Montenegro were performed. Seventy-four constituents, accounting for 84.9-99.0% of the total composition of the extracts, were identified. The common feature of the A. suaveolens, A. majoranifolius and A. alpinus methanol extracts was the high content of monoterpenes, while the common feature of the A. graveolens, A. arvensis and A. hungaricus methanol extracts was the prevalence of sesquiterpenes. The total flavonoids, polyphenols and tannins content, as well as antioxidant activity (FRAP and DPPH assay) of the methanolic extracts were investigated. The highest antioxidant activity was observed in the extract of A. alpinus which had high levels of all polyphenol classes examined. A disk diffusion method was used for the evaluation of the antimicrobial activities of the extracts against a panel of microorganisms (bacteria: Bacillus subtilis, Clostridium pyogenes, Enterococcus sp., Micrococcus flavus, Sarcina lutea, Staphylococcus aureus, Klebsiella pneumoniae, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella enteritidis and Escherichia coli; fungi: Aspergillus niger, Candida albicans and Saccharomyces cerevisiae). The preliminary bioassay results indicated that the methanol extract of A. alpinus could be a possible source of antioxidant and antimicrobial compounds. PMID:25026735

  3. In vitro activity of essential oils extracted from plants used as spices against fluconazole-resistant and fluconazole-susceptible Candida spp.

    Science.gov (United States)

    Pozzatti, Patrícia; Scheid, Liliane Alves; Spader, Tatiana Borba; Atayde, Margareth Linde; Santurio, Janio Morais; Alves, Sydney Hartz

    2008-11-01

    In the present study, the antifungal activity of selected essential oils obtained from plants used as spices was evaluated against both fluconazole-resistant and fluconazole-susceptible Candida spp. The Candida species studied were Candida albicans, Candida dubliniensis, Candida tropicalis, Candida glabrata, and Candida krusei. For comparison purposes, they were arranged in groups as C. albicans, C. dubliniensis, and Candida non-albicans. The essential oils were obtained from Cinnamomum zeylanicum Breyn, Lippia graveolens HBK, Ocimum basilicum L., Origanum vulgare L., Rosmarinus officinalis L., Salvia officinalis L., Thymus vulgaris L., and Zingiber officinale. The susceptibility tests were based on the M27-A2 methodology. The chemical composition of the essential oils was obtained by gas chromatography-mass spectroscopy and by retention indices. The results showed that cinnamon, Mexican oregano, oregano, thyme, and ginger essential oils have different levels of antifungal activity. Oregano and ginger essential oils were found to be the most and the least efficient, respectively. The main finding was that the susceptibilities of fluconazole-resistant C. albicans, C. dubliniensis, and Candida non-albicans to Mexican oregano, oregano, thyme, and ginger essential oils were higher than those of the fluconazole-susceptible yeasts (Pcinnamon essential oil than their fluconazole-susceptible counterparts (P<0.05). A relationship between the yeasts' susceptibilities and the chemical composition of the essential oils studied was apparent when these 2 parameters were compared. Finally, basil, rosemary, and sage essential oils did not show antifungal activity against Candida isolates at the tested concentrations. PMID:18997851

  4. Effect of homeopathic medicines on transplanted tumors in mice.

    Science.gov (United States)

    Es, Sunila; Kuttan, Girija; Kc, Preethi; Kuttan, Ramadasan

    2007-01-01

    Ultra low doses used in homeopathic medicines are reported to have healing potential for various diseases but their action remains controversial. In this study we have investigated the antitumour and antimetastatic activity of selected homeopathic medicines against transplanted tumours in mice. It was found that Ruta graveolens 200c and Hydrastis canadensis 200c significantly increased the lifespan of Ehrlich Ascites Carcinoma and Dalton's Lymphoma Ascites induced tumour-bearing animals by 49.7%, and 69.4% respectively. Moreover there was 95.6% and 95.8% reduction of solid tumour volume in Ruta 200c and Hydrastis 200c treated animals on the 31st day after tumour inoculation. Hydrastis 1M given orally significantly inhibited the growth of developed solid tumours produced by DLA cells and increased the lifespan of tumour bearing animals. Some 9 out of 15 animals with developed tumors were completely tumour free after treatment with Hydrastis 1M. Significant anti-metastatic activity was also found in B16F-10 melanoma-bearing animals treated with Thuja1M, Hydrastis 1M and Lycopodium1M. This was evident from the inhibition of lung tumour nodule formation, morphological and histopathological analysis of lung and decreased levels of gamma-GT in serum, a cellular marker of proliferation. These findings support that homeopathic preparations of Ruta and Hydrastis have significant antitumour activity. The mechanism of action of these medicines is not known at present. PMID:18159975

  5. DESARROLLO DE APIO MINIMAMENTE PROCESADO FORTIFICADO CON VITAMINA E, UTILIZANDO LA INGENIERIA DE MATRICES

    Directory of Open Access Journals (Sweden)

    YISELL JOHAN MARTELO CASTAÑO

    2011-01-01

    Full Text Available El objetivo de este trabajo fue desarrollar un producto minimamente procesado fortificado con vitamina E, a partir de apio (Apium graveolens L. var.dulce, utilizando la ingenieria de matrices como metodologia de obtencion de alimentos funcionales. Trozos de apio impregnados al vacio con dl¿¿tocoferol acetato emulsificado en una solucion isotonica al vegetal de NaCl, 1,2%, fueron evaluados en funcion del tiempo de almacenamiento y el envasado (con y sin vacio, en terminos de la cuantificacion de sus propiedades fisicoquimicas, color, textura, estabilidad de la vitamina E y caracteristicas sensoriales. Se formulo la emulsion con el objetivo de adicionar teoricamente un 73% del Valor Diario Recomendado (VDR vitamina E/100 g de apio fresco y su cuantificacion se realizo por HPLC. La respuesta a la impregnacion en la matriz fue de 12,10+-1,15%, lo cual permitio alcanzar un 112% VDR vitamina E/100g apio fresco, manteniendose este contenido durante el almacenamiento de 9 dias en ambos tipos de envasado. Los parametros fisicoquimicos del producto fueron afectados por la IV, el tiempo y el envasado, manteniendo su coloracion verdosa y presentando disminucion en la firmeza. La ingenieria de matrices constituye una metodologia efectiva para el desarrollo de apio minimamente procesado adicionado con vitamina E.

  6. Antibacterial activity of extracts from some edible plants commonly consumed in Asia.

    Science.gov (United States)

    Alzoreky, N S; Nakahara, K

    2003-02-15

    Extracts of edible plants (26 species) from China, Japan, Thailand and Yemen were screened for their antibacterial activity against Bacillus cereus, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli and Salmonella infantis. Buffered methanol (80% methanol and 20% PBS) and acetone extracted inhibitory substances against tested bacteria from 16 plants, as revealed by the disc assay. The minimum inhibitory concentrations (MICs) of extracts determined by the agar dilution method ranged from 165 to 2640 mg l(-1). The most sensitive microorganism to extracts from Azadirachta indica, Cinnamomum cassia, Rumex nervosus, Ruta graveolens, Thymus serpyllum and Zingiber officinale was B. cereus, with MIC of 165 to 660 mg l(-1). E. coli and S. infantis were only inhibited by Cinnamomum cassia extracts at the highest MIC (2640 mg l(-1)). L. monocytogenes (Tottori) was more resistant than the ATCC 7644 strain to extracts from Ruta chalepensis, Artemisia absinthium and Cissus spp. EDTA (0.85 mM) reduced the MICs of Cinnamomum cassia and Cissus rotundifolia by at least 50% when tested against E. coli, S. infantis, S. aureus and L. monocytogenes. PMID:12423924

  7. Selecting iodine-enriched vegetables and the residual effect of iodate application to soil.

    Science.gov (United States)

    Dai, Jiu-Lan; Zhu, Yong-Guan; Zhang, Min; Huang, Yi-Zhong

    2004-12-01

    A greenhouse pot experiment was conducted to select vegetables for iodine uptake. The residual effect of iodate fertilization on the growth of and iodine uptake by spinach plants were also investigated. Six vegetables, including leafy vegetables (pakchoi [Brassica chinensis L.], spinach [Spinacia oleracea L.]), tuber vegetables (onion [Allium cepa L.]), shoot vegetables (water spinach [Ipomoea aquatica Forsk.], celery [Apium graveolens L.]), and root vegetables (carrot [Daucus carota var. sativa DC.]) were examined. Results showed that the concentrations of iodate in soil had significant effect on the biomass of edible parts of pakchoi and spinach (p<0.01), whereas the concentrations of iodate in soil had no significant effect on that of carrots, water spinach, celery, and onion. Iodine concentrations in edible parts of vegetables and the transfer factors (TFedible parts) of soil-to-edible parts of vegetables significantly increased with increasing iodine concentrations in soil (p<0.001), and iodine concentrations in edible parts and TFedible parts of spinach were much higher than those of other vegetables at any treatment. Both transfer coefficients for edible parts (TCedible parts) and for aerial parts (TCaerial parts) of vegetables changed differently with increasing iodine concentrations in the soil, and TCedible parts and TCaerial parts of spinach were higher than those of other vegetables. Therefore, spinach was considered as an efficient vegetable for iodine biofortification. Further experiment showed that there is considerable residual effect of soil fertilization with iodate. PMID:15564656

  8. Linalool Affects the Antimicrobial Efficacy of Essential Oils.

    Science.gov (United States)

    Herman, Anna; Tambor, Krzysztof; Herman, Andrzej

    2016-02-01

    The high concentrations of essential oils are generally required to receive microbial purity of the products (cosmetics, medicine). On the other hand, their application due to the high concentration of essential oils may be limited by changes in organoleptic and textural quality of the products, as well as they cause irritation and allergies in users. Addition of linalool to essential oil may significantly enhance its antimicrobial effectiveness and reduce their concentrations in products, taking advantage of their synergistic and additive effects. The aim of the study was to compare antimicrobial activity of essential oil alone and in combination with linalool. The antimicrobial activity of the essential oil of Thymus vulgaris, Juniperus communis, Pelargonium graveolens, Citrus bergamia, Citrus grandis, Lavandula angustifolia, Cinnamomum zeylanicum, Melaleuca alternifolia, Syzygium aromaticum, linalool and their combination was investigated against bacteria and fungi using the disc diffusion method. The addition of linalool to S. aromaticum oil in a synergistic manner enhanced its antimicrobial efficacy against P. aeruginosa and A. brasiliensis. Moreover, the additive interaction between this oil and linalool was observed against S. aureus, E. coli and C. albicans. It was also found that linalool in an additive manner increased the antimicrobial effectiveness of T. vulgaris oil against P. aeruginosa. The antimicrobial properties of mixture of essential oils with their active constituents may be used for creating new strategies to maintain microbiological purity of products. PMID:26553262

  9. Response of Listeria monocytogenes-inoculated leafy salad vegetables following irradiation and refrigerated storage under modified atmosphere. Section 1. Radiation sensitivity and quality of fresh cut vegetables exposed to gamma irradiation

    International Nuclear Information System (INIS)

    This section summarizes research on quality of irradiated vegetables. Thirteen fresh-cut (minimally processed) vegetables (broccoli (Brassica oleracea italica), cilantro (Coriandrum sativum), red cabbage (Brassica oleracea capitata), endive (Cichorium endivia), parsley (Petroselinum crispum), green and red leaf lettuce (L. sativa), Iceberg (Lactuca sativa var. capitata) and Romaine lettuce (Lactuca sativa), spinach (Spinacia oleracea), carrots (Daucus carota), green onions, (Allium cepa) and celery (Apium graveolens dulce) plus alfalfa sprouts (Medicago sativa) were gamma irradiated at doses up to 3 kGy at 0.5 kGy intervals. The samples were then stored in air at 4 deg. C for 14 days. At the beginning and end of 14 days, electrolyte leakage, visual quality, and sogginess were assessed. Results showed that electrolyte leakage of vegetables increased linearly with increasing radiation doses when measured immediately after irradiation. Radiation dose threshold, defined as the dose at which electrolyte leakage was significantly (P<0.05) increased, varied among vegetables, ranging from 2.44 kGy for broccoli to 0.60 kGy for carrots. Irradiation had no effect on visual quality on the day of irradiation. After 14 days of storage, the responses of individual vegetables to ionizing radiation varied greatly. Irradiation, especially at lower doses, improved visual quality, and reduced sogginess and electrolyte leakage of many vegetables. It appears that most tested vegetables can tolerate 0.6 kGy radiation based on appearance and electrolyte leakage measurements. The implication and limitation of the results are discussed. (author)

  10. Efeito repelente de azadiractina e óleos essenciais sobre Aphis gossypii Glover (Hemiptera: Aphididae em algodoeiro Repellent effect of azadirachtin and essential oils on Aphis gossypii Glover (Hemiptera: Aphididae in cotton plants

    Directory of Open Access Journals (Sweden)

    Lígia Helena de Andrade

    2013-09-01

    Full Text Available A repelência de inseticidas botânicos tem se destacado como uma tática promissora no controle alternativo de pragas agrícolas e urbanas, podendo ser um dos componentes do manejo integrado de pragas. Objetivou-se com este trabalho identificar a repelência de inseticidas botânicos sobre fêmeas ápteras de Aphis gossypii Glover. Testes com chance de escolha foram realizados com discos de folha de algodoeiro, imersos nas caldas dos inseticidas e testemunha (água destilada com DMSO a 2%. Utilizou-se azadirachtina (0,075% e os óleos essenciais de Piper hispidinervum CDC, P. aduncum L., Cymbopogon winterianus (L., C. citratus (D.C. Stapf, Foeniculum vulgare Mill, Syzygium aromaticum (L. Merrill e Perry, Cinnamomum zeylanicum Blume, Schinus terebinthifolius Raddi e Chenopodium ambrosioides L. na concentração de 0,05%. C. citratus, C. winterianus, P. aduncum, S. terebinthifolius, azadirachtina e C. zeylanicum apresentaram os maiores percentuais de repelência, 100; 84; 66,67; 64; 60,87 e 48% respectivamente e reduziram a produção de ninfas em 100; 92; 42,9; 87,5; 80,65 e 89,74%, apresentando resultados significativos pelo teste do χ2 ao nível de 10% de probabilidade. Nos testes com F. vulgare (χ2 = 3,66, P = 0,05 as fêmeas de A. gossypii foram atraídas significativamente para os discos tratados e ocorreu um aumento na produção de ninfas nos resultados obtidos para F. vulgare (χ2 = 5,87, P = 0,02 e C. ambrosioides (χ2 = 14,31, P = 0,001.The repellence of botanical insecticides has emerged as a promising technique in the alternative control of urban and agricultural pests, being seen as one component of integrated pest management. The aim of this work was to identify the repellence of botanical insecticides on apterous females of Aphis gossypii Glover. Random-choice tests were carried out with discs from the leaves of cotton plants immersed in insecticide solution and in a control (distilled water with 2% DMSO. Azadirachtin was used

  11. Fungos endofíticos associados a plantas medicinais Endophytic fungi associated with medicinal plants

    Directory of Open Access Journals (Sweden)

    V Mussi-Dias

    2012-01-01

    Full Text Available Com a utilização de plantas medicinais em infusões, xaropes, tinturas, ungüentos, dentre outras formas, pressupõe-se que fungos endofíticos, presentes no interior das plantas, mas sem causar doença, possam tornar-se um componente destes produtos, principalmente quando utilizados in natura. Além disso, os fungos endofíticos podem também produzir substâncias tóxicas aos usuários ou mesmo alterar o metabolismo vegetal, modificando a composição e as propriedades medicinais, assim como, a qualidade do produto armazenado e comercializado. Neste sentido, objetivou-se isolar e identificar a flora fúngica endofítica de onze espécies medicinais escolhidas ao acaso. Obtiveram-se culturas-puras dos fungos Phomopsis, Colletotrichum, Pestalotia, Trichoderma, Fusarium, Nigrospora e Glomerella ocorrendo endofiticamente em Plectranthus barbatus, Vernonia condensata, Pfaffia paniculata, Foeniculum vulgare, Cymbopogon citratus, Cymbopogon nardus, Cordia curassavica, Maytenus ilicifolia, Punica granatum, Morus nigra e Bauhinia forficata. As espécies vegetais em que se identificaram o maior número de fungos endofíticos foram Vernonia condensata, Punica granatum e Morus nigra. Todos os fungos recuperados neste trabalho apresentaram características estritamente endofíticas, não manifestando patogenicidade nas espécies hospedeiras. Dentre os fungos detectados, especial atenção deve ser dada ao gênero Fusarium, uma vez que inúmeras espécies deste gênero são conhecidas produtoras de micotoxinas e constituem-se em importantes patógenos pós-colheita.With the use of medicinal plants in infusions, syrups, dyes, unguents, among other forms, it is expected that endophytic fungi, present inside the plants but not causing diseases, become components of these products, especially when used in natura. In addition, endophytic fungi can produce toxic substances to the users or even modify the plant metabolism, altering the medicinal composition and

  12. Levantamento etnobotânico de plantas medicinais na cidade de Ipameri - GO Ethnobotanical survey of medicinal plants in Ipameri City - Goiás State

    Directory of Open Access Journals (Sweden)

    M.R. Zucchi

    2013-01-01

    Full Text Available Os objetivos deste trabalho foram: identificar as espécies vegetais utilizadas com fins medicinais pela comunidade de Ipameri (Estado de Goiás; investigar as preferências com relação à produção e comercialização dessas plantas; e diagnosticar o perfil de gênero e as faixas etárias e salariais de seus usuários. Para isso, foram realizadas entrevistas estruturadas com 200 famílias da cidade e coletadas as plantas visando-se a sua correta identificação. O material foi herborizado, identificado e depositado no Herbário da Universidade Estadual de Goiás (HUEG. Das 200 famílias entrevistadas, 75 disseram não fazer uso de plantas com fins medicinais (37,5%, enquanto 125 afirmaram fazê-lo (62,5%. O grupo que utiliza relacionou 35 espécies mais empregadas: hortelã-rasteira (Mentha x villosa L., boldo-sete-dores (Plectranthus barbatus Andrews., capim-cidreira (Cymbopogon citratus (DC. Stapf., quebra-pedra (Phyllanthus niruri L., camomila (Chamomilla recutita (L. Rauschert., poejo (Mentha pulegium L., guaco (Mikania glomerata Spreng., mentrasto (Ageratum conyzoides L., alfavacão (Ocimum gratissimum L., losna (Artemisia canphorata Vill., bálsamo (Eysenhardtia platycarpa Mich., carqueja (Baccharis trimera (Less. DC., funcho (Foeniculum vulgare Mill., babosa (Aloe vera L. e malva (Althaea officinalis L.. Todas as famílias consumidoras (100% afirmaram preferir as plantas cultivadas de forma orgânica, selecionando-as através da boa aparência (68% das famílias e consumindo-as in natura (sem beneficiamento, 100%. A utilização de plantas medicinais em Ipameri é independente do sexo (54%, mulheres e 46%, homens e se estende às várias faixas etárias e também sócio-econômicas, configurando-se assim, um bom mercado consumidor.The aims of this study were: to identify the plant species used for medicinal purposes by the community at Ipameri (Goiás State; to investigate the preferences with respect to the production and marketing

  13. Effects of botanical insecticides on the instantaneous population growth rate of Aphis gossypii Glover (Hemiptera: Aphididae in cotton=Efeitos de inseticidas botânicos na taxa instantânea de crescimento populacional de Aphis gossypii Glover (Hemiptera: Aphididae em algodão

    Directory of Open Access Journals (Sweden)

    Edmilson Jacinto Marques

    2012-04-01

    Full Text Available Botanical insecticides have been studied aiming the alternative pest control. The present study investigated the effects of these insecticides on the instantaneous population growth rate (ri of Aphis gossypii. Botanical insecticides were tested in the following concentrations: Compostonat®, Rotenat-CE® and Neempro (0, 0.50, 0.75, 1.00, 1.25, 1.50 and 1.75%; Natuneem® and Neemseto® (0, 0.25, 0.50, 0.75 and 1.00% and essential oils of Foeniculum vulgare Mill., Cymbopogom winterianus (L., Chenopodium ambrosioides L. and Piper aduncum L (0, 0.0125, 0.025, 0.0375 and 0.05%. Cotton leaf discs, CNPA 8H cultivar with 5 cm in diameter were immersed for 30 seconds in products broth and dried for 30 minutes. Eight replicates per concentration were used and each disc was infested with five apterous adult females of A. gossypii uniform in size and confined for 10 days. Compostonat®, Rotenat® and Neempro provided negative ri decreasing A. gossypii population. Natuneem® and Neemseto® and the essential oil of F. vulgare showed positive ri increasing the population. The coefficients of determination (R2 of regression lines ranged from 0.46 to 0.85. The essential oils of C. winterianus, C. ambrosioides and P. aduncum were not statistically significant precluding the establishment of regression lines.Inseticidas botânicos têm sido estudados, visando o controle alternativo de pragas. O presente trabalho objetivou estudar os efeitos desses inseticidas sobre a taxa instantânea de crescimento populacional (ri de Aphis gossypii. Os inseticidas botânicos foram testados nas seguintes concentrações: Compostonat®, Rotenat-CE® e Neempro (0; 0,50; 0,75; 1,00; 1,25; 1,50 e 1,75%; Nautneem® e Neemseto® (0; 0,25; 0,50; 0,75 e 1,00%; e os óleos essenciais de Foeniculum vulgare Mill., Cymbopogom winterianus (L., Chenopodium ambrosioides L. e Piper aduncum L. (0; 0,0125; 0,025; 0,0375 e 0,05%. Discos de folhas de algodoeiro, cultivar CNPA 8H, com 5 cm de di

  14. Effect of Different Fertilizer Types and Processing Methods on the Nitrite Content of Vegetables%不同施肥种类与加工方法对蔬菜亚硝酸盐含量变化的影响

    Institute of Scientific and Technical Information of China (English)

    谭超; 颜嘉雯; 何牧; 龚加顺

    2010-01-01

    采用盆栽试验的方法,研究了施用不同肥料对不同蔬菜主要生长期中亚硝酸盐含量的动态变化规律,并探讨了不同加工方法对蔬菜亚硝酸盐含量的影响.结果表明,不同种类的氮肥对生菜(Lactuca sativa Linn.var.ramosa Hort.)、茴香(Foeniculum vulgare)、豆腐菜(Basella rubra)、菠菜(Prunella asiatica Nakai)、芫荽(Coriandrum sativum L.)和京白菜(Basella campestris)在生长发育过程中体内亚硝酸盐的积累有显著性影响(P<0.05).成熟期的蔬菜中,亚硝酸盐含量变化规律为:施混合肥料蔬菜>施硝酸铵蔬菜>施硫酸铵蔬菜>未施肥蔬菜.炒制的蔬菜中的亚硝酸盐含量高于煮制.因此,在蔬菜施肥过程中应该尽量少施化肥或施用少量硫酸铵,并进行合理加工.研究结果为绿色蔬菜合理施用氮肥提供科学依据,也为蔬菜合理烹饪提供参考.

  15. Evaluation of antimicrobial and phytochemical screening of Fennel, Juniper and Kalonji essential oils against multi drug resistant clinical isolates

    Institute of Scientific and Technical Information of China (English)

    Sharmishtha Purkayastha; Rittee Narain; Praveen Dahiya

    2012-01-01

    Objective: The inhibitory effects of essential oils including fennel, juniper and kalonji from Foeniculum Vulgare, Juniperus Osteosperma and Nigella Sativa on multi drug resistant clinical isolates were investigated. All the oils have been evaluated for phytochemical constituents, antibacterial activity and TLC bioautography assay. Methods: Preliminary phytochemical analysis was performed. The antibacterial potential of essential oils from fennel, juniper and kalonji fennel, juniper and kalonji was evaluated by agar well diffusion method against multi drug resistant clinical isolates. The antibacterial effect was investigated using the TLC-bioautographic method. Results: Preliminary phytochemical analysis demonstrated the presence of most of the phytochemicals including saponins, cardiac glycosides, steroids, terpenoids, flavonoids and tannins. Antibacterial activity of essential oils was assessed on eight multi-drug resistant (MDR) clinical isolates from both Gram-positive and Gram-negative bacteria and two standard strains. All the oils tested showed significant to moderate antibacterial activity toward all tested strains except Acinetobacter sp and Staphylococcus aureus MRSA. The maximum zone of inhibition was found to be 25依0.12 mm for juniper oil followed by 21依0.085 mm for kalonji oil againstStaphylococcus aureus 2. Thin layer chromatography and bioautography assay demonstrated well-defined growth inhibition zones against Staphylococcus aureus 2 and E. coli for juniper essential oil in correspondence with tannins observed at Rf values of 0.07 and 0.57. Conclusions: Based on the present study, the essential oils from juniper and kalonji possess antibacterial activity against several multi drug resistant pathogenic bacteria and thus can be used as a base for the development of new potent drugs and phytomedicine.

  16. Antibacterial activity against Clostridium genus and antiradical activity of the essential oils from different origin.

    Science.gov (United States)

    Kačániová, Miroslava; Vukovič, Nenad; Horská, Elena; Salamon, Ivan; Bobková, Alica; Hleba, Lukáš; Fiskelová, Martina; Vatľák, Alexander; Petrová, Jana; Bobko, Marek

    2014-01-01

    In the present study, the antimicrobial and antiradical activities of 15 essential oils were investigated. The antimicrobial activities were determined by using agar disc diffusion and broth microdilution methods against Clostridium genus and antioxidant properties of essential oils by testing their scavenging effect on DPPH radicals activities. We determined the antibacterial activity of Clostridium butyricum, Clostridium hystoliticum, Clostridium intestinale, Clostridium perfringens and Clostridium ramosum. We obtained the original commercial essential oils samples of Lavandula angustifolia, Carum carvi, Pinus montana, Mentha piperita, Foeniculum vulgare Mill., Pinus sylvestris, Satureia montana, Origanum vulgare L. (2 samples), Pimpinella anisum, Rosmarinus officinalis L., Salvia officinalis L., Abies alba Mill., Chamomilla recutita L. Rausch and Thymus vulgaris L. produced in Slovakia (Calendula a.s., Nova Lubovna, Slovakia). The results of the disk diffusion method showed very high essential oils activity against all tested strains of microorganisms. The best antimicrobial activity against C. butyricum was found at Pimpinella anisum, against C. hystoliticum was found at Pinus sylvestris, against C. intestinale was found at Satureia hortensis L., against C. perfringens was found at Origanum vulgare L. and against C. ramosum was found at Pinus sylvestris. The results of broth microdilution assay showed that none of the essential oils was active against C. hystoliticum. The best antimicrobial activity against C. butyricum was found at Abies alba Mill., against C. intestinale was found at Abies alba Mill., against C. perfringens was found at Satureia montana and against C. ramosum was found at Abius alba and Carum carvi. Antioxidant DPPH radical scavenging activity was determined at several solutions of oil samples (50 μL.mL(-1)-0.39 μL.mL(-1)) and the best scavenging effect for the highest concentration (50 μL.mL(-1)) was observed. The antioxidant properties

  17. Antioxidant Activity and Ethno pharmacological Survey of Achillea biebersteinii Afan. in the Treatment of Dysmenorrhoea in Traditional Medicine of Golestan Province, Iran

    Directory of Open Access Journals (Sweden)

    Masoumeh Mazandarani

    2015-04-01

    Full Text Available Objectives: Achillea biebersteinii Afan. has been used as antispasmodic and sedative agent to treat dysmenorrhoea in traditional medicine of Golestan province. The present study was conducted to evaluate the antioxidant activity. It is also an ethno pharmacological survey of Achillea biebersteinii Afan., as antispasmodic and sedative agent in treating dysmenorrhoea in traditional medicine of Golestan province. Materials and Methods: Ethno pharmacological data was obtained as field observation among well-known indigenous rural healers (68-82 ages in southwest of Golestan province in August 2011. The data gathered evaluated the potential of Achillea biebersteinii in preventing or treating dysmenorrhoea. Flowers of the plant were collected in July 2012 at an altitude of 2600 meters, ethanol extract was obtained by Maceration and antioxidant capacity was obtained by 1,1-diphenyl-2-picryl hydrazyl radical scavenging (DPPH. Results: Results showed that in traditional medicine of Golestan province, the flowers of Achillea biebersteinii has been used in combination with Peganum harmala, Mentha aquatica, Cuminum cyminum, Foeniculum vulgare and Nigella sativa as antispasmodic, anti-inflammation and sedative agent to treat stomach ache, dysmenorrhoea, facial flushing, cramps and menopause. Also the ethanol extract of the plant is a very good free radical scavenging with the highest antioxidant activity (IC50 = 1.27±0.1 μg/ml in dry weight. Conclusion: These finding not only confirm the use of the plant in the traditional medicine of Golestan province, but also can serve as a basis for phytochemical and pharmaceutical researches to identify and produce effective herbal drugs in prevention or treatment of common dysmenorrhoea.

  18. Türkiye'deki eczanelerde bulunan bitkisel ilaçlar

    Directory of Open Access Journals (Sweden)

    Sevda Süzgeç-Selçuk

    2012-09-01

    Full Text Available u çalışmada, 2012 yılında Türkiye'deki eczanelerde bulunan, Sağlık Bakanlığı ruhsatlı bitkisel ilaçlar incelenerek; formülasyonunda aktif bileşik olarak standardize edilmiş bitkisel drog ekstresi veya drog preparatları bulunan müstahzarlar ele alınmıştır. Bitkilerden kimyasal işlemler sonucu elde edilen, bitkisel kaynaklı saf bileşikler (atropin, morfin, efedrin vb. bitkisel ilaç olarak değerlendirilmediklerinden, bu çalışma kapsamına dahil edilmemiştir. Bu kapsamda, bitkisel ilaçların içeriğindeki; bitkilerinin kullanılan kısımları (drog, etken maddeleri, etki ve kullanılışları incelenmiştir. İncelenen bu bitkiler: Aesculus hippocastanum L., Amygdalus communis L., Allium sativum L., Camellia sinensis (L. Kuntze (Thea sinensis L., Capsicum annuum L., Cassia acutifolia Del. (C. angustifolia Vahl., Centella asiatica L., Cimicifuga racemosa L., Cola nitida (Vent. Schott & Endl., Eucalyptus globulus Labill., Foeniculum vulgare Miller, Ginkgo biloba L., Hamamelis virginiana L., Harpagophytum procumbens DC, Hedera helix L., Lavandula angustifolia Miller, Mentha piperita L., Passiflora incarnata L., Pelargonium sidoides DC., Pinus brutia Tenn., Populus sp., Rheum officinale Baill., Ricinus communis L., Serenoa repens (W. Bart. Small, Silybum marianum L., Thymus vulgaris L., Triticum aestivum L., Valeriana officinalis L, Vitex agnus-castus L., Vitis vinifera L., Zingiber officinale (Roscoe' dir. Sonuç olarak, 2012 yılında Türkiye eczanelerinde Sağlık Bakanlığı ruhsatlı 44 tane bitkisel ilaç tespit edilmiştir.

  19. Insecticidal Activity of Some Traditionally Used Ethiopian Medicinal Plants against Sheep Ked Melophagus ovinus.

    Science.gov (United States)

    Gemeda, Negero; Mokonnen, Walelegn; Lemma, Hirut; Tadele, Ashenif; Urga, Kelbessa; Addis, Getachew; Debella, Asfaw; Getachew, Mesaye; Teka, Frehiwot; Yirsaw, Kidist; Mudie, Kissi; Gebre, Solomon

    2014-01-01

    Twelve medicinal plants and a commercially used drug Ivermectin were examined for insecticidal activity against Melophagus ovinus sheep ked at different time intervals using in vitro adult immersion test. The findings show that at 3.13 µL/mL, 6.25 µL/mL and 12.5 µL/mL concentration of Cymbopogon citratus, Foeniculum vulgare and Eucalyptus globulus essential oils respectively, recorded 100% mortalities against M. ovinus within 3 hour of exposure. Significantly higher insecticidal activity of essential oils was recorded (P = 0.00) when compared to 10  μ g/mL Ivermectin after 3-hour exposure of M. ovinus at a concentration of ≥1.57  μ L/mL, ≥3  μ L/mL, and ≥12.7  μ L/mL essential oils of C. citratus, F. vulgare, and E. globulus, respectively. Among essential oils, C. citratus has showed superior potency at a three-hour exposure of the parasite (P = 0.00) at a concentration of ≥0.78  μ L/mL. Strong antiparasitic activity was recorded by aqueous extract of Calpurnia aurea (80% mortality) at a concentration of 200 mg/mL within 24 h among aqueous extracts of 9 medicinal plants. The results indicated all the four medicinal plants, particularly those tested essential oils, can be considered as potential candidates for biocontrol of M. ovinus sheep ked. PMID:24649357

  20. СРАВНИТЕЛЬНАЯ ОЦЕНКА АНТИОКСИДАНТНОЙ АКТИВНОСТИ ЭФИРНЫХ МАСЕЛ ПРЯНО-АРОМАТИЧЕСКИХ РАСТЕНИЙ МЕТОДОМ КАПИЛЛЯРНОЙ ГАЗОВОЙ ХРОМАТОГРАФИИ

    OpenAIRE

    Самусенко, Алексей

    2010-01-01

    Методом капиллярной газо-жидкостной хроматографии исследованы антиоксидантные свойства эфирных масел черного перца (Capsicum nigrum L.), имбиря (Zingiber officinale L.), кардамона (Elettaria cardamomum), ягод можжевельника (Juniperus pinchoti), фенхеля (Foeniculum officinale), мациса (Myristicia fragans L.), лимонной травы (Cymbopogon citratus) и семян тмина (Carum carvi). Оценка антиоксидантных свойств проведена по реакции окисления транс-2-гексеналя в соответствующую кислоту. Найдено, что н...

  1. ESSENTIAL OILS AND NATURAL ZEOLITE INFLUENCE ON PRODUCTION AND HEALTH PERFORMANCE OF BROILERS, AND MICROBIOLOGICAL CONTAMINATION OF CHICKEN MEAT

    Directory of Open Access Journals (Sweden)

    Brigita Hengl

    2013-12-01

    Full Text Available Essential oils and their components, as a group of phytogenic feed additive, have great potential uses in broiler fattening. Due to their antimicrobial and antioxidant properties and effects on improved food digestibility their positive impact on animals the health status can be expected, and therefore better final fattening results. In this research we studied the impact of XTRACTTM (a combination of essential oils components carvacrol, cinnamaldehid and capsicum Oleoresin, Arom Korm ® (essential oil combination of Foeniculum vulgare and Citrus limon, zeolite and a combination of zeolite with XTRACTTM or Aroma Korma ® on the fattening performance of chickens, their immunostimulating effect, the impact on the antioxidant status of the blood and muscle tissue, the impact on intestine micropopulation of chickens, effect on microbial contamination of meat, the impact on processing performances of broiler chicken and meat properties, and impact on the sensory quality of the chicken meat. The experiment was conducted on Ross 308 broilers, divided into 6 groups (control and treatment groups depending on the different supplements of essential oils, zeolites, or combinations thereof. The fattening lasted 42 days and total of 288 both sex chicks were included (48 per in each group. Influence of the addition of essential oils and natural zeolite had a different impact on the observed individual values. Separately added XTRACTTM and Aroma Korm ® had a good effect on the observed properties of fattening, the technological properties of meat, chicken health status, antioxidant parameters of blood and meat, microbiological contamination and organoleptic properties. Zeolite, as a standalone supplement, had the lowest impact on the observed properties, but in combination with Aroma Korm ® or XTRACTTM, Zeolite improved their activity.

  2. Antimicrobial activity of plant essential oils against bacterial and fungal species involved in food poisoning and/or food decay.

    Science.gov (United States)

    Lixandru, Brînduşa-Elena; Drăcea, Nicoleta Olguţa; Dragomirescu, Cristiana Cerasella; Drăgulescu, Elena Carmina; Coldea, Ileana Luminiţa; Anton, Liliana; Dobre, Elena; Rovinaru, Camelia; Codiţă, Irina

    2010-01-01

    The currative properties of aromatic and medicinal plants have been recognized since ancient times and, more recently, the antimicrobial activity of plant essential oils has been used in several applications, including food preservation. The purpose of this study was to create directly comparable, quantitative data on the antimicrobial activity of some plant essential oils prepared in the National Institute of Research-Development for Chemistry and Petrochemistry, Bucharest to be used for the further development of food packaging technology, based on their antibacterial and antifungal activity. The essential oils extracted from thyme (Thymus vulgaris L.), basil (Ocimum basilicum L.), coriander (Coriandrum sativum L.), rosemary (Rosmarinus officinalis L.), sage (Salvia officinalis L.), fennel (Foeniculum vulgare L.), spearmint (Mentha spicata L.) and carraway (Carum carvi L.) were investigated for their antimicrobial activity against eleven different bacterial and three fungal strains belonging to species reported to be involved in food poisoning and/or food decay: S. aureus ATCC 25923, S. aureus ATCC 6538, S. aureus ATCC 25913, E. coli ATCC 25922, E. coli ATCC 35218, Salmonella enterica serovar Enteritidis Cantacuzino Institute Culture Collection (CICC) 10878, Listeria monocytogenes ATCC 19112, Bacillus cereus CIP 5127, Bacillus cereus ATCC 11778, Candida albicans ATCC 10231, Aspergillus niger ATCC 16404, Penicillium spp. CICC 251 and two E. coli and Salmonella enterica serovar Enteritidis clinical isolates. The majority of the tested essential oils exibited considerable inhibitory capacity against all the organisms tested, as supported by growth inhibition zone diameters, MICs and MBC's. Thyme, coriander and basil oils proved the best antibacterial activity, while thyme and spearmint oils better inhibited the fungal species. PMID:21462837

  3. Chemical Constituents and Combined Larvicidal Effects of Selected Essential Oils against Anopheles cracens (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Jitrawadee Intirach

    2012-01-01

    Full Text Available A preliminary study on larvicidal activity against laboratory-colonized Anopheles cracens mosquitos revealed that five of ten plant oils at concentration of 100 ppm showed 95–100% larval mortality. The essential oils of five plants, including Piper sarmentosum, Foeniculum vulgare, Curcuma longa, Myristica fragrans, and Zanthoxylum piperitum, were then selected for chemical analysis, dose-response larvicidal experiments, and combination-based bioassays. Chemical compositions analyzed by gas chromatography coupled to mass spectrometry demonstrated that the main component in the oil derived from P. sarmentosum, F. vulgare, C. longa, M. fragrans, and Z. piperitum was croweacin (71.01%, anethole (63.00%, ar-turmerone (30.19%, safrole (46.60%, and 1,8-cineole (21.27%, respectively. For larvicidal bioassay, all five essential oils exerted promising efficacy in a dose-dependent manner and different performances on A. cracens after 24 hours of exposure. The strongest larvicidal potential was established from P. sarmentosum, followed by F. vulgare, C. longa, M. fragrans, and Z. piperitum, with LC50 values of 16.03, 32.77, 33.61, 40.00, and 63.17 ppm, respectively. Binary mixtures between P. sarmentosum, the most effective oil, and the others at the highest ratio were proved to be highly efficacious with a cotoxicity coefficient value greater than 100, indicating synergistic activity. Results of mixed formulations of different essential oils generating synergistic effects may prove helpful in developing effective, economical, and ecofriendly larvicides, as favorable alternatives for mosquito management.

  4. Orange oil effect in the control of fennel aphid

    Directory of Open Access Journals (Sweden)

    Ivanildo Cavalcanti de Albuquerque

    2009-08-01

    Full Text Available In the properties where fennel is grown, in the states of Bahia, Sergipe, Pernambuco and Paraiba, at the Northeast of Brazil, a high rate of usage of pesticides in the crop, aiming to control the aphid Hyadaphis foeniculi. The purpose of this study was to evaluate the effect of orange oil Prev-Am (sodium tetraborohydrate decahydrate, in the control of H. foeniculi aphid of the fennel crop. The trial was conducted in a fennel field located in Lagoa Seca Experimental Station, belonging to the EMEPA-PB. Forty-eight hours after the product has been sprayed, one flower of the umbel was collected and removed her aphids, which were placed in a "petri" plate from 9cm in diameter. As a following step, the insects were counted as part of two groups, considering the number of insects dead and alive, being tabulated for later analysis. The data were subjected to analysis of variance, using the experimental design of randomized blocks composed of six treatments (doses of 0.3, 0.4, 0.5, 0.6, 0.7% of orange oil (Prev-am and pure water as check, with five repetitions. The data were submitted to the regression analysis. The orange oil (Prev-am controls effectively H. foeniculi at the concentration of 0.3%, increasing the control up to concentrations of 0.6 and 0.7%. The product does not kill ladybugs (Cycloneda sanguinea and can be used in programs for integrated pest management.Keywords: Foeniculum vulgare, aphid, vegetable oil, ladybug, umbel.

  5. Development and validation of an high-performance liquid chromatography-diode array detector method for the simultaneous determination of six phenolic compounds in abnormal savda munziq decoction

    Directory of Open Access Journals (Sweden)

    Shuge Tian

    2015-01-01

    Full Text Available Aims: Given the high-effectiveness and low-toxicity of abnormal savda munziq (ASMQ, its herbal formulation has long been used in traditional Uyghur medicine to treat complex diseases, such as cancer, diabetes, and cardiovascular diseases. Settings and Design: ASMQ decoction by reversed-phase high-performance liquid chromatography coupled with a diode array detector was successfully developed for the simultaneous quality assessment of gallic acid, protocatechuic acid, caffeic acid, rutin, rosmarinic acid, and luteolin. The six phenolic compounds were separated on an Agilent TC-C18 reversed-phase analytical column (4.6 × 250 mm, 5 μm by gradient elution using 0.3% aqueous formic acid (v/v and 0.3% methanol formic acid (v/v at 1.0 mL/min. Materials and Methods: The plant material was separately ground and mixed at the following ratios (10: Cordia dichotoma (10.6, Anchusa italic (10.6, Euphorbia humifusa (4.9, Adiantum capillus-veneris (4.9, Ziziphus jujube (4.9, Glycyrrhiza uralensis (7.1, Foeniculum vulgare (4.9, Lavandula angustifolia (4.9, Dracocephalum moldavica L. (4.9, and Alhagi pseudoalhagi (42.3. Statistical Analysis Used: The precisions of all six compounds were 0.999. Results: The proposed method was successfully applied to determine the levels of six active components in ASMQ. Conclusions: Given the simplicity, precision, specificity, and sensitivity of the method, it can be utilized as a quality control approach to simultaneously determining the six phenolic compounds in AMSQ.

  6. Inhibition of microorganisms involved in deterioration of an archaeological site by silver nanoparticles produced by a green synthesis method.

    Science.gov (United States)

    Carrillo-González, Rogelio; Martínez-Gómez, Miriam Araceli; González-Chávez, Ma Del Carmen A; Mendoza Hernández, José Carlos

    2016-09-15

    The Citadel, part of the pre-Hispanic city of Teotihuacan and listed as a World Heritage Site, harbors irreplaceable archaeological walls and murals. This city was abandoned by the 7th century and its potential deterioration represents a noteworthy loss of the world's cultural heritage. This research consisted of isolation and identification of bacteria and fungi contributing to this deterioration from walls of a pre-Hispanic city. In addition, silver nanoparticles (AgNP) produced, using a green synthesis method, were tested as potential inhibitors of microbes. AgNP of different sizes and concentrations were tested using in situ assays. Leaf aqueous extracts from two plants species (Foeniculum vulgare and Tecoma stans) and two extraction procedures were used in the NP synthesis. The potential of AgNP as preventive/corrective treatments to protect stucco materials from biodeterioration, as well as the microbial inhibition on three stone materials (stucco, basalt and calcite) was analyzed. Twenty-three bacterial species belonging to eight genera and fourteen fungal species belonging to seven genera were isolated from colored stains, patinas and biofilms produced on the surfaces of archaeological walls from the pre-Hispanic city, Teotihuacan. AgNP from F. vulgare were more effective for in vitro microbial growth inhibition than those from T. stans. Bacteria were less sensitive to AgNP than fungi; however, sensitivity mainly depended on the microbial strain and the plant extract used to prepare AgNP. The use of AgNP as a preventive or corrective treatment to decrease microbial colonization in three kinds of stone used in historical walls was successful. Calcite was more colonized by Alternaria alternata, but less by Pectobacterium carotovorum. This is the first study at different scales (in vitro and tests on different stone types) of inhibition of biodeterioration-causing microorganisms isolated from an archaeological site by green synthesized AgNP. PMID:27015961

  7. Herbal medicines as diuretics: a review of the scientific evidence.

    Science.gov (United States)

    Wright, C I; Van-Buren, L; Kroner, C I; Koning, M M G

    2007-10-01

    There is increasing interest in the health and wellness benefits of herbs and botanicals. This is with good reason as they might offer a natural safeguard against the development of certain conditions and be a putative treatment for some diseases. One such area may be the lowering of blood pressure in those where it is elevated (i.e., hypertension). One class of clinical medicines used to lower blood pressure are known as diuretics and work by increasing the excretion of urine from the body as well as the amount of sodium in urine. There are a growing number of studies purporting diuretic effects with traditional medicines. The aim of this article was to review these studies and identify which extracts promote diuresis (which we assessed on terms of urine excreted and urinary sodium excretion) and also to identify the research needs in this area. We identified a number of species and genuses reporting diuretic effects. Of these, the most promising, at the present time, are the species Foeniculum vulgare, Fraxinus excelsior, Hibiscus sabdariffa, Petroselinum sativum and Spergularia purpurea, and species from the genuses Cucumis (Cucumis melo and Cucumis trigonus), Equisetum (Equisetum bogotense, Equisetum fluviatile, Equisetum giganteum, Equisetum hiemale var. affine and Equisetum myriochaetum), Lepidium (Lepidium latifolium and Lepidium sativum), Phyllanthus (Phyllanthus amarus, Phyllanthus corcovadensis and Phyllanthus sellowianus) and Sambucus (Sambucus mexicana and Sambucus nigra). However, there the number of studies is limited and we recommend that further studies be conducted to confirm reported effects. Such evidence is needed to provide scientific credence to the folklore use of traditional medicines and even be helpful in the development of future medicines, treatments and treatment guidelines. PMID:17804183

  8. Changes in Volatile Compounds during Aging of Sweet Fennel Fruits-Comparison of Hydrodistillation and Static Headspace Sampling Methods.

    Science.gov (United States)

    Najdoska-Bogdanov, Mence; Bogdanov, Jane B; Stefova, Marina

    2016-03-01

    Two extraction methods for subsequent gas chromatographic (GC) determination of volatiles from freshly harvested and aged fennel fruit samples (Foeniculum vulgare Mill.,ssp. vulgare var. dulce) have been compared. Hydrodistillation followed by GC-FID and GC-MS analysis was used as a standard method for essential oil characterization, while static headspace followed by GC (SHS-GC-FID) was used as a comparative method for determination of volatile components. As the fennel fruit ages, there is a gradual loss of the volatile components as indicated by the lower yield of essential oil and lower content of volatiles, as indicated by the alternative SHS-GC-FID analysis. Slight differences observed for the main components (trans-anethole, estragole, fenchone, and limonene) using the two methods are negligible, indicating that these volatiles did not undergo chemical transformation during the sample preparation procedures. A difference in anisaldehyde content was observed when the composition of the hydrodistilled essential oil was compared with the SHS-GC-FIDanalysis of volatiles and explanation for the variation of anisaldehyde content and the origin of other compounds was suggested. Comparison of the obtained results showed that limonene oxides, carvone and carveolare detectable in SHS-GC-FID analysis of the aged fennel fruits, while in hydrodistilled samples analyzed by GC-FID they were not present. Another observed difference was the appearance of products in significant amounts with higher retention times than trans-anethole, namely threo- and erythro-anethole β-hydroxymethylether and anethole glycol that are not detectable in the essential oil obtained by hydrodistillation. So, the relative abundance of the major components is comparable between these two methods for fennel seed up to 3 years from harvest and they can be used interchangeably depending on the purpose and amount of material. Furthermore, SHS-GC-FID can be used for assessment of maximum storage time

  9. Antioxidant, Anti-5-lipoxygenase and Antiacetylcholinesterase Activities of Essential Oils and Decoction Waters of Some Aromatic Plants

    Directory of Open Access Journals (Sweden)

    Sílvia M. Albano

    2012-01-01

    Full Text Available The scavenging of free radicals and superoxide anion, the inhibition of 5-lipoxygenase and the antiacetylcholinesterase activities of essential oils and decoction waters of eight aromatic plants (Dittrichia viscosa , Foeniculum vulgare, Origanum vulgare, Salvia officinalis, Thymbra capitata , Thymus camphoratus, Thymus carnosus and Thymus mastichina were studied. The essential oils were dominated by 1,8-cineole in S. officinalis (59%, T. mastichina (49% and T. camphoratus (21%; borneol (20% in T. carnosus; carvacrol in Thymbra capitata (68%; γ -terpinene (49% in O. vulgare; α -pinene (26% in F. vulgare; and trans-nerolidol (8% + β -oplopenone (7% in D. viscosa. O. vulgare decoction waters had the highest amount of phenols (4 5 ± 3 mg GAE/mL while F. vulgare only had 5 ± 0 mg GAE/mL. The decoction waters showed higher radical scavenging activity than the essential oils. O. vulgare decoction water showed the best antioxidant activity (IC 50= 3 ± 0 m g/mL, while the most effective essential oils were those of Thymbra capitata (IC 50=61 ± 2 m g/mL and O. vulgare (IC 50=15 6 ± 5 m g/mL. Thymbra capitata (IC 50= 6 ± 0 m g/mL decoction water showed the best superoxide anion scavenging activity. F. vulgare decoction water and essential oil revealed the best 5-lipoxygenase inhibition capacity (IC 50=2 7 ± 1 m g/mL and IC 50=6 8 ± 2 m g/mL, respectively. T. mastichina (IC 50=4 6 ± 4 m g/mL, S. officinalis (IC 50=5 1 ± 4 m g/mL, Thymbra capitata (IC 50=5 2 ± 1 m g/mL and T. camphoratus (IC 50=13 7 ± 2 m g/mL essential oils showed the best antiacetylcholinesterase activity.

  10. Antibacterial activity of some disinfectants, essential oils and radiation against some bacterial isolates

    International Nuclear Information System (INIS)

    Nosocomial bacteria has been considered problems for all hospitals. Bacterial isolates of the present study were isolated from Sharkia Hospitals, Egypt. The isolates were S. aureus, P. aeruginosa, E. coli, Klebsiella spp., Citrobacter spp., Enterobacter spp., Proteus spp., Serratia spp. and S. epidermidis. Two disinfectants (savlon and phenolics) were examined against all the bacterial isolates at the hospitals recommended concentrations to determine the most resistance bacterial isolates. Twelve essential oils, ultraviolet radiation, Gamma radiation and laser were tested against the most resistant bacterial isolates to disinfectants and antiseptics. These bacterial isolates were S. aureus and P. aeruginosa. The most effective concentration of savlon was 2%, while that of phenolics were 4 and 5% . Fumigation of essential oils of Eugenia caryophyllata L., Marjorum hortensis L., Foeniculum vulgare L., Rosmarinus officinalis L. and Thymus vulgaris L. had high effects against these bacterial isolates. Rosmarinus officinalis L., Marjorum hortensis L., Eugenia caryophyllata L. and Thymus vulgaris L. essential oils had high effects on bacterial isolates by disc diffusion method. Matricaria chamomilla L. and Eucalyptus spp. oils had no effects against P. aeruginosa. Both essential oils of Jasminum gradiflocum L. and Jasminum sambac L. had no effects by fumigation and diffused essential oils. Ultraviolet irradiation had lethal effect on S. aureus when it exposed to ultraviolet for 10 minutes at a distance of 20 cm, while it had a lethal effect on P. aeruginosa when exposed to the rays for 7 minutes at the same distance. Gamma irradiation had lethal effect on P. aeruginosa and S. aureus at 2.5 and 3 KGy, respectively. Laser had a lethal effect on P. aeruginosa and S. aureus after 14 and 15 minutes of exposure, respectively

  11. Efficacy of plant essential oils on postharvest control of rots caused by fungi on different stone fruits in vivo.

    Science.gov (United States)

    Lopez-Reyes, Jorge Giovanny; Spadaro, Davide; Prelle, Ambra; Garibaldi, Angelo; Gullino, Maria Lodovica

    2013-04-01

    The antifungal activity of plant essential oils was evaluated as postharvest treatment on stone fruit against brown rot and grey mold rot of stone fruit caused by Monilinia laxa and Botrytis cinerea, respectively. The essential oils from basil (Ocimum basilicum), fennel (Foeniculum sativum), lavender (Lavandula officinalis), marjoram (Origanum majorana), oregano (Origanum vulgare), peppermint (Mentha piperita), rosemary (Rosmarinus officinalis), sage (Salvia officinalis), savory (Satureja montana), thyme (Thymus vulgaris), and wild mint (Mentha arvensis) were tested at two different concentrations on apricots (cv. Kyoto and cv. Tonda di Costigliole), nectarines (cv. Big Top and cv. Nectaross) and plums (cv. Italia and cv. TC Sun). The volatile composition of the essential oils tested was determined by gas chromatography-mass spectrometry analysis. The treatments containing essential oils from oregano, savory, and thyme at 1% (vol/vol) controlled both B. cinerea and M. laxa growing on apricots cv. Tonda di Costigliole and plums cv. Italia and cv. TC Sun; however, the same treatments were phytotoxic for the carposphere of nectarines cv. Big Top and cv. Nectaross. Treatments with 10% (vol/vol) essential oils were highly phytotoxic, notwithstanding their efficacy against the pathogens tested. The essential oils containing as major components α-pinene, p-cymene, carvacrol, and thymol showed similar results on stone fruit, so their antimicrobial activity and the phytotoxicity produced could be based on the concentration of their principal compounds and their synergistic activity. The efficacy of the essential oil treatments on control of fungal pathogens in postharvest depended on the fruit cultivar, the composition and concentration of the essential oil applied, and the length of storage. PMID:23575125

  12. Effect of dietary supplementation of herbal seeds on carcass traits of turkey poults

    Directory of Open Access Journals (Sweden)

    Darshana B. Bhaisare

    2014-11-01

    Full Text Available Aim: The present study was conducted to find the effect of four herbal seeds on carcass traits of turkey poults. Materials and Methods: A biological study using Nandanam turkey poults (Meleagris gallapavo for 8 weeks duration was carried out to evaluate the effect of phytobiotics-containing four herbal seeds influence on production performances like biweekly body weight and on carcass traits. 150 poults were randomly subjected to five dietary treatments in a completely randomized design with basal diet (T1, 0.5% (5 g/kg level of each seeds thyme (Thymus vulgaris (T2, fenugreek (Trigonella foenum graecum (T3, fennel (Foeniculum vulgare (T4 and cumin (Cuminum cyminum (T5. Carcass traits like blood loss, feather loss, dressed weight, New York dressed weight, ready to cook yield and cut-up parts yield were studied. Results: The body weight at 8th week was higher (p<0.05 in poults fed with thyme; whereas at 6th week, fennel and cumin fed birds had better (p<0.05 body weight. Inclusion of herbal seeds did not affect the blood loss, dressed weight and ready to cook yield but it significantly (p<0.05 affected the feathered loss, New York dressed weight and giblet percentages. Feeding of fenugreek has improved New York dressed weight of poults. Feeding of fennel had depressive (p<0.05 effect on liver and gizzard weights. All the four phytobiotic seeds in feed had significant (p<0.05 reduction in breast weight with a compensatory improvement in drumstick and neck weights. Conclusion: The present study revealed that supplementation of phytobiotic herbal seeds has resulted in numerical improvement of body weight of poults throughout the study period whereas these seeds had negative effect on the yield of breast, with increased proportion of drumstick and neck.

  13. Wild vegetable mixes sold in the markets of Dalmatia (southern Croatia

    Directory of Open Access Journals (Sweden)

    Łuczaj Łukasz

    2013-01-01

    Full Text Available Abstract Background Dalmatia is an interesting place to study the use of wild greens as it lies at the intersection of influence of Slavs, who do not usually use many species of wild greens, and Mediterranean culinary culture, where the use of multiple wild greens is common. The aim of the study was to document the mixtures of wild green vegetables which are sold in all the vegetable markets of Dalmatia. Methods All vendors (68 in all 11 major markets of the Dalmatian coast were interviewed. The piles of wild vegetables they sold were searched and herbarium specimens taken from them. Results The mean number of species in the mix was 5.7. The most commonly sold wild plants are: Sonchus oleraceus L., Allium ampeloprasum L., Foeniculum vulgare Mill., Urospermum picroides F.W.Schmidt, Papaver rhoeas L., Daucus carota L., Taraxacum sp., Picris echioides L., Silene latifolia Poir. and Crepis spp. Also the cultivated beet (Beta vulgaris L. and a few cultivated Brassicaceae varieties are frequent components. Wild vegetables from the mix are usually boiled for 20–30 minutes and dressed with olive oil and salt. Altogether at least 37 wild taxa and 13 cultivated taxa were recorded. Apart from the mixes, Asparagus acutifolius L. and Tamus communis L. shoots are sold in separate bunches (they are usually eaten with eggs, as well as some Asteraceae species, the latter are eaten raw or briefly boiled. Conclusions The rich tradition of eating many wild greens may result both from strong Venetian and Greek influences and the necessity of using all food resources available in the barren, infertile land in the past. Although the number of wild-collected green vegetables is impressive we hypothesize that it may have decreased over the years, and that further in-depth local ethnobotanical studies are needed in Dalmatia to record the disappearing knowledge of edible plants.

  14. Methane emissions by livestock in India and mitigation strategies

    International Nuclear Information System (INIS)

    In India 92% enteric methane (CH4) is emitted by cattle and buffalo, about 7% by sheep and goats and only a very small fraction (less than 1%) is attributed to other ruminants and non-ruminant herbivores like yak, mithun, pig, horse, mules, ass, etc. Therefore the strategies to be adopted to mitigate CH4 emissions by livestock are primarily centred around cattle and buffalo. Keeping in mind the agricultural practices in India, the major mitigation techniques which might have some scope for practical application include replacement of non-productive or low productive animals with superior livestock, improving the quality of feeds offered to animals and the use of plant secondary metabolites which are present in many tropical plants. After screening more than 150 plant extracts, it was found that Terminalia chebula, Sapindus mukorossi, Populus deltoides, Foeniculum vulgare, Syzygium aromaticum, Allium sativum, Psidium guajava, Mentha piperita and Eucalyptus globulus were capable of inhibiting methanogenesis and ciliate protozoa in an in vitro gas production test. Although these plant extracts exhibited more than 50% inhibition in in vitro experiments, the same plants/ plant extracts either showed no effect or a very poor effect in in vivo experiments. Probable reasons include the different concentrations of plant secondary metabolites used in in vivo and in vitro experiments and large variations in the chemical composition of different accessions of the plant products. Therefore, detailed experiments are needed to optimise the doses of plant secondary metabolites required to produce significant inhibition of CH4 emissions without adversely affecting animal performance. (author)

  15. Splitting the exergy destruction into avoidable and unavoidable parts of a gas engine heat pump (GEHP) for food drying processes based on experimental values

    International Nuclear Information System (INIS)

    Highlights: • Advanced exergy analysis of a gas engine heat pump drying system for the first time. • Varying exergy efficiency values from 79.71% to 81.66% for the overall drying system. • Obtaining modified exergy efficiencies of 84.50–86.00% for the overall drying system. - Abstract: Some limitations in a conventional exergy analysis may be significantly reduced through an advanced exergy analysis. In this regard, the latter is a very useful tool to assess the real potential for improving a system component by splitting the exergy destruction into unavoidable and avoidable parts. This may provide a realistic measure to deduct the improvement potential for the thermodynamic efficiency of a component. For this purpose, improvement efforts are then made by focusing only on these avoidable parts. In this paper, a gas engine heat pump (GEHP) drying system was analyzed using both conventional and advanced exergy analyses. Three medicinal and aromatic plants (Foeniculum vulgare, Malva sylvestris L. and Thymus vulgaris) were dried in a pilot scale GEHP drier, which was designed, constructed and installed in Ege University, Izmir, Turkey. Drying experiments were performed at an air temperature of 45 °C with an air velocity of 1 m/s. For each system component, avoidable and unavoidable exergy destructions, modified exergy efficiency values and modified exergy destruction ratios were determined. Except for the compressor, the evaporator and the drying cabinet, most of the exergy destructions in the system components were avoidable and these avoidable parts can be reduced by design improvements. For the HP unit and the overall drying system, the values for exergy efficiency were obtained to be in the range of 82.51–85.11% and 79.71–81.66% while those for the modified exergy efficiency were calculated to be in the range of 85.70–89.26% and 84.50–86.00%, respectively

  16. Effects of aquous and ethanolic extracts of vegetal species on seed germination of Brachiaria decumbens Stapf/ Ação de extratos aquoso e etanólico de espécies vegetais na germinação de sementes de Brachiaria decumbens Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo Augusto Gorne Viani

    2002-05-01

    Full Text Available The objective of this study was to evaluate the effects of aquous and ethanolic extracts of medicinal species on seed germination of B. decumbens. The experimental design was completely randomized with 19 treatments (9 aquous extracts, 9 ethanolic extracts and a check was deionized water with 4 replicates. The species and organs used to obtain the extracts were Baccharis trimera (shoot, Baccharis articulata (shoot, Canna denudata (leaves, Cymbopogom citratus (leaves, Eucalyptus citriodora (leaves, Lippia alba (leaves and branches, Momordica charantia (leaves, branches, flowers, fruits and seeds, Ocimum gratissimum (leaves, branches and flowers e Ruta graveolens (leaves and branches. The extracts were obtained by aquous and ethanolic infusions in 10% and 1% concentration respectively. The seeds were treated with extracts for one hour and after this time sowed in plastic boxes. They were maintained in germination chamber (BOD with 16 hours of dark/20ºC and 8 hours of light/35ºC. The evaluation were made at 7Th and 21st days after seeding (DAS. The extraction methods affected seed germination. The use of aquous extract showed greater germination percentage than the ethanolic one at 7Th and 21st days. The evaluated extracts did not affect the seeds’ germination.O objetivo do experimento foi avaliar o efeito dos extratos aquoso e etanólico de espécies medicinais sobre germinação de sementes de B. decumbens. O delineamento experimental foi inteiramente casualizado com 19 tratamentos (9 extratos aquosos, 9 extratos etanólicos e 1 testemunha com água deionizada com quatro repetições. As espécies e as partes das plantas utilizadas para a obtenção dos extratos foram Baccharis trimera (caule, Baccharis articulata (caule, Canna denudata (folhas, Cymbopogom citratus (folhas, Eucalyptus citriodora (folhas, Lippia alba (folhas e ramos, Momordica charantia (folhas, ramos, flores, frutos e sementes, Ocimum gratissimum (folhas, ramos e flores e

  17. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas Evaluation of cuban hemp, nut sedge, johnson grass and herb of grace extracts in weed control

    Directory of Open Access Journals (Sweden)

    Liliana Osorio Salazar

    2009-04-01

    Full Text Available En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique, Cyperus rotundus L (coquito, Sorghum bicolor L (sorgo, y Ruta graveolens L (ruda sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga y Amaranthus dubius Mart (bledo y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo como solventes. Los extractos obtenidos se evaluaron en tres diluciones (0, 5 y 10 % en pruebas de germinación de semillas de las arvenses y del cultivo. Se emplearon tres repeticiones de 50 semillas cada una y el testigo se regó con agua destilada. Los extractos etanólicos y clorofórmicos de coquito y fique en las diluciones al 5 y 10 % presentaron el mayor efecto inhibitorio en la germinación a los 21 días. El ensayo de campo demostró el efecto inhibitorio de los extractos etanólicos de fique y coquito en la emergencia de las semillas del cilantro. El análisis de metabolitos secundarios comprobó la presencia de compuestos reportados como altamente tóxicos en fique y en menor cantidad en coquito, aunque los extractos de éste fueron los que más inhibieron la germinación.The objective of this work was to evaluate the effect of the extracts of the species Macrophylla furcraea Baker (cuban hemp, Cyperus rotundus L (nut sedge, Sorghum bicolor L (johnson grass and Ruta graveolens L (herb of grace on seed germination of two weeds and one crop. The extracts were obtained by the Soxhlet method, using water, ethanol and chloroform as solvents. Each extract was evaluated in three dilutions (0, 5 and 10 % v/v and was applied to Bidens pilosa L (spanish needle, Amaranthus dubius Mart (spleen amaranth and Coriandrum sativum L (coriander seeds. Three replications of 50 seeds each one were used and the control was watered only with destilled water. The results

  18. Atividade antifúngica de extratos de plantas a Colletotrichum gloeosporioides = Antifungal activity of plant extracts to Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Mercia Ikarugi Bomfim Celoto

    2008-01-01

    Full Text Available O presente trabalho teve como objetivo avaliar o efeito fungitóxico de extratos vegetais sobre o crescimento micelial e a germinação de esporos de Colletotrichum gloeosporioides. Os extratos foram obtidos a partir de plantas secas e moídas, utilizando-se água e etanol como meio extrator. Foram utilizadas 22 espécies de plantas para a obtençãodos extratos. Os extratos foram avaliados por meio da incorporação de 20% do extrato em meio BDA, antes ou após a autoclavagem do mesmo. Determinou-se a percentagem de inibição do crescimento micelial (PIC. Utilizando-se extrato na proporção de 50% e suspensão de esporos, determinou-se a percentagem de inibição da germinação de esporos (PIG. Verificou-se que os extratos hidroetanólicos proporcionaram maior PIC de C. gloeosporioides, enquanto maior PIG foi obtido com os extratos aquosos. Extratos não autoclavados foram mais eficientes na redução do crescimento micelial de C. gloeosporioides que os extratos autoclavados. Os extratos aquoso e hidroetanólico de melão-de-são-caetano e extrato hidroetanólico de eucalipto proporcionaram maiores PIC. Os extratos aquosos deLuffa acutangula, Eucalyptus citriodora, Chenopodium ambrosioides e Bauhinia, e os extratos hidroetanólicos de Ruta graveolens, Eucalyptus citriodora, Zingiber officinale e Chenopodiumambrosioides inibiram mais de 90% da germinação de esporos.The present work aimed to evaluate the effect fungitoxic of plant extracts on the mycelial growth and on the spores germination of C. gloeosporioides. The plant extracts were obtained starting from dried ground plants, using water and ethilic alcohol as extractor. Twenty-two plant species were used to obtain the extracts. The extracts were tested by means of the incorporation of 20% (v/v in PDA medium, before or after sterilization. The percentage ofinhibition of the mycelial growth (PIM was determined. Extract in the proportion of 50% was added to a spore suspension used to

  19. Fitossociologia de um trecho da mata ciliar do rio da Prata, Jardim, MS, Brasil Phythossociologic along a riparian forest at rio da Prata, Jardim, Mato Grosso do Sul State, Brazil

    Directory of Open Access Journals (Sweden)

    Joanice Lube Battilani

    2005-09-01

    Full Text Available O presente estudo teve como objetivos descrever a riqueza e a diversidade em espécies e analisar os aspectos fitossociológicos de um trecho da mata ciliar do rio da Prata, localizado na Fazenda Nossa Senhora Aparecida no município de Jardim, MS. Seis transectos de 150 m cada foram distribuídos aleatoriamente perpendiculares à margem do rio e subdivididos em 90 parcelas de 10 m×10 m. Em cada parcela foram amostrados todos os indivíduos com diâmetro à 1,30 m de altura do solo (DAP > 3,18 cm, totalizando 661 indivíduos pertencentes a 33 famílias, 57 gêneros e 66 espécies. As famílias Meliaceae, Mimosaceae, Sapindaceae, Euphorbiaceae, Fabaceae, Myrtaceae e Rutaceae destacaramse pelo elevado número de espécies. Myrcianthes pungens (O. Berg D. Legrand, Adelia membranifolia (Müll. Arg. Chodat & Hassl., Dalbergia sp., Holocalyx balansae Micheli, Unonopsis lindmanii R.E. Fr., Guarea kunthiana A. Juss., Trichilia claussenii C. DC., Guarea guidonea (L. Sleumer, Averrhoidium paraguaiense Radlk.e Astronium graveolens Jacq. foram as espécies de maior valor de importância. O índice de diversidade de Shannon (H' obtido foi 3,413 nats/indivíduo e a eqüabilidade (J' foi 0,815. A densidade e a área basal estimada foi 734,44 indivíduos/ha e 21,32 m²/ha respectivamente. Os resultados obtidos neste trabalho reforçam a necessidade de preservação da mata ciliar do rio da Prata e são de extrema importância para subsidiar projetos de manejo e recomposição nestas formações.The present study describes species richness and diversity, and analyses phythossociologic aspects of a riparian forest at Rio da Prata, Jardim district, Mato Grosso do Sul State, Brazil. The phytosociological study was carried out on six 150 m transects perpendicular to the river subdivided in 90 quadrats (10 m×10 m. All trees and shrubs with a minimum of 3,18 cm diameter at breast height were recorded, totalizing 661 individuals of 33 families, 57 genera and 66

  20. Repelência e deterrência na oviposição de Bemisia tabaci biótipo B pelo uso de extratos vegetais em Cucurbita pepo L Repellence and deterrence on oviposition of Bemisia tabaci biotype B by the use of vegetal extracts in Cucurbita pepo L

    Directory of Open Access Journals (Sweden)

    J.P.G.F. Silva

    2012-01-01

    Full Text Available Bemisia tabaci biótipo B é um dos principais insetos-praga na cultura da abobrinha (Cucurbita pepo L.. O manejo dessa mosca-branca tornou-se grande desafio aos agricultores, uma vez que esta apresenta rápida capacidade de desenvolver resistência a diferentes classes de inseticidas. Como alternativa vem sendo investigado o uso de extratos vegetais com atividades inseticida e/ou insetistática, os quais têm revelado resultados promissores no combate a inseto. O presente trabalho teve por objetivo avaliar os possíveis efeitos de sete extratos provenientes de cinco espécies vegetais, Ruta graveolens L. (folhas, Azadirachta indica A. Juss. (folhas + ramos, Trichilia pallida Swartz (ramos, T. pallida (folhas, A. indica (amêndoas, Chenopodium ambrosioides L. (inflorescências + ramos+ folhas e Mentha pulegium L. (folhas, sobre Bemisia tabaci biótipo B em abobrinha, por meio de testes de repelência e deterrência para oviposição. Em teste com chance de escolha, avaliou-se a atratividade e determinou-se o índice de repelência após 6, 24 e 48 horas da aplicação dos extratos. A oviposição foi verificada após a terceira contagem do número de adultos. O extrato à base de folhas de M. pulegium mostrou repelência e deterrência à oviposição de B. tabaci biótipo B, podendo ser recomendado como alternativa para o manejo do inseto.Bemisia tabaci biotype B is one of the main pests in squash (Cucurbita pepo L.. The management of this whitefly has become a major challenge to growers, since they have the ability to quickly develop resistance to different classes of insecticides. Alternatively, the use of plant extracts with insecticide and/or insectistatic activities has been investigated, showing promising results for the whitefly control. The present study evaluated the possible effects of seven extracts from five plant species, Ruta graveolens L. (leaves, Azadirachta indica A. Juss. (leaves + branches, Trichilia pallida Swartz (branches

  1. Atividade antimicrobiana de óleos essenciais de condimentos frente a amostras de Escherichia coli isoladas de aves e bovinos Antimicrobial activity of spice essential oils against Escherichia coli strains isolated from poultry and cattle

    Directory of Open Access Journals (Sweden)

    Deise Flores Santurio

    2011-06-01

    Full Text Available A discutida questão da substituição do uso de antibacterianos em rações (promotores de crescimento requer urgentes alternativas. Face às necessidades de inibidores microbianos nesses alimentos, os óleos essenciais (OES se constituem em alternativa, sob avaliação. Neste estudo, avaliou-se a atividade antimicrobiana dos OES de Origanum vulgare (orégano, Thymus vulgaris (tomilho, Cinnamomum zeylanicum (canela, Lippia graveolens (orégano mexicano, Zingiber officinale (gengibre, Salvia officinalis (sálvia, Rosmarinus officinalis (alecrim e Ocimum basilicum (manjericão frente a amostras de Escherichia coli isoladas de fezes de aves (n=43 e de bovinos (n=36. A concentração inibitória mínima (CIM e a concentração bactericida mínima (CBM foram determinadas para cada isolado através da técnica de microdiluição em caldo, a partir da máxima concentração de 6400µg mL-1 de cada OE testado. Observou-se atividade antimicrobiana para os OES de orégano, orégano mexicano, tomilho, canela. Para todas as amostras testadas, independente de sua origem, os OES mais e menos efetivos quanto à atividade antimicrobiana foram o orégano e a canela, respectivamente. Esses resultados confirmaram o potencial antibacteriano de alguns OES, os quais merecem novas investigações abordando sua adição na alimentação de aves e bovinos.The discussed issue about replacing the use of antibiotics in animal feed (growth promoters requires emerging alternatives. To meet the needs of microbial inhibitors in these foods, the essentials oils (EOS constitute potential alternatives under evaluation. In this study it was evaluated the antimicrobial activities of EOs from Oreganum vulgare (oregano, Thymus vulgaris (thyme, Lippia graveolens (Mexican oregano, Cinnamomum zeylanicum (cinnamon, Zingiber officinale (ginger, Salvia officinalis (sage, Rosmarinus officinalis (rosemary and Ocimum basilicum (basil against Escherichia coli strains isolated from poultry (n

  2. Florística e estrutura da comunidade arbórea de um remanescente florestal ripário no município de Guariba, Estado de São Paulo, Brasil. Floristic and structure of the arboreal community of riparian forest remain at Guariba municipality, São Paulo State, Brazil.

    Directory of Open Access Journals (Sweden)

    Nicole Maria Marson DONADIO

    2009-06-01

    Full Text Available O conhecimento sobre a composição eestrutura de comunidades florestais é fundamentalpara embasar ações de conservação e restauração.O objetivo deste trabalho foi realizar olevantamento florístico e descrever a estrutura dacomunidade arbórea de um remanescente florestallocalizado no município de Guariba, Estado de SãoPaulo. Foram alocadas 30 parcelas de 10 x 10 m,para amostrar os indivíduos arbóreos e arbustivoscom diâmetro à altura do peito (DAP ³ 5 cm.Foram encontradas 54 espécies, pertencentes a 47gêneros, distribuídos em 32 famílias botânicas,com índice de diversidade (H’ de 2,67 eequabilidade (J de 0,20. As famílias Meliaceae eFabaceae apresentaram maior riqueza em espécies.Calophyllum brasiliensis, Astronium graveolens,Scheffera morototoni, Xylopia aromatica eProtium widgrenii destacaram-se como as espéciesde maior valor de importância. Foram amostrados420 indivíduos. A presença de espécies do cerradosugere condição de ecótono e a dominância de umaespécie higrófila indica saturação hídrica em parteda área. A distribuição dos indivíduos em classesde tamanho revelou uma comunidade emregeneração com a maioria dos indivíduos com até15,0 cm de DAP e distribuídos entre 7 e 14,9 m,e com estoques de jovens tanto das espéciespioneiras como secundárias podendo garantir ofuturo da comunidade. Em termos sucessionais aárea estudada encontra-se em estádio de médiopara avançado.Knowledge of the composition andstructure of arboreal communities is paramount forconservation and restoration efforts. The mainobjectives of this study were to characterize thearboreal species floristic composition and describethe structure of the arboreal community of aremaining forest located at the municipality ofGuariba, State of São Paulo. Thirty plots of 10 x 10 mwere allocated. In each plot, diameter and heightwere measured for each individual tree withdiameter at breast height (dbh ³ 5 cm. Fifty-fourspecies were

  3. Plant compounds insecticide activity against Coleoptera pests of stored products Compostos de plantas com atividade inseticida a coleópteros-praga de produtos armazenados

    Directory of Open Access Journals (Sweden)

    Márcio Dionizio Moreira

    2007-07-01

    Full Text Available The objective of this work was to screen plants with insecticide activity, in order to isolate, identify and assess the bioactivity of insecticide compounds present in these plants, against Coleoptera pests of stored products: Oryzaephilus surinamensis L. (Silvanidae, Rhyzopertha dominica F. (Bostrichidae and Sitophilus zeamais Mots. (Curculionidae. The plant species used were: basil (Ocimum selloi Benth., rue (Ruta graveolens L., lion's ear (Leonotis nepetifolia (L. R.Br., jimson weed (Datura stramonium L., baleeira herb (Cordia verbenacea L., mint (Mentha piperita L., wild balsam apple (Mormodica charantia L., and billy goat weed or mentrasto (Ageratum conyzoides L.. The insecticide activity of hexane and ethanol extracts from those plants on R. dominica was evaluated. Among them, only hexane extract of A. conyzoides showed insecticide activity; the hexane extract of this species was successively fractionated by silica gel column chromatography, for isolation and purification of the active compounds. Compounds 5,6,7,8,3',4',5'-heptamethoxyflavone; 5,6,7,8,3'-pentamethoxy-4',5'-methilenedioxyflavone and coumarin were identified. However, only coumarin showed insecticide activity against three insect pests (LD50 from 2.72 to 39.71 mg g-1 a.i.. The increasing order of insects susceptibility to coumarin was R. dominica, S. zeamais and O. surinamensis.O objetivo deste trabalho foi selecionar plantas com atividade inseticida, para isolar, identificar e avaliar a bioatividade de compostos inseticidas presentes nessas plantas, contra as seguintes pragas de produtos armazenados da ordem Coleoptera: Sitophilus zeamais Mots. (Curculionidae, Rhyzopertha dominica F. (Bostrichidae e Oryzaephilus surinamensis L. (Silvanidae. As espécies de plantas usadas foram: anis (Ocimum selloi Benth, arruda (Ruta graveolens L., cordão-de-frade (Leonotis nepetifolia L., datura (Datura stramonium L., erva baleeira (Cordia verbenacea L., hortelã (Mentha piperita L., mel

  4. Controle de mosca-branca com extratos vegetais, em tomateiro cultivado em casa-de-vegetação Use of plant extracts on whitefly control in tomato grown in greenhouse

    Directory of Open Access Journals (Sweden)

    Edson LL Baldin

    2007-12-01

    Full Text Available Visando buscar métodos alternativos no controle da mosca-branca Bemisia tabaci (Gennadius biótipo B em tomateiro, foram realizados testes de atratividade e preferência para oviposição em casa-de-vegetação, utilizando-se quatorze extratos aquosos a 3% (peso/volume. Os extratos foram preparados com partes de Azadirachta indica, Trichilia pallida,Chenopodium ambrosioides,Piper nigrum,Melia azedarach,Ruta graveolens,Ricinus communis,Mentha pulegium,Tagetes erecta,Eucalyptus citriodora,Cymbopogon nardus e Coriandrum sativum. Numa segunda etapa, os extratos mais eficientes em casa-de-vegetação foram observados em laboratório, a fim de avaliar o possível efeito sistêmico dos mesmos sobre ninfas da mosca-branca. Constatou-se que as plantas de tomateiro pulverizadas com extratos à base de folhas de M. pulegium e folhas e sementes de A. indica foram menos atrativas aos adultos do inseto. Plantas pulverizadas com extratos de folhas de A. indica e folhas + ramos de R. communis mostraram efeitos deterrentes à oviposição do inseto, reduzindo o número de ovos; em contrapartida, o extrato à base de folhas de C. nardus estimulou a oviposição da mosca-branca sobre as plantas. O uso dos extratos por via sistêmica não afetou o período de desenvolvimento (ovo-adulto da mosca-branca; entretanto, a presença de extratos de sementes e folhas de A. indica e de folhas de M. pulegium provocou aumento significativo na mortalidade de ninfas de B. tabaci biótipo B.Looking for alternative methods of control to silverleaf whitefly Bemisia tabaci (Gennadius biotype B in tomato, attractiveness and oviposition preference tests were accomplished in greenhouse using fourteen aqueous extracts at 3% (weight/volume. The extracts were prepared with parts from Azadirachta indica,Trichilia pallida,Chenopodium ambrosioides,Piper nigrum,Melia azedarach,Ruta graveolens,Ricinus communis,Mentha pulegium,Tagetes erecta,Eucalyptus citriodora, Cymbopogon nardus and

  5. Medicinal plants with hepatoprotective activity in Iranian folk medicine

    Institute of Scientific and Technical Information of China (English)

    Majid; Asadi-Samani; Najme; Kafash-Farkhad; Nafiseh; Azimi; Ali; Fasihi; Ebrahim; Alinia-Ahandani; Mahmoud; Rafieian-Kopaei

    2015-01-01

    There are a number of medicinal combinations in the Iranian traditional medicine which are commonly used as tonic for liver.In this review,we have introduced some medicinal plants that are used mainly for the treatment of liver disorders in Iranian folk medicine,with focus on their hepatoprotective effects particularly against CCI4 agent.In this study,online databases including Web of Science.PubMed.Scopus,and Science Direct were searched for papers published from January 1970 to December 2013.Search terms consisted of medicinal plants,traditional medicine,folk medicine,hepatoprotective.Iran,liver,therapeutic uses,compounds,antioxidant.CCI4.anti-inflammatory,and antihepatotoxic,hepatitis,alone or in combination.Allium hirtifolium Boiss..Apium graveolens L..Cynara scolyinus.Berberis vulgaris L..,Calendula officinalis,Nigella sativa L..Taraxacum officinale.Tragopogon porrifolius.Prangos ferulacea L..Allium sativum,Marribium vulgare,Ammi majus L..Citrullus lanatus Thunb.Agrimonia eupatoria L.and Primus armeniaca L.are some of the medicinal plants that have been used for the treatment of liver disorders in Iranian folk medicine.Out of several leads obtained from plants containing potential hepatoprotective agents,silymarin,P-sitosterol,betalain,neoandrographolide.phyllanthin.andrographolide.curcumin.picroside.hypophyllanlhin.kutkoside,and glycyrrhizin have been demonstrated to have potent hepatoprotective properties.Despite encouraging data on possibility of new discoveries in the near future,the evidence on treating viral hepatitis or other chronic liver diseases by herbal medications is not adequate.

  6. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas

    Directory of Open Access Journals (Sweden)

    Mier Barona Carmen Elena

    2009-06-01

    Full Text Available En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique, Cyperus rotundus L (coquito, Sorghum bicolor L (sorgo, y Ruta graveolens L (ruda sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga y Amaranthus dubius Mart (bledo y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo como solventes. Los extractos obtenidos se evaluaron en tres diluciones (0, 5 y 10 % en pruebas de germinación de semillas de las arvenses y del cultivo. Se emplearon tres repeticiones de 50 semillas cada una y el testigo se regó con agua destilada. Los extractos etanólicos y clorofórmicos de coquito y fique en las diluciones al 5 y 10 % presentaron el mayor efecto inhibitorio en la germinación a los 21 días. El ensayo de campo demostró el efecto inhibitorio de los extractos etanólicos de fique y coquito en la emergencia de las semillas del cilantro. El análisis de metabolitos secundarios comprobó la presencia de compuestos reportados como altamente tóxicos en fique y en menor cantidad en coquito, aunque los extractos de éste fueron los que más inhibieron la germinación.

  7. Combined HPLC-CUPRAC (cupric ion reducing antioxidant capacity) assay of parsley, celery leaves, and nettle.

    Science.gov (United States)

    Yildiz, Leyla; Başkan, Kevser Sözgen; Tütem, Esma; Apak, Reşat

    2008-10-19

    This study aims to identify the essential antioxidant compounds present in parsley (Petroselinum sativum) and celery (Apium graveolens) leaves belonging to the Umbelliferae (Apiaceae) family, and in stinging nettle (Urtica dioica) belonging to Urticaceae family, to measure the total antioxidant capacity (TAC) of these compounds with CUPRAC (cupric ion reducing antioxidant capacity) and ABTS spectrophotometric methods, and to correlate the TAC with high performance liquid chromatography (HPLC) findings. The CUPRAC spectrophotometric method of TAC assay using copper(II)-neocuproine (2,9-dimethyl-1,10-phenanthroline) as the chromogenic oxidant was developed in our laboratories. The individual antioxidant constituents of plant extracts were identified and quantified by HPLC on a C18 column using a modified mobile phase of gradient elution comprised of MeOH-0.2% o-phosphoric acid and UV detection for polyphenols at 280 nm. The TAC values of HPLC-quantified antioxidant constituents were found, and compared for the first time with those found by CUPRAC. The TAC of HPLC-quantified compounds accounted for a relatively high percentage of the observed CUPRAC capacities of plant extracts, namely 81% of nettle, 60-77% of parsley (in different hydrolyzates of extract and solid sample), and 41-57% of celery leaves (in different hydrolyzates). The CUPRAC total capacities of the 70% MeOH extracts of studied plants (in the units of mmol trolox g(-1)plant) were in the order: celery leaves>nettle>parsley. The TAC calculated with the aid of HPLC-spectrophotometry did not compensate for 100% of the CUPRAC total capacities, because all flavonoid glycosides subjected to hydrolysis were either not detectable with HPLC, or not converted to the corresponding aglycons (i.e., easily detectable and quantifiable with HPLC) during the hydrolysis step. PMID:18804638

  8. Synthesis of L-ascorbic acid in the phloem

    Directory of Open Access Journals (Sweden)

    Haupt Sophie

    2003-11-01

    Full Text Available Abstract Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone. Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs.

  9. The ecological aspect of ethnobotany and ethnopharmacology of population in Bosnia and Herzegovina.

    Science.gov (United States)

    Redzić, Sulejman S

    2007-09-01

    This paper contains first systematical revision of the results on traditional use of wild medicinal and aromatic herbs on the territory of Bosnia and Herzegovina (B&H)--west of Balkan Peninsula; Southeast of Europe. There have been detected 227 plants belonging to 71 different plant families, which are being used with ethno therapeutic purpose. Results were obtained by method of open ethno botanical interview which comprised 150 persons, whose average age was 63. Medicinal plants in ethno therapy are being used either in fresh, raw or dried condition. Different herbal parts, depending on period of vegetation season, sometimes even in winter, are basis for preparation of infusions (59%), decoct (19%), tinctures (4%). Especially original are balms known as Bosnian "mehlems", which are fresh cuted herbal parts mixed with lukewarm resin, raw cow butter or honey. In ethno therapy are mostly being used aerial plant organs. Majority of herbs is being used for treatment of illnesses of respiratory (22%), gastrointestinal (19%) and urinary and genital system (9%), for treatment of skin conditions (11%), as well as for nervous system and heart diseases (16%). The most original plants on the field of ethno pharmacology, comparing with ethno therapy practice of other regions, are as follows: Ballota nigra, Aesculus hippocastanum, Calluna vulgaris, Centaurea cyanus, Euphrasia rostkoviana, Geranium robertianum, Gentiana asclepiadea, Helichrysum italicum, Lycopodium clavatum, Marrubium vulgare, Nepeta cataria, Populus tremula, Ruta graveolens, Tamus communis, Teucrium montanum, T. chamaedrys, and endemic plants Gentiana lutea subsp. symphyandra, Teucrium arduini, Micromeria thymifolia, Satureja montana, S. subspicata, Rhamnus fallax and Viola elegantula. There haven't been noticed significant differences in the frequencies of medicinal plants use among different ethnical groups. But, it has been perceived that longer ethno therapeutic tradition possess inhabitants of sub- and

  10. Estudio de la flora y la vegetaciòn del bosque en la estaciòn de primates Coloso-Sucre

    Directory of Open Access Journals (Sweden)

    Fernández Alonso José Luis

    2003-06-01

    Full Text Available El estudio se realizó en Coloso, Sucre, en la planicie del litoral Caribe, se efectuaron muestreos enla zona del arroyo el “Sereno” de la estación de primates. Se realizaron 14 levantamientos,utilizando el método de parcela y subparcelas, de 50 x 10 m2. Se censaron indivuidos con DAP =10 cm. La vegetación del sector “arroyo Sereno” fitosociológicamente se agrupa en la alianzaPoulsenio armatae- Anacardion excelsi, entre cuyas especies características también figuran: Achrasexcelsi, Brownea ariza, Brosimun guianense, Samanea saman, Pachira acuatica, Erythroxylumamazonicum y Aspidosperma spegazzinii. Comprende las asociaciones Ocoteo glomeratae- Spondietum mombinis entrecuyas especies características figuran: Ficus gigantea, Ocotea glomerata, Platymiscium pinnatumy Xylopiagrandifloray Astronio graveolentis- Guazumetum ulmifoliaecon Pseudobombax septenatum, Trichiliaacuminatay Stemmadenia grandiflora. Las especies con mayores valores de IVI (Índice de valor de im-portancia e IPF (Índice de predominio fisiónomico son Anacardium excelsum, Pulsenia armata,Spondias mombin, Ocotea glomerata, Astronium graveolensy Guazuma ulmifolia.En los censos se encon-traron 38 familias y 80 especies entre las cuales se destacan por número de género y especies Leguminosae, Bombacaceae, Anacardiaceae, Annonaceae, Apocynaceae, Bignoniaceae. Entre los génerosmás diversificados figuran Xylopia(Anonaceae, Aspidosperma (Apocynaceae y Bombax, Cavanillesia,Ciebas, Pseudobombax (Bombacaceae. En general los tipos de vegetación que se encontrarontambién se distribuyen en localidades de la región tropical de los valles del Magdalena y del Caucaconstituyendo una formación vegetal definida por el dominio de especies como Guazuma ulmifolia,Astronium graveolens, Spondias mombin, Anacardium occidentalisy especies de Tabebuia.

  11. Nanostructured lipid system as a strategy to improve the anti-Candida albicans activity of Astronium sp.

    Science.gov (United States)

    Bonifácio, Bruna Vidal; Ramos, Matheus Aparecido dos Santos; da Silva, Patrícia Bento; Negri, Kamila Maria Silveira; de Oliveira Lopes, Érica; de Souza, Leonardo Perez; Vilegas, Wagner; Pavan, Fernando Rogério; Chorilli, Marlus; Bauab, Taís Maria

    2015-01-01

    The genus Astronium (Anacardiaceae) includes species, such as Astronium fraxinifolium, Astronium graveolens, and Astronium urundeuva, which possess anti-inflammatory, anti-ulcerogenic, healing, and antimicrobial properties. Nanostructured lipid systems are able to potentiate the action of plant extracts, reducing the required dose and side effects and improving antimicrobial activity. This work aims to evaluate a nanostructured lipid system that was developed as a strategy to improve the anti-Candida albicans activity of hydroethanolic extracts of stems and leaves from Astronium sp. The antifungal activity against C. albicans (ATCC 18804) was evaluated in vitro by a microdilution technique. In addition to the in vitro assays, the Astronium sp. that showed the best antifungal activity and selectivity index was submitted to an in vivo assay using a model of vulvovaginal candidiasis infection. In these assays, the extracts were either used alone or were incorporated into the nanostructured lipid system (comprising 10% oil phase, 10% surfactant, and 80% aqueous phase). The results indicated a minimal inhibitory concentration of 125.00 µg/mL before incorporation into the nanostructured system; this activity was even more enhanced when this extract presented a minimal inhibitory concentration of 15.62 µg/mL after its incorporation. In vivo assay dates showed that the nanostructure-incorporated extract of A. urundeuva leaves was more effective than both the unincorporated extract and the antifungal positive control (amphotericin B). These results suggest that this nanostructured lipid system can be used in a strategy to improve the in vitro and in vivo anti-C. albicans activity of hydroethanolic extracts of Astronium sp. PMID:26300640

  12. Diverse patterns of stored water use among saplings in seasonally dry tropical forests.

    Science.gov (United States)

    Wolfe, Brett T; Kursar, Thomas A

    2015-12-01

    Tree species in seasonally dry tropical forests likely vary in their drought-survival mechanisms. Drought-deciduousness, which reduces water loss, and low wood density, which may permit dependence on stored water, are considered key traits. For saplings of six species at two distinct sites, we studied these and two associated traits: the seasonal amount of water released per stem volume ("water released") and the hydraulic capacitance of the stem (C). Two deciduous species with low stem density, Cavanillesia platanifolia and Bursera simaruba, had high C and high dry-season stem water potential (Ψ(stem)), but differed in dry-season water released. C. platanifolia did not use stored water during the dry season whereas B. simaruba, in a drier forest, released stored water. In both, water released was highest while flushing leaves, suggesting that stored water supports leaf flushing. In contrast, two deciduous species with intermediate stem density, Annona hayesii and Genipa americana, had intermediate C, low dry-season Ψ(stem), and high seasonal change in water released. Meanwhile, two evergreen species with intermediate stem density, Cojoba rufescens and Astronium graveolens, had relatively low C, low dry-season Ψ(stem), and intermediate seasonal change in water released. Thus, at least three, distinct stored-water-use strategies were observed. Additionally, bark relative water content (RWC) decreased along with Ψ(stem) during the dry season while xylem RWC did not change, suggesting that bark-stored water buffers Ψ(stem) seasonally. Together these results suggest that seasonal use of stored water and change in Ψ(stem) are associated with functional groups that are characterized by combinations of deciduousness and stem density. PMID:26025573

  13. Growth and photosynthetic performance of five tree seedlings species in response to natural light regimes from the Central Pacific of Costa Rica.

    Science.gov (United States)

    Guzmán, J Antonio; Cordero, Roberto A

    2013-09-01

    Environmental heterogeneity mostly dominated by differing light regimes affects the expression of phenotypic plasticity, which is important for plant growth and survival, especially in the forest understory. The knowledge about these responses to this heterogeneity is a key factor for forest restoration initiatives. In this study, we determine several phenotypic responses to contrasting light conditions in five native tree seedling species of La Cangreja National Park, Central Pacific of Costa Rica, four of them with threatened or relict populations. After 14 weeks at a medium gap condition (24% of full sun), seedlings were transferred and acclimated for 11 weeks to three different natural light regimes: large gap (LG), medium gap (MG) and small gap (SG), corresponding to 52%, 24%, 9% of the mean direct and indirect radiation at each site from full sun. Growth, biomass allocation and leaf gas exchange were measured after the acclimation period. Four species strongly reduced relative growth rate (RGR) in the lower light condition. Total biomass (TB) and RGR were different in Hymenaea courbaril and Platymiscium curiense. H. courbaril and Astronium graveolens had significant changes in the maximum assimilation rate, with a mean value in the LG of 11.02 and 7.70 micromolCO2/m2s, respectively. P. curuense showed the same trend and significant changes in RGR and biomass allocation. Aspidosperma myristicifolium and Plinia puriscalensis showed no adjustments to the light regimes in any of the measured variables. This study remarks the importance of determining the growth and physiological performance of these tree native species. It also demonstrates that the most threatened species are those with the less plastic responses to the light regimes, which stresses the difficult situation of their natural populations. This study highlights an urgent definition of the conservation and restoration needs of the degraded forests of the Costa Rican Central Pacific area, where these

  14. Synergism between ozone and light stress: structural responses of polyphenols in a woody Brazilian species.

    Science.gov (United States)

    Fernandes, Francine Faia; Cardoso-Gustavson, Poliana; Alves, Edenise Segala

    2016-07-01

    Microscopic studies on isolated ozone (O3) effects or on those in synergy with light stress commonly report the induction of polyphenols that exhibit different aspects within the vacuole of photosynthesizing cells. It has been assumed that these different aspects are randomly spread in the symptomatic (injured) regions of the leaf blade. Interestingly, secretory ducts that constitutively produce polyphenols also exhibit these same variations in their vacuolar aspect, in a spatial sequence related to the destiny of these cells (e.g., programmed cell death (PCD) in lytic secretion processes). Here, we demonstrate that the deposition pattern of polyphenols prior to the establishment of the hypersensitive-like response, a type of PCD caused by O3, follows the same one observed in the epithelial cells of the constitutive lysigenous secretory ducts. Astronium graveolens, an early secondary Brazilian woody species, was selected based on its susceptibility to high light and presence of secretory ducts. The synergism effects were assessed by exposing plants to the high O3 concentrations at an urban site in São Paulo City. Confocal, widefield and light microscopies were used to examine polyphenols' occurrence and aspects. The spatial pattern of polyphenols distribution along the leaflets of plants submitted to the synergism condition, in which a dense vacuolar aspect is the target of a cell destined to death, was also observed in the constitutive secretory cells prior to lysis. This similar structural pattern may be a case of homology of process involving both the constitutive (secretory ducts) and the induced (photosynthesizing cells) defenses. PMID:27155473

  15. Foliar accumulation of polycyclic aromatic hydrocarbons in native tree species from the Atlantic Forest (SE-Brazil).

    Science.gov (United States)

    Dias, Ana Paula L; Rinaldi, Mirian C S; Domingos, Marisa

    2016-02-15

    Polycyclic aromatic hydrocarbons (PAHs) are toxic to living organisms. They can accumulate on foliar surfaces due to their affinity with apolar organic compounds, which enables the use of native plant species as sentinels of atmospheric PAH deposition in polluted ecosystems. The present study extends the knowledge about this subject in the tropical region by focusing on the PAH accumulation in the foliage of dominant tree species (Astronium graveolens, Croton floribundus, Piptadenia gonoacantha) in four remnants of Semi-deciduous Atlantic Forest surrounded by diversified sources of PAHs and located in the cities of Campinas, Paulínia, Holambra and Cosmópilis (central-eastern part of São Paulo State, SE-Brazil). Leaves of the tree species were collected in the forest remnants during the wet and dry seasons (2011 to 2013). All samples were analyzed by high performance liquid chromatography (HPLC) coupled to a fluorescence detector for identification of 14 PAHs. The native tree species showed distinct capacities to accumulate PAHs. All of them accumulated proportionally more light PAHs than heavy PAHs, mainly during the dry period. P. gonoacantha was the most effective accumulator species. Higher accumulations of most of the PAHs occurred during the dry periods. The predominance of moderately (1 ≤ EF < 5) to highly enriched (EF ≥ 5) leaf samples of P. gonoacantha with regard to BaA and PHE in all of the forest remnants indicated that vehicular sources were widely distributed in the entire region. The predominance of the moderate to high enrichment of ACE in leaf samples from the forest remnants located in Paulínia, Holambra and Cosmópolis indicated that they were also affected by emissions from petrochemical industries. PMID:26657363

  16. Bioactive compounds from culinary herbs inhibit a molecular target for type 2 diabetes management, dipeptidyl peptidase IV.

    Science.gov (United States)

    Bower, Allyson M; Real Hernandez, Luis M; Berhow, Mark A; de Mejia, Elvira Gonzalez

    2014-07-01

    Greek oregano (Origanum vulgare), marjoram (Origanum majorana), rosemary (Rosmarinus officinalis), and Mexican oregano (Lippia graveolens) are concentrated sources of bioactive compounds. The aims were to characterize and examine extracts from greenhouse-grown or commercially purchased herbs for their ability to inhibit dipeptidyl peptidase IV (DPP-IV) and protein tyrosine phosphatase 1B (PTP1B), enzymes that play a role in insulin secretion and insulin signaling, respectively. Greenhouse herbs contained more polyphenols (302.7-430.1 μg of gallic acid equivalents/mg of dry weight of extract (DWE)) and flavonoids (370.1-661.4 μg of rutin equivalents/mg of DWE) compared to the equivalent commercial herbs. Greenhouse rosemary, Mexican oregano, and marjoram extracts were the best inhibitors of DPP-IV (IC₅₀=16, 29, and 59 μM, respectively). Commercial rosemary, Mexican oregano, and marjoram were the best inhibitors of PTP1B (32.4-40.9% at 500 μM). The phytochemicals eriodictyol, naringenin, hispidulin, cirsimaritin, and carnosol were identified by LC-ESI-MS as being present in greenhouse-grown Mexican oregano and rosemary. Computational modeling indicated that hispidulin, carnosol, and eriodictyol would have the best binding affinities for DPP-IV. Biochemically, the best inhibitors of DPP-IV were cirsimaritin (IC₅₀=0.43±0.07 μM), hispidulin (IC₅₀=0.49±0.06 μM), and naringenin (IC₅₀=2.5±0.29 μM). Overall, herbs contain several flavonoids that inhibit DPP-IV and should be investigated further regarding their potential in diabetes management. PMID:24881464

  17. The role of spices and lactic acid bacteria as antimicrobial agent to extend the shelf life of metata ayib (traditional Ethiopian spiced fermented cottage cheese).

    Science.gov (United States)

    Geremew, Tsehayneh; Kebede, Ameha; Andualem, Berhanu

    2015-09-01

    Spices and lactic acid bacteria have natural antimicrobial substances and organic compounds having antagonistic activity against microorganisms. The objective of this study was to investigate the role of spices and lactic acid bacteria as antimicrobial agent to extend the shelf life of metata ayib. Antimicrobial activities of spices and lactic acid bacteria (LAB) filtrates were determined by agar well diffusion method against E. coli, S. aureus, S. flexneri and S. peumoniae. Aantimicrobial activity of garlic was found to be the most effective against all the tested pathogens. Inhibition zones of garlic extract against all pathogens was significantly (P ≤ 0.05) greater than the remaining spice extracts. Inhibition zones (12.50 ± 1.00 to 15.50 ± 1.00 mm) of ginger and R. graveolens ethanol extracts against all tested pathogens were significantly (P ≤ 0.05) greater than the remaining solvent extracts. Inhibition zone of O. basilicum ethanol extract against all pathogenic bacteria was significantly (p ≤ 0.05) greater than hexane and acetone extracts. Lactobacillus isolates were shown the highest antimicrobial activity than the other LAB isolates against all pathogens. The synergistic effect of spices together with LAB might be contributed a lot to preserve and extend shelf life of metata ayib. Their antimicrobial activity can reduce the risk of spoilage and pathogenesis. The possible reason of LAB isolates was may be due to production of lactic acid, acetic acid and secondary metabolites like bacteriocins. Aseptic processing of traditional cottage cheese (ayib) is by far needed to minimize risks associated during consumption of metata ayib. PMID:26344979

  18. [Effects of ruta SSP on the activity of the smooth gastrointestinal muscle isolated of rat].

    Science.gov (United States)

    Grigorjev, Carlota A; Brizuela, Nilda Y

    2010-01-01

    Ruta graveolens L. and Ruta chalepensis L. are plants used in folkloric medicine as antispasmodics, digestive and for intestinal gases. Animals used as experimental model were rats of the Wistar line, adult females, clinically healthy and with a weight average of 250 grams. We used strips of stomach and duodenum. Each one of the segments mounted on two stirrups in a bath of organ isolated with Ringer-lactate solution, at 37° C , pH: 7.3-7.4, and bubbled with 95% O2, 5% CO2. One of the stirrups was connected vertically to the bottom of the bath and the other to a transducer of tension connected to a Beckman polygraph. We applied 500 mgs of basal tension. After the stabilization, the ethanolic extract of Ruta ssp was added in increasing doses. At 50μl/ml the tone lower 23% in small intestine and lower 27% in stomach. However at 100 μl/ml the tone lower 32% and 35% respectively. In the other parameters the amplitude decrease 50% in the stomach at dose of 5 μl/ml while in the small intestine the amplitude lower 60%. With 10 μl/ml the amplitude change in both organs ( 96% in small intestine, and 75% in stomach). The frequency changes in both organs ( 32% in small intestine, and 50% in stomach) at 10 μl/ml Rue showed decreased effects on isolated small intestine and stomach were is dose dependent, maybe we were demonstrated the effects digestive of Ruta. PMID:21450144

  19. Herbal infusions used for induced abortion.

    Science.gov (United States)

    Ciganda, Carmen; Laborde, Amalia

    2003-01-01

    Plants and herbs have been used to induce abortions but there is very little published information describing the commonly used ones. The purpose of this report is to describe the herbal products used to induce abortions, and to enhance awareness and understanding of their toxic effects. A descriptive retrospective survey was conducted on the calls received by the Montevideo Poison Centre between 1986 and 1999 concerning the ingestion of herbal infusions with abortive intent. A total of 86 cases involving 30 different plant species were identified. The species most frequently involved were ruda (Ruta chalepensis/graveolens), cola de quirquincho (Lycopodium saururus), parsley (Petroselinum hortense), and an over-the-counter herbal product named Carachipita. The components of Carachipita are pennyroyal (Mentha pulegium), yerba de la perdiz (Margiricarpus pinnatus), oregano (Origanum vulgare), and guaycuri (Statice brasiliensis). Abortion occurred in 23 cases after the ingestion of parsley, ruda, Carachipita, celery, Cedron, francisco alvarez, floripon, espina colorada. Out of the 23 cases, 15 involved the only the ingestion of plants, 4 cases used injected drugs (presumably hormones), and in 4 cases there was associated self-inflicted instrumental manipulation. Multiple organ system failure occurred in those patients who had ingested ruda (alone or in combination with parsley or fennel), Carachipita, arnica, or bardana. Deaths occurred in one case of Carachipita ingestion and in 4 cases of ruda ingestion (2 cases of ruda alone, 2 cases of ruda with parsley and fennel). Self-inflicted instrumental manipulations were found in 4 of the patients with multiple organ system failure and in one of those who died. The results of this report are not conclusive, but it appears that the ingestion of plants to induce abortion involves the risk of severe morbidity and mortality. PMID:12807304

  20. Assessment of heavy metal pollution in vegetables and relationships with soil heavy metal distribution in Zhejiang province, China.

    Science.gov (United States)

    Ye, Xuezhu; Xiao, Wendan; Zhang, Yongzhi; Zhao, Shouping; Wang, Gangjun; Zhang, Qi; Wang, Qiang

    2015-06-01

    There are increasing concerns on heavy metal contaminant in soils and vegetables. In this study, we investigated heavy metal pollution in vegetables and the corresponding soils in the main vegetable production regions of Zhejiang province, China. A total of 97 vegetable samples and 202 agricultural soil samples were analyzed for the concentrations of Cd, Pb, As, Hg, and Cr. The average levels of Cd, Pb, and Cr in vegetable samples [Chinese cabbage (Brassica campestris spp. Pekinensis), pakchoi (Brassica chinensis L.), celery (Apium graveolens), tomato (Lycopersicon esculentum), cucumber (Colletotrichum lagenarium), cowpea (Vigna unguiculata), pumpkin (Cucurbita pepo L.), and eggplant (Solanum melongena)] were 0.020, 0.048, and 0.043 mg kg(-1), respectively. The Pb and Cr concentrations in all vegetable samples were below the threshold levels of the Food Quality Standard (0.3 and 0.5 mg kg(-1), respectively), except that two eggplant samples exceeded the threshold levels for Cd concentrations (0.05 mg kg(-1)). As and Hg contents in vegetables were below the detection level (0.005 and 0.002 mg kg(-1), respectively). Soil pollution conditions were assessed in accordance with the Chinese Soil Quality Criterion (GB15618-1995, Grade II); 50 and 68 soil samples from the investigated area exceeded the maximum allowable contents for Cd and Hg, respectively. Simple correlation analysis revealed that there were significantly positive correlations between the metal concentrations in vegetables and the corresponding soils, especially for the leafy and stem vegetables such as pakchoi, cabbage, and celery. Bio-concentration factor values for Cd are higher than those for Pb and Cr, which indicates that Cd is more readily absorbed by vegetables than Pb and Cr. Therefore, more attention should be paid to the possible pollution of heavy metals in vegetables, especially Cd. PMID:26013654

  1. Activity of Six Essential Oils Extracted from Tunisian Plants against Legionella pneumophila.

    Science.gov (United States)

    Chaftar, Naouel; Girardot, Marion; Quellard, Nathalie; Labanowski, Jérôme; Ghrairi, Tawfik; Hani, Khaled; Frère, Jacques; Imbert, Christine

    2015-10-01

    The aim of this study was to investigate the composition of six essential oils extracted from Tunisian plants, i.e., Artemisia herba-alba Asso, Citrus sinensis (L.) Osbeck, Juniperus phoenicea L., Rosmarinus officinalis L., Ruta graveolens L., and Thymus vulgaris L., and to evaluate their activity against Legionella pneumophila (microdilution assays). Eight Legionella pneumophila strains were studied, including the two well-known serogroup 1 Lens and Paris strains as controls and six environmental strains isolated from Tunisian spas belonging to serogroups 1, 4, 5, 6, and 8. The essential oils were generally active against L. pneumophila. The activities of the A. herba-alba, C. sinensis, and R. officinalis essential oils were strain-dependent, whereas those of the J. phoenicea and T. vulgaris oils, showing the highest anti-Legionella activities, with minimum inhibitory concentrations (MICs) lower than 0.03 and lower than or equal to 0.07 mg/ml, respectively, were independent of the strains' serogroup. Moreover, the microorganisms treated with T. vulgaris essential oil were shorter, swollen, and less electron-dense compared to the untreated controls. Isoborneol (20.91%), (1S)-α-pinene (18.30%) β-phellandrene (8.08%), α-campholenal (7.91%), and α-phellandrene (7.58%) were the major components isolated from the J. phoenicea oil, while carvacrol (88.50%) was the main compound of the T. vulgaris oil, followed by p-cymene (7.86%). This study highlighted the potential interest of some essential oils extracted from Tunisian plants as biocides to prevent the Legionella risk. PMID:26460561

  2. Bacteriostasis Activity of Flower Extracts Against Three Species of Bacteria%花卉提取物对3种细菌的抑菌性测定

    Institute of Scientific and Technical Information of China (English)

    吕慧; 孟雪; 王志英

    2010-01-01

    利用丙酮超声波提取和减压浓缩技术,获得17种花卉茎、叶的提取物,分析各提取物对3种细菌的抑菌结果.天竺葵(Pelargonium graveolens)对腐生葡萄球菌(Staphylococcus saprophyticus)和藤黄葡萄球菌(Micrococcus luteus)具有抑制作用;杜鹃(Rhododendronsimsii & R. spp.)对腐生葡萄球菌和炭疽杆菌(Bacillus anthracis)具有抑制作用.天竺葵提取物4种供试质量浓度对腐生葡萄球菌的抑菌率均达96%以上,杜鹃提取物对炭疽杆菌的抑菌率在77%~84%之间.但天竺葵、杜鹃提取物分别对炭疽杆菌和藤黄葡萄球菌无抑制效果.2种花卉提取物抑菌率卡方检验结果表明,不同质量浓度的天竺葵提取物对藤黄葡萄球菌抑菌率差异显著;杜鹃提取物不同质量浓度间对腐生葡萄球菌的抑菌率差异显著.

  3. Lethal and Inhibitory Activities of Plant-Derived Essential Oils Against Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) Biotype B in Tomato.

    Science.gov (United States)

    Fanela, T L M; Baldin, E L L; Pannuti, L E R; Cruz, P L; Crotti, A E M; Takeara, R; Kato, M J

    2016-04-01

    The silverleaf whitefly Bemisia tabaci (Genn.) biotype B (Hemiptera: Aleyrodidae) is one of the most severe tomato pests in the world. The damage caused by this insect may compromise up to 100% of crop production, and management of this pest has relied on spraying of synthetic insecticides. However, due to the environmental issues associated with this practice, alternative methods such as the use of botanical pesticides are now used as a strategy of integrated pest management (IPM). We evaluated the effects of essential oils of five plant species on B. tabaci biotype B in tomato and demonstrate that the essential oils (0.5%) of Piper callosum (PC-EO), Adenocalymma alliaceum (AA-EO), Pelargonium graveolens (PG-EO), and Plectranthus neochilus (PN-EO) inhibit the settlement and oviposition of B. tabaci biotype B adults in tomato plants. In fumigation tests, A. alliaceum (AA-EO) at 0.4 μL/L of air after 72 h and 0.1 μL/L of air after 6 h was the most effective against nymphs and adults of B. tabaci biotype B, respectively. The major chemical constituents of PC-EO were identified as being safrole (29.3%), α-pinene (19.2%), and β-pinene (14.3%), whereas diallyl trisulfide (66.9%) and diallyl disulfide (23.3%) were the major compounds identified in AA-EO. This is the first report on the reduction of oviposition by the use of P. callosum (PC-EO) and A. alliaceum (AA-EO). In addition, the fumigant effect of A. alliaceum (AA-EO) on nymphs and adults has also been reported here for the first time. PMID:26712319

  4. Repelência e atividade inseticida de pós vegetais sobre Zabrotes subfasciatus Boheman em feijão-fava armazenado

    Directory of Open Access Journals (Sweden)

    J.E. Girão Filho

    2014-09-01

    Full Text Available O objetivo desta pesquisa foi avaliar o potencial inseticida de Piper nigrum L. (pimenta do reino, Ruta graveolens L. (arruda, Laurus nobilis L. (louro, Syzygium aromaticum (L. Merr. & L.M.Perry (cravo da índia, Chenopodium ambrosioides L. (mastruz, Piper tuberculatum Jaqc. (pimenta de macaco, Tagetes erecta L. (cravo de defunto, Cymbopogon nardus L. (citronela e Melissa officinalis L. (erva cidreira sobre Z. subfasciatus Boh. através dos testes de confinamento, onde os insetos foram confinados durante cinco dias em um recipiente contendo dez grãos de feijão-fava com 0,3 g do pó da planta a ser testada, e, com chance de escolha por meio de uma arena circular, os insetos tiveram a possibilidade de escolha entre grãos com os pós e a testemunha, grãos sem pó das plantas. Observou-se que houve plantas que atuaram como inseticida, outras que repeliram o inseto e não causaram a morte, e outras, que além de repelir também mataram os insetos quando em contato (cravo da índia e matruz. Concluímos que: P. nigrum, P. tuberculatum, S. aromaticum e C. ambrosioides são tóxicas à Z. subfasciatus causando-lhes a morte, L. nobilis, T. erecta, e C. nardus não apresentaram efeito tóxico sobre Z. subfasciatus, C. ambrosioides, S. aromaticum, e C. nardus são repelentes à Z. subfasciatus; P. nigrum, P. tuberculatum, e T. erecta são neutras, e que M. officinalis não apresentou nenhum efeito sobre Z. subfasciatus em relação aos parâmetros avaliados.

  5. In-vitro screening of acetylcholinesterase inhibitory activity of extracts from Palestinian indigenous flora in relation to the treatment of Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Mohammed Saleem Ali-Shtayeh

    2014-09-01

    Full Text Available Background: Cholinesterase inhibitory therapy serves as a strategy for the treatment of Alzheimer’s disease (AD. Several acetylcholinesterase inhibitors (AChEIs are used for the symptomatic treatment of AD. These compounds have been reported to have adverse effects, including gastrointestinal disturbances. This study was therefore partly aimed at investigating in vitro possible AChEIs in herbal medicines traditionally used in Palestine to treat cognitive disorders, and to point out the role of these plants as potential sources for development of newly potent and safe natural therapeutic agents of AD. Assay of AChE activity plays an important role in vitro characterization of drugs including potential treatments for AD. The most widely used method, is based on Ellman’s method. The reactant used in this method shows chemical reactivity with oxime antidots and thiol leading to false positive reactions. A new alternative assay could be of high interest. Methods: The effect on AChE activity of 92 extracts of 47 medicinal plants were evaluated using a new micro-well plate AChE activity (NA-FB and Ellman’s assays. In addition, antioxidant activity using DPPH was determined. Results: The main advantages of the new method (NA-FB is that the colorimetric change is better observable visually allowing spectrophotometric as well as colorimetric assay, and does not show any chemical reactivity with thiol. 67.4% and 37% of extracts inhibited AChE by >50% using the NA-FB and Ellman’s assays, respectively. Using NA-FB assay, 84 extracts interacted reversibly with the enzyme, of which Mentha spicata (94.8%, Foeniculum vulgare (89.81, and Oxalis pes-caprae (89.21 were most potent, and 8 showed irreversible inhibition of which leaves of Lupinus pilosus (92.02% were most active. Antioxidant activity was demonstrated by 73 extracts Majorana syriaca (IC50 0.21mg/ml, and Rosmarinus officinalis (0.38 were the most active. Conclusions: NA-FB assay has shown to be

  6. Evaluation of antibacterial activity of crude protein extracts from seeds of six different medical plants against standard bacterial strains.

    Science.gov (United States)

    Al Akeel, Raid; Al-Sheikh, Yazeed; Mateen, Ayesha; Syed, Rabbani; Janardhan, K; Gupta, V C

    2014-04-01

    A huge group of natural antimicrobial compounds are active against a large spectrum of bacterial strains causing infectious threat. The present study was conducted to investigate the crude extracts of antimicrobial protein and peptide efficacy from six medicinal plant seeds. Extraction was carried out in Sodium phosphate citrate buffer, and Sodium acetate buffer using different pH. Antimicrobial activities of these plants were determined by the microbiological technique using Agar well diffusion Assay. Extremely strong activity was observed in the seed extracts of Allium ascolinicum extracted in sodium phosphate citrate buffer at pH (5.8) against Proteus vulgaris, Escherichia coli and Staphylococcus aureus with zone of inhibition 17 mm, 17 mm and 15 mm and Rumex vesicarius at pH (7.6), Ammi majus at pH (6.8), Cichorium intybus at pH (7.4) and Cucumis sativus at pH (7.8) also showed better sensitivity against the bacterial strains with zone of inhibition ranges 16-10 mm and some of the strains were found to be resistant. Antibacterial activity pattern of different plant extracts prepared in sodium acetate buffer pH (6.5), among all the plant seed extracts used Foeniculum vulgare had shown good inhibition in all the bacterial strains used, with zone of inhibition ranges 11-12.5 mm, The extracts of C. intybus and C. sativus were found to be effective with zone of inhibition 11-6 mm and some of the strains were found to be resistant. Most of the strains found to have shown better sensitivity compared with the standard antibiotic Chloramphenicol (25 mcg). Our results showed that the plants used for our study are the richest source for antimicrobial proteins and peptides and they may be used for industrial extraction and isolation of antimicrobial compounds which may find a place in medicine industry as constituents of antibiotics. PMID:24600307

  7. Traditional knowledge of wild edible plants used in Palestine (Northern West Bank: A comparative study

    Directory of Open Access Journals (Sweden)

    Khlaif Rasha B

    2008-05-01

    Full Text Available Abstract Background A comparative food ethnobotanical study was carried out in fifteen local communities distributed in five districts in the Palestinian Authority, PA (northern West Bank, six of which were located in Nablus, two in Jenin, two in Salfit, three in Qalqilia, and two in Tulkarm. These are among the areas in the PA whose rural inhabitants primarily subsisted on agriculture and therefore still preserve the traditional knowledge on wild edible plants. Methods Data on the use of wild edible plants were collected for one-year period, through informed consent semi-structured interviews with 190 local informants. A semi-quantitative approach was used to document use diversity, and relative importance of each species. Results and discussion The study recorded 100 wild edible plant species, seventy six of which were mentioned by three informants and above and were distributed across 70 genera and 26 families. The most significant species include Majorana syriaca, Foeniculum vulgare, Malvasylvestris, Salvia fruticosa, Cyclamen persicum, Micromeria fruticosa, Arum palaestinum, Trigonella foenum-graecum, Gundelia tournefortii, and Matricaria aurea. All the ten species with the highest mean cultural importance values (mCI, were cited in all five areas. Moreover, most were important in every region. A common cultural background may explain these similarities. One taxon (Majoranasyriaca in particular was found to be among the most quoted species in almost all areas surveyed. CI values, as a measure of traditional botanical knowledge, for edible species in relatively remote and isolated areas (Qalqilia, and Salfit were generally higher than for the same species in other areas. This can be attributed to the fact that local knowledge of wild edible plants and plant gathering are more spread in remote or isolated areas. Conclusion Gathering, processing and consuming wild edible plants are still practiced in all the studied Palestinian areas. About 26

  8. Uso de hierbas medicinales en mujeres gestantes y en lactancia en un hospital universitario de Bogotá (Colombia The use of herbal medicine among pregnant and lactating women attending a university hospital in Bogota, Colombia

    Directory of Open Access Journals (Sweden)

    Gloria Paulina Pulido Acuña

    2012-12-01

    Full Text Available Las mujeres durante la gestación y lactancia utilizan diferentes hierbas y es escasa la información en el ámbito clínico en Colombia. Objetivo: Describir las prácticas relacionadas con el uso de hierbas en mujeres gestantes y en lactancia del Hospital de San José, Bogotá (Colombia. Metodología: Estudio de corte transversal. Con un cuestionario estructurado se indagó el uso, la frecuencia, el modo y razones de uso, de las hierbas medicinales y de quién se aprendió la práctica. Resultados: El uso de hierbas en mujeres gestantes y en lactancia fue de 33.6% (IC95%: 29.2% - 38% y 36.6% (IC95%: 30.8% - 42.3%, respectivamente. En el grupo de gestantes la hierba más usada fue la manzanilla (36.7% y en las mujeres en lactancia fue el hinojo (65%. Conclusión: Las mujeres gestantes y en lactancia, utilizan hierbas para las molestias del embarazo, acelerar el parto, disminuir el frío y promover la producción de leche.The use of herbal supplements is a common practice about pregnant and lactating women, however in Colombia there is limited data regarding the extent of women's use of herbal medicines during pregnancy and breastfeeding. The aim of this study was to describe the patterns of herbal medication use among pregnant and lactating women at the Hospital San Jose in Bogota, Colombia. Methods: Cross-sectional study. A questionnaire was designed to measure the frequency of herbal supplementation, why women took the herbal medicine, form of supplements, and who recommended the supplements or how did they learn about the herbal supplements. Results: The use of herbal supplements among pregnant and lactating women is 33.6% (CI 95%: 29.2%-38% and 36.6 (CI 95%: 30.8%-42.3%, respectively. The most common supplement used by pregnant women is Chamomile (36,7%, and among lactating women is Fennel (Foeniculum vulgare (65%. Conclusion: Pregnant and breastfeeding women use herbal supplements for specific pregnancy-related problems, to induce labor, to

  9. Ocorrência do uso de plantas medicinais por moradores de um bairro do município de Marília-SP

    Directory of Open Access Journals (Sweden)

    A. F. Macedo

    2009-01-01

    Full Text Available

    As plantas medicinais continuam ocupando lugar de destaque no arsenal terapêutico e muitas vezes, é o único recurso de muitas comunidades e grupos étnicos. O objetivo do presente trabalho foi pesquisar a ocorrência do uso de plantas medicinais em residências de um bairro do município de Marília-SP. Foram entrevistados moradores de 150 residências do Jardim Lavínia, no período de março a julho de 2006. Foram aplicados questionários semi-estruturados para o levantamento dos dados. Os resultados mostraram que 19,34% das residências, possuíam plantas e destas, 41,37% de Melissa officinalis, 31,03% de Matricaria chamomilla, 13,79% de Camellia sinensis, Mentha piperita e Foeniculum vulgare, 6,89% de Valeriana officinalis, Baccharis triptera, Peumus boldus e 27,52% outros. A indicação do uso foi de 55,17% por amigos/parentes, 13,79% por TV/Rádio, 13,79% por cultura/crenças, 6,89% não responderam e apenas 10,34% por prescrição médica. Das plantas medicinais encontradas, 31,25% eram utilizados de modo contrário à sua finalidade. Dos moradores entrevistados, 41,37% apresentavam idade acima de 46 anos e 31,03% possuíam ensino superior completo. Estes dados permitem concluir que mesmo o consumo sendo amplo no Brasil, ainda existe escassez de informação e a falta desta se dá também em indivíduos de nível superior, podendo gerar uso incorreto. Os meios de comunicação já não são mais os grandes vilões do estímulo do uso das plantas medicinais, a cultura popular faz com que as indicações sejam transmitidas de pessoa para pessoa, atingindo também a população mais favorecida economicamente. Palavras-chave: etnobotânica; plantas medicinais; farmacoterapia; fitoterápicos.

  10. Irradiated Sewage Sludge for Production of Fennel Plants in Sandy Soil

    International Nuclear Information System (INIS)

    Irradiated sewage sludge (SS) has proved to be a useful organic fertilizer particularly for sandy soil. The objective of this study is to compare the response of fennel (Foeniculum vulgare L.) plants growing in sandy soil to different fertilizer regimes, organic vs. mineral. In a field experiment four levels (20, 40, 60, 80 t/ha) of irradiated and non-irradiated sewage sludge were incorporated into sandy soil, in addition to the control treatment (mineral fertilizer). Samples analysis included the biomass production at the vegetative and flowering stages, chlorophyll content, total and reducing sugars and heavy metals content of the shoots. The data indicate that the biomass production has dramatically increased as the sludge application rate increased in both irradiated and non-irradiated plots. However, the increase was significantly higher under all irradiated treatments than the corresponding rates of non-irradiated treatments at both the vegetative and flowering stages. Also, the biomass production at all levels of application was higher than the control, receiving mineral fertilizer. At the vegetative stage, the biomass values ranged from 3.1 g/plant for the control to 10.2 and 34.1 g/plant at 80 t/ha for non-irradiated and irradiated sewage sludge, respectively. Whereas, at the flowering stage the values ranged from 9.8 g/plant for the control to 23.9 and 65.1 g/plant at 80 t/ha for non-irradiated and irradiated sewage sludge, respectively. Total sugars, reducing sugar, non-reducing sugar, and chlorophyll content has increased as the sludge application rate increased. At 80t/ha application rate of irradiated sludge, the reducing sugars content was 29.39 mg/g DW at the vegetative stage and 37.85 mg/g DW at the flowering stage. Reducing sugars recorded lower values in the control plants, 14.54 mg/g DW at the vegetative stage and 18.78 mg/g DW at the flowering stage. Heavy metals (Zn, Fe, Pb, Cd) of the shoots was also determined. Sewage sludge was a good

  11. Oxidative stability of chicken thigh meat after treatment of fennel and savory essential oils

    Directory of Open Access Journals (Sweden)

    Adriana Pavelková

    2016-05-01

    Full Text Available In the present work, the effect of the fennel and savory essential oils on oxidative stability of chicken thigh muscles during chilled storage was investigated. In the experiment were used chickens of hybrid combination Cobb 500 after 42 days of the fattening period. The obtained fresh chicken thigh with skin from left half-carcass were divided into five groups (n = 5: C - control air-packaged group; A1 - vacuum-packaged experimental group; A2 - vacuum-packaged experimental group with EDTA solution 1.50% w/w; A3 - vacuum-packaged experimental group with fennel (Foeniculum vulgare essential oil at concentrations 0.2% v/w and A4 - vacuum-packaged experimental group with savory (Satureja hortensis essential oil at concentration 0.2% v/w. The essential oils were applicate on surface chicken thighs. The chicken thighs were packaged using a vacuum packaging machine and stored in refrigerate at                 4 ±0.5 °C. The value of thiobarbituric acid (TBA expressed as amount of malondialdehyde (MDA in 1 kg sample was measured during storage in 1st, 4th, 8th, 12th and 16th day. The treatments of chicken thighs with fennel and savory essential oils show statistically significant differences between all testing groups and control group, where higher average value of MDA measured in thigh muscle of broiler chickens was in samples of control group                 (0.359 mg.kg-1 compared to experimental groups A1 (0.129 mg.kg-1, A2 (0.091 mg.kg-1, A3 (0.084 mg.kg-1 and A4 (0.089 mg.kg-1 after 16-day of chilled storage. Experiment results show that the treatment of chicken thigh with fennel and savory essential oils had positive influence on the reduction of oxidative processes in thigh muscles during chilling storage and use of essential oil is one of the options increase shelf life of fresh chicken meat.

  12. The importance of a taste. A comparative study on wild food plant consumption in twenty-one local communities in Italy.

    Science.gov (United States)

    Ghirardini, Maria Pia; Carli, Marco; del Vecchio, Nicola; Rovati, Ariele; Cova, Ottavia; Valigi, Francesco; Agnetti, Gaia; Macconi, Martina; Adamo, Daniela; Traina, Mario; Laudini, Francesco; Marcheselli, Ilaria; Caruso, Nicolò; Gedda, Tiziano; Donati, Fabio; Marzadro, Alessandro; Russi, Paola; Spaggiari, Caterina; Bianco, Marcella; Binda, Riccardo; Barattieri, Elisa; Tognacci, Alice; Girardo, Martina; Vaschetti, Luca; Caprino, Piero; Sesti, Erika; Andreozzi, Giorgia; Coletto, Erika; Belzer, Gabriele; Pieroni, Andrea

    2007-01-01

    A comparative food ethnobotanical study was carried out in twenty-one local communities in Italy, fourteen of which were located in Northern Italy, one in Central Italy, one in Sardinia, and four in Southern Italy. 549 informants were asked to name and describe food uses of wild botanicals they currently gather and consume. Data showed that gathering, processing and consuming wild food plants are still important activities in all the selected areas. A few botanicals were quoted and cited in multiple areas, demonstrating that there are ethnobotanical contact points among the various Italian regions (Asparagus acutifolius, Reichardia picroides, Cichorium intybus, Foeniculum vulgare, Sambucus nigra, Silene vulgaris, Taraxacum officinale, Urtica dioica, Sonchus and Valerianella spp.). One taxon (Borago officinalis) in particular was found to be among the most quoted taxa in both the Southern and the Northern Italian sites. However, when we took into account data regarding the fifteen most quoted taxa in each site and compared and statistically analysed these, we observed that there were a few differences in the gathering and consumption of wild food plants between Northern and Southern Italy. In the North, Rosaceae species prevailed, whereas in the South, taxa belonging to the Asteraceae, Brassicaceae, and Liliaceae s.l. families were most frequently cited. We proposed the hypothesis that these differences may be due to the likelihood that in Southern Italy the erosion of TK on wild vegetables is taking place more slowly, and also to the likelihood that Southern Italians' have a higher appreciation of wild vegetables that have a strong and bitter taste. A correspondence analysis confirmed that the differences in the frequencies of quotation of wild plants within the Northern and the Southern Italian sites could be ascribed only partially to ethnic/cultural issues. An additional factor could be recent socio-economic shifts, which may be having a continued effort on

  13. The importance of a taste. A comparative study on wild food plant consumption in twenty-one local communities in Italy

    Directory of Open Access Journals (Sweden)

    Binda Riccardo

    2007-05-01

    Full Text Available Abstract A comparative food ethnobotanical study was carried out in twenty-one local communities in Italy, fourteen of which were located in Northern Italy, one in Central Italy, one in Sardinia, and four in Southern Italy. 549 informants were asked to name and describe food uses of wild botanicals they currently gather and consume. Data showed that gathering, processing and consuming wild food plants are still important activities in all the selected areas. A few botanicals were quoted and cited in multiple areas, demonstrating that there are ethnobotanical contact points among the various Italian regions (Asparagus acutifolius, Reichardia picroides, Cichorium intybus, Foeniculum vulgare, Sambucus nigra, Silene vulgaris, Taraxacum officinale, Urtica dioica, Sonchus and Valerianella spp.. One taxon (Borago officinalis in particular was found to be among the most quoted taxa in both the Southern and the Northern Italian sites. However, when we took into account data regarding the fifteen most quoted taxa in each site and compared and statistically analysed these, we observed that there were a few differences in the gathering and consumption of wild food plants between Northern and Southern Italy. In the North, Rosaceae species prevailed, whereas in the South, taxa belonging to the Asteraceae, Brassicaceae, and Liliaceae s.l. families were most frequently cited. We proposed the hypothesis that these differences may be due to the likelihood that in Southern Italy the erosion of TK on wild vegetables is taking place more slowly, and also to the likelihood that Southern Italians' have a higher appreciation of wild vegetables that have a strong and bitter taste. A correspondence analysis confirmed that the differences in the frequencies of quotation of wild plants within the Northern and the Southern Italian sites could be ascribed only partially to ethnic/cultural issues. An additional factor could be recent socio-economic shifts, which may be having

  14. 20种非寄主植物挥发物对褐飞虱拒避与引诱行为的影响%Effects of volatiles in twenty non-host plants on the repellented and attractive behaviors of brown planthopper, Nilaparvata lugens

    Institute of Scientific and Technical Information of China (English)

    张献英; 霍治国; 犹昌艳; 胡飞

    2014-01-01

    【目的】为开发和设计褐飞虱Nilaparvata lugens拒避剂与引诱剂提供科学依据.【方法】利用Y型嗅觉仪测定褐飞虱对20种非寄主植物释放的挥发物及对α-蒎烯、α-水芹烯、崁烯、芳樟醇的拒避与引诱行为.【结果和结论】枸树Broussonetia papyrifera、塞楝Khaya senegalensis、胜红蓟Ageratum conyzoides、蟛蜞菊Wedelia chinensis、鬼针草Bidens pilosa、马樱丹Lantana camara、桉树Eucalyptus exsetrta、毛麻楝Chukrasia tabularis的叶片和小茴香Foeniculum vulgare的种子挥发物对褐飞虱雌成虫具有显著的拒避作用,其中蟛蜞菊、塞楝和桉树叶片挥发物的拒避作用比较明显,拒避率分别为87.5%、83.3%和72.0%;洋葱Allium cepa(鳞茎)挥发物对褐飞虱具有极显著的引诱作用,引诱率为73.1%;其他植物叶片挥发物对褐飞虱的拒避与引诱行为没有显著的影响.9种植物共有的3种挥发成分在测试浓度下,α-蒎烯对褐飞虱雌成虫有显著的引诱作用,崁烯对其有显著的拒避作用,α-水芹烯则对其拒避与引诱行为没有显著影响.水稻挥发物芳樟醇因含量不同,褐飞虱雌成虫的选择行为有差异,芳樟醇用量为1μL时对褐飞虱具有显著引诱作用,10μL以上时表现为拒避作用,15μL以上均具有极显著的拒避作用.%[Objective]To provide scientific evidence for the development and design of repellents and at-tractants of brown planthopper ,Nilaparvata lugens Stal ( BPH).[Method] The repellented and attrac-tivebehaviors response of female adults BPH to volatiles of twenty non-host plants and α-phellandrene ,α-pinene ,camphene and linalool were tested by a Y-tube olfactometer .[Result and conclusion] The vola-tiles of Broussonetia papyrifera,Khaya senegalensis,Ageratum conyzoides,Wedelia chinensis,Bidens pilosa, Lantana camara, Eucalyptus exsetrta, Chukrasia tabularis, and the nuts of Foeniculum vulgare revealed

  15. Comparison Of Cd And Zn Accumulation In Tissues Of Different Vascular Plants: A Radiometric Study

    Directory of Open Access Journals (Sweden)

    Dürešová Zuzana

    2015-12-01

    Full Text Available The aim of the present work was to compare the accumulation and translocation of Cd and Zn in plants of tobacco (Nicotiana tabacum L., celery (Apium graveolens L., maize (Zea mays L., giant reed (Arundo donax L., and alpine pennycress (Noccaea caerulescens L. under conditions of short-term hydroponic experiments using nutrient solutions spiked with radionuclides 109Cd or 65Zn, and direct gamma-spectrometry. It was found that the time-course of metals accumulation in studied plants was not different in terms of target metal, but it was significantly different on the level of plant species. The highest values of Cd accumulation showed plants of giant reed, whereby the accumulation decreased in the order: giant reed > tobacco > alpine pennycress >> maize and celery. On the basis of concentration ratios (CR [Me]shoot / [Me]root calculation for both metals, it was found that Cd and Zn were in prevailing part accumulated in the root tissues and only partially accumulated in the shoots, where the amount of accumulated Cd and Zn increased from the oldest developed leaves to the youngest developed leaves. The CR values corresponding to these facts were calculated in the range 0.06 – 0.27 for Cd and for Zn 0.06 – 0.48. In terms of plant species, the CR values obtained for Cd decreased in the order: maize > celery > tobacco and giant reed > alpine pennycress. The similarity between studied objects – individual plant species on the basis of the obtained variables defining Cd or Zn accumulation at different conditions of the experiments as well as the relationships between obtained variables and conditions of the experiments were subjected to multivariate analysis method – cluster analysis (CA. According to the findings and this analysis, it can be expected that plants of tobacco and giant reed will dispose with similar characteristics as plants of alpine pennycress, which are classified as Zn/Cd hyperaccumulators, in terms of Cd or Zn accumulation

  16. Avaliação fototóxica e screening mutagênico de extratos de propolis, Aloe spp. e Hamamelis virginiana

    Directory of Open Access Journals (Sweden)

    M. F.S. RAMOS

    2009-01-01

    Full Text Available

    A utilização de extratos vegetais em produtos farmacêuticos e cosméticos tem mostrado ser uma tendência mundial e cresceu substancialmente nas duas últimas décadas. No entanto, há ainda poucos relatos na literatura com relação à atividade mutagênica ou fototóxica de extratos vegetais. No presente trabalho foi avaliada a atividade fototóxica e o “screening” mutagênico de extratos fluidos e secos de própolis, Aloe spp. e Hamamelis virginiana. Na investigação de fototoxicidade foram realizados ensaios microbiológicos, utilizando cepas de Candida albicans e Saccharomyces cerevisiae, bem como ensaios biológicos com cobaias albinos. Extratos etanólicos de Ruta graveolens e Citrus spp., além de 8-metoxipsoraleno (fármaco sintético padrão, foram usados como controles positivos em ambos os testes. A atividade mutagênica foi avaliada qualitativamente segundo o “spot test” descrito por Maron & Ames, com cepas de Salmonella typhimurium TA97, TA98, TA100 e TA102, empregando como controle positivo o óxido de 4-nitroquinolina. Não foi observada atividade fototóxica, em ambos os ensaios realizados, para qualquer dos extratos. O ensaio microbiológico demonstrou uma atividade fungistática ou fungicida nos extratos secos de hamamélis. Os resultados obtidos nos ensaios microbiológicos com a levedura S. cerevisiae indicam que este microrganismo apresentou eficiência no procedimento de “screening” de atividade fototóxica comparável à obtida com C. albicans. Os extratos vegetais não apresentaram atividade mutagênica nos ensaios preliminares realizados. Palavras-chave: Aloe spp., Hamamelis virginiana, própolis, fototoxicidade, mutagenicidade.

  17. Natural Plant Oils and Terpenes as Protector for the Potato Tubers against Phthorimaea operculella Infestation by Different Application Methods

    Directory of Open Access Journals (Sweden)

    Aziza Sharaby

    2014-06-01

    Full Text Available For protecting potato tubers from the potato tuber moth (PTM infestation during storage, different concentrations of ten natural plant oils and three commercial monoterpnes were tested, some as fumigants or dusts against adults or dusts against neonate larvae, while others as sprays on the gunny sacks in which potato tubers were stored. Tuber damage indices as well as persistence indices for tested materials were assessed. Vapors of Cymbopogon citratus, Myristica fragrans (nutmag, Mentha citrata and a-Ionone (monoterpene caused a highly significant reductions in the life span of exposed moths as well as in new adult offsprings. Other tested oils as Cinnamonium zeylanicum, Myristica. fragrans (Mace and Pelargonium graveolens caused a insignificant effect. There was no significant effect of the tested vapors on egg hatchability, except in case of oils of C. citratus, M. fragrans (nutmag and M. tragrans(Mace oil which caused high reduction in egg hatchability. According to the values of damage indices, the most effective oil vapors were arranged ascendingly as follows: Myristica (nutmag < Cymbopogon < Mentha < a - Ionone. Dusting potato tubers with 1% conc., (mixed with talcum powder of Myristica, Mentha, Cymbopogons oils and a-Ionone (monoterpene caused high reduction in egg deposition, adult emergence as well as percentage of penetrated larvae of PTM. According to their damage indices, Cymbopogon and ά-Ionone were the most protective oils, followed by Myristica and Mentha. Spraying gunnysacks with 1% conc., of the aforementioned natural oils separately elicited high reduction in PTM progeny; while their combinations did not elicit any significant synergistic effect. According to their tuber damage indices, it was found that Cymbopogon oil alone or mixed with Myristica oil showed the best protective effect, followed by Myristica oil alone and Mentha oil mixed with Cymbopogon oil. Assessment of the persistence index of various tested materials

  18. Nanostructured lipid system as a strategy to improve the anti-Candida albicans activity of Astronium sp.

    Directory of Open Access Journals (Sweden)

    Bonifácio BV

    2015-08-01

    Full Text Available Bruna Vidal Bonifácio,1 Matheus Aparecido dos Santos Ramos,1 Patrícia Bento da Silva,2 Kamila Maria Silveira Negri,1 Érica de Oliveira Lopes,1 Leonardo Perez de Souza,3 Wagner Vilegas,4 Fernando Rogério Pavan,1 Marlus Chorilli,2 Taís Maria Bauab11Department of Biological Sciences, 2Department of Drugs and Medicines, School of Pharmaceutical Sciences, 3Department of Organic Chemistry, Chemistry Institute, UNESP – Univ Estadual Paulista, Araraquara, São Paulo, Brazil; 4Coastal Campus of São Vicente, UNESP – Univ Estadual Paulista, São Vicente, São Paulo, BrazilAbstract: The genus Astronium (Anacardiaceae includes species, such as Astronium fraxinifolium, Astronium graveolens, and Astronium urundeuva, which possess anti-inflammatory, anti-ulcerogenic, healing, and antimicrobial properties. Nanostructured lipid systems are able to potentiate the action of plant extracts, reducing the required dose and side effects and improving antimicrobial activity. This work aims to evaluate a nanostructured lipid system that was developed as a strategy to improve the anti-Candida albicans activity of hydroethanolic extracts of stems and leaves from Astronium sp. The antifungal activity against C. albicans (ATCC 18804 was evaluated in vitro by a microdilution technique. In addition to the in vitro assays, the Astronium sp. that showed the best antifungal activity and selectivity index was submitted to an in vivo assay using a model of vulvovaginal candidiasis infection. In these assays, the extracts were either used alone or were incorporated into the nanostructured lipid system (comprising 10% oil phase, 10% surfactant, and 80% aqueous phase. The results indicated a minimal inhibitory concentration of 125.00 µg/mL before incorporation into the nanostructured system; this activity was even more enhanced when this extract presented a minimal inhibitory concentration of 15.62 µg/mL after its incorporation. In vivo assay dates showed that the

  19. Sensitization prevalence, antibody cross-reactivity and immunogenic peptide profile of Api g 2, the non-specific lipid transfer protein 1 of celery.

    Directory of Open Access Journals (Sweden)

    Gabriele Gadermaier

    Full Text Available BACKGROUND: Celery (Apium graveolens represents a relevant allergen source that can elicit severe reactions in the adult population. To investigate the sensitization prevalence and cross-reactivity of Api g 2 from celery stalks in a Mediterranean population and in a mouse model. METHODOLOGY: 786 non-randomized subjects from Italy were screened for IgE reactivity to rApi g 2, rArt v 3 (mugwort pollen LTP and nPru p 3 (peach LTP using an allergen microarray. Clinical data of 32 selected patients with reactivity to LTP under investigation were evaluated. Specific IgE titers and cross-inhibitions were performed in ELISA and allergen microarray. Balb/c mice were immunized with purified LTPs; IgG titers were determined in ELISA and mediator release was examined using RBL-2H3 cells. Simulated endolysosomal digestion was performed using microsomes obtained from human DCs. RESULTS: IgE testing showed a sensitization prevalence of 25.6% to Api g 2, 18.6% to Art v 3, and 28.6% to Pru p 3 and frequent co-sensitization and correlating IgE-reactivity was observed. 10/32 patients suffering from LTP-related allergy reported symptoms upon consumption of celery stalks which mainly presented as OAS. Considerable IgE cross-reactivity was observed between Api g 2, Art v 3, and Pru p 3 with varying inhibition degrees of individual patients' sera. Simulating LTP mono-sensitization in a mouse model showed development of more congruent antibody specificities between Api g 2 and Art v 3. Notably, biologically relevant murine IgE cross-reactivity was restricted to the latter and diverse from Pru p 3 epitopes. Endolysosomal processing of LTP showed generation of similar clusters, which presumably represent T-cell peptides. CONCLUSIONS: Api g 2 represents a relevant celery stalk allergen in the LTP-sensitized population. The molecule displays common B cell epitopes and endolysosomal peptides that encompass T cell epitopes with pollen and plant-food derived LTP.

  20. The perspective crops for the bioregenerative human life support systems

    Science.gov (United States)

    Polonskiy, Vadim; Polonskaya, Janna

    The perspective crops for the bioregenerative human life support systems V.I. Polonskiy, J.E. Polonskaya aKrasnoyarsk State Agrarian University, 660049, Krasnoyarsk, Russia In the nearest future the space missions will be too long. In this case it is necessary to provide the crew by vitamins, antioxidants, and water-soluble dietary fibers. These compounds will be produced by higher plants. There was not enough attention at present to increasing content of micronutrients in edible parts of crops candidates for CELSS. We suggested to add the new crops to this list. 1. Barley -is the best crop for including to food crops (wheat, rice, soybean). Many of the health effects of barley are connected to dietary fibers beta-glucan of barley grains. Bar-ley is the only seed from cereals including wheat with content of all eight tocopherols (vitamin E, important antioxidant). Barley grains contain much greater amounts of phenolic compounds (potential antioxidant activities) than other cereal grains. Considerable focus is on supplement-ing wheat-based breads with barley to introduce the inherent nutritional advantages of barley flour, currently only 20We have selected and tested during 5 generations two high productive barley lines -1-K-O and 25-K-O. Our investigations (special breeding program for improving grain quality of barley) are in progress. 2. Volatile crops. Young leaves and shoots of these crops are edible and have a piquant taste. A lot of organic volatile compounds, oils, vitamins, antioxidants are in their biomass. These micronutrients are useful for good appetite and health of the crew. We have investigated 11 species: basil (Ocimum basilicum), hyssop (Hyssopus officinalis), marjoram (Origanum majorana), sweet-Mary (Melissa officinalis), common thyme (Thymus vulgaris), creeping thyme (Thymus serpyllum), summer savory (Satureja hortensis), catnip (Nepeta cataria), rue (Ruta graveolens), coriander (Coriandrum Ativum), sulfurwort (Levisticum officinale). These

  1. Patent literature on mosquito repellent inventions which contain plant essential oils--a review.

    Science.gov (United States)

    Pohlit, Adrian Martin; Lopes, Norberto Peporine; Gama, Renata Antonaci; Tadei, Wanderli Pedro; Neto, Valter Ferreira de Andrade

    2011-04-01

    Bites Bites of mosquitoes belonging to the genera Anopheles Meigen, Aedes Meigen, Culex L. and Haemagogus L. are a general nuisance and are responsible for the transmission of important tropical diseases such as malaria, hemorrhagic dengue and yellow fevers and filariasis (elephantiasis). Plants are traditional sources of mosquito repelling essential oils (EOs), glyceridic oils and repellent and synergistic chemicals. A Chemical Abstracts search on mosquito repellent inventions containing plant-derived EOs revealed 144 active patents mostly from Asia. Chinese, Japanese and Korean language patents and those of India (in English) accounted for roughly 3/4 of all patents. Since 1998 patents on EO-containing mosquito repellent inventions have almost doubled about every 4 years. In general, these patents describe repellent compositions for use in topical agents, cosmetic products, incense, fumigants, indoor and outdoor sprays, fibers, textiles among other applications. 67 EOs and 9 glyceridic oils were individually cited in at least 2 patents. Over 1/2 of all patents named just one EO. Citronella [Cymbopogon nardus (L.) Rendle, C.winterianus Jowitt ex Bor] and eucalyptus (Eucalyptus LʼHér. spp.) EOs were each cited in approximately 1/3 of all patents. Camphor [Cinnamomum camphora (L.) J. Presl], cinnamon (Cinnamomum zeylanicum Blume), clove [Syzygium aromaticum (L.) Merr. & L.M. Perry], geranium (Pelargonium graveolens LʼHér.), lavender (Lavandula angustifolia Mill.), lemon [Citrus × limon (L.) Osbeck], lemongrass [Cymbopogon citratus (DC.) Stapf] and peppermint (Mentha × piperita L.) EOs were each cited in > 10% of patents. Repellent chemicals present in EO compositions or added as pure “natural” ingredients such as geraniol, limonene, p-menthane-3,8-diol, nepetalactone and vanillin were described in approximately 40% of all patents. About 25% of EO-containing inventions included or were made to be used with synthetic insect control agents having mosquito

  2. 芹菜素对癌细胞作用机理的研究进展%Research progress in mechanism of apigenin' s anticarcinogenic activity on cancer cells

    Institute of Scientific and Technical Information of China (English)

    陈况况; 章宏慧; 陈健初

    2013-01-01

    Apigenin is an important flavonoid in Apium graveolens.lt has the effect of inhibition and cell apotosis induction on many kinds of cancer cells.But the mechanism of its effect on cancer cells has not yet been explained thoroughly and accurately.ln this paper,apigenin' s anti-cancer effect was summarized and discussed with the reference of relevant literatures of anticarcinogenic activity in recent years. The research of the mechanism was further concentrated on the cellular and molecular levels including the inhibition or activation on gene and protein, regulation of signal factor, intervention of enzyme activity. This research of the mechanism of apigenin' s anticarcinogenic activity v/as an important part of cancer chemoprevention, which provided theory basis for its application as a cancer chemoprevention agent.%芹菜素是芹菜中含有的一种重要的黄酮类物质,对多种癌细胞都有抑制其生长和促使其凋亡的作用,但是它对于癌细胞产生作用的具体机制尚未得到全面准确的阐释.本文参考近年来对芹菜素抗癌作用的研究的相关文献,分别对芹菜素对一些癌细胞的作用机制做了归纳和探讨.芹菜素对癌细胞作用的机理研究已经深入到细胞和分子水平,抑癌机理包括对基因和蛋白的抑制或激活,对信号因子的调节,干预酶发挥作用等.对芹菜素的抗癌作用机理的研究是通过饮食对癌症进行化学预防的一个重要部分,芹菜素作为癌症化学预防制剂具有广阔的应用前景.

  3. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  4. Chlorophyll fluorescence of tropical tree species in a semi-deciduous forest gap Fluorescência da clorofila de espécies arbóreas tropicais em uma clareira de floresta semidecídua

    Directory of Open Access Journals (Sweden)

    Rafael Vasconcelos Ribeiro

    2004-02-01

    Full Text Available The characterization of different ecological groups in a forest formation/succession is unclear. To better define the different successional classes, we have to consider ecophysiological aspects, such as the capacity to use or dissipate the light energy available. The main objective of this work was to assess the chlorophyll fluorescence emission of tropical tree species growing in a gap of a semi-deciduous forest. Three species of different ecological groups were selected: Croton floribundus Spreng. (pioneer, P, Astronium graveolens Jacq. (early secondary, Si, and Esenbeckia febrifuga A. Juss. (late secondary, St. The potential (Fv/Fm and effective (deltaF/Fm' quantum efficiency of photosystem II, apparent electron transport rate (ETR, non-photochemical (qN and photochemical (qP quenching of fluorescence were evaluated, using a modulated fluorometer, between 7:30 and 11:00 h. Values of Fv/Fm remained constant in St, decreasing in P and Si after 9:30 h, indicating the occurrence of photoinhibition. Concerning the measurements taken under light conditions (deltaF/Fm', ETR, qP and qN, P and Si showed better photochemical performance, i.e., values of deltaF/Fm', ETR and qP were higher than St when light intensity was increased. Values of qN indicated that P and Si had an increasing tendency of dissipating the excess of energy absorbed by the leaf, whereas the opposite was found for St. The principal component analysis (PCA, considering all evaluated parameters, showed a clear distinction between St, P and Si, with P and Si being closer. The PCA results suggest that chlorophyll fluorescence may be a potential tool to differentiate tree species from distinct successional groups.A caracterização dos diferentes grupos ecológicos envolvidos nos processos de formação/sucessão florestal é ainda pouco precisa. Para melhor distinção das classes sucessionais deve-se levar em consideração aspectos ecofisiológicos, como a capacidade de

  5. 铁线莲属黄花铁线莲组修订%A revision of Clematis sect. Meclatis (Ranunculaceae)

    Institute of Scientific and Technical Information of China (English)

    王文采

    2006-01-01

    Clematis sect. Meclatis is revised in this paper. Brief taxonomic history and geographical distribution of the section are given, its systematic position and the relationships among the species are discussed, and the evolutionary trends of some characters in the section are evaluated. Clematis akebioides (Maxim.) Veitch and C. tangutica (Maxim.) Korsh. are considered the primitive species in the section, whereas C. caudigera W. T. Wang and C. corniculata W. T. Wang are considered the advanced ones. The western edge of the Qinghai-Xizang (Tibet) plateau with the Pamirs and the adjacent mountains, the highest land mass in the world, where 10 species of the section are concentrated, is regarded as the distribution center, and the eastern edge of the Qinghai-Xizang (Tibet) plateau, where the two primitive species, C. akebioides and C. tangutica, sympatrically occur, may be the center of origin of the section. The inclusion of C. ispahanica Boiss. and C. graveolens Lindl. in sect. Meclatis by some authors is not accepted, with the former being a member of sect. Clematis, and the latter a member of sect. Brachiatae Snoeijer. A new variety, C. intricata Bunge var. intrapuberula W. T. Wang, is described, and two new combinations, C. tangutica var. mongolica (Grey-Wilson) W. T. Wang and C. tibetana Kuntze var. pamiralaica (Grey-Wilson) W. T. Wang, is proposed. As a result, 13 species and 13 varieties are recognized in sect. Meclatis. They are keyed, described, and illustrated.%对毛茛科铁线莲属Clematis的黄花铁线莲组sect. Meclatis进行了全面修订, 确定此属含13种和13变种(包括1新变种和2新变种等级);写出了此组的分类学简史和地理分布, 并对其在铁线莲属中的系统位置和组内诸种的亲缘关系进行了讨论;还写出了此组的分种、分变种检索表, 以及各种植物的形态描述、地理分布、生长环境等, 并附有各种的插图.此组的花构造与对枝铁线莲组sect. Brachiatae

  6. Problemas associados ao uso de plantas medicinais comercializadas no Mercadão de Madureira, município do Rio de Janeiro, Brasil Problems associated with the use of medicinal plants commercialized in "Mercadão de Madureira", Rio de Janeiro City, Brazil

    Directory of Open Access Journals (Sweden)

    R. Bochner

    2012-01-01

    Full Text Available O uso de plantas medicinais pela população brasileira é prática tradicional, sendo muitas vezes o único recurso utilizado na atenção básica de saúde. O uso terapêutico dessas plantas envolve várias etapas da cadeia produtiva, sendo a procedência, coleta, secagem, armazenamento, comércio, modo de preparo pelo usuário e uso. O objetivo desse trabalho documental, de caráter exploratório, foi levantar a produção científica existente sobre os problemas associados a cada uma dessas etapas e discutir as questões relacionadas à carência de estudos para comprovar a eficácia farmacológica e a ausência de riscos toxicológicos, bem como a prática de autodiagnóstico. As vinte plantas mais comercializadas em grande mercado do município do Rio de Janeiro em agosto de 2007 serviram de base para o levantamento documental do presente estudo. Dessas, seis apresentaram propriedades tóxicas comprovadas dependendo do preparo e uso, a arnica (Solidago chilensis Meyen, aroeira (Shinus terebinthifolius Raddi., arruda (Ruta graveolens L., babosa (Aloe vera L., confrei (Symphytum officinale L. e poejo (Mentha pulegium Lam. & DC.. A Agência Nacional de Vigilância Sanitária aponta contra indicações para boldo-do-Chile (Peumus boldus Molina, chapéu-de-couro (Echinodorus macrophyllus Micheli, erva-cidreira (Lippia alba N.E.Br., erva-de-bicho (Polygonum spp., espinheira-santa (Maytenus spp., picão (Bidens pilosa L., poejo (Mentha pulegium Lam. e tanchagem (Plantago major L.. O abajerú, arnica, boldo-do-Chile, confrei, erva-de-bicho e espinheira-santa tiveram relato de problemas de identificação na coleta e comercialização frente a outras morfologicamente semelhantes. Plantas cultivadas e silvestres apresentam variabilidade de princípios ativos influenciados por fatores ambientais e genéticos, como chapéu-de-couro (Echinodorus macrophyllus Micheli, erva-cidreira (Lippia alba N.E.Br. e erva-de-bicho (Polygonum spp.. A contaminação e

  7. Aplicación de Tecnología de Barreras para la Conservación de Mezclas de Vegetales Mínimamente Procesados / Application of Barrier Technology for the Conservation of Minimally Processed Vegetables Mixtures

    Directory of Open Access Journals (Sweden)

    Alejandro Escobar Hernández

    2014-03-01

    Full Text Available Los vegetales son componentes esenciales de la dietahumana y su procesamiento trae como consecuencia el rápido deterioro ocasionado por el aumento de las reacciones metabólicas, esto hace necesario que se utilicen tecnologías emergentes de conservación. En este trabajo se estudió el efecto de la tecnología de barreras (desinfección, tratamiento térmico, recubrimiento comestible, atmósfera modificada y refrigeración sobre la vida útil de una mezcla de vegetales mínimamente procesados compuesta por brócoli (Brassica oleracea var. itálica, coliflor (Brassica oleracea var. botrytis, zucchini (Cucurbita pepo L., chayote (Sechium edule, apio (Apium graveolens y zanahoria (Daucus carota. Las barreras fueron aplicadas a las hortalizas para luego ser envasadas en dos tipos de bandejas (empaque en atmósfera modificada y empaque en bandeja sello plus. Los vegetales se almacenaron durante 12 días en refrigeración (4 °C y 95% HR, se llevaron a cabo análisis microbiológicos, físicoquímicos y sensoriales, y un estudio de vida útil. Los resultados mostraron que el proceso de desinfección con NaClO 100 ppm y el tratamiento térmico de 60 °C durante 2 min, tuvieron efecto en la reducción de la población microbiana para el día cero de evaluación. La calidad general se conservó para los 12 días dealmacenamiento, en la zanahoria, chayote, coliflor y apio. Laevaluación fisicoquímica presentó diferencias estadísticamente significativas de los parámetros evaluados con respecto al tiempo de almacenamiento. El estudio de vida útil arrojó tiempos de 7 y 5 días para la mezcla de vegetales empacada en bandeja sello plus en atmósfera modificada, respectivamente. La combinación debarreras se muestra como alternativa viable en la conservación de mezclas de vegetales mínimamente procesados. /  Vegetables are essential components of the human diet. However, rapid deterioration of vegetables occurs after

  8. Pollen calendar of the city of Salamanca (Spain). Aeropalynological analysis for 1981-1982 and 1991-1992.

    Science.gov (United States)

    Hernández Prieto, M; Lorente Toledano, F; Romo Cortina, A; Dávila González, I; Laffond Yges, E; Calvo Bullón, A

    1998-01-01

    We report a study on the contents of airborne pollen in the city of Salamanca (Spain) aimed at establishing a pollen calendar for the city for the yearly periods of maximum concentrations, relating these with quantifiable atmospheric variables over two two-year periods with an interval of 10 years between them: 1981-82 and 1991-92. The pollen was captured with Burkard spore-traps, based on Hirst's volumetric method. Determinations were made daily and were used to make preparations, previously stained with basic fuscin, for study under light microscopy at x 1,000 magnification. 946 preparations were analyzed, corresponding to the same number of days distributed over 150 weeks of the periods studied. The results afforded the identification of 48 different types of pollen grain: Grasses (Poaceae), Olea europea (olive), Quercus rotundifolia (Holm-oak), other Quercus spp. (Q. pyrenaica, Q. suber, Q. faginea, etc.), Cupressaceae (Cupressus sempervivens, C. arizonica, Juniperus communis etc.), Plantago (Plantago lanceolata, Plantago media, etc.), Pinaceae (Pinus communis, Abies alba, etc.), Rumex sp. (osier), Urtica dioica (nettle), Parietaria (Parietaria officinalis, P. judaica), Chenopodio-Amaranthaceae (Chenopodium sp., Amaranthus sp., Salsola kali, etc.), Artemisia vulgaris (Artemisia), other Compositae (Taraxacum officinalis, Hellianthus sp. etc.), Castanea sativa (Chestnut), Ligustrum sp. (privet), Betula sp. (birch), Alnus sp. (common alder), Fraxinus sp (ash), Populus sp. (poplar), Salix sp. (willow), Ulmus sp. (elm), Platanus sp. (plantain, plane), Carex sp. (sweet flag), Erica sp. (common heather), Leguminosae or Fabaceae:--Papillionaceae (Medicago sp.; Cercis sp., Robina sp.)--Cesalpinoideae Acacia sp. (Acacia),--Mimosoideae: Sophora japonica, Umbelliferae (Foeniculum sp., Cirsium sp., etc.), Centaurea sp., Cistus sp. (rock rose), Typha sp (bulrush), Mirtaceae (Myrtus communis), Juglans regia (Walnut), Galium verum, Filipendula sp. (spirea/drop wort), Rosaceae

  9. Inativação termoquímica de Escherichia coli, Staphylococcus aureus e Salmonella enterica Enteritidis por óleos essenciais

    Directory of Open Access Journals (Sweden)

    Alcilene de Abreu Pereira

    2014-11-01

    Full Text Available O controle do crescimento microbiano tanto na indústria de alimentos quanto em ambientes hospitalares é de extrema importância. Entretanto, observa-se aumento da resistência dos microrganismos aos desinfetantes mais empregados, observando-se a necessidade de estudos com novos antimicrobianos. Assim, o objetivo desse trabalho foi avaliar a atividade antimicrobiana e a curva de morte termoquímica de soluções desinfetantes de óleos essenciais sobre Escherichia coli, Staphylococcus aureus e Salmonella Enteritidis. Foram utilizados os óleos essenciais de Thymus vulgaris (tomilho, Elettaria cardamomum (cardamomo, Eugenia caryophyllus (cravo botão e Foeniculum vulgare dulce (funcho doce. As concentrações mínimas inibitórias foram determinadas utilizando-se a técnica de diluição em placas. As concentrações testadas foram de (%: 0,00; 0,25; 0,5; 1,0; 2,0; 2,5; 3,0; 3,5; 4,0; 4,5; e 5,0. Escherichia coli foi a única bactéria sensível a todos os óleos em concentrações abaixo de 5%. Cravo da índia não inibiu o crescimento de S. aureus nas concentrações testadas. Somente o óleo essencial de tomilho inibiu o crescimento de Salmonella Enteritidis. Observando-se as curvas de morte termoquímica de S. aureus, nota-se que a solução desinfetante contendo óleo essencial de tomilho foi a mais eficiente, tanto a 25 quanto a 40°C, sendo necessário apenas 10min. de contato para não serem mais detectadas células viáveis. A solução desinfetante contendo 0,25% de óleo essencial de tomilho, tanto a 25 quanto a 40°C, eliminou as células de S. Enteritidis após10min. de contato. Já pra E. coli , os melhores resultados foram obtidos com as soluções desinfetantes contendo óleos essenciais de funcho doce e cravo da índia a 25 e 40°C e tomilho a 40°C. Todos os tratamentos, exceto aqueles contendo óleo essencial de cardamomo, reduziram o número de células viáveis das bactérias testadas em pelo menos 5 ciclos log, sendo

  10. Some features of formation of biocenoses of Absheron contaminated by radionuclides

    International Nuclear Information System (INIS)

    Full text:Gray-brown soils of Absheron peninsula, developing in the arid conditions of the dry subtropical climate subjected to various forms of industrial pollution, among which oil pollution occupy a dominant position. The researches carried out in Azerbaijan on technologically-contaminated gray-brown soils of Absheron, have shown that contaminants of various etiologies form quite different from each other biocenoses. First of all it is connected with change not only the specific physicochemical properties of the soil, but also plant cover and associated with them trophic (nutritional) structure of the soil microbiota and invertebrates. Depending on the chemical properties of pollutants entering the soil, there are formed specific phytocenosis and complexes of invertebrate animals with microorganisms. The creation of these biocenoses occurs by the gradual complication of adaptive mechanisms to these pollutants in individual groups and plant species and soil organisms (3). Oil pollution is always accompanied by the accumulation of toxic, carcinogenic compounds and some radionuclides in the soil. Therefore, phytoremediation of these soils has the important and priority significance (4, 5). To this purpose, there were carried out experiments on the small plots in gray-brown soils, versions of which differed among themselves with different concentrations of contamination by radionuclides. As fitoremediant there were used native plants for the Absheron: wormwood (Artemisia fragrance), fennel (Foeniculum vulgare) and hog bean (Hyoscyamus niger). Observations have shown that the formation of the initial stages of biocenoses happen with great intensity. Variants with a lower concentration of these components (10-6 M) differed with relatively better development of plants (increased growth and branching of model bushes). With the increase in the concentration of radionuclides (10-4 M) there were noted some deferred response in the development of individual model bushes

  11. GAMBARAN PRAKTIK PENGGUNAAN JAMU OLEH DOKTER DI ENAM PROVINSI DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Delima Delima

    2013-02-01

    Full Text Available Abstract Herbal medicine has been widely used. Government supports become more obvious since the declaration of “Saintifikasi Jamu” in Januari 2010 in Kendal, Central Java. To obtain this program, inventory of herbal medicine usage by physicians was conducted. This was a cross sectional descriptive study in 6 provinces of Java and Bali. Doctors registered as member of herbal medicine related association were invited and asked to fill a set of structured questionnaire. A total of 108 physicians using Indonesian herbal medicine participated in this study. They were either general practitioners or specialists with median age of 43 (range 26-70 years old. They (76.9% have used herbal medicine for 1-10 years with median of  2 patients per day (range 0-40. The physicians also practiced other traditional medicines such as acupuncture (47.2 %, massage (7.4 %, acupressure (6.5%. Besides prescribing herbal medicine to their patients, all physicians also consumed herbal medicine for themselves and their family. They used mainly with mono or combined herb in capsule and simplicia. Mostly herbal medicine were given to hypertension, dyslipidemia, diabetes mellitus, acute upper respiratory disease, hepatitis, hyperuricemia, osteoarthritis, diarrhea, cancer, and gastritis. Curcuma xanthorrhiza, Andrographis paniculata, Curcuma domestica (turmeric, Centella asiatica, Orthosiphon aristatus, Apium graveolens (celery, Phylanthus niruri, Guazuma ulmifolia, Zingiber officinale, and Curcuma zedoaria were prescribed. As conclusion, most of the herbal physician in Java and Bali prescribed Indonesian herbal medicine in this 10 years periode combined with foreign herbal medicine and other traditional medicines but still using conventional medicine as the highest standard of theraphy. Key words: herbal medicine, Saintifikasi Jamu, traditional medicine AbstrakPemanfaatan jamu telah berkembang luas. Dukungan pemerintahpun semakin jelas sejak dicanangkannya Saintifikasi

  12. Cloning, evolution and expression pattern analysis of M6PR gene in celery%芹菜中6-磷酸甘露糖还原酶基因的克隆、进化和表达分析

    Institute of Scientific and Technical Information of China (English)

    蒋倩; 王枫; 侯喜林; 马静; 李梦瑶; 熊爱生

    2013-01-01

    Full-lengths of cDNA sequences encoding mannose-6-phosphate reductase (M6PR)were cloned from celery (Apium graveolens) cultivars‘Jinnanshiqin' and‘Meiguoxiqin' with reverse transcript PCR (RT-PCR).Sequence analysis showed that the length of the gene was 930 bp,containing a complete open reading frame,which encoded 309 amino acids residues.Its relative molecular mass was 35×103,and pI was 6.38.Three-dimension structure analysis showed that M6PRs from the two celery cultivars were composed by 11 α-helices and 13 β-strands,among which there was a hydrophobic cavity.Catalysis was promoted by a conserved tetrad of active site residues (Tyr,Lys,Asp and His).Amino acid sequence comparison indicated that the M6PRs from ‘Jinnanshiqin' and‘Meiguoxiqin' had high similarity with the AKRs from Selaginella moellendorffii,Physcomitrella patens and Picea sitchensis.Quantitative real-time PCR analysis showed that M6PR gene was tissue-specific and was mainly expressed in the stem.%以2个芹菜品种‘津南实芹’和‘美国西芹’为试材,采用RT-PCR技术分别获得6-磷酸甘露糖还原酶(M6PR)cDNA 序列.序列分析表明:来源于2个芹菜品种的6-磷酸甘露糖还原酶基因核苷酸序列全长均为930 bp,编码309个氨基酸;预测其蛋白质相对分子质量为35×103,pI值为6.38.空间结构分析显示:M6PR蛋白由11个α-螺旋和13条β-延伸主链组成,中间形成1个疏水穴;催化四分体(Asp、Tyr、Lys和His)分布于疏水穴内部,具有催化活性.进化分析显示:芹菜M6PR与卷柏、小立碗藓、云杉等远古物种的醛-酮还原酶(AKR)相似性较高.实时定量PCR表达分析表明:M6PR基因主要在芹菜的茎中表达,具有明显的组织特异性.

  13. 蔬菜作物轮作对嫁接西瓜植株生理代谢与生长的影响%Effects of Rotation with Vegetables on Physiological Metabolism and Growth of Grafted Watermelon

    Institute of Scientific and Technical Information of China (English)

    盛萍萍; 宋尚成; 李敏; 刘润进

    2011-01-01

    With the continuous cropping 20 years soil of watermelon which was collected from the Chanle County, Shandong Province as control, we studied the effect to physiological metabolism and growing of grafting watermelon in the rotation soil of leeks, garlic, and celery. Results showed that rotation could increase root activity and growth of grafting watermelon, and the rotation treatment with celery was the best, of which stem diameter, fresh weight of root, leaf numbers per plant and root activity were increased 10.7% , 20. 3% , 10. 5% , 38. 8% respectively comparing with the control. The leaf chlorophyll content of grafted watermelon grown in rotation soil of leeks, garlic, and celery was significantly higher than that of the control, and grown in rotation soil of celery increased most, Chlorophyll A and Chlorophyll B increased 24.9% and 17.8% respectively comparing with the control. Net photo-synthetic rate of the control was inferior to others. The rotation was proved to increase the activity of SOD, POD, CAT, decreasing the contents of MDA, and it reduce most in the lamina of grafted watermelon in rotation soil of celery, which is 9. 1%. It was concluded that rotation could improve physiological metablism and grwoth of grafted watermelon and reducing replant disease.%以山东昌乐连作20年西瓜(Citrullus lanatus)的土壤为对照,比较轮作大葱(Allium fistulosum)、大蒜(Allium sativum)和芹菜(Apium graveolens)土壤对嫁接西瓜部分生理代谢与生长的影响,结果表明,轮作可以提高嫁接西瓜根系活力和生长量,其中以种植芹菜的处理根系活力最高,生长量最大,其茎粗、地下部鲜重、单株叶片数和根系活力分别比连作西瓜处理(对照)增加10.7%、20.3%、10.5%和38.8%;轮作大葱、大蒜和芹菜处理的西瓜叶片叶绿素含量显著高于对照,其中轮作芹菜增加最多,叶绿素a和叶绿素b含量分别比对照增加了24.9%和17.8%;连作西瓜处理的嫁接

  14. [Nesting habitat characterization for Amazona oratrix (Psittaciformes: Psittacidae) in the Central Pacific, Mexico].

    Science.gov (United States)

    Monterrubio-Rico, Tiberio C; Álvarez-Jara, Margarito; Tellez-Garcia, Loreno; Tena-Morelos, Carlos

    2014-09-01

    The nesting requirements of the Yellow-headed Parrot (Amazona oratrix) are poorly understood, despite their broad historical distribution, high demand for pet trade and current endangered status. Information concerning their nesting requirements is required in order to design specific restoration and conser- vation actions. To assess this, we studied their nesting ecology in the Central Pacific, Michoacan, Mexico during a ten year period. The analyzed variables ranged from local scale nest site characteristics such as nesting tree species, dimensions, geographic positions, diet and nesting forest patches structure, to large scale features such as vegetation use and climatic variables associated to the nesting tree distributions by an ecological niche model using Maxent. We also evaluated the parrot tolerance to land management regimes, and compared the Pacific nest trees with 18 nest trees recorded in an intensively managed private ranch in Tamaulipas, Gulf of Mexico. Parrots nested in tall trees with canopy level cavities in 92 nest-trees recorded from 11 tree species. The 72.8% of nesting occurred in trees of Astronium graveolens, and Enterolobium cyclocarpum which qualified as key- stone trees. The forests where the parrots nested, presented a maximum of 54 tree species, 50% of which were identified as food source; besides, these areas also had a high abundance of trees used as food supply. The lowest number of tree species and trees to forage occurred in an active cattle ranch, whereas the highest species rich- ness was observed in areas with natural recovery. The nesting cavity entrance height from above ground of the Pacific nesting trees resulted higher than those found in the Gulf of Mexico. We hypothesize that the differences may be attributed to Parrot behavioral differences adapting to differential poaching pressure and cavity avail- ability. Nesting trees were found in six vegetation types; however the parrots preferred conserved and riparian semi

  15. Aplicación de tratamiento térmico, recubrimiento comestible y baño químico como tratamientos poscosecha para la conservación de hortalizas mínimamente procesadas

    Directory of Open Access Journals (Sweden)

    Alejandro Escobar Hernández

    2014-01-01

    Full Text Available El consumo creciente ha estimulado el desarrollo de los vegetales cuarta gama o mínimamente procesados. Actualmente, se promueve el uso de tecnologías aplicadas a estos productos que les brinden mayor duración y garanticen la reducción de pérdidas poscosecha. En esta investigación se evaluó el efecto de tres de estas tecnologías poscosecha sobre la intensidad de la respiración y la calidad sensorial general de las hortalizas mínimamente procesadas: brócoli (Brassica oleracea var. Itálica, coliflor (Brassica oleracea var. Botrytis, zucchini (Cucurbita pepo L., apio (Apium graveolens, zanahoria (Daucus carota y chayote (Sechium edule. Para el recubrimiento comestible se utilizó pectina de bajo metoxilo (2%, cera carnauba (1%, glicerol (1.5% y ácido ascórbico (0.05%. El tratamiento térmico se hizo a 60 °C durante 2 min, con adición de ácido ascórbico (0.25%, ácido cítrico (0.5% y cloruro de calcio (0.025%. El baño químico se realizó con una solución de ácido cítrico (0.5%, ácido ascórbico (0.05% y cloruro de calcio (0.05%. La tasa de producción de CO2 se midió por el método estático, monitoreando la composición de los gases del espacio de cabeza durante 24 h a 8 °C y humedad relativa de 90%. La evaluación sensorial de color, aroma, crujencia y sabor objetable fueron las características organolépticas tomadas en cuenta para evaluar la calidad general de cada vegetal, la cual fue realizada con un panel de siete jueces previamente entrenados. Se utilizó un diseño de bloques completos al azar, siendo los bloques cada uno de los vegetales y las variables de respuesta la tasa de respiración y la calidad sensorial general. Se encontró que el tratamiento térmico y el recubrimiento comestible permitieron que los vegetales conservaran la calidad sensorial. El análisis estadístico no mostró diferencias significativas respecto al control (P > 0.05. La celeridad de la respiración disminuyó en el apio, el br

  16. 美洲棘蓟马对不同蔬菜寄主的偏好性%Hosts preference of Echinothrips americanus Morgan for different vegetables

    Institute of Scientific and Technical Information of China (English)

    朱亮; 石宝才; 宫亚军; 王泽华; 康总江; 马吉德; 魏书军

    2013-01-01

    Echinothrips americanus Morgan (Thysanoptera; Thripidae) was recently (2010) found in the Beijing area and Yangling, Shaanxi Province, China. Current studies report that this thrips uses 48 families-106 species-as host plants, most of which are ornamental plants in the Araceae, Euphorbiaceae, and Apocynaceae families. The host preferences of this thrips among vegetable plants have rarely been studied. The preference for and suitability of 13 potential crop hosts of E. americanus were studied in the laboratory by comparing adult host selection, oviposition preference, and developmental and survival rates. Twelve vegetable species, i. e., Vigna unguiculata, Glycine max (Leguminosae), Daucus carota, Foeniculum vulgare (Apiaceae), Solarium melongena, Capsicum frutescens, Solarium lycopersicum (Solanaceae), Cucumis sativus, Cucurbita moschata (Cucurbitaceae), Brassica chinensis, Brassica campestris, and Brassica oleracea (Brassicaceae), and one non-vegetable host, Medicago sativa (Fabaceae) were tested. One to two weeks-old plants of each crop were grown in a greenhouse into which 100 thrips were released, and plants were examined for thrips infestation daily. The host-plant and oviposition selection data were analyzed with a log-linear model and variance analysis using the software DPS vl3.5. The host and oviposition preference of the thrips to the 13 different plant species differed significantly. The most adults were found on C. moschata, with 23.5 per plant, while the plant with the most eggs was C. frutescens, with 50. 32 per plant. No adults were found on F. vulgare, B. oleracea, or M. sativa. There were significantly more adults on C. sativus, C. moschata, B. chinensis, G. max, and C. frutescens, more than 10 per plant, than on the other host plants. Additionally, there were significantly more eggs on those five host species-more than 30 per plant-than on other plants, except V. unguiculata. There were no eggs on D. carota, B. oleracea, or M. sativa, suggesting

  17. Methane emission by livestock in India and mitigation strategies

    International Nuclear Information System (INIS)

    (saponins, tannins, lignins, essential oils, etc.) have antimicrobial activities to protect the plants against invasion by microbes. This plant property can be exploited for control of undesirable microbes in the rumen. The initial screening experiments have indicated that the extracts of plants containing secondary metabolites are effective against methanogenesis and ciliate protozoa, and some have an adverse effect on degradability of feed in the rumen. Based on the results of in vitro screening experiments, a few plants and some mixtures of plants have been selected for inclusion in the diet of ruminants to study their effect on in vivo methane emission as estimated by open circuit respiration calorimeter. - A mixture of Allium sativum, Syzygium aromaticum, Foeniculum vulgare and Mentha piperita (oil) in the ratio of 2:1:2:1 respectively, was fed to buffaloes at the rate of 2g/kg of feed. Although each of the plants individually inhibited in vitro methanogenesis, but the level of mixture feeding might not be sufficient to have a similar effect on in vivo methane emission. - Terminalia chebula and Allium sativum both inhibited in vivo methane emission, but T. chebula was more effective than the latter. Both these plants both separately and as a mixture improved dry matter digestibility of feed by 10.6 to 11.3% in. In another experiment, a mixture of 3 plants fed to cattle calves at 2% of DM intake on alternate days inhibited methane production by 9.4% and the body weight gain was 8.7% (448 vs. 412 g/d) higher as compared to control, with no adverse effect on digestibility of different nutrients. - The results of the in vivo experiments conducted so far indicate that plants containing secondary metabolites, showing promising results in in vitro experiments, do have a potential to be used as rumen modulators for controlling methane emission in ruminants. The levels used in in vitro experiments are usually very high and may not vivo experiments. Therefore, the level of

  18. Cloning and expression analysis of gibberellin oxidase geneAgGA2ox from Apium graceolens under abiotic stress treatments%芹菜赤霉素氧化酶基因AgGA2ox的克隆及非生物逆境下表达分析

    Institute of Scientific and Technical Information of China (English)

    冯凯; 王广龙; 黄莹; 徐志胜; 黄蔚; 熊爱生

    2016-01-01

    Gibberellins (GAs) have important impacts on the growth and development of plants.GA2oxgene plays a crucial role in regulating gibberellins synthesis. TheAgGA2oxgene encoding GA oxidase was cloned from two celery cultivars, ‘Luhe Huangxinqin’ and ‘Ventura’, respectively. Sequence analysis revealed thatAg-GA2ox gene contained a full-length open reading frame of 996 bp, which encodes 331 amino acids. There are eight nucleotide sites and two amino acid residues differences in two cultivars. Relative molecular mass of Ag-GA2ox from ‘Luhe Huangxinqin’ and ‘Ventura’ were predicted to be 37 044.6 and 36 984.5, respectively. They showed the same theoretical isoelectric point (8.31). Phylogenetic analysis indicates that the GA2ox showed high evolutionary conservation among celery and other species, and the AgGA2ox was most closed toPanax quinquefolius. Quantitative real-time PCR analysis demonstrats that theAgGA2oxgene was tissue-speciifc in celery, and it mainly expressed in petiole.AgGA2oxgene was response to abiotic stress, such as low and high temperatures, drought, and salt stress. It was upregulated after low temperature treatment and downregulated after high temperature, drought, and salt treatments. Expression level differences ofAgGA2ox between ‘Luhe Huangxinqin’ and ‘Ventura’ may be related to the different abilities to abiotic resistance.%赤霉素(GAs)对植物生长发育有重要影响,赤霉素氧化酶基因(GA2ox)在GAs合成过程中起重要调控作用。本文从不同芹菜(Apium graveolens)品种‘六合黄心芹’和‘文图拉’中分别克隆得到编码赤霉素氧化酶的基因AgGA2ox,序列分析显示两个品种AgGA2ox基因均包含一个全长996 bp的开放阅读框,编码331个氨基酸,在核苷酸水平上有8个碱基位点的差异,氨基酸水平上有2个位点的差异。AgGA2ox蛋白在‘六合黄心芹’和‘文图拉’两个品种中的相对分子质量分别为37044.6和36984.5,理