Book review. Anestesia e analgesia locoregionale del cane e del gatto. Francesco Staffieri

Directory of Open Access Journals (Sweden)

Manuel Graziani

2014-03-01

Full Text Available Il volume di anestesia e analgesia locoregionale del cane e del gatto è pensato per essere un testo "da sala operatoria" – come afferma l'autore – perché consente un rapido, ma allo stesso tempo dettagliato, consulto per il libero professionista che si trova a gestire un'anestesia. Si tratta di un piccolo libro, tascabile, che può essere considerato un punto di partenza per gli studenti e per tutti quei medici veterinari che intendono avvicinarsi in maniera specialistica all'arte dell'anestesiologia veterinaria. L'anestesia locoregionale costituisce, infatti, uno strumento insostituibile per la gestione del dolore perioperatorio in medicina veterinaria. Nel volume si forniscono le nozioni di base per praticare i principali blocchi nervosi centrali e periferici. Per ogni blocco sono riportate le tecniche alla cieca (mediante l'ausilio dei punti di repere anatomici e quelle con l'impiego dello stimolatore nervoso periferico. Il volume, corredato da immagini foto e grafici, per un totale di 65 figure, si apre con i capitoli relativi ai farmaci, agli strumenti e alle complicanze dell'anestesia locoregionale. Prosegue con i blocchi nervosi centrali (anestesia epidurale e spinale e si conclude con i blocchi periferici (testa, arto anteriore, torace, arto posteriore. L'autore, Francesco Staffieri, è un medico veterinario che svolge il dottorato di ricerca nel Dipartimento delle Emergenze e dei Trapianti di Organi, Sezioni di Cliniche Veterinarie e Produzioni Animali dell'Università degli Studi Aldo Moro di Bari.

Anestesia volátil e monitorização anestésica.

OpenAIRE

Alexandre, Nuno; Costa, Margarida; Mascarenhas, Ramiro

2009-01-01

Os autores apresentam um texto de apoio à disciplina de anestesiologia do curso de Medicina Veterinária .Neste texto são abordadas diversas temáticas da anestesia volátil tais como: equipamentos utilizados em anestesia volátil, farmacologia dos anestésicos voláteis. A monitorização dos pacientes é abordada na vertente mecânica ou intrumental e na componente básica.

Prótesis fija con anestesia acupuntural Fixed prosthesis with acupuncture anesthesia

Directory of Open Access Journals (Sweden)

Marcia Hortensia Corona Carpio

2006-09-01

Full Text Available Se presenta un caso de una paciente femenina de 72 años de edad con antecedentes alérgicos a la anestesia dental y preocupación de rehabilitar su estética con prótesis fija. Se decidió aplicar anestesia acupuntural en la preparación de los pilares para recibir el puente fijo. Se exponen las técnicas y los resultados obtenidos. No se manifestaron reacciones adversas. La paciente evolucionó satisfactoriamente con el tratamiento alternativo realizado.

Anestesia e artrite reumatoide

Directory of Open Access Journals (Sweden)

Eneida Maria Vieira

2011-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A artrite reumatoide (AR é uma doença inflamatória crônica e de etiologia desconhecida. Os pacientes com AR são reconhecidos como pessoas com redução na expectativa de vida, em comparação com a população em geral. As doenças reumáticas são numerosas e ocorrem com alta variabilidade; algumas são desenvolvidas rapidamente; outras, cronicamente, provocando incapacidades durante toda a vida. Os riscos anestésicos, em desordens osteoarticulares, envolvem, além das deformidades mecânicas causadas pela doença, os sistemas cardiovascular, respiratório, renal e digestivo. CONTEÚDO: A proposta da presente revisão foi levantar a importância das fases da doença em processo, que podem influenciar no controle da anestesia antes, durante e após a cirurgia, destacando a experiência dos autores em uma avaliação retrospectiva dos casos de pacientes portadores de artrite reumatoide juvenil (ARJ submetidos a próteses ortopédicas, com ênfase para as técnicas de intubação. CONCLUSÕES: Pacientes com artrite reumatoide podem apresentar um bom número de problemas complexos para o anestesiologista. Isso requer uma cuidadosa avaliação pré-operatória; a anestesia requer experiência com a técnica e o cuidado pós-operatório deve ser criteriosamente escolhido para atender à necessidade específica do paciente. O procedimento demanda efetiva comunicação entre cirurgião, reumatologista e anestesiologista, para que cada membro do grupo multidisciplinar contribua com sua experiência, visando a um melhor benefício ao paciente.

Avaliação da memória sob anestesia venosa total

Directory of Open Access Journals (Sweden)

Gulistan Aktas

2013-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Neste estudo, objetivamos avaliar a memória implícita e explícita em pacientes submetidos à cirurgia abdominal sob anestesia venosa total (AVT com propofol e remifentanil, na qual o nível de anestesia foi controlado pelo monitoramento do índice bispectral (BIS. MÉTODO: Anestesia venosa total foi administrada a 60 pacientes adultos para obter níveis de BIS de 40-60. Os pacientes foram randomicamente divididos em três grupos, de acordo com as gravações que ouviram. Os pacientes do grupo categoria (CT ouviram uma fita gravada contendo cinco nomes de animais. Os pacientes do grupo recordar palavras (RP ouviram uma fita gravada contendo cinco palavras de frequência média na língua turca, depois de adaptadas. Os pacientes do grupo controle (GC ouviram os sons do mar até o fim da cirurgia. Duas horas após a cirurgia, os testes foram administrados a cada paciente na sala de recuperação para avaliar a memória. RESULTADOS: Houve uma diferença entre os escores dos grupos CT e GC no Miniexame do Estado Mental (MMSE; todos os escores foram > 20. Os resultados dos testes de categoria e recordar palavras, aplicados para avaliar a memória implícita, não foram estatisticamente diferentes entre os grupos. Não houve evidência de memória implícita em nenhum dos pacientes. Um paciente lembrou-se de ouvir "o som de água" como uma prova de memória explícita. Onze pacientes declararam não ter sonhado. CONCLUSÕES: Apesar de não termos encontrado nenhuma evidência de memória implícita sob anestesia adequada com AVT, um paciente apresentou memória explícita. Embora a profundidade adequada da anestesia fornecida pelo monitoramento do BIS corrobore nossos resultados para a memória implícita, ela não explica os resultados para a memória explícita.

Anestesia para cirurgia ortopédica em criança com susceptibilidade à hipertermia maligna: relato de caso Anestesia para cirugía ortopédica en niño con susceptibilidad a la hipertermia maligna: relato de caso Anesthesia for orthopedic surgery in a child susceptible to malignant hyperthermia: case report

Directory of Open Access Journals (Sweden)

Renato Santiago Gomez

2003-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Hipertermia maligna é uma miopatia autossômica dominante desencadeada por anestésicos inalatórios e bloqueadores neuromusculares, como halotano e succinilcolina, causando aumento da temperatura que pode ser fatal sem o tratamento imediato. O objetivo deste relato é descrever a conduta anestésica em uma criança susceptível à hipertermia maligna que foi submetida a procedimento cirúrgico ortopédico. RELATO DO CASO: Paciente do sexo feminino, com 3 anos, portadora de luxação congênita do quadril e susceptibilidade à hipertermia maligna, conforme história de anestesia anterior, foi submetida à correção cirúrgica ortopédica sob anestesia geral, com propofol e fentanil, associada à anestesia peridural lombar. A temperatura da paciente foi monitorizada continuamente durante a cirurgia e no período pós-operatório. A paciente apresentou recuperação pós-operatória sem intercorrências e recebeu alta hospitalar após cinco dias. CONCLUSÕES: A combinação de anestesia regional e venosa para o procedimento cirúrgico proposto em paciente com susceptibilidade à hipertermia maligna permitiu a condução anestésica com segurança.JUSTIFICATIVA Y OBJETIVOS: Hipertermia maligna es una miopatia autosómica dominante desencadenada por anestésicos inhalatorios y bloqueadores neuromusculares, como halotano y succinilcolina, causando aumento de la temperatura que puede ser fatal sin el tratamiento inmediato. El objetivo de este relato es describir la conducta anestésica en un niño susceptible a la hipertermia maligna que fue sometida a procedimiento quirúrgico ortopédico. RELATO DEL CASO: Niño, del sexo femenino, con 3 años, portadora de luxación congénita del cuadril (anca y susceptibilidad a la hipertermia maligna, conforme historia de anestesia anterior, fue sometida a la corrección quirúrgica ortopédica bajo anestesia general, con propofol y fentanil, asociada a anestesia peridural lumbar. La

Estrategias de Control en la Práctica de Anestesia

Directory of Open Access Journals (Sweden)

Juan Albino Méndez Pérez

2011-07-01

Full Text Available Resumen: Este artículo se centra en el modelado y control de la hipnosis durante la anestesia de pacientes sometidos a intervenciones quirúrgicas. Por un lado en este trabajo se aborda el problema del modelado del proceso presentando resultados validados con pacientes reales. Asimismo, se propone un controlador avanzado para regular el estado hipnótico. El algoritmo empleado se basa en combinar una acción nominal obtenida a partir de la dinámica inversa juntamente con una acción correctora que se obtiene a partir de un controlador predictivo. El trabajo persigue desarrollar una técnica que permita la regulación del estado del paciente y que tenga características de adaptabilidad a los diferentes individuos. Se muestran resultados preliminares de la estrategia propuesta para demostrar la eficiencia del sistema. Palabras clave: Anestesia, BIS, Propofol, Control, Control PID, Control Predictivo, Control Adaptativo

Complicações respiratórias em pacientes com paralisia cerebral submetidos à anestesia geral

OpenAIRE

Mello, Sérgio Silva de; Marques, Ronaldo Soares; Saraiva, Renato Ângelo

2007-01-01

JUSTIFICATIVA E OBJETIVOS: Anestesia em pacientes com paralisia cerebral (PC) pode representar um desafio para o anestesiologista. Este estudo prospectivo teve como objetivo determinar a prevalência e o risco de complicações respiratórias em crianças com PC submetidas à anestesia geral inalatória (AGI) para tomografia computadorizada (TC). MÉTODO: Participaram do estudo pacientes com idades entre 1 e 17 anos, estado físico ASA I a III, submetidos a AGI com sevoflurano e máscara laríngea para ...

Anestesia extra-dural en el parto

Directory of Open Access Journals (Sweden)

Alberto Cárdenas Escobar

1956-05-01

Full Text Available Desde que A. J. Corning practicó en 1885 la primera inyección de una solución de cocaína en el espacio epidural, diversos métodos anestésicos que utilizan este espacio han sido ensayados, tanto en cirugía como en obstetricia. Sicard y Cathelin, en 1901, usaron el hiatus sacro para anestesia epidural en operaciones urológicas. Stoeckel y Schlimpert en 1911 fueron los primeros en emplear este método en obstetricia. Reemplazaron la cocaína por novocaína. recientemente preparada, y lograron analgesia bastante satisfactoria durante 30 minutos a 1 hora, en casos seleccionados

Anestesia em criança com síndrome de Pallister-Killian: relato de caso Anestesia en niño con síndrome de Pallister-Killian: relato de caso Anesthesia in child with Pallister-Killian syndrome: case report

Directory of Open Access Journals (Sweden)

José Roquennedy Souza Cruz

2004-10-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A síndrome de Pallister-Killian (SPK é uma doença genética rara causada por uma anomalia, em mosaico, no cromossomo 12. Há pouca informação sobre esta síndrome na literatura anestésica. O objetivo deste relato foi divulgar e discutir as características que podem ser de interesse para a anestesia. RELATO DO CASO: Paciente do sexo masculino, 5 anos de idade, foi submetido a anestesia geral para a realização de ressonância magnética do crânio. Apresentava as características típicas da SPK: dismorfismo facial, alopecia temporal, micrognatismo, macroglossia, retardo mental, convulsões e alterações pigmentares cutâneas. A anestesia foi induzida e mantida com sevoflurano sob máscara facial e cânula orofaríngea, com ventilação assistida manual durante a indução. Não houve intercorrências e o exame foi feito em regime ambulatorial. CONCLUSÕES: A importância da avaliação pré-anestésica é enfatizada, devido às malformações, inclusive cardíacas, associadas a esta síndrome. É recomendada a preparação para possível dificuldade de intubação traqueal ou de manutenção das vias aéreas.JUSTIFICATIVA Y OBJETIVOS: La síndrome de Pallister-Killian (SPK es una rara enfermedad genética causada por una anomalía, en mosaico, en el cromosoma 12. Hay poca información sobre esta síndrome en la literatura anestésica. El objetivo de este relato fue divulgar y discutir las características que pueden ser de interés para la anestesia. RELATO DEL CASO: Paciente del sexo masculino, 5 años de edad, fue sometido a anestesia general para la realización de resonancia magnética del cráneo. Presentaba las características típicas de la SPK: dismorfismo facial, alopecia temporal, micrognatismo, macroglosia, retardo mental, convulsiones y alteraciones pigmentares cutáneas. La anestesia fue inducida y mantenida con sevoflurano sobre máscara facial y cánula orofaríngea, con ventilación manual

Usos do sulfato de magnésio em obstetrícia e em anestesia Usos del sulfato de magnesio en obstetricia y en anestesia Applications of Magnesium Sulfate in Obstetrics and Anesthesia

Directory of Open Access Journals (Sweden)

Fabiano Timbó Barbosa

2010-02-01

la degradación de los ácidos nucleicos, proteínas y ácidos grasos; regula el paso de los iones transmembrana e interviene en la actividad de varias enzimas. El paciente en estado crítico, presenta una tendencia a la hipomagnesemia, y el tratamiento consiste en corregir la causa cuando es posible, acompañada de la reposición del magnesio. Ya ha quedado demostrada la reducción de la concentración alveolar mínima (CAM, de los agentes inhalatorios en animales y el uso de opioides en humanos bajo anestesia. CONCLUSIONES: El sulfato de magnesio, ha venido siendo utilizado en obstetricia con una buena efectividad para la inhibición del parto prematuro y para el tratamiento de las crisis convulsivas asociadas al cuadro de eclampsia. Es un fármaco con potencial analgésico y sedativo que puede ser utilizado como coadyuvante durante la anestesia general, atenuando la respuesta presórica a la intubación traqueal y disminuyendo la necesidad del uso de anestésicos.BACKGROUND AND OBJECTIVES: Magnesium is predominantly an intracellular ion. Its blocking effects on NMDA receptors are responsible for the analgesic and sedative characteristics of this ion. The objective of this study was to review the physiology, pharmacology, and decreased plasma levels of magnesium, as well as its applications in obstetrics and anesthesia. CONTENTS: Magnesium is an intracellular cation with multiple functions: it is a cofactor for enzymes of the glucose metabolism and those that participate in the degradation of nucleic acids, proteins, and fatty acids; it regulates the movements of transmembrane ions; and it intervenes in the activity of several enzymes. Critical patients have a tendency to develop hypomagnesemia, and the treatment consists in correcting the cause, whenever possible, and replacement of magnesium. A reduction in the minimum alveolar concentration (MAC of inhalational agents in animals and the use of opioids in humans under anesthesia has been demonstrated. CONCLUSIONS

Comparação da anestesia geral e bloqueio do plexo cervical superficial em tireoidectomias parciais Comparison between general anesthesia and superficial cervical plexus block in partial thyroidectomies

Directory of Open Access Journals (Sweden)

Rui Celso Martins Mamede

2008-02-01

Full Text Available Tireoidectomia sob efeito de bloqueio do plexo cervical superficial (BPCS tem sofrido resistência. OBJETIVO: Comparar variáveis cirúrgicas e anestésicas, custos do tratamento e grau de satisfação de pacientes submetidos à hemitireoidectomia sob efeito de anestesia geral e BPCS. CASUÍSTICA E MÉTODOS: Foram 21 pacientes submetidos à anestesia geral (AG e outro tanto ao BPCS. Após sedação, no grupo com BPCS, usou-se marcaína com vasoconstritor, e quando necessário, lidocaína a 2% com vasoconstritor. Sedação intra-operatória com diazepam endovenoso e metoprolol para controle da PA e FC eram administradas quando necessário. Usou-se anestesia geral (AG segundo padronização do serviço. RESULTADOS: Foram significantes (pThyroidectomy under the effect of superficial cervical plexus block (SCPB has met resistance. AIM: to compare variables in patients submitted to hemithyroidectomy under the effect of general anesthesia (GA and SCPB. CASE REPORT AND METHODS: GA was used in 21 patients, and SCPB was used in another 21 patients. Following sedation, marcaine 0.5% with vasoconstrictor was used in the SCPB group. Intraoperative sedation with diazepam and metoprolol to control arterial pressure and cardiac frequency was given as needed. GA followed the standard method in the unit. RESULTS: We found significant results (p<0.05, Student’s t-test for surgery time (GA - 111.4 min; SCPB - 125.5 min, anesthesia time (GA - 154.1 min; SCPB - 488.6 min, time in the surgery room (GA - 15 min; SCPB - 1 min, treatment costs (GA - R$203.2; SCPB - R$87.4, presence of bradycardia (GA - 0; SCPB - 23.8% and laryngotracheal injury (GA - 51; SCPB - 0 %. We also found the following non-significant results: hospitalization time (GA - 17.3; SCPB - 15.1 hours; bleeding volume (GA - 41,9 g; SCPB - 47.6 g, size of the operative specimen (GA - 52.1 cm3; SCPB - 93.69 cm3 and patient satisfaction level (GA - 3.8; SCPB - 3.9. CONCLUSION: Although the incidence of

Avaliação da memória sob anestesia venosa total Evaluación de la memoria bajo anestesia venosa total The assessment of memory under total intravenous anesthesia

Directory of Open Access Journals (Sweden)

Gulistan Aktas

2013-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Neste estudo, objetivamos avaliar a memória implícita e explícita em pacientes submetidos à cirurgia abdominal sob anestesia venosa total (AVT com propofol e remifentanil, na qual o nível de anestesia foi controlado pelo monitoramento do índice bispectral (BIS. MÉTODO: Anestesia venosa total foi administrada a 60 pacientes adultos para obter níveis de BIS de 40-60. Os pacientes foram randomicamente divididos em três grupos, de acordo com as gravações que ouviram. Os pacientes do grupo categoria (CT ouviram uma fita gravada contendo cinco nomes de animais. Os pacientes do grupo recordar palavras (RP ouviram uma fita gravada contendo cinco palavras de frequência média na língua turca, depois de adaptadas. Os pacientes do grupo controle (GC ouviram os sons do mar até o fim da cirurgia. Duas horas após a cirurgia, os testes foram administrados a cada paciente na sala de recuperação para avaliar a memória. RESULTADOS: Houve uma diferença entre os escores dos grupos CT e GC no Miniexame do Estado Mental (MMSE; todos os escores foram > 20. Os resultados dos testes de categoria e recordar palavras, aplicados para avaliar a memória implícita, não foram estatisticamente diferentes entre os grupos. Não houve evidência de memória implícita em nenhum dos pacientes. Um paciente lembrou-se de ouvir "o som de água" como uma prova de memória explícita. Onze pacientes declararam não ter sonhado. CONCLUSÕES: Apesar de não termos encontrado nenhuma evidência de memória implícita sob anestesia adequada com AVT, um paciente apresentou memória explícita. Embora a profundidade adequada da anestesia fornecida pelo monitoramento do BIS corrobore nossos resultados para a memória implícita, ela não explica os resultados para a memória explícita.JUSTIFICATIVA Y OBJETIVOS: En este estudio evaluamos la memoria implícita y explícita en pacientes sometidos a la cirugía abdominal bajo anestesia venosa total

Electrocardiographic study on geriatric dogs undergoing general anesthesia with isoflurane Estudo eletrocardiográfico em cães geriátricos submetidos à anestesia geral com isofluorano

Directory of Open Access Journals (Sweden)

Andreza Conti-Patara

2009-04-01

Full Text Available The purpose of this study was to clarify the degree of influence of anesthetic agents commonly used during anesthesia on the heart conduction systems of geriatric dogs, with or without the presence of electrocardiographic changes in the pre-anesthetic electrocardiogram and also to determine the possible causes of ST-segment and T-wave changes during anesthesia, by monitoring ventilation and oxygenation. 36 geriatric dogs were evaluated. In addition to electrocardiographic evaluation, the pre-anesthetic study included serum levels of urea, creatinine, total protein, albumin and electrolytes. The pre-anesthetic medication consisted of acepromazine (0.05mg kg-1 in association with meperidine (3.0mg kg-1 by IM injection. Anesthesia was induced with propofol (3.0 to 5.0mg kg-1 by IV injection and maintained with isoflurane in 100% oxygen. During the anesthesia, the animals were monitored by continued computerized electrocardiogram. Systemic blood pressure, heart rate, respiratory rate, end-tidal carbon dioxide, partial pressure of carbon dioxide in arterial blood, arterial oxygen saturation, partial pressure of arterial oxygen and oxygen saturation of hemoglobin were closely monitored. During maintenance anesthesia, normal sinus rhythm was more common (78%. ST-segment and T-wave changes during the anesthetic procedure were quite common and were related to hypoventilation. The use of isoflurane did not result in arrhythmia, being therefore a good choice for this type of animal; Electrocardiographic findings of ST-segment and T-wave changes during the maintenance anesthesia were evident in animals with hypercapnia, a disorder that should be promptly corrected with assisted or controlled ventilation to prevent complicated arrhythmias.Os objetivos deste estudo foram esclarecer a influência dos agentes anestésicos comumente utilizados durante a anestesia no sistema de condução cardíaco em cães idosos, com ou sem alterações eletrocardiográficas pr

Anestesia e síndrome do QT longo Anestesia e síndrome del QT largo Anesthesia and the long QT syndrome

Directory of Open Access Journals (Sweden)

Michelle Nacur Lorentz

2007-10-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: As disritmias cardíacas são fatores importantes de morbimortalidade no período perioperatório. Dentre as causas de disritmias, a síndrome do QT longo, tanto em sua forma genética como adquirida deve ser lembrada, já que muitos fármacos usados em anestesia, bem como ocorrências no período perioperatório podem prolongar o intervalo QT e precipitar disritmias cardíacas potencialmente malignas. CONTEÚDO: Revisão da síndrome do QT longo (LQTS, abordando suas causas e sua definição, assim como os mecanismos da doença. Além de citar vários fármacos implicados no prolongamento do intervalo QT, as abordagens anestésicas mais adequadas para os pacientes afetados são sugeridas. CONCLUSÃO: A síndrome do QT longo, possível causa de morbimortalidade intra e pós-operatória, pode estar relacionada com fármacos utilizados durante anestesia. Essa condição demanda conhecimento do anestesiologista a fim de evitar desfecho desfavorável do ato operatório.JUSTIFICATIVA Y OBJETIVOS: Las arritmias cardíacas son factores importantes de morbi mortalidad en el período perioperatorio. Entre las causas de arritmias, el síndrome del QT largo, tanto en su forma genética como adquirida debe ser recordado ya que muchos fármacos usados en anestesia, e incidencias en el período perioperatorio pueden prolongar el intervalo QT y precipitar arritmias potencialmente malignas. CONTENIDO: Revisión del Síndrome del QT largo (LQTS, abordando sus causas y definición, y los mecanismos de la enfermedad. Además de citar varios fármacos implicados en el prolongamiento del intervalo QT, los abordajes anestésicos más adecuadas para los pacientes afectados son sugeridas. CONCLUSIÓN: El síndrome del QT largo, posible causa de morbimortalidad intra y postoperatoria, puede estar relacionada a fármacos utilizados durante anestesia. Esa condición demanda conocimiento del anestesiólogo para evitar un desenlace no deseado de

An evaluation of new circle system of anesthesia. Quantitative anesthesia with isoflurane in new zealand rabbits Avaliação de um novo sistema circular de anestesia: anestesia quantitativa com isuflorane em coelhos

Directory of Open Access Journals (Sweden)

Neuber M. Fonseca

1997-12-01

Full Text Available A small circuit system of anesthesia was developed by Fonseca and Goldenberg in 1993. The authors used in this study New Zealand White (NZW rabbits under closed system anesthetic regiment by insoflurane. Twenty male adult New Zealand rabbits were distributed in two groups of ten animals. No premedicant drugs were given. Endotraqueal intubation was made after intravenous administration of propofol (10mg/kg. Insoflurane was used to anesthesia management, administred by lowflow closed system technique with cooper kettle vaporizer, fixed by pre-calculated vaporizing flow in double times intervals. The group II underwent surgical periostal scratching in the medial tibial surface at the proximal shaft. Rabbits breathed spontaneously. Hypotensio, hypercapnia and respiratory acidosis were characteristic of the cardiopulmonary effects of the anesthesia. The corneal reflex and pinch reflex was useful as reliable indicators of anesthesic depth. Manual or mechanical ventilation should be considered as a way of improving alveolar ventilation and normalize blood-gas values. The system developed by Fonseca and Goldenberg was considered suitable for anesthesic management in rabbits.Um sistema circular de anestesia para animais de pequeno porte foi desenvolvido por FONSECA e GOLDENBERG, em 1993. No presente estudo foram utilizados 20 coelhos brancos linhagem Nova Zelândia, submetidos ao sistema com isoflurane, distribuidos em dois grupos de 10 animais. O grupo I, controle, que foi apenas anestesiado e o grupo II foi submetido a raspagem periostal da parte proximal e medial da tíbia. Não foi administrada droga pré-anestésica. Após administração do propofol intravenoso (10mg/kg procedeu-se a intubação endotraqueal. O isuflorane foi administrado lentamente no sistema circular de anestesia. Os animais respiravam espontaneamente. Houve efeitos cardiorespiratórios conseqüentes da anestesia, tais como, hipotensão, hipercapnia e acidose respiratória. O

Anestesia em paciente com síndrome de Rubinstein-Taybi: relato de caso Anestesia en paciente con síndrome de Rubinstein-Taybi: relato de caso Anesthesia in patient with Rubinstein-Taybi syndrome: case report

Directory of Open Access Journals (Sweden)

Carlos Rogério Degrandi Oliveira

2005-10-01

la anestesia general para extracciones de dientes anormalmente posicionados. Presentaba las características típicas de la SRT, retardo físico y mental, anormalidades craneofaciales y hálux y pulgares anchos. La anestesia fue inducida y mantenida con sevoflurano, inicialmente bajo máscara facial y después intubación nasotraqueal en ventilación asistida manual con sistema de Bain. No hubo interocurrencias y la cirugía fue realizada en régimen ambulatorial. CONCLUSIONES: La importancia de la evaluación pre-anestésica es realizada, debido a las malformaciones, incluso cardíacas, asociadas a este síndrome. En este caso en particular, el paciente no presentaba comprometimiento cardíaco, presente en un tercio de los casos. Se recomienda preparación para una posible dificultad de mantenimiento de las vías aéreas.BACKGROUND AND OBJECTIVES: Rubinstein-Taybi syndrome (RTS is a genetic disease caused by mutation or deletion of chromosome 16, and characterized by growth and mental retardation, clubbing thumbs and toes and craniofacial abnormalities. There is little information about RTS in the anesthetic literature. This report aimed at describing the anesthetic management of a patient with Rubinstein-Taybi syndrome submitted to dentistry surgery and at discussing aspects of this syndrome that may be relevant to anesthesia. CASE REPORT: Male patient, 9-year-old, 28 kg, to be submitted to general anesthesia for extraction of abnormally positioned teeth. Patient presented with typical RTS characteristics (growth and mental retardation, clubbing thumbs and toes and craniofacial abnormalities. Anesthesia was induced and initially maintained with sevoflurane under facial mask; after tracheal intubation it was maintained under manually controlled ventilation with Bain system. There have been no complications and procedure was performed in outpatient regimen. CONCLUSIONS: The importance of thorough preanesthetic evaluation is emphasized due to possible associated

MethPrimer: designing primers for methylation PCRs.

Science.gov (United States)

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Aplicação do monitor Narcotrend® para avaliar a profundidade da anestesia em crianças submetidas à cirurgia cardíaca: estudo prospectivo e controlado Aplicación del monitor Narcotrend® para evaluar la profundidad de la anestesia en niños sometidos a la cirugía cardíaca: estudio prospectivo y controlado Application of Narcotrend® monitor for evaluation of depth of anesthesia in infants undergoing cardiac surgery: a prospective control study

Directory of Open Access Journals (Sweden)

Yiyan Jiang

2013-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Investigar a eficácia clínica, segurança e viabilidade do monitor Narcotrend® para avaliar a profundidade da anestesia em crianças com doença cardíaca congênita (DCC submetidas à cirurgia cardíaca. MÉTODOS: Foram randomicamente selecionadas 80 crianças submetidas à anestesia geral em cirurgia seletiva. As crianças foram divididas em dois grupos de forma aleatória (n = 40 por grupo. No grupo Narcotrend, a profundidade da anestesia foi monitorada com o Narcotrend. No grupo padrão, a profundidade da anestesia foi controlada de acordo com a experiência clínica. A pressão arterial média (PAM e a frequência cardíaca (FC foram determinadas e a dose de fentanil e relaxante muscular e os tempos de recuperação e de extubação foram registrados. RESULTADOS: Em ambos os grupos, os sinais vitais apresentaram-se estáveis durante a cirurgia. No grupo Narcotrend, a PAM e a FC foram mais estáveis, a dose total de fentanil e relaxante muscular significativamente menor e os tempos de recuperação e extubação acentuadamente mais reduzidos em comparação com o grupo padrão. CONCLUSÃO: A aplicação do monitor Narcotrend para medir a profundidade da anestesia foi útil para controlar a profundidade da anestesia em crianças com DCC que receberam anestesia intravenosa total, na qual uma pequena quantidade de narcóticos pode obter a anestesia ideal. Além disso, os tempos de recuperação e extubação foram menores e os efeitos secundários, como sensibilização intraoperatória, puderam ser evitados.JUSTIFICATIVA Y OBJETIVOS: Investigar la eficacia clínica, la seguridad y la viabilidad del monitor Narcotrend® para evaluar la profundidad de la anestesia en niños con enfermedad cardíaca congénita (ECC sometidos a la cirugía cardíaca. MÉTODOS: Un total de 80 niños sometidos a la anestesia general en cirugía selectiva fueron seleccionados aleatoriamente. Los niños fueron divididos en dos grupos de

Aplicação do monitor Narcotrend® para avaliar a profundidade da anestesia em crianças submetidas à cirurgia cardíaca: estudo prospectivo e controlado

Directory of Open Access Journals (Sweden)

Yiyan Jiang

2013-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Investigar a eficácia clínica, segurança e viabilidade do monitor Narcotrend® para avaliar a profundidade da anestesia em crianças com doença cardíaca congênita (DCC submetidas à cirurgia cardíaca. MÉTODOS: Foram randomicamente selecionadas 80 crianças submetidas à anestesia geral em cirurgia seletiva. As crianças foram divididas em dois grupos de forma aleatória (n = 40 por grupo. No grupo Narcotrend, a profundidade da anestesia foi monitorada com o Narcotrend. No grupo padrão, a profundidade da anestesia foi controlada de acordo com a experiência clínica. A pressão arterial média (PAM e a frequência cardíaca (FC foram determinadas e a dose de fentanil e relaxante muscular e os tempos de recuperação e de extubação foram registrados. RESULTADOS: Em ambos os grupos, os sinais vitais apresentaram-se estáveis durante a cirurgia. No grupo Narcotrend, a PAM e a FC foram mais estáveis, a dose total de fentanil e relaxante muscular significativamente menor e os tempos de recuperação e extubação acentuadamente mais reduzidos em comparação com o grupo padrão. CONCLUSÃO: A aplicação do monitor Narcotrend para medir a profundidade da anestesia foi útil para controlar a profundidade da anestesia em crianças com DCC que receberam anestesia intravenosa total, na qual uma pequena quantidade de narcóticos pode obter a anestesia ideal. Além disso, os tempos de recuperação e extubação foram menores e os efeitos secundários, como sensibilização intraoperatória, puderam ser evitados.

Feocromocitoma y anestesia: Revisión del tema a propósito de un caso

Directory of Open Access Journals (Sweden)

Yolanda Sotolongo Molina

2002-12-01

Full Text Available Se reporta el caso de un paciente al cual se le realizó resección de un feocromocitoma en el Instituto de Nefrología. Se describen sus antecedentes, anestesia general orotraqueal, control hemodinámico con lidocaína y nitropusiato de sodio y monitoreo transoperatorio empleado. Se realizó una revisión bibliográfica a través del Medline, a la luz de los conocimientos actuales de la atención perioperatoria, métodos anestésicos, terapéutica con vasodilatadores, bloqueadores alfa y beta adrenérgicos, sulfato de magnesio y bloqueadores de los canales de calcio utilizados en el paciente con feocromocitoma

Anestesia venosa total para laringectomia parcial em paciente na 28ª semana de gestação: relato de caso

OpenAIRE

Costa, José; Mendes, Dalva Maria Carvalho; Lobo, José Eduardo de Oliveira; Furuguem, Adriana Barrozo Ribeiro; Santos, Gabriel Gilberto

2005-01-01

JUSTIFICATIVA E OBJETIVOS: Uma anestesia para paciente gestante constitui um desafio ao anestesiologista em virtude dos riscos para a mãe e para o feto. São muitas as complicações descritas pela literatura como malformações fetais, parto prematuro, instabilidade hemodinâmica materna e até morte fetal. O objetivo deste caso é mostrar uma paciente gestante de 28 semanas, submetida a laringectomia parcial sob anestesia geral venosa total com propofol, remifentanil e cisatracúrio. RELATO DO CASO:...

Doença de Moyamoya e anestesia com sevoflurano fora do centro cirúrgico: relato de caso Enfermedad de Moyamoya y anestesia con sevoflurano fuera del centro quirúrgico: relato de caso Moyamoya disease and sevoflurane anesthesia outside the surgery center: case report

Directory of Open Access Journals (Sweden)

Sheila Braga Machado

2002-06-01

causa de accidente vascular cerebral en individuos jóvenes. El objetivo de este relato es presentar el caso de un paciente con enfermedad de Moyamoya que fue sometido a anestesia general con sevoflurano para procedimiento diagnóstico fuera del centro quirúrgico. RELATO DEL CASO: Niño con 13 años, estado físico ASA IV, portador de enfermedad de Moyamoya con secuela neurológica después de tres accidentes vasculares cerebrales, insuficiencia renal crónica e hipertensión arterial sistémica, sometido a endoscopia digestiva alta. En decúbito dorsal y después monitorización, se realizó inducción inalatoria por la cánula de traqueostomía con sevoflurano (aumento gradual de la concentración inspiratoria hasta 6% y mezcla de oxígeno/óxido nitroso a 50%. Un catéter venoso fue introducido para infusión de solución glucosada a 5%. Fue realizada ventilación controlada manual, siendo la manutención de la anestesia hecha con sevoflurano a 4% y mezcla de oxígeno/óxido nitroso a 50%. Al final del procedimiento los agentes anestésicos fueron descontinuados simultáneamente y fue administrado oxígeno a 100%. La anestesia fue satisfactoria, con buena estabilidad hemodinámica, sin ocurrencia de complicaciones durante el procedimiento y con un precoz despertar. CONCLUSIONES: El sevoflurano puede ofrecer nuevas perspectivas para la anestesia inhalatoria en pacientes con enfermedad neurológica que realizan procedimiento ambulatorial, ya que permite buena estabilidad hemodinamica y despertar precoz, preservando la fisiología cerebral.BACKGROUND AND OBJECTIVES: Moyamoya disease is a progressive cerebrovascular disorder implying anesthetic challenges due to patients’ poor brain perfusion, in addition to being a major cause for stroke in young people. This report aimed at describing a case of Moyamoya’s disease in a patient submitted to general anesthesia with sevoflurane for a diagnostic procedure outside the surgery center. CASE REPORT: Male child, 13 years

Incidência de tremor em anestesia peridural com ou sem fentanil: estudo comparativo

Directory of Open Access Journals (Sweden)

Abreu Múcio Paranhos de

2004-01-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A maioria dos trabalhos encontrados na literatura, relacionando a influência dos opióides administrados por via peridural com o tremor intra e pós-operatório, foram realizados com grupos de pacientes obstétricas, nas quais a resposta do centro termorregulador pode ser diferente das pacientes não grávidas. O objetivo deste trabalho foi comparar o bloqueio peridural com e sem fentanil, quanto à incidência de tremores e outras complicações no intra e pós-operatório em pacientes submetidos à cirurgia de varizes sob anestesia peridural com bupivacaína a 0,5% com adrenalina a 1:200.000. MÉTODO: Trinta e quatro pacientes, estado físico ASA I e II, submetidos à cirurgia para tratamento de varizes de membros inferiores, foram divididos aleatoriamente em 2 grupos (n = 17, e receberam midazolam (0,05 mg.kg-1, por via venosa seguido de anestesia peridural lombar, utilizando-se no grupo S, 20 ml bupivacaína a 0,5% (com vasoconstritor associado a 2 ml de solução fisiológica a 0,9% e no grupo F, 20 ml de bupivacaína a 0,5% (com vasoconstritor associada ao fentanil (100 µg. Foram estudados: incidência de tremor, temperatura dos pacientes, necessidade do uso de meperidina, e a incidência de náuseas e vômitos nos seguintes momentos: M1 - admissão do paciente na sala de operação; M2 - imediatamente antes da anestesia; M3 - 30 minutos após o término da injeção do anestésico local; M4 - 60 minutos após o término da injeção do anestésico local; M5 - 90 minutos após o término da injeção do anestésico local; M6 - final da anestesia; M7 - antecedendo a alta da sala de recuperação pós-anestésica. RESULTADOS: Quanto aos dados antropométricos, estado físico, tempo médio de duração da anestesia e cirurgia, temperatura dos pacientes e da sala de operação e incidência de náuseas e vômitos não houve diferença estatística entre os grupos. Houve diferença estatística aos 60 minutos (M4 e

Efeitos fetais e maternos do propofol, etomidato, tiopental e anestesia epidural, em cesariana eletivas de cadelas

Directory of Open Access Journals (Sweden)

Lavor Mário Sérgio Lima de

2004-01-01

Full Text Available O objetivo deste trabalho foi comparar os efeitos entre os fármacos indutores de anestesia como propofol, etomidato e tiopental, e a anestesia epidural com lidocaína seguida de indução, em cadelas submetidas à cesariana, e seus neonatos. Para tanto, foram utilizadas 20 cadelas e 129 filhotes distribuídos em quatro grupos. No grupo 1 (5 cadelas e 39 neonatos, a indução anestésica foi feita com propofol; no grupo 2 (5 cadelas e 25 neonatos, com etomidato; no grupo 3 (5 cadelas e 26 neonatos com tiopental e no grupo 4, (5 cadelas e 39 neonatos utilizou-se anestesia epidural e indução com halotano através de máscara. Em todos os casos, a medicação pré-anestésica foi feita com midazolam na dose de 0,22mg kg-1 via IM, e a manutenção anestésica com halotano em circuito semifechado e concentração inicial de 3V%. As variáveis avaliadas nas cadelas foram: temperatura retal, freqüência cardíaca, freqüência respiratória, saturação da oxi-hemoglobina (SpO2, pressão arterial média. Para a avaliação dos recém-nascidos, foram mensurados: freqüência cardíaca, esforço respiratório, movimentos musculares, coloração das mucosas e irritabilidade reflexa interpretados através do escore de Apgar modificado, bem como a SpO2 do neonato. Os resultados mostraram que todos os protocolos foram adequados para as mães com mínimos efeitos sistêmicos. Para o neonato, a utilização de anestesia epidural na mãe, seguida de indução e manutenção com halotano foi superior aos protocolos que usaram agentes injetáveis na indução anestésica.

Anestesia venosa total para timectomia em paciente com Miastenia Gravis: relato de caso

Directory of Open Access Journals (Sweden)

Rezer Gabrielle

2003-01-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Pacientes com doenças neuromusculares, como Miastenia Gravis, respondem de maneira anormal aos anestésicos, conforme a técnica e as drogas administradas. O objetivo deste relato é mostrar um caso de paciente portadora de Miastenia Gravis, submetida a timectomia sob anestesia venosa total com propofol e remifentanil. RELATO DO CASO: Paciente feminina, 52 anos, 72 kg, com história de Miastenia Gravis submetida a timectomia transesternal, sob anestesia venosa total, com o uso de propofol em infusão alvo controlada (3 g.ml-1 e remifentanil contínuo (0,3 µg.kg-1.min-1. Para a intubação traqueal foi utilizada succinilcolina (50 mg, sendo realizada sem dificuldade. Com a finalidade de realizar a analgesia pós-operatória, foram utilizados tramadol (50 mg, cetoprofeno (100 mg e dipirona (1 g, no per-operatório. Após a cirurgia, a infusão de propofol e remifentanil foi encerrada e, 15 minutos depois, a paciente foi extubada. A paciente apresentava-se eupnéica, acordada, sem dor, movimentando membros, com freqüência respiratória de 14 mpm e mantendo saturação de oxigênio de 97%. Permaneceu com cateter nasal de O2 a 2 L.min-1 na UTI intermediária, durante 36 horas, e recebeu alta hospitalar no 4º dia do pós-operatório. CONCLUSÕES: A anestesia venosa total, com agentes anestésicos de curta duração e sem metabólitos ativos, favoreceu a recuperação e a extubação precoce da paciente

Epidermólisis bulosa en el niño y anestesia

Directory of Open Access Journals (Sweden)

Joaquín L. de la Lastra Rodríguez

1999-06-01

Full Text Available La epidermólisis bulosa comprende un grupo heterogéneo de enfermedades ampollosas de la piel y mucosas de origen congénito y hereditario. El tratamiento es insatisfactorio en gran parte, por lo cual son necesarias ciertas medidas para proteger al paciente y evitar la aparición de dichas lesiones y sus complicaciones. Se describe el manejo anestesiológico en un niño de 3 años de edad, al que se le administró anestesia general intravenosa con clorhidrato de ketamina y diazepán, y se describen todos los cuidados y recomendaciones que hay que tener para evitar especialmente los roces, las presiones y las temperaturas altas.Epidermolysis bullosa is a heterogenous group of ampullary diseases of the skin and mucosas of congenital and hereditary origin. The treatment is largely unsatisfactory, and that´s why it is necessary to take some measures to protect the patient and to prevent the appareance of such lesions and their complications. It is described the anesthetic management of a 3-year-old child that was administered intravenous general anesthesia with ketamine hydrochlorate and diazepam. The care and recommendations that should be taken into account to avoid touches, pressures and high temperatures, are described.

Anestesia para separação de gêmeos isquiópagos no período neonatal: relato de caso Anestesia para separación de gemelos isquiópagos en el período neonatal Anesthetic management for neonatal conjoined twins separation: case report

Directory of Open Access Journals (Sweden)

Norma Sueli Pinheiro Módolo

2002-07-01

para la literatura existente, relatando los desafíos encontrados por nuestro equipo en el atendimiento a la cirurgia-anestesia de separación de gemelos isquiópagos. RELATO DO CASO: Pacientes gemelos, nacidos a término, de parto cesariano, pesando juntos 5.100 g, clasificados como isquiópagus tetrapus. Dos equipos anestésico-quirúrgicos estaban presentes, siendo el procedimiento anestésico esquematizado con aparato de anestesia, cardioscópio, capnógrafo, oxímetro de pulso, termómetro eléctrico, estetoscópio esofágico, todos en duplo. Se realizó inducción anestésica con halotano y fentanil, con los gemelos en posición lateral y con rotación de la cabeza en 45º para facilitar la intubación traqueal. Los recién-nacidos fueron mantenidos en ventilación controlada manualmente, utilizando el sistema de Rees-Baraka. La anestesia fue mantenida con halotano, oxígeno y fentanil. Durante el per-operatorio, fueron encontrados organismos abdominales duplos, con excepción del cólon, que era único. Las vejigas y los ísquios estaban ligados. Al final de la cirugía los dos niños se presentaban con señales vitales estables. Los gemelos permanecieron en la Unidad de Terapia Intensiva (UTI Neonatal por cuatro semanas y recibieron alta en buen estado general. CONCLUSIONES: Se resalta la importancia del engranaje del equipo, del estudio retrospectivo multidisciplinar, de la monitorización adecuada y perfeccionada observación clínica; todos esos factores contribuyeron para la buena evolución y alta de los gemelos.BACKGROUND AND OBJECTIVES: The separation of conjoined twins has always raised considerable interest because of surgical and anesthetic complexity, pathology rarity and few survival chances. The goal of this description was to contribute to existing literature by reporting the challenges faced by our team during an anesthetic-surgical procedure for ischiopagus twins separation. CASE REPORT: Term conjoined twins, born from Cesarean section, weighing

Espondilodiscitis secundaria a anestesia peridural Spondilodiscitis secondary to peridural anesthesia

OpenAIRE

Yvei González Orlandi; Luis Elizondo Barriel; Reinel Junco Martín; Jorge Rojas Manresa; Victor Duboy Limonta; Federico Córdova Armengol

2010-01-01

Se presenta el caso de un paciente con espondilodiscitis secundaria al uso de anestesia peridural lumbar para la resección transuretral de una hiperplasia fibroadenomatosa de la próstata. El cuadro clínico estuvo determinado por lumbalgia aguda con incremento progresivo que llevó al confinamiento en cama del paciente. En el examen físico del sistema osteomioarticular predominó la contractura paravertebral lumbar, así como en la palpación de esta región. En el examen neurológico no se encontra...

Anestesia venosa total (AVT em lactente com doença de Werdnig-Hoffmann: relato de caso Anestesia venosa total (AVT en lactante con enfermedad de Werdnig-Hoffmann: relato de caso Total intravenous anesthesia (TIVA in an infant with Werdnig-Hoffmann disease: case report

Directory of Open Access Journals (Sweden)

Luis Otavio Esteves

2010-10-01

Full Text Available Foi com grande interesse que li o artigo "Anestesia Venosa Total (AVT em Lactente com Doença de Werdnig-Hoffmann. Relato de Caso", de Resende e col. ¹, publicado nesta revista. Gostaria, em primeiro lugar, de parabenizar os autores pela iniciativa. Entretanto, dois pontos me chamaram a atenção. O primeiro refere-se à definição de lactente, a qual compreende o período de 1 a 12 meses de idade. A partir de 12 meses, define-se como pré-escolar ou apenas criança. No artigo, o autor coloca a idade do paciente como 1 ano, mas não especifica meses ou dias. Provavelmente, esse paciente tem mais de 12 meses, sendo, dessa forma, a definição de lactente inadequada. O segundo e mais importante ponto diz respeito à técnica usada e ao título do artigo. No título, utilizou-se a expressão "anestesia venosa total", mas no relato foi dito que, além de propofol e remifentanil, a anestesia foi mantida com oxigênio e N2O. Se foi usado um gás com propriedades anestésicas (N2O, não seria correto classificar essa técnica como venosa total. Além disso, ele cita o artigo de Crawford e col. ², que definiu doses de remifentanil para intubação em crianças. Esse estudo foi realizado utilizando-se oxigenação na concentração de 100%, pois os autores provavelmente entendem que a adição de gases com propriedades anestésicas interferiria nos resultados obtidosFue con un gran interés que leí el artículo "Anestesia Venosa Total (AVT en Lactante con Enfermedad de Werdnig-Hoffmann. Relato de Caso", de Resende y col. ¹, publicado en esta revista. Y de hecho quiero, en primer lugar, felicitar a los autores por la iniciativa. Sin embargo, dos puntos me llamaron la atención. El primero, se refiere a la definición de lactante, la cual abarca el período de 1 a 12 meses de edad. A partir de los 12 meses, se define como preescolar o apenas como niño. En el artículo, el autor coloca la edad del paciente como de 1 año, pero no especifica meses o d

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

Anestesia venosa total (AVT) em lactente com doença de Werdnig-Hoffmann: relato de caso Anestesia general intravenosa (AVT) en lactante con enfermedad de Werdnig-Hoffmann: relato de caso Total intravenous anesthesia (TIVA) in an infant with Werdnig-Hoffmann disease: case report

OpenAIRE

Marco Antonio Cardoso de Resende; Elizabeth Vaz da Silva; Osvaldo José Moreira Nascimento; Alberto Esteves Gemal; Giseli Quintanilha; Eliana Maria Vasconcelos

2010-01-01

JUSTIFICATIVA E OBJETIVOS: A doença de Werdnig-Hoffmann é a causa mais comum de hipotonia no lactente e quando presente logo após o nascimento tem pior prognóstico. Fraqueza muscular simétrica, arreflexia e fasciculações da língua são característicos. A maioria dos lactentes morre antes dos dois anos por insuficiência respiratória. O presente relato apresenta um caso com técnica venosa total durante anestesia. RELATO DO CASO: Paciente feminina, branca, um ano, 10 kg, estado físico ASA III, co...

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Anestesia venosa total (AVT em lactente com doença de Werdnig-Hoffmann: relato de caso Anestesia general intravenosa (AVT en lactante con enfermedad de Werdnig-Hoffmann: relato de caso Total intravenous anesthesia (TIVA in an infant with Werdnig-Hoffmann disease: case report

Directory of Open Access Journals (Sweden)

Marco Antonio Cardoso de Resende

2010-04-01

á presente después del nacimiento su pronóstico empeora. La debilidad muscular simétrica, la arreflexia y las fasciculaciones de la lengua son sus características. La mayoría de los lactantes fallece antes de los dos años por insuficiencia respiratoria. El presente relato presenta un caso con la técnica venosa total durante la anestesia. RELATO DEL CASO: Paciente femenina, blanca, de un año, 10 kg, estado físico ASA III, con enfermedad de Werdnig-Hoffmann diagnosticada desde los dos meses de edad. Candidata a la gastrostomía y fundoplicatura en la técnica abierta y traqueostomía. Monitorización con cardioscopio, presión arterial no invasiva, oxímetro de pulso, estetoscopio precordial y temperatura rectal posterior a la venoclisis. Fue preoxigenada y después de recibir el bolo de atropina (0,3 mg, se le realizó la inducción anestésica con remifentanil bolo (20 µg y propofol (30 mg. Después de la intubación traqueal fue ventilada de forma controlada manualmente, en sistema sin absorvedor de CO2, Baraka, FAG de 4 L.min-1, FiO2 0,5 (0(2/N(20. Mantenida bajo anestesia con propofol 250 µg.kg-1.min-1 y remifentanil 0,3 µg.kg-1.min-1 en infusión continua manual. El tiempo quirúrgico fue de 150 minutos. El despertar se dio en 8 minutos después del término de la infusión, con ventilación espontánea. A las dos horas, fue transferida a la unidad pediátrica y recibió alta al 4º día del postoperatorio. CONCLUSIONES: La elección de la técnica anestésica prioriza la seguridad que proviene de la familiaridad del manejo de los fármacos existentes. En los niños con enfermedades neuromusculares, la anestesia general intravenosa con remifentanil y propofol en sistemas de infusión, por la duración de la acción extremadamente corta, puede influir en la evolución de la enfermedad favorablemente.BACKGROUND AND OBJECTIVES: Werdnig-Hoffmann disease is the most common cause of hypotonia in infants and its prognosis is worse if it is present shortly after

Anestesia congênita de córnea associada à anestesia de ramo do trigêmio: relato de caso Congenital corneal anesthesia related to trigeminal anesthesia: case report

Directory of Open Access Journals (Sweden)

Miguel José Calix Netto

2005-12-01

Full Text Available A anestesia corneana por ser uma condição rara, freqüentemente é confundida ou não diagnosticada durante o exame de rotina do segmento anterior. Relato de caso de um paciente de 18 anos encaminhado ao ambulatório de córnea e doenças externas com quadro clinico de síndrome de olho seco e com diagnóstico provável de síndrome de Sjögren. Era amblíope de olho direito devido à opacidade corneana no eixo visual secundária a trauma com unha na infância. Foi pesquisada sensibilidade corneana que era ausente em ambos os olhos; olho seco grave e com BUT (tempo de quebra do filme lacrimal menor que 4 segundos. Foi feito diagnóstico de anestesia corneana congênita associada a hipoestesia do nervo trigêmio pela avaliação neurológica da sensibilidade facial e movimentos bruscos do queixo que evidenciavam alterações sensoriais do nervo. O oftalmologista geral e principalmente o especialista em segmento anterior devem ter como rotina a pesquisa da sensibilidade corneana no exame do segmento anterior.Corneal anesthesia is a rare condition, therefore its diagnosis is frequently impaired or it is not noticed during the anterior segment examination. Case report of a 18-year-old patient referred to our Corneal and External Disease Department who complained of dry eye symptoms and with a suspicion of Sjögren's syndrome. She had amblyopia of the right eye, consequence of corneal leucoma over the visual axis secondary to a fingernail traumatism inflicted by herself in childhood. On the ophthalmologic examination corneal sensitivity was absent in both eyes. Severe dry eye and breakup time less than four seconds. Diagnosis of congenital corneal anesthesia was established, secondary to trigeminal anesthesia found on neurological evaluation of facial sensitivity. She also showed sudden movements of the chin which evidenced sensorial pathology of the trigeminal nerve. The general ophthalmologist and specially anterior segment specialists must

Anestesia regional para cirugía cardiovascular pediátrica

Directory of Open Access Journals (Sweden)

Lincoln de la Parte Pérez

2004-03-01

Full Text Available Durante los últimos años se han publicado numerosos artículos sobre el uso de anestesia espinal y peridural asociada a la anestesia general, en niños sometidos a operaciones cardiovasculares. El uso de esta técnica produce una disminución significativa de la respuesta de estrés que se observa durante y después de las operaciones cardiovasculares y que es particularmente intensa en recién nacidos y lactantes. Adicionalmente produce una mejor función pulmonar, mayor estabilidad hemodinámica, posibilidad de extubación precoz, excelente analgesia posoperatoria y una menor estadía en la sala de recuperación anestésica. Las complicaciones más importantes asociadas a su uso son la hipotensión arterial, la depresión respiratoria y el hematoma epidural. Las contraindicaciones más importantes para la realización de estas técnicas incluyen la presencia de cianosis, policitemia, coagulopatía preexistente y en los lactantes menores de 6 meses. Existe además un dilema ético importante relacionado con su uso. Por una parte es cierto que pueden obtenerse un grupo de ventajas, que también podrían lograrse con la aplicación de otras técnicas encaminadas a la extubación precoz (Fast track cardiac anesthesia y por la otra, existe siempre el peligro latente de sangramiento y de formación de un hematoma epidural. Se realiza una revisión bibliográfica sobre las diferentes técnicas utilizadas.Several articles have been published on the use of spinal and epidural anesthesia associated with general anesthesia in children undergoing cardiovascular surgery. The use of this technique causes a significant decrease of the stress response observed during and after cardiovascular surgery and that is particularly intense in newborns and infants. Besides, it produces a better pulmonary function, a longer hemodynamic stability, the possibility of fast track cardiac anesthesia, an excellent postoperative analgesia and a shorter stay in the

Anestesia em paciente portador de distrofia muscular de Duchenne: relato de casos Anestesia en un paciente portador de distrofia muscular de Duchenne: relato de casos Anesthesia for Duchenne muscular dystrophy patients: case reports

Directory of Open Access Journals (Sweden)

Rodrigo Machado Saldanha

2005-08-01

eficiente nos portadores de DMD.JUSTIFICATIVA Y OBJETIVOS: Relatar dos casos de anestesia en pacientes portadores de Distrofia Muscular de Duchenne (DMD, una enfermedad rara, progresiva e incapacitante, y discutir sobre la conducta anestésica y comprometimiento de las funciones pulmonar y cardiaca, la posibilidad de ocurrencia de hipertermia maligna, la mayor sensibilidad a los bloqueadores neuromusculares y el aumento de la morbidad pos-operatoria son algunos de los desafíos enfrentados por el Anestesiologista. RELATO DE LOS CASOS: El primer caso fue el de un paciente pediátrico con diagnóstico de DMD y rabdomiosarcoma, agendado para exéresis de la lesión y vaciamiento cervical ampliado. En la evaluación pre-anestésica, anamnesis, examen clínico y exámenes complementarios no fueron detectadas alteraciones, excepto por la tumoración cervical. Se optó por la técnica venosa total, con remifentanil en infusión continuada y propofol en infusión mira-controlada, sin la utilización de bloqueadores neuromusculares. El procedimiento quirúrgico tuvo duración de 180 minutos, sin intercurrencias. El segundo caso fue de un paciente del sexo masculino, 24 años, con diagnóstico de DMD y colelitiasis con indicación quirúrgica, en el cual la evaluación pre-operatoria reveló pneumopatia restrictiva grave, con disminuciones de la capacidad y de la reserva respiratorias, siendo necesario el uso de BIPAP nasal nocturno. En este paciente, se optó por la intubación traqueal con sedación mínima y anestesia tópica, seguida por la técnica venosa total con remifentanil en infusión continuada y propofol en infusión mira-controlada, sin la utilización de bloqueadores neuromusculares. Al término, el paciente fue extubado aún en la sala del operaciones e inmediatamente colocado en el BIPAP nasal. Encaminado a la UTI, con alta en el 2º PO y alta hospitalaria en el 3º PO. CONCLUSIONES: La anestesia venosa total con infusión continuada de propofol y remifentanil sin

Anestesia em gestante com hipertensão intracraniana por meningite tuberculosa: relato de caso Anestesia en gestante con hipertensión intracraneal por meningitis tísica: relato de caso Anesthesia in pregnant patient with intracranial hypertension due to tuberculous meningitis: case report

Directory of Open Access Journals (Sweden)

Vanessa Breitenbach

2005-02-01

área electiva. RELATO DEL CASO: Paciente blanca, 32 años, 60 kg, 1,62 m de estatura, en la 36ªsemana de edad gestacional, agendada para interrupción quirúrgica de la gestación por presentarse tetraparética, con hidrocefalia consecuente de meningitis tísica, (tuberculosa. Se escogió la anestesia general para la cesárea con inducción en secuencia rápida y maniobra de Sellick para la intubación traqueal. Las drogas utilizadas fueron tiopental (250 mg, rocuronio (50 mg, fentanil (100 µg y lidocaína (60 mg por vía venosa. La inducción anestésica fue suave y mantenida con isoflurano hasta el inicio del encerramiento de la piel de la paciente, con mínimas alteraciones de sus señales vitales y del recién nacido, que recibió índice de Apgar 8 y 9, en el 1º y 5º minutos, respectivamente. La paciente despertó precozmente, sin deficiencias neurológicas adicionales. CONCLUSIONES:La anestesia general aún es la técnica anestésica preferida para cesárea en gestantes con hipertensión intracraneal, utilizándose drogas de media-vida corta y que tengan mínima interferencia en la presión intracraneal y en el recién nacido.BACKGROUND AND OBJECTIVES: It is a well-established fact today that the technique of choice for elective cesarean delivery is regional anesthesia. However, in patients with intracranial hypertension and central nervous system infection, this technique should be avoided. This paper aimed at reporting the anesthetic management of a pregnant patient with intracranial hypertension due to tuberculous meningitis submitted to elective cesarean delivery. CASE REPORT: Caucasian patient, 32 years old, 1.62 m height and 60 kg weight, in the 36th week of gestational age admitted to the obstetrics unit to have her pregnancy interrupted by cesarean delivery because she had become quadriparetic with hydrocephalus due to tuberculous meningitis. The chosen technique was general anesthesia with rapid sequence induction and Sellick maneuver for intubation. Drugs

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Anestesia venosa total para laringectomia parcial em paciente na 28ª semana de gestação: relato de caso Anestesia venosa total para laringectomía parcial en paciente en la 28ª semana de embarazo: relato de caso Total intravenous anesthesia for partial laryngectomy in 28 weeks pregnant patient: case report

OpenAIRE

José Costa; Dalva Maria Carvalho Mendes; José Eduardo de Oliveira Lobo; Adriana Barrozo Ribeiro Furuguem; Gabriel Gilberto Santos

2005-01-01

JUSTIFICATIVA E OBJETIVOS: Uma anestesia para paciente gestante constitui um desafio ao anestesiologista em virtude dos riscos para a mãe e para o feto. São muitas as complicações descritas pela literatura como malformações fetais, parto prematuro, instabilidade hemodinâmica materna e até morte fetal. O objetivo deste caso é mostrar uma paciente gestante de 28 semanas, submetida a laringectomia parcial sob anestesia geral venosa total com propofol, remifentanil e cisatracúrio. RELATO DO CASO:...

Efeitos do óxido nitroso em hipotensão controlada durante anestesia com baixo fluxo

Directory of Open Access Journals (Sweden)

Semiha Barçın

2013-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Investigamos o efeito do óxido nitroso (N2O em hipotensão controlada durante anestesia com baixo fluxo (isoflurano-dexmedetomidina em termos de hemodinâmica, consumo de anestésico e custos. MÉTODOS: Quarenta pacientes foram randomicamente alocados em dois grupos. Infusão de dexmedetomidina (0,1 µg.kg-1.min-1 foi mantida por 10 minutos. Subsequentemente, essa infusão foi mantida até os últimos 30 minutos de operação a uma dose de 0,7 µg.kg-1.hora-1. Tiopental (4-6 mg.kg-1 e brometo de vecurônio (0,08 0,12 mg.kg-1 foram administrados na indução de ambos os grupos. Isoflurano (2% foi administrado para manutenção da anestesia. O Grupo N recebeu uma mistura de 50% de O2-N2O e o Grupo A recebeu uma mistura de 50% de O2-ar como gás de transporte. Anestesia com baixo fluxo (1 L.min-1 foi iniciada após um período de 10 minutos de alto fluxo inicial (4,4 L.min-1. Os valores de pressão arterial, frequência cardíaca, saturação periférica de O2, isoflurano inspiratório e expiratório, O2 inspiratório e expiratório, N2O inspiratório e expiratório, CO2 inspiratório, concentração de CO2 após expiração e concentração alveolar mínima foram registrados. Além disso, as taxas de consumo total de fentanil, dexmedetomidina e isoflurano, bem como de hemorragia, foram determinadas. RESULTADOS: A frequência cardíaca diminuiu em ambos os grupos após a carga de dexmedetomidina. Após a intubação, os valores do Grupo A foram maiores nos minutos um, três, cinco, 10 e 15. Após a intubação, os valores de hipotensão desejados foram alcançados em 5 minutos no Grupo N e em 20 minutos no grupo A. Os valores da CAM foram mais altos no Grupo N nos minutos um, três, cinco, 10 e 15 (p < 0,05. Os valores da FiO2 foram mais altos entre 5 e 60 minutos no Grupo A, enquanto foram mais altos no Grupo N aos 90 minutos (p < 0,05. Os valores de Fi Iso (isoflurano inspiratório foram menores no Grupo N nos minutos

Anestesia local e sedação para cirurgia de implante coclear: uma alternativa possível Local anesthesia for cochlear implant surgery: a possible alternative

Directory of Open Access Journals (Sweden)

Rogério Hamerschmidt

2010-10-01

Full Text Available Aanestesia geral sempre foi motivo de dúvida dos pacientes que vão ser submetidos a qualquer cirurgia, especialmente o implante coclear. Como já realizamos as cirurgias otológicas com anestesia local e sedação, julgamos perfeitamente possível a realização da cirurgia do implante coclear também com esse tipo de anestesia, diminuindo os riscos, a morbidade e os custos para o hospital. OBJETIVOS: Estudo prospectivo para demonstrar a técnica anestésica e cirúrgica utilizada em três casos de adultos submetidos ao implante coclear, avaliando a segurança e a eficácia de tal técnica. MATERIAL E MÉTODOS: Foram feitas três cirurgias de implante coclear, duas com implante Cochlear e uma com Med-EL, sem intercorrências transoperatórias, durante a telemetria e no pós-operatório imediato. RESULTADOS: Os três pacientes adultos tiveram alta hospitalar aproximadamente três horas após a cirurgia, deambulando, sem eventos nauseosos, relatando um pós-operatório mais fácil do que esperavam, mesmo no momento da telemetria intraoperatória. CONCLUSÃO: Anestesia local e sedação é uma alternativa para casos selecionados de pacientes para o implante coclear, principalmente naqueles de mais idade ou que apresentem contraindicação para a anestesia geral, os riscos e a morbidade são menores.The aim of this paper is to illustrate the possibility of performing a cochlear implant surgery with local anesthesia and sedation, the anesthetic technique and the advantages of that in comparison to a general anesthesia. AIMS: prospective study demonstrating the possibility of doing cochlear implant surgery under local anesthesia and sedation. MATERIALS AND METHODS: we describe three successful cases operated under local anesthesia, including neural telemetry and the conditions the patient presented after the surgery, with a very good recovery and no complications during and after the procedure. RESULTS: these three surgeries show the possibility of

Oxigênio suplementar e incidência de náuseas e vômitos perioperatórios no parto cesariano sob anestesia subaracnoidea Oxígeno suplementario e incidencia de náuseas y vómitos perioperatorios en el parto cesariano bajo anestesia subaracnoidea Supplemental oxygen and the incidence of perioperative nausea and vomiting in cesarean sections under subarachnoid block

Directory of Open Access Journals (Sweden)

Fernanda Salomão Turazzi Pécora

2009-10-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Oxigênio suplementar pode reduzir a incidência de náuseas e vômitos pós-operatórios em pacientes submetidos à anestesia geral. O objetivo deste estudo foi testar a eficácia do oxigênio suplementar durante a cesariana eletiva sob anestesia subaracnoidea em diminuir a incidência de náuseas e vômitos perioperatórios. MÉTODO: Após indução de anestesia subaracnoidea padronizada, noventa e quatro parturientes submetidas ao parto operatório foram distribuídas de forma aleatória para receberem, através de cateter nasal tipo óculos, 4 L.min-1 de oxigênio (Grupo O ou ar comprimido (Grupo S até o final do procedimento. As pacientes foram inquiridas acerca da ocorrência de náuseas e vômitos durante a operação e nas primeiras seis e 24 horas de pós-parto. RESULTADOS: Os dois grupos mostraram-se comparáveis quanto às variáveis demográficas, perioperatórias e quanto aos dados do recém-nascido. No Grupo O, a incidência de náusea durante a operação nas primeiras 6 horas de pós-operatório e entre 6 e 24 horas de pós-operatório foi de 35%, 20% e 13%, respectivamente, enquanto no Grupo S foi de 35%, 30% e 19%, respectivamente. A incidência de vômito no Grupo O foi de 9%, 11% e 6% nos períodos correspondentes e no Grupo S 21%, 7% e 7%, respectivamente. Essas diferenças não foram significativas. CONCLUSÕES: Na população estudada, a oxigenoterapia suplementar desde a indução da anestesia até o término da operação não reduziu a incidência de náuseas ou vômitos intraoperatórios e pós-operatórios em mulheres submetidas ao parto cesariano sob anestesia subaracnoidea.JUSTIFICATIVA Y OBJETIVOS: El oxígeno suplementario puede reducir la incidencia de náuseas y vómitos postoperatorios en pacientes sometidos a la anestesia general. El objetivo de este estudio, fue comprobar la eficacia del oxígeno suplementario durante la cesárea electiva bajo anestesia subaracnoidea, para reducir

Primer3_masker: integrating masking of template sequence with primer design software.

Science.gov (United States)

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

Historia de la Anestesia en Colombia

Directory of Open Access Journals (Sweden)

Efraím Otero-Ruiz

2000-08-01

Full Text Available

Con el patrocinio de la Sociedad Colombiana de Anestesiología y Reanimación (SCARE y pulcramente editado por Gente Nueva Editorial, en Julio de 1999 ha publicado el Académico Jaime Herrera Pontón su volumen “Historia de la Anestesia en Colombia“, aparecido justamente con motivo de los 50 años de fundación de dicha Sociedad.

El volumen, de pasta dura y de 300 páginas, con prólogo de Luis Duque Gómez, Presidente de la Academia Colombiana de Historia e ilustrado con numerosas fotografías, está dividido en 14 capítulos y 3 apéndices, precedidos de una introducción a cargo del autor.

Los 4 primeros capítulos, desde la conquista y la colonia hasta los primeros decenios de nuestra república, describen las primeras plantas sedantes y analgésicas nativas lo mismo que los primeros venenos paralizantes empleados por nuestros aborígenes, el opio empleado como profundo analgésico en nuestras guerras emancipadoras y la creación de los primeros programas de estudios médicos en Colombia. De ahí arrancan dos extensos capítulos, pivotales en el desarrollo de esta historia: el 50., titulado “El siglo XIX desde la primera demostración del éter” y el 60. “El siglo XX hasta la creación de la Sociedad Colombiana de Anestesia”. En ellos se describen de manera más o menos suscinta los primeros esfuerzos para diferenciar las técnicas anestésicas de las quirúrgicas propiamente dichas y el lento pero prodigioso esfuerzo por hacer de la anestesiología una especialidad médica, fenómeno que no sucede hasta bien entradas la 4a. y 5a. décadas del pasado siglo. Esos primeros cien años, como sucede en el resto del mundo occidental, estarán dominados por el éter y el cloroformo en método abierto ya que otros agentes, como el etileno y el ciclopropano, apenas comienzan a llegar en vísperas de la lIa. Guerra Mundial, lo mismo que los primeros aparatos de circuito cerrado, la inducción por barbitúricos intravenosos y

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Anestesia em paciente com Distrofia Muscular de Duchenne: relato de caso

Directory of Open Access Journals (Sweden)

Tonelli Deoclécio

2003-01-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A distrofia muscular de Duchenne é uma afecção recessiva ligada ao cromossomo X, geralmente diagnosticada na infância, acentuando-se progressivamente até agravar a função respiratória. O objetivo deste relato é apresentar um caso de um paciente com distrofia muscular de Duchenne diagnosticada há 2 anos, submetido à postectomia, sob anestesia geral com cetamina S. RELATO DO CASO: Paciente com 9 anos de idade com Distrofia Muscular de Duchenne diagnosticada há 2 anos, submetido à anestesia geral com levo-cetamina (1,5 mg.kg-1, por via venosa, sob ventilação espontânea assistida manualmente por sistema de Baraka (Mapleson A e bloqueio peniano com bupivacaína a 0,5% (25 mg. Foram usados monitores de pressão arterial não invasiva, oximetria de pulso, cardioscopia e temperatura esofagiana. No decorrer da cirurgia, o caso evoluiu sem intercorrências, sendo que no período pós-operatório o paciente apresentou alguns episódios de vômitos sem outras alterações significativas. Permaneceu internado por 24 horas, tendo alta hospitalar assintomático. CONCLUSÕES: A avaliação pré-anestésica cuidadosa, o uso de monitorização adequada e medicações que não predisponham o aparecimento de complicações tornam seguro o procedimento em pacientes portadores de Distrofia Muscular de Duchenne e seu pós-operatório.

Alterações transitórias do exame neurológico durante o despertar da anestesia com enflurano, isoflurano ou sevoflurano Alteraciones transitorias del examen neurológico durante el despertar de la anestesia con enflurano, isoflurano o sevoflurano Transient neurological changes during emergence from enflurane, isoflurane or sevoflurane anesthesia

Directory of Open Access Journals (Sweden)

Luiz Fernando Soares

2001-12-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Anormalidades transitórias do exame neurológico ocorrem durante o despertar da anestesia com halotano, enflurano e isoflurano. Pouco se conhece sobre a ocorrência de anormalidades do exame neurológico durante a recuperação da anestesia com sevoflurano. Este estudo teve como objetivo comparar a prevalência de tais achados durante a recuperação da anestesia com enflurano (Grupo E, isoflurano (Grupo I e sevoflurano (Grupo S. MÉTODO: Foram estudados 44 pacientes que receberam anestesia com enflurano, isoflurano ou sevoflurano em N2O a 50%. Foram anotados antes da indução, imediatamente após a cessação da administração do anestésico e 5, 10, 15, 20, 30 e 40 minutos após: temperatura timpânica, nível de consciência, tônus muscular, reflexos pupilar, ciliar, bicipital, patelar e cutâneo-plantar, bem como a ocorrência de calafrios. RESULTADOS: As respostas dos reflexos pupilar, ciliar, patelar e cutâneo-plantar correlacionaram-se com o nível de consciência. Os grupos não diferiram quanto à prevalência de hipertonia muscular, hiperreflexia bicipital, clônus plantar e resposta extensora cutâneo-plantar. Hiperreflexia patelar foi mais freqüente no grupo do enflurano do que no grupo do isoflurano. Calafrios foram mais freqüentes nos grupos E e I do que no grupo do sevoflurano. A temperatura timpânica não diferiu entre os pacientes que apresentaram ou não calafrios. CONCLUSÕES: Alterações reversíveis do exame neurológico podem estar presentes por até 40 minutos durante a recuperação da anestesia com enflurano, isoflurano ou sevoflurano.JUSTIFICATIVA Y OBJETIVOS: Anormalidades transitorias del examen neurológico ocurren durante el despertar de la anestesia con halotano, enflurano e isoflurano. Poco se conoce sobre la ocurrencia de anormalidades del examen neurológico durante la recuperación de la anestesia con sevoflurano. Este estudio tuvo como objetivo comparar la prevalencia de tal

Anestesia peridural torácica para cirurgia plástica de mama em paciente portadora de miastenia gravis: relato de caso Anestesia peridural torácica para cirugía plástica de mama en paciente portadora de miastenia gravis: relato de caso Thoracic epidural anesthesia for mammaplasty in myasthenia gravis patient: case report

Directory of Open Access Journals (Sweden)

Fabiano Timbó Barbosa

2005-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A miastenia gravis é uma doença crônica, auto-imune, caracterizada pela fraqueza da musculatura esquelética em decorrência da diminuição dos receptores de acetilcolina na junção neuromuscular. O objetivo deste relato é mostrar um caso de paciente com miastenia gravis submetida a anestesia peridural torácica para cirurgia plástica de mama. RELATO DO CASO: Paciente com 51 anos, portadora de miastenia gravis foi submetida a anestesia peridural torácica com bupivacaína e fentanil. Não houve sinais de depressão respiratória. A paciente recebeu alta hospitalar após 36 horas. CONCLUSÕES: O presente caso sugere como conduta anestésica para o paciente portador de miastenia gravis a anestesia peridural como técnica única, sem a obrigatoriedade de intubação orotraqueal.JUSTIFICATIVA Y OBJETIVOS: La miastenia gravis es una enfermedad crónica, auto-inmune, caracterizada por la debilidad de la musculatura esquelética resultante de la disminución de los receptores de acetilcolina en la unión neuromuscular. El objetivo de este relato es mostrar el caso de una paciente con miastenia gravis sometida a anestesia peridural torácica para una cirugía plástica de mama. RELATO DEL CASO: Paciente del sexo femenino, 51 años, portadora de miastenia gravis fue sometida a anestesia peridural torácica con bupivacaína y fentanil. No hubo señales de depresión respiratoria. La paciente recibió alta hospitalaria después de 36 horas. CONCLUSIONES: Este actual caso sugiere como conducta anestésica para el paciente portador de miastenia gravis la anestesia peridural como única técnica, sin la obligatoriedad de intubación orotraqueal.BACKGROUND AND OBJECTIVES: Myasthenia gravis is a chronic autoimmune disease characterized by skeletal muscles weakness promoted by decreased acetylcholine receptors in the neuromuscular junction. This report aimed at describing a case of myasthenia gravis patient submitted to thoracic

Anestesia em paciente com insensibilidade congênita a dor e anidrose Anestesia en paciente con insensibilidad congénita al dolor y anhidrosis Anesthesia in a patient with congenital insensitivity to pain and anhidrosis

Directory of Open Access Journals (Sweden)

Carlos Rogério Degrandi Oliveira

2009-10-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A insensibilidade congênita a dor e anidrose (ICDA ou neuropatia hereditária sensorial e autonômica tipo IV (NHSA tipo IV é neuropatia autossômica recessiva rara do grupo das neuropatias hereditárias sensoriais e autonômicas (NHSA, caracterizada por insensibilidade ao estímulo doloroso, anidrose e retardo mental. Existem poucos relatos sobre a conduta anestésica em pacientes com ICDA devido sua extrema raridade. O objetivo deste relato foi apresentar a conduta anestésica em paciente com ICDA submetida à artrodese de tornozelo esquerdo com colocação de haste e discutir as características de interesse para a anestesia nestes pacientes. RELATO DO CASO: Paciente com história de ICDA foi admitida para artrodese de tornozelo esquerdo devido à artropatia de Charcot. Na sala de operação foi monitorizada com eletrocardiógrafo, índice bispectral, SEF 95%, pressão arterial não invasiva e saturação periférica da hemoglobina, medicada com midazolam como pré-anestésico e submetida à anestesia venosa com propofol e cisatracúrio. Não houve a necessidade de administração de analgésicos. Após intubação traqueal, foi acrescentada monitorização da pressão expiratória final do gás carbônico e da temperatura esofágica. Não apresentou complicações no período perioperatório. Teve alta hospitalar no segundo dia de pós-operatório. CONCLUSÕES: Embora apresentem insensibilidade à dor, alguns pacientes apresentam hiperestesia tátil, o que poderia causar sensações desagradáveis durante a manipulação cirúrgica. Apesar de relatos na literatura de pacientes submetidos a bloqueios no neuroeixo e até mesmo a procedimentos sem anestesia, neste caso utilizou-se a anestesia venosa que proporcionou condições adequadas para o procedimento anestésico-cirúrgico.JUSTIFICATIVA Y OBJETIVOS: La falta de sensibilidad congénita al dolor y la anhidrosis (ICDA o neuropatía hereditaria sensorial y auton

Anestesia em criança com síndrome de Guillain-Barré após vacina de sarampo: relato de caso Anestesia en un niño con síndrome de Guillain-Barré después de la vacuna de sarampión: relato de caso Anesthesia in Guillain-Barré pediatric patient after measles vaccination: case report

Directory of Open Access Journals (Sweden)

Deoclécio Tonelli

2005-12-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A síndrome de Guillain-Barré após vacina de sarampo é rara. O diagnóstico muitas vezes é tardio, o que leva a um aumento da morbidade. O presente relato apresenta um caso avançado e os cuidados especiais exigidos durante a anestesia. RELATO DO CASO: Paciente do sexo masculino, com quatro anos de idade com síndrome de Guillain-Barré desde um ano de idade, foi submetido a gastrostomia sob anestesia geral sem intercorrências, com sevoflurano e sem bloqueadores neuromusculares. CONCLUSÕES: O caso ilustra a raridade etiológica de uma síndrome importante na prática anestésica assim como os eventos adversos pós-vacinação, a melhor escolha para a equipe anestésica e as complicações da síndrome de Guillain-Barré na infância.JUSTIFICATIVA Y OBJETIVOS: El síndrome de Guillain-Barré después de la vacuna de sarampión es rara. El diagnóstico en la mayoría de las veces es tardío, lo que lleva a un aumento de la morbidez. Este actual relato presenta un caso avanzado y todas las atenciones especiales exigidas durante la anestesia. RELATO DEL CASO: Paciente del sexo masculino, con cuatro años de edad con síndrome de Guillain-Barré desde hace un año de edad, fue sometido a gastrostomía bajo anestesia general sin intercurrencias, con sevoflurano y sin bloqueadores neuromusculares. CONCLUSIONES: El caso ilustra la rareza etiológica de una síndrome importante en la práctica anestésica, así como los eventos adversos pos-vacunación, la mejor elección para el equipo anestésico y las complicaciones de la síndrome de Guillain-Barré en la infancia.BACKGROUND AND OBJECTIVES: Guillain-Barré syndrome following measles vaccination is uncommon. Diagnosis is often delayed, leading to increased morbidity. This report describes an advanced Guillain-Barré case and the special approaches required during anesthesia. CASE REPORT: Male patient, four years old, with Guillain-Barré syndrome diagnosed at 1 year of

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

Hipertensão arterial sistêmica e anestesia Hipertensión arterial sistémica y anestesia Systemic hypertension and anesthesia

Directory of Open Access Journals (Sweden)

Michelle Nacur Lorentz

2005-10-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Devido à grande prevalência da hipertensão arterial sistêmica na população e a falta de consenso sobre que níveis pressóricos o anestesiologista deve aceitar para induzir uma anestesia para cirurgia eletiva, realizou-se uma revisão na literatura que trata da associação hipertensão arterial e anestesia. Considerando que a suspensão de uma cirurgia implica em gastos, o que torna a Medicina cada vez mais cara, e que, por outro lado, o ato anestésico deve ser realizado com a maior segurança possível, o objetivo desse trabalho foi analisar as evidências da literatura que possam nortear a prática clínica. CONTEÚDO: O artigo apresenta incidência e classificação da hipertensão arterial sistêmica além de relatar e comentar trabalhos relevantes que abordam a hipertensão arterial no paciente cirúrgico. CONCLUSÕES: Ainda não estão estabelecidos quais níveis máximos de pressão são compatíveis com uma cirurgia eletiva, sendo que, atualmente, os critérios para a suspensão da cirurgia no paciente hipertenso mal controlado são muito mais baseados em dados empíricos que em evidências. Existe uma tendência em postergar a cirurgia quando a PA é superior a 180/110 mmHg, mas cada caso deve ser analisado isoladamente, valorizando mais lesões em órgãos alvo que a pressão arterial propriamente dita.JUSTIFICATIVA Y OBJETIVOS: Debido a la grande superioridad de la hipertensión arterial sistémica en la población y la falta de acuerdo sobre que niveles presóricos el anestesiologista debe aceptar para inducir una anestesia para cirugía electiva, se realizó una revisión en la literatura que trata de la asociación hipertensión arterial y anestesia. Considerando que la suspensión de una cirugía implica en gastos, lo que hace la Medicina cada vez más cara, y que, por otro lado, el acto anestésico debe ser realizado con la mayor seguridad posible, la finalidad de ese trabajo fue analizar las

Ablação curativa da fibrilação atrial: comparação entre sedação profunda e anestesia geral Curative ablation of atrial fibrillation: comparison between deep sedation and general anesthesia

Directory of Open Access Journals (Sweden)

Elizabeth Bessadas Penna Firme

2012-12-01

Full Text Available OBJETIVO: Comparar sedação profunda com anestesia geral para ablação curativa de fibrilação atrial. MÉTODOS: Estudo prospectivo, aleatório, com 32 pacientes, idades entre 18 e 65 anos, ASA 2 e 3, IMC d" 30kg/m², distribuídos em dois grupos: sedação profunda (G1 e anestesia geral (G2. Todos receberam midazolan (0,5mg/kg venoso. O G1 recebeu propofol (1mg/kg e máscara facial de O2, seguido da infusão contínua de propofol (25-50mg/kg/min e remifentanil (0,01-0,05µg/kg/min. O G2 recebeu propofol (2mg/kg e máscara laríngea com tubo de drenagem, seguido da infusão contínua de propofol (60-100mg/kg/min e remifentanil (0,06-0,1µg/kg/min. Foram comparados: frequência cardíaca, pressão arterial invasiva, complicações, recidiva (desfecho em três meses e gasometrias. RESULTADOS: Os pacientes do G1 apresentaram gasometrias arteriais com níveis de PaCO2 maiores e pH menores (p=0,001 e maior incidência de tosse. Ocorreu diminuição da PAM e FC no G2. Exceto a tosse, as complicações e recidivas foram semelhantes em ambos os grupos. CONCLUSÃO: Ambas as técnicas podem ser utilizadas para a ablação curativa da fibrilação atrial. A anestesia geral proporcionou menores alterações respiratórias e maior imobilidade do paciente.OBJECTIVE: To compare deep sedation with general anesthesia for curative ablation of atrial fibrillation. METHODS: We conducted a prospective, randomized study with 32 patients, aged between 18 and 65 years, ASA 2 and 3, BMI d" 30kg/m2, divided into two groups: deep sedation (G1 and general anesthesia (G2. All patients received intravenous midazolam (0.5 mg / kg. G1 received propofol (1mg/kg and O2 by facemask, followed by continuous infusion of propofol (25-50mg/kg/min and remifentanil (0.01-0.05 mg / kg / min. G2 received propofol (2mg/kg and laryngeal mask with built-in drain tube, followed by continuous infusion of propofol (60-100mg/kg/min and remifentanil (0.06 to 0.1g/kg/min. We compared heart rate

UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

Directory of Open Access Journals (Sweden)

Nomin Batnyam

2012-01-01

Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

Emprego do propofol, isofluorano e morfina para a anestesia geral de longa duração em bezerros

Directory of Open Access Journals (Sweden)

Alves G.E.S.

2003-01-01

Full Text Available Foram estudadas características da bioquímica do sangue, da pressão arterial e da freqüência de pulso de 12 bezerros mantidos sob anestesia por 13 horas, utilizando-se propofol para a indução e isofluorano para manutenção, associados à administração de morfina intra-tecal. Os valores de freqüência de pulso, pressão arterial e glicemia apresentaram pequenas variações e se mantiveram próximos dos valores de referência para bezerros anestesiados. Ao longo do período de anestesia houve aumento significativo, mas discreto, do hematócrito, hemoglobina, pCO2, CO2 total, bicarbonato e potássio. O pH do sangue, pO2, Na+ e Ca++ apresentaram reduções significativas. Este protocolo anestésico foi seguro para a manutenção de bezerros anestesiados por período prolongado.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Anestesia para cesariana em gestante com hipoplasia de aorta distal: relato de caso Anestesia para cesárea en embarazada con hipoplasia de aorta distal: relato de caso Anesthesia for cesarean section on a pregnant woman with hypoplasia of the distal aorta: case report

Directory of Open Access Journals (Sweden)

Leonardo de Andrade Reis

2008-02-01

ésico adequado à realização do ato cirúrgico.JUSTIFICATIVA Y OBJETIVOS: Anomalías vasculares maternas, potencialmente graves para el feto, pueden colocar en riesgo la perfusión uterina, suscitando cuidados mucho más puntuales por parte del equipo anestésico. El objetivo de este relato fue mostrar la conducta anestésica para operación en cesárea en una embarazada con hipoplasia de aorta distal, bien debajo de la emergencia de las arterias renales, con estenosis de la arteria renal y falta de arterias ilíacas. RELATO DEL CASO: Paciente de 30 años, 54 kg, en el 2° embarazo con una cesárea anterior sin intercurrencias. Durante la realización de ecografía de gestación en la 12ª semana se observó una interrupción de la aorta bien debajo de la salida de las arterias renales. A la paciente se le realizó cineangiocoronariografía que mostró hipoplasia de la aorta distal por debajo de las arterias renales, con ausencia de las arterias ilíacas. Durante la investigación clínica la paciente se mostró asintomática, con excepción de hipertensión arterial y claudicación a los grandes esfuerzos. La paciente fue sometida a la anestesia peridural continua, con titulación de la dosis anestésica necesaria para la realización de la cesárea. Inicialmente se inyectaron 50 mg de bupivacaína a 0,5% sin vasoconstrictor y 10 µg de sufentanil. Quince minutos después, la anestesia fue complementada con 25 mg más de bupivacaína a 0,5%, lo que fue suficiente para alcanzar un adecuado nivel de bloqueo. La cesárea transcurrió sin intercurrencias y el niño nació en buenas condiciones clínicas. CONCLUSIONES: El uso de anestesia peridural continua con dosis fraccionadas demostró ser una técnica anestésica segura para la realización de este procedimiento por reducir los riesgos de hipotensión arterial materna inherente al bloqueo espinal y también por minimizar la transferencia placentaria de fármacos que ocurren cuando se usa la anestesia general. La titulaci

Paresia transitória unilateral combinada do nervo hipoglosso e do nervo lingual após intubação para anestesia

Directory of Open Access Journals (Sweden)

Hulya Ulusoy

2014-04-01

Full Text Available Lesões de nervos podem ocorrer na região faringolaríngea durante a anestesia geral. Os nervos mais comumente lesionados são o hipoglosso, lingual e laríngeo recorrente. As lesões podem surgir em decorrência de vários fatores, como, por exemplo, durante a laringoscopia, intubação endotraqueal e inserção de tubo e por pressão do balão, ventilação com máscara, manobra aérea tripla, via aérea orofaríngea, modo de inserção do tubo, posição da cabeça e do pescoço e aspiração. As lesões nervosas nessa região podem acometer um único nervo isolado ou causar a paralisia de dois nervos em conjunto, como a do nervo laríngeo recorrente e hipoglosso (síndrome de Tapia. No entanto, a lesão combinada dos nervos lingual e hipoglosso após intubação para anestesia é uma condição muito mais rara. O risco dessa lesão pode ser reduzido por meio de medidas preventivas. Descrevemos um caso de paresia unilateral combinada dos nervos hipoglosso e lingual após intubação para anestesia.

Anestesia em paciente portadora de síndrome de Mckusick-Kaufman: relato de caso Anestesia en paciente portadora de síndrome de Mckusick-Kaufman: relato de caso Anesthesia in Mckusick-Kaufman syndrome patient: case report

Directory of Open Access Journals (Sweden)

Adriano Bechara de Souza Hobaika

2004-12-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A síndrome de Mckusick-Kaufman é uma doença rara, caracterizada tipicamente por hidrometrocolpos, polidactilia e defeitos cardíacos congênitos. Pacientes portadores desta doença podem ser submetidos a diversos procedimentos cirúrgicos durante a sua vida e o anestesiologista deve estar preparado para possíveis alterações. O objetivo deste artigo é relatar a conduta anestésica adotada em uma paciente portadora desta síndrome. RELATO DO CASO: Paciente do sexo feminino de 11 anos, 37 kg, portadora da síndrome de Mckusick-Kaufman, insuficiência renal crônica, encefalopatia hipertensiva e asma grave submetida à retirada de cateter peritoneal infectado e confecção de fístula arteriovenosa. História pregressa de intubação prolongada. A anestesia foi induzida com alfentanil (1 mg, propofol (50 mg e atracúrio (25 mg e mantida com sevoflurano (2% a 4% e doses fracionadas de alfentanil. A traquéia foi intubada sem complicações e a extubação foi realizada na sala de cirurgia após o retorno satisfatório da função neuromuscular. CONCLUSÕES: Apesar de a síndrome de Mckusick-Kaufman tratar-se de uma associação variável de defeitos congênitos, alguns cuidados anestésicos comuns podem ser definidos. Este caso apresentou fatores complicadores da anestesia e a indução com propofol e alfentanil e a manutenção com sevoflurano proporcionaram à paciente uma anestesia com mínimas repercussões ventilatórias e hemodinâmicas.JUSTIFICATIVA Y OBJETIVOS: La síndrome de Mckusick-kaufman es una dolencia rara, caracterizada típicamente por hidrometrocolpos, polidactilia y defectos cardiacos congénitos. Pacientes portadores de esta enfermedad pueden ser sometidos a varios procedimientos cirúrgicos durante su vida y el anestesiologista debe estar preparado para posibles alteraciones. El objetivo de este artículo es relatar la conducta anestésica adoptada en una paciente portadora de este s

Herniorrafia inguinal em crianças: valor da anestesia local associada Inguinal hernia repair in children: importance of local anesthesia association

Directory of Open Access Journals (Sweden)

José Guilherme Minossi

2002-07-01

Full Text Available OBJETIVO: Descrever uma técnica de anestesia local no tratamento de hérnias inguinais em crianças. MÉTODO: Foram operadas 48 crianças com hérnias inguinais sob anestesia local na Santa Casa de Misericórdia de Cerqueira César, SP, sendo 34 do sexo masculino e 14 do sexo feminino, com idades entre 3 meses e 12 anos. Apenas quatro crianças tinham hérnia bilateral. A anestesia local foi realizada com lidocaína a 1% na dose de 5 mg/kg de peso através do bloqueio dos nervos abdominogenitais próximos à espinha ilíaca ântero-superior, à altura do anel inguinal externo e na pele ao redor da incisão. A sedação foi feita com cetamina na dose de 1 a 2 mg/kg e diazepam 0,2 a 0,4 mg/kg de peso. RESULTADOS: Todas as cirurgias puderam ser realizadas com tranqüilidade com este método, com exceção de uma criança em que o bloqueio não foi efetivo e a anestesia complementada com inalação de halogenado, sob máscara. Como complicações pós-operatórias, ocorreram três hematomas, sendo um de parede e dois em bolsa escrotal, todos com boa evolução. CONCLUSÕES: O uso da anestesia local associada à sedação é procedimento simples e seguro para realizar herniorrafias inguinais em crianças.AIM: To describe an anesthetic technique, as well as the results of surgical treatment of the inguinal hernia in children. PATIENTS/METHODS: Forty-eight patients were submitted to inguinal hernia repair under local anesthesia at "Santa Casa de Misericórdia de Cerqueira César", State of São Paulo, Brazil. There were 34 male and 14 female patients, range from 3 months to 12 years old. Local anesthesia was performed with a dose of 5 mg/kg body weight of 1% lidocaine through iliohypogastric and ilioinguinal nerve blocks, medially to the anterior superior iliac spine, and at level of the pubic tubercle. Sedation was done with an association of ketamine (1 to 2 mg/kg and diazepam (0,2 to 0,4 mg/kg. RESULTS: In all patients except one the procedure was

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

Anestesia em paciente com síndrome de Rubinstein-Taybi: relato de caso

OpenAIRE

Oliveira, Carlos Rogério Degrandi; Elias, Luciana

2005-01-01

JUSTIFICATIVA E OBJETIVOS: A síndrome de Rubinstein-Taybi (SRT) é uma doença genética causada por uma mutação ou apagamento do cromossomo 16, caracterizada por retardo físico e mental, anormalidades craniofaciais e hálux e polegares largos. Há pouca informação sobre esta síndrome na literatura anestésica. O objetivo deste relato foi apresentar a conduta anestésica em paciente submetido à cirurgia odontológica e discutir as características de interesse para a anestesia nesses pacientes. RELATO...

Insuficiência respiratória aguda durante anestesia pediátrica: atelectasia e pneumotórax hipertensivo: relato de caso

Directory of Open Access Journals (Sweden)

Joel Massari Rezende

2012-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A tarefa primordial do anestesiologista é garantir a adequada oxigenação do paciente. O objetivo deste relato é des crever o diagnóstico e conduta em um caso de insuficiência respiratória aguda durante anestesia, com finalidade didática. RELATO DO CASO: Criança de três anos submetida à anestesia para cirurgia urológica apresentou insuficiência respiratória por obstruções de brônquios por secreção, evoluindo com atelectasia e pneumotórax hipertensivo. Apresentamos o desenrolar do caso, e os meios de tratamento aplicado, com destaque para a urgência e técnica da drenagem no pneumotórax hipertensivo. CONCLUSÕES: A atenção do anestesiologista para o diagnóstico precoce de complicações respiratórias e o conhecimento das medidas prioritárias em cada momento pode evitar efeitos adversos graves

Anestesia em paciente com síndrome de Marshall-Smith: relato de caso Anestesia en paciente con síndrome de Marshall-Smith: relato de caso Anesthesia in a patient with Marshall-Smith syndrome: case report

Directory of Open Access Journals (Sweden)

Beatriz Lemos da Silva Mandim

2007-08-01

éreas para identificação de obstrução alta e baixa. Durante a anestesia, a ventilação espontânea deve ser mantida durante a indução até que seja possível o controle das vias aéreas evitando a utilização de bloqueadores neuromusculares.JUSTIFICATIVA Y OBJETIVO: El síndrome Marshall-Smith es una enfermedad rara, caracterizada por deformidad facial, acelerada madurez ósea, atraso en el desarrollo neuro psicomotor y anormalidad de las vías aéreas. Los pacientes con este síndrome presentan una gran probabilidad de complicaciones anestésicas, principalmente con relación al manejo de las vías aéreas. Existen pocos datos en la literatura anestésica a respecto de este síndrome. El objetivo de este relato fue presentar las dificultades y la conducta anestésica en un niño de 28 días, portador de este síndrome, sometido a cirugía para la corrección de atresia de coanas bajo anestesia general. RELATO DEL CASO: Niño del sexo masculino, 28 días de vida, 2,8 kg, sometido a anestesia general para la corrección quirúrgica de atresia de coanas. Presentaba las características típicas del síndrome Marshall-Smith como tórax estrecho, pectus escavatum, manos y pies grandes, cuello largo, deformidad facial, palato alto y estrecho y una acelerada madurez ósea. La inducción anestésica fue por inhalación bajo máscara con O2 a 100% asociado al sevoflurano. Debido a la posibilidad de intubación difícil, fue programada intubación traqueal con fibrobroncoscopio. Después de intubación traqueal y ventilación asistida manual, fue administrado 1,5 mg de rocuronio y, pasados diez minutos, el paciente presentó bradicardia (80 lpm e hipoxia acentuada (30% de saturación de O2 e imposibilidad de ventilación manual a través del tubo traqueal, siendo necesaria la realización de traqueotomía de urgencia cuando se optó por suspender el procedimiento quirúrgico. CONCLUSIÓN: En casos de emergencia anestésico-quirúrgica donde el niño no ventila y no es posible

Citocinas e anestesia

Directory of Open Access Journals (Sweden)

João Batista Santos Garcia

2002-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Vários trabalhos têm abordado as citocinas que podem ser estimuladas e liberadas por lesão cirúrgica, trauma, infecção, inflamação e câncer. Níveis elevados circulantes das citocinas parece ter implicações no aparecimento de complicações e retardo da recuperação pós-operatória de pacientes. O objetivo da presente revisão é resumir as informações hoje disponíveis sobre citocinas. CONTEÚDO: As citocinas são moléculas polipeptídicas produzidas por uma grande variedade de células e parecem não ter função na homeostase, sob condições normais. Esses mediadores são responsáveis por respostas locais ou sistêmicas, gerando alterações imunológicas, metabólicas, hemodinâmicas, endócrinas e neurais. Podem ativar respostas biológicas benéficas, como estimulação da função antimicrobiana, cicatrização de feridas, mieloestimulação e mobilização de substratos. No entanto, a secreção abundante de citocinas está associada a efeitos deletérios como hipotensão arterial, falência de órgãos e morte. CONCLUSÕES: Ao concluir esta revisão, fica evidente que as citocinas desempenham um papel de fundamental importância como mediadores de respostas metabólicas, hormonais, imunológicas e hematológicas, que há potencial terapêutico com o bloqueio de sua expressão e que a anestesia pode interferir de alguma forma na sua ativação. No entanto, muitas perguntas não estão ainda respondidas e estudos devem ser realizados nos próximos anos buscando esclarecer as ações das citocinas não só para a experimentação mas também para a prática clínica.

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

Sigmund Freud (1856-1939 e Karl Köller (1857-1944 e a descoberta da anestesia local Sigmund Freud (1856-1939 y Karl Köller (1857-1944 y el Descubrimiento de la anestesia local Sigmund Freud (1856-1939 and Karl Köller (1857-1944 and the Discovery of local anesthesia

Directory of Open Access Journals (Sweden)

Almiro dos Reis Jr

2009-04-01

Full Text Available JUSTIFICATVA E OBJETIVOS: O entendimento por vezes admitido de que Sigmund Freud teve a intuição de utilizar a cocaína como anestésico local para intervenções cirúrgicas, ou mesmo de que ele tenha tido algum papel na descoberta da anestesia local não é verídico. Os objetivos das pesquisas de Freud eram outros e o verdadeiro realizador da descoberta foi Karl Köller, sobre o que há argumentos irrefutáveis. Diante desses fatos, tem importância histórica o conhecimento correto da questão. CONTEÚDO: O texto refere-se às propriedades há muito conhecidas da cocaína. Recorda dados pessoais, atividades profissionais e científicas de Sigmund Freud e de Karl Köller. Apresenta as pesquisas de Freud sobre efeitos fisiopatológicos observados com a cocaína. Expõe as razões das duras críticas recebidas por Freud diante de conceitos por ele emitidos. Descreve a súbita, porém consciente e justificada idéia de Karl Köller de estudar cientificamente a cocaína como anestésico local em animais e seres humanos. Indica como foram realizadas as pesquisas pioneiras que culminaram com a descoberta da anestesia local por Köller e as duas exposições sobre esta, feitas em Viena. Relata a primeira intervenção cirúrgica oftalmológica sob anestesia local. Comprova a imediata difusão pelo mundo da descoberta que marcou o início da anestesia locorregional. Comenta numerosos documentos comprobatórios da prioridade de Köller na descoberta. Finalmente, menciona as numerosas homenagens recebidas por Köller em várias partes do mundo. CONCLUSÕES: A anestesia locorregional foi iniciada por Karl Köller em 1884, quando ele provou a possibilidade de praticar intervenções cirúrgicas oftalmológicas sem dor utilizando a cocaína como anestésico local. Sigmund Freud realizou muitas pesquisas sobre a cocaína, mas não participou diretamente do importantíssimo feito.JUSTIFICATIVA Y OBJETIVOS: Los que a veces se cree de que Sigmund Freud tuvo

Atitudes atuais de anestesiologistas e médicos em especialização com relação à anestesia venosa total Actitudes actuales de anestesiólogos y médicos en especialización con relación a la anestesia venosa total Current attitude of anesthesiologists and anesthesiology residents regarding total intravenous anesthesia

Directory of Open Access Journals (Sweden)

Fernando Squeff Nora

2006-08-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: No passado, tempo, custos, informações, treinamento e avaliação da profundidade da anestesia limitavam a aceitação da anestesia venosa total (TIVA. O objetivo deste estudo foi determinar atitudes de anestesiologistas e médicos em especialização com relação à anestesia venosa total. MÉTODO: Um questionário foi enviado a 150 anestesiologistas e 102 residentes. A concordância (C e discordância (D em cada item foram comparadas por testes z (consenso, se p JUSTIFICATIVA Y OBJETIVOS: Antiguamente, tiempo, costes, informaciones, capacitación y evaluación de la profundidad de la anestesia limitaban la aceptación de la anestesia venosa total (TIVA. El objetivo de este estudio fue el de determinar las actitudes de anestesiólogos y médicos en especialización con relación a la anestesia venosa total. MÉTODO: Un cuestionario fue enviado a 150 anestesiólogos y 102 residentes. La concordancia (C y discordancia (D en cada ítem se compararon por pruebas z (consenso, si p BACKGROUND AND OBJECTIVES: In the past, time, cost, information, training, and the evaluation of the plane of anesthesia limited the acceptance of total intravenous anesthesia (TIVA. The objective of this study was to determine the attitude of anesthesiologists and other anesthesiology residents regarding total intravenous anesthesia. METHODS: A questionnaire was sent to 150 anesthesiologists and 102 residents. The concordance (C and disaccord (D of each item were compared by z tests (consensus if p < 0.05. RESULTS: There were 98 responses. The data represent the number of answers for each category. The majority of the participants agreed that the quality of the awakening stimulates the use of the TIVA (C/D = 86/8; p < 0.05; that the future depends on the development of drugs with a fast onset of action and immediate recovery (C/D = 88/5; p < 0.05; that they would like to use TIVA more often (C/D = 72/21; p < 0.05; and to have more information

Anestesia para obesidade mórbida Anestesia para obesidad mórbida Anesthesia for morbid obesity

Directory of Open Access Journals (Sweden)

Michelle Nacur Lorentz

2007-04-01

, mientras que en los EUA ya llegó a tener un carácter epidémico. El paciente obeso presenta una serie de alteraciones fisiopatológicas, además de importantes comorbidades lo que exige del anestesiólogo un pleno conocimiento de la fisiopatología de la enfermedad. El procedimiento quirúrgico de reducción gástrica ha sido cada vez más realizado y el período perioperatorio presenta características únicas con alteraciones cardiovascular y pulmonar que lo convierten en un verdadero desafío para los profesionales involucrados. El hospital también debe estar preparado para recibir a esos pacientes con equipos adecuados, un equipo multidisciplinario y cuidados postoperatorios adecuados. El objetivo de este estudio fue demostrar que el paciente obeso mórbido no es solamente un paciente con exceso de peso, y por tanto se buscó guiar las principales conductas a ser observadas. CONTENIDO: En este artículo presentamos las principales alteraciones fisiopatológicas del obeso mórbido, como también datos epidemiológicos y enfermedades correlativas. Se realiza una revisión de las dosis de los medicamentos usados en la anestesia, como también el mejor de los abordajes pre, intra y postoperatorio por partes del anestesiólogo. CONCLUSIONES: El abordaje del paciente con obesidad mórbida exige una planificación minuciosa que se inicia en la selección de los pacientes, tiene una continuidad con el preoperatorio detallado y intraoperatorio individualizado, y se extiende hasta el postoperatorio, cuando la incidencia de complicaciones pulmonar, cardiovascular e infecciosa es mayor que en la población no obesa. Para que los resultados sean favorables es extremadamente importante la involucración de un equipo multiprofesional que incluye Clínica General, Anestesiología, Cirugía General, Enfermería, Psicología, Fisioterapia, Nutrología y Terapia Intensiva.BACKGROUND AND OBJECTIVES: Morbid obesity is very frequent in our society, having achieved the level of an

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Analgesia de parto: estudo comparativo entre anestesia combinada raquiperidural versus anestesia peridural contínua Analgesia de parto: estudio comparativo entre anestesia combinada raqui-peridural versus anestesia peridural continua Labor analgesia: a comparative study between combined spinal-epidural anesthesia versus continuous epidural anesthesia

Directory of Open Access Journals (Sweden)

Carlos Alberto de Figueiredo Côrtes

2007-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: O alívio da dor no trabalho de parto tem recebido atenção constante visando ao bem-estar materno, diminuindo o estresse causado pela dor e reduzindo as conseqüências deste sobre o concepto. Inúmeras técnicas podem ser utilizadas para analgesia de parto. Este trabalho teve como objetivo comparar a técnica peridural contínua com a combinada, ambas com o uso de bupivacaína a 0,25% em excesso enantiomérico 50% e fentanil como agentes. MÉTODO: Participaram do estudo 40 parturientes em trabalho de parto com dilatação cervical entre 4 e 5 cm que foram distribuídas em dois grupos iguais de forma aleatória. O Grupo I recebeu anestesia peridural contínua. O Grupo II recebeu anestesia combinada. Foram avaliados: medidas antropométricas, idade gestacional, dilatação cervical, tempo entre o bloqueio e a ausência de dor por meio da escala analógica visual, possibilidade de deambulação, tempo entre o início da analgesia e a dilatação cervical completa, duração do período expulsivo, parâmetros hemodinâmicos maternos e vitalidade do recém-nascido. Possíveis complicações, como depressão respiratória, hipotensão arterial materna, prurido, náuseas e vômitos, também foram observadas. Para a comparação das médias utilizou-se o teste t de Student e para a paridade e tipo de parto utilizou-se o teste do Qui-quadrado. RESULTADOS: Não houve diferença estatística significativa entre os dois grupos em relação ao tempo entre o início da analgesia e a dilatação cervical completa, bem como em relação ao tempo da duração do período expulsivo, incidência de cesariana relacionada com a analgesia, parâmetros hemodinâmicos maternos e vitalidade do recém-nascido. CONCLUSÕES: Ambas as técnicas se mostraram eficazes e seguras para a analgesia do trabalho de parto, embora a técnica combinada tenha proporcionado um rápido e imediato alívio da dor. Estudos clínicos com maior número de casos s

Efeitos cardiovasculares da anestesia local com vasoconstritor durante exodontia em coronariopatas Cardiovascular effects of local anesthesia with vasoconstrictor during dental extraction in coronary patients

Directory of Open Access Journals (Sweden)

Valeria C. L. S. Conrado

2007-05-01

Full Text Available OBJETIVO: Avaliar a ocorrência de variáveis detectoras de isquemia miocárdica, durante ou após o tratamento odontológico, sob anestesia com vasoconstritor (adrenalina. MÉTODOS: Foram incluídos 54 pacientes coronariopatas submetidos a exodontia sob anestesia local com ou sem vasoconstritor, divididos em dois grupos (sorteio por envelope: grupo I, composto por 27 que receberam anestésico com vasoconstritor; e grupo II, composto por 27 que receberam anestésico sem vasoconstritor. Todos os pacientes foram submetidos a monitoração eletrocardiográfica com Holter por 24 horas, a Doppler-ecocardiografia realizada antes e após intervenção odontológica, e a dosagem dos marcadores bioquímicos antes e 24 horas após a exodontia (creatina cinase fração MB [CK-MB] massa, CK-MB atividade e troponina T. A freqüência cardíaca e a pressão arterial nas fases pré-anestesia, pós-anestesia e pós-exodontia também foram aferidas. A Doppler-ecocardiografia teve como objetivo avaliar a contratilidade segmentar do ventrículo esquerdo e a eventual ocorrência de insuficiência mitral. Em todos os casos foi mantido o protocolo farmacológico habitual prescrito pelo cardiologista. RESULTADOS: Três pacientes do grupo I apresentaram depressão do segmento ST (1,0 mm durante a aplicação da anestesia, dois outros pacientes do mesmo grupo tiveram elevação da CK-MB massa, e em nenhum caso foi verificada presença de isquemia avaliada pelos demais métodos. Não houve registro, neste estudo, de precordialgia, arritmias e ocorrência ou agravamento de hipocontratilidade segmentar do ventrículo esquerdo ou insuficiência mitral. CONCLUSÃO: A exodontia praticada sob uso de anestesia com adrenalina 1:100.000 não implica riscos isquêmicos adicionais quando realizada com boa técnica anestésica e manutenção do tratamento farmacológico prescrito pelo cardiologista.OBJECTIVE: To evaluate the occurrence of variables detecting myocardial ischemia

Toracoscopia diagnóstica com anestesia local: metodologia e aplicações

Directory of Open Access Journals (Sweden)

Luís Rocha

1998-01-01

Full Text Available RESUMO: A toracoscopia assume cada vez mais um papel importante no diagnóstico e terapêutica de muitos doentes com derrames pleurais recidivantes. É um método simples e bern tolerado, com elevado valor diagnóstico, permitindo uma intervenção mais precoce. Além do diagnóstico permite controlar derrames pleurais recidivantes e malignos, o que poderá complementarmente ter importância de ordem clínica no tratamento e melboria da qualidade de vida do doente. Apesar do número de complicações reduzido e da sua pequena importância, pensamos que se trata de uma técnica a indicar em base individual, tendo em conta o risco/beneficio. Os autores abordam a técnica e metodologia utilizada na toracoscopia, suas contra-indicações, complicações e indicações, fazendo uma revisão teórica dos resultados descritos na literatura e realçando a modalidade anestésica que utilizam: a anestesia local com ajuda de pré-medicação. SUMMARY: Diagnostic thoracoscopy and sometimes therapeutic, assumes an important role in the etiology and symptoms relief of many patients with recurrent pleural effusions. It's a simple and well tolerable method, with high diagnostic yield, that contributes to an earlier intervention. It can control malignant and recurrent pleural effusions, which will have an important role in the treatment and quality of the patient's life. In spite of the number of complications being small and of lack of importance, we think that the use of thoracoscopy is to be decided in an Individual basis, weighting risks and benefits. The authors summarise the technique and methodology, their contraindications, complications and indications, reviewing some published results, emphasising the anaesthesia method and some information supporting local anaesthesia with pré-medication. Key-Words: Thoracoscopy, Local anaesthesia, Pleural effusion, Pleurodesis, Talc poudrage, Palavras-chave: Toracoscopia, Anestesia local, Derrame pleural, Pleurodese

Efeitos hemodinâmicos da anestesia em plano profundo com infusão intravenosa contínua de propofol ou propofol associado à lidocaína em cães

Directory of Open Access Journals (Sweden)

Rodrigo Mannarino

2014-02-01

Full Text Available Os efeitos hemodinâmicos da anestesia total intravenosa com propofol ou propofol associado à lidocaína foram estudados em 12 cães. No grupo P (n=6, os animais receberam bolus de 6mg kg-1 de propofol e infusão contínua de 1,25mg kg-1 min-1. No grupo PL (n=6, os animais receberam bolus de 6mg kg-1 de propofol e 1,5mg kg-1 de lidocaína, seguido de infusão de 1,0mg kg-1 min-1 e 0,25mg kg-1 min-1, dos mesmos fármacos, respectivamente. Os animais foram instrumentados para mensuração das variáveis hemodinâmicas e do índice bispectral (BIS, aos 75, 90, 105 e 120 minutos de anestesia. Foram observados valores menores de índice cardíaco, índice sistólico, pressões arteriais sistólica, diastólica e média no grupo P do que no grupo PL (P<0,05. Não foram observadas diferenças entre os grupos na frequência cardíaca, índice de resistência vascular sistêmica e BIS. As concentrações plasmáticas de propofol foram menores no grupo PL do que no grupo P (medianas de 5,7 a 6,1µg mL-1 no grupo P versus 3,1 a 3,7µg mL-1 no grupo PL. As concentrações plasmáticas de lidocaína (medianas de 2,27 a 2,51µg mL-1 mensuradas encontram-se na faixa que resulta em analgesia e abaixo de valores que resultam em toxicidade em cães. Os valores de BIS obtidos nos dois grupos foram compatíveis com plano profundo de anestesia (médias de 43 a 46 e 45 a 49 nos grupos P e PL, respectivamente. A manutenção da anestesia em plano profundo com lidocaína-propofol causa menor depressão cardiovascular do que a anestesia com dose equipotente de propofol isoladamente.

Caso: Infección cutánea en el punto de punción de anestesia subaracnoidea

OpenAIRE

López Pérez, Jesús; Castañer Ramón-Llín, Carla; Furones Tormo, Beatriz; Fernández Fernández, María Adoración; García Ferreira, Joaquín; Fayos de la Asunción, Miguel E

2012-01-01

Mujer de 76 años de edad, con antecedentes de asma bronquial en tratamiento con bromuro de ipatropio e hipertiroidismo tratado con carbimazol. Artrosis generalizada y gonartrosis bilateral. Propuesta para cirugía traumatológica de protesis total de rodilla derecha. Se realiza técnica locorregional mediante anestesia subaracnoidea resultando exitosa tras 4 intentos fallidos de punción, confirmando salida de LCR transparente. Se administra bupivacaina isobárica 14 mg. más 20 mcg de fentanilo...

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Anestesia em anã acondroplásica obesa mórbida para gastroplastia redutora Anestesia en enana acondroplásica obesa mórbida para gastroplastia reductora Anesthesia for bariatric surgery in an achondroplastic dwarf with morbid obesity

Directory of Open Access Journals (Sweden)

Maria Angélica Abrão

2009-02-01

forma más común entre los diversos tipos de osteocondrodisplasias causadoras del enanismo. El enano puede ser acometido de obesidad con una relativa frecuencia, y el tratamiento quirúrgico ha demostrado una mayor eficacia, tanto para la pérdida efectiva de peso como para a su mantenimiento a largo plazo. El objetivo de este trabajo fue presentar un caso de gastroplastia reductora con derivación intestinal en Y-de-Roux en enano acondroplásico obeso mórbido. Se analizaron las diversas dificultades encontradas en el manejo anestésico de este paciente y la manera a través de la cual se abordaron, objetivando la disminución de la morbi mortalidad en el intraoperatorio. RELATO DEL CASO: Paciente de 29 años, femenina, enana, con acondroplasia y obesidad mórbida desde la infancia. Sus medidas eran de 123 cm de altura y peso corporal de 144 kg, al momento de la entrada en el servicio de Cirugía Bariátrica. Con un índice de masa corporal (IMC de 95,18 kg.m-2, presentaba varias enfermedades asociadas, principalmente del sistema respiratorio y osteoarticular. Después de un largo período de acompañamiento con dieta, ejercicios físicos y apoyo psicológico, la paciente mejoró su condición clínica, siéndole intervenida con la operación propuesta: gastroplastia reductora a la Capella-Fobi. En la anestesia, hubo dificultad en la intubación traqueal con la paciente despierta y bajo laringoscopía directa, siendo necesaria utilización del broncofibroscopio. Transcurso intraoperatorio sin complicaciones, siendo mantenida bajo anestesia general venosa total con infusión continua de remifentanil y propofol. Extubada al final del procedimiento en la sala de operaciones. CONCLUSIONES: Las comorbidades simultáneas de la acondroplasia y de la obesidad mórbida pueden dificultar el manejo anestésico, principalmente con relación a las aéreas. Es necesario una evaluación preanestésica bien conducida para anticipar conductas y minimizar esos riesgos, optimizando as

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Anestesia para colecistectomia videolaparoscópica em paciente portador de Doença de Steinert: relato de caso e revisão de literatura Anestesia para colecistectomía videolaparoscópica en oaciente oortador de Enfermedad de Steinert: relato de caso y revisión de la literatura Anesthesia for videolaparoscopic cholecystectomy in a patient with Steinert Disease: case report and review of the literature

Directory of Open Access Journals (Sweden)

Flora Margarida Barra Bisinotto

2010-04-01

anestesiólogo. Los pacientes presentan una mayor sensibilidad a los fármacos anestésicos y complicaciones, principalmente cardíacas y pulmonares. Además de eso, existe la posibilidad de presentar hipertermia maligna y crisis miotónica. Se ha descrito el caso de un paciente que tuvo una complicación pulmonar importante después de haber sido sometido a la anestesia general. RELATO DEL CASO: Paciente de 39 años, portador de DM1, sometido a la anestesia general para colecistectomía videolaparoscópica. La anestesia fue venosa total con propofol y remifentanil y rocuronio. El procedimiento quirúrgico de 90 minutos no presentó intercurrencias, pero después de la extubación, el paciente presentó insuficiencia respiratoria y crisis miotónica, que hizo la intubación traqueal imposible. Se utilizó la máscara laríngea, que posibilitó la oxigenación adecuada, y la ventilación mecánica se mantuvo hasta la recuperación total de la actividad respiratoria. Evolucionó sin otras complicaciones. CONCLUSIONES: La DM1 es una enfermedad que presenta varias peculiaridades para el anestesiólogo. El conocimiento minucioso de su involucración sistémica, asociado a la acción diferenciada de los fármacos anestésicos en esos pacientes, proporcionará un acto anestésico-quirúrgico más seguro.BACKGROUND AND OBJECTIVES: Myotonic dystrophies are autosomal dominant neuromuscular diseases. Among them, myotonic dystrophy type 1 (MD1, or Steinert disease, is the most common in adults, and besides muscular involvement it also has important systemic manifestations. Myotonic dystrophy type 1 poses a challenge to the anesthesiologist. Those patients are more sensitive to anesthetics and prone to cardiac and pulmonary complications. Besides, the possibility of developing malignant hyperthermia and myotonic episodes is also present. CASE REPORT: This is a 39-year old patient with DM1 who underwent general anesthesia for videolaparoscopic cholecystectomy. Total intravenous

Falhas na anestesia subaracnóidea Fallos en la anestesia subaracnoide Failure of subarachnoid blocks

Directory of Open Access Journals (Sweden)

Hugo Praxedes

2010-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Desde Bier, é descrita falha de anestesia subaracnóidea que causa desconforto ao paciente e que ocorre, eventualmente, mesmo diante de profissionais hábeis que a tenham conduzido de forma tecnicamente correta. Há variação, no entanto, de conceito de falha e, principalmente, de identificação precisa de causas. O objetivo do trabalho é identificar melhor as causas deste desconforto por meio de revisão sistemática de publicações com casuística significativa. CONTEÚDO: Dividiu-se a análise em três tópicos: anatomia e suas variações; o agente anestésico, que trata da seleção do agente, suas soluções e adições, de forma a atingir o resultado mais apropriado à intervenção cirúrgica proposta; e a dose, discutindo-se concentração, volume ou dose gravimétrica, no sentido de obter resultado mais adequado tanto no que diz respeito à intensidade do bloqueio quanto à sua duração. CONCLUSÕES: As falhas são mais afeitas a fatores técnicos: avaliação anatômica adequada, escolha criteriosa da agulha e do local da punção, cuidados no armazenamento dos agentes, adequação de dose, baricidade, além de posicionamento correto do paciente durante e após punção, tudo adequado ao objetivo cirúrgico.JUSTIFICATIVA Y OBJETIVOS: Bier ya describía los fallos en la anestesia subaracnoidea que causa la incomodidad al paciente, y que se da, eventualmente, incluso con la presencia de profesionales hábiles que la hayan conducido de forma técnicamente correcta. Existe una variación, sin embargo, del concepto de fallo y principalmente, de la identificación precisa de las causas. El objetivo del trabajo es identificar mejor las causas de esa incomodidad a través de la revisión sistemática de publicaciones con casuística significativa. CONTENIDO: El análisis se dividió en tres tópicos: la anatomía y sus variaciones; el agente anestésico, que trata sobre la selección del agente, sus soluciones

Anestesia venosa total (AVT) em lactente com doença de Werdnig-Hoffmann: relato de caso

OpenAIRE

Resende, Marco Antonio Cardoso de; Silva, Elizabeth Vaz da; Nascimento, Osvaldo José Moreira; Gemal, Alberto Esteves; Quintanilha, Giseli; Vasconcelos, Eliana Maria

2010-01-01

JUSTIFICATIVA E OBJETIVOS: A doença de Werdnig-Hoffmann é a causa mais comum de hipotonia no lactente e quando presente logo após o nascimento tem pior prognóstico. Fraqueza muscular simétrica, arreflexia e fasciculações da língua são característicos. A maioria dos lactentes morre antes dos dois anos por insuficiência respiratória. O presente relato apresenta um caso com técnica venosa total durante anestesia. RELATO DO CASO: Paciente feminina, branca, um ano, 10 kg, estado físico ASA III, co...

Doença de Moyamoya e anestesia com sevoflurano fora do centro cirúrgico: relato de caso

OpenAIRE

Machado, Sheila Braga; Mendes, Florentino Fernandes; Angelini, Adriana de Campos

2002-01-01

JUSTIFICATIVA E OBJETIVOS: A doença de Moyamoya é uma desordem cerebrovascular progressiva que representa um desafio anestésico em virtude da precária circulação cerebral destes pacientes, constituindo-se numa importante causa de acidente vascular cerebral em indivíduos jovens. O objetivo deste relato é apresentar o caso de um paciente com doença de Moyamoya que foi submetido à anestesia geral com sevoflurano para procedimento diagnóstico fora do centro cirúrgico. RELATO DO CASO: Criança com ...

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Anestesia epidural com associação medetomidina e lidocaína, em gatos pré-medicados com acepromazina e midazolam

Directory of Open Access Journals (Sweden)

D.A.S.D. Lima

2011-04-01

Full Text Available Avaliaram-se os efeitos anestésicos promovidos pela associação medetomidina e lidocaína por via epidural, em gatos pré-tratados com acepromazina e midazolam. Foram utilizados 10 gatos adultos, machos e fêmeas, hígidos e com média de peso de 2,5±0,6kg, distribuídos em dois grupos (GM e GL de igual número (n=5. Administraram-se, como medicação pré-anestésica, acepromazina, 0,2mg/kg, e midazolam, 0,5mg/kg, via intramuscular, e 20 minutos depois, nos animais do GM, por via epidural, lidocaína, 4,4mg/kg, associada à medetomidina, 0,02mg/kg. Os gatos do GL receberam lidocaína, 4,4mg/kg, associada à solução de NaCl a 0,9%. As avaliações ocorreram antes da pré-anestesia (MPA, 20 minutos após a MPA e antes da anestesia epidural, e aos 10, 20, 30 e 40 minutos após a anestesia epidural, respectivamente, T-20, T0, T10, T20, T30 e T40. Foram avaliados: frequência cardíaca (FC e respiratória (FR, temperatura do corpo, saturação de oxiemoglobina, analgesia, miorrelaxamento e período de recuperação. No GM, a FC diminuiu em T20, T30 e T40 em relação ao T-20 e T10 e foi mais baixa que a FC do GL em T20, T30 e T40, respectivamente, 86, 91 e 88 bat/min e 194, 205 e 177 bat/min. A FR variou entre o T-20 e os outros momentos de avaliação nos animais do GL. Nas variáveis eletrocardiográficas, houve diferenças entre T20, T30 e T40 e T-20 e T0, valores de 235, 238 e 240ms e 156 e 161ms, respectivamente, somente no GM. Este grupo diferiu do GL nas avaliações em T20, T30 e T40, valores de 147, 132 e 150ms para os gatos do GL. Oitenta por cento dos gatos tiveram analgesia intensa, e em todos os animais ocorreu relaxamento da mandíbula e da língua. O tempo de recuperação foi de 40 e 15min no GM e no GL, respectivamente. Concluiu-se que a associação lidocaína com medetomidina promoveu plano anestésico estável com grau de anestesia e recuperação anestésica de boa qualidade.

Anestesia para cesariana em paciente portadora de cardiomiopatia hipertrófica familiar: relato de caso Anestesia para cesária en paciente portadora de cardiomiopatía hipertrófica familiar: relato de caso Anesthesia for cesarean section in a patient with familiar hypertrophic cardiomyopathy: case report

Directory of Open Access Journals (Sweden)

Renato Mestriner Stocche

2007-12-01

caracterizada por hipertrofia del septo ventricular y grado variable de estenosis aórtica subvalvar. En esa enfermedad, el aumento de la contratilidad del miocardio y la disminución de la resistencia vascular periférica pueden agravar la obstrucción de la vía de salida del VE, produciendo arritmia e isquemia cardiaca. Este relato quiso discutir el manoseo anestésico para cesárea en paciente con CHF. RELATO DEL CASO: Paciente con 33 semanas de embarazo y diagnóstico previo de CHF presentó en el holter de 24 horas 22 episodios de taquicardia ventricular no sustentada (TVNS y 2 episodios de taquicardia ventricular sustentada (TVS. Refería episodios de palpitación, disnea y dolor precordial de corta duración. La paciente fue medicada con atenolol y presentó control de los síntomas y de las arritmias cardiacas. Con 38 semanas y 5 días de embarazo la paciente fue sometida a la cesárea electiva. Además de la habitual monitorización contó con el análisis de segmento ST y presión arterial invasiva. Se utilizó anestesia intradural-epidural con inyección de 5 µg de sunfentanil en la raqui seguida de administración de bupivacaína a 0,375% en dosis de incremento hasta alcanzar una altura de T6 (total de 16 mL. Se usó metaraminol como vasopresor. No hubo hipotensión arterial materna u otras complicaciones en el perioperatorio. CONCLUSIONES: La anestesia general se usa con frecuencia para cesáreas de pacientes con CHF. La anestesia intradural-epidural con instalación lenta del bloqueo fue una alternativa segura. En esas pacientes, el aumento de la contratilidad miocárdica debe ser evitado, y si fuere necesario se debe utilizar un a-agonista para la corrección de hipotensión arterial materna.BACKGROUND AND OBJECTIVES: Familiar Hypertrophic cardiomyopathy (FHC is a rare hereditary cardiac disorder characterized by hypertrophy of the ventricular septum and variable degrees of subvalvular aortic stenosis. In this disease, the increase in myocardial contractility

Implementación de la lista de verificación de la seguridad de la cirugía, sugerida por la Organización Mundial de la Salud, en pacientes sometidos a intervenciones quirúrgicas con anestesia

OpenAIRE

Fierro Márquez, Cindy Lorenna

2015-01-01

Objetivo principal: Comparar la efectividad de la lista de verificación para la seguridad de la cirugía propuesta, respecto a la lista de chequeo institucional, en cuanto a la incidencia de eventos adversos asociados a una intervención anestésico-quirúrgica, en pacientes adultos sometidos a cirugía bajo anestesia general, regional o combinada. Diseño: Estudio cuasi-experimental, tipo antes/después, con grupo de control no equivalente. Hipótesis: La lista de verificación para la segurida...

Procedimentos cirúrgicos em pacientes proctológicos selecionados, sob anestesia local: estudo de 150 casos

Directory of Open Access Journals (Sweden)

HENRIQUES Alexandre Cruz

2000-01-01

Full Text Available Experiência no tratamento de 150 pacientes portadores de afecções anorretais e da região sacrococcígea operados sob anestesia local no Hospital de Ensino da Faculdade de Medicina do ABC, São Bernardo do Campo, SP, no período de março de 1995 a março de 1998. Descrevem a técnica anestésica empregada, operações realizadas e a tolerância ao procedimento. A morbidade intra-operatória foi de 10,6% (16 pacientes e a pós-operatória de 6% (9 pacientes. A idade dos pacientes variou entre 15 e 92 anos de idade, com média de 42 anos; 58% eram do sexo masculino e 42% feminino. O tempo médio de cirurgia foi de 45 minutos e o de permanência hospitalar foi de 8 horas. Todos os pacientes foram orientados sobre a técnica anestésica, suas vantagens e desvantagens, e somente após sua aprovação, a cirurgia era programada. Internação hospitalar foi necessária em cinco pacientes (3,3%. Em nenhum caso foi necessário modificar a técnica anestésica. Interrogados, 96,7% dos pacientes afirmaram não sentir dor durante a operação e que repetiriam o procedimento. Conclui-se que o tratamento cirúrgico das afecções orificiais e da região sacrococcígea com anestesia local além de viável e seguro, é bem aceito pelos pacientes.

Randomized clinical trial comparing spinal anesthesia with local anesthesia with sedation for loop colostomy closure Ensaio clínico randomizado comparando raquianestesia com anestesia local, associadas à sedação para o fechamento de colostomia em alça

Directory of Open Access Journals (Sweden)

Rone Antônio Alves de Abreu

2010-09-01

Full Text Available CONTEXT: Recent studies have shown that local anesthesia for loop colostomy closure is as safe as spinal anesthesia for this procedure. OBJECTIVES: Randomized clinical trial to compare the results from these two techniques. METHODS: Fifty patients were randomized for loop colostomy closure using spinal anesthesia (n = 25 and using local anesthesia (n = 25. Preoperatively, the bowel was evaluated by means of colonoscopy, and bowel preparation was performed with 10% oral mannitol solution and physiological saline solution for lavage through the distal colostomy orifice. All patients were given prophylactic antibiotics (cefoxitin. Pain, analgesia, reestablishment of peristaltism or peristalsis, diet reintroduction, length of hospitalization and rehospitalization were analyzed postoperatively. RESULTS: Surgery duration and local complications were greater in the spinal anesthesia group. Conversion to general anesthesia occurred only with spinal anesthesia. There was no difference in intraoperative pain between the groups, but postoperative pain, reestablishment of peristaltism or peristalsis, diet reintroduction and length of hospitalization were lower with local anesthesia. CONCLUSIONS: Local anesthesia plus sedation offers a safer and more effective method than spinal anesthesia for loop colostomy closure.CONTEXTO: Estudos recentes têm demonstrado que a anestesia local para o fechamento de colostomia em alça é tão segura quanto a raquianestesia para estes procedimentos. OBJETIVOS: Comparar os resultados do fechamento de colostomia em alça usando essas duas técnicas. MÉTODOS: Cinquenta pacientes foram randomizados para o fechamento de colostomia em alça sob raquianestesia (n = 25 e anestesia local (n = 25. No pré-operatório, o cólon foi avaliado por colonoscopia e o preparo intestinal foi realizado com solução oral de manitol a 10% e limpeza com solução salina fisiológica através do orifício distal da colostomia. Todos os

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

Anestesia regional e trombocitopenia não pré-eclâmptica; hora de repensar o nível seguro de plaquetas Anestesia regional y trombocitopenia no preclámptica; es hora de pensar de nuevo sobre el nivel seguro de plaquetas Regional anesthesia and non-preeclamptic thrombocytopenia: time to re-think the safe platelet count

Directory of Open Access Journals (Sweden)

Motoshi Tanaka

2009-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Apesar de a anestesia regional ser amplamente utilizada no controle da dor em obstetrícia, seu uso pode não ser apropriado nas pacientes com trombocitopenia por causa do risco de hematoma no neuroeixo. Não existem fortes evidências sugerindo número mínimo de plaquetas necessário para garantir a segurança na realização da anestesia regional. O objetivo deste estudo foi rever a segurança da anestesia regional em pacientes com trombocitopenia não pré-eclâmptica na instituição durante período de cinco anos. MÉTODO: Foi realizada revisão retrospectiva dos prontuários médicos de todas as pacientes obstétricas não pré-eclâmpticas cujo parto foi realizado na instituição entre abril de 2001 e março de 2006 e que apresentaram contagem de plaquetas JUSTIFICATIVA Y OBJETIVOS: A pesar de que la anestesia regional esté siendo muy utilizada en el control del dolor en obstetricia, su uso puede no ser muy apropiado en las pacientes con trombocitopenia, debido al riesgo de hematoma en el neuro eje. No existen fuertes evidencias que sugieran un número mínimo de plaquetas necesario para garantizar la seguridad en la realización de la anestesia regional. El objetivo de este estudio fue analizar la seguridad de la anestesia regional en pacientes con trombocitopenia no preeclámptica en la institución durante un período de cinco años. MÉTODO: Fue realizada revisión retrospectiva de las historias clínicas médicas de todas las pacientes obstétricas no preeclámpticas cuyo parto fue realizado en la institución entre abril de 2001 y marzo de 2006 y que presentaron BACKGROUND AND OBJECTIVES: Although regional anesthesia is widely used for pain control in obstetrics, it may not be appropriate for patients with thrombocytopenia due to the risk of neuraxial hematoma. There is no strong evidence to suggest the minimum platelet count that is necessary to ensure the safe practice of regional anesthesia. The

Doença de Moyamoya e anestesia com sevoflurano fora do centro cirúrgico: relato de caso Enfermedad de Moyamoya y anestesia con sevoflurano fuera del centro quirúrgico: relato de caso Moyamoya disease and sevoflurane anesthesia outside the surgery center: case report

OpenAIRE

Sheila Braga Machado; Florentino Fernandes Mendes; Adriana de Campos Angelini

2002-01-01

JUSTIFICATIVA E OBJETIVOS: A doença de Moyamoya é uma desordem cerebrovascular progressiva que representa um desafio anestésico em virtude da precária circulação cerebral destes pacientes, constituindo-se numa importante causa de acidente vascular cerebral em indivíduos jovens. O objetivo deste relato é apresentar o caso de um paciente com doença de Moyamoya que foi submetido à anestesia geral com sevoflurano para procedimento diagnóstico fora do centro cirúrgico. RELATO DO CASO: Criança com ...

A primer on pseudorandom generators

CERN Document Server

Goldreich, Oded

2010-01-01

A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

Influência da anestesia venosa total, entropia e laparoscopia sobre o estresse oxidativo

Directory of Open Access Journals (Sweden)

Rogean Rodrigues Nunes

2012-08-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Estudos recentes correlacionam mortalidade pós-operatória e anestésica, especialmente a profundidade anestésica e pressão arterial sistólica (PAS. O objetivo deste estudo foi avaliar os efeitos da profundidade da anestesia venosa total (AVT realizada com remifentanil e propofol com monitoração da entropia de resposta (RE sobre as concentrações sanguíneas dos marcadores do estresse oxidativo: TBARS e glutationa, durante operações pelo acesso vídeolaparoscópico. MÉTODO: Vinte pacientes adultas, ASA I, IMC 20-26 kg.m-2, idades entre 20 e 40 anos, foram aleatoriamente distribuidas em dois grupos iguais: Grupo I - submetidas a procedimento anestésico-cirúrgico com RE mantida entre 45 e 59 e Grupo II - submetidas a procedimento anestésico-cirúrgico com RE entre 30 e 44. Em ambos os grupos, a infusão de remifentanil e propofol foi controlada pelo sitio efetor (Se, ajustados para manter RE nos valores desejados (Grupos I e II e avaliando-se sempre a taxa de supressão (TS. As pacientes foram avaliadas em seis momentos: M1(imediatamente antes da indução anestésica, M2 (antes da intubação traqueal [IT], M3 (5 minutos após IT, M4 (imediatamente antes do pneumoperitônio-PPT, M5 (1 minuto após o PPT e M6 (uma hora após a operação. Em todos os momentos foram avaliados os seguintes parâmetros: PAS, PAD, FC, RE, TS, TBARS e glutationa. RESULTADOS: Observaram-se aumentos no TBARS e glutationa em M5, tanto no Grupo I como no Grupo II (p GI em M5 - p < 0,05% sugerem interferência de mais um fator (anestesia profunda, como responsável pelo aumento no MA, provavelmente como resultados de maior depressão do sistema nervoso autônomo e menor autorregulação esplâncnica.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

NARCIS (Netherlands)

Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

1994-01-01

Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

Anestesia en la operación de Fontan

Directory of Open Access Journals (Sweden)

Lincoln de la Parte Pérez

2002-12-01

Full Text Available La técnica de Fontan ofrece la primera operación fisiológica para la atresia tricuspídea (AT mediante la separación completa de las circulaciones sistémicas y pulmonar. Este proceder se basa en el principio de que la presión en la aurícula derecha es suficiente para garantizar un flujo sanguíneo adecuado a los pulmones, lo que hace innecesaria la función del ventrículo derecho. A partir de su introducción, existe una esperanza para los pacientes con un solo ventrículo y es un procedimiento cada vez más frecuente en el Servicio de Anestesia Cardiovascular. Esta realidad fue el motivo para presentar una revisión bibliográfica actualizada sobre la técnica anestésica que se debe emplear en este procedimiento quirúrgico.Fontan´s technique offers the first physiological operation for tricuspid atresia by complete separation of systemic and pulmonary circulation. This procedure is based on the principle that the right atrium pressure is enough to assure an adequate blood flow to the lungs, which makes the function of right ventricle unnecessary. After the introduction of this procedure, there is a hope for those patients with only one ventricle, therefore, this is an increasingly frequent technique applied in the cardiovascular anesthesia service. Such a reality was the main reason for presenting an updated literature review of the anesthetic technique that should be used in this surgical procedure.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

ANESTESIA EM EQÜINOS COM DETOMIDINA E TILETAMINA-ZOLAZEPAM

Directory of Open Access Journals (Sweden)

Cláudio Corrêa Natalini

1994-01-01

Full Text Available RESUMO Seis eqüinos foram anestesiados, via intravenosa, com o cloridrato de detomidina 1% (0,03mg/kg, associado à combinação tiletamina-zolazepam 5% (1mg/kg. Foram registrados o tempo para obtenção do decúbito lateral e o tempo para retorno à posição de estação. As freqüências cardíaca e respiratória, a temperatura retal, os vaiores arteriais de pH, PCO2, PO2, HCO3, excesso de bases e SATO2, foram analisados no período anterior à sedação (valor basal, durante a anestesia e ao retorno à posição de estação. Dois eqüinos foram submetidos a procedimentos cirúrgicos. O tempo médio para a obtenção do decúbito lateral foi de 53,80 ± 9,06 segundos. O período médio em decúbito lateral foi de 28,50 ± 5,05 minutos e o tempo para retorno à estação foi de 39,16 ± 4,59 minutos. A análise hemogasométrica arterial revelou a ocorrência de hipoxemia no período anestésico. As freqüências cardíaca, respiratória e temperatura retal mantiveram-se estáveis no período estudado.

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

Anestesia regional y saturación de oxígeno posoperatorio en el paciente geriátrico

Directory of Open Access Journals (Sweden)

Alfonso R León

2001-06-01

Full Text Available Numerosos estudios plantean la necesidad de suministrar oxígeno suplementario a pacientes geriátricos en el período posoperatorio (PO, después de anestesia regional como profilaxis de hipoxemia. Teniendo en cuenta lo anterior, se decidió comprobar cómo se comporta la saturación de oxígeno (STO2 en el PO en los pacientes geriátricos que se asistieron con el uso de esta técnica. Previa autorización del consejo científico se seleccionaron al azar 50 pacientes ASA I-II-II (F = 30, K = 20 intervenidos de hemiabdomen inferior y miembros inferiores. Preoperatoriamente se registraron variables demográficas, antecedentes patológicos personales (APP y (STO2. Se realizó anestesia subaracnoidea (SA o peridural (PE. En el PO se realizaron 6 mediciones de la STO2 (cada 10 min durante 1 h a la salida del salón de operaciones. Se procesaron estadísticamente los resultados (comparación de medias. Edad promedio 76 ± 6 años, anestesia PE 20, SA 30, Hb media 10,5 g/L STO2 preoperatorio 94 % ± 1,5. Mediciones en el PO 1ra. 95 % ± 1,8; 2da. 94 % ± 1,3; 3ra. 93 % ± 2,1; 4ta. 95 % ± 1,9; 5ta. 94 % ± 1,5; 6ta. 93 % ± 1,7. No se hallaron diferencias estadísticamente significativas entre estas mediciones, ni en relación con la SOT2 preoperatorias con el uso de esta técnica anestésica en la población geriátricaMany studies state the need to administer supplementary oxygen to elderly patients in the postoperative period (POP after regional anesthesia as a prophylaxis of hipoxemia. Bearing in mind the above mentioned, we decided to confirm the behaviour of oxygen saturation (O2S in the POP of these aged patients that were assisted with this technique. Having cosulted the Scientifc Council, we proceed to a random selection of 50 ASA I-II-III patients (F = 30, K = 20 that underwent an operation of inferior hemiabdomen and lower limbs. Demographic variables, personal pathologic histories (PPH and 02S were obtained before the operation

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Hipotensión arterial y variabilidad de la frecuencia cardiaca en pacientes embarazadas llevadas a cesarea bajo anestesia raquídea

OpenAIRE

Amaya Rios, Juan Carlos; Garcia Montaño, Nestor Ivan

2015-01-01

INTRODUCCION La hipotensión arterial por anestesia raquídea en embarazadas llevadas a cesárea es frecuente y deletérea para la madre y el feto, sin que a la fecha exista una herramienta clínicamente útil para predecirla. La variabilidad de la frecuencia cardiaca es una medida que estima la actividad del sistema nervioso autónomo y algunos estudio iniciales indican una posible utilidad como herramienta predictiva de hipotensión arterial en esta población. METODOLOGIA Se realizó un es...

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Anestesia para salpingectomia parcial bilateral em paciente com miocardiopatia hipertrófica idiopática: relato de um caso e revisão da literatura Anestesia para salpingectomía parcial bilateral en paciente con miocardiopatía hipertrófica idiopática: relato de un caso y revisión del literatura Anesthesia for partial bilateral salpingectomy in a patient with idiopathic hypertrophic cardiomyopathy: case report and review of the literature

Directory of Open Access Journals (Sweden)

Ana Sofia Del Castillo Sardi

2010-02-01

ón autosómica dominante que se caracteriza por hipertrofia del septum ventricular y anormalidades de la válvula mitral. RELATO DEL CASO: Paciente segundigesta, 25 años con diagnóstico de cardiomiopatía hipertrófica hace 4 años e antecedente de asma bronquial leve intermitente controlada con inhalaciones esporádicas de corticoesteroides. Presentaba soplo holosistólico IV/VI plurifocal e importante escoliosis, con los espacios intervertebrales palpables. Refirió palpitaciones esporádicas durante todo el embarazo y se encontraba medicada con 100 mg de atenolol diarios. Presentaba hemograma, creatinina y electrolitos dentro de los límites normales, ecocardiograma que reportaba cardiomiopatía hipertrófica de predominio septal con fracción de eyección sistólica del 76%. La paciente entró en labor de parto de urgencia, obteniéndose producto femenino vivo, APGAR 9/9, sin complicaciones hemodinámicas maternas ni fetales. Se programa para la realización de salpingectomía parcial bilateral. Se entrevista a la paciente, la cual nos refirió que se rehusaba a recibir anestesia general para el procedimiento. La técnica anestésica elegida fue la regional combinada. El procedimiento quirúrgico duró 20 minutos, y los cambios de presión arterial y frecuencia cardíaca fue menos del 10% que el de los valores iniciales, sin complicaciones hemodinámicas ni quirúrgicas inmediatas. CONCLUSIONES: La mortalidad absoluta materna con cardiomiopatia hipertrófica (CH es muy baja y suele estar confinada a mujeres con factores de alto riesgo. No hay evidencia que la anestesia regional aumenta el riesgo en mujeres con CH cuando se utiliza para el parto vaginal. Tanto la anestesia general como regional han sido utilizado con éxito y sin complicaciones en cesáreas de parturientas con CH.BACKGROUND AND OBJECTIVES: Hypertrophic cardiomyopathy is a rare, autosomal dominant cardiac disorder characterized by hypertrophy of the interventricular septum and mitral valve

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

Anestesia e o usuário de Ecstasy Anestesia y el usuario de Ecstasy Anesthesia and the Ecstasy user

Directory of Open Access Journals (Sweden)

Eduardo Toshiyuki Moro

2006-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Nos últimos anos o número de novos usuários de agentes ilícitos tem aumentado de forma significativa em todo o mundo. A maconha e a cocaína, além do álcool e do tabaco, têm sido os agentes citados com freqüência, porém houve um aumento significativo de usuários de outros agentes psicoestimulantes ou alucinógenos, como o Ecstasy, o GHB, o LSD e a metanfetamina, empregados com o objetivo de intensificar as experiências sociais. O objetivo do presente artigo foi discutir a apresentação clínica, os efeitos deletérios e as potenciais interações com o ato anestésico no paciente cirúrgico usuário desses agentes ilícitos. CONTEÚDO: O artigo discute os mecanismos de ação, a apresentação clínica, os efeitos deletérios e as possíveis repercussões observadas durante a anestesia no usuário de MDMA (3,4-metilenodioximetanfetamina, também conhecido como Ecstasy. CONCLUSÕES: A apresentação clínica e os efeitos deletérios provocados pelo 3,4-metilenodioximetanfetamina (Ecstasy, assim como potenciais interações com o ato anestésico devem ser do conhecimento do anestesiologista, pois em muitas situações esses usuários serão submetidos a intervenções cirúrgicas de emergência, ou mesmo eletivas.JUSTIFICATIVA Y OBJETIVOS: En los últimos años el número de nuevos usuarios de drogas ilícitas ha aumentado de forma significativa en todo el mundo. La marihuana y la cocaína, además del alcohol y del tabaco, han sido las drogas citadas frecuentemente, sin embargo, hubo un aumento significativo de usuarios de otros agentes psicoestimulantes o alucinógenos, como el Ecstasy, el GHB, el LSD y la metanfetamina, empleados con el objetivo de intensificar las experiencias sociales. El objetivo del presente artículo fue el de traer a colación la presentación clínica, los efectos destructivos y las potenciales interacciones con el acto anestésico en el paciente quirúrgico usuario de esas drogas

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Anestesia venosa total para laringectomia parcial em paciente na 28ª semana de gestação: relato de caso Anestesia venosa total para laringectomía parcial en paciente en la 28ª semana de embarazo: relato de caso Total intravenous anesthesia for partial laryngectomy in 28 weeks pregnant patient: case report

Directory of Open Access Journals (Sweden)

José Costa

2005-04-01

remifentanil proporcionou estabilidade hemodinâmica para a mãe e o feto, com um despertar precoce e suave.JUSTIFICATIVA Y OBJETIVOS: Anestesia para paciente embarazada constituye un desafío al anestesiologista en virtud de los riesgos para la madre y el feto. Son muchas las complicaciones descritas por la literatura como malformaciones fetales, alumbramiento prematuro, instabilidad hemodinámica materna y hasta muerte fetal. El objetivo de este caso es mostrar una paciente embarazada de 28 semanas, sometida a laringectomía parcial bajo anestesia general venosa total con propofol, remifentanil y cisatracúrio. RELATO DEL CASO: Paciente con 29 años, 59 kg, primigesta de 28 semanas con diagnóstico previo de carcinoma epidermóide próximo a la cuerda vocal derecha, siendo indicada laringectomía. La monitorización inicial se constituyó de presión arterial no invasiva y invasiva, cardioscopía, oxicapnografía y cardiotocografía continuada realizada por el tocólogo. Punción venosa en el miembro superior derecho y miembro superior izquierdo con catéter 16G y 18G respectivamente. Fueron administrados por vía venosa midazolan (1 mg, cefazolina (1 g, metoclopramida (10 mg y dipirona (1 g. La paciente recibió oxígeno a 100% bajo máscara por 3 minutos e inducción venosa fue hecha con el uso de propofol en infusión en la dosis escogida de 3 µg.mL-1 y remifentanil continuado (1 µg.kg-1 en bolus y 0,2 µg.kg-1.min-1 de mantenimiento. Como bloqueador neuromuscular fue administrado cisatracúrio (13mg y procedida la intubación traqueal con un tubo de 6,5mm alambrado con balonete. Fue mantenida en un plano anestésico con propofol y remifentanil en bomba además de complementaciones de cisatracúrio. El feto permaneció monitorizado continuamente con cardiotocografía realizada y analizada por el tocólogo. Después del término de la cirugía fueron apagadas las bombas infusoras de propofol y remifentanil con la paciente despertando 10 minutos después. Despertó sin

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Anestesia por isofluorano em eqüinos submetidos à infusão contínua de medetomidina ou xilazina Isoflurane anesthesia in horses during medetomidine or xilazine continuous infusion

Directory of Open Access Journals (Sweden)

Renata Gebara Sampaio Dória

2009-04-01

Full Text Available Avaliaram-se oito eqüinos sob anestesia geral inalatória com isofluorano (1CAM e infusão contínua de xilazina (0,35mg kg-1h-1 ou medetomidina (3,5µg kg-1h-1, em relação à freqüência cardíaca, ritmo cardíaco, freqüência respiratória, pressão arterial, hemogasometria arterial e temperatura, nos tempos T0 (imediatamente antes do início da infusão contínua e T10 ao T60 (intervalos de 10 minutos, após início da infusão contínua. Houve redução da freqüência cardíaca e da temperatura e elevação da pressão arterial média. A paCO2 (no GM elevou-se e a paO2 mostrou-se maior no GM que no GX. Conclui-se que a infusão contínua de doses equipotentes de xilazina e medetomidina, durante anestesia geral inalatória, com isofluorano, em eqüinos, promove alterações cardiocirculatórias, respiratórias, térmicas e hemogasométricas discretas e equivalentes.Eight horses under inhalant general anesthesia with isoflurane (1MAC and continuous infusion of xylazine (0.35mg kg-1h-1 or medetomidine (3.5µg kg-1h-1 were evaluated for heart rate and rhythm, respiratory rate, arterial blood pressure, arterial blood gas analysis and temperature immediately before the beginning of the continuous infusion (T0 and in intervals of 10 minutes after the beginning of the continuous infusion (T10 to T60. Heart rate and temperature decreased and mean arterial pressure increased. PaCO2 (in GM increased and GM showed a higher paO2 than GX. We conclude that equipotent doses of continuous infusion of medetomidine and xylazine during inhalant general anesthesia with isoflurane in horses promote slight and equivalent cardiocirculatory, respiratory, thermic and arterial blood gases changes.

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Efedrina versus fenilefrina: prevenção de hipotensão arterial durante anestesia raquídea para cesariana e efeitos sobre o feto Efedrina versus fenilefrina: prevención de hipotensión arterial durante anestesia raquidea para cesárea y efectos sobre el feto Ephedrine versus phenylephrine: prevention of hypotension during spinal block for cesarean section and effects on the fetus

Directory of Open Access Journals (Sweden)

Edno Magalhães

2009-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A hipotensão arterial durante a anestesia raquídea para cesariana deve-se ao bloqueio simpático e compressão aorto-cava pelo útero e pode ocasionar efeitos deletérios para o feto e a mãe. A efedrina e fenilefrina melhoram o retorno venoso após bloqueio simpático durante anestesia raquídea. O objetivo deste estudo foi comparar a eficácia da efedrina e da fenilefrina em prevenir e tratar a hipotensão arterial materna durante anestesia raquídea e avaliar seus efeitos colaterais e alterações fetais. MÉTODO: Sessenta pacientes, submetidas à anestesia raquídea com bupivacaína e sufentanil para cesariana, foram divididas aleatoriamente em dois grupos para receber, profilaticamente, efedrina (Grupo E, n = 30, dose = 10 mg ou fenilefrina (Grupo F, n = 30, dose = 80 µg. Hipotensão arterial (pressão arterial menor ou igual a 80% da medida basal foi tratada com bolus de vasoconstritor com 50% da dose inicial. Foram avaliados: incidência de hipotensão arterial, hipertensão arterial reativa, bradicardia e vômitos, escore de Apgar no primeiro e quinto minutos e gasometria do cordão umbilical. RESULTADOS: A dose média de efedrina foi 14,8 ± 3,8 mg e 186,7 ± 52,9 µg de fenilefrina. Os grupos foram semelhantes quanto aos parâmetros demográficos e incidência de vômitos, bradicardia e hipertensão arterial reativa. A incidência de hipotensão arterial foi de 70% no Grupo E e 93% no Grupo F (p JUSTIFICATIVA Y OBJETIVOS: La hipotensión arterial durante la anestesia raquídea para cesárea se debe al bloqueo simpático y a la compresión aortocava por el útero y puede ocasionar efectos malignos para el feto y su madre. La efedrina y fenilefrina mejoran el retorno venoso después del bloqueo simpático durante la anestesia raquídea. El objetivo de este estudio fue comparar la eficacia de la efedrina y de la fenilefrina en prevenir y tratar la hipotensión arterial materna durante la anestesia raquídea y

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Hiperpotassemia pela solução Euro-Collins na anestesia para transplante renal: relato de caso

Directory of Open Access Journals (Sweden)

Eunice Sizue Hirata

2013-10-01

Full Text Available OBJETIVOS: Descrever uma anestesia para transplante renal que se complicou com a elevação brusca de potássio, pela reperfusão do rim com solução Euro-Collins no campo operatório. Também será relatado o diagnóstico e o tratamento empregados nessa complicação. CONCLUSÃO: O uso de soluções de perfusão no campo cirúrgico requer cuidados na monitoração, como eletrocardioscopia e dosagem de potássio sérico, e disponibilidade para uso imediato de gluconato de cálcio, insulina e salbutamol. A substituição da solução Euro-Collins por soro fisiológico imediatamente antes do implante pode ser uma opção útil em pacientes com níveis de potássio sabidamente elevados.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Anestesia venosa total com infusão alvo-controlada de remifentanil e propofol para ablação de fibrilação atrial Anestesia venosa total con infusión objeto-controlada de remifentanil y propofol para ablación de la fibrilación atrial Total intravenous anesthesia with target-controlled infusion of remifetanil and propofol for ablation of atrial fibrillation

Directory of Open Access Journals (Sweden)

Fernando Squeff Nora

2009-12-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A ablação de fibrilação atrial (FA é um procedimento novo em nosso meio, embora seja comum em outros centros. A escolha da anestesia, monitores e cuidados anestesiológicos para esse procedimento, realizado fora do bloco cirúrgico, não tem sido descrita. O objetivo deste relato foi descrever uma técnica de anestesia para a realização de ablação de FA. RELATO DO CASO: Paciente feminina, 49 anos, 73 kg, 155 cm, ASA II por hipertensão arterial sistêmica. A monitorização constou de eletrocardiograma com 12 derivações, oximetria de pulso, frequência cardíaca, eletroencefalografia bispectral para medidas de BIS, taxa de supressão (SR e SEF95 e pressão arterial média (PAM. A indução anestésica foi realizada com propofol por via venosa, em infusão alvo-controlada (IAC, com alvo regulado em 4 µg.mL-1, remifentanil por via venosa, em IAC, com alvo de 3 ng.mL¹, e rocurônio por via venosa em bolus na dose de 0,2 mg.kg-1. O modelo farmacocinético de propofol utilizado foi o descrito por Marsh e incorporado à bomba de propofol PFS®. O modelo farmacocinético de remifentanil utilizado foi o descrito por Minto e incorporado à bomba de infusão Alaris PK®. As concentrações, no local efetor ou biofase, corresponderam às informações obtidas através das bombas de infusão e representaram medidas preditivas das concentrações de ambos os fármacos nos respectivos locais de ação. As concentrações de propofol e de remifentanil foram reguladas de acordo com o BIS e a PAM, respectivamente. CONCLUSÕES: A anestesia venosa total para ablação de FA pode ser uma opção segura, levando-se em conta que não há alteração da eletrofisiologia das vias acessórias. A literatura é escassa a este respeito e novas publicações poderão ou não justificar esta modalidade de anestesia durante ablação de FA.JUSTIFICATIVA Y OBJETIVOS: La ablación de fibrilación atrial (FA es un procedimiento nuevo en

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Anestesia para el tratamiento intraparto extraútero (EXIT) en fetos con diagnóstico prenatal de malformaciones cervical y oral: relato de casos

OpenAIRE

Helfer, Daniel Corrêa [UNIFESP; Clivatti, Jefferson [UNIFESP; Yamashita, Américo Massafuni [UNIFESP; Moron, Antonio Fernandes [UNIFESP

2012-01-01

JUSTIFICATIVA E OBJETIVOS: O feto com diagnóstico pré-natal de massa cervical, ou qualquer outra doença que obstrua as vias aéreas, não deve ser abordado de forma convencional por apresentar dois desafios ao médico assistente logo após o parto: o tempo limitado para se estabelecer o acesso a vias aéreas potencialmente difíceis e a ausência de anestesia do neonato caso seja necessária instrumentação das vias aéreas. O procedimento EXIT (ex utero intrapartum treatment - EXIT procedure) consiste...

Alterações eletroneurofisiológicas em anestesia com sevoflurano: estudo comparativo entre pacientes saudáveis e pacientes com paralisia cerebral Alteraciones eletroneurofisiológicas en anestesia con sevoflurano: estudio comparativo entre pacientes saludables y pacientes con parálisis cerebral Electroneourophysiological changes in anesthesia with sevoflurane: comparative study between healthy and cerebral palsy patients

Directory of Open Access Journals (Sweden)

Sérgio Silva de Mello

2003-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Estudos avaliando a farmacodinâmica de drogas anestésicas em Paralisia Cerebral (PC são escassos. O objetivo deste estudo foi comparar a resposta eletroneurofisiológica de pacientes normais e com PC à anestesia com sevoflurano, utilizando o EEG bispectral (BIS e potencial evocado somatossensitivo de curta latência (PESS como técnica de monitorização do grau de profundidade anestésica. MÉTODO: Foram selecionados 24 pacientes de 3 a 18 anos, candidatos a cirurgias na Rede Sarah de Hospitais do Aparelho Locomotor, divididos em 2 grupos: 1. PC - 12 crianças com PC tipo espástica; 2. Controle (C - 12 crianças sem doença do SNC. A anestesia foi realizada com sevoflurano associado a N2O a 60% em ventilação assistida. As variáveis BIS e ondas N9, N13, N19 e P/N 22 do PESS - latência e amplitude - foram avaliadas nas frações expiradas de sevoflurano (FEsev de 1,2 e 2,5% (0,5 e 1 CAM. Foram monitorizadas a temperatura e a P ET CO2. Para análise foram utilizadas média e desvio-padrão para o BIS, e média da variação percentual dos valores de latência e amplitude das ondas do PESS, nas duas concentrações do anestésico. RESULTADOS: Não houve diferença de sexo, idade, peso e temperatura entre os grupos. Sob efeito da anestesia, os valores de BIS foram mais reduzidos no grupo PC, sendo a diferença entre os grupos estatisticamente significante com a FEsev 2,5% (30,3 x 37,5; p JUSTIFICATIVA Y OBJETIVOS: Estudios evaluando la farmacodinámica de drogas anestésicas en Parálisis Cerebral (PC son escasos. El objetivo de este estudio fue comparar la respuesta eletroneurofisiológica de pacientes normales y con PC a la anestesia con sevoflurano, utilizando el EEG bispectral (BIS y potencial evocado somatosensitivo de corta latencia (PESS como técnica de monitorización del grado de profundidad anestésica. MÉTODO: Fueron seleccionados 24 pacientes de 3 a 18 años, candidatos a cirugías en la Red Sarah de

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

El estrabismo en el niño y anestesia Strabismus in the child and anesthesia

Directory of Open Access Journals (Sweden)

Joaquín L. de la Lastra Rodríguez

2001-06-01

Full Text Available Se analiza el manejo anestésico de 41 niños tratados por estrabismo con anestesia general, administrada a 37 de ellos por vía endotraqueal para la corrección quirúrgica y a los 4 restantes por vía intravenosa para la inyección de toxina botulínica (TBX tipo A en microdosis intraocular. Se destacan aspectos importantes de interés anestesiológico como son las implicaciones clínicas que pudieran resultar del manejo anestésico, los cuidados especiales que requieren estos pacientes, la importancia de la evaluación preoperatoria que considere aspectos de interés especial y propios, etc. No hubo complicaciones transoperatorias. El vómito fue la complicación posoperatoria vista en 6 pacientes y sólo 1 sometido a tratamiento quirúrgico requirió además del mantenimiento de una hidratación intravenosa con la administración de una dosis de dimenhidrinato, antihistamínico de fuerte acción antiemética. Se presenta el manejo anestésico para la inyección intraocular de microdosis de TBX tipo A realizada con buenos resultados con Atropina, Diazepán y Clorhidrato de Ketamina por vía intravenosa.The anesthetic management of 41 children with strabismus treated with general anesthesia is analyzed. 37 of them were administered intratracheal anesthesia for surgical correction and the other 4 intravenous anesthesia for the injection of an intraocular microdose of botulinum toxin A (TBX. Important aspects of anesthesiologic interest as the clinical implications that may result from the anesthetic management, the special care required by these patients, the importance of the preoperative evaluation that takes into account aspects of special interest, of the authors' interest and others, are stressed . There were no transoperative complications. Vomiting was the postoperative complication observed in 6 patients and only one of those who underwent surgery required besides the maintenance of an intravenous hydration the administration of a dose

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Anestesia por isofluorano em eqüinos submetidos à infusão contínua de medetomidina ou xilazina

OpenAIRE

Dória,Renata Gebara Sampaio; Valadão,Carlos Augusto Araújo; Canola,Paulo Aléscio; Guirro,Érica Cristina Bueno do Prado; Mendes,Marina Ceccato; Escobar,André; Ribeiro,Gesiane; Natalini,Cláudio Côrrea

2009-01-01

Avaliaram-se oito eqüinos sob anestesia geral inalatória com isofluorano (1CAM) e infusão contínua de xilazina (0,35mg kg-1h-1) ou medetomidina (3,5µg kg-1h-1), em relação à freqüência cardíaca, ritmo cardíaco, freqüência respiratória, pressão arterial, hemogasometria arterial e temperatura, nos tempos T0 (imediatamente antes do início da infusão contínua) e T10 ao T60 (intervalos de 10 minutos, após início da infusão contínua). Houve redução da freqüência cardíaca e da temperatura e el...

Espondilodiscitis secundaria a anestesia peridural Spondilodiscitis secondary to peridural anesthesia

Directory of Open Access Journals (Sweden)

Yvei González Orlandi

2010-12-01

Full Text Available Se presenta el caso de un paciente con espondilodiscitis secundaria al uso de anestesia peridural lumbar para la resección transuretral de una hiperplasia fibroadenomatosa de la próstata. El cuadro clínico estuvo determinado por lumbalgia aguda con incremento progresivo que llevó al confinamiento en cama del paciente. En el examen físico del sistema osteomioarticular predominó la contractura paravertebral lumbar, así como en la palpación de esta región. En el examen neurológico no se encontraron alteraciones. La tomografía axial computarizada multicorte, así como la gammagrafía ósea de columna lumbar, confirmaron el diagnóstico. Se indicó tratamiento médico basado en los síntomas, antibioticoterapia combinada y ortesis externa. La recuperación total del paciente ocurrió a los 6 meses del inicio de la enfermedad.This is the case of a patient presenting with spondilodiscitis secondary to use of lumbar peridural anesthesia for transurethral resection of a prostatic fibroadenoma hyperplasia The clinical picture was determined by a acute lumbar pain with a progressive increase leading to put to bed the patient. In physical examination of osteomyoarticular system there was predominance of lumbar paravertebral contracture, as well as in palpation of this region. In neurological examination there weren't alterations. The multi-scan computed axial tomography and the spine column bone scintigraphy confirmed the diagnosis. Medical treatment was prescribed based on symptoms, combined antibiotic drug therapy and external orthesis. The total recovery of patient occurred at 6 months from the onset of disease.

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Anestesia en el tronco arterioso común

Directory of Open Access Journals (Sweden)

Lincoln de la Parte Pérez

2003-04-01

Full Text Available El tronco arterioso es una anomalía congénita del corazón poco frecuente, que se asocia con una alta mortalidad. El 50 % de los pacientes fallece antes de los 3 meses de edad y el 80 % antes del año. La causa más frecuente de muerte es el fallo cardíaco agudo. Presentamos una experiencia en 2 lactantes operados en el Cardiocentro del Hospital Pediátrico Universitario "William Soler", durante el año 2001: una niña de 7 meses de edad, desnutrida, con un tronco común tipo II, hipertensión pulmonar y síndrome de DiGeorge, el segundo paciente era un lactante de 3 meses de edad, con un tronco común tipo I. Se utilizó fentanyl en la inducción y el mantenimiento de la anestesia. La temperatura recta se bajó a 25 °C y los tiempos de circulación extracorpórea fueron de 100 y 121 min y el de pinzamiento aórtico de 30 y 31 min. Se utilizó apoyo farmacológico con dobutrex en dosis bajas. Se emplearon fentanyl, vasodilatadores en infusión continua e hiperventilación, como medidas para evitar la crisis de hipertensión pulmonar. Los enfermos evolucionaron satisfactoriamente durante todo el transoperatorio.The truncus arteriosus is a rare congenital abnormality that is associated with high mortality. 50 % of the patients died before being 3 months old and 80 % before the first year. The most frequent cause of death is acute heart failure. The cases of 3 infants operated on at the Heart Center of William Soler Pediatric Teaching Hospital during 2001 are presented: a seven-old month malnourished girl with a type II common truncus, pulmonary hypertension and DiGiorgio's syndrome, and a 3-month-old female infant with type I common truncus. Fentanyl was used in the induction and maintenance of anesthesia. The straight temperature was lowered to 25 °C, whereas the times of extracorporeal circulation were 100 and 121 min and those of the aortic clamping were 30 and 31 min. Low doses of dobutrex were administered as pharmacological support

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

DEFF Research Database (Denmark)

Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

2015-01-01

the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Anestesia en la operación de Blalock-Taussig

Directory of Open Access Journals (Sweden)

Lincoln de la Parte Pérez

2001-09-01

Full Text Available A pesar de los avances en la última década de las técnicas quirúrgicas para la reparación total de los defectos congénitos cianóticos del corazón, aún algunos pacientes necesitan procedimientos quirúrgicos paliativos durante los primeros meses de vida. Se presenta un estudio retrospectivo de 160 pacientes operados con la técnica paliativa de Blalock-Taussig, en el Cardiocentro del Hospital Pediátrico Universitario "William Soler", en el período de 1990 a 1993. Padecían de Tetralogía de Fallot 120 pacientes, 35 de atresia pulmonar y el resto 5, de transposición de los grandes vasos. El fentanyl fue el agente más utilizado en la inducción y mantenimiento de la anestesia y aportó gran estabilidad hemodinámica. Las complicaciones transoperatorias más frecuentes fueron las arritmias cardíacas (25 pacientes, 15,6 % y dentro de éstas, la mayoría extrasístoles ventriculares (18 pacientes. No hubo fallecidos durante el transoperatorio.In spite of the advances achieved by the surgical techniques for the total repair of congenital cyanotic heart defects in the last decade, some patients still need palliative surgical procedures during the first months of life. A retrospective study of 160 patients that were operated on by using Blalock-Taussig palliative technique at the Heart Center of "William Soler" Pediatric Teaching Hospital, from 1990 to 1993, was conducted. 120 patients suffered from Tetralogy of Fallot, 35 from pulmonary atresia, and the other 5 from transposition of great vessels. Fentanyl was the most used agent in the induction and maintenance of anesthesia and it produced a high hemodynamic stability. The most common transoperative complications were cardiac arrhytmias (25 patients, 15.6 % and, within them, the most were ventricular extrasystoles (18 patients. There were no deaths during the transoperative.

Relato de caso: anestesia em paciente portador de distrofia torácica asfixiante: Síndrome de Jeune

Directory of Open Access Journals (Sweden)

Deise Saletti

2012-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Síndrome de Jeune, ou Distrofia Torácica Asfixiante, é uma doença autossômica recessiva. Esta síndrome é caracterizada por uma displasia óssea com variadas anormalidades: torácica, pancreática, cardíaca, hepática, renal e da retina. A idade em que o quadro clínico dos pacientes se apresenta está correlacionada com a gravidade da doença. Esses pacientes apresentam policondrodistrofia com costelas largas, curtas, horizontais e junções costocondrais irregulares levando a uma caixa torácica rígida e reduzida com grau de injúria respiratória variado. RELATO DO CASO: Paciente do sexo masculino, 4 meses, 7 kg, portador de Distrofia Torácica Asfixiante. Apresentava-se intubado e com caixa torácica reduzida. Ecocardiograma: hipertensão pulmonar leve. Tomografia de tórax: hipoplasia pulmonar. Submetido à toracoplastia bilateral e toracotomia sob anestesia geral. Manutenção da anestesia: infusão contínua de sufentanil e sevoflurano. Parâmetros ventilatórios: ventilação mecânica ciclada à pressão. Com a abertura do tórax, houve melhora dos parâmetros ventilatórios e, após o posicionamento da prótese torácica, observou-se limitação ventilatória. Decidiu-se pela diminuição da prótese torácica com consequente melhora da ventilação. CONCLUSÕES: É imprescindível o diagnóstico de todas as anormalidades presentes para o correto manejo anestésico. Foi necessária observação para adequar ventilação pré- e pós-toracotomia/toracoplastia e para manter o paciente hemodinamicamente estável. A forma mais adequada para ventilação mecânica é a ciclada à pressão para vencer a barreira mecânica. No intraoperatório, é desejável manter o pico de pressão inspiratória o mais baixo possível para minimizar o risco de barotrauma, de impedimento do retorno venoso e diminuição do débito cardíaco.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

Science.gov (United States)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

Directory of Open Access Journals (Sweden)

Stephen Larson

2014-03-01

Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

Science.gov (United States)

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

2010-01-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Temperatura, Oximetría Cerebral y Disfunción Cognitiva Postoperatoria (DCPO) en pacientes intervenidos de Prótesis Total de Rodilla (PTR) con anestesia intradural. Estudio prospectivo

OpenAIRE

Salazar Garcia, Fátima

2015-01-01

Introducción: La Disfunción cognitiva postoperatoria (DCPO) tiene una alta incidencia en pacientes de cirugía ortopédica. Durante la anestesia y la cirugía se produce un descenso progresivo de la temperatura. Esta hipotermia tiene efectos deletéreos pero también puede tener un efecto protector cerebral. Nosotros planteamos la hipótesis que la temperatura perioperatoria puede tener un impacto sobre la aparición de DCPO. Por otro lado, la monitorización de la saturación regional cerebral de...

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Química general II

OpenAIRE

Olba Torrent, Amparo

2018-01-01

El document forma part dels materials docents programats mitjançant l'ajut del Servei de Política Lingüística de la Universitat de València Temes de l'assignatura: Química general II del primer curs del Grau de Química Topics of the course: General Chemistry II in the first year of the Degree in Chemistry

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

Topografia do cone medular da irara (Eira barbara e sua relevância em anestesias epidurais

Directory of Open Access Journals (Sweden)

Érika Branco

2013-06-01

Full Text Available Encontrada principalmente na América do Sul, a irara é um carnívoro pertencente à família Mustelidae, a qual pouco se tem informações sobre sua morfologia de forma geral. Diante disso, objetivou-se conhecer melhor parte do sistema nervoso desta espécie, mais precisamente a topografia do cone medular, a fim de subsidiar intervenções anestésicas peridurais nesta, uma vez que a clínica de animais selvagens vem crescendo a cada dia. Foram estudados três exemplares machos, adultos, provenientes da área de Mina Bauxita, Paragominas, doados ao Laboratório de Pesquisa Morfológica Animal (LaPMA, Universidade Federal Rural da Amazônia (UFRA, Belém, os quais foram radiografados e dissecados ao nível lombossacral, seguido de exposição do cone medular. Este, por sua vez, situou-se entre L4-L6 possuindo comprimento médio de 4,31cm, o que nos levou a sugerir a região sacrococcígea como ponde ideal para prática de anestesias epidurais nesta espécie.

Anestesia em paciente portadora de doença de moyamoya: relato de caso Anestesia en paciente portadora de enfermedad de moyamoya: relato de caso Anesthesia in patient with moyamoya disease: case report

Directory of Open Access Journals (Sweden)

Adriano Bechara de Souza Hobaika

2005-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A doença de moyamoya é uma vasculopatia cerebral progressiva rara, mais freqüentemente diagnosticada em populações asiáticas, mas que também vem sendo identificada no Brasil. Durante a sua vida, pacientes portadores desta doença podem ser submetidos aos mais variados tipos de procedimentos cirúrgicos. O anestesiologista deve entender a fisiopatologia da doença e instituir as medidas peri-operatórias mais adequadas, no intuito de melhorar o prognóstico destes pacientes. RELATO DO CASO: Paciente do sexo feminino, 22 anos, com insuficiência renal crônica, portadora da doença de moyamoya, submetida à intervenção cirúrgica para instalação de fístula arteriovenosa. A anestesia foi induzida com fentanil, propofol e atracúrio e mantida com sevoflurano. Durante o procedimento, a paciente foi mantida em normocapnia e normotermia. A extubação foi realizada e a paciente transferida à sala de recuperação pós-anestésica sem complicações. CONCLUSÕES: Este artigo apresenta os cuidados anestésicos dispensados a uma paciente portadora da doença de moyamoya.JUSTIFICATIVA Y OBJETIVOS: La enfermedad de moyamoya es una vasculopatia cerebral progresiva rara, más frecuentemente diagnosticada en individuos asiáticos, y que también viene siendo identificada en Brasil. Durante su vida, pacientes portadores de esta enfermedad pueden ser sometidos a los más variados tipos de procedimientos quirúrgicos. El anestesiologista debe entender la fisiopatología de la enfermedad e instituir las medidas peri-operatorias más adecuadas, en el designio de mejorar el pronóstico de estos enfermos. RELATO DEL CASO: Paciente del sexo femenino, 22 años, insuficiencia renal crónica, portadora de la enfermedad de moyamoya, sometida a intervención quirúrgica para la instalación de fístula arteriovenosa. La anestesia fue inducida con fentanil, propofol y atracúrio y mantenida con sevoflurano. Durante el procedimiento

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

Science.gov (United States)

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

2010-03-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

Dexmedetomidina associada a propofol em sedação durante anestesia local para cirurgia plástica Dexmedetomidina asociada a propofol en sedación durante anestesia local para cirugía plástica Dexmedetomidine/propofol association for plastic surgery sedation during local anesthesia

Directory of Open Access Journals (Sweden)

José Roberto Nociti

2003-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A dexmedetomidina é um novo agonista alfa2-adrenérgico com propriedades potencialmente úteis em anestesia. Este estudo comparativo tem por finalidade observar os efeitos da dexmedetomidina sobre o consumo de propofol e a evolução dos parâmetros cardiovasculares e respiratórios, quando incluída em técnica de sedação durante anestesia local em cirurgia plástica. MÉTODO: Participaram do estudo 40 pacientes do sexo feminino com idades entre 16 e 60 anos, estado físico ASA I ou II, submetidas a cirurgias plásticas eletivas sob anestesia local. Foram distribuídas aleatoriamente em dois grupos de vinte: C (controle e D (dexmedetomidina. Em ambos, a sedação foi obtida com propofol na dose em bolus inicial de 1 mg.kg-1 seguida de infusão contínua em velocidade ajustada para se obter grau de sedação consciente. No grupo D, as pacientes receberam infusão venosa contínua de dexmedetomidina à velocidade de 0,01 µg.kg-1.min-1, concomitante com a de propofol. Foram avaliados: efeito da dexmedetomidina sobre o consumo de propofol; variação dos parâmetros cardiovasculares (PAS, PAD, PAM, FC e respiratórios (SpO2, P ET CO2; qualidade do controle do sangramento per-operatório e características da recuperação pós-anestésica. RESULTADOS: A velocidade média de infusão de propofol foi menor no grupo D (35,2 ± 5,3 µg.kg-1.min-1 do que no grupo C (72,6 ± 8,5 µg.kg-1.min-1. Os valores médios de PAS, PAD e PAM decresceram em relação ao inicial, a partir dos 30 minutos, no grupo D, mantendo-se a seguir estáveis até o final; no grupo C, aumentaram. A FC manteve-se estável no grupo D e aumentou a partir dos 30 minutos no grupo C. O tempo médio para obedecer ao comando de "abrir os olhos" foi menor no grupo D (6,3 ± 2,5 min em relação ao C (8,9 ± 2,7 min. O controle do sangramento per-operatório foi superior no grupo D em relação ao C. CONCLUSÕES: O emprego da dexmedetomidina associada ao

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Dilemas bioéticos na prática da anestesia

Directory of Open Access Journals (Sweden)

José Abelardo Garcia de Meneses

2001-10-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: As relações da sociedade humana com o universo e a aplicação de novos conceitos éticos estudados por filósofos, fundamentalmente para acompanhar a evolução das ciências biomédicas, originaram a Bioética. O objetivo é tratar dos avanços nas relações humanas entre médicos e pacientes, propostos pelos princípios bioéticos em adição aos tradicionais princípios hipocráticos, aqui discutidos no particular da prática desta ciência fascinante a Anestesiologia. O presente trabalho visa estimular e aprofundar as discussões bioéticas na área da Anestesiologia. CONTEÚDO: São discutidos os limites entre o ato médico benevolente e não-maleficente, indissociavelmente comprometido com o bem-estar do paciente, os benefícios da conduta médica paternalista, visando à preservação da saúde e da vida, e do outro lado, o respeito à autonomia do cidadão-doente, potencial paciente, e o seu direito ao consentimento livre, renovável, revogável e plenamente esclarecido para quaisquer atos médicos. CONCLUSÕES: Com base no quanto é apresentado no presente trabalho o anestesiologista deve sempre decidir beneficentemente em defesa da saúde do indivíduo e da sacralidade da vida, entendendo os limites entre a autonomia do paciente e o direito do médico aplicar tratamento arbitrário à revelia da vontade daquele, em obediência aos princípios da beneficência e da não-maleficência, disponibilizando os benefícios da ciência médica (justiça em favor da vida, posto que, em anestesia muitas vezes, há um limite incompreensivelmente tênue entre vida e morte.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

Anestesia para correção cirúrgica de fístula de artéria coronária sem circulação extracorpórea: relato de caso

Directory of Open Access Journals (Sweden)

Raquel Reis Soares

2011-12-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Descrita em 1865 por Krause ¹, a fístula de artéria coronária comunicando-se com cavidades cardíacas, artéria pulmonar ou seio coronário é muito rara. Representa 0,2% a 0,4 % das cardiopatias congênitas e 0,1% a 0,2% da população adulta submetida a angiografias coronarianas ². O objetivo deste relato é apresentar anestesia para cirurgia de fechamento de fístula coronária em procedimento eletivo, considerando suas particularidades. RELATO DE CASO: Paciente do sexo masculino com 59 anos, cuja fístula coronária foi diagnosticada durante investigação clínica de dor torácica progressiva e dispneia de longa data. O paciente foi submetido a uma correção cirúrgica de fístula de artéria coronária sob anestesia geral sem a utilização de circulação extracorpórea (CEC.O paciente evoluiu sem intercorrências, tendo alta hospitalar com melhora clínica em sete dias de pós-operatório. CONCLUSÕES: A fístula coronária é afecção rara, mas o anestesiologista pode deparar com esse tipo de paciente em situações distintas. É importante compreender sua fisiopatologia para abordar adequadamente o paciente no perioperatório, favorecendo seu melhor prognóstico.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

Science.gov (United States)

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Hematoma subdural intracraniano pós-anestesia subaracnóidea: relato de dois casos e revisão de 33 casos da literatura

Directory of Open Access Journals (Sweden)

Jane Auxiliadora Amorim

2010-12-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Hematoma subdural intracraniano é uma complicação rara pós-anestesia subaracnóidea. Relatamos dois casos de mulheres que desenvolveram hematoma subdural crônico pós-anestesia subaracnóidea, diagnosticados após a evolução clínica prolongada de cefaleia pós-punção dural (CPPD e analisamos outros 33 casos encontrados em revisão da literatura. RELATO DOS CASOS: Nos 35 pacientes (idade entre 20-88 anos, 19 homens, 14 tinham mais de 60 anos (40% sendo 12 (86% homens. A relação se inverte no grupo de pacientes mais jovens (< 60 anos, no qual há duas vezes mais mulheres (14:7. Dois picos de maior incidência foram observados: 30-39 anos (31% e 60-69 anos (29%. O período de tempo decorrido entre o início dos sintomas até o diagnóstico variou entre 4 horas e 29 semanas. Cefaleia foi referida por 26/35 (74,3% casos; alteração do nível de consciência em 14/35 (40,0%; vômitos em 11/35 (31,4%; hemiplegia ou hemiparesia em 8/35 (22,9%; diplopia ou paresia do VI nervo craniano em 5/35 (14,3%; e distúrbio da linguagem em 4/35 (11,4%. Os fatores contribuintes foram: gravidez, múltiplas punções, uso de anticoagulantes, anormalidades vasculares intracranianas e atrofia cerebral. Em 15 casos, não foi citado qualquer fator contribuinte. Quatro em 35 pacientes (11,4% ficaram com sequelas neurológicas e 4/35 (11,4% morreram. CONCLUSÕES: A presença de qualquer um desses sinais ou sintomas mencionados serve de alerta para a possibilidade de ocorrer hematoma subdural intracraniano como complicação da punção dural, principalmente naqueles pacientes que apresentaram CPPD por mais de uma semana, quando uma investigação por neuroimagem se faz necessária.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Relativistic Astrophysics and Cosmology: A Primer

International Nuclear Information System (INIS)

Abramowicz, Marek A

2007-01-01

'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

Anestesia para cesariana em paciente com síndrome de Guillain-Barré: relato de caso

Directory of Open Access Journals (Sweden)

Daniel Volquind

2013-08-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A Síndrome de Guillain-Barré durante a gestação é considerada uma CIRURGIA, Cesárea; complicação neurológica rara e o manejo anestésico para a cesariana nessas pacientes ainda não é consenso na literatura. O objetivo deste artigo é relatar o caso de uma paciente gestante portadora da Síndrome de Guillain-Barré submetida à cesariana. RELATO DO CASO: Paciente feminina, 22 anos, com 35 semanas e cinco dias de idade gestacional, da celularidade. A técnica anestésica empregada foi a anestesia geral, induzida com propofol 1,5 mg.kg-1 e mantida com sevofiurano 2% em oxigênio e fentanil 3 µg.kg-1. O procedimento transcorreu sem complicações, tanto para a gestante quanto para o concepto. A paciente obteve alta no décimo dia de internação, após melhora progressiva do quadro neurológico. CONCLUSÕES: A técnica anestésica a ser empregada em gestantes portadoras da Síndrome de Guillain-Barré que necessitam fazer cesariana permanece como escolha do anestesiologista, que deve ser guiado pelo quadro clínico e pelas comorbidades de cada paciente.

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

NEUROCIENCIA Y ANESTESIA

OpenAIRE

Antonello Penna S., Dr., MD, PhD; Rodrigo Gutiérrez R., Dr., MD PhD(c)

2017-01-01

RESUMEN: Uno de los focos principales de la neurociencia es entender las funciones cerebrales superiores y cómo estas son inhibidas de manera reversible por los anestésicos generales. Por ello, la comprensión del mecanismo de acción de estos fármacos, que rutinariamente se utilizan en la práctica clínica, ha permitido avanzar enormemente en entender cómo se integra la información a nivel cerebral para establecer las nuevas memorias, la capacidad de reaccionar al medio externo y las bases de l...

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

Science.gov (United States)

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Cirugía de catarata con anestesia tópica en pacientes con condiciones especiales Results of catact surgery with topical anesthesia in patients with special conditions

Directory of Open Access Journals (Sweden)

Henry Pérez González

2012-06-01

Full Text Available Objetivo: Determinar los resultados de la cirugía de catarata por técnica de Blumenthal con anestesia tópica en pacientes con condiciones especiales en el Centro Oftalmológico "José Martí", Uruguay. Métodos: Se realizó un estudio descriptivo, longitudinal prospectivo. El universo estuvo constituido por 99 pacientes con necesidad de cirugía de catarata, evaluados en la unidad de rehabilitación básica funcional durante el año 2010, la muestra por 67 pacientes mayores de 18 años portadores de alguna "condición especial" sometidos a cirugía con uso de anestesia tópica, previa evaluación y entrenamiento. Resultados: Los principales motivos de derivación a la unidad fueron los trastornos auditivos (44,78 % y las crisis nerviosas (25,37 %. El 44,78 % de los pacientes presentó una edad mayor a los 79 años, 53,74 % eran hombres y prevaleció la catarata senil (85,07 %. La única complicación intraoperatoria fue la rotura de cápsula posterior (1,49 % y el edema corneal transitorio en el posoperatorio, observado en un 7,46 %. El 77,61 % alcanzó una buena agudeza visual posterior a la cirugía. Conclusiones: Los resultados de la cirugía de catarata con uso de anestesia tópica en pacientes con condiciones especiales fueron satisfactorios. Se observó una notable mejoría de la agudeza visual con un mínimo de complicaciones.Objective: To determine the results of cataract surgery with Blumenthal technique and topical anesthesia in patients with special conditions in “José Martí” Ophthalmological Center in Uruguay during 2010. Methods: A prospective, longitudinal and descriptive was carried out. The universe of study was 99 patients needing cataract surgery after being evaluated by the Basic Functional Rehabilitation Unit during 2010. The sample was 67 patients over 18 years-old carrying a “special condition”, who underwent cataract surgery with topical anesthesia, after evaluation and training. Results: The main reasons for

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

Anestesia subaracnóidea para cesariana em paciente portadora de esclerose múltipla: relato de caso Anestesia subaracnoidea para cesárea en paciente portadora de esclerosis múltiple: relato de caso Subarachnoid anesthesia for cesarean section in a patient with multiple sclerosis: case report

Directory of Open Access Journals (Sweden)

Fabiano Timbó Barbosa

2007-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A esclerose múltipla é uma doença adquirida que se caracteriza por áreas desmielinizadas no encéfalo e na medula espinal. O quadro clínico depende das áreas anatômicas acometidas. As principais causas de morte são infecção, falência respiratória e estado de mal epiléptico. Ocorre em pacientes geneticamente predispostos após contato com fatores ambientais, principalmente os vírus. O objetivo desse relato foi apresentar a técnica anestésica adotada em paciente com esclerose múltipla submetida à cesariana. RELATO DO CASO: Paciente com 32 anos, 60 kg, portadora de esclerose múltipla, tratada com metilprednisolona, deu entrada no centro obstétrico para realização de cesariana. Após monitoração foi realizada anestesia subaracnóidea com bupivacaína a 0,5% hiperbárica (12,5 mg associada à morfina (0,1 mg. O procedimento evoluiu sem intercorrências e a paciente recebeu alta hospitalar 48 horas após o parto sem piora dos sintomas preexistentes. CONCLUSÕES: O presente caso sugere que a raquianestesia pode ser administrada em paciente portador de esclerose múltipla sem a ocorrência obrigatória de exacerbações agudas dos sintomas no período pós-operatório.JUSTIFICATIVA Y OBJETIVOS: La esclerosis múltiple es una enfermedad adquirida que se caracteriza por áreas desmielinizadas en el encéfalo y en la médula espinal. El cuadro clínico depende de las áreas anatómicas acometidas. Las principales causas de muerte son infección, falencia respiratoria y estado de mal epiléptico. Ocurre en pacientes genéticamente predispuestos después del contacto con factores ambientales, principalmente los virus. El objetivo de este relato fue presentar la técnica anestésica adoptada en paciente con esclerosis múltiple sometida a cesárea. RELATO DEL CASO: Paciente con 32 anos, 60 kg, portadora de esclerosis múltiple, tratada con metilprednisolona, entró en el centro obstétrico para realizaci

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Epidural anesthesia using a 0,75% ropivacaine and subarachnoid anesthesia with a 0,5% bupivacaine associated or not with clonidine in hemorroidectomies Anestesia peridural com ropivacaína a 0,75% e anestesia subaracnóidea com bupivacaína a 0,5% associadas ou não à clonidina em hemorroidectomias

Directory of Open Access Journals (Sweden)

João Florêncio de Abreu Baptista

2008-12-01

24 horas foram anotados. RESULTADOS: A intensidade da dor, 8 horas após a cirurgia, foi menor no grupo 4, e significantemente menor no grupo 4 em relação aos grupos 1 e 2, 12 horas (p=0,022; p=0,001 e 24 horas (p=0,03; p=0,003. A freqüência do uso de vasoconstritores no transoperatório e de analgésicos no pós-operatório não diferiu entre os grupos. Não houve complicações anestésicas. CONCLUSÕES: A anestesia subaracnóidea com bupivacaína a 0,5%, com clonidina, apresentou melhor analgesia que a anestesia peridural com ropivacaína a 0,75% com ou sem clonidina, porém todas foram seguras e eficazes. A clonidina contribuiu para diminuir a dor na anestesia subracnóidea.

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Anestesia epidural com ropivacaína, lidocaína ou associação de lidocaína e xilazina em cães: efeitos cardiorrespiratório e analgésico Epidural anaesthesia using ropivacaine, lidocaine or the combination of lidocaine and xylazine in dogs: cardiorespiratory and analgesic effects

Directory of Open Access Journals (Sweden)

Simone Salata Gasparini

2007-04-01

Full Text Available Este estudo investigou o efeito da ropivacaína, da lidocaína e da associação de lidocaína e xilazina na anestesia epidural de cães. Trinta cães foram tranqüilizados com acepromazina intravenosa, distribuídos em três grupos e submetidos à anestesia epidural no espaço lombo-sacro, com lidocaína 2% com vasoconstrictor (GL, ropivacaína 1% (GR ou com xilazina associada à lidocaína (GXL. Mensuraram-se as freqüências cardíaca (FC e respiratória (f, a pressão arterial sistólica (PAS, a concentração final expirada de CO2 (EtCO2, o volume minuto (VM e a temperatura retal (T. Para avaliação da analgesia somática, utilizou-se o teste do panículo e o teste térmico a 55°C. Os protocolos produziram anestesia da região retro-umbilical, sendo que a associação XL produziu bloqueio anestésico mais cranial, porém causou bradicardia moderada. A duração da anestesia foi mais prolongada nos animais dos grupos GXL (240 min e GR (250 min, quando comparada as do grupo GL (120 min.This study was aimed at investigating the effects of ropivacaine, lidocaine or lidocaine combined with xylazine for epidural anaesthesia in dogs. Thirty dogs were sedated with acepromazine IV, divided in to three groups and submitted to lumbosacral epidural anaesthesia using 2% lidocaine with adrenaline (L or 1% ropivacaine (R or xylazine combined with lidocaine (XL. Heart and respiratory rates, systolic arterial blood pressure, EtCO2, minute volume and temperature were measured. Cutaneous anaesthesia was investigated using a forceps and thermic stimulus. All protocols produced retroumbilical anaesthesia. The combination of XL produced a more cranial anaesthetic block, with moderate bradycardia. The duration of the anaesthesia was more prolonged in animals treated with XL (240min and R (250min, when compared to L alone (120min.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Desarrollo de un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de educación general básica

OpenAIRE

Chaglla Cholota, Kléber Fabián

2016-01-01

1. Introducción. --2. Plantemiento de la Propuesta de Trabajo. --3. Marco Teórico. --4. Metodología. --5. Resultados. --6. Conclusiones y Recomendaciones. El presente proyecto de investigación propone desarrollar un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de Educación General Básica en la Unidad Educativa Intercultural Bilingüe “Huayna Capac”. Con el uso de este sitio web los docentes podrán generar material e...

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Anestesia subtenoniana en cirugía de estrabismo Sub-Tenon's anesthesia in strabismus surgery

Directory of Open Access Journals (Sweden)

Rosa M. Naranjo Fernández

2004-12-01

Full Text Available Se realizó un estudio descriptivo, retrospectivo de 30 pacientes con el diagnóstico de estrabismo que acudieron al Servicio de Oftalmología Pediátrica y Estrabismo del Hospital Oftalmológico Docente "Ramón Pando Ferrer" y fueron operados con la técnica de anestesia subtenoniana desde abril de 2003 hasta mayo de 2004; se analizaron las variables: edad, entidad diagnostica y grado de dolor. Se encontró que el rango de edad que predominó fue de 20 a 39 años, la esotropía como el diagnóstico más frecuente, el grado de dolor fue significativo en la tracción muscular y la técnica anestésica subtenoniana resultó efectiva independientemente de la técnica quirúrgica aplicada, sin complicaciones y con buena analgesia.A descriptive and retrospective study of 30 patients with the diagnosis of strabismus that were operated on at the Service of Pediatric Ophthalmology and Strabismus of "Ramón Pando Ferrer" Ophthalmological Hospital by the technique of sub-Tenon's anesthesia from April 2003 to May 2004 was conducted.The following variables were analyzed: age, diagnostic entity and pain degree. It was found a predominance of the age range 20-39. Esotropia was the most frequent diagnosis. The pain degree was significant in the muscular traction and the sub-Tenon's anesthetic technique proved to be effective independently of the surgical technique applied, without complications and with good analgesia.

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

Directory of Open Access Journals (Sweden)

Orzuza, Gloria Beatriz

2013-01-01

Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

Cirugía ambulatoria en el Servicio de Cirugía General Oncológica Ambulatory surgery in the General Oncology Surgery Service

Directory of Open Access Journals (Sweden)

Maria Cristina Infante Carbonell

2006-12-01

Full Text Available Se hizo un estudio descriptivo, transversal y retrospectivo que incluyó a los pacientes que podían tratarse mediante cirugía mayor ambulatoria y de corta estadía hospitalaria, con el fin de determinar los beneficios de este método, nunca antes aplicados en nuestra provincia en este tipo de institución de salud. Predominaron las afecciones ginecológicas, entre ellas la conización de cuello uterino. Utilizamos anestesia local, espinal general endovenosa, general endotraqueal y combinada (acupuntura e hipnosis. Las enfermedades asociadas no constituyeron limitaciones en la muestra que escogimos y se encontró un mínimo de complicaciones posquirúrgicas. Las evidentes ventajas económicas (el ahorro de camas hospitalarias y la disminución del coste hospitalario, así como un elevado grado de satisfacción de los operados y sus familiares, valida la utilizaci��n de este método, ya no tan novedoso, y justifica también que se recomiende incrementar la aplicación del procedimiento y que se extienda al mayor número posible de afecciones quirúrgicas

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Guías de abordaje de problemas de conducta de los niños y niñas del Primer Año de Educación General Básica Jaime Burbano Alomía.

OpenAIRE

Dávila Tena, Hiparía Magdalena

2011-01-01

Diseñar guías de orientación metodológica para paliar los problemas de conducta que afectan a los niños /as, del Primer Año de Educación General Básica ‘’Jaime Burbano Alomía ‘’ En el presente año lectivo 2110-2011 Los problemas de conducta existentes en el entorno educativo de la ciudad de Otavalo, constituyen el motivo más elocuente para el desarrollo del presente trabajo, ello nos da la oportunidad idónea para emprender cambios sustanciales en las formas de diagnóstico para enfrenta...

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

Eletroacupuntura na anestesia com propofol em cães Electroacupuncture on propofol anaesthesia in dogs

Directory of Open Access Journals (Sweden)

Renata Navarro Cassu

2008-09-01

Full Text Available Resultados satisfatórios têm sido relatados com o emprego da eletroacupuntura (EA, como adjuvante da anestesia geral no homem e em animais. O objetivo do trabalho é avaliar a dose de indução anestésica do propofol em função do emprego da eletroacupuntura em cães. Foram utilizados 20 cães, distribuídos em dois grupos de igual número, GEA: foi realizada EA nos acupontos estômago 36 (E36, vesícula biliar 34 (VB 34 e baço-pâncreas 6 (BP 6, bilateralmente, durante 45 minutos antes da indução anestésica e GC: não foi realizada EA antes da indução anestésica. Os animais foram tranqüilizados com acepromazina intravenosa (0,05mg.kg-1 60 minutos antes da indução anestésica, realizada com propofol na taxa de 0,2ml.kg.min-1. A análise estatística foi realizada por test t não pareado(PElectro-acupuncture (EA has been used as an adjuvant of general anesthesia in men and animals. The aim of this study was to evaluate the effect of EA on propofol dose for induction of anesthesia in dogs. Twenty healthy adult crossbred dogs were used and randomly distributed in two groups (n=10 per group: GEA dogs were submitted to EA in the acupoints stomach 36, gall bladder 34 and spleen 6, bilaterally, for 45 minutes before induction of anesthesia. Dogs in the control group (GC were not treated before induction of anesthesia. Animals were sedated with 0.05mg kg-1 of acepromazine intravenously. Anesthesia was induced with intravenous propofol using a 0.2ml.kg.min-1 infusion rate 60 minutes after sedation. The statistical analysis was accomplished by the unpaired t test to compare differences between groups (P<0.05. Values are presented as mean±SD. There was no significant difference in the dose of propofol required to abolish the podal withdrawal reflex between groups (5.0±2.0mg kg-1 for the control group and 5.2±1.6mg kg-1 for the EA treated group, suggesting that EA did not potentiate propofol anesthesia in dogs.

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

DEFF Research Database (Denmark)

Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

2005-01-01

Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

Influência da técnica de anestesia no tempo de ocupação de sala cirúrgica nas operações anorretais Influence of the anesthetic technique on the time spent in operating rooms in anorectal procedures

Directory of Open Access Journals (Sweden)

Paulo Gustavo Kotze

2008-06-01

Full Text Available INTRODUÇÃO: atualmente cerca de 90% das operações anorretais são realizadas em regime ambulatorial. A técnica anestésica é fator fundamental na busca de reduzido tempo de internação, agilidade no ambiente cirúrgico e redução de custos nestes procedimentos. Não há consenso na literatura sobre qual o melhor tipo de anestesia para essas operações. OBJETIVO: comparar o tempo de ocupação de sala cirúrgica em pacientes submetidos a operações anorretais através da técnica de raquianestesia com bupivacaína 0,5% isobárica comparada com a técnica de anestesia venosa com propofol associada ao bloqueio perianal local com lidocaína a 2% e bupivacaína 0,5%. MÉTODOS: Foram incluídos 99 pacientes divididos em 2 grupos: grupo I (raquianestesia, composto por 50 pacientes e grupo II (anestesia combinada, composto por 49 pacientes. Foram estudados os procedimentos cirúrgicos e o tempo de procedimento anestésico-cirúrgico, e medida indireta da ocupação da sala cirúrgica. RESULTADOS: Não houve diferença estatística significativa entre os grupos estudados em relação ao tipo de procedimento cirúrgico, sexo e idade. O tempo médio do procedimento anestésico-cirúrgico, no grupo I foi de 53,1 min e de 44,08 min no grupo II (p=0,034. CONCLUSÕES: As duas técnicas estudadas foram eficazes. Houve menor tempo de procedimento anestésico-cirúrgico nos pacientes operados com anestesia combinada, com significância estatística.INTRODUCTION: around ninety percent of anorectal surgical procedures are performed as day cases. The choice of a proper anesthetic technique is important to achieve reduced time in the operating rooms, hospital stay and low costs. There is no evidence in the literature that a superior type of anesthesia for these procedures exists. OBJECTIVE: to compare the time spent on operating rooms in patients submitted to anorectal surgical procedures through spinal anesthesia (0,5% bupivacaine with combined anesthesia

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

Science.gov (United States)

Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

2017-07-01

Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Anestesia em paciente obstétrica portadora de anemia falciforme e traço talassêmico após plasmaféresis: relato de caso Anesthesia in obstetric patient with sickle cell anemia and thalassemic trait after plasmapheresis: case report

Directory of Open Access Journals (Sweden)

Eduardo Barbosa Leão

2005-06-01

-indicam a anestesia regional; além disto, a plasmaféresis potencialmente depleta os estoques de colinesterases plasmáticas, o que interfere na anestesia. Entretanto, o arsenal medicamentoso disponível permitiu o manuseio seguro desta situação.JUSTIFICATIVA Y OBJETIVOS: La plasmaféresis es una técnica de tratamiento de elección para pacientes con anemia hemolítica grave. Una de sus consecuencias es la depleción de colinesterasa plasmática, lo que interfiere en la metabolización de algunos bloqueadores neuromusculares de uso corriente en la práctica anestesiológica. RELATO DEL CASO: Paciente con 26 años, estado físico ASA IV, gestación de 30 semanas y 3 días, portadora de anemia falciforme, trazo talasémico y alo-inmunización para antígenos de alta frecuencia. Presentó crisis de falcización, siendo transfundida con derivado sanguíneo incompatible. Evolucionó con hemólisis maciza, siendo admitida con hemoglobina de 3 g/dL y hematócrito del 10%, ictericia intensa, taquicardia, apatía y con pérdida de color. En la evaluación hematológica se concluyó ser una situación de inexistencia de sangre compatible para transfusión. Fue tratada con corticoterapia, inmunoglobulinas y plasmaféresis. En el segundo día de internación, evolucionó con insuficiencia renal aguda y edema pulmonar agudo, empeoramiento del estado general e inestabilidad hemodinámica. Indicada la resolución de la gestación como resultado del cuadro clínico de la paciente y del sufrimiento fetal agudo que se sobrepuso. La paciente fue admitida en la sala de operaciones consciente, disneica, pálida, ictérica, SpO2 del 91% en aire ambiente, frecuencia cardiaca de 110 lpm y presión arterial de 110 x 70 mmHg, en uso de dopamina (1 µg.kg-1 min-1 y dobutamina (10 µg.kg-1.min-1. Se optó por anestesia general balanceada, con alfentanil (2,5 mg, etomidato (14 mg y atracúrio (35 mg e isoflurano. No se observó interocurrencias anestésico- quirúrgicas. Al final, la paciente fue

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

Directory of Open Access Journals (Sweden)

Indhu Kanakaraj

Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Análisis del clima familiar y resiliencia en una muestra de estudiantes universitarios de primer curso

OpenAIRE

Caamaño Fandiño, Alba María

2016-01-01

Traballo Fin de Grao en Educación Social. Curso 2015-2016 [ES] La modalidad elegida para desarrollar este Trabajo de Fin de Grado es la de iniciación a la investigación de campo. Así, este estudio se plantea con el objetivo general de analizar la resiliencia y el clima familiar en una muestra del alumnado universitario de primer año, en esta ocasión, perteneciente a la Universidad de Santiago de Compostela. La sociedad cambia constantemente y, con ella, las necesidades de los individuos...

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

Estudo clínico prospectivo aleatório sobre o uso da máscara laríngea Supreme® em pacientes submetidos a anestesia geral

Directory of Open Access Journals (Sweden)

Sara R. Barreira

2013-12-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Dispositivos supraglóticos são cada vez mais usados como opção à intubação traqueal durante procedimentos eletivos de complexidade variável. O objetivo deste estudo foi avaliar prospectivamente o uso clínico da máscara laríngea Supreme® (MLS em pacientes submetidas a procedimentos cirúrgicos eletivos na mama e compará-la ao tubo endotraqueal (TE. MÉTODO: 60 pacientes submetidas a procedimentos cirúrgicos da mama sob anestesia geral foram distribuídas aleatoriamente em dois grupos de acordo com o dispositivo usado (MLS ou TE. Foram avaliados: tempo de inserção, número de tentativas para inserção, resposta hemodinâmica à inserção, presença de sangue no dispositivo usado e incidência de dor de garganta, disfagia, náuseas e vômitos no pós-operatório. RESULTADOS: Não houve diferença entre os grupos com relação ao tempo de inserção, ao número de tentativas para inserção bem-sucedida e à presença de sangue no dispositivo. A frequência cardíaca e a pressão arterial após a inserção foram maiores no grupo TE. A incidência de dor de garganta e disfagia após duas horas de pós-operatório também foi maior no grupo TE. Não houve diferença na incidência e na intensidade das complicações avaliadas após seis horas de pós-operatório. CONCLUSÕES: O uso da MLS como técnica de acesso à via aérea durante a anestesia geral em procedimentos cirúrgicos eletivos na mama é tão seguro e eficiente quanto a intubação traqueal, com a vantagem de desencadear menor resposta hemodinâmica durante a sua execução e menor incidência de dor de garganta e disfagia nas primeiras horas de pós-operatório.

Baixa dose de bupivacaína isobárica, hiperbárica ou hipobárica para raquianestesia unilateral Baja dosis de bupivacaína isobara, hiperbara o hipobara para anestesia raquidea unilateral Low dose isobaric, hyperbaric, or hypobaric bupivacaine for unilateral spinal anesthesia

Directory of Open Access Journals (Sweden)

Luiz Eduardo Imbelloni

2007-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A raquianestesia unilateral pode apresentar vantagens principalmente em pacientes em regime ambulatorial. Baixa dose da solução anestésica, velocidade lenta da injeção espinal e a posição lateral facilitam a obtenção da distribuição unilateral na raquianestesia. Foram comparadas soluções isobárica, hiperbárica e hipobárica de bupivacaína com objetivos de se obter raquianestesia unilateral em pacientes submetidos a intervenções cirúrgicas ortopédicas em regime ambulatorial. MÉTODO: Cento e cinqüenta pacientes foram aleatoriamente separados em três grupos para receberem 5 mg de bupivacaína a 0,5% isobárica (Grupo Iso, ou 5 mg de bupivacaína a 0,5% hiperbárica (Grupo Hiper, ou 5 mg de bupivacaína a 0,15% hipobárica (Grupo Hipo. As soluções foram administradas no interespaço L3-L4 com o paciente na posição lateral e permanecendo nesta posição por 20 minutos. A anestesia sensitiva foi avaliada pelo teste da picada da agulha. O bloqueio motor avaliado pela escala modificada de Bromage. Ambos os bloqueios foram comparados com o lado não operado e entre si. RESULTADOS: Existiu diferença significativa entre o lado operado e não-operado em todos os três grupos aos 20 minutos, mas maior freqüência de raquianestesia unilateral foi obtida com as soluções hiperbárica e hipobárica de bupivacaína. Bloqueio sensitivo e motor foram observados em 14 pacientes do Grupo Iso, 38 pacientes no Grupo Hiper e 40 pacientes no Grupo Hipo. Não ocorreram alterações hemodinâmicas em nenhum paciente. Não foram observados cefaléia pós-punção nem sintomas neurológicos temporários. CONCLUSÕES: A raquianestesia com soluções hipobárica e hiperbárica proporcionou maior freqüência de unilateralidade. Após 20 minutos a solução isobárica de bupivacaína mobilizou-se no líquido cefalorraquidano (LCR, resultando em apenas 28% de raquianestesia unilateral.JUSTIFICATIVA Y OBJETIVOS: La

Análise de custos entre a raquianestesia e a anestesia venosa com propofol associada ao bloqueio perianal local em operações anorretais Cost analysis between spinal and venous anesthesia with propofol associated with local perianal block in anorectal procedures

Directory of Open Access Journals (Sweden)

Paulo Gustavo Kotze

2009-09-01

Full Text Available RACIONAL: Atualmente cerca de 90% das operações anorretais podem ser realizadas em regime ambulatorial. A técnica anestésica é fator fundamental na busca de menor tempo de internamento e redução de custos nestes procedimentos. Não há consenso na literatura sobre qual o melhor tipo de anestesia para essas operações. OBJETIVO: Comparar os custos da técnica de raquianestesia com bupivacaína 0,5% isobárica com a técnica de anestesia venosa com propofol associada ao bloqueio perianal local com lidocaína a 2% e bupivacaína 0,5% (anestesia combinada em pacientes submetidos a operações anorretais. MÉTODOS: Foram analisados dados de 99 pacientes submetidos à operações anorretais, divididos em dois grupos: grupo I (raquianestesia, composto por 50 pacientes e grupo II (anestesia combinada, composto por 49 pacientes. Foram estudados os procedimentos cirúrgicos, tempo de procedimento anestésico-cirúrgico, tempo de internamento e custos globais de cada paciente. RESULTADOS: Não houve diferença estatística significativa entre os grupos estudados em relação ao tipo de procedimento cirúrgico, sexo, idade e complicações. O tempo médio do procedimento anestésico-cirúrgico, no grupo I foi de 53,1 minutos e de 44,08 minutos no grupo II (P=0,034. O tempo médio de internamento foi de 19,68 horas no grupo I e de 7,08 horas no grupo II (PBACKGROUND: Approximately ninety percent of anorectal surgical procedures are performed in ambulatory basis. The choice of a proper anesthetic technique is important to achieve shorter hospital stay and low costs. There's no evidence in the literature that an ideal type of anesthesia for these procedures exists. AIM: To compare the costs of patients operated with spinal anesthesia (0,5% bupivacaine with combined anesthesia (propofol and local perineal block with 2% lidocaine and 0,5% bupivacaine in anorectal surgical procedures. METHODS: Data from 99 patients submitted to anorectal operations were

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

International Nuclear Information System (INIS)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-01-01

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Anestesia por isofluorano em eqüinos submetidos à infusão contínua de medetomidina ou xilazina Isoflurane anesthesia in horses during medetomidine or xilazine continuous infusion

OpenAIRE

Renata Gebara Sampaio Dória; Carlos Augusto Araújo Valadão; Paulo Aléscio Canola; Érica Cristina Bueno do Prado Guirro; Marina Ceccato Mendes; André Escobar; Gesiane Ribeiro; Cláudio Côrrea Natalini

2009-01-01

Avaliaram-se oito eqüinos sob anestesia geral inalatória com isofluorano (1CAM) e infusão contínua de xilazina (0,35mg kg-1h-1) ou medetomidina (3,5µg kg-1h-1), em relação à freqüência cardíaca, ritmo cardíaco, freqüência respiratória, pressão arterial, hemogasometria arterial e temperatura, nos tempos T0 (imediatamente antes do início da infusão contínua) e T10 ao T60 (intervalos de 10 minutos, após início da infusão contínua). Houve redução da freqüência cardíaca e da temperatura e el...

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Signals and systems primer with Matlab

CERN Document Server

Poularikas, Alexander D

2006-01-01

Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

DEFF Research Database (Denmark)

Hansen, A C; Grunwald, T; Lund, Anders Henrik

2001-01-01

could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

Science.gov (United States)

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

Science.gov (United States)

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

Science.gov (United States)

Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

2015-07-28

Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

Science.gov (United States)

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Blood Donation and Transfusion: A Primer for Health Educators.

Science.gov (United States)

Felts, W. Michael; Glascoff, Mary A.

1991-01-01

Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

Small Commercial Building Re-tuning: A Primer

Energy Technology Data Exchange (ETDEWEB)

Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

2013-09-30

To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

Directory of Open Access Journals (Sweden)

Jonas Binladen

2007-02-01

Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

Directory of Open Access Journals (Sweden)

Christopher A Gulvik

Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Primers As Socializing Agents in American and Finnish Schools.

Science.gov (United States)

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

NARCIS (Netherlands)

RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

1990-01-01

We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

Directory of Open Access Journals (Sweden)

Anderson Pinheiro de Freitas

2004-06-01

Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Benzocaine hydrochloride anesthesia in carp (Cyprinus carpio / Cloridrato de benzocaína na anestesia de carpas (Cyprinus carpio

Directory of Open Access Journals (Sweden)

Marco Antonio da Rocha

2008-08-01

Full Text Available Fish anesthesia is indicated to allow the accomplishment of several procedures such as biometry, tagging, transportation, physical examination, surgical procedures, and reproductive management. The doses of benzocaine in the carp anesthesia (Cyprinus carpio were determined, carrying through six phases with 40 fish each. The average weight of carps in each phase was of 147.45±7.99g, 173.32±9.15g, 191.26±14.05g, 269.84±19.24g, 285.25±17.97g, and 300.91±16.45g. In each phase, fish had been captured and placed in four containers each one with different concentrations of benzocaine (100, 140, 180 and 220 mg/L respectively. The induction time (IT was registered for each fish and after that the anesthetic induction biometry was performed. In each phase the minimal dose of benzocaine was calculated using the Linear Response Plateau (LRP, in a model that included dose and IT. The LRP was calculated for each phase: 125.79mg/L in 114.33s, 155.68mg/L in 115.75s, 145.33mg/L in 102.52s, 149.50mg/L in 140.53s, 166.42mg/L in 116.15s, and 158.34mg/L in 102.00s. The optimal dose was related with the weight, resulting in the equation: dose=114.230+0.158 x weight (r2=0.53. The equation shows that an increase in the weight in 1g corresponds to an increase of 0.158 mg/L in the dose of benzocaine hydrochloride for carps.A anestesia em peixes é indicada para permitir a realização de diversos procedimentos como: biometria, marcação, transporte, exame físico, procedimentos cirúrgicos e manejo reprodutivo. Determinou-se a dose de benzocaína na anestesia de carpas (Cyprinus carpio, com a realização de seis etapas com 40 peixes cada. O peso médio das carpas em cada etapa foi de 147,45±7,99g, 173,32±9,15g, 191,26±14,05g, 269,84±19,24g, 285,25±17,97g, e 300,91±16,45g. Em cada etapa, os peixes foram capturados e colocados em quatro recipientes com benzocaína nas concentrações de 100, 140, 180 e 220 mg/L respectivamente. O tempo de indução (TI foi

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

A method for automatically extracting infectious disease-related primers and probes from the literature

Directory of Open Access Journals (Sweden)

Pérez-Rey David

2010-08-01

Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

Anestesia para ventriculostomia por via endoscópica para tratamento de hidrocefalia: relato de casos Anestesia para ventriculostomía por vía endoscópica para tratamiento de hidrocefalia: relato de casos Anesthesia for endoscopic ventriculostomy for the treatment of hydrocephalus: case report

Directory of Open Access Journals (Sweden)

Friederike Wolff Valadares

2007-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A terceiro-ventriculostomia endoscópica está se tornando um procedimento de rotina entre as intervenções neurocirúrgicas infantis. Entretanto, relatos sobre anestesia para crianças submetidas a tais procedimentos ainda são escassos. O objetivo desta série de casos foi demonstrar os cuidados e a eficácia do método empregado. RELATO DOS CASOS: Foram avaliadas retrospectivamente 38 crianças abaixo de 2 anos que se submeteram à terceiro-ventriculostomia neuroendoscópica para tratamento de hidrocefalia obstrutiva no período de 1999 a 2004 no Biocor Instituto. Foram estudados o diagnóstico, comorbidades, idade, peso, técnica anestésica, monitorização e as complicações intra e pós-operatórias. Todos os pacientes, entre 1 semana e 20 meses, apresentavam hidrocefalia obstrutiva por compressão do aqueduto de etiologia variada. A indução anestésica em 35 crianças foi por via inalatória e por via venosa em três delas. A monitorização de 34 pacientes foi com eletrocardiograma, oxímetro de pulso, capnógrafo e termômetro esofágico, sendo quatro crianças monitorizadas com pressão arterial invasiva contínua. A manutenção da anestesia em 15 pacientes foi balanceada com fentanil e isoflurano e em outros 23 pacientes inalatória com isoflurano. Trinta e cinco crianças foram extubadas após o procedimento na sala cirúrgica e outras três no CTI. Seis pacientes foram encaminhados ao CTI após a extubação. Complicações observadas: disritmias cardíacas sem repercussão hemodinâmica no intra-operatório (seis casos. Dois pacientes tiveram sangramento intra-operatório, mas somente um deles demandou implante de derivação ventricular externa. As complicações no pós-operatório foram: vômitos (6, picos febris (4 convulsões (2, laringoespasmo (1 e estridor laríngeo (1. CONCLUSÕES: A terceiro-ventriculostomia apresenta baixa incidência de complicações mesmo em pacientes com menos de 24

Primer on molecular genetics. DOE Human Genome Program

Energy Technology Data Exchange (ETDEWEB)

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

A Primer on Concepts and Applications of Proteomics in Neuroscience

DEFF Research Database (Denmark)

Hosp, Fabian; Mann, Matthias

2017-01-01

The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

Science.gov (United States)

Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

1996-07-01

To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

Science.gov (United States)

2018-01-18

This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

DEFF Research Database (Denmark)

Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

2014-01-01

Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

Directory of Open Access Journals (Sweden)

S Hamid Raji

2011-01-01

Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

Pre-anesthetic Anxiety Level in Children with Congenital Heart Disease: Comparison between Maternal Presence during Anesthetic Induction and Midazolam Premedication

Directory of Open Access Journals (Sweden)

Ratna F Soenarto

2016-09-01

Full Text Available General anesthesia was needed by children with congenital heart disease (CHD who underwent cardiaccatheterization procedure and surgery. Pre-anesthetic anxiety in children with CHD can cause significantproblems during induction of anesthesia which leads to negative postoperative outcomes. This studycompared the role of maternal presence during anesthesia induction with midazolam premedication onpre-anesthetic anxiety level in children with CHD. Dr. Cipto Mangunkusumo National Hospital on April toSeptember 2014. Forty-five CHD patients aged 2-5 years old who underwent cardiac invasive procedurewere divided into P group (received midazolam premedication and M group (had maternal presence duringanesthesia induction. Modified Yale Pre-anxiety Scale (MYPAS was used for measuring anxiety level ineach patient during preoperative visit, on the time patient entered the procedure room and during induction ofanesthesia. There was no significant difference of MYPAS scores between the two groups in all measurementtimes. The MYPAS score results were non-anxious (median score 23.4 and the highest was at induction ofanesthesia. Inter-rater agreement test between 2 observers was good (k>0.5. In conclusion, there was nosignificant difference between the effect of maternal presence during induction of anesthesia and midazolampremedication on pre-anesthetic anxiety level in children with CHD. Keywords: pre-anesthetic anxiety, congenital heart disease, maternal presence, midazolam.   Peran Kehadiran Ibu selama Induksi Anestesia dengan PremedikasiMidazolam terhadap Tingkat Kecemasan Pra-anestesia Anak denganPenyakit Jantung Bawan Abstrak Pembiusan umum diperlukan oleh pasien dengan penyakit jantung bawaan (PJB pada saat kateterisasiatau pembedahan jantung. Kecemasan pra-anestesia dapat menimbulkan masalah saat induksi anestesiayang berdampak negatif pascapembedahan. Penelitian ini bertujuan untuk membandingkan efek premedikasimidazolam dan kehadiran ibu selama

Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

Science.gov (United States)

Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

2010-03-01

Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

Science.gov (United States)

Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

2013-01-01

Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-07-01

Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

Development of a microsatellite primer set to investigate the genetic ...

Indian Academy of Sciences (India)

Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

Development of specific primers for genus Fusarium and F. solani ...

African Journals Online (AJOL)

Yomi

2012-01-05

Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

Science.gov (United States)

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO

Directory of Open Access Journals (Sweden)

Marco Suárez

2006-05-01

Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

Ares, Janus, Globalization: A Primer For The Military Leader in NATO

National Research Council Canada - National Science Library

Clemons, Dean

2002-01-01

...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

Bayesian models a statistical primer for ecologists

CERN Document Server

Hobbs, N Thompson

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

The proper generalized decomposition for advanced numerical simulations a primer

CERN Document Server

Chinesta, Francisco; Leygue, Adrien

2014-01-01

Many problems in scientific computing are intractable with classical numerical techniques. These fail, for example, in the solution of high-dimensional models due to the exponential increase of the number of degrees of freedom. Recently, the authors of this book and their collaborators have developed a novel technique, called Proper Generalized Decomposition (PGD) that has proven to be a significant step forward. The PGD builds by means of a successive enrichment strategy a numerical approximation of the unknown fields in a separated form. Although first introduced and successfully demonstrated in the context of high-dimensional problems, the PGD allows for a completely new approach for addressing more standard problems in science and engineering. Indeed, many challenging problems can be efficiently cast into a multi-dimensional framework, thus opening entirely new solution strategies in the PGD framework. For instance, the material parameters and boundary conditions appearing in a particular mathematical mod...

Anesthesia of silver catfish with eugenol: time of induction, cortisol response and sensory analysis of fillet Anestesia de jundiás com eugenol: tempo de indução, resposta ao cortisol e análise sensorial do filé

Directory of Open Access Journals (Sweden)

Mauro Alves da Cunha

2010-10-01

Full Text Available The aim of this study was to identify the time of anesthetic induction and recovery of silver catfish (Rhamdia quelen exposed to eugenol. It was also determined the efficacy of the anesthetic as a stress reducing agent and performed a sensory analysis of the fillets from fish exposed to this substance. The silver catfish were exposed to air for 1min to carry out biometry, and blood was collected at 0, 1 and 4 hours later. Eugenol can be used in the range of 20-50mg L-1 for anesthetic induction in silver catfish, and recovery time from anesthesia was not affected by eugenol concentration. The control group showed significantly higher cortisol levels 4 hours after biometry than at time zero. Fish anesthetized with eugenol (50mg L-1 presented significantly lower plasma cortisol levels than control fish at the same time. These data indicate that eugenol inhibits the rise of cortisol in the blood. The sensory analysis test demonstrated that eugenol modifies the flavor of the fillet and therefore is contra-indicated for anesthetization of silver catfish that are intended for human consumption.O objetivo deste estudo foi identificar o tempo de indução e recuperação anestésica de jundiás (Rhamdia quelen expostos ao eugenol, bem como a eficácia desse anestésico na inibição do estresse e realizar análise sensorial dos filés dos peixes expostos a essa substância. Os jundiás foram expostos ao ar por um minuto para realização da biometria, e o sangue foi coletado zero, uma e quatro horas depois. O eugenol pode ser usado na faixa de 20-50mg L-1 para a indução da anestesia em jundiás, e o tempo de recuperação da anestesia não foi afetado pela concentração do eugenol. O grupo de controle mostrou níveis significativamente mais elevados do cortisol quatro horas após a biometria que no tempo zero. Os peixes anestesiados com eugenol (50mg L-1 apresentaram níveis significativamente mais baixos do cortisol plasmático do que peixes do grupo

A web-based adaptive tutor to teach PCR primer design

NARCIS (Netherlands)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

A Web-based Adaptive Tutor to Teach PCR Primer Design

NARCIS (Netherlands)

Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

Radiation protection primer

International Nuclear Information System (INIS)

Aigner, R.; Melzer, E.; Seissler, H.

1986-01-01

This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

Bond strength of primer/cement systems to zirconia subjected to artificial aging.

Science.gov (United States)

Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

2016-11-01

Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

Incorporating travel-time reliability into the congestion management process : a primer.

Science.gov (United States)

2015-02-01

This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

Bayesian models: A statistical primer for ecologists

Science.gov (United States)

Hobbs, N. Thompson; Hooten, Mevin B.

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

Science.gov (United States)

Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

2016-01-01

Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

Directory of Open Access Journals (Sweden)

Fernanda Martins Castro

2015-06-01

Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

International Nuclear Information System (INIS)

D. S. Lucas

2004-01-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

Science.gov (United States)

Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

2016-01-01

Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

Science.gov (United States)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

A Primer on Observational Measurement.

Science.gov (United States)

Girard, Jeffrey M; Cohn, Jeffrey F

2016-08-01

Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

Directory of Open Access Journals (Sweden)

Julio J. Masquijo

2014-10-01

Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

Anestesia do pirarucu por aspersão da benzocaína diretamente nas brânquias Anesthesia in pirarucu by benzocaine sprays in the gills

Directory of Open Access Journals (Sweden)

Alexandre Honczaryk

2010-02-01

Full Text Available O pirarucu (Arapaima gigas é um peixe que pode atingir mais de 2m e 100kg. No entanto, por ser um animal de grande porte, o risco de acidentes é bastante elevado durante o manejo. Logo, anestésicos são essenciais para segurança no trabalho. Nesse contexto, estudou-se a possibilidade do uso da benzocaína aspergida diretamente nas brânquias do pirarucu, para indução à anestesia do peixe pulmonado da Amazônia sem riscos de afogamento. Foram testadas as concentrações de 25, 50 e 75mg L-1 em indivíduos adultos (55,1±7,0kg e 1,80±0,1m e as concentrações de 50 e 100mg L-1 em juvenis (6,0±0,6kg e 87,2±5,6cm. Os resultados mostram viabilidade do uso da benzocaína aspergida diretamente nas brânquias do pirarucu em concentrações de 50 a 100mg L-1, proporcionando anestesia com ausência de movimentação por aproximadamente 2min, tempo suficiente para procedimentos rápidos, como biometria, injeções, marcação, coleta de raspados de muco na superfície do corpo e brânquias. Mortalidade de animais não foi observada mesmo um mês após os testes.Pirarucu (Arapaima gigas is a fish that may achieve more than 2m and 100kg. Thus handling of this fish may impose risks to workers. In this way, anesthetics are imperative for safety at work, but usual anesthetics baths are not feasible for pirarucu because of the fish size and the species pulmonary respiration. Pirarucu may die drowned if submersed as the other fishes in anesthetics baths. Therefore, this work tested the possible use of benzocaine directly sprinkled in the gills of pirarucu. In the first experiment, benzocaine solutions in concentrations of 25, 50 and 75mg L-1 were tested for adult fish (55.1±7.0kg e 1.80±0.1m. In the second one, the anesthetic in concentrations of 50 and 100mg L-1 were tested for juveniles (6.0±0.6kg e 87.2±5.6cm. Benzocaine sprinkled directly in the gills of pirarucu showed to be an efficient anesthetic both for juveniles and adult fish. It was

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

Science.gov (United States)

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

Science.gov (United States)

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

Directory of Open Access Journals (Sweden)

Douglas de Almeida Pereira

2015-09-01

Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

Science.gov (United States)

Duina, Andrea A; Miller, Mary E; Keeney, Jill B

2014-05-01

The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

ALGUNOS MITOS EN ANESTESIOLOGÍA

Directory of Open Access Journals (Sweden)

Claudio Ricke, Dr.

2017-09-01

Full Text Available RESUMEN: En anestesiología, como en otras especialidades, existen muchos conceptos que damos por verdaderos sin haber analizado la evidencia científica que los apoya o refuta. El objetivo de esta revisión es evaluar la evidencia detrás de algunas “verdades” bastante difundidas, entre ellas, la relación entre alergia al huevo o soya y el uso del propofol; la superioridad de la anestesia regional en cirugía de cadera; el concepto de “alergia al yodo”; el dolor crónico postoperatorio; efectos a largo plazo de la anestesia y efectos dañinos de los anestésicos en el sistema nervioso. Para ello, se realizó una revisión no sistemática de la literatura, mostrando algunos trabajos que apoyen o refuten dichas creencias. SUMMARY: In anesthesiology, as well as in other medical specialties, there are several concepts that we consider true without having previously analised any scientific evidence that supports or refutes them. The aim of this review is to asses the evidence behind some of these widespread “truths”, such as the relationship between egg or soy allergies and the use of propofol; the superiority of regional anaesthesia over general anaesthesia for hip surgery; the concept of “iodine allergies”; post operatory chronic pain; long term effects of anaesthesia and negative effects of the anaesthesia on the nervous system. To achieve this aim, it was develop a nonsystematic review of the literature, showing some works that support or deny such beliefs. Palabras clave: Mitos, propofol, huevo, anestesia general, artroplastía de cadera, anestesia regional, alergia al yodo, hipertermia maligna, resultado (outcome, neurotoxicidad, dolor crónico postoperatorio, Keywords: Myths, propofol, eggs, general anesthesia, hip arthroplasty, regional anesthesia, iodine allergy, Malignant Hyperthermia, outcome, neurotoxicity, chronic postoperative pain

Anestesia em paciente com Xeroderma Pigmentoso: relato de caso Anestesia en paciente con Xeroderma Pigmentoso: relato de caso Anesthesia in patient with Xeroderma Pigmentosum: case report

Directory of Open Access Journals (Sweden)

Carlos Rogério Degrandi Oliveira

2003-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: O Xeroderma Pigmentoso é uma doença autossômica recessiva rara, caracterizada pelo desenvolvimento prematuro de neoplasias devido à extrema sensibilidade à radiação ultravioleta. Estas manifestações ocorrem por falha no mecanismo de excisão e reparo do DNA. Se comparados a indivíduos normais, estes pacientes apresentam risco 1000 vezes maior de desenvolver neoplasias em áreas expostas ao sol. O objetivo deste relato é apresentar a conduta anestésica em uma paciente portadora de Xeroderma Pigmentoso submetida à cirurgia oftalmológica. RELATO DO CASO: Paciente do sexo feminino, 7 anos, portadora de Xeroderma Pigmentoso com comprometimento facial extenso, admitida para exérese de lesão papilar no olho direito. Foi prescrito midazolam (10 mg por via oral, como medicação pré-anestésica. A monitorização inicial consistiu de cardioscópio, oxímetro de pulso, estetoscópio precordial e pressão arterial não invasiva. Foi realizada pré-oxigenação com oxigênio a 100% por 3 minutos e indução inalatória sob máscara com oxigênio a 100% e sevoflurano em concentrações crescentes até 7%. Após acesso venoso periférico com cateter 22G, foram injetados propofol (50 mg e succinilcolina (20 mg e realizada intubação traqueal com tubo 5,5 mm sem balonete. Um guia de metal foi utilizado para facilitar a introdução do tubo traqueal. A manutenção da anestesia foi feita com sevoflurano a 3,5% e oxigênio a 100%, com sistema de Bain. A criança foi extubada na sala cirúrgica e encaminhada à sala de recuperação pós-anestésica em boas condições. CONCLUSÕES: As alterações faciais e orofaríngeas decorrentes desta doença determinaram dificuldades na adaptação da máscara facial e intubação traqueal. A educação constante do paciente e de seus familiares constitui o objetivo mais importante no manuseio desta doença.JUSTIFICATIVA Y OBJETIVOS: El Xeroderma Pigmentoso es una enfermedad autos

Evaluación costo-efectividad de lidocaína al 5 % y bupivacaína al 0,5 % en anestesia espinal

Directory of Open Access Journals (Sweden)

Eréndira González Orozco

Full Text Available Se realizó un estudio económico prospectivo de costo-efectividad con datos primarios de efectividad obtenidos de un ensayo clínico aleatorizado, donde se comparan 2 anestésicos vía espinal: lidocaína al 5 % y bupivacaína al 0,5 %. La efectividad se evaluó como la probabilidad de aparición de síntomas neurológicos transitorios, reacción adversa propia de este grupo de medicamentos. Se formaron aleatoriamente 2 grupos de pacientes que requerían cirugías por debajo del ombligo con una duración no mayor de 120 min, con la aplicación de cada una de las opciones de anestesia estudiada a cada grupo, 109 pacientes en el grupo de lidocaína y 97 en el grupo de bupivacaína. Un especialista en Neurología evaluó a ciegas la condición neurológica posquirúrgica de cada paciente antes y 24 h después de la intervención. Se calcularon los costos de cada alternativa, que incluyeron los ocasionados por la toxicidad neurológica, y se determinaron las relaciones costo-efectividad y los costos incrementales. El grupo de bupivacaína resultó la alternativa con mejor relación costo-efectividad

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Denilce Meneses Lopes

2010-01-01

Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

Science.gov (United States)

Pitta, João; Branco, Teresa C; Portugal, Jaime

2018-05-01

Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

Directory of Open Access Journals (Sweden)

Ana Paula Morales Cobra Carvalho

2009-06-01

Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.

Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

Science.gov (United States)

Corman, Rena

This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

Science.gov (United States)

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

OpenAIRE

Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

2015-01-01

Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

A primer on the mortgage market and mortgage finance

OpenAIRE

Daniel J. McDonald; Daniel L. Thornton

2008-01-01

This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

Science.gov (United States)

Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

2018-02-01

The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

A primer on quantum fluids

CERN Document Server

Barenghi, Carlo

2016-01-01

The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

Making the connection: advancing traffic incident management in transportation planning : a primer.

Science.gov (United States)

2013-07-01

"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

Science.gov (United States)

Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

A Web-Based Adaptive Tutor to Teach PCR Primer Design

Science.gov (United States)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

Development of specific primers for the detection of HVA1 from ...

African Journals Online (AJOL)

aghomotsegin

2014-01-22

Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

De neurocirujano a primer ministro de Salud de la Argentina

Directory of Open Access Journals (Sweden)

Karina Inés Ramacciotti

2008-01-01

Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

Agitação no despertar da anestesia em crianças: aspectos atuais Emergence agitation in pediatric anesthesia: current features

Directory of Open Access Journals (Sweden)

Leopoldo Muniz da Silva

2008-04-01

Full Text Available OBJETIVO: A agitação pós-operatória é um fenômeno clínico bem documentado em crianças, com incidência variando de 10 a 67%. Não existe explicação definitiva para a agitação no despertar. Várias causas têm sido discutidas na literatura, como rápido retorno à consciência em ambiente não familiar, presença de dor (ferida, dor de garganta, distensão vesical, etc., estresse na indução, hipoxemia, obstrução da via aérea, ambiente barulhento, duração da anestesia, temperamento da criança, uso de medicação pré-anestésica e técnica anestésica empregada. O objetivo deste estudo é discutir as possíveis causas da agitação pós-operatória em crianças, subsidiando ações referentes à identificação e prevenção mais adequada. FONTES DOS DADOS: Artigos originais e revisões, publicados no período de 1991 a 2007 e indexados no MEDLINE e PubMed, utilizando as seguintes palavras-chave: agitação no despertar, incidência, etiologia, diagnóstico, tratamento, criança, anestesia pediátrica. SÍNTESE DOS DADOS: É apresentada neste artigo uma revisão de possíveis desencadeadores de agitação, assim como uma proposta de escala para uniformização adequada do diagnóstico e medidas que implementam a prevenção e o tratamento. CONCLUSÕES: Nenhum fator pode, de maneira isolada, ser implicado como causador de agitação pós-operatória, devendo ser considerada como uma síndrome com componentes biológicos, farmacológicos, psicológicos e sociais, os quais o anestesiologista e o pediatra intensivista devem estar preparados para identificar, prevenir e intervir adequadamente quando necessário.OBJECTIVE: Postoperative agitation in children is a well-documented clinical phenomenon with incidence ranging from 10% to 67%. There is no definitive explanation for this agitation. Possible causes include rapid awakening in unfamiliar settings, pain (wounds, sore throat, bladder distension, etc., stress during induction

A primer on physical-layer network coding

CERN Document Server

Liew, Soung Chang; Zhang, Shengli

2015-01-01

The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

Directory of Open Access Journals (Sweden)

Alejandro Gonzalez-Martinez

2015-01-01

Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Great Lakes rivermouths: a primer for managers

Science.gov (United States)

Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

2013-01-01

Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

Science.gov (United States)

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Avaliação da indução, recuperação, agitação ao despertar e consumo com uso de duas marcas de sevoflurano para anestesia ambulatorial

Directory of Open Access Journals (Sweden)

Cíntia Reina Grisan Tomal

2012-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: O sevoflurano por suas características farmacológicas é o anestésico ideal para procedimentos de curta duração. Existem duas marcas de sevoflurano no mercado brasileiro, o Sevocris® e Sevorane®, com diferentes formulações e envasamento. O objetivo deste estudo foi analisar se existem diferenças entre os dois anestésicos na indução, manutenção, recuperação e consumo. MÉTODO: Foram incluídas 130 crianças dividas em dois grupos segundo a marca do agente utilizado: Grupo 1 sevoflurano da Cristália® e Grupo 2 da Abbott®. Foram analisados os seguintes parâmetros: frequência cardíaca, pressão arterial sistólica e diastólica, fração inspirada e expirada de sevoflurano, valores de BIS, temperatura timpânica, tempos de indução e recuperação, agitação ao despertar pela escala PAED e consumo do anestésico por pesagem dos vaporizadores. A indução foi realizada com 1 CAM e incrementadas a cada três movimentos respiratórios em 0,5 CAM, até no máximo 3 CAM. RESULTADO: Não houve diferença entre os grupos quanto ao tempo de procedimento e de anestesia e nos parâmetros avaliados na indução. No Grupo 1, o número de crianças que necessitaram bolus adicionais de sevoflurano na manutenção da anestesia foi maior que no 2 (p < 0,05. A fração inspirada e expirada de sevoflurano no final do procedimento foi menor no Grupo 1 (p < 0,001. No momento do despertar o valor do BIS foi menor no Grupo 1 (p = 0,045. Outros parâmetros avaliados na recuperação não mostraram diferença entre os grupos. O consumo de anestésico foi semelhante entre os grupos.

PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

OpenAIRE

Belyavsky, A; Vinogradova, T; Rajewsky, K

1989-01-01

A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

Routes to effective evacuation planning primer series : evacuating populations with special needs.

Science.gov (United States)

2009-04-01

Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

2018-01-01

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.

2018-05-23

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

Science.gov (United States)

Rockne, Karl J; Strand, Stuart E

2003-09-01

Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

Directory of Open Access Journals (Sweden)

Yuli Kurniawati

2015-05-01

Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

Right-to-left shunt determination in dog lungs under inhalation anesthesia with rebreathing and non-rebreathing system Determinação de shunt venoso-arterial em pulmões de cães sob anestesia geral inalatória por sistemas com e sem reinalação

Directory of Open Access Journals (Sweden)

André Leguthe Rosa

2006-12-01

Full Text Available PURPOSE: To investigatge right-to-left shunt determination in dog lungs under inhalantion anesthesia with non-rebreathing and rebreathing systems and fraction of inspired oxygen (F I O2 of 0.9 and 0.4, respectively. METHODS: Two groups of 10 dogs each under inhalation anesthesia with sevoflurane: GI in which it was utilized non-rebreathing semiclosed system and F I O2 = 0.9, and GII in which it was utilized rebreathing semiclosed system and F I O2 = 0.4. The study parameters were: heart rate, medium arterial pressure, right-to-left intrapulmonary shunt, hematocrit, hemoglobin, arterial partial pressure of oxygen, mixed venous partial pressure of oxygen, mixed venous oxygen saturation, arterial partial pressure of carbon dioxide, partial pressure of water in the alveoli. RESULTS: Shunt results were significantly different between the two groups - GI data were higher than GII in all the evaluated moments. Hence, the group with nonrebreathing (GI developed a superior grade of intrapulmonary shunt when compared with the rebreathing group (GII. The partial pressure of water in the alveoli was significantly higher in GII. CONCLUSION: The inhalation anesthesia with non-rebreathing system and F I O2 = 0.9 developed a higher grade of intrapulmonary right-to-left shunt when compared with the rebreathing system and F I O2 = 0.4. The higher humidity in GII contributed to the result.OBJETIVO: Comparar a formação de shunt venoso-arterial em pulmões de cães submetidos a anestesia geral inalatória utilizando-se sistemas de anestesia com e sem reinalação, com fração inspirada de oxigênio de 0,4 e 0,9, respectivamente. MÉTODOS: Empregaram-se 20 cães induzidos com tiopental sódico (30mg/kg e mantidos com sevoflurano (3% e alocados em dois grupos (n=10; os animais de GI foram ventilados com modalidade controlada em sistema semifechado, sem reinalação, F I O2 = 0,9, e os de GII, com modalidade controlada, sistema semifechado, com reinalação e F I O2

Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

Science.gov (United States)

Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

2012-01-01

Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum

Science.gov (United States)

Danford, M. D.; Higgins, R. H.

1985-01-01

The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

Science.gov (United States)

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

Directory of Open Access Journals (Sweden)

Laura Navarro-Sampedro

2012-11-01

Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Transient Heat Transfer Model for Car Body Primer Curing

OpenAIRE

D. Zabala; N. Sánchez; J. Pinto

2010-01-01

A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

Anestesia para implante de marca-passo em paciente adulto com ventrículo único não-operado: relato de caso Anestesia para implante de marcapaso en paciente adulto con ventrículo único no operado: relato de caso Anesthesia for pacemaker implant in an adult patient with unoperated univentricular heart: case report

Directory of Open Access Journals (Sweden)

Adriano Bechara de Souza Hobaika

2007-02-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Ventrículo único é anormalidade rara encontrada em cerca de 1% dos pacientes com cardiopatia congênita. Somente 11 casos de pacientes com ventrículo único não-operado e idade acima de 50 anos foram relatados na literatura. Este trabalho teve como objetivo descrever a conduta anestésica em paciente com ventrículo único para implante de marca-passo. RELATO DO CASO: Paciente do sexo feminino, 47 anos, com presença de dupla via de entrada do ventrículo esquerdo, L-transposição de grandes artérias e estenose subpulmonar, sem correção cirúrgica prévia, foi agendada para implante de marca-passo cardíaco definitivo seqüencial de duas câmaras. Ao MAPA apresentava bloqueio atrioventricular de segundo grau e uma freqüência cardíaca média de 45 bpm. Os exames pré-operatórios mostravam hematócrito de 57%, coagulograma normal, função ventricular preservada. A monitorização constou de oxímetro de pulso, ECG nas derivações D II e V5, PIA, capnógrafo e analisador de gases. Um marca-passo temporário transcutâneo foi disponibilizado no caso de bradicardia intensa. A anestesia foi induzida com fentanil (0,25 mg, etomidato (20 mg e atracúrio (35 mg. Quatro minutos após a indução, a freqüência cardíaca diminuiu para 30 bpm, sendo administrado 1 mg de atropina, com reversão da bradicardia. A anestesia foi mantida com sevoflurano a 2,5%, ar 60% e oxigênio 40%. O estado hemodinâmico e a saturação de oxigênio permaneceram estáveis. A paciente foi encaminhada à unidade de terapia intensiva estável e extubada ao final do procedimento. CONCLUSÕES: A conduta anestésica para implante de marca-passo em paciente de 47 anos com dupla via de entrada do ventrículo esquerdo e estenose subpulmonar não-operada foi adequada, haja vista que permitiu a realização do procedimento indicado.JUSTIFICATIVA Y OBJETIVOS: Ventrículo único es una anormalidad rara encontrada en aproximadamente 1% de los

Hemorragias obstétricas en el primer y segundo trimestre del embarazo

OpenAIRE

García Rodríguez, Blanca

2013-01-01

Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

NARCIS (Netherlands)

Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

2004-01-01

Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

Influence of power density and primer application on polymerization of dual-cured resin cements monitored by ultrasonic measurement.

Science.gov (United States)

Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi

2010-08-01

We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.

Bupivacaína racêmica, levobupivacaína e ropivacaína em anestesia loco-regional para oftalmologia: um estudo comparativo Racemic bupivacaine, levobupi vacaine and ropivacaine in regional anesthesia for ophtalmology: a comparative study

Directory of Open Access Journals (Sweden)

Edno Magalhães

2004-04-01

Full Text Available OBJETIVO: A bupivacaína racêmica, utilizada largamente em anestesia peribulbar devido à boa qualidade de bloqueio motor, apresenta menor margem de segurança para cardiotoxicidade em relação a ropivacaína e bupivacaína levógira. O objetivo deste estudo foi comparar o grau de bloqueio motor e alteração da pressão intra-ocular (PIO em anestesia peribulbar produzida pela bupivacaína racêmica, levobupivacaína e ropivacaína. MÉTODOS: Noventa e sete pacientes, estado físico I e II da classificação da Sociedade Americana de Anestesiologistas, submetidos a anestesia peribulbar, foram divididos em três grupos: grupo A-(n=16 bupivacaína racêmica 0,75% com adrenalina 1:200.000; grupo B -(n=16 bupivacaína levógira 0,75% com adrenalina 1:200.000; grupo C -(n=15 ropivacaína 0,75%. Utilizou-se 7ml da solução anestésica com 280 UI de hialuronidase, em punção única no rebordo orbital inferior. Foram registrados a PIO e grau de bloqueio motor 5 minutos antes da punção e 1, 2, 3, 4, 5 e 10 minutos após a punção. O bloqueio motor foi avaliado pela escala de Nicoll. Para a análise estatística, foram utilizados os testes de Wilcoxon, análise de freqüência simples e t de Student. Foi considerado significativo pBACKGROUND AND OBJECTIVE: Racemic bupivacaine, used in peribulbar anesthesia owing to its high potential to promote motor blockade, presents a smaller safety margin for cardiotoxicity in relation to ropivacaine and levobupivacaine. The objective of this study was to compare the degree of motor blockade and alteration of intraocular pressure (IOP produced by racemic bupivacaine, levobupivacaine and ropivacaine in peribulbar block. METHOD: Ninety seven patients, ASA physical status I and II, submitted to peribulbar anesthesia, were randomly allocated into three groups: group A-(n=16 receiving racemic bupivacaine 0.75% with epinephrine 1:200.000; group B -(n=16 levobupivacaine 0.75% with epinephrine 1:200.000; group C -(n=15

Evaluation of shear bond strength of metal bracket to enamel after application of primers over bracket base-an in vitro study

Directory of Open Access Journals (Sweden)

Firuzbakht MM

2011-04-01

Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.

A finite element primer for beginners the basics

CERN Document Server

Zohdi, Tarek I

2014-01-01

The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

Transport phenomena in Newtonian fluids a concise primer

CERN Document Server

Olsson, Per

2013-01-01

This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

Science.gov (United States)

Mendrek, M. J.

1992-01-01

A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

Directory of Open Access Journals (Sweden)

Irma Suriyani

2015-05-01

Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

Anestesia para paciente portador da equência de moebius: relato de caso Anestesia para Paciente Portador de la Secuencia de Moebius: relato de Caso Anesthesia in a patient with moebius sequence: case report

Directory of Open Access Journals (Sweden)

Adriano Bechara de Souza Hobaika

2009-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A sequência de Moebius (SM é uma rara paralisia do VI e VII nervos cranianos. Alterações craniofaciais estão presentes em aproximadamente 90% destes pacientes, o que pode tornar a intubação traqueal muito difícil. RELATO DO CASO: Paciente do sexo masculino, 2 anos e 5 meses, portador de SM, submetido à broncoscopia flexível para avaliação de laringotraqueomalácia. Comorbidades: crises de broncoespasmo e comunicação interventricular. Realizou-se indução anestésica com sevoflurano em O2 a 100% e venóclise. Introduziu-se máscara laríngea AMBU® número 2,5 e o fibrobroncoscópio foi introduzido através da mesma. O procedimento foi realizado sem complicações e a broncoscopia revelou-se normal. O paciente recebeu alta para casa após duas horas. CONCLUSÕES: O controle das vias aéreas é o grande desafio nestes pacientes, havendo relato de falha ou dificuldade de intubação em 13 pacientes de uma série de 41 casos analisados. Micrognatia, retrognatia, hipoplasia mandibular e fenda palatina são algumas características destes pacientes. Em outra grande série com 106 anestesias em pacientes com SM há descrição do uso da máscara laríngea em um caso. Parece não haver contra-indicação a realizar o procedimento em regime ambulatorial. Há relato de aspiração pulmonar e obstrução respiratória na sala de recuperação devido à dificuldade em deglutir e eliminar as secreções da boca e recomenda-se administrar antisialogogos.JUSTIFICATIVA Y OBJETIVOS: La secuencia de Moebius (SM es una rara parálisis del VI y VII nervios cranianos. Las alteraciones craneofaciales están presentes en aproximadamente un 90% de esos pacientes, lo que puede hacer con que la intubación traqueal sea muy difícil. RELATO DEL CASO: Paciente del sexo masculino, 2 años y 5 meses, portador de SM, sometido a la broncoscopia flexible para la evaluación de laringotraqueomalacia. Comorbidades: crisis de broncoespasmo

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

International Nuclear Information System (INIS)

Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

2017-01-01

Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

Directory of Open Access Journals (Sweden)

Esther Lantero

2017-07-01

Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

Energy Technology Data Exchange (ETDEWEB)

Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

2017-07-01

Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

Perioperative management of a morbidly obese pregnant patient undergoing cesarean section under general anesthesia – case report

Directory of Open Access Journals (Sweden)

Márcio Luiz Benevides

2016-07-01

Full Text Available Background and objectives: The increased prevalence of obesity in the general population extends to women of reproductive age. The aim of this study is to report the perioperative management of a morbidly obese pregnant woman, body mass index >50 kg/m2, who underwent cesarean section under general anesthesia. Case report: Pregnant woman in labor, 35 years of age, body mass index 59.8 kg/m2. Cesarean section was indicated due to the presumed fetal macrosomia. The patient refused spinal anesthesia. She was placed in the ramp position with cushions from back to head to facilitate tracheal intubation. Another cushion was placed on top of the right gluteus to create an angle of approximately 15° to the operating table. Immediately before induction of anesthesia, asepsis was carried out and sterile surgical fields were placed. Anesthesia was induced in rapid sequence, with Sellick maneuver and administration of remifentanil, propofol, and succinilcolina. Intubation was performed using a gum elastic bougie, and anesthesia was maintained with sevoflurane and remifentanil. The interval between skin incision and fetal extraction was 21 min, with the use of a Simpson's forceps scoop to assist in the extraction. The patient gave birth to a newborn weighing 4850 g, with Apgar scores of 2 in the 1st minute (received positive pressure ventilation by mask for about 2 min and 8 in the 5th minute. The patient was extubated uneventfully. Multimodal analgesia and prophylaxis of nausea and vomiting was performed. Mother and newborn were discharged on the 4th postoperative day. Resumo: Justificativa e objetivos: O aumento na prevalência da obesidade na população geral se estende para mulheres na idade reprodutiva. O objetivo deste estudo é relatar o controle perioperatório de uma gestante obesa mórbida com índice de massa corporal >50 Kg/m2, submetida a parto cesariano sob anestesia geral. Relato do caso: Gestante de 35 anos com índice de massa corporal

Thinking in systems a primer

CERN Document Server

Meadows, Donella H

2008-01-01

In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions

Directory of Open Access Journals (Sweden)

Retno Asti Werdhani

2017-04-01

Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer     Family Acts in Cases Management In Primary Care through The Five Family Oriented Question   Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were

Evaluation of the shear bond strength of lingual brackets manufactured by three different processes using two different adhesive primers: An in vitro study

Directory of Open Access Journals (Sweden)

Shrinivas Ashtekar

2016-01-01

Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.

La Construcción de Políticas Turísticas Orientadas a los Sectores Medios Durante el Primer Peronismo: Argentina 1946-1955

OpenAIRE

Piglia, Melina; Pastoriza, Elisa

2017-01-01

En el marco general de los estudios de las políticas públicas durante el primer peronismo (Argentina 1946-1955), el presente trabajo pretende abordar aspectos descuidados de las políticas turísticas, desde una perspectiva de historia social. El artículo sostiene que, junto a las más conocidas transformaciones producidas en el campo del turismo obrero y el turismo social, se puede advertir durante el período peronista la puesta en marcha de políticas turísticas orientadas al turismo de los sec...

Conocimiento sobre Medicina Natural y Tradicional por residentes de Medicina General Integral

OpenAIRE

González Rodríguez, Raidel; Cardentey García, Juan

2016-01-01

Introducción: los residentes de Medicina General Integral requieren conocimientos de Medicina Natural y Tradicional para su práctica asistencial. Objetivo: evaluar el conocimiento de la Medicina Natural y Tradicional por residentes de Medicina General Integral. Materiales y Métodos: se realizó una investigación descriptiva, transversal y analítica en el Policlínico Docente "Raúl Sánchez Rodríguez" de Pinar del Río en el primer trimestre del año 2016. El universo estuvo conformado por 50 resid...

Towards a global antibiotic resistance surveillance system : a primer for a roadmap

NARCIS (Netherlands)

Grundmann, Hajo

The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

Primer Vector Optimization: Survey of Theory, new Analysis and Applications

Science.gov (United States)

Guzman

This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

Estado neurológico e cardiorrespiratório de filhotes de cães nascidos de parto normal ou de cesariana sob anestesia geral inalatória com sevofluorano Neurological and cardiocirculatory investigation of dog neonates born by normal parturition or cesarean section on sevoflurane inhalation anesthesia

OpenAIRE

Daniela Tozadore Gabas; Lidia Mitsuko Matsubara; Valéria Nobre Leal de Souza Oliva; Leandro Rodello; Cláudio Nazaretian Rossi; Silvia Helena Venturolli Perri

2006-01-01

A anestesia obstétrica possibilita um procedimento mais seguro para a mãe e para os fetos. Em medicina veterinária, no entanto, a literatura científica a respeito do assunto é deficiente. Este trabalho teve como objetivo avaliar o grau de depressão neurológica, hemodinâmica e respiratória fetais provocado pelo agente anestésico, em que as mães foram submetidas ao parto normal ou à cesariana, utilizando-se sevofluorano como agente de manutenção anestésica, comparando-o com o parto normal. Fora...

Effects of constant rate infusion of anesthetic or analgesic drugs on general anesthesia with isoflurane: A retrospective study in 200 dogs Efeitos da infusão intravenosa contínua de fármacos anestésicos ou analgésicos sobre a anestesia geral com isoflurano: Estudo retrospectivo em 200 cães

Directory of Open Access Journals (Sweden)

Sofia de Amorim Cerejo

2013-09-01

Full Text Available Constant rate infusion (CRI shows several advantages in balanced anesthesia, such as reduction of requirement for inhaled anesthetics and control of pain. The most commonly used drugs in these protocols are local anesthetics, dissociative, and opioids, which may be administered alone or in combinations. We evaluated the records of 200 dogs that underwent various surgical procedures with anesthetic or analgesic CRI in the perioperative period during 2011 and 2012 at the Veterinary Hospital of Franca University (Unifran, and identified possible complications during the transoperative period. Records evaluated included clinical state, laboratory tests, drugs used in premedication and induction, and CRI protocol. Acepromazine and morphine were the main drugs used in premedication. Propofol was used to induce anesthesia alone or in combination with other agents. We evaluated records of the 25 different CRI protocols. Fentanyl was the main drug employed in CRI, either alone or in combination. There were 128 episodes of anesthetic complications during CRI;the most common were hypotension, hypertension, and tachycardia, which occurred in 43 (32%, 35 (26.3%, and 19 (14.2% dogs, respectively. Cardiac arrhythmia was reported in only 4 dogs. Signs of respiratory depression were present in dogs treated with 6 different CRI protocols. The consumption of isoflurane (vol % reduced between 15.7% and 21.05% after 30minutes of the CRI in the fentanyl and fentanyl–lidocaine–ketamine CRI groups (pO uso de técnicas de infusão contínua (IC possui inúmeras vantagens na anestesia balanceada, como a redução do requerimento de anestésicos inalatórios e controle da dor. Os fármacos mais comumente utilizados nestes protocolos são os anestésicos locais, dissociativos e opioides, que podem ser administrados isoladamente ou em associações. Foram avaliados os prontuários de 200 cães que foram submetidos a diversos procedimentos cirúrgicos com IC de anest

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

Science.gov (United States)

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A primer on polymer nomenclature: Structure-based, sourced-based and trade names

Science.gov (United States)

Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

Directory of Open Access Journals (Sweden)

Luis A. Gomez-Puerta

2014-05-01

Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA

OpenAIRE

BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO

2004-01-01

Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.

A new set of validated SSR primers for application in mulberry ...

Indian Academy of Sciences (India)

user

2018-01-11

Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

Moessbauer spectroscopic study of corrosion products beneath primer coating containing anticorrosive pigments

International Nuclear Information System (INIS)

Kumar, A.V.R.; Nigam, R.K.

1998-01-01

The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)

A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

Directory of Open Access Journals (Sweden)

Andrés Alvarado

Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

Directory of Open Access Journals (Sweden)

Elif Çepni

2012-01-01

Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

Comparative evaluation of self-etching primers and phosphoric acid effectiveness on composite to enamel bond: an in vitro study.

Science.gov (United States)

Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay

2013-09-01

The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.

Anestesia no cardiovascular en el paciente con cardiopatía congénita y flujo pulmonar aumentado

Directory of Open Access Journals (Sweden)

Lincoln de la Parte Pérez

2003-12-01

Full Text Available Los lactantes y dentro de éstos los de menor edad y peso corporal, que padecen de cardiopatías congénitas con flujo pulmonar aumentado y son sometidos a anestesia para procedimientos quirúrgicos no cardiovasculares, tienen un gran riesgo anestésico, por lo que es necesario enfatizar que estos pacientes presentan habitualmente múltiples alteraciones anatómicas y de la fisiología cardiovascular con repercusión en diferentes órganos y sistemas, diversas enfermedades asociadas que empeoran el pronóstico y necesitan frecuentemente tratamiento médico con digitálicos, diuréticos y fármacos vasoactivos desde muy temprano, de modo que la evaluación preoperatoria, incluidas las investigaciones no invasivas, deben ser realizadas por cardiólogos experimentados y cuando se programan para procedimientos quirúrgicos, deben ser remitidos para un centro con recursos y la experiencia necesaria en el manejo de los pacientes con cardiopatías congénitas. Se presenta una revisión bibliográfica actualizada sobre el manejo anestésico de estos pacientes.Infants and among them the youngest and with the least body weight suffering from congenital heart diseases with increased pulmonary flow and who receive anesthesia to undergo noncardiovascular surgical procedures, are at a great anesthetic risk . That's why, it is necessary to make emphasis on the fact that these patients usually present multiple anatomical alterations and cardiovascular physiology disorders with repercussion on different organs and systems, diverse associated diseases that worsen the prognosis, and that they frequently need medical treatment with digitalis, diuretics and vasoactive drugs very early. Taking this into account, the preoperative evaluation, including non-invasive research should be carried out by experienced cardiologists and when they are scheduled for surgical procedures, they should be referred to a center with resources and the necessary experience in the

In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

Science.gov (United States)

Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

2017-01-01

The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

Science.gov (United States)

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.