WorldWideScience

Sample records for anestesia general primer

  1. Sevofluorano en la anestesia general del perro

    OpenAIRE

    Villalobos Núñez, Carmen María

    2002-01-01

    Para la realización de esta Tesis se han recogido datos de anestesias clínicas realizadas con sevofluorano, con el objeto de valorar los efectos de este agente anestésico en el sistema cardiorrespiratorio. Para ello se han recogido diversos parámetros cardiovasculares y respiratorios monitorizados durante toda la técnica anestésica, así como los tiempos de recuperación, con el objetivo de valorar la duración y calidad de la anestesia. El objetivo de esta Tesis es el estudio de validez clínica...

  2. Anestesia general en el conejo (General Anaesthesia in rabbit

    Directory of Open Access Journals (Sweden)

    Bimonte Patetta, Diego:

    2007-07-01

    Full Text Available Los autores realizan una revisión de las técnicas utilizadas para la anestesia en conejos (Oryctolagus cuniculus, relatando la xperiencia acumulada en 10 años de anestesia en esta especie bajo distintos regímenes: anestesia inyectable, inhalatoria, en uso tanto clínico como en la investigación. Se hace una descripción de las técnicas anestésicas utilizadas así como los procedimientos empleados tanto en anestesia inyectable como en inhalatoria en esta especie,así como la comparación de una de las técnicas de anestesia recomendada y la utilizada como base en nuestro quirófano.

  3. Anestesia general vs. peridural en colecistectomía laparoscópica

    OpenAIRE

    Edmundo Gónima; Juan Carlos Martínez; Claudia Perilla

    2007-01-01

    Objetivo. Este estudio fue diseñado para establecer las diferencias entre la anestesia general y la peridural en colecistectomía laparoscópica. Métodos. Se trata de un estudio clínico experimental, aleatorio, comparativo y prospectivo. Participaron 52 pacientes, ASA 1 y 2, programados para colecistectomía laparoscópica en la Clínica Universitaria Teletón. Los dos grupos recibieron premedicación con dipirona, ondansetrón y dexametasona. Al grupo asignado a anestesia peridural se le realizó pun...

  4. Estudo comparativo entre anestesia peridural torácica e anestesia geral em mastectomia oncológica Estudio comparativo entre la anestesia epidural torácica y la anestesia general en mastectomia oncológica Comparative study between thoracic epidural block and general anesthesia for oncologic mastectomy

    Directory of Open Access Journals (Sweden)

    Sérgio D. Belzarena

    2008-12-01

    utiliza a menudo para procedimientos estéticos de la mama y existen pocos relatos de su uso en mastectomías con exploración axilar. El presente estudio comparó la técnica con anestesia general en operaciones oncológicas de la mama. MÉTODO: Cuarenta pacientes que se dividieron en dos grupos. En el grupo epidural (n = 20 se hizo una epidural torácica con bupivacaína y fentanil asociados a la sedación con midazolam. El otro grupo (n = 20, recibió anestesia general convencional con propofol, atracurio y fentanil y mantenimiento con O2 e isoflurano. En el intraoperatorio y durante la operación, se verificó la necesidad de complementación de la anestesia o de la sedación y variables hemodinámicas. En el postoperatorio fue registrado el tiempo para el alta de la sala de recuperación postanestésica y hospitalaria, la intensidad del dolor y el consumo de analgésicos, efectos adversos y la satisfacción con la técnica anestésica. RESULTADOS: Los grupos fueron similares y no hubo diferencia en la duración de la operación. Se hizo necesario complementar la sedación en un 100% de las pacientes que recibieron anestesia epidural y en un 15% fue complementada la analgesia con infiltración de anestésico local en la axila. Hubo una mayor incidencia de hipertensión arterial en el grupo de la anestesia general y de hipotensión entre las que recibieron epidural. Ocurrió prurito en un 55% de las pacientes con anestesia epidural. Náusea (30% y vómito (45%, fueron más frecuentes entre las que recibieron anestesia general. La analgesia postoperatoria tuvo una mejor calidad y el consumo de analgésicos fue menor en el grupo de la anestesia epidural. El período de internación también fue menor. CONCLUSIONES: La técnica epidural tiene algunas ventajas con relación a la anestesia general y puede ser considerada una opción para la anestesia en mastectomías oncológicas con vaciado axilar.BACKGROUND AND OBJECTIVES: Thoracic epidural block is frequently used for

  5. Crisis de glaucoma agudo durante una laparotomía con el uso de anestesia general

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Llerena Rodríguez

    2003-03-01

    Full Text Available Se reporta el caso de una paciente del sexo femenino de 56 años de edad a la que se le realizó laparotomía con anestesia general orotraqueal con tiopental, succinilcolina, halotane, óxido nitroso y oxígeno sin que se observaran complicaciones inmediatas. A las 48 horas presentó el cuadro clínico correspondiente a un glaucoma agudo y, que por no ceder al tratamiento medicamentoso, se le realizó iridectomía periférica con anestesia local. En el análisis de los antecedentes patológicos familiares relacionados con la intervención quirúrgica para apendicectomía y de los medicamentos utilizados, se llegó a la conclusión de que la existencia de historia familiar de glaucoma en esta paciente, unida a la maniobra de laringoscopia, al uso de succinilcolina y la atropina fueron factores que de forma individual o asociados contribuyeron al ataque de glaucoma agudo.The case of a female patient aged 56 who underwent laparotomy with general orotracheal anesthesia with thiopental, succinylcholine, halothane, nitric oxide and oxigen was reported. No immediate complications were observed. 48 hours later he presented the clinical picture corresponding to acute glaucoma. As she did not respond to drug treatment, peripheral iridectomy was performed with local anesthesia. In the analysis of the family pathological history related with appendectomy and with the drugs used, it was concluded that the existance of glaucoma family history in this patient together with the laryngoscopy maneuver, the use of succinylcholine and atropine were factors that in an individual or associated way contributed to the acute glaucoma attack.

  6. Anestesia regional intravenosa primeiro centenário (1908-2008: Início, desenvolvimento e estado atual A anestesia regional intravenosa primer centenario (1908-2008: Inicio, desarrollo y estado actual Intravenous regional anesthesia first century (1908-2008: Beggining, development, and current status

    Directory of Open Access Journals (Sweden)

    Almiro dos Reis Jr

    2008-06-01

    desarrollos técnicos, fisiopatológicos, farmacológicos, farmacocinéticos y clínicos, para lo que la Anestesiología brasileña dio un gran aporte. Completando este año en 2008 su primer centenario, la anestesia regional intravenosa merece tener su historia conocida y la fecha no puede pasar desapercibida sino que debe ser recordada y festejada.BACKGROUND AND OBJECTIVES: Intravenous regional block is celebrating its 100th anniversary in 2008. Since this is a widely used technique, this milestone should be recorded, the date celebrated, Brazilian anesthesiologists should be remembered of its evolutive process, especially in the last 40 years, and we should pay homage to the individual who started it: August Karl Gustav Bier. CONTENTS: This report describes the beginning of locoregional anesthesia in general and regional intravenous block in particular, since the introduction of garroting of the extremities to the discovery and improvement of needles, syringes, and local anesthetics. The technical details used initially by Bier, and the pathophysiological and clinical concepts enounced by him at the beginning of the 20th Century are described. It describes the initial evolution and that of the following decades of intravenous regional block, lists national and international pioneers, explains the reasons for the relatively late scientific studies on the technique, and describes the main contributions that made it an effective and safe technique. Finally, it describes the current state of the main knowledge acquired over the years, such as the mechanism and site of action of the anesthetic and ischemia, the use of modern anesthetic solutions, improvement of postoperative analgesia and motor block, pharmacokinetic and pathophysiological concepts, and the best interpretation of possible complications. CONCLUSIONS: Intravenous regional block is the anesthetic technique created by A. K. G. Bier exactly 100 years ago. In the first half of the 20th Century, it evolved little and

  7. Anestesia peridural lombar ou bloqueio do plexo lombar combinados à anestesia geral: eficácia e efeitos hemodinâmicos na artroplastia total do quadril Anestesia epidural lumbar o bloqueo del plexo lumbar combinados con la anestesia general: eficacia y efectos hemodinámicos en la artroplastia total de la cadera Epidural lumbar block or lumbar plexus block combined with general anesthesia: efficacy and hemodynamic effects on total hip arthroplasty

    Directory of Open Access Journals (Sweden)

    Leonardo Teixeira Domingues Duarte

    2009-12-01

    avanzada y de las enfermedades asociadas a los pacientes. El objetivo del estudio, fue evaluar si el bloqueo del plexo lumbar combinado con la anestesia general, equivale a la anestesia epidural lumbar en cuanto a la eficacia del bloqueo nociceptivo, efectos hemodinámicos secundarios, dificultad en su ejecución e influencia en el sangramiento operatorio en pacientes sometidos a la ATC. MÉTODO: Pacientes estado físico ASA I a III que fueron ubicados aleatoriamente en los grupos Epidural y Lumbar. En el grupo Epidural, se realizó la anestesia epidural lumbar continua con la ropivacaína a 0,5% 10 a 15 mL. En el grupo Lumbar, fue realizado el bloqueo del plexo lumbar por la vía posterior con ropivacaína a 0,5% 0,4 mL.kg-1. Todos los pacientes fueron sometidos a la anestesia general. Se estudiaron: la dificultad en la ejecución de los bloqueos, su eficacia y los efectos hemodinámicos secundarios. RESULTADOS: Cuarenta y un pacientes fueron incluidos en el estudio. El tiempo para la ejecución del bloqueo epidural fue menor, pero el número de intentos en colocar la aguja fue similar en los dos grupos. El bloqueo epidural fue más eficaz. En el grupo Lumbar, se registró un aumento de la presión arterial diastólica y media (PAM y en el doble producto. Después de la incisión, el consumo anestésico durante la operación fue mayor. Posteriormente al bloqueo, la PAM fue menor en los 50, 60 y 70 minutos después de la realización del bloqueo epidural. El sangramiento fue parecido en los dos grupos. CONCLUSIONES: La técnica epidural promovió un bloqueo nociceptivo más eficaz sin asociarse a la inestabilidad hemodinámica, cuando se le combinó con la anestesia general. El bloqueo del plexo lumbar fue una técnica útil en combinación con la anestesia general cuando la anestesia epidural estuvo contraindicada.BACKGROUND AND OBJECTIVES: Anesthesia for total hip arthroplasty (THA is a challenge due to the advanced age and associated diseases of patients. The objective

  8. Anestesia espinal para colecistectomia

    Directory of Open Access Journals (Sweden)

    Nayibe Salamanca R

    2009-10-01

    Full Text Available Introducción: La anestesia espinal o subaracnoidea brinda al paciente calidad y múltiples ventajas. Sin embargo, en procedimientos quirúrgicos que comprometen al abdomen superior ha sido poco empleada, como en la colecistectomía. En estas cirugías, ya sean laparoscópicas o abiertas, se ha empleado de forma rutinaria la anestesia general. Objetivo: Describir la aplicación de anestesia espinal para la realización de colecistectomía abierta. Materiales y métodos: Es un estudio retrospectivo, serie de casos, que evaluó 32 pacientes ASA I y II a los que se les realizó colecistectomía abierta, bajo anestesia espinal, en el tiempo comprendido entre junio de 2002 y junio de 2004, en un Hospital Nivel II de la ciudad de Popayán, previo consentimiento aprobado por el Comité Científico del Hospital. Resultados: En 25 mujeres y 7 hombres, con edad media de 33,6 años, se observó que la frecuencia cardiaca y la presión arterial sistólica, diastólica y media disminuyeron durante los primeros 20 minutos; luego, sus valores se incrementaron hasta estabilizarse por debajo de los parámetros iniciales respectivos. El 34,3% de la población presentó eventos transoperatorios como hipotensión, bradicardia, náusea, vómito, dolor en hombro o dolor torácico. En dos de estos Caucapacientes fue necesario cambiar a anestesia general. En el postoperatorio, 21,7% de los pacientes presentaron efectos adversos: náusea, vómito y cefalea. El 90 % egresaron del hospital en las primeras 48 horas. No se reportó mortalidad intra o postoperatorio inmediata. Conclusiones: La anestesia espinal es una alternativa a tener en cuenta para procedimientos como la colecistectomía abierta.Introduction: Spinal anaesthesia offers patients quality as well as several advantages; however in surgical procedures which involve the upper abdomen it had been less employed in procedures such as cholecistectomy by laparoscopic technique or via opening the abdomen where the

  9. Anestesia geral após falha da raquianestesia para procedimento de urgência em paciente com mucopolissacaridose: relato de caso Anestesia general después de la falla de la anestesia raquidea para procedimiento de urgencia en paciente con mucopolisacaridosis: relato de caso General anesthesia after failed spinal block for emergency surgery in a patient with mucopolysaccharidosis: case report

    Directory of Open Access Journals (Sweden)

    Fabiano Timbó Barbosa

    2007-12-01

    presentar la conducta anestésica adoptada con paciente portador de muco polisacaridosis que se presentó en el centro quirúrgico para la realización de intervención quirúrgica de urgencia. RELATO DEL CASO: Paciente de 15 años, sexo masculino, con diagnóstico de muco polisacaridosis, llegó al centro quirúrgico para tratamiento de hernia umbilical encarcelada. Después de la monitorización, se sometió a la anestesia subaracnoidea con bupivacaina hiperbárica en la posición sentado. Después de identificar la falla en la anestesia raquidea, el paciente fue sometido a la anestesia general. La inducción anestésica fue realizada con clonidina, fentanil y propofol por vía venosa, seguida de intubación sin intercurrencias. Después de 45 minutos de procedimiento quirúrgico, el paciente fue extubado y llevado a recuperación anestésica. Allá estuvo por 12 horas bajo observación, recibiendo alta para enfermería sin haber tenido intercurrencias durante ese período. CONCLUSIONES: En el caso en cuestión, no hubo dificultad en el manejo de las vías aéreas. Sin embargo, ese es el principal problema encontrado en ese grupo de pacientes, cabiéndole al anestesiólogo escoger la mejor técnica para garantizar un adecuado manoseo de las vías aéreas.BACKGROUND AND OBJECTIVES: Mucopolysaccharidosis are a group of heterogenous disorders secondary to the deficiency of a lysosomal enzyme, with accumulation of acid mucopolysaccharides in the tissues. It carries a 20% perioperative mortality rate due mainly to difficulties on handling the airways. The objective of this report was to present the anesthetic approach of a patient with mucopolysaccharidosis who presented in the operating room for emergency surgery. CASE REPORT: A 15 year-old male patient with a diagnosis of mucopolysaccharidosis was admitted to the operating room for treatment of an incarcerated umbilical hernia. After monitoring, a subarachnoid block with hyperbaric bupivacaine was performed with the patient

  10. Anestesia peridural contínua com ropivacaína a 0,2% associada a anestesia geral para cirurgia do abdômen superior em crianças Anestesia peridural contínua con ropivacaína a 0,2% asociada a anestesia general para cirugía del abdomen superior en niños Continuous epidural anesthesia with 0.2% ropivacaine associated to general anesthesia for upper abdominal surgery in children

    Directory of Open Access Journals (Sweden)

    Jyrson Guilherme Klamt

    2003-04-01

    pacientes do grupo Sufentanil. CONCLUSÕES: A combinação da anestesia peridural torácica contínua com ropivacaína a 0,2% (1,5 ml.kg-1 associada à infusão de propofol promove anestesia efetiva e segura para cirurgias abdominais altas em crianças. O ritmo de infusão de propofol e o tempo de sedação foram reduzidos com a adição de sufentanil.JUSTIFICATIVA Y OBJETIVOS: Técnicas anestésicas han sido empleadas en pacientes pediátricos para varios tipos de cirugías, presentando entre otras ventajas, la analgesia pós-operatoria. El objetivo de este estudio fue evaluar el ritmo de infusión de propofol y la recuperación pós-anestésica de niños sometidos a cirugía abdominal alta bajo anestesia peridural torácica con ropivacaína a 0,2%, asociada a anestesia general con propofol o propofol más sufentanil. MÉTODO: Veintiséis niños ASA I, II y III, con edades entre 0 y 4 años, sometidos a cirugía abdominal alta fueron seleccionados para anestesia peridural torácica (T7-T8 con ropivacaína a 0,2% (1,5 ml.kg-1. Fueron divididos aleatoriamente en dos grupos: Propofol (infusión de propofol y Sufentanil (infusión de propofol más sufentanil 1 µg.kg-1. Los ritmos de infusiones de propofol fueron de 20 y 10 mg.kg-1.h-1 en los grupos Propofol y Sufentanil, respectivamente, ajustadas de modo a mantener la presión arterial cerca de 20% de los valores pré-inducción e interrumpidas 10 a 15 minutos antes del final estimado de la cirugía. La recuperación pós-anestésica fue evaluada a través de una escala modificada de Aldrete-Kroulik y sedación evaluada a través de una escala de 5 puntos. RESULTADOS: Dos niños de cada grupo fueron excluidos por problemas técnicos. El ritmo de infusión fue significativamente menor en el grupo Sufentanil en relación al grupo Propofol durante 100 minutos después del inicio de la cirugía. Los tiempos para extubación y transferencia para la sala de recuperación pós-anestésica (SRPA fueron significativamente menores en

  11. Complicações e seqüelas neurológicas da anestesia regional realizada em crianças sob anestesia geral: um problema real ou casos esporádicos? Complicaciones y secuelas neurológicas de la anestesia regional realizada en niños bajo anestesia general: ¿ Un problema real o casos esporádicos? Neurological complications and damage of regional block in children under general anesthesia: a real problem or sporadic cases?

    OpenAIRE

    Verônica Vieira da Costa; Mônica Rossi Rodrigues; Maria do Carmo Barretto de Carvalho Fernandes; Renato Ângelo Saraiva

    2006-01-01

    JUSTIFICATIVA E OBJETIVOS: Tem sido discutido se a técnica de anestesia regional em crianças, que na maioria das vezes é realizada após a anestesia geral, é realmente segura. Há o risco potencial de uma lesão neurológica permanente ou temporária quando o paciente não pode informar eventual parestesia ou dor, durante a realização da anestesia regional, o que gera insegurança por parte dos anestesiologistas. O objetivo deste estudo foi avaliar a prevalência de complicações e seqüelas neurológic...

  12. PD5: A General Purpose Library for Primer Design Software

    OpenAIRE

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliab...

  13. Efeito da anestesia geral na cognição e na memória do idoso Efecto de la anestesia general en la cognición y memoria del paciente de edad avanzada Effects of general anesthesia in elderly patients’ memory and cognition

    Directory of Open Access Journals (Sweden)

    Régis Borges Aquino

    2004-10-01

    7 horas.JUSTIFICATIVA Y OBJETIVOS: La anestesia general y la función mental han sido objetivos de estudios y consideraciones, especialmente por el sentimiento de que ella, particularmente en paciente de edad avanzada, podría inducir alteraciones en la cognición y en la memoria. El objetivo de esa pesquisa fue evaluar el efecto de la anestesia general en la cognición y en la memoria del paciente de edad avanzada correlacionándola al sexo, a la edad y al tiempo de anestesia. MÉTODO: Estudio de coorte controlado realizado en pacientes categorizados en dos grupos de observación: a- anestésico; b- clínicos (controle. Las variables del resultado consideradas fueron los escores del teste MiniMental, del teste de Fluencia Verbal y del test de Recuerdo Numérico. Anestesia general con halotano, isoflurano, sevoflurano, tiopental, propofol, etomidato, fentanil alfentanil, succinilcolina atracúrio, pancuronio. Intra-operatorio con PaCO2 entre 30 y 45 mmHg y saturación de hemoglobina superior a 90% y tolerancia de PA con disminución hasta 20% del valor basal. Fueron excluidos pacientes que presentaron algún evento adverso en el intra y pos-operatorio. Datos categóricos analizados por el test del Qui-cuadrado. La comparación inicial entre los grupos en el momento basal (pre-anestésico fue realizada por la t de Student para muestras independientes. Para evaluación del efecto del proceso anestésico a lo largo del tiempo, fue utilizado el análisis de variancia (ANOVA para medidas repetidas. RESULTADOS: En el teste del MiniMental los grupos presentaron comportamiento semejante siendo notado aumento de escores a lo largo del tiempo. En el test de Fluencia Verbal, en ambos los grupos los escores se mantuvieron prácticamente inalterados. En el test de Recuerdo Numérico el comportamiento de los grupos fue muy semejante a lo largo del seguimiento siendo que los escores aumentaran en ambos los grupos. CONCLUSIONES: No fue detectado declinio de cognición o de memoria

  14. Atelectasia pulmonar em cães durante anestesia geral Pulmonary atelectasis in dogs during general anesthesia

    Directory of Open Access Journals (Sweden)

    Patrícia Cristina Ferro Lopes

    2010-02-01

    Full Text Available A pressão intrapleural normalmente é menor que a pressão intrapulmonar. Consequentemente , os pulmões tendem ao colapso e se retraem, afastando-se da parede torácica. No início do século XX, Pasteur descreveu a atelectasia pulmonar, que ocorre com frequência durante a indução anestésica, persiste no período pós-operatório e pode contribuir de maneira significativa para a morbidade e o aumento nos gastos com medicamentos. Em medicina veterinária, no entanto, a atelectasia não é frequentemente diagnosticada, apesar de que isso não implica afirmar que tal afecção não ocorra, visto que existem relatos do desenvolvimento desse quadro em cães e em outras espécies. No contexto da anestesia geral, essa complicação pulmonar pode ser encontrada em animais que respiram 80 a 100% de oxigênio. A partir dessas informações, torna-se necessário que o profissional da anestesiologia veterinária obtenha conhecimentos complementares sobre o tema. Com este trabalho, objetivou-se descrever alguns dos mecanismos da atelectasia e seus pontos relevantes, de modo a familiarizar os profissionais quanto aos pormenores dessa importante, e nem sempre bem compreendida, alteração fisiológica respiratória.Pleural pressure is usually lower than pulmonary pressure. Therefore, the lungs tend to collapse and increase its distance from thoracic walls. At the beginning of 20th century, Pasteur described the pulmonary atelectasis, which develops during induction of anesthesia and persists to the postoperative period. It can contribute significantly to morbidity and to increase the medical expenses. In veterinary medicine, pulmonary atelectasis is not frequently diagnosed, which doesn't rule out the occurrence of this disease, since there are reports of atelectsasis in dogs. This pulmonary complication can be found in animals that breathe 80% to 100% oxygen in anesthetic procedures. Based on this information, the veterinary anesthesiologist is required

  15. Anestesia neuroaxial comparada à anestesia geral para revascularização dos membros inferiores em idosos: revisão sistemática com metanálise de ensaios clínicos aleatórios Anestesia neuroaxial comparada a la anestesia general para la revascularización de los miembros inferiores en ancianos: revisión sistemática con metanálisis de ensayos clínicos aleatorios Neuroaxis block compared to general anesthesia for revascularization of the lower limbs in the elderly: a systematic review with metanalysis of randomized clinical studies

    Directory of Open Access Journals (Sweden)

    Fabiano Timbó Barbosa

    2009-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A controvérsia atual é saber se a anestesia neuroaxial (AN é mais eficiente que a geral (AG em idosos submetidos à cirurgia não-cardíaca. O objetivo foi determinar a eficiência da AN comparada à AG para revascularização de membros inferiores (RMI em idosos. MÉTODO: Utilizada estratégia de busca para as bases de dados: MEDLINE (1955 a 2007, CINHAL ( 1982 a 2007, Embase (1980 a 2007, LILACS (1982 a 2007 e ISI (1945 a 2007. Dois revisores analisaram independentemente os artigos em busca de ensaios clínicos aleatórios (ECA que comparassem a AN com a AG para a RMI. O texto completo dos ECA que atendessem aos critérios de inclusão foram analisados. Discordâncias foram analisadas em reuniões de consenso. A metanálise foi realizada com o software Review Manager, por meio da razão de chances com intervalo de confiança de 95%. RESULTADOS: Foram selecionados três artigos originais envolvendo 465 pacientes. Não houve significância estatística na metanálise das variáveis: mortalidade (OR: 0,90; IC 95%: 0,30 - 2,73; P = 0,85 raquianestesia; OR: 1,30; IC 95%: 0,38 - 4,48; P = 0,68 anestesia peridural, infarto miocárdico (OR: 1,38; IC 95%: 0,29 - 6,46; P = 0,68 e taxa de amputação dos membros inferiores (OR: 0,81; IC 95%: 0,30 - 2,19; P = 0,68 raquianestesia; OR: 0,70; IC 95%: 0,24 - 2,07; P = 0,52 anestesia peridural. Houve significância estatística para pneumonia (OR: 0,37; IC 95%: 0,15 - 0,89; P = 0,03, porém houve heterogeneidade clínica. CONCLUSÕES: As evidências geradas nessa metanálise foram insuficientes para demonstrar que a AN é mais eficiente, equivalente, ou menos eficiente quando comparada a AG para RMI em idosos.JUSTIFICATIVA Y OBJETIVOS: La controversia actual es saber si la anestesia neuroaxial (AN es más eficaz que la anestesia general (AG en ancianos sometidos a la cirugía no cardíaca. El objetivo fue determinar la eficacia de la AN comparada con la AG para revascularizaci

  16. Complicações respiratórias em pacientes com paralisia cerebral submetidos à anestesia geral Complicaciones respiratorias en pacientes con parálisis cerebral sometidos a la anestesia general Respiratory complications in patients with cerebral palsy undergoing general anesthesia

    Directory of Open Access Journals (Sweden)

    Sérgio Silva de Mello

    2007-10-01

    álisis cerebral (PC puede representar un desafío para el anestesiólogo. Este estudio prospectivo tuvo como objetivo determinar la prevalencia y el riesgo de complicaciones respiratorias en niños con PC sometidos a anestesia general inhalatoria para tomografía computadorizada. MÉTODO: Participaron del estudio pacientes con edades entre 1 y 17 años, estado físico ASA I a III, sometidos a AGI con sevoflurano y máscara laríngea para TC en el período de junio/2002 a junio/ 2003, divididos en 3 grupos: PC tetraplégicos (PCT, Otros tipos de PC (PCO, y paciente sin PC (NPC. Los padres o responsables respondieron a un cuestionario con preguntas sobre el historial médico de los pacientes, infección de vías aéreas superiores (IVAS, asma, convulsión, no coordinación oro faríngea, reflujo gastroesofágico, etc. Datos sobre la incidencia y la gravedad de las complicaciones respiratorias fueron recolectados proscpectivamente (tos, bronco espasmo, laringo espasmo, hipoxemia, aspiración. La muestra fue calculada para una incidencia esperada de 5% en el grupo NPC, con una diferencia de 15% entre los grupos (alfa = 0,05 y beta = 0,1, utilizando los tests del Chi-cuadrado, exacto de Fisher y t de Student. RESULTADOS: Conformaron la muestra 290 pacientes divididos en los grupos de la siguiente forma: PCT - 100, PCO - 79 y NPC- 111. No hubo diferencia en la prevalencia de complicaciones respiratorias entre los grupos PCT (4%, PCO (8,9% y NPC (7,3%. Hubo una asociación entre la presencia de IVAS y la incidencia de complicaciones (riesgo relativo 10,71. CONCLUSIONES: Niños con parálisis cerebral tipo tetraplegia espástica no parecen correr riesgo aumentado de complicaciones respiratorias durante la anestesia general inhalatoria con sevoflurano y máscara laríngea. El estudio confirma IVAS como factor de riesgo para la incidencia de esas complicaciones.BACKGROUND AND OBJETIVES: Anesthesia in patients with cerebral palsy (CP poses a challenge for the anesthesiologist. The objective

  17. Regressão da anestesia geral em pacientes com paralisia cerebral: estudo comparativo utilizando o índice bispectral Regresión de la anestesia general en pacientes con parálisis cerebral: estudio comparativo utilizando el índice bispectral Regression of general anesthesia in patients with cerebral palsy: a comparative study using the bispectral index

    Directory of Open Access Journals (Sweden)

    Verônica Vieira da Costa

    2006-10-01

    ésica, versus 41,9% dos pacientes com PC. CONCLUSÕES: Os pacientes com paralisia cerebral apresentaram retorno mais lento da consciência em comparação com o grupo-controle.JUSTIFICATIVA Y OBJETIVOS: Se ha descrito que los pacientes con parálisis cerebral (PC son más sensibles a los agentes anestésicos, lo que podría comprometer el despertar de la anestesia. El objetivo de este estudio fue el de evaluar la recuperación de pacientes con PC comparada a los pacientes sin enfermedad del SNC. MÉTODO: Participaron del estudio niños de 5 a 15 años, divididos en dos grupos: con diagnóstico de parálisis cerebral y sin la enfermedad del SNC. Todos se sometieron a anestesia general con sevoflurano asociado a óxido nitroso y oxígeno a 50%. Además de la monitorización habitualmente empleada fueron monitorizados con el EEG-BIS. Durante el despertar de la anestesia, la extubación traqueal y el posanestésico inmediato, se avaluó la regresión de la anestesia según los criterios adoptados por Saraiva. También se evaluó la velocidad de eliminación de los agentes anestésicos correlacionándola con los valores de EEG-BIS y comparándola con los dos grupos de pacientes. El análisis estadístico se realizó a través del análisis de exploración de datos y prueba estadística para la comparación de promedios, considerando como diferencia estadística significativa el valor de p menor o igual a 5%. RESULTADOS: Se evaluaron 56 pacientes siendo 31 con PC y 25 sin enfermedad del SNC. Los grupos fueron homogéneos con relación a la edad y el sexo. El valor del EEG-BIS basal de los pacientes con PC fue menor que el grupo control, con diferencia estadística significativa (p = 0,04. En los cinco primeros minutos después de la interrupción del sevoflurano, el valor del EEG-BIS de los pacientes con PC presentó una elevación más lenta con relación al control. La velocidad de eliminación del agente anestésico fue semejante en los dos grupos. A los quince minutos 48% de los

  18. The proper generalized decomposition for advanced numerical simulations a primer

    CERN Document Server

    Chinesta, Francisco; Leygue, Adrien

    2014-01-01

    Many problems in scientific computing are intractable with classical numerical techniques. These fail, for example, in the solution of high-dimensional models due to the exponential increase of the number of degrees of freedom. Recently, the authors of this book and their collaborators have developed a novel technique, called Proper Generalized Decomposition (PGD) that has proven to be a significant step forward. The PGD builds by means of a successive enrichment strategy a numerical approximation of the unknown fields in a separated form. Although first introduced and successfully demonstrated in the context of high-dimensional problems, the PGD allows for a completely new approach for addressing more standard problems in science and engineering. Indeed, many challenging problems can be efficiently cast into a multi-dimensional framework, thus opening entirely new solution strategies in the PGD framework. For instance, the material parameters and boundary conditions appearing in a particular mathematical mod...

  19. Complicações respiratórias em pacientes com paralisia cerebral submetidos à anestesia geral Complicaciones respiratorias en pacientes con parálisis cerebral sometidos a la anestesia general Respiratory complications in patients with cerebral palsy undergoing general anesthesia

    OpenAIRE

    Sérgio Silva de Mello; Ronaldo Soares Marques; Renato Ângelo Saraiva

    2007-01-01

    JUSTIFICATIVA E OBJETIVOS: Anestesia em pacientes com paralisia cerebral (PC) pode representar um desafio para o anestesiologista. Este estudo prospectivo teve como objetivo determinar a prevalência e o risco de complicações respiratórias em crianças com PC submetidas à anestesia geral inalatória (AGI) para tomografia computadorizada (TC). MÉTODO: Participaram do estudo pacientes com idades entre 1 e 17 anos, estado físico ASA I a III, submetidos a AGI com sevoflurano e máscara laríngea para ...

  20. Anestesia espinal para colecistectomía

    Directory of Open Access Journals (Sweden)

    Nayibe Salamanca R

    2007-04-01

    Full Text Available Introducción : La anestesia espinal o subaracnoidea brinda al paciente calidad y múltiples ventajas. Sin embargo, en procedimientos quirúrgicos que comprometen al abdomen superior ha sido poco empleada, como en la colecistectomía. En estas cirugías, ya sean laparoscópicas o abiertas, se ha empleado de forma rutinaria la anestesia general. Objetivo: Describir la aplicación de anestesia espinal para la realización de colecistectomía abierta. Materiales y métodos: Es un estudio retrospectivo, serie de casos, que evaluó 32 pacientes ASA I y II a los que se les realizó colecistectomía abierta, bajo anestesia espinal, en el tiempo comprendido entre junio de 2002 y junio de 2004, en un Hospital Nivel II de la ciudad de Popayán, previo consentimiento aprobado por el Comité Científico del Hospital. Resultados : En 25 mujeres y 7 hombres, con edad media de 33,6 años, se observó que la frecuencia cardiaca y la presión arterial sistólica, diastólica y media disminuyeron durante los primeros 20 minutos; luego, sus valores se incrementaron hasta estabilizarse por debajo de los parámetros iniciales respectivos. El 34,3% de la población presentó eventos transoperatorios como hipotensión, bradicardia, náusea, vómito, dolor en hombro o dolor torácico. En dos de estos pacientes fue necesario cambiar a anestesia general. En el postoperatorio, 21,7% de los pacientes presentaron efectos adversos: náusea, vómito y cefalea. El 90 % egresaron del hospital en las primeras 48 horas. No se reportó mortalidad intra o postoperatorio inmediata. Conclusiones: La anestesia espinal es una alternativa a tener en cuenta para procedimientos como la colecistectomía abierta.Introduction: Spinal anaesthesia offers patients quality as well as several advantages; however in surgical procedures which involve the upper abdomen it had been less employed in procedures such as cholecistectomy by laparoscopic technique or via opening the abdomen where the

  1. Anestesia venosa total (AVT em lactente com doença de Werdnig-Hoffmann: relato de caso Anestesia general intravenosa (AVT en lactante con enfermedad de Werdnig-Hoffmann: relato de caso Total intravenous anesthesia (TIVA in an infant with Werdnig-Hoffmann disease: case report

    Directory of Open Access Journals (Sweden)

    Marco Antonio Cardoso de Resende

    2010-04-01

    á presente después del nacimiento su pronóstico empeora. La debilidad muscular simétrica, la arreflexia y las fasciculaciones de la lengua son sus características. La mayoría de los lactantes fallece antes de los dos años por insuficiencia respiratoria. El presente relato presenta un caso con la técnica venosa total durante la anestesia. RELATO DEL CASO: Paciente femenina, blanca, de un año, 10 kg, estado físico ASA III, con enfermedad de Werdnig-Hoffmann diagnosticada desde los dos meses de edad. Candidata a la gastrostomía y fundoplicatura en la técnica abierta y traqueostomía. Monitorización con cardioscopio, presión arterial no invasiva, oxímetro de pulso, estetoscopio precordial y temperatura rectal posterior a la venoclisis. Fue preoxigenada y después de recibir el bolo de atropina (0,3 mg, se le realizó la inducción anestésica con remifentanil bolo (20 µg y propofol (30 mg. Después de la intubación traqueal fue ventilada de forma controlada manualmente, en sistema sin absorvedor de CO2, Baraka, FAG de 4 L.min-1, FiO2 0,5 (0(2/N(20. Mantenida bajo anestesia con propofol 250 µg.kg-1.min-1 y remifentanil 0,3 µg.kg-1.min-1 en infusión continua manual. El tiempo quirúrgico fue de 150 minutos. El despertar se dio en 8 minutos después del término de la infusión, con ventilación espontánea. A las dos horas, fue transferida a la unidad pediátrica y recibió alta al 4º día del postoperatorio. CONCLUSIONES: La elección de la técnica anestésica prioriza la seguridad que proviene de la familiaridad del manejo de los fármacos existentes. En los niños con enfermedades neuromusculares, la anestesia general intravenosa con remifentanil y propofol en sistemas de infusión, por la duración de la acción extremadamente corta, puede influir en la evolución de la enfermedad favorablemente.BACKGROUND AND OBJECTIVES: Werdnig-Hoffmann disease is the most common cause of hypotonia in infants and its prognosis is worse if it is present shortly after

  2. Citocinas e anestesia

    Directory of Open Access Journals (Sweden)

    João Batista Santos Garcia

    2002-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Vários trabalhos têm abordado as citocinas que podem ser estimuladas e liberadas por lesão cirúrgica, trauma, infecção, inflamação e câncer. Níveis elevados circulantes das citocinas parece ter implicações no aparecimento de complicações e retardo da recuperação pós-operatória de pacientes. O objetivo da presente revisão é resumir as informações hoje disponíveis sobre citocinas. CONTEÚDO: As citocinas são moléculas polipeptídicas produzidas por uma grande variedade de células e parecem não ter função na homeostase, sob condições normais. Esses mediadores são responsáveis por respostas locais ou sistêmicas, gerando alterações imunológicas, metabólicas, hemodinâmicas, endócrinas e neurais. Podem ativar respostas biológicas benéficas, como estimulação da função antimicrobiana, cicatrização de feridas, mieloestimulação e mobilização de substratos. No entanto, a secreção abundante de citocinas está associada a efeitos deletérios como hipotensão arterial, falência de órgãos e morte. CONCLUSÕES: Ao concluir esta revisão, fica evidente que as citocinas desempenham um papel de fundamental importância como mediadores de respostas metabólicas, hormonais, imunológicas e hematológicas, que há potencial terapêutico com o bloqueio de sua expressão e que a anestesia pode interferir de alguma forma na sua ativação. No entanto, muitas perguntas não estão ainda respondidas e estudos devem ser realizados nos próximos anos buscando esclarecer as ações das citocinas não só para a experimentação mas também para a prática clínica.

  3. Ablação curativa da fibrilação atrial: comparação entre sedação profunda e anestesia geral Curative ablation of atrial fibrillation: comparison between deep sedation and general anesthesia

    Directory of Open Access Journals (Sweden)

    Elizabeth Bessadas Penna Firme

    2012-12-01

    Full Text Available OBJETIVO: Comparar sedação profunda com anestesia geral para ablação curativa de fibrilação atrial. MÉTODOS: Estudo prospectivo, aleatório, com 32 pacientes, idades entre 18 e 65 anos, ASA 2 e 3, IMC d" 30kg/m², distribuídos em dois grupos: sedação profunda (G1 e anestesia geral (G2. Todos receberam midazolan (0,5mg/kg venoso. O G1 recebeu propofol (1mg/kg e máscara facial de O2, seguido da infusão contínua de propofol (25-50mg/kg/min e remifentanil (0,01-0,05µg/kg/min. O G2 recebeu propofol (2mg/kg e máscara laríngea com tubo de drenagem, seguido da infusão contínua de propofol (60-100mg/kg/min e remifentanil (0,06-0,1µg/kg/min. Foram comparados: frequência cardíaca, pressão arterial invasiva, complicações, recidiva (desfecho em três meses e gasometrias. RESULTADOS: Os pacientes do G1 apresentaram gasometrias arteriais com níveis de PaCO2 maiores e pH menores (p=0,001 e maior incidência de tosse. Ocorreu diminuição da PAM e FC no G2. Exceto a tosse, as complicações e recidivas foram semelhantes em ambos os grupos. CONCLUSÃO: Ambas as técnicas podem ser utilizadas para a ablação curativa da fibrilação atrial. A anestesia geral proporcionou menores alterações respiratórias e maior imobilidade do paciente.OBJECTIVE: To compare deep sedation with general anesthesia for curative ablation of atrial fibrillation. METHODS: We conducted a prospective, randomized study with 32 patients, aged between 18 and 65 years, ASA 2 and 3, BMI d" 30kg/m2, divided into two groups: deep sedation (G1 and general anesthesia (G2. All patients received intravenous midazolam (0.5 mg / kg. G1 received propofol (1mg/kg and O2 by facemask, followed by continuous infusion of propofol (25-50mg/kg/min and remifentanil (0.01-0.05 mg / kg / min. G2 received propofol (2mg/kg and laryngeal mask with built-in drain tube, followed by continuous infusion of propofol (60-100mg/kg/min and remifentanil (0.06 to 0.1g/kg/min. We compared heart rate

  4. Anestesia geral com propofol em cães pré-tratados com acepromazina e alfentanil General anesthesia with propofol in dogs premedicated with acepromazine and alfentanil

    Directory of Open Access Journals (Sweden)

    Silvia Renata Gaido Cortopassi

    2000-08-01

    Full Text Available Foram utilizados 30 cães, sem raça definida, adultos, (10 machos e 20 fêmeas, com peso médio de 14,44 ± 2,72kg, distribuídos em três grupos. O grupo I (GI recebeu a associação de 0,1 mg/kg de acepromazina, 0,05mg/kg de alfentanil e 6,0mg/kg de propofol; o grupo H (GII O,1 mg/kg de acepromazina, O,1ml/kg de solução fisiológica e 6,0mg/kg de propofol; e o grupo III (GIII recebeu 0,05 ml/kg de solução fisiológica, 0,05mg/kg de alfentanil e 6,0mg/kg de propofol. Todos os fármacos foram administrados através da via intravenosa. Houve bradicardia intensa e de curta duração nos animais dos grupos I e III após a administração do alfentanil, tendo a frequência cardíaca se restabelecido após a indução da anestesia. No atinente à pressão arterial, os animais dos grupos l e II apresentaram hipotensão acentuada, havendo recuperação dos índices pressóricos apenas do GII. As três associações anestésicas promoveram alterações dos valores obtidos na hemogasometria arterial, verificando-se aumento da PaCO2 e decréscimo do pH, PaO2 e SaO2 o que se traduz em depressão respiratória, sendo que nos animais tratados com alfentanil o grau de depressão foi mais grave. O alfentanil ainda promoveu aumento significativo da frequência respiratória. A indução anestésica nos três grupos experimentais foi suave, não se observando fenômenos excitatórios. O propofol, como agente indutor, mostrou ser fármaco potente e seguro, não tendo ocorrido depressão das funções cardiovasculares e respiratórias. A acepromazina e a associação de acepromazina e alfentanil como medicações pré-anestésicas são efetivas, pois contribuíram para obtenção de técnica anestésica isenta de efeitos adversos, não se observando excitação ou mioclonia.The objective of this study was to evaluate the effects of three different associations: acepromazine 0,1mg/kg, alfentanil 0,05mg/kg and propofol 6,0mg/kg (Group l; acepromazine 0,1mg

  5. Elaboración y evaluación de un doble torniquete para uso en anestesia regional intravenosa

    OpenAIRE

    Arteaga V., Rafael; Ardila O., Carlos; Fonseca P., Jaime

    2011-01-01

    Los autores describen un doble torniquete para anestesia regional y de fácil construcción por la sencillez de sus componentes. En cinco voluntarios no se detectó escape del medio de contraste inyectado. La anestesia fue excelente en la gran mayoría de cincuenta pacientes operados en sus miembros. En ningún caso se observó toxicidad general por escape del anestésico local.

  6. Meningitis tras anestesia y analgesia espinal

    Directory of Open Access Journals (Sweden)

    M. Robles Romero

    2013-08-01

    Full Text Available El objetivo de esta revisión es una puesta al día en la etiología, diagnóstico, profilaxis y tratamiento de la meningitis tras anestesia y analgesia espinales. Aunque es una complicación mayor de esta técnica y su incidencia es baja, cada vez son más frecuentes los casos publicados en la literatura médica. Según su etiología se les clasifica en meningitis sépticas, víricas y asépticas. Las meningitis sépticas son las más frecuentes, y en su etiología cada vez juega un papel más destacado como agente implicado el estreptococo salivarius. Como meningitis asépticas se clasifican aquellas en las que el cultivo de líquido cefalorraquídeo es negativo, con un periodo de latencia de síntomas inferior a seis horas, que pueden cursar con eosinofilia en el líquido cefalorraquídeo y unos niveles cercanos a la normalidad en la glucorraquia. Suelen tener buena respuesta y evolución con tratamiento antibiótico con vancomicina y cefalosporinas de tercera generación. Como profilaxis incidir en las medidas de asepsia, sobre todo en el uso de mascarilla facial para realizar la técnica, como práctica para disminuir la incidencia de gérmenes cuyo origen está en la cavidad oral y orofaringe. Asimismo podrían reducir la incidencia de meningitis las medidas de asepsia tales como el lavado de manos, uso de guantes y asepsia de la piel. La diferenciación entre meningitis séptica y aséptica se hará con mayor seguridad cuando se estandaricen las técnicas para detectar genoma bacteriano en el líquido cefalorraquídeo; actualmente se etiquetan como meningitis asépticas aquellas en las que el cultivo de líquido cefalorraquídeo es negativo y cuya tinción de Gram es negativa. Pese a que el pronóstico y evolución en rasgos generales de las meningitis tras anestesia y analgesia espinal es bueno, en comparación con las meningitis adquiridas en la comunidad, por la escasa virulencia de las bacterias implicadas (Estreptococo salivarius

  7. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    CERN Document Server

    Mix, L J; Mandell, A M; Mosier, A C; Raymond, J; Raymond, S N; Stewart, F J; Von Braun, K; Zhaxybayeva, O; Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Because of the great diversity of material, each section was written by a different author with a different expertise. The Primer was constructed collaboratively. Ninety researchers from around the world contributed information with regard to what they expected from other astrobiologists and what they would like to know themselv...

  8. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    OpenAIRE

    Mix, Lucas J; Armstrong, John C; Mandell, Avi M.; Mosier, Annika C.; Raymond, Jason; Raymond, Sean N.; Stewart, Frank J; von Braun, Kaspar; Zhaxybayeva, Olga; Billings, Linda; Cameron, Vyllinniskii; Claire, Mark; Dick, Greg J; Domagal-Goldman, Shawn D.; Javaux, Emmanuelle

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endea...

  9. O primeiro a utilizar anestesia em cirurgia não foi um dentista. Foi o m édico Crawford Williamson Long El primero en utilizar la anestesia en cirugía no fue un dentista, fue el médico Crawford Williamson Long The first to use surgical anesthesia was not a dentist, but the physician Crawford Williamson Long

    Directory of Open Access Journals (Sweden)

    Almiro dos Reis Júnior

    2006-06-01

    de sus aspectos. Pero es fácil definir que Crawford Williamson Long fue el primero a utilizar el éter sulfúrico para operar varios pacientes, sin dolor, y realizar analgesias obstétricas. La historia es un puente que conecta el pasado al presente y que debe ser estudiada y entendida desde sus orígenes. Así se justifica recordar o dar a conocer quien fue Long, un nombre seguramente poco conocido entre nosotros, y cual fue su participación en el descubrimiento de la anestesia. CONTENIDO: El texto nos cuenta lo que llevó Crawford Williamson Long a convertirse en el primer médico a operar sin dolor cuatro años y medio antes de Morton, por qué y cómo eso se dio, y el papel que desempeñó en uno de los más grandes descubrimientos de la Medicina. La biografía de Long se narra, resaltando su carácter, la competencia, la dedicación, la modestia, el desprendimiento y un cierto desapego con relación a la conquista de la gloria. Las circunstancias que lo llevaron a no divulgar inmediatamente su hallazgo se describen. Analizamos su involucración en la discusión por la primacía del descubrimiento de la anestesia y su fallecimiento. Finalmente, los numerosos homenajes recibidos por Long en los EUA y en otros países. CONCLUSIONES: W. T. G. Morton es generalmente considerado como el autor del descubrimiento de la anestesia general, principalmente por haber sido el primero a hacer una exitosa demostración pública, en un importante hospital de Boston (EUA. Pero quedó probado que Long fue el primero a utilizar la anestesia quirúrgica y que es reconocido en varias regiones de su país como el padre de la anestesia quirúrgica y "su descubridor". Es necesario, incluso, revertir el hecho de ser Long poco conocido entre nosotros e insertarlo en el lugar a que tiene derecho en la historia de la anestesia general.BACKGROUND AND OBJECTIVES: The history of the discovery of anesthesia is not totally explained, but it is easy to establish that Crawford Williamson Long

  10. Espondilite anquilosante e anestesia Espondilitis anquilosante y anestesia Ankylosing spondylitis and anesthesia

    Directory of Open Access Journals (Sweden)

    Carlos Rogério Degrandi Oliveira

    2007-04-01

    40 años; es rara después de los 50 años. Las mujeres corresponden solamente a la minoría de pacientes. Existe poca información sobre la EA en la literatura anestésica. El objetivo de este artículo fue revisar aspectos de la EA de interés para el anestesiólogo, permitiendo un adecuado manoseo perioperatorio. CONTENIDO: Están definidas las características de la espondilitis anquilosante en cuanto a la clínica y la conducta anestésica. CONCLUSIONES: Los pacientes con enfermedades crónicas de la columna vertebral presentan desafíos específicos para el anestesiólogo. El manoseo de la vía aérea y el acceso al neuro-eje podrán ser difíciles. La preferencia ha sido dada a la anestesia general, incluso con la vía aérea de difícil acceso, evitando la anestesia en el neuro-eje. El grado de involucración de la columna cervical determinará cuanto podrá ser difícil la intubación traqueal. Un cuidado especial debe tenerse para evitar la manipulación excesiva de la columna cervical, lo que podría conllevar al trauma de la médula espinal.BACKGROUND AND OBJECTIVES: Ankylosing spondylitis (AS is a chronic inflammatory disease of the joints, included in the group of seronegative spondyloarthropathies. Its main characteristic is the fusion of the bones in the spine, which causes loss of flexibility of the back and neck. Other large articulations and connective tissues can be affected by the inflammatory process. It affects mainly men between the ages of 20 and 40; it is rare after the age of 50. Women represent a minority of patients. There is little information about AS in the anesthetic literature. The objective of this article was to review the characteristics of AS pertaining anesthesiology for an adequate perioperative handling. CONTENTS: The clinical characteristics of ankylosing spondylitis pertaining to the anesthetic conduct are reviewed. CONCLUSIONS: Patients with chronic diseases of the spine represent specific challenges to the anesthesiologist

  11. Electrocardiographic study on geriatric dogs undergoing general anesthesia with isoflurane Estudo eletrocardiográfico em cães geriátricos submetidos à anestesia geral com isofluorano

    Directory of Open Access Journals (Sweden)

    Andreza Conti-Patara

    2009-04-01

    Full Text Available The purpose of this study was to clarify the degree of influence of anesthetic agents commonly used during anesthesia on the heart conduction systems of geriatric dogs, with or without the presence of electrocardiographic changes in the pre-anesthetic electrocardiogram and also to determine the possible causes of ST-segment and T-wave changes during anesthesia, by monitoring ventilation and oxygenation. 36 geriatric dogs were evaluated. In addition to electrocardiographic evaluation, the pre-anesthetic study included serum levels of urea, creatinine, total protein, albumin and electrolytes. The pre-anesthetic medication consisted of acepromazine (0.05mg kg-1 in association with meperidine (3.0mg kg-1 by IM injection. Anesthesia was induced with propofol (3.0 to 5.0mg kg-1 by IV injection and maintained with isoflurane in 100% oxygen. During the anesthesia, the animals were monitored by continued computerized electrocardiogram. Systemic blood pressure, heart rate, respiratory rate, end-tidal carbon dioxide, partial pressure of carbon dioxide in arterial blood, arterial oxygen saturation, partial pressure of arterial oxygen and oxygen saturation of hemoglobin were closely monitored. During maintenance anesthesia, normal sinus rhythm was more common (78%. ST-segment and T-wave changes during the anesthetic procedure were quite common and were related to hypoventilation. The use of isoflurane did not result in arrhythmia, being therefore a good choice for this type of animal; Electrocardiographic findings of ST-segment and T-wave changes during the maintenance anesthesia were evident in animals with hypercapnia, a disorder that should be promptly corrected with assisted or controlled ventilation to prevent complicated arrhythmias.Os objetivos deste estudo foram esclarecer a influência dos agentes anestésicos comumente utilizados durante a anestesia no sistema de condução cardíaco em cães idosos, com ou sem alterações eletrocardiográficas pr

  12. Collecting Behavioral Data in General Education Settings: A Primer for Behavioral Data Collection

    Science.gov (United States)

    Lee, David L.; Vostal, Brooks; Lylo, Brooke; Hua, Youjia

    2011-01-01

    Recent trends toward the inclusion of students with disabilities mean that a majority of students with emotional and behavioral disorders (EBD) now spend at least 40% of their day in general education settings. With this change in location, teachers in general education settings are now asked to perform tasks that were not given much emphasis…

  13. Anestesia espinal alta para mastoplastia reductora. Experiencia de tres años

    Directory of Open Access Journals (Sweden)

    Néstor Parets Correa

    2012-05-01

    Full Text Available Fundamento: la aplicación de anestesia neuroaxial espinal alta en las intervenciones quirúrgicas resulta un tema controversial. Objetivo: describir los resultados de la aplicación de anestesia neuroaxial espinal alta en intervenciones quirúrgicas para mastoplastia reductora. Métodos: estudio descriptivo realizado en el Hospital General Universitario Dr. Gustavo Aldereguía Lima, de Cienfuegos, desde junio de 2006 hasta junio de 2009, que incluyó 90 pacientes operadas, en las cuales se empleó anestesia neuroaxial espinal alta. Se analizaron las variables: edad, índice de masa corporal, saturación de HBO2, tensión arterial, frecuencia cardiaca, uso de analgesia preventiva, comportamiento de la  analgesia posoperatoria, estado de satisfacción, presencia de complicaciones, técnica quirúrgica, duración del acto quirúrgico y de la anestesia. Resultados: el 50 % tenía  entre 35 y 44 años; 46, 7 % estaban sobrepeso; el 80 % se operó de hipertrofia mamaria; en el 97, 8 % se utilizó la mastopalstia reductora; ninguna presentó cifras altas de tensión arterial antes ni después de la aplicación de la anestesia, el 41,1 % presentó cifras bajas de tensión arterial después de la anestesia; la frecuencia cardiaca estuvo baja en el 31, 1 % después de aplicada la anestesia y alta en el 4, 4 %. La analgesia posoperatoria fue buena en el 87, 8 % de las pacientes; no hubo compromiso ventilatorio en ningún caso y el 100 % mostró satisfacción con la técnica anestésica. Conclusiones: la aplicación de la técnica anestésica permite desarrollar exitosamente las intervenciones quirúrgicas con un mínimo de riesgos y complicaciones para las pacientes.

  14. Avaliação de alterações timpanométricas em pacientes submetidos à anestesia geral com óxido nitroso Evaluation of tympanometric alterations in patients subject to general anesthesia with nitrous oxide

    Directory of Open Access Journals (Sweden)

    Fernanda Mossumez Fernandes Teixeira

    2005-06-01

    Full Text Available O óxido nitroso é um gás inalatório que pode aumentar a pressão intratimpânica durante o ato anestésico, bem como causar pressão negativa após sua suspensão, principalmente em pacientes com disfunção da tuba auditiva. Estas variações pressóricas podem trazer implicações clínicas, como ruptura de membrana timpânica, desarticulação da cadeia ossicular, hemotímpano, barotrauma, deslocamento de prótese de estapedotomia e lateralização do enxerto nas timpanoplastias, além da entrada de fluido seroso na orelha média durante a fase de pressão negativa. OBJETIVO: Avaliar a influência do óxido nitroso na pressão da orelha média em uma população sem disfunção tubária, realizando timpanometria no pré e pós-operatório. FORMA DE ESTUDO: Coorte transversal. MATERIAL E MÉTODO: Foi realizado um estudo prospectivo com pacientes internados no Hospital Universitário Clementino Fraga Filho - UFRJ, submetidos à anestesia geral com o uso do óxido nitroso a 50%, durante o período de abril a julho de 2003. Avaliou-se ainda se a duração da cirurgia, anestésicos associados, presença de rinite alérgica e desvio de septo nasal poderiam influenciar no aparecimento das alterações da pressão intratimpânica. RESULTADOS: A amostra constituiu-se de 50 pacientes, encontrando-se em quase metade (48% alterações timpanométricas no pós-operatório (curva tipo C, quando comparado às de controle do pré-operatório (curva tipo A. Sexo e idade não interferiram no aparecimento das alterações timpanométricas no pós-operatório, bem como a duração da cirurgia. O tipo de anestésico volátil associado, desvio de septo nasal e rinite alérgica não exerceram influência na pressão da orelha média no pós-operatório. CONCLUSÃO: O óxido nitroso altera a pressão na orelha média tanto na fase de indução quanto na fase de resolução anestésica.Nitrous oxide is an inhaling gas that can increase intratympanic pressure

  15. Evaluación a través de tomografía computarizada del efecto de una infusión endovenosa de ketamina en el desarrollo de atelectasia inducida por anestesia general en perros Evaluation of an endovenous ketamine infusion through computed tomography on the development of pulmonary atelectasis due to general anesthesia in dogs

    OpenAIRE

    CA Henríquez; LM Mieres; HA Bustamante; Herzberg; CE Campillo; MP Cabrera; MA Gómez

    2011-01-01

    El objetivo del estudio fue evaluar, a través de tomografía computarizada, el efecto de una infusión endovenosa de ketamina sobre la atelectasia pulmonar en perros sometidos a anestesia inhalatoria. Para esto se utilizaron 12 perros separados en dos grupos (A y B) de 6 perros cada uno. Ambos fueron sometidos al mismo protocolo anestésico que consistió en premedicación con xilacina, inducción con propofol y mantención con anestesia inhalatoria por un periodo de dos horas. Al grupo B se le admi...

  16. Avaliação da aplicação do índice de tobin no desmame da ventilação mecânica após anestesia geral Evaluación de la aplicación del índice de tobin en el destete de la ventilación mecánica después de la anestesia general Evaluating the use of the tobin index when weaning patients from mechanical ventilation after general anesthesia

    Directory of Open Access Journals (Sweden)

    Nara de Cássia Mantovani

    2007-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVO: O índice preditivo de descontinuação da ventilação mecânica é parâmetro de prognóstico de desmame. O objetivo deste estudo foi avaliar a aplicação do índice de Tobin antes da extubação traqueal em pacientes submetidos à anestesia geral. MÉTODO: Foram analisados 80 pacientes, 40 (50% homens e 40 (50% mulheres submetidos a colecistectomia sob anestesia geral. A média de idade foi 57,7 ± 12,4 (33 a 82 anos e a média do peso corpóreo foi 70,85 ± 11,07 (48 a 90 kg. Trinta e sete (46,2% pacientes eram tabagistas. O índice de Tobin foi obtido pela relação entre freqüência respiratória e volume corrente em ciclos/litro/minuto (c.L-1.min-1. Foram estudadas as variáveis: idade, peso, tabagismo, risco anestésico-cirúrgico, duração do procedimento, volume corrente expirado e freqüência respiratória pós-operatória, tempo de permanência na recuperação pós-anestésica, ocorrências clínicas intra-operatórias e gravidade das ocorrências clínicas após extubação. Foram utilizados testes estatísticos paramétricos e não-paramétricos, e análise de regressão logística univariada e múltipla. RESULTADOS: A idade (p = 0,019, peso corpóreo (p = 0,006, tabagismo (p = 0,014, risco anestésico (p = 0,0001, volume corrente (p 80 c.L-1.min-1 e 80 c.L-1.min-1, a idade avançada e o peso corpóreo elevado constituíram variáveis independentes de risco para o insucesso do desmame da ventilação mecânica.JUSTIFICATIVAS Y OBJETIVOS: El índice de predicción de descontinuación de la ventilación mecánica es parámetro de pronóstico de destete. El objetivo de este estudio fue evaluar la aplicación del índice de Tobin antes de la extubación traqueal en pacientes sometidos a la anestesia general. MÉTODO: Fueron analizados 80 pacientes, 40 (50% hombres y 40 (50% mujeres sometidos a colecistectomía bajo anestesia general. El promedio de edad fue 57,7 ± 12,4 (33 a 82 años y la media del peso

  17. Hemofilia e anestesia Hemofilia y anestesia Hemophilia and anesthesia

    Directory of Open Access Journals (Sweden)

    Rafael Py Gonçalves Flores

    2004-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Há mais de 25 anos não se discute, na Revista Brasileira de Anestesiologia, de maneira geral, o manuseio do paciente hemofílico durante o peri-operatório. Apesar da hemofilia ter sido definida como doença no início do século XIX, existem, até hoje, muitas descobertas relacionadas a ela. O objetivo dessa revisão é apontar os cuidados relacionados ao paciente hemofílico durante o período peri-operatório, ressaltando o manuseio da hemofilia tipo A e o papel do anestesiologista na equipe multidisciplinar. CONTEÚDO: Estão definidas as características da hemofilia quanto à clínica e aos achados laboratoriais, a terapia farmacológica atual e os cuidados com o manuseio do paciente hemofílico no intra-operatório. CONCLUSÕES: O manuseio do paciente hemofílico foi aprimorado. Como conseqüência desse avanço, percebe-se a importância e a necessidade de que novos conhecimentos, principalmente em relação à terapia de reposição, sejam dominados por hematologistas e por todo o corpo clínico-cirúrgico. Quando pacientes hemofílicos submetem-se a procedimentos cirúrgicos é necessário o envolvimento de uma equipe multidisciplinar da qual o anestesiologista faz parte. A este profissional cabe a responsabilidade de tomar as condutas mais adequadas frente ao paciente hemofílico, participando e comunicando-se ativamente com os membros da equipe multidisciplinar.JUSTIFICATIVA Y OBJETIVOS: Hace más de 25 años que en la Revista Brasileña de Anestesiologia, de manera general, no se discute el manoseo del paciente hemofílico durante el peri-operatorio. A pesar de la hemofilia haber sido definida como enfermedad en el inicio del siglo XIX, existen hasta hoy, muchos hallazgos relacionados a ella. El objetivo de esa revisión es apuntar las atenciones relacionadas al paciente hemofílico durante el período peri-operatorio, realzando el manoseo de la hemofilia tipo A y el papel del anestesiologista en el

  18. Avaliação comparativa entre a anestesia geral com halotano e isoflurano sobre a pressão arterial em cães Comparartive evaluation of the general anesthesia with halothane and isoflurane on the arterial pressure in dogs

    Directory of Open Access Journals (Sweden)

    Cláudio Corrêa Natalini

    2000-06-01

    Full Text Available As alterações produzidas pelo halotano e isoflurano sobre as pressões arteriais sistólica, diastólica e média foram avaliadas em 34 caninos de ambos os sexos e de diferentes pesos corporais e raças, todos submetidos a procedimentos cirúrgicos ortopédicos, divididos em dois grupos de 17 animais, submetidos a jejum prévio de 12 horas antes da indução anestésica. Os animais de ambos os grupos receberam sulfato de atropina 0,04mg/kg, associado ao sulfato de morfina 1,5mg/kg, administrados por via intramuscular e indução anestésica com propofol 6mg/kg por via intravenosa e a anestesia geral foi mantida com halotano no grupo I e o isoflurano no grupo II. Em ambos os grupos, o óxido nitroso na proporção 2:1 com oxigênio foi utilizado como gás diluente do anestésico volátil. Decorridos 15 minutos do início da anestesia volátil, as pressões sistólica, diastólica e média foram mensuradas pelo método oscilométrico indireto até o período de 90 minutos. Observou-se que as pressões arteriais sistólica e diastólica do grupo II foi maior a partir dos 45 minutos de manutenção com os anestésicos voláteis, não ocorrendo diferença significativa na freqüência cardíaca. Conclui-se que a manutenção anestésica com isoflurano produz valores de pressão arterial sistólica e diastólica superiores à manutenção com halotano que causou hipotensão arterial dos 45 aos 75 minutos de anestesia volátil.Changes in arterial systolic, diastolic, and mean blood pressure were evaluated and compared in 34 dogs anesthetized with halothane or isoflurane and submitted to orthopedic surgeries. Two groups were formed each with 17 dogs. These animals were fasted for 12 hours before anesthesia induction. Anesthetic technique was premedication with 0.04mg/kg atropine intramuscular combined 1.5mg/kg morphine intramuscular. Anesthesia was induced with 6.0mg/kg propofol intravenously. Anesthesia was maintained with halothane in group I and

  19. Meningitis tras anestesia y analgesia espinal

    OpenAIRE

    M. Robles Romero; M.A. Rojas Caracuel; C. del Prado Álvarez

    2013-01-01

    El objetivo de esta revisión es una puesta al día en la etiología, diagnóstico, profilaxis y tratamiento de la meningitis tras anestesia y analgesia espinales. Aunque es una complicación mayor de esta técnica y su incidencia es baja, cada vez son más frecuentes los casos publicados en la literatura médica. Según su etiología se les clasifica en meningitis sépticas, víricas y asépticas. Las meningitis sépticas son las más frecuentes, y en su etiología cada vez juega un papel más destacado como...

  20. Anestesia no paciente usuário de cocaína Anestesia en el paciente usuario de cocaína Anesthesia in cocaine users

    Directory of Open Access Journals (Sweden)

    Ana Luft

    2007-06-01

    anestesias regionales como la general presentan riesgos significativos en esos pacientes.BACKGROUND AND OBJECTIVES: Cocaine is the illicit drug most frequently associated with death, and the anesthesiologist should be aware of the perioperative complications of this drug in patients with acute intoxication or with a history of chronic use. The knowledge of the neurophysiology, pharmacology, and physiopathological consequences of cocaine abuse may facilitate the care of these patients. The objective of this work was to review the information on cocaine and its interactions with anesthesia. CONTENTS: This paper discusses the pharmacology, physiopathological consequences of cocaine use, and its interactions with anesthesia. CONCLUSIONS: The knowledge and early recognition of the complications associated with the use of cocaine are essential for the adequate management of cocaine users. The anesthesiologist should be prepared because both regional and general anesthesia carry significant risks in those patients.

  1. Avaliação da aplicação do índice de tobin no desmame da ventilação mecânica após anestesia geral Evaluación de la aplicación del índice de tobin en el destete de la ventilación mecánica después de la anestesia general Evaluating the use of the tobin index when weaning patients from mechanical ventilation after general anesthesia

    OpenAIRE

    Nara de Cássia Mantovani; Lúcia Maria Martins Zuliani; Daniela Tiemi Sano; Daniel Reis Waisberg; Israel Ferreira da Silva; Jaques Waisberg

    2007-01-01

    JUSTIFICATIVA E OBJETIVO: O índice preditivo de descontinuação da ventilação mecânica é parâmetro de prognóstico de desmame. O objetivo deste estudo foi avaliar a aplicação do índice de Tobin antes da extubação traqueal em pacientes submetidos à anestesia geral. MÉTODO: Foram analisados 80 pacientes, 40 (50%) homens e 40 (50%) mulheres submetidos a colecistectomia sob anestesia geral. A média de idade foi 57,7 ± 12,4 (33 a 82 anos) e a média do peso corpóreo foi 70,85 ± 11,07 (4...

  2. Efeito da administração de solução salina na estabilidade da circulação durante a indução de anestesia geral com propofol em estudo randômico e controlado de procedimentos ginecológicos Efecto de la administración de solución salina normal en la estabilidad de la circulación durante la inducción de anestesia general con propofol en estudio aleatorio y controlado de procedimientos ginecológicos Effect of normal saline administration on circulation stability during general anesthesia induction with propofol in gynecological procedures - randomised-controlled study

    Directory of Open Access Journals (Sweden)

    Daher Rabadi

    2013-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVO: Comparar o efeito da administração profilática de solução salina normal com o efeito hipotensor de propofol em pacientes do sexo feminino programadas para procedimentos ginecológicos. MÉTODO: Foram randomicamente alocadas em dois grupos 69 pacientes, ASA I-II. O Grupo 1 recebeu 5 mL.kg-1 de solução salina a 0,9% 10 minutos antes da indução e o Grupo 2 não recebeu nada (controle. A anestesia foi induzida com propofol e fentanil e depois mantida com propofol e remifentanil. As variáveis hemodinâmicas foram mensuradas pré- e pós-indução da anestesia geral. RESULTADOS: Após a indução, ambos os grupos apresentaram queda significativa da pressão arterial média (p JUSTIFICATIVA Y OBJETIVO: Comparar el efecto de la administración profiláctica de solución salina normal con el efecto hipotensor de propofol en pacientes del sexo femenino programadas para procedimientos ginecológicos. MÉTODO: Sesenta y nueve pacientes con ASA I-II fueron ubicados aleatoriamente en dos grupos. El Grupo 1 recibió 5 mL.kg-1 de solución salina al 0,9% 10 minutos antes de la inducción y el Grupo 2 no recibió nada. La anestesia fue inducida con propofol y fentanilo y después se mantuvo con propofol y remifentanilo. Las variables hemodinámicas fueron mensuradas antes y después de la inducción de la anestesia general. RESULTADOS: Después de la inducción, ambos grupos presentaron una caída significativa de la presión arterial promedio (p BACKGROUND AND OBJECTIVE: To compare the effect of prophylactic administration of normal saline against the hypotensive effect of propofol in female patients booked for gynecological procedures. METHOD: Sixty nine ASA (I, II patients were randomly allocated into two groups, group 1 received 5 mL.kg-1 of 0.9% normal saline 10 minutes before induction, whereas group 2 received nothing (control. Anesthesia was induced with propofol and fentanyl then maintained with propofol and

  3. Phonics Primer

    Science.gov (United States)

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  4. Bloqueo del ganglio estrellado y anestesia subaracnoidea: Caso Clínico Blockade of the inferior cervical ganglion with subarachnoid anesthesia: Clinical case

    OpenAIRE

    L. San Norberto; F. Hernández-Zaballos; Santos, J.; F. J. Sánchez-Montero; Vaquero, M.; E. Sánchez-Barrado; Muriel, C.

    2007-01-01

    El ganglio estrellado está formado por la unión del ganglio cervical inferior y el primer ganglio torácico. El bloqueo de dicho ganglio es usado para el diagnóstico y tratamiento de diversos síndromes dolorosos crónicos. Esta técnica con anestésicos locales suele ser segura aunque no exenta de complicaciones como convulsiones, neumotórax o anestesia espinal entre otras. Estas complicaciones pueden minimizarse con una adecuada vigilancia, monitorización y recursos adecuados. Para un correcto d...

  5. Laryngeal mask airway and endotracheal tube: odynophagia and dysfhonia incidence under general anesthesia at the University Hospital San Vicente de Paúl, Medellín, 2000 Máscara laríngea y tubo endotraqueal: incidencia de odinogagia y disfonía por su uso en anestesia general en el Hospital Universitario San Vicente de Paúl, Medellín, 2000

    Directory of Open Access Journals (Sweden)

    Mónica del Rosario Guzmán Carazo

    2001-03-01

    Full Text Available We describe the odynophagia and dysphonia incidence after the use of either laryngeal mask (LM or endotracheal tube (ETT in adult patients submitted to elective surgery, under general anesthesia, at the University Hospital San Vicente of Paul, Medellín, Colombia, between February 14 and March 16 of 2000. A descriptive and prospective study was carried out in 63 patients, in which the global incidence of odynophagia was 15.9% and that of dysphonia 12.5%; there was a higher odynophagia incidence with the use of ETT, 37.5%, than with LM, 2.6%. The dysphonia incidence was also higher with the use of the TET (25% than with LM (5.1%. The odynophagia incidence was higher in women (19.1% than in men (6.2%. Dysphonia was also more frequent in women (14.8% than in men (6.2%. Accordingly, we can conclude that odynophagia and dysphonia incidences are lower in men, when the time of anesthesia is two hours or less and when LM is used. More studies are necessary to carry out a comparative analysis of the complications with the use of LM and ETT, in order to offer the safest and more effective technique for insuring the airway. Se describe la incidencia de odinofagia y disfonía después del uso de la máscara laríngea (ML o del tubo endotraqueal (TET en pacientes adultos sometidos a cirugía electiva, bajo anestesia general, en el Hospital Universitario San Vicente de Paúl, de Medellín, entre febrero y marzo de 2000. Se hizo un estudio descriptivo, prospectivo, de corte transversal, en 63 pacientes, en los cuales se encontró una incidencia global de odinofagia del 15.9% y de disfonía del 12.5%. Hubo una mayor incidencia de odinofagia con el uso del TET, 37.5%, que con la ML, 2.6%. La incidencia de disfonía también fue mayor con el uso del TET (25% que con la ML (5.1%. La incidencia de odinofagia fue mayor en las mujeres (19.1% que en los hombres (6.2%. La disfonía también fue más frecuente en mujeres (14.8% que en hombres (6.2%. De acuerdo con los

  6. Evaluación a través de tomografía computarizada del efecto de una infusión endovenosa de ketamina en el desarrollo de atelectasia inducida por anestesia general en perros Evaluation of an endovenous ketamine infusion through computed tomography on the development of pulmonary atelectasis due to general anesthesia in dogs

    Directory of Open Access Journals (Sweden)

    CA Henríquez

    2011-01-01

    Full Text Available El objetivo del estudio fue evaluar, a través de tomografía computarizada, el efecto de una infusión endovenosa de ketamina sobre la atelectasia pulmonar en perros sometidos a anestesia inhalatoria. Para esto se utilizaron 12 perros separados en dos grupos (A y B de 6 perros cada uno. Ambos fueron sometidos al mismo protocolo anestésico que consistió en premedicación con xilacina, inducción con propofol y mantención con anestesia inhalatoria por un periodo de dos horas. Al grupo B se le administró además una infusión de ketamina. Se realizaron cortes tomográficos 1 cm craneal al diafragma, en los minutos 0, 60 y 120 posteriores a la inducción, con el fin de monitorear la evolución en el caso de presentarse atelectasia. La totalidad del estudio fue realizado en las dependencias del Hospital Clínico Veterinario de la Universidad Austral de Chile. Se determinó la presencia de atelectasia en diferentes grados en el 58% de los perros, observándose en la totalidad de los animales en sólo uno de los pulmones. Además se presentó en 5 perros en el grupo sin infusión de ketamina y sólo 2 en el grupo con infusión. Asimismo, las áreas atelectásicas variaron entre 0,13 y 8,03 cm² en el grupo A y 0,07 y 2,10 cm² en el grupo B. La infusión de ketamina no influyó en la presentación de atelectasia pulmonar. Con respecto a la evolución de la atelectasia a través del tiempo, se apreciaron leves cambios en ambos grupos, los cuales no fueron estadísticamente significativos (P > 0,05.The aim of this study was to assess through computed tomography the presence of pulmonary atelectasis in dogs under inhalatory anesthesia and evaluate the effect of an endovenous ketamine infusion upon it. For this purpose 12 dogs separated in two groups (A and B of 6 dogs each were used. Both groups were subjected to the same anesthetic protocol. The protocol consisted in premedication with xilacine IM, induction with propofol IV and maintenance with

  7. Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

    Science.gov (United States)

    Ballesteros Benavides, Maria Elvira

    Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los

  8. Estenosis hipertrófica de píloro y anestesia espinal Hypertrophic pyloric stenosis and spinal anesthesia

    Directory of Open Access Journals (Sweden)

    I. Fernández Jiménez

    2009-01-01

    Full Text Available Introducción: La realización de la piloromiotomía extramucosa con abordaje umbilical o supraumbilical bajo anestesia espinal puede contribuir a la disminución de la morbimortalidad potencial asociada al tratamiento quirúrgico de la estenosis hipertrófica de píloro (EHP.
    Pacientes y métodos: Se realizó un estudio retrospectivo de 60 pacientes con EHP. Se analizaron la edad al diagnóstico, clínica, tipo de anestesia y evolución postoperatoria. En 50 pacientes se indujo anestesia general con atropina, fentanilo, propofol, succinil-colina y sevoflurano. En 10 pacientes se realizó bloqueo espinal con bupivacaína 0,5% hiperbárica espinal y sedación con bolos de propofol.
    Resultados: La edad media al diagnóstico fue de 34,07 días. Todos presentaron vómitos proyectivos, y se asociaron a pérdida de peso (33,3%, irritabilidad (15%, deshidratación (6,6%, ictericia (5% y estreñimiento (5%. El tiempo medio de evolución fue de 4,8 días. El diagnóstico se realizó mediante ecografía abdominal en todos los casos. En los casos de anestesia espinal, el bloqueo se instauró en menos de 10 minutos, los niveles sensitivos alcanzados oscilaron entre T3-T5 y el tiempo medio de duración fue de 60
    minutos. En ningún caso se registró bradicardia <100 latidos/minuto, saturación <95%, apneas >15 segundos, ni cambios en la tensión arterial >15%. El inicio medio de la tolerancia oral fue de 18,7 horas para los pacientes intervenidos con anestesia general, y de 9,5 horas para el grupo de anestesia espinal. Un paciente precisó ingreso postoperatorio en la UCI pediátrica por necesidad de intubación prolongada.
    Conclusiones: La anestesia espinal en la piloromiotomía extramucosa es una alternativa segura a la anestesia general. El acceso y las condiciones quirúrgicas son iguales a los realizados bajo anestesia general. Nuestros resultados sugieren que puede disminuir el tiempo de inicio de tolerancia oral y de ingreso

  9. Anestesia para obesidade mórbida Anestesia para obesidad mórbida Anesthesia for morbid obesity

    Directory of Open Access Journals (Sweden)

    Michelle Nacur Lorentz

    2007-04-01

    , mientras que en los EUA ya llegó a tener un carácter epidémico. El paciente obeso presenta una serie de alteraciones fisiopatológicas, además de importantes comorbidades lo que exige del anestesiólogo un pleno conocimiento de la fisiopatología de la enfermedad. El procedimiento quirúrgico de reducción gástrica ha sido cada vez más realizado y el período perioperatorio presenta características únicas con alteraciones cardiovascular y pulmonar que lo convierten en un verdadero desafío para los profesionales involucrados. El hospital también debe estar preparado para recibir a esos pacientes con equipos adecuados, un equipo multidisciplinario y cuidados postoperatorios adecuados. El objetivo de este estudio fue demostrar que el paciente obeso mórbido no es solamente un paciente con exceso de peso, y por tanto se buscó guiar las principales conductas a ser observadas. CONTENIDO: En este artículo presentamos las principales alteraciones fisiopatológicas del obeso mórbido, como también datos epidemiológicos y enfermedades correlativas. Se realiza una revisión de las dosis de los medicamentos usados en la anestesia, como también el mejor de los abordajes pre, intra y postoperatorio por partes del anestesiólogo. CONCLUSIONES: El abordaje del paciente con obesidad mórbida exige una planificación minuciosa que se inicia en la selección de los pacientes, tiene una continuidad con el preoperatorio detallado y intraoperatorio individualizado, y se extiende hasta el postoperatorio, cuando la incidencia de complicaciones pulmonar, cardiovascular e infecciosa es mayor que en la población no obesa. Para que los resultados sean favorables es extremadamente importante la involucración de un equipo multiprofesional que incluye Clínica General, Anestesiología, Cirugía General, Enfermería, Psicología, Fisioterapia, Nutrología y Terapia Intensiva.BACKGROUND AND OBJECTIVES: Morbid obesity is very frequent in our society, having achieved the level of an

  10. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  11. Falhas na anestesia subaracnóidea Fallos en la anestesia subaracnoide Failure of subarachnoid blocks

    Directory of Open Access Journals (Sweden)

    Hugo Praxedes

    2010-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Desde Bier, é descrita falha de anestesia subaracnóidea que causa desconforto ao paciente e que ocorre, eventualmente, mesmo diante de profissionais hábeis que a tenham conduzido de forma tecnicamente correta. Há variação, no entanto, de conceito de falha e, principalmente, de identificação precisa de causas. O objetivo do trabalho é identificar melhor as causas deste desconforto por meio de revisão sistemática de publicações com casuística significativa. CONTEÚDO: Dividiu-se a análise em três tópicos: anatomia e suas variações; o agente anestésico, que trata da seleção do agente, suas soluções e adições, de forma a atingir o resultado mais apropriado à intervenção cirúrgica proposta; e a dose, discutindo-se concentração, volume ou dose gravimétrica, no sentido de obter resultado mais adequado tanto no que diz respeito à intensidade do bloqueio quanto à sua duração. CONCLUSÕES: As falhas são mais afeitas a fatores técnicos: avaliação anatômica adequada, escolha criteriosa da agulha e do local da punção, cuidados no armazenamento dos agentes, adequação de dose, baricidade, além de posicionamento correto do paciente durante e após punção, tudo adequado ao objetivo cirúrgico.JUSTIFICATIVA Y OBJETIVOS: Bier ya describía los fallos en la anestesia subaracnoidea que causa la incomodidad al paciente, y que se da, eventualmente, incluso con la presencia de profesionales hábiles que la hayan conducido de forma técnicamente correcta. Existe una variación, sin embargo, del concepto de fallo y principalmente, de la identificación precisa de las causas. El objetivo del trabajo es identificar mejor las causas de esa incomodidad a través de la revisión sistemática de publicaciones con casuística significativa. CONTENIDO: El análisis se dividió en tres tópicos: la anatomía y sus variaciones; el agente anestésico, que trata sobre la selección del agente, sus soluciones

  12. Anestesia em paciente portador de deficiência de glicose-6-fosfato-desidrogenase: relato de caso Anestesia en paciente portador de deficiencia de glicosa-6-fosfato-desidrogenasa: relato de caso Anesthesia in glucose 6-phosphate dehydrogenase-deficient patient: case report

    Directory of Open Access Journals (Sweden)

    Múcio Paranhos de Abreu

    2002-11-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A Deficiência de Glicose-6-Fosfato-Desidrogenase (G6PD é uma enzimopatia relativamente comum, mas as publicações relacionando essa condição com a anestesia são escassas. O objetivo deste relato é apresentar um caso de paciente portador de Deficiência de G6PD, submetido à tenotomia para alongamento de tendão de Aquiles, sob anestesia venosa associada à bloqueio subaracnóideo. Relato do caso: Paciente masculino, 9 anos, 48 kg, portador de deficiência de G6PD e polineuropatia periférica, submetido à tenotomia de tendão de Aquiles, sob anestesia geral venosa com midazolam, propofol e fentanil , associada à bloqueio subaracnóideo com bupivacaína hiperbárica a 0,5%. Ao final da cirurgia o paciente despertou tranqüilo, sem dor ou outras queixas, evoluiu bem, recebendo alta hospitalar sem intercorrências. CONCLUSÕES: Pela evolução do caso relatado, a anestesia subaracnóidea com bupivacaína associada à anestesia venosa total com propofol, mostrou ser uma técnica segura em pacientes portador de deficiência de G6PD.JUSTIFICATIVA Y OBJETIVOS: - La Deficiencia de Glucosa-6-Fosfato-Desidrogenasa (G6PD es una enzimopatia relativamente común, más las publicaciones relacionando esa condición con la anestesia son escasas. El objetivo de este relato es presentar un caso de un paciente portador de Deficiencia de G6PD, sometido a tenotomia para alongamiento de tendón de Aquiles, bajo anestesia venosa asociada al bloqueo subaracnóideo. RELATO DEL CASO: Paciente masculino, 9 años, 48 kg, portador de deficiencia de G6PD y polineuropatia periférica, sometido a tenotomia de tendón de Aquiles, bajo anestesia general venosa con midazolam, propofol y fentanil asociada a bloqueo subaracnóideo con bupivacaína hiperbárica a 0,5%. Al final de la cirugía el paciente despertó tranquilo, sin dolor u otras quejas, evoluyó bien, recibiendo alta hospitalar sin interocurrencias. CONCLUSIONES: Por la evolución del

  13. Dexmedetomidina: papel atual em anestesia e cuidados intensivos

    OpenAIRE

    Joana Afonso; Flávio Reis

    2012-01-01

    JUSTIFICATIVA E OBJETIVOS: Atualizar e rever a aplicação da dexmedetomidina em anestesia e cuidados intensivos. Este trabalho é uma revisão abrangente dos usos clínicos, farmacologia, farmacocinética, mecanismo de ação e efeitos adversos da dexmedetomidina. CONTEÚDO: O uso efetivo de agentes sedativo-hipnóticos e analgésicos é parte integral do conforto e segurança dos pacientes. A dexmedetomidina é um potente e altamente seletivo agonista dos adrenoceptores α-2 com propriedades simpaticolíti...

  14. Anestesia ambulatorial para radioterapia em paciente portador de miastenia gravis: relato de caso Anestesia ambulatorial para radioterapia en paciente portador de miastenia gravis: relato de caso Outpatient anesthesia for radiotherapy in a patient with myasthenia gravis: case report

    Directory of Open Access Journals (Sweden)

    Raquel Marcondes Bussolotti

    2006-08-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A miastenia gravis (MG é doença auto-imune rara, caracterizada pela redução de receptores nicotínicos na junção neuromuscular, com incidência de 14/100.000. O objetivo deste relato foi descrever o caso de paciente portador de miastenia gravis submetido à anestesia geral balanceada, para tratamento radioterápico de carcinoma espinocelular de parótida, em regime ambulatorial. RELATO DO CASO: Paciente do sexo masculino, 87 anos, 87 kg, estado físico ASA III, com história de miastenia gravis; acidente vascular encefálico prévio (AVE; marca-passo por bloqueio atrioventricular total; hipertensão arterial sistêmica (HAS. Foram programadas sete sessões de radioterapia de 20 minutos para tratamento de tumor de parótida, sob anestesia geral. Na sala de radioterapia foi monitorizado com cardioscópio, monitor de pressão arterial não-invasiva, oxímetro de pulso, e submetido à anestesia geral com propofol e sevoflurano. Após a indução, foi mantido em ventilação espontânea com cânula de Guedel e cateter nasofaríngeo com O2 /sevoflurano, para acomodação da máscara imobilizadora. Na sala de recuperação pós-anestésica, não apresentou complicações. CONCLUSÕES: A escolha dos anestésicos e o acompanhamento clínico criterioso permitiram a boa evolução do paciente, com AVE prévio, cardiopata e idoso, submetido à anestesia geral balanceada para procedimento de aplicação de radioterapia, em regime ambulatorial.JUSTIFICATIVA Y OBJETIVOS: La Miastenia Gravis (MG es una enfermedad auto inmune rara, caracterizada por la reducción de receptores nicotínicos en la junción neuromuscular, con incidencia de 14/100.000. El objetivo de este relato fue el de describir el caso del paciente portador de miastenia gravis sometido a la anestesia general balanceada, para tratamiento radioterápico de carcinoma espinocelular de parótida en régimen ambulatorial. RELATO DEL CASO: Paciente del sexo masculino

  15. Síndrome de Turner e anestesia Síndrome de turner y anestesia Turner syndrome and anesthesia

    Directory of Open Access Journals (Sweden)

    Marcius Vinícius M. Maranhão

    2008-02-01

    alteraciones anatómicas y fisiológicas en especial relacionadas con las vías aéreas y el sistema cardiovascular. Fue objeto de este artículo hacer una revisión de las alteraciones anátomo-fisiológicas del síndrome de Turner de mayor interés para el anestesiólogo, discutir el manoseo perioperatorio y hacer una revisión de la literatura respecto de la conducta anestésica en esos pacientes. CONTENIDO: El síndrome de Turner es una enfermedad genética caracterizada por una anormalidad en el número o en la morfología del cromosoma sexual. Frecuentemente el cromosoma sexual falta, resultando en cariótipo 45,X y un fenotipo de disgenesia gonadal. Las principales alteraciones anatomo-fisiológicas de interés para el anestesiólogo incluyen cuello corto, hipoplasia maxilar y mandibular lo que puede provocar una vía aérea difícil. La extensión más corta de la tráquea como su bifurcación más superior, puede facilitar la intubación endobrónquica y la extubación traqueal accidental cuando haya una tracción de la cánula traqueal. La presencia de cardiopatías, enfermedades endocrinas y gastrointestinales, alteraciones hepáticas y renales como también la extensión ósteo-articular además de las alteraciones oftálmicas y auditivas son frecuentes debiendo ser detectadas durante la evaluación preanestésica. Las técnicas de anestesia general o regional parecen ser seguras en este tipo de pacientes ³. CONCLUSIONES: El síndrome de Turner es una anormalidad genética que presenta importantes alteraciones anátomo-fisiológicas de interés para el anestesiólogo. El conocimiento de esas alteraciones permite el manejo anestésico seguro con una baja morbi-mortalidad perioperatoria.BACKGROUND AND OBJECTIVES: Turner syndrome is a frequent and complex genetic abnormality affecting women, being associated with a wide variety of anatomical and physiological changes, especially related with the airways and cardiovascular system. The objective of this report was to

  16. Atelectasias durante anestesia: fisiopatologia e tratamento Atelectasias durante anestesia: fisiopatología y tratamiento Atelectasis during anesthesia: pathophysiology and treatment

    Directory of Open Access Journals (Sweden)

    Luiz Marcelo Sá Malbouisson

    2008-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O colapso pulmonar intra-operatório é uma complicação de elevada incidência em pacientes submetidos à intervenção cirúrgica sob anestesia geral com relaxamento/paralisia da musculatura. Essa complicação está associada à piora das trocas gasosas no intra-operatório e, em alguns casos, necessidade de suporte respiratório prolongado no período pós-operatório. Os objetivos deste estudo foram revisar os aspectos fisiopatológicos da formação de atelectasias durante anestesia geral e as possíveis manobras terapêuticas para prevenir e tratar essa complicação. CONTEÚDO: Nesta revisão, os conceitos sobre a incidência de atelectasias intra-operatórias, os fatores relacionados com o seu desenvolvimento, tanto mecânicos quanto associados ao ajuste do respirador durante procedimento cirúrgico, os aspectos do diagnóstico e as estratégias de prevenção e tratamento foram abordados de maneira sistemática. CONCLUSÕES: A compreensão dos mecanismos relacionados com o desenvolvimento do colapso pulmonar durante o período intra-operatório, assim como o seu tratamento, pode contribuir para a redução da incidência de complicações pulmonares pós-operatórias, o tempo de recuperação e os custos hospitalares.JUSTIFICATIVA Y OBJETIVOS: El colapso pulmonar intraoperatorio es una complicación de elevada incidencia en pacientes sometidos a la intervención quirúrgica bajo anestesia general con relajamiento/parálisis de la musculatura. Esta complicación está asociada al empeoramiento de los cambios de gas en el intraoperatorio y en algunos casos, necesidad de soporte respiratorio prolongado en el período postoperatorio. Los objetivos de este estudio fueron los de revisar los aspectos fisiopatológicos de la formación de atelectasias durante anestesia general y las posibles maniobras terapéuticas para prevenir y tratar esa complicación. CONTENIDO: En esta revisión, los conceptos sobre la

  17. Dexmedetomidina: papel atual em anestesia e cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Joana Afonso

    2012-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Atualizar e rever a aplicação da dexmedetomidina em anestesia e cuidados intensivos. Este trabalho é uma revisão abrangente dos usos clínicos, farmacologia, farmacocinética, mecanismo de ação e efeitos adversos da dexmedetomidina. CONTEÚDO: O uso efetivo de agentes sedativo-hipnóticos e analgésicos é parte integral do conforto e segurança dos pacientes. A dexmedetomidina é um potente e altamente seletivo agonista dos adrenoceptores α-2 com propriedades simpaticolíticas, sedativas, amnésicas e analgésicas, que tem sido descrito como um adjuvante útil e seguro em várias aplicações clínicas. Proporciona uma "sedação consciente" única, analgésica, sem depressão respiratória. Os usos correntes revistos incluem sedação na unidade de tratamento intensivo - UTI (adulta e pediátrica, departamento de emergência, anestesia regional e geral, neurocirurgia, sedação para procedimentos pediátricos, intubação por fibra ótica em doentes acordados, cirurgia cardíaca e cirurgia bariátrica. CONCLUSÕES: A dexmedetomidina oferece a capacidade única de fornecer sedação e analgesia sem depressão respiratória. É um agente novo com uma grande margem de segurança, excelente capacidade sedativa e moderadas propriedades analgésicas. Embora o seu amplo uso seja, atualmente, em pacientes de unidades de cuidados intensivos cirúrgicos e não cirúrgicos, a dexmedetomidina parece ter futuras aplicações promissoras nas áreas de neuroproteção, cardioproteção e renoproteção. São necessários mais estudos detalhados para definir o seu papel como sedativo em doentes críticos, neurocirúrgicos e pediátricos, como adjuvante da anestesia e como sedativo durante procedimentos

  18. Meningitis tras anestesia espinal Meningitis after a spinal anesthesia

    Directory of Open Access Journals (Sweden)

    A. L. Vázquez-Martínez

    2008-03-01

    Full Text Available La meningitis post-punción es una importante complicación de la anestesia espinal. Describimos el caso de un varón de cuarenta y seis años que ingresó para tratamiento quirúrgico de una hernia umbilical, la cirugía se realizó bajo anestesia intradural. Tras la intervención el paciente comenzó con un cuadro clínico compatible con meningitis, que se confirmó tras examen del líquido cefalorraquídeo. Se trató con antibióticos a pesar de la no identificación de gérmenes, siendo la evolución favorable. El diagnóstico etiológico de una meningitis iatrogénica no siempre es posible, pero siempre debemos tener en cuenta esta posibilidad. En este artículo queremos revisar la situación actual del problema, especialmente la profilaxis y la actitud terapéutica.Post-dural puncture meningitis is a serious complication of spinal anesthesia. We describe the case of a forty six years old male who was admitted for surgical intervention of an umbilical hernia, performed under spinal anesthesia. After surgery the patient developed a clinical syndrome compatible with meningitis, the diagnosis was confirmed by examination of the cerebrospinal fluid. Broad-spectrum antibiotics were started although spinal cultures were negatives, and the patient's clinical course was favourable. The meningitis differential diagnosis may be difficult, but we must think about this possibility. In this case report ,we want to check the present situation, specially the prevention and medical treatment.

  19. Anestesia para colonoscopia: anestesia inhalatoria con sevoflurano frente a anestesia intravenosa con propofol Colonoscopic anesthesia: Inhalatory anesthesia with sevoflurane versus intravenous anesthesia with propofol

    Directory of Open Access Journals (Sweden)

    S. De la Torre Carazo

    2012-03-01

    Full Text Available Introducción: Las exploraciones endoscópicas como la colonoscopia son actualmente cada vez más frecuentes, tanto por prescripción clínica, como para despistaje del cáncer de colon, siendo precisa Anestesia/sedación prácticamente en todos los casos. La técnica más frecuentemente usada es la intravenosa con propofol, en algunos casos no puede realizarse, y se plantea una alternativa inhalatoria. Objetivo: comparación de las características de una técnica habitual con propofol (A y de una inhalatoria con Sevoflurano (B. Sujetos y Método: Se estudian las características de ambas técnicas en dos grupos de 150 pacientes cada uno, valorándose las ventajas de cada una, complicaciones, tolerancia, tiempo de recuperación, aceptación por el endoscopista y el paciente de ambas técnicas. Resultados: en ambas técnicas las complicaciones son muy escasas, el grado de tolerancia es buena/muy buena en el 99% del grupo (A, frente a un 97% del grupo (B. Discusión: Aunque no hemos encontrado publicaciones comparando ambas técnicas en anestesia para colonoscopia, el uso de Sevoflurano ha demostrado características similarmente favorables en pacientes contraindicados para el uso de propofol, siempre que cambiemos el esquema de anestésia intravenosa por inhalatoria. Conclusión: Ambas técnicas son igualmente útiles y seguras, pudiendo emplearse la técnica inhalatoria con Sevoflurano en los pacientes en los que el propofol resulte inadecuado, con iguales prestaciones y versatilidad.Introduction: The exploratory endoscopy and colonoscopy are now increasingly common, both clinical prescription, and for colon cancer screening, needing Anesthesia / sedation in virtually all cases. The most commonly used is intravenous propofol, which in some cases cannot be performed, and an alternative is inhaled. Objective: To compare the characteristics of a standard technique with propofol (A and an inhalation with sevoflurane (B. Subjects and Methods: We

  20. Uso de dexmedetomidina em anestesia geral para tratamento cirúrgico de aneurisma cerebral, em paciente gestante, portadora de doença hipertensiva específica da gestação: relato de caso Uso de dexmedetomidina en anestesia general para tratamiento quirúrgico de aneurisma cerebral, en paciente embarazada, portadora de enfermedad hipertensiva específica del embarazo: relato de caso Dexmedetomidine in general anesthesia for surgical treatment of cerebral aneurysm in pregnant patient with specific hypertensive disease of pregnancy: case report

    Directory of Open Access Journals (Sweden)

    Kleber Machareth de Souza

    2005-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A incidência de cirurgias não obstétricas em pacientes gestantes é de 0,36% a 2%. No entanto, cirurgias visando o tratamento cirúrgico de aneurisma cerebral em gestantes são extremamente raras. A doença hipertensiva específica da gestação, apresenta prevalência clínica de 10% na população gestante. Trata-se de uma doença de elevada complexidade clínica, acometendo múltiplos órgãos e sistemas. A dexmedetomidina, fármaco agonista alfa2, apresenta importante seletividade para estes receptores, quando utilizada em doses clínicas terapêuticas e promove adequada estabilidade hemodinâmica, se empregada no período peri-operatório. O objetivo deste relato foi apresentar uma técnica com a qual fosse possível a manutenção da homeostase materna, preservando ao máximo o fluxo sangüíneo útero-placentário e a vitalidade fetal, sem deixar de lado aspectos fundamentais relativos à otimização da relação oferta/demanda de oxigênio cerebral e adequação das condições do tecido cerebral propícias ao manuseio cirúrgico. RELATO DO CASO: Gestante com 19 anos encaminhada para tratamento cirúrgico de aneurisma cerebral, estando na vigésima sétima semana de gestação. No pré-operatório, apresentava-se consciente, orientada, com presença de déficit à esquerda e quadro clínico compatível com toxemia gravídica. Foi administrada dexmedetomidina (1 µg.kg-1 em 20 minutos, seguida de indução anestésica com propofol (2,5 mg.kg-1, fentanil (7,5 µg.kg-1, lidocaína (1 mg.kg-1 e rocurônio (2 mg.kg-1 em seqüência rápida. A manutenção da anestesia foi obtida com propofol (50 µg.kg-1.min-1, alfentanil (1 µg.kg-1.min-1 e dexmedetomidina (0,7 µg.kg-1.min-1. A cirurgia foi realizada sem qualquer intercorrência, não havendo seqüela neurológica subjacente. CONCLUSÕES: Neste caso o uso da dexmedetomidina tornou possível um adequado manuseio hemodinâmico, mantendo otimizado o fluxo sang

  1. High Spinal Anesthesia for Reductive Mammaplasty: a Three Years Experience Anestesia espinal alta para mastoplastia reductora. Experiencia de tres años

    Directory of Open Access Journals (Sweden)

    Néstor Parets Correa

    2012-05-01

    Full Text Available

    Background: High spinal neuraxial anesthesia is a controversial issue when used in surgery. Objective: To describe the results of the application of high spinal neuraxial anesthesia in reductive mammaplasty surgery. Methods: A descriptive study was conducted at the Dr. Gustavo Aldereguía Lima General University Hospital of Cienfuegos from June 2006 to June 2009. It included 90 patients who underwent surgery with high spinal neuraxial anesthesia. The following variables were analyzed: age, body mass index, HbO2 saturation, blood pressure, heart rate, use of preemptive analgesia, postoperative analgesia behavior, satisfaction level, complications, surgical technique and duration of surgery and anesthesia application. Results: 50% of patients were between 35 and 44 years old; 46, 7% were overweight; 80% had surgery for breast hypertrophy; reductive mastopalstia was performed in 97, 8% of cases; no patients presented rates of high blood pressure before or after the application of anesthesia; 41.1% showed low levels of blood pressure after anesthesia; heart rate was low in 31, 1% of cases after the application of anesthesia and high in 4, 4%. Postoperative analgesia was good in 87, 8% of patients, there was no ventilatory complication and 100% of patients expressed their satisfaction with the anesthetic technique. Conclusions: The application of this anesthetic technique can successfully develop surgeries with minimal risks and complications for patients.

    Fundamento: la aplicación de anestesia neuroaxial espinal alta en las intervenciones quirúrgicas resulta un tema controversial. Objetivo: describir los resultados de la aplicación de anestesia neuroaxial espinal alta en intervenciones quirúrgicas para mastoplastia reductora. Métodos: estudio descriptivo realizado en el Hospital General Universitario

  2. O sevofluorano em psitacídeos (Amazonas aestiva: determinação da dose mínima (d. a. m para produção de anestesia geral Sevoflurane in psitacines (Amazonas aestiva: determination of minimal anesthetic concentration to produce general anesthesia

    Directory of Open Access Journals (Sweden)

    Alexandra Alves Nicolau

    2002-10-01

    Full Text Available Foram utilizados 10 psitacídeos da espécie Amazonas aestiva (papagaio-verdadeiro. Após contenção física, a anestesia foi induzida com o auxílio de uma máscara facial conectada ao sistema de Maplesson D (BARAKA, utilizando sevofluorano a 6V% e fluxo diluente de O2 de 1,5/min de oxigênio. A determinação da Dose Anestésica Mínima (DAM foi estabelecida de maneira similar àquela proposta por LUDDERS et al. (1990. A DAM obtida neste experimento 3,44V%, que eqüivale a concentração alveolar mínima de mamíferos mostrou-se maior nas aves analisadas quando comparada a obtida nos mamíferos. O anestésico mostrou-se bastante seguro para a espécie, não alterando de forma deletéria as variáveis fisiológicas analisadas.Ten adult psittacines (Amazonas aestiva were used. After appropriate immobilization the anesthetic induction was accomplished with facial mask connect to modified circuit of Maggil using 6V% of Sevofluorano with oxygen flow rate at 1.5/. The Minimal Anesthetic Concentration was determined in a manner similar to that proposed by LUDDERS et al. (1990. The MAC obtained was 3.44V%, higher than MAC. proposed to mammals. Sevoflurane can be used safely in avian species once it did not alter significantly all physiological parameters analyzed.

  3. Effects of constant rate infusion of anesthetic or analgesic drugs on general anesthesia with isoflurane: A retrospective study in 200 dogs Efeitos da infusão intravenosa contínua de fármacos anestésicos ou analgésicos sobre a anestesia geral com isoflurano: Estudo retrospectivo em 200 cães

    Directory of Open Access Journals (Sweden)

    Sofia de Amorim Cerejo

    2013-09-01

    Full Text Available Constant rate infusion (CRI shows several advantages in balanced anesthesia, such as reduction of requirement for inhaled anesthetics and control of pain. The most commonly used drugs in these protocols are local anesthetics, dissociative, and opioids, which may be administered alone or in combinations. We evaluated the records of 200 dogs that underwent various surgical procedures with anesthetic or analgesic CRI in the perioperative period during 2011 and 2012 at the Veterinary Hospital of Franca University (Unifran, and identified possible complications during the transoperative period. Records evaluated included clinical state, laboratory tests, drugs used in premedication and induction, and CRI protocol. Acepromazine and morphine were the main drugs used in premedication. Propofol was used to induce anesthesia alone or in combination with other agents. We evaluated records of the 25 different CRI protocols. Fentanyl was the main drug employed in CRI, either alone or in combination. There were 128 episodes of anesthetic complications during CRI;the most common were hypotension, hypertension, and tachycardia, which occurred in 43 (32%, 35 (26.3%, and 19 (14.2% dogs, respectively. Cardiac arrhythmia was reported in only 4 dogs. Signs of respiratory depression were present in dogs treated with 6 different CRI protocols. The consumption of isoflurane (vol % reduced between 15.7% and 21.05% after 30minutes of the CRI in the fentanyl and fentanyl–lidocaine–ketamine CRI groups (pO uso de técnicas de infusão contínua (IC possui inúmeras vantagens na anestesia balanceada, como a redução do requerimento de anestésicos inalatórios e controle da dor. Os fármacos mais comumente utilizados nestes protocolos são os anestésicos locais, dissociativos e opioides, que podem ser administrados isoladamente ou em associações. Foram avaliados os prontuários de 200 cães que foram submetidos a diversos procedimentos cirúrgicos com IC de anest

  4. Book review. Anestesia e analgesia locoregionale del cane e del gatto. Francesco Staffieri

    Directory of Open Access Journals (Sweden)

    Manuel Graziani

    2014-03-01

    Full Text Available Il volume di anestesia e analgesia locoregionale del cane e del gatto è pensato per essere un testo "da sala operatoria" – come afferma l'autore – perché consente un rapido, ma allo stesso tempo dettagliato, consulto per il libero professionista che si trova a gestire un'anestesia. Si tratta di un piccolo libro, tascabile, che può essere considerato un punto di partenza per gli studenti e per tutti quei medici veterinari che intendono avvicinarsi in maniera specialistica all'arte dell'anestesiologia veterinaria. L'anestesia locoregionale costituisce, infatti, uno strumento insostituibile per la gestione del dolore perioperatorio in medicina veterinaria. Nel volume si forniscono le nozioni di base per praticare i principali blocchi nervosi centrali e periferici. Per ogni blocco sono riportate le tecniche alla cieca (mediante l'ausilio dei punti di repere anatomici e quelle con l'impiego dello stimolatore nervoso periferico. Il volume, corredato da immagini foto e grafici, per un totale di 65 figure, si apre con i capitoli relativi ai farmaci, agli strumenti e alle complicanze dell'anestesia locoregionale. Prosegue con i blocchi nervosi centrali (anestesia epidurale e spinale e si conclude con i blocchi periferici (testa, arto anteriore, torace, arto posteriore. L'autore, Francesco Staffieri, è un medico veterinario che svolge il dottorato di ricerca nel Dipartimento delle Emergenze e dei Trapianti di Organi, Sezioni di Cliniche Veterinarie e Produzioni Animali dell'Università degli Studi Aldo Moro di Bari.

  5. Efeitos fetais e maternos do propofol, etomidato, tiopental e anestesia epidural, em cesariana eletivas de cadelas

    OpenAIRE

    Lavor Mário Sérgio Lima de; Pompermayer Luiz Gonzaga; Nishiyama Shirley Miti; Duarte Tatiana Schmitz; Filgueiras Richard da Rocha; Odenthal Maria Esther

    2004-01-01

    O objetivo deste trabalho foi comparar os efeitos entre os fármacos indutores de anestesia como propofol, etomidato e tiopental, e a anestesia epidural com lidocaína seguida de indução, em cadelas submetidas à cesariana, e seus neonatos. Para tanto, foram utilizadas 20 cadelas e 129 filhotes distribuídos em quatro grupos. No grupo 1 (5 cadelas e 39 neonatos), a indução anestésica foi feita com propofol; no grupo 2 (5 cadelas e 25 neonatos), com etomidato; no grupo 3 (5 cadelas e 26 neonatos) ...

  6. Anestesia venosa total em paciente portador de Osteogênesis imperfecta: relato de caso Anestesia venosa total en paciente portador de Osteogénesis imperfecta: relato de caso Total intravenous anesthesia in Osteogenesis imperfecta patient: case report

    Directory of Open Access Journals (Sweden)

    José Francisco Nunes Pereira das Neves

    2004-10-01

    ón fue monitorizado con ECG, FC, PANI y SpO2 y sometido a anestesia general venosa total con propofol, alfentanil y cisatracúrio. Después de IOT, fue acrecentada monitorización de la P ET CO2 y de la temperatura esofágica. En el período intra-operatorio y en la sala de recuperación pos-anestésica no presentó complicaciones. Tuvo alta hospitalar en el 5º día de post operatorio. CONCLUSIONES: El presente relato mostró una buena evolución intra y post operatoria de paciente con Osteogenesis Imperfecta sometido a anestesia general venosa total. La complexidad de la enfermedad mostró la necesidad de evaluación y monitorización adecuada por el anestesiologista.BACKGROUND AND OBJECTIVES: Osteogenesis Imperfecta is an uncommon genetic connective tissue disease with prevalence of 1/10000, primarily involving endochondral ossification, resulting in brittle bones, multiple fractures and skeletal deformities. This article aimed at reporting a case of Osteogenesis Imperfecta patient submitted to total intravenous anesthesia for fractured femur surgical repair. CASE REPORT: Male patient, 15 years old, 41 kg, 140 cm, with history of Osteogenesis Imperfecta and cardiopathy, scheduled for fractured femur surgical repair. In the operating room patient was monitored with ECG, HR, NIBP and SpO2 and was submitted to total intravenous anesthesia with propofol, alfentanil and cisatracurium. Monitoring of P ET CO2 and esophageal temperature was introduced after TI. There have been no complications both in the intraoperative period and in the post-anesthetic care unit. Patient was discharged 5 days later. CONCLUSIONS: This report has shown satisfactory intra and postoperative evolution of Osteogenesis Imperfecta patient submitted to total intravenous general anesthesia. Disease complexity has shown the need for anesthesiologist’s adequate evaluation and monitoring.

  7. Usos do sulfato de magnésio em obstetrícia e em anestesia Usos del sulfato de magnesio en obstetricia y en anestesia Applications of Magnesium Sulfate in Obstetrics and Anesthesia

    Directory of Open Access Journals (Sweden)

    Fabiano Timbó Barbosa

    2010-02-01

    la degradación de los ácidos nucleicos, proteínas y ácidos grasos; regula el paso de los iones transmembrana e interviene en la actividad de varias enzimas. El paciente en estado crítico, presenta una tendencia a la hipomagnesemia, y el tratamiento consiste en corregir la causa cuando es posible, acompañada de la reposición del magnesio. Ya ha quedado demostrada la reducción de la concentración alveolar mínima (CAM, de los agentes inhalatorios en animales y el uso de opioides en humanos bajo anestesia. CONCLUSIONES: El sulfato de magnesio, ha venido siendo utilizado en obstetricia con una buena efectividad para la inhibición del parto prematuro y para el tratamiento de las crisis convulsivas asociadas al cuadro de eclampsia. Es un fármaco con potencial analgésico y sedativo que puede ser utilizado como coadyuvante durante la anestesia general, atenuando la respuesta presórica a la intubación traqueal y disminuyendo la necesidad del uso de anestésicos.BACKGROUND AND OBJECTIVES: Magnesium is predominantly an intracellular ion. Its blocking effects on NMDA receptors are responsible for the analgesic and sedative characteristics of this ion. The objective of this study was to review the physiology, pharmacology, and decreased plasma levels of magnesium, as well as its applications in obstetrics and anesthesia. CONTENTS: Magnesium is an intracellular cation with multiple functions: it is a cofactor for enzymes of the glucose metabolism and those that participate in the degradation of nucleic acids, proteins, and fatty acids; it regulates the movements of transmembrane ions; and it intervenes in the activity of several enzymes. Critical patients have a tendency to develop hypomagnesemia, and the treatment consists in correcting the cause, whenever possible, and replacement of magnesium. A reduction in the minimum alveolar concentration (MAC of inhalational agents in animals and the use of opioids in humans under anesthesia has been demonstrated. CONCLUSIONS

  8. Anestesia em paciente com síndrome de Rubinstein-Taybi: relato de caso Anestesia en paciente con síndrome de Rubinstein-Taybi: relato de caso Anesthesia in patient with Rubinstein-Taybi syndrome: case report

    Directory of Open Access Journals (Sweden)

    Carlos Rogério Degrandi Oliveira

    2005-10-01

    la anestesia general para extracciones de dientes anormalmente posicionados. Presentaba las características típicas de la SRT, retardo físico y mental, anormalidades craneofaciales y hálux y pulgares anchos. La anestesia fue inducida y mantenida con sevoflurano, inicialmente bajo máscara facial y después intubación nasotraqueal en ventilación asistida manual con sistema de Bain. No hubo interocurrencias y la cirugía fue realizada en régimen ambulatorial. CONCLUSIONES: La importancia de la evaluación pre-anestésica es realizada, debido a las malformaciones, incluso cardíacas, asociadas a este síndrome. En este caso en particular, el paciente no presentaba comprometimiento cardíaco, presente en un tercio de los casos. Se recomienda preparación para una posible dificultad de mantenimiento de las vías aéreas.BACKGROUND AND OBJECTIVES: Rubinstein-Taybi syndrome (RTS is a genetic disease caused by mutation or deletion of chromosome 16, and characterized by growth and mental retardation, clubbing thumbs and toes and craniofacial abnormalities. There is little information about RTS in the anesthetic literature. This report aimed at describing the anesthetic management of a patient with Rubinstein-Taybi syndrome submitted to dentistry surgery and at discussing aspects of this syndrome that may be relevant to anesthesia. CASE REPORT: Male patient, 9-year-old, 28 kg, to be submitted to general anesthesia for extraction of abnormally positioned teeth. Patient presented with typical RTS characteristics (growth and mental retardation, clubbing thumbs and toes and craniofacial abnormalities. Anesthesia was induced and initially maintained with sevoflurane under facial mask; after tracheal intubation it was maintained under manually controlled ventilation with Bain system. There have been no complications and procedure was performed in outpatient regimen. CONCLUSIONS: The importance of thorough preanesthetic evaluation is emphasized due to possible associated

  9. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. Anestesia em paciente portador de distrofia muscular de Duchenne: relato de casos Anestesia en un paciente portador de distrofia muscular de Duchenne: relato de casos Anesthesia for Duchenne muscular dystrophy patients: case reports

    Directory of Open Access Journals (Sweden)

    Rodrigo Machado Saldanha

    2005-08-01

    eficiente nos portadores de DMD.JUSTIFICATIVA Y OBJETIVOS: Relatar dos casos de anestesia en pacientes portadores de Distrofia Muscular de Duchenne (DMD, una enfermedad rara, progresiva e incapacitante, y discutir sobre la conducta anestésica y comprometimiento de las funciones pulmonar y cardiaca, la posibilidad de ocurrencia de hipertermia maligna, la mayor sensibilidad a los bloqueadores neuromusculares y el aumento de la morbidad pos-operatoria son algunos de los desafíos enfrentados por el Anestesiologista. RELATO DE LOS CASOS: El primer caso fue el de un paciente pediátrico con diagnóstico de DMD y rabdomiosarcoma, agendado para exéresis de la lesión y vaciamiento cervical ampliado. En la evaluación pre-anestésica, anamnesis, examen clínico y exámenes complementarios no fueron detectadas alteraciones, excepto por la tumoración cervical. Se optó por la técnica venosa total, con remifentanil en infusión continuada y propofol en infusión mira-controlada, sin la utilización de bloqueadores neuromusculares. El procedimiento quirúrgico tuvo duración de 180 minutos, sin intercurrencias. El segundo caso fue de un paciente del sexo masculino, 24 años, con diagnóstico de DMD y colelitiasis con indicación quirúrgica, en el cual la evaluación pre-operatoria reveló pneumopatia restrictiva grave, con disminuciones de la capacidad y de la reserva respiratorias, siendo necesario el uso de BIPAP nasal nocturno. En este paciente, se optó por la intubación traqueal con sedación mínima y anestesia tópica, seguida por la técnica venosa total con remifentanil en infusión continuada y propofol en infusión mira-controlada, sin la utilización de bloqueadores neuromusculares. Al término, el paciente fue extubado aún en la sala del operaciones e inmediatamente colocado en el BIPAP nasal. Encaminado a la UTI, con alta en el 2º PO y alta hospitalaria en el 3º PO. CONCLUSIONES: La anestesia venosa total con infusión continuada de propofol y remifentanil sin

  11. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  12. Primer on Social Economics.

    Science.gov (United States)

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  13. Anestesia e o usuário de Ecstasy Anestesia y el usuario de Ecstasy Anesthesia and the Ecstasy user

    Directory of Open Access Journals (Sweden)

    Eduardo Toshiyuki Moro

    2006-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Nos últimos anos o número de novos usuários de agentes ilícitos tem aumentado de forma significativa em todo o mundo. A maconha e a cocaína, além do álcool e do tabaco, têm sido os agentes citados com freqüência, porém houve um aumento significativo de usuários de outros agentes psicoestimulantes ou alucinógenos, como o Ecstasy, o GHB, o LSD e a metanfetamina, empregados com o objetivo de intensificar as experiências sociais. O objetivo do presente artigo foi discutir a apresentação clínica, os efeitos deletérios e as potenciais interações com o ato anestésico no paciente cirúrgico usuário desses agentes ilícitos. CONTEÚDO: O artigo discute os mecanismos de ação, a apresentação clínica, os efeitos deletérios e as possíveis repercussões observadas durante a anestesia no usuário de MDMA (3,4-metilenodioximetanfetamina, também conhecido como Ecstasy. CONCLUSÕES: A apresentação clínica e os efeitos deletérios provocados pelo 3,4-metilenodioximetanfetamina (Ecstasy, assim como potenciais interações com o ato anestésico devem ser do conhecimento do anestesiologista, pois em muitas situações esses usuários serão submetidos a intervenções cirúrgicas de emergência, ou mesmo eletivas.JUSTIFICATIVA Y OBJETIVOS: En los últimos años el número de nuevos usuarios de drogas ilícitas ha aumentado de forma significativa en todo el mundo. La marihuana y la cocaína, además del alcohol y del tabaco, han sido las drogas citadas frecuentemente, sin embargo, hubo un aumento significativo de usuarios de otros agentes psicoestimulantes o alucinógenos, como el Ecstasy, el GHB, el LSD y la metanfetamina, empleados con el objetivo de intensificar las experiencias sociales. El objetivo del presente artículo fue el de traer a colación la presentación clínica, los efectos destructivos y las potenciales interacciones con el acto anestésico en el paciente quirúrgico usuario de esas drogas

  14. Aplicação do monitor Narcotrend® para avaliar a profundidade da anestesia em crianças submetidas à cirurgia cardíaca: estudo prospectivo e controlado Aplicación del monitor Narcotrend® para evaluar la profundidad de la anestesia en niños sometidos a la cirugía cardíaca: estudio prospectivo y controlado Application of Narcotrend® monitor for evaluation of depth of anesthesia in infants undergoing cardiac surgery: a prospective control study

    Directory of Open Access Journals (Sweden)

    Yiyan Jiang

    2013-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Investigar a eficácia clínica, segurança e viabilidade do monitor Narcotrend® para avaliar a profundidade da anestesia em crianças com doença cardíaca congênita (DCC submetidas à cirurgia cardíaca. MÉTODOS: Foram randomicamente selecionadas 80 crianças submetidas à anestesia geral em cirurgia seletiva. As crianças foram divididas em dois grupos de forma aleatória (n = 40 por grupo. No grupo Narcotrend, a profundidade da anestesia foi monitorada com o Narcotrend. No grupo padrão, a profundidade da anestesia foi controlada de acordo com a experiência clínica. A pressão arterial média (PAM e a frequência cardíaca (FC foram determinadas e a dose de fentanil e relaxante muscular e os tempos de recuperação e de extubação foram registrados. RESULTADOS: Em ambos os grupos, os sinais vitais apresentaram-se estáveis durante a cirurgia. No grupo Narcotrend, a PAM e a FC foram mais estáveis, a dose total de fentanil e relaxante muscular significativamente menor e os tempos de recuperação e extubação acentuadamente mais reduzidos em comparação com o grupo padrão. CONCLUSÃO: A aplicação do monitor Narcotrend para medir a profundidade da anestesia foi útil para controlar a profundidade da anestesia em crianças com DCC que receberam anestesia intravenosa total, na qual uma pequena quantidade de narcóticos pode obter a anestesia ideal. Além disso, os tempos de recuperação e extubação foram menores e os efeitos secundários, como sensibilização intraoperatória, puderam ser evitados.JUSTIFICATIVA Y OBJETIVOS: Investigar la eficacia clínica, la seguridad y la viabilidad del monitor Narcotrend® para evaluar la profundidad de la anestesia en niños con enfermedad cardíaca congénita (ECC sometidos a la cirugía cardíaca. MÉTODOS: Un total de 80 niños sometidos a la anestesia general en cirugía selectiva fueron seleccionados aleatoriamente. Los niños fueron divididos en dos grupos de

  15. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  16. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  17. Anestesia congênita de córnea associada à anestesia de ramo do trigêmio: relato de caso Congenital corneal anesthesia related to trigeminal anesthesia: case report

    Directory of Open Access Journals (Sweden)

    Miguel José Calix Netto

    2005-12-01

    Full Text Available A anestesia corneana por ser uma condição rara, freqüentemente é confundida ou não diagnosticada durante o exame de rotina do segmento anterior. Relato de caso de um paciente de 18 anos encaminhado ao ambulatório de córnea e doenças externas com quadro clinico de síndrome de olho seco e com diagnóstico provável de síndrome de Sjögren. Era amblíope de olho direito devido à opacidade corneana no eixo visual secundária a trauma com unha na infância. Foi pesquisada sensibilidade corneana que era ausente em ambos os olhos; olho seco grave e com BUT (tempo de quebra do filme lacrimal menor que 4 segundos. Foi feito diagnóstico de anestesia corneana congênita associada a hipoestesia do nervo trigêmio pela avaliação neurológica da sensibilidade facial e movimentos bruscos do queixo que evidenciavam alterações sensoriais do nervo. O oftalmologista geral e principalmente o especialista em segmento anterior devem ter como rotina a pesquisa da sensibilidade corneana no exame do segmento anterior.Corneal anesthesia is a rare condition, therefore its diagnosis is frequently impaired or it is not noticed during the anterior segment examination. Case report of a 18-year-old patient referred to our Corneal and External Disease Department who complained of dry eye symptoms and with a suspicion of Sjögren's syndrome. She had amblyopia of the right eye, consequence of corneal leucoma over the visual axis secondary to a fingernail traumatism inflicted by herself in childhood. On the ophthalmologic examination corneal sensitivity was absent in both eyes. Severe dry eye and breakup time less than four seconds. Diagnosis of congenital corneal anesthesia was established, secondary to trigeminal anesthesia found on neurological evaluation of facial sensitivity. She also showed sudden movements of the chin which evidenced sensorial pathology of the trigeminal nerve. The general ophthalmologist and specially anterior segment specialists must

  18. Anestesia em paciente com síndrome de Gilbert: relato de caso

    Directory of Open Access Journals (Sweden)

    Barbosa Fabiano Timbó

    2004-01-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A síndrome de Gilbert é uma doença crônica benigna, a qual leva à icterícia recorrente com grande aumento da bilirrubina não conjugada, que pode levar à toxicidade após o uso de medicações utilizadas na prática diária. O objetivo deste relato é descrever a conduta anestésica em uma paciente com síndrome de Gilbert, submetida à cirurgia videolaparoscópica. RELATO DO CASO: Paciente do sexo feminino, com 22 anos, portadora da síndrome de Gilbert, submetida à cirurgia videolaparoscópica sob anestesia geral com propofol, alfentanil, succinilcolina, atracúrio e isoflurano. Não houve sinais de toxicidade durante a anestesia. A paciente apresentou recuperação pós-operatória sem intercorrências e recebeu alta hospitalar após três dias. CONCLUSÕES: O paciente portador da síndrome de Gilbert pode ser submetido à anestesia geral de forma segura sem o aparecimento de toxicidade desde que sejam evitados os fatores que possam levar à diminuição da atividade da glicuroniltransferase.

  19. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  20. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  1. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  2. Solarium primer. [Monograph

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    Solaria can be used to collect solar energy for space heating and provide an open environment. This primer introduces the basic concepts of an energy-efficient solarium and provides information on the practical aspects of siting, design, and construction. The horticultural use of a solarium as a greenhouse is not dealt with except in explaining the influence this may have on its design and operation. The book shows the characteristics of different types of solaria, their advantages as well as their limitations. It also explains the prerequisite of a successful addition to an existing home. Design and construction details accompany the text. 73 references, 2 tables.

  3. Anestesia para correção intra-útero de mielomeningocele: relato de caso Anestesia para corrección intra-útero de mielomeningocele: relato de caso Anesthesia for intrauterine myelomeningocele correction: case report

    Directory of Open Access Journals (Sweden)

    Angélica de Fátima de Assunção Braga

    2005-06-01

    magnésio (4 g/20minutos, seguido de infusão contínua (2 g/hora. Ao final da cirurgia injetou-se morfina (2 mg pelo cateter peridural para analgesia pós-operatória. CONCLUSÕES: A anestesia para cirurgia fetal envolve dois seres, m��e e feto, e o manuseio anestésico exige segurança materno-fetal, anestesia e imobilidade fetal, relaxamento uterino, prevenção do trabalho de parto prematuro e analgesia pós-operatória.JUSTIFICATIVA Y OBJETIVOS: La cirugía fetal constituye tratamiento de malformaciones en el período prenatal, que no son adecuadamente corregidas después del nacimiento y tiene como objetivo tratar o evitar la progresión de las anomalías. El objetivo de este relato es presentar un caso de anestesia para corrección intra-útero de mielomeningocele. RELATO DEL CASO: Paciente con 19 años, 23 semanas de edad gestacional, sin antecedentes anestésicos, estado físico ASA I, sometida a cirugía fetal intrauterina, bajo anestesia general asociada a la peridural continuada. En el pre-operatorio se utilizaron indometacina (50 mg por vía rectal, metoclopramida (10 mg por vía venosa, cimetidina (50 mg por vía venosa, y como medicación pre-anestésica midazolam (2 mg por vía venosa. En el espacio peridural se inyectó bupivacaína a 0,25% con adrenalina (25 mg asociada al fentanil (100 µg, seguida del pasaje de catéter cefálico, para analgesia postoperatoria. El útero fue mantenido dislocado para la izquierda con auxilio de la cuña de Crawford. Inducción anestésica en secuencia rápida, con fentanil, propofol y rocuronio y mantenimiento con isoflurano en concentración del 2,5% a 3% vehiculado en O2 y N2O (50%. Después de la histerotomía, realizada con staplin (grapadoras para promover hemostasia, la región fetal a ser operada fue expuesta y la analgesia e inmovilidad fetal, fue lograda con la asociación fentanil (10 µg.kg-1 y pancuronio (0,1 mg.kg-1 administrada en la región glútea fetal. La presión arterial sistólica materna fue

  4. Avaliação da memória sob anestesia venosa total

    Directory of Open Access Journals (Sweden)

    Gulistan Aktas

    2013-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Neste estudo, objetivamos avaliar a memória implícita e explícita em pacientes submetidos à cirurgia abdominal sob anestesia venosa total (AVT com propofol e remifentanil, na qual o nível de anestesia foi controlado pelo monitoramento do índice bispectral (BIS. MÉTODO: Anestesia venosa total foi administrada a 60 pacientes adultos para obter níveis de BIS de 40-60. Os pacientes foram randomicamente divididos em três grupos, de acordo com as gravações que ouviram. Os pacientes do grupo categoria (CT ouviram uma fita gravada contendo cinco nomes de animais. Os pacientes do grupo recordar palavras (RP ouviram uma fita gravada contendo cinco palavras de frequência média na língua turca, depois de adaptadas. Os pacientes do grupo controle (GC ouviram os sons do mar até o fim da cirurgia. Duas horas após a cirurgia, os testes foram administrados a cada paciente na sala de recuperação para avaliar a memória. RESULTADOS: Houve uma diferença entre os escores dos grupos CT e GC no Miniexame do Estado Mental (MMSE; todos os escores foram > 20. Os resultados dos testes de categoria e recordar palavras, aplicados para avaliar a memória implícita, não foram estatisticamente diferentes entre os grupos. Não houve evidência de memória implícita em nenhum dos pacientes. Um paciente lembrou-se de ouvir "o som de água" como uma prova de memória explícita. Onze pacientes declararam não ter sonhado. CONCLUSÕES: Apesar de não termos encontrado nenhuma evidência de memória implícita sob anestesia adequada com AVT, um paciente apresentou memória explícita. Embora a profundidade adequada da anestesia fornecida pelo monitoramento do BIS corrobore nossos resultados para a memória implícita, ela não explica os resultados para a memória explícita.

  5. Photovoltaics module interface: General purpose primers

    Science.gov (United States)

    Boerio, J.

    1985-01-01

    The interfacial chemistry established between ethylene vinyl acetate (EVA) and the aluminized back surface of commercial solar cells was observed experimentally. The technique employed is called Fourier Transform Infrared (FTIR) spectroscopy, with the infrared signal being reflected back from the aluminum surface through the EVA film. Reflection infrared (IR) spectra are given and attention is drawn to the specific IR peak at 1080/cm which forms on hydrolytic aging of the EVA/aluminum system. With this fundamental finding, and the workable experimental techniques, candidate silane coupling agents are employed at the interface, and their effects on eliminating or slowing hydrolytic aging of the EVA/aluminum interface are monitored.

  6. Hematoma epidural secundario a anestesia espinal: Tratamiento conservador Epidural hematoma secondary to spinal anesthesia: Conservative treatment

    Directory of Open Access Journals (Sweden)

    M. Bermejo

    2004-11-01

    Full Text Available Introducción: El hematoma epidural secundario a una anestesia neuroaxial es una complicación poco frecuente, pero de gran trascendencia tanto por sus implicaciones clínicas como por las médico legales; según algunos autores su incidencia puede oscilar entre 1/190.000-1/200.000 para las punciones peridurales y 1/320.000 en el caso de las espinales. El aspecto prioritario en su manejo terapéutico es el del diagnóstico y tratamiento precoz, antes de las 6-12 primeras horas. No obstante, en determinados pacientes como en el caso que presentamos puede no ser precisa la cirugía, resolviéndose el cuadro con tratamiento conservador. Caso clínico: Varón de 73 años, ASA IV, con antecedentes de cirrosis con hipertensión portal, hiperesplenismo, EPOC, obesidad, cardiopatía hipertensiva e insuficiencia tricuspídea. Se programa para alcoholización prostática al haber sido desechada la cirugía. En la analítica preoperatoria destacaba una actividad de protrombina del 80% y 90.000 plaquetas. Se realizaron varios intentos fallidos de punción espinal, finalmente fue precisa una anestesia general con ventilación espontánea mediante mascarilla laríngea, propofol, fentanilo y sevoflurano. A las 36 horas, comienza la clínica en forma de dolor intenso lumbar, sin irradiación y arreflexia cutáneo plantar, confirmándose en la RMN la presencia de un hematoma epidural de L1 a L4. Ante la ausencia de paraparesia flácida, afectación esfinteriana u otros signos sensitivo-motores y tras consulta con la Unidad de Raquis y con el Servicio de Neurología se decide tratamiento conservador y actitud expectante en forma de analgesia y monitorización neurológica estricta, clínica y radiológica. Evolucionando favorablemente en los siguientes días. Discusión: Determinadas condiciones clínicas pueden influir en la aparición de un hematoma tras la realización de un bloqueo regional central: heparinas de bajo peso molecular, punciones dificultosas

  7. Anestesia para separação de gêmeos isquiópagos no período neonatal: relato de caso Anestesia para separación de gemelos isquiópagos en el período neonatal Anesthetic management for neonatal conjoined twins separation: case report

    Directory of Open Access Journals (Sweden)

    Norma Sueli Pinheiro Módolo

    2002-07-01

    para la literatura existente, relatando los desafíos encontrados por nuestro equipo en el atendimiento a la cirurgia-anestesia de separación de gemelos isquiópagos. RELATO DO CASO: Pacientes gemelos, nacidos a término, de parto cesariano, pesando juntos 5.100 g, clasificados como isquiópagus tetrapus. Dos equipos anestésico-quirúrgicos estaban presentes, siendo el procedimiento anestésico esquematizado con aparato de anestesia, cardioscópio, capnógrafo, oxímetro de pulso, termómetro eléctrico, estetoscópio esofágico, todos en duplo. Se realizó inducción anestésica con halotano y fentanil, con los gemelos en posición lateral y con rotación de la cabeza en 45º para facilitar la intubación traqueal. Los recién-nacidos fueron mantenidos en ventilación controlada manualmente, utilizando el sistema de Rees-Baraka. La anestesia fue mantenida con halotano, oxígeno y fentanil. Durante el per-operatorio, fueron encontrados organismos abdominales duplos, con excepción del cólon, que era único. Las vejigas y los ísquios estaban ligados. Al final de la cirugía los dos niños se presentaban con señales vitales estables. Los gemelos permanecieron en la Unidad de Terapia Intensiva (UTI Neonatal por cuatro semanas y recibieron alta en buen estado general. CONCLUSIONES: Se resalta la importancia del engranaje del equipo, del estudio retrospectivo multidisciplinar, de la monitorización adecuada y perfeccionada observación clínica; todos esos factores contribuyeron para la buena evolución y alta de los gemelos.BACKGROUND AND OBJECTIVES: The separation of conjoined twins has always raised considerable interest because of surgical and anesthetic complexity, pathology rarity and few survival chances. The goal of this description was to contribute to existing literature by reporting the challenges faced by our team during an anesthetic-surgical procedure for ischiopagus twins separation. CASE REPORT: Term conjoined twins, born from Cesarean section, weighing

  8. Anestesia e síndrome do QT longo Anestesia e síndrome del QT largo Anesthesia and the long QT syndrome

    Directory of Open Access Journals (Sweden)

    Michelle Nacur Lorentz

    2007-10-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: As disritmias cardíacas são fatores importantes de morbimortalidade no período perioperatório. Dentre as causas de disritmias, a síndrome do QT longo, tanto em sua forma genética como adquirida deve ser lembrada, já que muitos fármacos usados em anestesia, bem como ocorrências no período perioperatório podem prolongar o intervalo QT e precipitar disritmias cardíacas potencialmente malignas. CONTEÚDO: Revisão da síndrome do QT longo (LQTS, abordando suas causas e sua definição, assim como os mecanismos da doença. Além de citar vários fármacos implicados no prolongamento do intervalo QT, as abordagens anestésicas mais adequadas para os pacientes afetados são sugeridas. CONCLUSÃO: A síndrome do QT longo, possível causa de morbimortalidade intra e pós-operatória, pode estar relacionada com fármacos utilizados durante anestesia. Essa condição demanda conhecimento do anestesiologista a fim de evitar desfecho desfavorável do ato operatório.JUSTIFICATIVA Y OBJETIVOS: Las arritmias cardíacas son factores importantes de morbi mortalidad en el período perioperatorio. Entre las causas de arritmias, el síndrome del QT largo, tanto en su forma genética como adquirida debe ser recordado ya que muchos fármacos usados en anestesia, e incidencias en el período perioperatorio pueden prolongar el intervalo QT y precipitar arritmias potencialmente malignas. CONTENIDO: Revisión del Síndrome del QT largo (LQTS, abordando sus causas y definición, y los mecanismos de la enfermedad. Además de citar varios fármacos implicados en el prolongamiento del intervalo QT, los abordajes anestésicos más adecuadas para los pacientes afectados son sugeridas. CONCLUSIÓN: El síndrome del QT largo, posible causa de morbimortalidad intra y postoperatoria, puede estar relacionada a fármacos utilizados durante anestesia. Esa condición demanda conocimiento del anestesiólogo para evitar un desenlace no deseado de

  9. ¿Disminuyen las complicaciones respiratorias postoperatorias en pacientes con enfermedad pulmonar obstructiva crónica con el uso de ventilación controlada por presión en anestesia?

    OpenAIRE

    Barriga Moreno, Adriana Paola

    2013-01-01

    Antecedentes: La ventilación mecánica en una de las principales medidas terapéuticas en anestesiología por lo que se requiere mejorar su conocimiento buscando nuevos modos ventilatorios que permitan tener mejores desenlaces en los pacientes que requieren soporte ventilatorio invasivo durante cirugías realizadas bajo anestesia general. El uso de la ventilación controlada por presión trae ventajas fisiológicas para los pacientes que requieren soporte con ventilación mecánica invasiva, el ob...

  10. Anestesia e apnéia obstrutiva do sono Anestesia y apnea obstructiva del sueño Anesthesia and obstructive sleep apnea

    Directory of Open Access Journals (Sweden)

    Charles Machado

    2006-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A manutenção da permeabilidade das vias aéreas superiores (VAS é fundamental para anestesia e para pacientes com apnéia obstrutiva do sono (AOS. Durante ambos os estados ocorre uma redução do tônus da musculatura faríngea. Identificar pacientes com AOS é importante a fim de prevenir riscos durante o período perioperatório. O objetivo deste trabalho foi apresentar uma revisão sobre a relação entre AOS e anestesia, levando em conta o planejamento da anestesia, enfatizando a importância da identificação da síndrome da apnéia e hipopnéia obstrutiva do sono (SAHOS. CONTEÚDO: A SAHOS ocorre principalmente por colapso total ou parcial da faringe, podendo levar a diminuição na saturação da oxiemoglobina e complicações cardiovasculares. Os principais fatores predisponentes são sexo masculino, obesidade, características crânio e orofaciais. Seu diagnóstico é clínico e polissonográfico, o que também quantifica a gravidade da AOS. Os pacientes com SAHOS especialmente acentuada podem apresentar problemas durante a intubação traqueal e sedação, estando alguns mais susceptíveis à ocorrência de hipóxia e hipercapnia, mesmo na vigência de pulmões normais. Os autores discutem a importância do diagnóstico prévio e tratamento da SAHOS na tentativa de reduzir o risco anestésico. CONCLUSÕES: O diagnóstico e tratamento prévio da SAHOS com pressão positiva contínua nas VAS podem reduzir complicações perioperatórias e influenciar na conduta anestésica e na recuperação pós-anestésica.JUSTIFICATIVA Y OBJETIVOS: El mantenimiento de la permeabilidad de las vías aéreas superiores (VAS es fundamental para la anestesia y para pacientes con apnea obstructiva del sueño (AOS. Durante los de los estados, ocurre una reducción del tono de la musculatura faríngea. Identificar pacientes con AOS es importante para prevenir riesgos durante el período perioperatorio. El objetivo de este

  11. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  12. Anestesia em paciente portador de deficiência de glicose-6-fosfato-desidrogenase: relato de caso

    OpenAIRE

    Abreu Múcio Paranhos de; Freire Carla Cristina Silva; Miura Rogério Shiuguetoshi

    2002-01-01

    JUSTIFICATIVA E OBJETIVOS: A Deficiência de Glicose-6-Fosfato-Desidrogenase (G6PD) é uma enzimopatia relativamente comum, mas as publicações relacionando essa condição com a anestesia são escassas. O objetivo deste relato é apresentar um caso de paciente portador de Deficiência de G6PD, submetido à tenotomia para alongamento de tendão de Aquiles, sob anestesia venosa associada à bloqueio subaracnóideo. Relato do caso: Paciente masculino, 9 anos, 48 kg, portador de deficiência de G6PD e poline...

  13. Efeitos fetais e maternos do propofol, etomidato, tiopental e anestesia epidural, em cesariana eletivas de cadelas

    Directory of Open Access Journals (Sweden)

    Lavor Mário Sérgio Lima de

    2004-01-01

    Full Text Available O objetivo deste trabalho foi comparar os efeitos entre os fármacos indutores de anestesia como propofol, etomidato e tiopental, e a anestesia epidural com lidocaína seguida de indução, em cadelas submetidas à cesariana, e seus neonatos. Para tanto, foram utilizadas 20 cadelas e 129 filhotes distribuídos em quatro grupos. No grupo 1 (5 cadelas e 39 neonatos, a indução anestésica foi feita com propofol; no grupo 2 (5 cadelas e 25 neonatos, com etomidato; no grupo 3 (5 cadelas e 26 neonatos com tiopental e no grupo 4, (5 cadelas e 39 neonatos utilizou-se anestesia epidural e indução com halotano através de máscara. Em todos os casos, a medicação pré-anestésica foi feita com midazolam na dose de 0,22mg kg-1 via IM, e a manutenção anestésica com halotano em circuito semifechado e concentração inicial de 3V%. As variáveis avaliadas nas cadelas foram: temperatura retal, freqüência cardíaca, freqüência respiratória, saturação da oxi-hemoglobina (SpO2, pressão arterial média. Para a avaliação dos recém-nascidos, foram mensurados: freqüência cardíaca, esforço respiratório, movimentos musculares, coloração das mucosas e irritabilidade reflexa interpretados através do escore de Apgar modificado, bem como a SpO2 do neonato. Os resultados mostraram que todos os protocolos foram adequados para as mães com mínimos efeitos sistêmicos. Para o neonato, a utilização de anestesia epidural na mãe, seguida de indução e manutenção com halotano foi superior aos protocolos que usaram agentes injetáveis na indução anestésica.

  14. Uso de dexmedetomidina en anestesia total intravenosa / Use of total intravenous anesthesia dexmetomidine

    OpenAIRE

    García Botero, Andrés

    2011-01-01

    La dexmedetomidina Inicialmente se uso en unidades de cuidados intensivos para sedación. Sin embargo, sus efectos sedantes, analgésicos y ansiolíticos sin alteración de la función ventilatoria, permiten ampliar su uso en cirugía como anestésico intravenoso. . La literatura reporta su utilidad en poblaciones quirúrgicas definidas, sin embargo aun faltan estudios que respalden su utilización en todos los escenarios de la anestesia total intravenosa (TIVA). El Propósito de la actual revisión es...

  15. Anestesia del toro bravo. Estudio clínico, cardiorrespiratorio y neurológico

    OpenAIRE

    Muñoz Rascón, Pilar

    2014-01-01

    El toro bravo, tanto por su temperamento como por ser una raza extensiva en semilibertad se asemeja más a los bovinos de vida libre como el búfalo o el bisonte que a los bovinos domésticos. Estos animales, en ocasiones, requieren asistencia veterinaria para la realización de procedimientos medico-quirúrgicos, diagnósticos o de manejo que necesitan de la anestesia como herramienta imprescindible para su realización. La inmovilización de estos animales resulta esencial para minim...

  16. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu

    2007-01-01

    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  17. Contaminação do aparelho de anestesia por agentes patógenos

    Directory of Open Access Journals (Sweden)

    Luiza Alves de Castro Arai

    2011-02-01

    Full Text Available JUSTIFICATIVA E OJETIVOS: Avaliação da contaminação dos aparelhos de anestesia por meio de coletas de 56 amostras para cultura no sistema circular do aparelho de anestesia, em traqueias previamente reprocessadas por desinfecção com hipoclorito à 1% ou glutaraldeído à 2% , após lavagem com sabão e água não estéreis, secas com jato de ar comprimido e armazenadas em papel com grau cirúrgico, e em outros locais do circuito respiratório não reprocessados, antes dos procedimentos anestésicos. MÉTODO: Foram realizadas culturas de amostras das traqueias dos ramos inspiratórios, ramos expiratórios, canister, cal sodada e frasco coletor (dreno, em swab com meio Stuart e semeadas em meio de cultura Agar sangue, Mac Conkey e Sabouraud. RESULTADOS: Nas traqueias reprocessadas dos ramos inspiratórios e expiratórios dos aparelhos de anestesia, o nível de contaminação em alguns sítios foi de até 39,3%, com a presença de fungos e bactérias e, em alguns casos, com a presença de mais de um micro-organismo sendo 75% da contaminação de fungos e 25% de bactérias. Foi encontrada cultura positiva para Candida sp., Dermatophytus sp., Penicillium sp., Aspergillus sp., Staphylococcus aureus, Staphylococcus saprophyticcu e Staphylococcus epidermidis. No canister houve contaminação em 25% com o crescimento de Candida sp., Penicillium sp., Dermatophytus sp., Aspergillus sp. e Fusarium sp. No frasco coletor, observou-se a contaminação de 36% das amostras analisadas com crescimento de Candida sp., Dermatophytus sp., Staphilocccus saprophyticus e Acinetobacter bauman nii. Nas culturas da cal sodada não houve crescimento de micro-organismos. CONCLUSÕES: Em todos os pontos analisados, com exceção da cal sodada, houve crescimento de micro-organismos com a possibilidade de haver contaminação cruzada.

  18. Anestesia subdural após punção peridural: relato de dois casos Anestesia subdural después punción peridural: relato de dos casos Subdural anesthesia after epidural puncture: two case reports

    Directory of Open Access Journals (Sweden)

    Carlos Escobar Vásquez

    2003-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Anestesias condutivas peridurais são realizadas amplamente no nosso meio. A anestesia subdural acidental após punção peridural é uma complicação rara. O objetivo deste relato é descrever dois casos de injeção subdural que coincidentemente ocorreram de forma consecutiva realizadas pelo mesmo anestesiologista. RELATO DOS CASOS: Caso 1: Paciente do sexo masculino, 41 anos, estado físico ASA I, a realizar procedimento cirúrgico de retirada de cálculo renal. Optou-se por anestesia peridural. Após 30 minutos do início da anestesia, o paciente mantinha-se comunicativo mas sonolento com SpO2 de 100%, quando lentamente começou a apresentar diminuição da SpO2 chegando a 80%. Apresentava-se inconsciente com apnéia e anisocoria. A partir deste momento foi levantada hipótese diagnóstica de anestesia subdural acidental. O paciente foi então intubado e mantido em ventilação controlada mecânica. Terminada a cirurgia, foi encaminhado para a sala de recuperação, recebendo alta após 6 horas, sem nenhuma alteração clínico-neurológica. Caso 2: Paciente do sexo feminino, 82 anos, estado físico ASA II, programado para procedimento cirúrgico de fixação de fratura transtrocanteriana. Optou-se por anestesia peridural contínua. Assim como no caso anterior, após 30 minutos, a paciente começou a apresentar diminuição da SpO2 para 90%. Mostrava-se inconsciente e com anisocoria; entretanto, sem apnéia. Optou-se por manter a paciente sob vigilância constante, não sendo necessária intubação. A hipótese diagnóstica aventada também neste caso foi de anestesia subdural acidental. Terminada a cirurgia, a paciente foi encaminhada à sala de recuperação pós-anestésica, tendo alta após 4 horas, sem nenhuma alteração clínico-neurológica. CONCLUSÕES: Anestesia subdural acidental é uma complicação extremamente rara. A hipótese diagnóstica de anestesia subdural acidental, nestes casos, limitou

  19. Anestesia em gestante com hipertensão intracraniana por meningite tuberculosa: relato de caso Anestesia en gestante con hipertensión intracraneal por meningitis tísica: relato de caso Anesthesia in pregnant patient with intracranial hypertension due to tuberculous meningitis: case report

    Directory of Open Access Journals (Sweden)

    Vanessa Breitenbach

    2005-02-01

    área electiva. RELATO DEL CASO: Paciente blanca, 32 años, 60 kg, 1,62 m de estatura, en la 36ªsemana de edad gestacional, agendada para interrupción quirúrgica de la gestación por presentarse tetraparética, con hidrocefalia consecuente de meningitis tísica, (tuberculosa. Se escogió la anestesia general para la cesárea con inducción en secuencia rápida y maniobra de Sellick para la intubación traqueal. Las drogas utilizadas fueron tiopental (250 mg, rocuronio (50 mg, fentanil (100 µg y lidocaína (60 mg por vía venosa. La inducción anestésica fue suave y mantenida con isoflurano hasta el inicio del encerramiento de la piel de la paciente, con mínimas alteraciones de sus señales vitales y del recién nacido, que recibió índice de Apgar 8 y 9, en el 1º y 5º minutos, respectivamente. La paciente despertó precozmente, sin deficiencias neurológicas adicionales. CONCLUSIONES:La anestesia general aún es la técnica anestésica preferida para cesárea en gestantes con hipertensión intracraneal, utilizándose drogas de media-vida corta y que tengan mínima interferencia en la presión intracraneal y en el recién nacido.BACKGROUND AND OBJECTIVES: It is a well-established fact today that the technique of choice for elective cesarean delivery is regional anesthesia. However, in patients with intracranial hypertension and central nervous system infection, this technique should be avoided. This paper aimed at reporting the anesthetic management of a pregnant patient with intracranial hypertension due to tuberculous meningitis submitted to elective cesarean delivery. CASE REPORT: Caucasian patient, 32 years old, 1.62 m height and 60 kg weight, in the 36th week of gestational age admitted to the obstetrics unit to have her pregnancy interrupted by cesarean delivery because she had become quadriparetic with hydrocephalus due to tuberculous meningitis. The chosen technique was general anesthesia with rapid sequence induction and Sellick maneuver for intubation. Drugs

  20. Factores que influyen en la decisión de utilizar anestesia epidural en las mujeres

    OpenAIRE

    Campoy Quesada, María Josefa; Haro García, Juan Pedro de

    2014-01-01

    Justificación: La inmigración en España es un fenómeno de gran importancia que repercute en el área de la salud. Objetivo: Investigar la relación entre la elección de la anestesia epidural y la nacionalidad de la mujer, y a su vez, observar si influyen además otros factores en esta decisión. Diseño y Metodología: Estudio cuantitativo, transversal y descriptivo con una muestra de 634 mujeres que han dado a luz en el Hospital del Noroeste de la Región de Murcia. Las variables seleccionadas fuer...

  1. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  2. Manobra de recrutamento alveolar em anestesia: como, quando e por que utilizá-la Maniobra de reclutamiento alveolar en anestesia: como, cuando y por qué utilizarla Alveolar recruitment maneuver in anesthetic practice: how, when and why it may be useful

    Directory of Open Access Journals (Sweden)

    Luciana Oliveira Gonçalves

    2005-12-01

    pacientes. CONCLUSIONES: La MRA puede ser útil en la práctica anestésica, mejorando la oxigenación postoperatoria y deshaciendo atelectasias de pacientes sometidos a anestesia general.BACKGROUND AND OBJECTIVES: Alveolar recruitment maneuver (ARM is the reopening of lung tissue collapsed by increased airway inspiratory pressure, primarily performed in patients with acute respiratory distress syndrome. This study aimed at evaluating ARM in anesthesia, how to do it and in which clinical situations. METHODS: Literature review using MedLine database in the period 1993 to 2004. RESULTS: Most common approach for recruitment maneuver is sustained inflation by CPAP with pressures varying from 30 to 40 cmH2O for 30 to 90 seconds. ARM was beneficial during laparoscopic procedures, single-lung ventilation surgeries and cardiac surgeries, and for obese and pediatric patients. CONCLUSIONS: Recruitment maneuver may be useful for anesthetic practice, improving postoperative oxygenation and re-expanding atelectasis of anesthetized patients.

  3. Orofacial pain: a primer.

    Science.gov (United States)

    De Rossi, Scott S

    2013-07-01

    Orofacial pain refers to pain associated with the soft and hard tissues of the head, face, and neck. It is a common experience in the population that has profound sociologic effects and impact on quality of life. New scientific evidence is constantly providing insight into the cause and pathophysiology of orofacial pain including temporomandibular disorders, cranial neuralgias, persistent idiopathic facial pains, headache, and dental pain. An evidence-based approach to the management of orofacial pain is imperative for the general clinician. This article reviews the basics of pain epidemiology and neurophysiology and sets the stage for in-depth discussions of various painful conditions of the head and neck. PMID:23809298

  4. Anestesia em criança com síndrome de Pallister-Killian: relato de caso Anestesia en niño con síndrome de Pallister-Killian: relato de caso Anesthesia in child with Pallister-Killian syndrome: case report

    Directory of Open Access Journals (Sweden)

    José Roquennedy Souza Cruz

    2004-10-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A síndrome de Pallister-Killian (SPK é uma doença genética rara causada por uma anomalia, em mosaico, no cromossomo 12. Há pouca informação sobre esta síndrome na literatura anestésica. O objetivo deste relato foi divulgar e discutir as características que podem ser de interesse para a anestesia. RELATO DO CASO: Paciente do sexo masculino, 5 anos de idade, foi submetido a anestesia geral para a realização de ressonância magnética do crânio. Apresentava as características típicas da SPK: dismorfismo facial, alopecia temporal, micrognatismo, macroglossia, retardo mental, convulsões e alterações pigmentares cutâneas. A anestesia foi induzida e mantida com sevoflurano sob máscara facial e cânula orofaríngea, com ventilação assistida manual durante a indução. Não houve intercorrências e o exame foi feito em regime ambulatorial. CONCLUSÕES: A importância da avaliação pré-anestésica é enfatizada, devido às malformações, inclusive cardíacas, associadas a esta síndrome. É recomendada a preparação para possível dificuldade de intubação traqueal ou de manutenção das vias aéreas.JUSTIFICATIVA Y OBJETIVOS: La síndrome de Pallister-Killian (SPK es una rara enfermedad genética causada por una anomalía, en mosaico, en el cromosoma 12. Hay poca información sobre esta síndrome en la literatura anestésica. El objetivo de este relato fue divulgar y discutir las características que pueden ser de interés para la anestesia. RELATO DEL CASO: Paciente del sexo masculino, 5 años de edad, fue sometido a anestesia general para la realización de resonancia magnética del cráneo. Presentaba las características típicas de la SPK: dismorfismo facial, alopecia temporal, micrognatismo, macroglosia, retardo mental, convulsiones y alteraciones pigmentares cutáneas. La anestesia fue inducida y mantenida con sevoflurano sobre máscara facial y cánula orofaríngea, con ventilación manual

  5. O alvorecer da anestesia inalatória: uma perspectiva histórica El alborear de la anestesia inhaladora: una perspectiva histórica Dawning of inhalational anesthesia: a historical perspective

    Directory of Open Access Journals (Sweden)

    R icardo Jakson de Freitas Maia

    2002-11-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A história, ao contrário do que muitos imaginam, não é algo limitado ao passado e de caráter imutável. Ela sofre adaptações de acordo com as conveniências de uma ou outra classe social dominante. Informações que foram ocultadas, deliberadamente ou não, uma vez descobertas, poderão mudar conceitos atuais, até então estabelecidos como verdadeiros. Sendo assim, a história, como qualquer outra ciência, não é totalmente imparcial; sofre influências e interferências de forças de natureza política, religiosa, econômica e cultural. Com a História da anestesia não é diferente. Algumas questões permanecem intrigantes: Por que se levou tanto tempo para a civilização controlar a dor? Quem realmente descobriu a Anestesia? Como era o mundo quando se deu a descoberta oficial da Anestesia? Para refletir sobre tais perguntas faz-se necessário recorrer à História da Anestesia. CONTEÚDO: O texto aborda o ato cirúrgico, a dor e a anestesia desde a cultura helênica até a primeira anestesia oficialmente reconhecida, destacando nomes freqüentemente esquecidos e as peculiaridades históricas que beneficiaram ou prejudicaram um ou outro descobridor. Também enfoca os valores, a cultura e o desenvolvimento científico no século XIX, correlacionando-os com os eventos que marcaram o advento da anestesia. CONCLUSÕES: Não seria justo atribuir o mérito da descoberta da anestesia a uma única pessoa. As peculiaridades históricas que beneficiaram ou prejudicaram um ou outro pesquisador não podem ser esquecidas. Morton foi sem dúvidas o mais agraciado pelas circunstâncias. Viveu no tempo e local privilegiados, e conviveu com as pessoas mais apropriadas ao seu intento. Todavia uma questão persiste. Afinal, quem é o mais importante: o pai da idéia ou aquele que a divulgou? A resposta certamente cairá no campo da subjetividade.JUSTIFICATIVA Y OBJETIVOS: La historia, al contrario de lo que muchos se

  6. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads;

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  7. A Primer on Multilevel Modeling

    Science.gov (United States)

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  8. A classical primer for QCD

    International Nuclear Information System (INIS)

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  9. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  10. Primer on bioproducts

    International Nuclear Information System (INIS)

    This document provides a general introduction to biotechnology, bioproducts and alternatives to fossil fuels and petrochemicals. It includes an introduction to the concept of bioproducts, a description of common products that can be manufactured using biomass and an overview of the ways bioproducts are made. It also addresses issues such as risks and benefits of bioproduct technologies and the environmental, social and economic considerations of bioproducts. The possibilities of using biofuels and bioenergy for heat and power, to fuel vehicles and as a fuel for fuel cells were also discussed. Biogas from municipal and farm wastes is currently used to drive some gas turbines for power generation. The role of biochemicals and biomaterials in industrial processes and products was also reviewed along with some domestic and international bioproducts already developed and innovative products under development. The document also explains how plants, animals and other organisms can be used to replace or complement fossil fuels to help generate energy and make chemicals, plastics and other materials. While some reports suggest that bioproducts consume less energy and produce less greenhouse gases than conventional products, other reports suggest that they are rarely superior to conventional products and some may even contribute to the eutrophication of lakes, rivers and other surface waters. figs., 80 refs

  11. Enhanced quantization: a primer

    International Nuclear Information System (INIS)

    Although classical mechanics and quantum mechanics are separate disciplines, we live in a world where Planck’s constant ℏ > 0, meaning that the classical and quantum world views must actually coexist. Traditionally, canonical quantization procedures postulate a direct linking of various c-number and q-number quantities that lie in disjoint realms, along with the quite distinct interpretations given to each realm. In this paper we propose a different association of classical and quantum quantities that renders classical theory a natural subset of quantum theory letting them coexist as required. This proposal also shines light on alternative linking assignments of classical and quantum quantities that offer different perspectives on the very meaning of quantization. In this paper we focus on elaborating the general principles, while elsewhere we have published several examples of what this alternative viewpoint can achieve; these examples include removal of singularities in classical solutions to certain models, and an alternative quantization of several field theory models that are trivial when quantized by traditional methods but become well defined and nontrivial when viewed from the new viewpoint. (paper)

  12. Anestesia no paciente com síndrome do pulmão encolhido: relato de caso

    Directory of Open Access Journals (Sweden)

    Silvia Piccolo-Daher

    2012-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A incidência de acometimento pulmonar no Lúpus Eritematoso Sistêmico (LES pode apresentar-se como uma síndrome denominada Síndrome do Pulmão Encolhido (SPE. De fisiopatologia bastante controversa, a SPE pode induzir dependência da ventilação mecânica. Devido à raridade, o número de publicações é restrito. O objetivo deste relato é apresentar o caso de paciente com SPE, submetida à correção de hérnia incisional sob anestesia peridural torácica. RELATO DO CASO: Paciente hipertensa, obesa e portadora de LES, diagnosticada com SPE há 18 anos. Dependente de oxigênio domiciliar noturno, apresentava dispneia aos pequenos esforços e espirometria com distúrbio ventilatório restritivo grave. Em pós-operatório anterior sob anestesia geral, permaneceu em ventilação mecânica por nove dias com desmame difícil. Submetida à correção de hérnia incisional por três horas sob anestesia peridural torácica, sem qualquer complicação respiratória per ou pós-operatória. CONCLUSÕES: A Síndrome do Pulmão Encolhido é uma doença rara, que exige do anestesiologista conhecimentos prévios, clínico e laboratorial, do paciente. A técnica de anestesia peridural torácica mostrou-se uma opção anestésica satisfatória para esta paciente, com evolução respiratória altamente satisfatória.

  13. Influência da anestesia venosa total, entropia e laparoscopia sobre o estresse oxidativo

    Directory of Open Access Journals (Sweden)

    Rogean Rodrigues Nunes

    2012-08-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Estudos recentes correlacionam mortalidade pós-operatória e anestésica, especialmente a profundidade anestésica e pressão arterial sistólica (PAS. O objetivo deste estudo foi avaliar os efeitos da profundidade da anestesia venosa total (AVT realizada com remifentanil e propofol com monitoração da entropia de resposta (RE sobre as concentrações sanguíneas dos marcadores do estresse oxidativo: TBARS e glutationa, durante operações pelo acesso vídeolaparoscópico. MÉTODO: Vinte pacientes adultas, ASA I, IMC 20-26 kg.m-2, idades entre 20 e 40 anos, foram aleatoriamente distribuidas em dois grupos iguais: Grupo I - submetidas a procedimento anestésico-cirúrgico com RE mantida entre 45 e 59 e Grupo II - submetidas a procedimento anestésico-cirúrgico com RE entre 30 e 44. Em ambos os grupos, a infusão de remifentanil e propofol foi controlada pelo sitio efetor (Se, ajustados para manter RE nos valores desejados (Grupos I e II e avaliando-se sempre a taxa de supressão (TS. As pacientes foram avaliadas em seis momentos: M1(imediatamente antes da indução anestésica, M2 (antes da intubação traqueal [IT], M3 (5 minutos após IT, M4 (imediatamente antes do pneumoperitônio-PPT, M5 (1 minuto após o PPT e M6 (uma hora após a operação. Em todos os momentos foram avaliados os seguintes parâmetros: PAS, PAD, FC, RE, TS, TBARS e glutationa. RESULTADOS: Observaram-se aumentos no TBARS e glutationa em M5, tanto no Grupo I como no Grupo II (p GI em M5 - p < 0,05% sugerem interferência de mais um fator (anestesia profunda, como responsável pelo aumento no MA, provavelmente como resultados de maior depressão do sistema nervoso autônomo e menor autorregulação esplâncnica.

  14. Avaliação da memória sob anestesia venosa total Evaluación de la memoria bajo anestesia venosa total The assessment of memory under total intravenous anesthesia

    Directory of Open Access Journals (Sweden)

    Gulistan Aktas

    2013-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Neste estudo, objetivamos avaliar a memória implícita e explícita em pacientes submetidos à cirurgia abdominal sob anestesia venosa total (AVT com propofol e remifentanil, na qual o nível de anestesia foi controlado pelo monitoramento do índice bispectral (BIS. MÉTODO: Anestesia venosa total foi administrada a 60 pacientes adultos para obter níveis de BIS de 40-60. Os pacientes foram randomicamente divididos em três grupos, de acordo com as gravações que ouviram. Os pacientes do grupo categoria (CT ouviram uma fita gravada contendo cinco nomes de animais. Os pacientes do grupo recordar palavras (RP ouviram uma fita gravada contendo cinco palavras de frequência média na língua turca, depois de adaptadas. Os pacientes do grupo controle (GC ouviram os sons do mar até o fim da cirurgia. Duas horas após a cirurgia, os testes foram administrados a cada paciente na sala de recuperação para avaliar a memória. RESULTADOS: Houve uma diferença entre os escores dos grupos CT e GC no Miniexame do Estado Mental (MMSE; todos os escores foram > 20. Os resultados dos testes de categoria e recordar palavras, aplicados para avaliar a memória implícita, não foram estatisticamente diferentes entre os grupos. Não houve evidência de memória implícita em nenhum dos pacientes. Um paciente lembrou-se de ouvir "o som de água" como uma prova de memória explícita. Onze pacientes declararam não ter sonhado. CONCLUSÕES: Apesar de não termos encontrado nenhuma evidência de memória implícita sob anestesia adequada com AVT, um paciente apresentou memória explícita. Embora a profundidade adequada da anestesia fornecida pelo monitoramento do BIS corrobore nossos resultados para a memória implícita, ela não explica os resultados para a memória explícita.JUSTIFICATIVA Y OBJETIVOS: En este estudio evaluamos la memoria implícita y explícita en pacientes sometidos a la cirugía abdominal bajo anestesia venosa total

  15. ¿Influye la anestesia en los resultados de la cirugía oncológica?

    Directory of Open Access Journals (Sweden)

    N. Esteve

    2014-06-01

    Full Text Available Los criterios de calidad en la cirugía oncológica radical se basan en la extirpación completa del tumor, con márgenes libres, sin enfermedad macroscópica residual, en una linfadenectomía adecuada y en la mínima manipulación tumoral posible. A pesar de conseguir estos objetivos, tras la extirpación puede quedar enfermedad residual no visible o micrometástasis, con potencial de crecimiento y diseminación, dependiendo de la capacidad tumoral y de las defensas del huésped. Tres factores perioperatorios pueden desplazar potencialmente el equilibrio hacia la progresión de la enfermedad residual mínima: a la cirugía, por la manipulación, libera células tumorales a la circulación, deprime la inmunidad celular (IC, incluyendo la actividad citotóxica de las células Th1 (T helper y las NK (natural killer, reduce los factores anti-angiogénicos e incrementa los pro-angiogénicos; b los anestésicos generales, excepto el propofol, disminuyen la IC; y c los opioides inhiben la IC y humoral y promueven el crecimiento tumoral. La anestesia y la analgesia regional bloquean las aferencias nociceptivas intraoperatorias y disminuyen o eliminan el dolor agudo postoperatorio. Combinada con la anestesia general, disminuiría el consumo de anestésicos volátiles, potencialmente inmunosupresores. Estas acciones preservan la inmunidad al disminuir la respuesta neuroendocrina e inflamatoria al estrés y el consumo de opioides. Los estudios experimentales apoyan esta hipótesis. Los estudios clínicos presentan resultados contradictorios. Desde el año 2000, se han realizado 21 estudios en cáncer de mama, próstata, colon y recto, pulmón, hígado y melanoma. Dieciséis son retrospectivos, 5 muestran resultados positivos en cuanto a la asociación de la analgesia epidural y la disminución de la recurrencia oncológica. Otros 5 muestran resultados parciales, y 6 estudios no mostraron ninguna asociación. Los 5 estudios prospectivos también muestran

  16. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  17. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  18. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.

    Science.gov (United States)

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  19. Loop Quantum Geometry: A primer

    CERN Document Server

    Corichi, A

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  20. Sample Return Primer and Handbook

    Science.gov (United States)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  1. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  2. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  3. Loop Quantum Geometry: A primer

    OpenAIRE

    Corichi, Alejandro

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-expert...

  4. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  5. Anestesia em paciente com síndrome de Rubinstein-Taybi: relato de caso Anestesia en paciente con síndrome de Rubinstein-Taybi: relato de caso Anesthesia in patient with Rubinstein-Taybi syndrome: case report

    OpenAIRE

    Carlos Rogério Degrandi Oliveira; Luciana Elias

    2005-01-01

    JUSTIFICATIVA E OBJETIVOS: A síndrome de Rubinstein-Taybi (SRT) é uma doença genética causada por uma mutação ou apagamento do cromossomo 16, caracterizada por retardo físico e mental, anormalidades craniofaciais e hálux e polegares largos. Há pouca informação sobre esta síndrome na literatura anestésica. O objetivo deste relato foi apresentar a conduta anestésica em paciente submetido à cirurgia odontológica e discutir as características de interesse para a anestesia nesses pacientes. RELATO...

  6. An evaluation of new circle system of anesthesia. Quantitative anesthesia with isoflurane in new zealand rabbits Avaliação de um novo sistema circular de anestesia: anestesia quantitativa com isuflorane em coelhos

    Directory of Open Access Journals (Sweden)

    Neuber M. Fonseca

    1997-12-01

    Full Text Available A small circuit system of anesthesia was developed by Fonseca and Goldenberg in 1993. The authors used in this study New Zealand White (NZW rabbits under closed system anesthetic regiment by insoflurane. Twenty male adult New Zealand rabbits were distributed in two groups of ten animals. No premedicant drugs were given. Endotraqueal intubation was made after intravenous administration of propofol (10mg/kg. Insoflurane was used to anesthesia management, administred by lowflow closed system technique with cooper kettle vaporizer, fixed by pre-calculated vaporizing flow in double times intervals. The group II underwent surgical periostal scratching in the medial tibial surface at the proximal shaft. Rabbits breathed spontaneously. Hypotensio, hypercapnia and respiratory acidosis were characteristic of the cardiopulmonary effects of the anesthesia. The corneal reflex and pinch reflex was useful as reliable indicators of anesthesic depth. Manual or mechanical ventilation should be considered as a way of improving alveolar ventilation and normalize blood-gas values. The system developed by Fonseca and Goldenberg was considered suitable for anesthesic management in rabbits.Um sistema circular de anestesia para animais de pequeno porte foi desenvolvido por FONSECA e GOLDENBERG, em 1993. No presente estudo foram utilizados 20 coelhos brancos linhagem Nova Zelândia, submetidos ao sistema com isoflurane, distribuidos em dois grupos de 10 animais. O grupo I, controle, que foi apenas anestesiado e o grupo II foi submetido a raspagem periostal da parte proximal e medial da tíbia. Não foi administrada droga pré-anestésica. Após administração do propofol intravenoso (10mg/kg procedeu-se a intubação endotraqueal. O isuflorane foi administrado lentamente no sistema circular de anestesia. Os animais respiravam espontaneamente. Houve efeitos cardiorespiratórios conseqüentes da anestesia, tais como, hipotensão, hipercapnia e acidose respiratória. O

  7. Hematoma após anestesia peridural: tratamento conservador. Relato de caso Hematoma posterior a la anestesia peridural: tratamiento conservador. Relato de caso Hematoma after epidural anesthesia: conservative treatment. Case report

    OpenAIRE

    Edno Magalhães; Cátia Sousa Govêia; Luís Cláudio de Araújo Ladeira; Laura Elisa Sócio de Queiroz

    2007-01-01

    JUSTIFICATIVA E OBJETIVOS: O hematoma associado à compressão espinhal após anestesia peridural é uma complicação neurológica grave, apesar da pequena incidência relatada (1:150.000). É um episódio agudo, e o tratamento tradicionalmente aplicado é a descompressão cirúrgica de urgência. Mais recentemente, em casos específicos, o tratamento com corticosteróide tem sido aplicado como alternativa, com boa recuperação neurológica. O objetivo deste relato foi expor um caso de hematoma peridural com ...

  8. Anestesia em paciente portador de distrofia muscular de Duchenne: relato de casos Anestesia en un paciente portador de distrofia muscular de Duchenne: relato de casos Anesthesia for Duchenne muscular dystrophy patients: case reports

    OpenAIRE

    Rodrigo Machado Saldanha; Juliano Rodrigues Gasparini; Letícia Sales Silva; Roberto Rigueti de Carli; Victor Ugo Dorigo de Castilhos; Mariana Moraes Pereira das Neves; Fernando Paiva Araújo; Paulo César de Abreu Sales; José Francisco Nunes Pereira das Neves

    2005-01-01

    JUSTIFICATIVA E OBJETIVOS: Este estudo objetiva relatar dois casos de anestesia em pacientes portadores de Distrofia Muscular de Duchenne (DMD), uma doença rara, progressiva e incapacitante, e discutir sobre a conduta anestésica. O comprometimento das funções pulmonar e cardíaca, a possibilidade de ocorrência de hipertermia maligna, a maior sensibilidade aos bloqueadores neuromusculares e o aumento da morbidade pós-operatória são alguns dos desafios enfrentados pelo anestesiologista. RELATO D...

  9. Anestesia em paciente com Xeroderma Pigmentoso: relato de caso Anestesia en paciente con Xeroderma Pigmentoso: relato de caso Anesthesia in patient with Xeroderma Pigmentosum: case report

    Directory of Open Access Journals (Sweden)

    Carlos Rogério Degrandi Oliveira

    2003-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O Xeroderma Pigmentoso é uma doença autossômica recessiva rara, caracterizada pelo desenvolvimento prematuro de neoplasias devido à extrema sensibilidade à radiação ultravioleta. Estas manifestações ocorrem por falha no mecanismo de excisão e reparo do DNA. Se comparados a indivíduos normais, estes pacientes apresentam risco 1000 vezes maior de desenvolver neoplasias em áreas expostas ao sol. O objetivo deste relato é apresentar a conduta anestésica em uma paciente portadora de Xeroderma Pigmentoso submetida à cirurgia oftalmológica. RELATO DO CASO: Paciente do sexo feminino, 7 anos, portadora de Xeroderma Pigmentoso com comprometimento facial extenso, admitida para exérese de lesão papilar no olho direito. Foi prescrito midazolam (10 mg por via oral, como medicação pré-anestésica. A monitorização inicial consistiu de cardioscópio, oxímetro de pulso, estetoscópio precordial e pressão arterial não invasiva. Foi realizada pré-oxigenação com oxigênio a 100% por 3 minutos e indução inalatória sob máscara com oxigênio a 100% e sevoflurano em concentrações crescentes até 7%. Após acesso venoso periférico com cateter 22G, foram injetados propofol (50 mg e succinilcolina (20 mg e realizada intubação traqueal com tubo 5,5 mm sem balonete. Um guia de metal foi utilizado para facilitar a introdução do tubo traqueal. A manutenção da anestesia foi feita com sevoflurano a 3,5% e oxigênio a 100%, com sistema de Bain. A criança foi extubada na sala cirúrgica e encaminhada à sala de recuperação pós-anestésica em boas condições. CONCLUSÕES: As alterações faciais e orofaríngeas decorrentes desta doença determinaram dificuldades na adaptação da máscara facial e intubação traqueal. A educação constante do paciente e de seus familiares constitui o objetivo mais importante no manuseio desta doença.JUSTIFICATIVA Y OBJETIVOS: El Xeroderma Pigmentoso es una enfermedad autos

  10. Algorithms and Software for PCR Primer Design

    OpenAIRE

    Huang, Yu-ting

    2015-01-01

    Polymerase Chain Reaction (PCR) is a widely used technology in molecular bi-ology for DNA amplification. To generate multiple copies of a DNA molecule, a pair ofprimers (two synthesized DNA sequences with a total length of 15-30 bases) are annealedto the boundaries of the targeted DNA molecule. Then, the new replicated DNA fragmentelongates from one primer to the other.Though primers always hybridize to their respective complements within DNAsequences, primer pairs for targeted DNA sequences ...

  11. Insuficiência respiratória aguda durante anestesia pediátrica: atelectasia e pneumotórax hipertensivo: relato de caso

    OpenAIRE

    Joel Massari Rezende; Bruno Ricciardi Silveira

    2012-01-01

    JUSTIFICATIVA E OBJETIVOS: A tarefa primordial do anestesiologista é garantir a adequada oxigenação do paciente. O objetivo deste relato é des crever o diagnóstico e conduta em um caso de insuficiência respiratória aguda durante anestesia, com finalidade didática. RELATO DO CASO: Criança de três anos submetida à anestesia para cirurgia urológica apresentou insuficiência respiratória por obstruções de brônquios por secreção, evoluindo com atelectasia e pneumotórax hipertensivo. Apresentamos o ...

  12. Efeitos do óxido nitroso em hipotensão controlada durante anestesia com baixo fluxo

    OpenAIRE

    2013-01-01

    JUSTIFICATIVA E OBJETIVOS: Investigamos o efeito do óxido nitroso (N2O) em hipotensão controlada durante anestesia com baixo fluxo (isoflurano-dexmedetomidina) em termos de hemodinâmica, consumo de anestésico e custos. MÉTODOS: Quarenta pacientes foram randomicamente alocados em dois grupos. Infusão de dexmedetomidina (0,1 µg.kg-1.min-1) foi mantida por 10 minutos. Subsequentemente, essa infusão foi mantida até os últimos 30 minutos de operação a uma dose de 0,7 µg.kg-1.hora-1. Tiopental (4-6...

  13. Anestesia no paciente com síndrome do pulmão encolhido: relato de caso

    OpenAIRE

    Silvia Piccolo-Daher; Edno Magalhães

    2012-01-01

    JUSTIFICATIVA E OBJETIVOS: A incidência de acometimento pulmonar no Lúpus Eritematoso Sistêmico (LES) pode apresentar-se como uma síndrome denominada Síndrome do Pulmão Encolhido (SPE). De fisiopatologia bastante controversa, a SPE pode induzir dependência da ventilação mecânica. Devido à raridade, o número de publicações é restrito. O objetivo deste relato é apresentar o caso de paciente com SPE, submetida à correção de hérnia incisional sob anestesia peridural torácica. RELATO DO CASO: Paci...

  14. Analgesia de parto: estudo comparativo entre anestesia combinada raquiperidural versus anestesia peridural contínua Analgesia de parto: estudio comparativo entre anestesia combinada raqui-peridural versus anestesia peridural continua Labor analgesia: a comparative study between combined spinal-epidural anesthesia versus continuous epidural anesthesia

    Directory of Open Access Journals (Sweden)

    Carlos Alberto de Figueiredo Côrtes

    2007-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O alívio da dor no trabalho de parto tem recebido atenção constante visando ao bem-estar materno, diminuindo o estresse causado pela dor e reduzindo as conseqüências deste sobre o concepto. Inúmeras técnicas podem ser utilizadas para analgesia de parto. Este trabalho teve como objetivo comparar a técnica peridural contínua com a combinada, ambas com o uso de bupivacaína a 0,25% em excesso enantiomérico 50% e fentanil como agentes. MÉTODO: Participaram do estudo 40 parturientes em trabalho de parto com dilatação cervical entre 4 e 5 cm que foram distribuídas em dois grupos iguais de forma aleatória. O Grupo I recebeu anestesia peridural contínua. O Grupo II recebeu anestesia combinada. Foram avaliados: medidas antropométricas, idade gestacional, dilatação cervical, tempo entre o bloqueio e a ausência de dor por meio da escala analógica visual, possibilidade de deambulação, tempo entre o início da analgesia e a dilatação cervical completa, duração do período expulsivo, parâmetros hemodinâmicos maternos e vitalidade do recém-nascido. Possíveis complicações, como depressão respiratória, hipotensão arterial materna, prurido, náuseas e vômitos, também foram observadas. Para a comparação das médias utilizou-se o teste t de Student e para a paridade e tipo de parto utilizou-se o teste do Qui-quadrado. RESULTADOS: Não houve diferença estatística significativa entre os dois grupos em relação ao tempo entre o início da analgesia e a dilatação cervical completa, bem como em relação ao tempo da duração do período expulsivo, incidência de cesariana relacionada com a analgesia, parâmetros hemodinâmicos maternos e vitalidade do recém-nascido. CONCLUSÕES: Ambas as técnicas se mostraram eficazes e seguras para a analgesia do trabalho de parto, embora a técnica combinada tenha proporcionado um rápido e imediato alívio da dor. Estudos clínicos com maior número de casos s

  15. Midazolan-Tiopental: compatibilidad y sinergismo farmacológico en anestesia pediátrica

    Directory of Open Access Journals (Sweden)

    Joaquín L de la Lastra Rodríguez

    1996-06-01

    Full Text Available La administración de tiopental ha sido recomendada para completar la inducción anestésica, cuando la dosis de midazolán ha sido insuficiente; además es reconocido el efecto de sinergismo entre ambos fármacos. El objetivo del trabajo fue analizar el beneficio que representa esta técnica de inducción en un grupo de 25 pacientes pediátricos, con la utilización de dosis de midazolán de 0,3 mg/kg de peso y de tiopental de 2,5 mg/kg de peso. Los resultados fueron satisfactorios y se observó la ausencia o la disminución de la respuesta hipertensora arterial después de la laringoscopia directa y de la intubación endotraqueal. El mantenimiento de la anestesia fue garantizado con una mezcla de oxígeno y de óxido nitroso y dosis intermitentes de fentaniloThe administration of thiopental has been recommended to complete anesthetic induction, when the dose of midazolam has not been sufficient; moreover, the sinergistic effect between both drugs is well know. The aim of this work was to analize the advantage of this induction technique in a group of 25 pediatric patients, with the use of a dose of 0.3 mg/kg midazolam and 2.5 mg/kg thiopental. Results were satisfactory and the absence or decrease of arterial hypertensive response after direct laryngoscopy and endotracheal intubation was observed. The maintenance of anesthesia was guaranteed by mixing nitrous oxide and intermittent doses of fentanyl

  16. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  17. Anestesia venosa total para laringectomia parcial em paciente na 28ª semana de gestação: relato de caso Anestesia venosa total para laringectomía parcial en paciente en la 28ª semana de embarazo: relato de caso Total intravenous anesthesia for partial laryngectomy in 28 weeks pregnant patient: case report

    Directory of Open Access Journals (Sweden)

    José Costa

    2005-04-01

    remifentanil proporcionou estabilidade hemodinâmica para a mãe e o feto, com um despertar precoce e suave.JUSTIFICATIVA Y OBJETIVOS: Anestesia para paciente embarazada constituye un desafío al anestesiologista en virtud de los riesgos para la madre y el feto. Son muchas las complicaciones descritas por la literatura como malformaciones fetales, alumbramiento prematuro, instabilidad hemodinámica materna y hasta muerte fetal. El objetivo de este caso es mostrar una paciente embarazada de 28 semanas, sometida a laringectomía parcial bajo anestesia general venosa total con propofol, remifentanil y cisatracúrio. RELATO DEL CASO: Paciente con 29 años, 59 kg, primigesta de 28 semanas con diagnóstico previo de carcinoma epidermóide próximo a la cuerda vocal derecha, siendo indicada laringectomía. La monitorización inicial se constituyó de presión arterial no invasiva y invasiva, cardioscopía, oxicapnografía y cardiotocografía continuada realizada por el tocólogo. Punción venosa en el miembro superior derecho y miembro superior izquierdo con catéter 16G y 18G respectivamente. Fueron administrados por vía venosa midazolan (1 mg, cefazolina (1 g, metoclopramida (10 mg y dipirona (1 g. La paciente recibió oxígeno a 100% bajo máscara por 3 minutos e inducción venosa fue hecha con el uso de propofol en infusión en la dosis escogida de 3 µg.mL-1 y remifentanil continuado (1 µg.kg-1 en bolus y 0,2 µg.kg-1.min-1 de mantenimiento. Como bloqueador neuromuscular fue administrado cisatracúrio (13mg y procedida la intubación traqueal con un tubo de 6,5mm alambrado con balonete. Fue mantenida en un plano anestésico con propofol y remifentanil en bomba además de complementaciones de cisatracúrio. El feto permaneció monitorizado continuamente con cardiotocografía realizada y analizada por el tocólogo. Después del término de la cirugía fueron apagadas las bombas infusoras de propofol y remifentanil con la paciente despertando 10 minutos después. Despertó sin

  18. Anestesia para cesariana em paciente portadora de cardiomiopatia hipertrófica familiar: relato de caso Anestesia para cesária en paciente portadora de cardiomiopatía hipertrófica familiar: relato de caso Anesthesia for cesarean section in a patient with familiar hypertrophic cardiomyopathy: case report

    Directory of Open Access Journals (Sweden)

    Renato Mestriner Stocche

    2007-12-01

    caracterizada por hipertrofia del septo ventricular y grado variable de estenosis aórtica subvalvar. En esa enfermedad, el aumento de la contratilidad del miocardio y la disminución de la resistencia vascular periférica pueden agravar la obstrucción de la vía de salida del VE, produciendo arritmia e isquemia cardiaca. Este relato quiso discutir el manoseo anestésico para cesárea en paciente con CHF. RELATO DEL CASO: Paciente con 33 semanas de embarazo y diagnóstico previo de CHF presentó en el holter de 24 horas 22 episodios de taquicardia ventricular no sustentada (TVNS y 2 episodios de taquicardia ventricular sustentada (TVS. Refería episodios de palpitación, disnea y dolor precordial de corta duración. La paciente fue medicada con atenolol y presentó control de los síntomas y de las arritmias cardiacas. Con 38 semanas y 5 días de embarazo la paciente fue sometida a la cesárea electiva. Además de la habitual monitorización contó con el análisis de segmento ST y presión arterial invasiva. Se utilizó anestesia intradural-epidural con inyección de 5 µg de sunfentanil en la raqui seguida de administración de bupivacaína a 0,375% en dosis de incremento hasta alcanzar una altura de T6 (total de 16 mL. Se usó metaraminol como vasopresor. No hubo hipotensión arterial materna u otras complicaciones en el perioperatorio. CONCLUSIONES: La anestesia general se usa con frecuencia para cesáreas de pacientes con CHF. La anestesia intradural-epidural con instalación lenta del bloqueo fue una alternativa segura. En esas pacientes, el aumento de la contratilidad miocárdica debe ser evitado, y si fuere necesario se debe utilizar un a-agonista para la corrección de hipotensión arterial materna.BACKGROUND AND OBJECTIVES: Familiar Hypertrophic cardiomyopathy (FHC is a rare hereditary cardiac disorder characterized by hypertrophy of the ventricular septum and variable degrees of subvalvular aortic stenosis. In this disease, the increase in myocardial contractility

  19. Anestesia em criança com síndrome de Guillain-Barré após vacina de sarampo: relato de caso Anestesia en un niño con síndrome de Guillain-Barré después de la vacuna de sarampión: relato de caso Anesthesia in Guillain-Barré pediatric patient after measles vaccination: case report

    Directory of Open Access Journals (Sweden)

    Deoclécio Tonelli

    2005-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A síndrome de Guillain-Barré após vacina de sarampo é rara. O diagnóstico muitas vezes é tardio, o que leva a um aumento da morbidade. O presente relato apresenta um caso avançado e os cuidados especiais exigidos durante a anestesia. RELATO DO CASO: Paciente do sexo masculino, com quatro anos de idade com síndrome de Guillain-Barré desde um ano de idade, foi submetido a gastrostomia sob anestesia geral sem intercorrências, com sevoflurano e sem bloqueadores neuromusculares. CONCLUSÕES: O caso ilustra a raridade etiológica de uma síndrome importante na prática anestésica assim como os eventos adversos pós-vacinação, a melhor escolha para a equipe anestésica e as complicações da síndrome de Guillain-Barré na infância.JUSTIFICATIVA Y OBJETIVOS: El síndrome de Guillain-Barré después de la vacuna de sarampión es rara. El diagnóstico en la mayoría de las veces es tardío, lo que lleva a un aumento de la morbidez. Este actual relato presenta un caso avanzado y todas las atenciones especiales exigidas durante la anestesia. RELATO DEL CASO: Paciente del sexo masculino, con cuatro años de edad con síndrome de Guillain-Barré desde hace un año de edad, fue sometido a gastrostomía bajo anestesia general sin intercurrencias, con sevoflurano y sin bloqueadores neuromusculares. CONCLUSIONES: El caso ilustra la rareza etiológica de una síndrome importante en la práctica anestésica, así como los eventos adversos pos-vacunación, la mejor elección para el equipo anestésico y las complicaciones de la síndrome de Guillain-Barré en la infancia.BACKGROUND AND OBJECTIVES: Guillain-Barré syndrome following measles vaccination is uncommon. Diagnosis is often delayed, leading to increased morbidity. This report describes an advanced Guillain-Barré case and the special approaches required during anesthesia. CASE REPORT: Male patient, four years old, with Guillain-Barré syndrome diagnosed at 1 year of

  20. Anestesia endovenosa en perros mediante el uso de propofol en dosis única, premedicado con acepromazina-atropina y xilazina-atropina Intravenous anaesthesia in dogs using a single dose of propofol premedicated with atropine _ acepromazine or atropine _ xylazine

    Directory of Open Access Journals (Sweden)

    J. THIBAUT

    2002-01-01

    Full Text Available Se efectuó la valoración de la acción anestésica del propofol en perros, mediante administración endovenosa en dosis única, con dos protocolos de premedicación: atropina - acepromacina, y atropina - xilacina. Se trabajó con 20 perros mestizos de uno a seis años de edad, clínicamente sanos, divididos al azar en dos grupos de 10 cada uno. Al primer grupo, de 16.2±1.63 kg, se administró acepromacina en dosis de 1.5 mg/kg i.m. , al grupo 2, de 11.9±1.71 kg, se le aplicó xilacina en dosis de 3 mg/kg i.m. A ambos grupos se inyectó atropina en dosis de 0.1 mg/kg s.c. Se administraron 10 min. más tarde 5 mg/kg de propofol en la vena femoral, luego se evaluó el efecto del propofol sobre las variables: período de latencia, duración de la anestesia quirúrgica , período de recuperación anestésica, frecuencia respiratoria, frecuencia cardíaca, presión arterial y temperatura corporal. Además se determinaron las reacciones adversas. Los resultados difirieron significativamente entre los dos grupos. La inducción anestésica fue de 0.45 + 0.03 min. en el primero (A.A.P y 0.26 + 0.03 min. en el segundo (X.A.P. La duración de la anestesia quirúrgica fue de 12.3 + 1.89 min y 25.2 + 1.78 min y el período de recuperación de 4.5 + 0.63 min y 10,1 + 0,98 min en el grupo 1 y 2, respectivamente. Las variables fisiológicas en ambos grupos se mantuvieron sin modificaciones estadísticamente significativas durante el transcurso de la anestesia quirúrgica; la frecuencia respiratoria tuvo un valor inicial promedio de 14.3 + 2.45 y 13.0 + 1.54 ciclos/min. en el grupo 1 y 2, respectivamente. La frecuencia cardíaca fue de 175 + 11.81 lat/min en el grupo 1 y 148.4 + 9.04 lat/min en el grupo 2. La presión arterial promedio fue de 102.6 + 5.69 y 111.8 + 10.43 mm Hg para el grupo 1 y 2 respectivamente y la temperatura corporal en el grupo 1 fue de 38.5 + 0.17 y en el grupo 2 de 38.7 + 0.20 ºC. Las reacciones adversas se presentaron al inicio de la

  1. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  2. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  3. URPD: a specific product primer design tool

    Science.gov (United States)

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  4. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  5. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  6. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  7. Anestesia em anã acondroplásica obesa mórbida para gastroplastia redutora Anestesia en enana acondroplásica obesa mórbida para gastroplastia reductora Anesthesia for bariatric surgery in an achondroplastic dwarf with morbid obesity

    Directory of Open Access Journals (Sweden)

    Maria Angélica Abrão

    2009-02-01

    forma más común entre los diversos tipos de osteocondrodisplasias causadoras del enanismo. El enano puede ser acometido de obesidad con una relativa frecuencia, y el tratamiento quirúrgico ha demostrado una mayor eficacia, tanto para la pérdida efectiva de peso como para a su mantenimiento a largo plazo. El objetivo de este trabajo fue presentar un caso de gastroplastia reductora con derivación intestinal en Y-de-Roux en enano acondroplásico obeso mórbido. Se analizaron las diversas dificultades encontradas en el manejo anestésico de este paciente y la manera a través de la cual se abordaron, objetivando la disminución de la morbi mortalidad en el intraoperatorio. RELATO DEL CASO: Paciente de 29 años, femenina, enana, con acondroplasia y obesidad mórbida desde la infancia. Sus medidas eran de 123 cm de altura y peso corporal de 144 kg, al momento de la entrada en el servicio de Cirugía Bariátrica. Con un índice de masa corporal (IMC de 95,18 kg.m-2, presentaba varias enfermedades asociadas, principalmente del sistema respiratorio y osteoarticular. Después de un largo período de acompañamiento con dieta, ejercicios físicos y apoyo psicológico, la paciente mejoró su condición clínica, siéndole intervenida con la operación propuesta: gastroplastia reductora a la Capella-Fobi. En la anestesia, hubo dificultad en la intubación traqueal con la paciente despierta y bajo laringoscopía directa, siendo necesaria utilización del broncofibroscopio. Transcurso intraoperatorio sin complicaciones, siendo mantenida bajo anestesia general venosa total con infusión continua de remifentanil y propofol. Extubada al final del procedimiento en la sala de operaciones. CONCLUSIONES: Las comorbidades simultáneas de la acondroplasia y de la obesidad mórbida pueden dificultar el manejo anestésico, principalmente con relación a las aéreas. Es necesario una evaluación preanestésica bien conducida para anticipar conductas y minimizar esos riesgos, optimizando as

  8. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  9. Anestesia para colecistectomia videolaparoscópica em paciente portador de Doença de Steinert: relato de caso e revisão de literatura Anestesia para colecistectomía videolaparoscópica en oaciente oortador de Enfermedad de Steinert: relato de caso y revisión de la literatura Anesthesia for videolaparoscopic cholecystectomy in a patient with Steinert Disease: case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Flora Margarida Barra Bisinotto

    2010-04-01

    anestesiólogo. Los pacientes presentan una mayor sensibilidad a los fármacos anestésicos y complicaciones, principalmente cardíacas y pulmonares. Además de eso, existe la posibilidad de presentar hipertermia maligna y crisis miotónica. Se ha descrito el caso de un paciente que tuvo una complicación pulmonar importante después de haber sido sometido a la anestesia general. RELATO DEL CASO: Paciente de 39 años, portador de DM1, sometido a la anestesia general para colecistectomía videolaparoscópica. La anestesia fue venosa total con propofol y remifentanil y rocuronio. El procedimiento quirúrgico de 90 minutos no presentó intercurrencias, pero después de la extubación, el paciente presentó insuficiencia respiratoria y crisis miotónica, que hizo la intubación traqueal imposible. Se utilizó la máscara laríngea, que posibilitó la oxigenación adecuada, y la ventilación mecánica se mantuvo hasta la recuperación total de la actividad respiratoria. Evolucionó sin otras complicaciones. CONCLUSIONES: La DM1 es una enfermedad que presenta varias peculiaridades para el anestesiólogo. El conocimiento minucioso de su involucración sistémica, asociado a la acción diferenciada de los fármacos anestésicos en esos pacientes, proporcionará un acto anestésico-quirúrgico más seguro.BACKGROUND AND OBJECTIVES: Myotonic dystrophies are autosomal dominant neuromuscular diseases. Among them, myotonic dystrophy type 1 (MD1, or Steinert disease, is the most common in adults, and besides muscular involvement it also has important systemic manifestations. Myotonic dystrophy type 1 poses a challenge to the anesthesiologist. Those patients are more sensitive to anesthetics and prone to cardiac and pulmonary complications. Besides, the possibility of developing malignant hyperthermia and myotonic episodes is also present. CASE REPORT: This is a 39-year old patient with DM1 who underwent general anesthesia for videolaparoscopic cholecystectomy. Total intravenous

  10. Efeitos do óxido nitroso em hipotensão controlada durante anestesia com baixo fluxo

    Directory of Open Access Journals (Sweden)

    Semiha Barçın

    2013-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Investigamos o efeito do óxido nitroso (N2O em hipotensão controlada durante anestesia com baixo fluxo (isoflurano-dexmedetomidina em termos de hemodinâmica, consumo de anestésico e custos. MÉTODOS: Quarenta pacientes foram randomicamente alocados em dois grupos. Infusão de dexmedetomidina (0,1 µg.kg-1.min-1 foi mantida por 10 minutos. Subsequentemente, essa infusão foi mantida até os últimos 30 minutos de operação a uma dose de 0,7 µg.kg-1.hora-1. Tiopental (4-6 mg.kg-1 e brometo de vecurônio (0,08 0,12 mg.kg-1 foram administrados na indução de ambos os grupos. Isoflurano (2% foi administrado para manutenção da anestesia. O Grupo N recebeu uma mistura de 50% de O2-N2O e o Grupo A recebeu uma mistura de 50% de O2-ar como gás de transporte. Anestesia com baixo fluxo (1 L.min-1 foi iniciada após um período de 10 minutos de alto fluxo inicial (4,4 L.min-1. Os valores de pressão arterial, frequência cardíaca, saturação periférica de O2, isoflurano inspiratório e expiratório, O2 inspiratório e expiratório, N2O inspiratório e expiratório, CO2 inspiratório, concentração de CO2 após expiração e concentração alveolar mínima foram registrados. Além disso, as taxas de consumo total de fentanil, dexmedetomidina e isoflurano, bem como de hemorragia, foram determinadas. RESULTADOS: A frequência cardíaca diminuiu em ambos os grupos após a carga de dexmedetomidina. Após a intubação, os valores do Grupo A foram maiores nos minutos um, três, cinco, 10 e 15. Após a intubação, os valores de hipotensão desejados foram alcançados em 5 minutos no Grupo N e em 20 minutos no grupo A. Os valores da CAM foram mais altos no Grupo N nos minutos um, três, cinco, 10 e 15 (p < 0,05. Os valores da FiO2 foram mais altos entre 5 e 60 minutos no Grupo A, enquanto foram mais altos no Grupo N aos 90 minutos (p < 0,05. Os valores de Fi Iso (isoflurano inspiratório foram menores no Grupo N nos minutos

  11. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  12. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  13. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  14. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  15. Anestesia peridural torácica para cirurgia plástica de mama em paciente portadora de miastenia gravis: relato de caso Anestesia peridural torácica para cirugía plástica de mama en paciente portadora de miastenia gravis: relato de caso Thoracic epidural anesthesia for mammaplasty in myasthenia gravis patient: case report

    OpenAIRE

    Fabiano Timbó Barbosa; Marta Cristiane Bezerra Correia; Rafael Martins da Cunha; Ismar Lima Cavalcanti

    2005-01-01

    JUSTIFICATIVA E OBJETIVOS: A miastenia gravis é uma doença crônica, auto-imune, caracterizada pela fraqueza da musculatura esquelética em decorrência da diminuição dos receptores de acetilcolina na junção neuromuscular. O objetivo deste relato é mostrar um caso de paciente com miastenia gravis submetida a anestesia peridural torácica para cirurgia plástica de mama. RELATO DO CASO: Paciente com 51 anos, portadora de miastenia gravis foi submetida a anestesia peridural torácica com bupivacaína ...

  16. Dexmedetomidina associada a propofol em sedação durante anestesia local para cirurgia plástica Dexmedetomidina asociada a propofol en sedación durante anestesia local para cirugía plástica Dexmedetomidine/propofol association for plastic surgery sedation during local anesthesia

    OpenAIRE

    José Roberto Nociti; Paulo Sérgio Mateus Serzedo; Eduardo Barbin Zuccolotto; Fabiana Sebben; Raul F. Gonzales

    2003-01-01

    JUSTIFICATIVA E OBJETIVOS: A dexmedetomidina é um novo agonista alfa2-adrenérgico com propriedades potencialmente úteis em anestesia. Este estudo comparativo tem por finalidade observar os efeitos da dexmedetomidina sobre o consumo de propofol e a evolução dos parâmetros cardiovasculares e respiratórios, quando incluída em técnica de sedação durante anestesia local em cirurgia plástica. MÉTODO: Participaram do estudo 40 pacientes do sexo feminino com idades entre 16 e 60 anos, estado físico A...

  17. Anestesia em paciente portador de deficiência de glicose-6-fosfato-desidrogenase: relato de caso Anestesia en paciente portador de deficiencia de glicosa-6-fosfato-desidrogenasa: relato de caso Anesthesia in glucose 6-phosphate dehydrogenase-deficient patient: case report

    OpenAIRE

    Múcio Paranhos Abreu; Carla Cristina Silva Freire; Rogério Shiuguetoshi Miura

    2002-01-01

    JUSTIFICATIVA E OBJETIVOS: A Deficiência de Glicose-6-Fosfato-Desidrogenase (G6PD) é uma enzimopatia relativamente comum, mas as publicações relacionando essa condição com a anestesia são escassas. O objetivo deste relato é apresentar um caso de paciente portador de Deficiência de G6PD, submetido à tenotomia para alongamento de tendão de Aquiles, sob anestesia venosa associada à bloqueio subaracnóideo. Relato do caso: Paciente masculino, 9 anos, 48 kg, portador de deficiência de G6PD e poline...

  18. Anestesia em paciente com insensibilidade congênita a dor e anidrose Anestesia en paciente con insensibilidad congénita al dolor y anhidrosis Anesthesia in a patient with congenital insensitivity to pain and anhidrosis

    Directory of Open Access Journals (Sweden)

    Carlos Rogério Degrandi Oliveira

    2009-10-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A insensibilidade congênita a dor e anidrose (ICDA ou neuropatia hereditária sensorial e autonômica tipo IV (NHSA tipo IV é neuropatia autossômica recessiva rara do grupo das neuropatias hereditárias sensoriais e autonômicas (NHSA, caracterizada por insensibilidade ao estímulo doloroso, anidrose e retardo mental. Existem poucos relatos sobre a conduta anestésica em pacientes com ICDA devido sua extrema raridade. O objetivo deste relato foi apresentar a conduta anestésica em paciente com ICDA submetida à artrodese de tornozelo esquerdo com colocação de haste e discutir as características de interesse para a anestesia nestes pacientes. RELATO DO CASO: Paciente com história de ICDA foi admitida para artrodese de tornozelo esquerdo devido à artropatia de Charcot. Na sala de operação foi monitorizada com eletrocardiógrafo, índice bispectral, SEF 95%, pressão arterial não invasiva e saturação periférica da hemoglobina, medicada com midazolam como pré-anestésico e submetida à anestesia venosa com propofol e cisatracúrio. Não houve a necessidade de administração de analgésicos. Após intubação traqueal, foi acrescentada monitorização da pressão expiratória final do gás carbônico e da temperatura esofágica. Não apresentou complicações no período perioperatório. Teve alta hospitalar no segundo dia de pós-operatório. CONCLUSÕES: Embora apresentem insensibilidade à dor, alguns pacientes apresentam hiperestesia tátil, o que poderia causar sensações desagradáveis durante a manipulação cirúrgica. Apesar de relatos na literatura de pacientes submetidos a bloqueios no neuroeixo e até mesmo a procedimentos sem anestesia, neste caso utilizou-se a anestesia venosa que proporcionou condições adequadas para o procedimento anestésico-cirúrgico.JUSTIFICATIVA Y OBJETIVOS: La falta de sensibilidad congénita al dolor y la anhidrosis (ICDA o neuropatía hereditaria sensorial y auton

  19. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  20. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly......Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...

  1. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    OpenAIRE

    Nomin Batnyam; Jimin Lee; Jungnam Lee; Seung Bok Hong; Sejong Oh; Kyudong Han

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR-...

  2. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  3. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  4. Atelectasia pulmonar em cães durante anestesia geral Pulmonary atelectasis in dogs during general anesthesia

    OpenAIRE

    Patrícia Cristina Ferro Lopes; Newton Nunes

    2010-01-01

    A pressão intrapleural normalmente é menor que a pressão intrapulmonar. Consequentemente , os pulmões tendem ao colapso e se retraem, afastando-se da parede torácica. No início do século XX, Pasteur descreveu a atelectasia pulmonar, que ocorre com frequência durante a indução anestésica, persiste no período pós-operatório e pode contribuir de maneira significativa para a morbidade e o aumento nos gastos com medicamentos. Em medicina veterinária, no entanto, a atelectasia não é frequentemente ...

  5. Utilidad del Índice Biespectral en la Monitorización de la Conciencia Durante la Anestesia General

    OpenAIRE

    Rodrigo A. Tardio Flores; Jacquie Sejas Clavijo; Virginia Castellon Sejas; Carmen Bustamante; Anell Orozco Cadima

    2010-01-01

    En los últimos años el despertar transoperatorio es uno de los principales temores de los enfermos que van a ser intervenidos quirúrgicamente y se relaciona a consecuencias como el síndrome de estrés postraumático y a las implicaciones legales resultantes. Diversos reportes que han enfatizado la elevada incidencia del despertar transoperatorio y sus efectos adversos se han diseñado diferentes técnicas para su detección temprana y monitorización; entre los cuales el más importante es el índic...

  6. Homenagem a August Karl Gustav Bier por ocasião dos 100 anos da anestesia regional intravenosa e dos 110 anos da raquianestesia

    Directory of Open Access Journals (Sweden)

    Almiro dos Reis Jr

    2008-08-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: August Karl Gustav Bier foi o introdutor de duas importantes técnicas de anestesia regional: a anestesia regional intravenosa e a anestesia subaracnóidea, ambas até hoje amplamente empregadas. Completando neste ano de 2008 a primeira delas 100 anos e a segunda 110 anos de existência, seria mais do que justo prestarmos uma homenagem ao notável médico que as criou. CONTEÚDO: O texto relata os dados familiares, estudantis iniciais, do curso acadêmico e da residência médica, as atividades profissionais e universitárias, a personalidade, a aposentadoria e o falecimento de A. K. G. Bier. Descreve suas numerosas contribuições à Medicina e à Anestesiologia em particular. Refere-se às pesquisas que realizou sobre a anestesia regional intravenosa, muitas ainda válidas ou incompletamente esclarecidas. Cita as experiências iniciais e as discordâncias sobre seu papel na criação da raquianestesia. Narra episódios que ele viveu durante a Primeira e a Segunda Guerra Mundial. Também são mencionadas as enormes contribuições de Bier à cultura, aos esportes, à educação física e, sobretudo, à ecologia, ao criar a famosa Floresta de Sauen. Finalmente, são citadas as merecidas homenagens que recebeu em sua pátria e em vários outros países. CONCLUSÕES: A. K. G. Bier criou e introduziu em Anestesiologia dois notáveis e ainda atuais métodos de anestesia regional e foi grande defensor da preservação do meio ambiente. Portanto, ocorrendo neste ano o primeiro centenário da anestesia regional intravenosa é válida a descrição de sua biografia como um tributo ao importante médico alemão.

  7. Anestesia em paciente com síndrome de Marshall-Smith: relato de caso Anestesia en paciente con síndrome de Marshall-Smith: relato de caso Anesthesia in a patient with Marshall-Smith syndrome: case report

    Directory of Open Access Journals (Sweden)

    Beatriz Lemos da Silva Mandim

    2007-08-01

    éreas para identificação de obstrução alta e baixa. Durante a anestesia, a ventilação espontânea deve ser mantida durante a indução até que seja possível o controle das vias aéreas evitando a utilização de bloqueadores neuromusculares.JUSTIFICATIVA Y OBJETIVO: El síndrome Marshall-Smith es una enfermedad rara, caracterizada por deformidad facial, acelerada madurez ósea, atraso en el desarrollo neuro psicomotor y anormalidad de las vías aéreas. Los pacientes con este síndrome presentan una gran probabilidad de complicaciones anestésicas, principalmente con relación al manejo de las vías aéreas. Existen pocos datos en la literatura anestésica a respecto de este síndrome. El objetivo de este relato fue presentar las dificultades y la conducta anestésica en un niño de 28 días, portador de este síndrome, sometido a cirugía para la corrección de atresia de coanas bajo anestesia general. RELATO DEL CASO: Niño del sexo masculino, 28 días de vida, 2,8 kg, sometido a anestesia general para la corrección quirúrgica de atresia de coanas. Presentaba las características típicas del síndrome Marshall-Smith como tórax estrecho, pectus escavatum, manos y pies grandes, cuello largo, deformidad facial, palato alto y estrecho y una acelerada madurez ósea. La inducción anestésica fue por inhalación bajo máscara con O2 a 100% asociado al sevoflurano. Debido a la posibilidad de intubación difícil, fue programada intubación traqueal con fibrobroncoscopio. Después de intubación traqueal y ventilación asistida manual, fue administrado 1,5 mg de rocuronio y, pasados diez minutos, el paciente presentó bradicardia (80 lpm e hipoxia acentuada (30% de saturación de O2 e imposibilidad de ventilación manual a través del tubo traqueal, siendo necesaria la realización de traqueotomía de urgencia cuando se optó por suspender el procedimiento quirúrgico. CONCLUSIÓN: En casos de emergencia anestésico-quirúrgica donde el niño no ventila y no es posible

  8. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  9. Anestesia por isofluorano em eqüinos submetidos à infusão contínua de medetomidina ou xilazina Isoflurane anesthesia in horses during medetomidine or xilazine continuous infusion

    Directory of Open Access Journals (Sweden)

    Renata Gebara Sampaio Dória

    2009-04-01

    Full Text Available Avaliaram-se oito eqüinos sob anestesia geral inalatória com isofluorano (1CAM e infusão contínua de xilazina (0,35mg kg-1h-1 ou medetomidina (3,5µg kg-1h-1, em relação à freqüência cardíaca, ritmo cardíaco, freqüência respiratória, pressão arterial, hemogasometria arterial e temperatura, nos tempos T0 (imediatamente antes do início da infusão contínua e T10 ao T60 (intervalos de 10 minutos, após início da infusão contínua. Houve redução da freqüência cardíaca e da temperatura e elevação da pressão arterial média. A paCO2 (no GM elevou-se e a paO2 mostrou-se maior no GM que no GX. Conclui-se que a infusão contínua de doses equipotentes de xilazina e medetomidina, durante anestesia geral inalatória, com isofluorano, em eqüinos, promove alterações cardiocirculatórias, respiratórias, térmicas e hemogasométricas discretas e equivalentes.Eight horses under inhalant general anesthesia with isoflurane (1MAC and continuous infusion of xylazine (0.35mg kg-1h-1 or medetomidine (3.5µg kg-1h-1 were evaluated for heart rate and rhythm, respiratory rate, arterial blood pressure, arterial blood gas analysis and temperature immediately before the beginning of the continuous infusion (T0 and in intervals of 10 minutes after the beginning of the continuous infusion (T10 to T60. Heart rate and temperature decreased and mean arterial pressure increased. PaCO2 (in GM increased and GM showed a higher paO2 than GX. We conclude that equipotent doses of continuous infusion of medetomidine and xylazine during inhalant general anesthesia with isoflurane in horses promote slight and equivalent cardiocirculatory, respiratory, thermic and arterial blood gases changes.

  10. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D.

    2003-01-17

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  11. Alterações eletrocardiográficas em cães pré-medicados com levomepromazina e submetidos à anestesia por propofol e sevoflurano

    Directory of Open Access Journals (Sweden)

    Selmi A.L.

    2002-01-01

    Full Text Available Avaliaram-se as variáveis eletrocardiográficas em cães submetidos à anestesia pelo sevoflurano. Foram empregados 16 cães clinicamente sadios, adultos, machos ou fêmeas, com peso médio de 15±3,5kg. Administrou-se levomepromazina (1,0 mg/kg seguida pela administração de propofol (5,0 mg/kg, ambos pela via endovenosa. Os animais foram intubados e submetidos à anestesia inalatória com sevoflurano diluído em oxigênio, através de circuito semi-fechado na concentração de 3,5V%. As aferições das freqüências cardíaca e respiratória, oximetria, capnometria, pressões arteriais sistólica, diastólica e média e das variáveis eletrocardiográficas foram realizadas imediatamente antes da administração da levomepromazina, 15 minutos após e imediatamente antes da administração do propofol, após 15 minutos da administração do agente inalatório e consecutivamente a cada 20 minutos. Após administração de levomepromazina, propofol e sevoflurano observou-se decréscimo das pressões arteriais sistólica e média. A levomepromazina ocasionou prolongamento do intervalo QT. O sevoflurano promoveu prolongamento da onda P e aumento de sua amplitude aos 70 e 130 minutos de anestesia, respectivamente, além de prolongamento do intervalo QT. Concluiu-se que a anestesia por sevoflurano, nas condições deste experimento, promoveu prolongamento do intervalo QT, sem no entanto incorrer em arritmias.

  12. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-06-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  13. A primer on linear models

    CERN Document Server

    Monahan, John F

    2008-01-01

    Preface Examples of the General Linear Model Introduction One-Sample Problem Simple Linear Regression Multiple Regression One-Way ANOVA First Discussion The Two-Way Nested Model Two-Way Crossed Model Analysis of Covariance Autoregression Discussion The Linear Least Squares Problem The Normal Equations The Geometry of Least Squares Reparameterization Gram-Schmidt Orthonormalization Estimability and Least Squares Estimators Assumptions for the Linear Mean Model Confounding, Identifiability, and Estimability Estimability and Least Squares Estimators F

  14. Development of Specific Primer for Tricholoma matsutake

    OpenAIRE

    Kim, Jang-Han; Han, Yeong-Hwan

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used ...

  15. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  16. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  17. Anestesia para salpingectomia parcial bilateral em paciente com miocardiopatia hipertrófica idiopática: relato de um caso e revisão da literatura Anestesia para salpingectomía parcial bilateral en paciente con miocardiopatía hipertrófica idiopática: relato de un caso y revisión del literatura Anesthesia for partial bilateral salpingectomy in a patient with idiopathic hypertrophic cardiomyopathy: case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Ana Sofia Del Castillo Sardi

    2010-02-01

    ón autosómica dominante que se caracteriza por hipertrofia del septum ventricular y anormalidades de la válvula mitral. RELATO DEL CASO: Paciente segundigesta, 25 años con diagnóstico de cardiomiopatía hipertrófica hace 4 años e antecedente de asma bronquial leve intermitente controlada con inhalaciones esporádicas de corticoesteroides. Presentaba soplo holosistólico IV/VI plurifocal e importante escoliosis, con los espacios intervertebrales palpables. Refirió palpitaciones esporádicas durante todo el embarazo y se encontraba medicada con 100 mg de atenolol diarios. Presentaba hemograma, creatinina y electrolitos dentro de los límites normales, ecocardiograma que reportaba cardiomiopatía hipertrófica de predominio septal con fracción de eyección sistólica del 76%. La paciente entró en labor de parto de urgencia, obteniéndose producto femenino vivo, APGAR 9/9, sin complicaciones hemodinámicas maternas ni fetales. Se programa para la realización de salpingectomía parcial bilateral. Se entrevista a la paciente, la cual nos refirió que se rehusaba a recibir anestesia general para el procedimiento. La técnica anestésica elegida fue la regional combinada. El procedimiento quirúrgico duró 20 minutos, y los cambios de presión arterial y frecuencia cardíaca fue menos del 10% que el de los valores iniciales, sin complicaciones hemodinámicas ni quirúrgicas inmediatas. CONCLUSIONES: La mortalidad absoluta materna con cardiomiopatia hipertrófica (CH es muy baja y suele estar confinada a mujeres con factores de alto riesgo. No hay evidencia que la anestesia regional aumenta el riesgo en mujeres con CH cuando se utiliza para el parto vaginal. Tanto la anestesia general como regional han sido utilizado con éxito y sin complicaciones en cesáreas de parturientas con CH.BACKGROUND AND OBJECTIVES: Hypertrophic cardiomyopathy is a rare, autosomal dominant cardiac disorder characterized by hypertrophy of the interventricular septum and mitral valve

  18. Manutenção térmica em galinhas domésticas mantidas sob anestesia inalatória com isofluorano Thermal maintenance in chickens under inhalant anesthesia with isoflurane

    Directory of Open Access Journals (Sweden)

    Adriano Bonfim Carregaro

    2008-08-01

    Full Text Available A hipotermia em aves sob anestesia é freqüentemente observada, causando alterações fisiológicas e metabólicas que podem levar ao óbito. O estudo avaliou dois métodos de manutenção térmica em galinhas submetidas à anestesia inalatória com isofluorano. Foram utilizadas seis galinhas, pesando entre 1 e 1,5kg, com idade aproximada de um ano. Os animais foram autocontrole, submetidos a três grupos: controle (GC, não sendo utilizado nada; alumínio (GA, envoltos por papel alumínio comercial; manta (GM, envoltos por uma manta térmica de dupla face de alumínio. Após jejum prévio de quatro horas, as aves foram submetidas à anestesia inalatória por meio de máscara facial com 4V% de isofluorano e mantidas posteriormente com 2V% do mesmo agente inalatório, em um circuito avalvular com umidificador, após intubação endotraqueal. As aves foram mantidas em sala climatizada (26°C e posicionadas em decúbito lateral. As variáveis mensuradas foram a temperatura corpórea, freqüência cardíaca, freqüência respiratória e saturação de oxihemoglobina, nos momentos zero, 5, 15, 30, 45, 60, 75 e 90 minutos. Tanto no GC quando no GM houve hipotermia aos 15 minutos, acentuando-se até o fim das mensurações. No GA a hipotermia só ocorreu após 45 minutos. Houve bradicardia no GC a partir de 15 minutos, no GM a partir de 30 minutos e no GA somente após 60 minutos. Observou-se bradipnéia no GC após 45 minutos e aos 15 e 30 minutos no GA e GM, respectivamente. Ambos os métodos foram eficientes na manutenção térmica, sendo o alumínio mais eficiente devido a menor variação de parâmetros fisiológicos.Hypothermia in birds under general anesthesia is frequently seen, causing physiologic and metabolic alterations that may lead to death. This study evaluated two thermic maintenance methods in chickens under inhalant anesthesia by isoflurane. Six chickens, weighing between 1 and 1.5kg and with approximately one year old, were

  19. Anestesia para septoplastia e turbinectomia em paciente portador de doença de von Willebrand: relato de caso Anestesia para septoplastia y turbinectomia en paciente portador de enfermedad de von Willebrand: relato de caso Anesthesia for septoplasty and turbinectomy in von Willebrand disease patient: case report

    Directory of Open Access Journals (Sweden)

    Múcio Paranhos de Abreu

    2003-06-01

    la enfermedad de von Willebrand sea el mas común de los disturbios hemorrágicos hereditarios, las publicaciones nacionales, relacionando esta enfermedad y la práctica anestésica, son escasas. El objetivo de este relato es presentar un caso de anestesia general para septoplastia y turbinectomia en paciente portador de Enfermedad de von Willebrand - Tipo I, tratado profilacticamente con desmopresina (1-deamino-8- D-arginina vasopresina, DDAVP en los períodos pré y pós-operatorio. RELATO DEL CASO: Paciente con 19 años, sexo femenino, 58 kg, portadora de hipotiroidismo, controlado con L-tiroxina (75 mg, y de enfermedad de von Willebrand, que se manifestó hace tres años, después de extracción dentaría de los dientes del juicio, con sangramiento persistente en el período pós-operatorio. Con el objetivo de evitar nuevos episodios hemorrágicos en los períodos per e pós-operatorio de la cirugía de septoplastia y turbinectomia que fue sometida, la paciente fue tratada profilaticamente con desmopresina (0,3 µg.kg-1. La inducción anestésica fue realizada con midazolam (2,5 mg, fentanil (150 µg, droperidol (2,5 mg, lidocaína (60 mg, atracúrio (30 mg y metoprolol (4 mg, seguida de intubación traqueal y ventilación sobre presión positiva intermitente. La manutención de la anestesia fue realizada con mezcla de oxígeno y óxido nitroso a 50% y sevoflurano a 2%. Esta técnica proporcionó un buen control de la frecuencia cardíaca y de los niveles presóricos durante la cirugía. La paciente permaneció con tampón nasal por 24 horas y cuando éste fue retirado, no hubo sangramiento. La paciente recibió alta hospitalar al día siguiente al de la cirugía, sin interocurrencias. No hubo episodio hemorrágico en el período pós-operatório inmediato o tardío. CONCLUSIONES: El tratamiento profiláctico con DDAVP asociado a la técnica anestésica utilizada en este caso, se mostró eficaz en el control del sangramiento per y pós-operatorio.BACKGROUND AND

  20. Foundations of cryptography a primer

    CERN Document Server

    Goldreich, Oded

    2014-01-01

    Foundations of Cryptography surveys the main paradigms, approaches and techniques used to conceptualize, define and provide solutions to natural cryptographic problems. The author starts by presenting some of the central tools; that is, computational difficulty (in the form of one-way functions), pseudorandomness, and zero-knowledge proofs. Based on these tools, the emphasis is shifted to the treatment of basic applications such as encryption and signature schemes as well as the design of general secure cryptographic protocols. The author has created a unique overview that includes well over 1

  1. A Primer on Energy Conditions

    CERN Document Server

    Curiel, Erik

    2014-01-01

    An energy condition, in the context of a wide class of spacetime theories (including general relativity), is, crudely speaking, a relation one demands the stress-energy tensor of matter satisfy in order to try to capture the idea that "energy should be positive". The remarkable fact I will discuss in this paper is that such simple, general, almost trivial seeming propositions have profound and far-reaching import for our understanding of the structure of relativistic spacetimes. It is therefore especially surprising when one also learns that we have no clear understanding of the nature of these conditions, what theoretical status they have with respect to fundamental physics, what epistemic status they may have, when we should and should not expect them to be satisfied, and even in many cases how they and their consequences should be interpreted physically. Or so I shall argue, by a detailed analysis of the technical and conceptual character of all the standard conditions used in physics today, including exam...

  2. Primer Design Assistant (PDA): a web-based primer design tool

    OpenAIRE

    Chen, S. H.; Lin, C. Y.; Cho, C.S.; Lo, C.Z.; Hsiung, C. A.

    2003-01-01

    Primer Design Assistant (PDA) is a web interface primer design service combined with thermodynamic theory to evaluate the fitness of primers. It runs in a Linux–Apache–MySQL–PHP structure on a PC equipped with dual CPU (Intel Pentium III 1.4 GHz) and 512 Mb of RAM. A succinct user interface of PDA is accomplished by built-in parameters setting. Advanced options on 5′ GC content, 3′ GC content, dimer check and hairpin check are available. The option of covered region constrains the PCR product...

  3. Relato de caso: anestesia em paciente portador de distrofia torácica asfixiante: Síndrome de Jeune

    Directory of Open Access Journals (Sweden)

    Deise Saletti

    2012-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Síndrome de Jeune, ou Distrofia Torácica Asfixiante, é uma doença autossômica recessiva. Esta síndrome é caracterizada por uma displasia óssea com variadas anormalidades: torácica, pancreática, cardíaca, hepática, renal e da retina. A idade em que o quadro clínico dos pacientes se apresenta está correlacionada com a gravidade da doença. Esses pacientes apresentam policondrodistrofia com costelas largas, curtas, horizontais e junções costocondrais irregulares levando a uma caixa torácica rígida e reduzida com grau de injúria respiratória variado. RELATO DO CASO: Paciente do sexo masculino, 4 meses, 7 kg, portador de Distrofia Torácica Asfixiante. Apresentava-se intubado e com caixa torácica reduzida. Ecocardiograma: hipertensão pulmonar leve. Tomografia de tórax: hipoplasia pulmonar. Submetido à toracoplastia bilateral e toracotomia sob anestesia geral. Manutenção da anestesia: infusão contínua de sufentanil e sevoflurano. Parâmetros ventilatórios: ventilação mecânica ciclada à pressão. Com a abertura do tórax, houve melhora dos parâmetros ventilatórios e, após o posicionamento da prótese torácica, observou-se limitação ventilatória. Decidiu-se pela diminuição da prótese torácica com consequente melhora da ventilação. CONCLUSÕES: É imprescindível o diagnóstico de todas as anormalidades presentes para o correto manejo anestésico. Foi necessária observação para adequar ventilação pré- e pós-toracotomia/toracoplastia e para manter o paciente hemodinamicamente estável. A forma mais adequada para ventilação mecânica é a ciclada à pressão para vencer a barreira mecânica. No intraoperatório, é desejável manter o pico de pressão inspiratória o mais baixo possível para minimizar o risco de barotrauma, de impedimento do retorno venoso e diminuição do débito cardíaco.

  4. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  5. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420. ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.712, year: 2014

  6. Porous Media Primer for Physicists

    Science.gov (United States)

    Hunt, Allen; Ewing, Robert

    The study of soils and rocks is the province of many different disciplines. These disciplines have historically focused on applications rather than understanding, and this pragmatic approach has led to some cutting of corners. Furthermore, the different disciplines have different goals, so they have developed their own peculiar vocabulary, insights, and biases. For example, petroleum engineers generally work with consolidated rock, so the concept of a particle size distribution is not as central to their thinking as it is to a soil scientist. Meanwhile, soil scientists working with just two fluids - air and water - can frequently get away with assuming that air is infinitely compressible (and has density and viscosity of zero); petroleum engineers working with multiple flowing gases and liquids must consider all fluid phases in concert. Insofar as the structure of the medium is concerned, the material presented here tends to be centered on soil physics, but we have attempted to make contact with other disciplines in important cases.

  7. Anestesia venosa total em regime de infusão alvo-controlada: uma análise evolutiva Anestesia venosa total en régimen de infusión objeto controlada: un análisis evolutivo Total intravenous anesthesia as a target-controlled infusion: an evolutive analysis

    Directory of Open Access Journals (Sweden)

    Fernando Squeff Nora

    2008-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A anestesia venosa total (AVT sofreu diversos avanços desde o início da utilização da técnica. Desde a síntese dos primeiros anestésicos venosos, com a introdução dos barbitúricos (1921 e do tiopental (1934, a AVT evoluiu até o desenvolvimento da AVT com auxílio de bombas com infusão alvo-controlada (IAC. O primeiro modelo farmacocinético para uso em IAC foi descrito por Schwilden em 1981. Foi demonstrado, a partir daí, que era possível manter a concentração plasmática desejada de um fármaco utilizando-se bomba de infusão gerenciada por computador. CONTEÚDO: Este artigo visou a descrever as bases teóricas da IAC, a apresentar uma proposta de desenvolvimento de um vocabulário comum em IAC ainda não publicado no Brasil e a fazer uma análise crítica dos aspectos atuais da IAC no mundo e no Brasil. CONCLUSÕES: A chegada de novas bombas de infusão dotadas dos modelos farmacocinéticos do remifentanil, sufentanil e propofol inaugura outro capítulo da AVT e alinha o Brasil com a tendência mundial em IAC. Esses sistemas possibilitarão a IAC de hipnóticos e opióides concomitantemente. A conclusão mais importante, no entanto, refere-se à economia à medida que os fármacos utilizados nessas bombas não ficarão restritos apenas a uma empresa farmacêutica, a exemplo do que ocorreu com o propofol. Hoje já se dispõe de equipamentos para utilização de propofol e opióides, em IAC, que aceitam qualquer apresentação farmacêutica com a vantagem da possibilidade de alteração da concentração do fármaco na seringa, de acordo com a diluição desejada.JUSTIFICATIVA Y OBJETIVOS: La anestesia venosa total (AVT tuvo diversos avances desde el inicio de la utilización de la técnica. Desde la síntesis de los primeros anestésicos venosos, con la introducción de los barbitúricos (1921 y del tiopental (1934, la AVT evolucionó hasta el desarrollo de la AVT con el auxilio de bombas con infusi

  8. Loop-Mediated Amplification Accelerated by Stem Primers

    Directory of Open Access Journals (Sweden)

    Laurence Tisi

    2011-12-01

    Full Text Available Isothermal nucleic acid amplifications (iNAATs have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility.

  9. Loop-mediated amplification accelerated by stem primers.

    Science.gov (United States)

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  10. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  11. Caries inhibition by fluoride-releasing primers.

    Science.gov (United States)

    Kerber, L J; Donly, K J

    1993-10-01

    This study evaluated the caries inhibition of dentin primers with the addition of fluoride. Two standardized Class V preparations were placed in 20 molars, the gingival margin placed below the cementoenamel junction and the occlusal margin placed in enamel. Two dentin primers (Syntac and ScotchPrep) were placed in equal numbers of 20 preparations, according to manufacturer's instructions. Ammonium fluoride (10% by weight) was then added to these primers and they were placed in the remaining 20 preparations, opposing the non-fluoridated primer of the same system. All teeth were then restored with a non-fluoridated resin composite. All teeth were subjected to an artificial caries challenge (pH 4.2) for 5 days. Sections of 100 microns were obtained, photographed under polarized light microscopy, then demineralized areas were quantitated by digitization. Results demonstrated the mean areas (mm2 +/- S.D.) demineralization at 0.25 mm, 0.5 mm and 1.0 mm from the restoration margin to be: Syntac/fluoride (1.44 +/- 0.49, 1.68 +/- 0.54, 3.72 +/- 0.74); Syntac (1.99 +/- 0.58, 1.50 +/- 0.35, 2.98 +/- 1.26); ScotchPrep/fluoride (1.23 +/- 0.68, 1.55 +/- 0.64, 3.08 +/- 1.16); ScotchPrep (1.90 +/- 0.83, 1.71 +/- .038, 3.36 +/- 0.62). A paired t-test indicated primers with fluoride to demonstrate significantly less demineralization 0.25 mm from the restoration margin (P < 0.07). PMID:7880460

  12. Economic sanctions: an ethical primer

    Directory of Open Access Journals (Sweden)

    H. J.G. Zandman

    2008-07-01

    Full Text Available The world has developed into a globe with increasingly inter- twined economic interests, with greater economic interdepen- dence than ever before. This has caused a new weapon to step onto the world scene in the 20th and 21st centuries, applied to bring nations to heel. It is aimed at those nations which do not conform to particular, usually ethically perceived standards. “Economic sanctions” is the name of this new weapon.  This article aims to evaluate the wielding of economic sanctions from the perspective of principles based on a Biblical worldview in order to assist Christians in making an informed decision as to what their stance ought to be regarding this phenomenon.   Data show that there is an incremental increase of the use of economic sanctions in world politics. At present, sanctions have uncertain grounding in ethics and little or no standing in inter- national law. Their effectiveness is seriously questioned, their economic cost, especially to the implementer(!, is considerable. The question as to whether economic sanctions should be deplored or embraced at times would be helped with further investigation beyond the scope of this article, notably with re- gard to what has been surmised in the context of the sanctions deployed regarding the apartheid regime in South Africa.   The results of economic sanctions appear to bear out the Biblical principles in that both, actual results plus Biblical prin- ciples, generally send a discouraging message regarding this approach to political conflict.

  13. Anestesia peridural torácica para cirurgia plástica de mama em paciente portadora de miastenia gravis: relato de caso Anestesia peridural torácica para cirugía plástica de mama en paciente portadora de miastenia gravis: relato de caso Thoracic epidural anesthesia for mammaplasty in myasthenia gravis patient: case report

    Directory of Open Access Journals (Sweden)

    Fabiano Timbó Barbosa

    2005-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A miastenia gravis é uma doença crônica, auto-imune, caracterizada pela fraqueza da musculatura esquelética em decorrência da diminuição dos receptores de acetilcolina na junção neuromuscular. O objetivo deste relato é mostrar um caso de paciente com miastenia gravis submetida a anestesia peridural torácica para cirurgia plástica de mama. RELATO DO CASO: Paciente com 51 anos, portadora de miastenia gravis foi submetida a anestesia peridural torácica com bupivacaína e fentanil. Não houve sinais de depressão respiratória. A paciente recebeu alta hospitalar após 36 horas. CONCLUSÕES: O presente caso sugere como conduta anestésica para o paciente portador de miastenia gravis a anestesia peridural como técnica única, sem a obrigatoriedade de intubação orotraqueal.JUSTIFICATIVA Y OBJETIVOS: La miastenia gravis es una enfermedad crónica, auto-inmune, caracterizada por la debilidad de la musculatura esquelética resultante de la disminución de los receptores de acetilcolina en la unión neuromuscular. El objetivo de este relato es mostrar el caso de una paciente con miastenia gravis sometida a anestesia peridural torácica para una cirugía plástica de mama. RELATO DEL CASO: Paciente del sexo femenino, 51 años, portadora de miastenia gravis fue sometida a anestesia peridural torácica con bupivacaína y fentanil. No hubo señales de depresión respiratoria. La paciente recibió alta hospitalaria después de 36 horas. CONCLUSIONES: Este actual caso sugiere como conducta anestésica para el paciente portador de miastenia gravis la anestesia peridural como única técnica, sin la obligatoriedad de intubación orotraqueal.BACKGROUND AND OBJECTIVES: Myasthenia gravis is a chronic autoimmune disease characterized by skeletal muscles weakness promoted by decreased acetylcholine receptors in the neuromuscular junction. This report aimed at describing a case of myasthenia gravis patient submitted to thoracic

  14. Hiperpotassemia pela solução Euro-Collins na anestesia para transplante renal: relato de caso

    Directory of Open Access Journals (Sweden)

    Eunice Sizue Hirata

    2013-10-01

    Full Text Available OBJETIVOS: Descrever uma anestesia para transplante renal que se complicou com a elevação brusca de potássio, pela reperfusão do rim com solução Euro-Collins no campo operatório. Também será relatado o diagnóstico e o tratamento empregados nessa complicação. CONCLUSÃO: O uso de soluções de perfusão no campo cirúrgico requer cuidados na monitoração, como eletrocardioscopia e dosagem de potássio sérico, e disponibilidade para uso imediato de gluconato de cálcio, insulina e salbutamol. A substituição da solução Euro-Collins por soro fisiológico imediatamente antes do implante pode ser uma opção útil em pacientes com níveis de potássio sabidamente elevados.

  15. Anestesia para cesariana em paciente com síndrome de Guillain-Barré: relato de caso

    Directory of Open Access Journals (Sweden)

    Daniel Volquind

    2013-08-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A Síndrome de Guillain-Barré durante a gestação é considerada uma CIRURGIA, Cesárea; complicação neurológica rara e o manejo anestésico para a cesariana nessas pacientes ainda não é consenso na literatura. O objetivo deste artigo é relatar o caso de uma paciente gestante portadora da Síndrome de Guillain-Barré submetida à cesariana. RELATO DO CASO: Paciente feminina, 22 anos, com 35 semanas e cinco dias de idade gestacional, da celularidade. A técnica anestésica empregada foi a anestesia geral, induzida com propofol 1,5 mg.kg-1 e mantida com sevofiurano 2% em oxigênio e fentanil 3 µg.kg-1. O procedimento transcorreu sem complicações, tanto para a gestante quanto para o concepto. A paciente obteve alta no décimo dia de internação, após melhora progressiva do quadro neurológico. CONCLUSÕES: A técnica anestésica a ser empregada em gestantes portadoras da Síndrome de Guillain-Barré que necessitam fazer cesariana permanece como escolha do anestesiologista, que deve ser guiado pelo quadro clínico e pelas comorbidades de cada paciente.

  16. Topografia do cone medular da irara (Eira barbara e sua relevância em anestesias epidurais

    Directory of Open Access Journals (Sweden)

    Érika Branco

    2013-06-01

    Full Text Available Encontrada principalmente na América do Sul, a irara é um carnívoro pertencente à família Mustelidae, a qual pouco se tem informações sobre sua morfologia de forma geral. Diante disso, objetivou-se conhecer melhor parte do sistema nervoso desta espécie, mais precisamente a topografia do cone medular, a fim de subsidiar intervenções anestésicas peridurais nesta, uma vez que a clínica de animais selvagens vem crescendo a cada dia. Foram estudados três exemplares machos, adultos, provenientes da área de Mina Bauxita, Paragominas, doados ao Laboratório de Pesquisa Morfológica Animal (LaPMA, Universidade Federal Rural da Amazônia (UFRA, Belém, os quais foram radiografados e dissecados ao nível lombossacral, seguido de exposição do cone medular. Este, por sua vez, situou-se entre L4-L6 possuindo comprimento médio de 4,31cm, o que nos levou a sugerir a região sacrococcígea como ponde ideal para prática de anestesias epidurais nesta espécie.

  17. MPprimer: a program for reliable multiplex PCR primer design

    OpenAIRE

    Wang Xiaolei; Hang Xingyi; Li Zhifeng; Wu Yonghong; Lu Yiming; Wang Wen; Qu Wubin; Shen Zhiyong; Zhao Dongsheng; Zhang Chenggang

    2010-01-01

    Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nons...

  18. Hematoma após anestesia peridural: tratamento conservador. Relato de caso Hematoma posterior a la anestesia peridural: tratamiento conservador. Relato de caso Hematoma after epidural anesthesia: conservative treatment. Case report

    Directory of Open Access Journals (Sweden)

    Edno Magalhães

    2007-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O hematoma associado à compressão espinhal após anestesia peridural é uma complicação neurológica grave, apesar da pequena incidência relatada (1:150.000. É um episódio agudo, e o tratamento tradicionalmente aplicado é a descompressão cirúrgica de urgência. Mais recentemente, em casos específicos, o tratamento com corticosteróide tem sido aplicado como alternativa, com boa recuperação neurológica. O objetivo deste relato foi expor um caso de hematoma peridural com tratamento conservador e recuperação neurológica completa. RELATO DO CASO: Paciente do sexo feminino, 34 anos, estado físico ASA I, sem qualquer histórico de coagulopatia ou terapia anticoagulante, submetida à anestesia peridural com punção única, em L2-L3, para tratamento cirúrgico de varizes nos membros inferiores. Oito horas após a anestesia regional, ela ainda apresentava bloqueio motor completo (escala de Bromage, redução das sensibilidades térmica e dolorosa abaixo do nível L3, hiperalgesia na região plantar esquerda, preservação dos reflexos tendinosos e ausência de dor lombar. A tomografia computadorizada revelou hematoma peridural em L2 com compressão do saco dural. Dez horas após a punção peridural não havia progressão dos sinais e sintomas neurológicos. Optou-se, então, pelo tratamento com metilprednisolona em infusão venosa contínua (5,3 mg.kg-1 na primeira hora e 1,4 mg.kg-1.h-1 nas 23 horas subseqüentes. Oito horas após o início do tratamento, a paciente recuperou as sensibilidades térmica e dolorosa, e houve regressão total do bloqueio motor. Na 12ª hora, deambulava e referia dor na ferida operatória. O hematoma peridural não foi visualizado em nova tomografia computadorizada na 14ª hora após o início do tratamento. A paciente recebeu alta hospitalar 86 horas depois do início do tratamento conservador, sem comprometimento neurológico. Uma tomografia computadorizada de controle, ap

  19. Monte Carlo primer for health physicists

    International Nuclear Information System (INIS)

    The basic ideas and principles of Monte Carlo calculations are presented in the form of a primer for health physicists. A simple integral with a known answer is evaluated by two different Monte Carlo approaches. Random number, which underlie Monte Carlo work, are discussed, and a sample table of random numbers generated by a hand calculator is presented. Monte Carlo calculations of dose and linear energy transfer (LET) from 100-keV neutrons incident on a tissue slab are discussed. The random-number table is used in a hand calculation of the initial sequence of events for a 100-keV neutron entering the slab. Some pitfalls in Monte Carlo work are described. While this primer addresses mainly the bare bones of Monte Carlo, a final section briefly describes some of the more sophisticated techniques used in practice to reduce variance and computing time

  20. A primer for criticality calculations with DANTSYS

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D. [Univ. of New Mexico, Albuquerque, NM (United States). Nuclear Criticality Safety Group

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  1. A primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem

  2. Book review: feminist research practice: a primer

    OpenAIRE

    Smith, Emma

    2013-01-01

    The fully revised and updated Second Edition of Feminist Research Practice: A Primer, edited by Sharlene Nagy Hesse-Biber, draws on the expertise of a wide group of interdisciplinary scholars who aim to cover cutting-edge research methods and explore research questions related to the complex and diverse issues that deeply impact women’s lives. Emma Smith finds that it will be valuable for academics already working from or looking to develop their understanding and use of feminist research pra...

  3. Primer for the algebraic geometry of sandpiles

    OpenAIRE

    Perkinson, David; Perlman, Jacob; Wilmes, John

    2011-01-01

    The Abelian Sandpile Model (ASM) is a game played on a graph realizing the dynamics implicit in the discrete Laplacian matrix of the graph. The purpose of this primer is to apply the theory of lattice ideals from algebraic geometry to the Laplacian matrix, drawing out connections with the ASM. An extended summary of the ASM and of the required algebraic geometry is provided. New results include a characterization of graphs whose Laplacian lattice ideals are complete intersection ideals; a new...

  4. Weathered Hydrocarbon Wastes: A Risk Management Primer

    OpenAIRE

    Brassington, Kirsty J.; Hough, Rupert L.; Paton, Graeme I.; Semple, Kirk T.; Risdon, Graeme C.; Crossley, Jane; Hay, I; Askari, K.; Pollard, Simon J. T.

    2007-01-01

    We provide a primer and critical review of the characterization, risk assessment, and bioremediation of weathered hydrocarbons. Historically the remediation of soil contaminated with petroleum hydrocarbons has been expressed in terms of reductions in total petroleum hydrocarbon (TPH) load rather than reductions in risk. There are several techniques by which petroleum hydrocarbons in soils can be characterized. Method development is often driven by the objectives of published...

  5. Anestesia em paciente portadora de doença de moyamoya: relato de caso Anestesia en paciente portadora de enfermedad de moyamoya: relato de caso Anesthesia in patient with moyamoya disease: case report

    Directory of Open Access Journals (Sweden)

    Adriano Bechara de Souza Hobaika

    2005-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A doença de moyamoya é uma vasculopatia cerebral progressiva rara, mais freqüentemente diagnosticada em populações asiáticas, mas que também vem sendo identificada no Brasil. Durante a sua vida, pacientes portadores desta doença podem ser submetidos aos mais variados tipos de procedimentos cirúrgicos. O anestesiologista deve entender a fisiopatologia da doença e instituir as medidas peri-operatórias mais adequadas, no intuito de melhorar o prognóstico destes pacientes. RELATO DO CASO: Paciente do sexo feminino, 22 anos, com insuficiência renal crônica, portadora da doença de moyamoya, submetida à intervenção cirúrgica para instalação de fístula arteriovenosa. A anestesia foi induzida com fentanil, propofol e atracúrio e mantida com sevoflurano. Durante o procedimento, a paciente foi mantida em normocapnia e normotermia. A extubação foi realizada e a paciente transferida à sala de recuperação pós-anestésica sem complicações. CONCLUSÕES: Este artigo apresenta os cuidados anestésicos dispensados a uma paciente portadora da doença de moyamoya.JUSTIFICATIVA Y OBJETIVOS: La enfermedad de moyamoya es una vasculopatia cerebral progresiva rara, más frecuentemente diagnosticada en individuos asiáticos, y que también viene siendo identificada en Brasil. Durante su vida, pacientes portadores de esta enfermedad pueden ser sometidos a los más variados tipos de procedimientos quirúrgicos. El anestesiologista debe entender la fisiopatología de la enfermedad e instituir las medidas peri-operatorias más adecuadas, en el designio de mejorar el pronóstico de estos enfermos. RELATO DEL CASO: Paciente del sexo femenino, 22 años, insuficiencia renal crónica, portadora de la enfermedad de moyamoya, sometida a intervención quirúrgica para la instalación de fístula arteriovenosa. La anestesia fue inducida con fentanil, propofol y atracúrio y mantenida con sevoflurano. Durante el procedimiento

  6. Influência da clonidina por via venosa no custo de anestesia com sevoflurano em cirurgias de ouvido médio em regime ambulatorial Influencia de la clonidina por vía venosa en el costeo de anestesia con sevoflurano en cirugías de oído medio en régimen ambulatorial Influence of intravenous clonidine in the cost of sevoflurane anesthesia for outpatient middle ear procedures

    Directory of Open Access Journals (Sweden)

    Renato Mestriner Stocche

    2004-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A clonidina é um agente a2-agonista que diminui o consumo de anestésicos venosos e inalatórios. Este estudo visou avaliar a relação custo-benefício da medicação pré-anestésica com clonidina por via venosa em anestesia geral com sevoflurano em regime ambulatorial. MÉTODO: Trata-se de estudo encoberto, aleatório, controlado com placebo, realizado com pacientes com idade entre 15 e 52 anos. Os pacientes foram divididos em 3 grupos de 15: Grupo S (placebo, Grupo C3 (clonidina 3 µg.kg-1 e Grupo C5 (5 µg.kg-1. A indução anestésica foi feita com sevoflurano, alfentanil (30 µg.kg-1 e pancurônio (0,08 mg.kg-1. Foram anotados a freqüência de complicações, consumo de halogenados, tempo de anestesia, tempo de recuperação fase I e II. A análise de custos considerou gastos diretos e indiretos. RESULTADOS: Não houve diferenças entre os grupos em relação aos dados demográficos, freqüência de complicações e tempo para recuperação anestésica fase I. A recuperação anestésica fase II foi prolongada no grupo C5 (p JUSTIFICATIVA Y OBJETIVOS: La clonidina es un agente a2-agonista que diminuye el consumo de anestésicos venosos e inhalatorios. Este estudio visó evaluar la relación costeo-beneficio de la medicación pre-anestésica con clonidina por vía venosa en anestesia general con sevoflurano en régimen ambulatorial. MÉTODO: Se trata de estudio encubierto, aleatorio, controlado con placebo, realizado con pacientes con edad entre 15 y 52 años. Los pacientes fueron divididos en 3 grupos de 15: Grupo S (placebo, C3 (clonidina 3 µg.kg-1 y C5 (5 µg.kg-1. La inducción anestésica fue hecha con sevoflurano, alfentanil (30 µg.kg-1 y pancuronio (0,08 mg.kg-1. Fueron anotados la frecuencia de complicaciones, consumo de halogenados, tiempo de anestesia, tiempo de recuperación parte I y II. El análisis de gastos consideró gastos directos e indirectos. RESULTADOS: No hubo diferencias entre los

  7. Ablação curativa da fibrilação atrial: comparação entre sedação profunda e anestesia geral

    Directory of Open Access Journals (Sweden)

    Elizabeth Bessadas Penna Firme

    2012-12-01

    Full Text Available OBJETIVO: Comparar sedação profunda com anestesia geral para ablação curativa de fibrilação atrial. MÉTODOS: Estudo prospectivo, aleatório, com 32 pacientes, idades entre 18 e 65 anos, ASA 2 e 3, IMC d" 30kg/m², distribuídos em dois grupos: sedação profunda (G1 e anestesia geral (G2. Todos receberam midazolan (0,5mg/kg venoso. O G1 recebeu propofol (1mg/kg e máscara facial de O2, seguido da infusão contínua de propofol (25-50mg/kg/min e remifentanil (0,01-0,05µg/kg/min. O G2 recebeu propofol (2mg/kg e máscara laríngea com tubo de drenagem, seguido da infusão contínua de propofol (60-100mg/kg/min e remifentanil (0,06-0,1µg/kg/min. Foram comparados: frequência cardíaca, pressão arterial invasiva, complicações, recidiva (desfecho em três meses e gasometrias. RESULTADOS: Os pacientes do G1 apresentaram gasometrias arteriais com níveis de PaCO2 maiores e pH menores (p=0,001 e maior incidência de tosse. Ocorreu diminuição da PAM e FC no G2. Exceto a tosse, as complicações e recidivas foram semelhantes em ambos os grupos. CONCLUSÃO: Ambas as técnicas podem ser utilizadas para a ablação curativa da fibrilação atrial. A anestesia geral proporcionou menores alterações respiratórias e maior imobilidade do paciente.

  8. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  9. Efeito sinérgico entre a dexmedetomidina e a ropivacaína 0,75% na anestesia peridural Synergistic effect between dexmedetomidine and 0.75% ropivacaine in epidural anesthesia

    OpenAIRE

    Paula Fialho Saraiva Salgado; Amália Tieco Sabbag; Priscila Costa da Silva; Sergio Luís Aparecido Brienze; Helio Pontes Dalto; Norma Sueli Pinheiro Módolo; José Reinaldo Cerqueira Braz; Paulo Nascimento Jr

    2008-01-01

    OBJETIVO: O objetivo deste estudo foi avaliar as características clínicas da anestesia peridural realizada com ropivacaína associada à dexmedetomidina. MÉTODOS: Quarenta pacientes submetidos à correção cirúrgica de hérnia inguinal ou varizes de membros inferiores sob anestesia peridural participaram deste estudo. Os pacientes foram divididos em: Grupo Controle (n = 20), ropivacaína 0,75%, 20 ml (150 mg); e Grupo Dexmedetomidina (n = 20), ropivacaína 0,75%, 20 ml (150 mg), mais dexmedetomidina...

  10. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  11. Anestesia em criança com síndrome de Guillain-Barré após vacina de sarampo: relato de caso Anestesia en un niño con síndrome de Guillain-Barré después de la vacuna de sarampión: relato de caso Anesthesia in Guillain-Barré pediatric patient after measles vaccination: case report

    OpenAIRE

    Deoclécio Tonelli; Paula de Camargo Neves Sacco; Desire Calegari; Gustavo Cimerman; Carolina Mourão dos Santos; Rodrigo Gonzales Farath

    2005-01-01

    JUSTIFICATIVA E OBJETIVOS: A síndrome de Guillain-Barré após vacina de sarampo é rara. O diagnóstico muitas vezes é tardio, o que leva a um aumento da morbidade. O presente relato apresenta um caso avançado e os cuidados especiais exigidos durante a anestesia. RELATO DO CASO: Paciente do sexo masculino, com quatro anos de idade com síndrome de Guillain-Barré desde um ano de idade, foi submetido a gastrostomia sob anestesia geral sem intercorrências, com sevoflurano e sem bloqueadores neuromus...

  12. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P;

    2007-01-01

    template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. METHODOLOGY: We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the...... differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the...... distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power...

  13. Amputação interescapulotorácica sob anestesia locorregional

    Directory of Open Access Journals (Sweden)

    José Alves de Moraes

    2013-10-01

    Full Text Available Forequarter amputations are an uncommon option for the treatment of upper limb and shoulder girdle tumors nowadays. This procedure can be done by different approaches and general anesthesia is commonly used. The authors report a case of forequarter amputation by the posterior approach performed for treatment of a soft-tissue sarcoma under a brachial plexus block associated with venous sedation and local anesthesia.

  14. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  15. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  16. Primer izpeljave analize besedila v kvalitativni raziskavi

    OpenAIRE

    Roblek, Vasja

    2013-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  17. Primer izpeljave analize besedila v kvalitativni raziskavi:

    OpenAIRE

    Roblek, Vasja

    2009-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  18. Insuficiência respiratória aguda durante anestesia pediátrica: atelectasia e pneumotórax hipertensivo: relato de caso

    Directory of Open Access Journals (Sweden)

    Joel Massari Rezende

    2012-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A tarefa primordial do anestesiologista é garantir a adequada oxigenação do paciente. O objetivo deste relato é des crever o diagnóstico e conduta em um caso de insuficiência respiratória aguda durante anestesia, com finalidade didática. RELATO DO CASO: Criança de três anos submetida à anestesia para cirurgia urológica apresentou insuficiência respiratória por obstruções de brônquios por secreção, evoluindo com atelectasia e pneumotórax hipertensivo. Apresentamos o desenrolar do caso, e os meios de tratamento aplicado, com destaque para a urgência e técnica da drenagem no pneumotórax hipertensivo. CONCLUSÕES: A atenção do anestesiologista para o diagnóstico precoce de complicações respiratórias e o conhecimento das medidas prioritárias em cada momento pode evitar efeitos adversos graves

  19. Nuevos materiales ecogénicos y dispositivos de ecoguiado en anestesia regional New materials and devices echogenic ultrasound-assisted regional anesthesia

    Directory of Open Access Journals (Sweden)

    J. L. Laguillo Cadenas

    2013-04-01

    Full Text Available La anestesia regional y la ecografía parecen ir de la mano en la última década. A la dificultad de la identificación de estructuras nerviosas se añade la de visualizar en el ecógrafo el material de punción conforme se realizan las técnicas analgésicas o anestésicas. La ecogenicidad de agujas y catéteres se debe a la reflexión del ultrasonido en la superficie de Estos. Para incrementar su visualización y facilitar al anestesiólogo la técnica, se han desarrollado nuevos dispositivos y avances en los acabados de estos materiales de punción. El objeto de esta revisión es recopilar de la literatura la información publicada acerca de este desarrollo en materiales de punción para anestesia o analgesia regional.Regional anesthesia and ultrasonography have apparently gone hand in hand in the last decade. The difficulty of visualizing the puncture material in the ultrasound machine during the analgesic or anesthetic techniques is added to that of the nerve structure identification. Different devices and advances on previous materials are appearing so as to facilitate this visualization to the anaesthesiologist. This review aims to gather the information published about these developments.

  20. Neuropatía periférica tras el parto: Implicaciones de la anestesia epidural Peripheral neuropathy after delivery implications for epidural anaesthesia

    Directory of Open Access Journals (Sweden)

    S. Velázquez

    2006-05-01

    Full Text Available La incidencia de lesiones neurológicas de miembros inferiores en la práctica obstétrica es del 0,08% y 0,92%. La incidencia de complicaciones neurológicas asociadas a la técnica epidural ha sido estimada en 2 casos de cada 10.000 epidurales. Durante los últimos años, con la generalización de la analgesia epidural para el trabajo de parto, es posible que algunas de las neuropatías sean atribuidas a esta técnica, olvidando que hay otros mecanismos de lesión en estas situaciones. Presentamos el caso de una paciente primigesta de 21 años de edad y 139 cm de altura sin antecedentes de interés, que 24 horas tras una epidural para parto y un expulsivo prolongado resuelto con fórceps, desarrolla un "pie caído", que evolucionó a la resolución funcional completa. El pie caído puede darse como consecuencia de una lesión del nervio peroneo, del ciático, o de una raíz del plexo lumbo-sacro. La clínica unida al uso de pruebas como la resonancia magnética (RNM y el electromiograma (EMG, ayudan en el diagnóstico diferencial de la lesión. Parece necesario el estudio del las neuropatías relacionadas con el parto para descartar su relación con la técnica anestésica empleada. Con frecuencia, estas lesiones se deben a mecanismos ajenos a la analgesia-anestesia epidural, si bien debemos procurar minimizar su incidencia con la realización de punciones a niveles adecuados, evitando la inyección de anestésicos cuando existen parestesias, valorando los factores de riesgo en obstetricia y, una vez producida la lesión, con un seguimiento clínico estrecho.Postpartum neurological damage occurs in the obstetric practice with an incidence between 0.08-0.92%. Neurological damage secondary to epidural technique is about 2:10,000. In last years, epidural anesthesia has become a generalized practice in obstetrics. Because of it, sometimes, the postpartum neurological damage can be attributed to epidural analgesia, forgetting other mechanisms. We

  1. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  2. pmoA Primers for Detection of Anaerobic Methanotrophs▿

    OpenAIRE

    Luesken, F.A.; Zhu, B.; Alen, T.A. van; Butler, M.K.; Diaz, M. R.; Song, B.; Op den Camp, H.J.M.; M. S. M. Jetten; Ettwig, K.F.

    2011-01-01

    Published pmoA primers do not match the pmoA sequence of “Candidatus Methylomirabilis oxyfera,” a bacterium that performs nitrite-dependent anaerobic methane oxidation. Therefore, new pmoA primers for the detection of “Ca. Methylomirabilis oxyfera”-like methanotrophs were developed and successfully tested on freshwater samples from different habitats. These primers expand existing molecular tools for the study of methanotrophs in the environment.

  3. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  4. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  5. ESTRATEGIAS PICTOFÓNICAS. UN ESTUDIO COMPARATIVO DE EFICACIA EN LA ENSEÑANZA DE LA LECTURA INICIAL PARA EL PRIMER GRADO DE EDUCACIÓN GENERAL BÁSICA EN SEIS ESCUELAS PÚBLICAS EN CARTAGO, COSTA RICA ESTRATEGIAS PICTOFONICAS. (A COMPARATIVE STUDY EFFECTIVENESS IN THE TEACHING OF EARLY READING FIRST GRADE FOR GENERAL BASIC EDUCATION IN SIX PUBLIC SCHOOL IN CARTAGO, COSTA RICA

    Directory of Open Access Journals (Sweden)

    Carpio Brenes María de los Ángeles

    2011-08-01

    Full Text Available Resumen:Este es un artículo que presenta los resultados de un estudio experimental, que se hizo para contrastar la eficacia en la enseñanza de la lectura, en primer grado de Educación Básica, con las estrategias pictofónicas, método que estimula un proceso dual de aprendizaje de la lectura mediante la asociación del grafema con el dibujo que lo representa (proceso logográfica y el fonema con la palabra clave (proceso alfabético; en tres escuelas públicas costarricenses (grupo experimental, frente al método ecléctico, propuesto por el Ministerio de Educación Pública (MEP aplicado en otras tres escuelas públicas (grupo cuasi control del Núcleo Uno, Circuito 05 de la Región Educativa de Cartago, Costa Rica. Para comprobar la adquisición, en cinco meses, de una mejor decodificación de sílabas y palabras, mediante el dominio de las reglas de correspondencia grafema-fonema, se aplicaron, en febrero y junio de 2010, subpruebas de cuatro test de lectura: LEA, P.E.R.E.L, PROLEC y LEE. Los análisis evidencian que se obtuvo, no sólo una mejor decodificación por parte de los estudiantes del grupo experimental, sino también un mejor desempeño en la segmentación fonética y una mayor generalización hacia nuevas combinaciones silábicas, por lo que se concluye que las estrategias pictofónicas son eficaces para la enseñanza de la lectura.Abstract: This article presents the results of a experimental study that was made to contrast the effectiveness in teaching of the reading in first grade with the estrategias pictofónicas (pictorial-phonic strategies, method that encourages a dual process oflearning to read by associating the grapheme with the picture that represents (logographic process and the phoneme with the keyword (alphabetic process; in three costarrican elementary schools (experimental group, against the método ecléctico (eclectic method, proposed by the Ministry of Public Education (MEP, applied in other three public

  6. Anestesia para paciente portador da equência de moebius: relato de caso Anestesia para Paciente Portador de la Secuencia de Moebius: relato de Caso Anesthesia in a patient with moebius sequence: case report

    Directory of Open Access Journals (Sweden)

    Adriano Bechara de Souza Hobaika

    2009-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A sequência de Moebius (SM é uma rara paralisia do VI e VII nervos cranianos. Alterações craniofaciais estão presentes em aproximadamente 90% destes pacientes, o que pode tornar a intubação traqueal muito difícil. RELATO DO CASO: Paciente do sexo masculino, 2 anos e 5 meses, portador de SM, submetido à broncoscopia flexível para avaliação de laringotraqueomalácia. Comorbidades: crises de broncoespasmo e comunicação interventricular. Realizou-se indução anestésica com sevoflurano em O2 a 100% e venóclise. Introduziu-se máscara laríngea AMBU® número 2,5 e o fibrobroncoscópio foi introduzido através da mesma. O procedimento foi realizado sem complicações e a broncoscopia revelou-se normal. O paciente recebeu alta para casa após duas horas. CONCLUSÕES: O controle das vias aéreas é o grande desafio nestes pacientes, havendo relato de falha ou dificuldade de intubação em 13 pacientes de uma série de 41 casos analisados. Micrognatia, retrognatia, hipoplasia mandibular e fenda palatina são algumas características destes pacientes. Em outra grande série com 106 anestesias em pacientes com SM há descrição do uso da máscara laríngea em um caso. Parece não haver contra-indicação a realizar o procedimento em regime ambulatorial. Há relato de aspiração pulmonar e obstrução respiratória na sala de recuperação devido à dificuldade em deglutir e eliminar as secreções da boca e recomenda-se administrar antisialogogos.JUSTIFICATIVA Y OBJETIVOS: La secuencia de Moebius (SM es una rara parálisis del VI y VII nervios cranianos. Las alteraciones craneofaciales están presentes en aproximadamente un 90% de esos pacientes, lo que puede hacer con que la intubación traqueal sea muy difícil. RELATO DEL CASO: Paciente del sexo masculino, 2 años y 5 meses, portador de SM, sometido a la broncoscopia flexible para la evaluación de laringotraqueomalacia. Comorbidades: crisis de broncoespasmo

  7. Hacia el Entendimiento de la Analgesia y Anestesia en Animales Silvestres

    Directory of Open Access Journals (Sweden)

    Farnando Nassar-Montoya

    2010-02-01

    Full Text Available La práctica en especies silvestres que lógicamente conlleva la utilización de fármacos analgésicos y anestésicos, presenta una idiosincrasia propia que tiene que ser entendida desde la conceptualización del significado de la medicina veterinaria. Por esto, estos textos inician con una reflexión a partir del siguiente texto de una sentencia del Tribunal Nacional de Ética Profesional de Medicina Veterinaria y Zootecnia de Colombia: “… La investigada se excusó en que realizó el examen clínico general previa la cirugía, sin embargo, el examen superficial o externo del animal no es suficiente para hacer una evaluación completa del estado de salud como lo exige la norma. Cuando un animal va a ser intervenido quirúrgicamente y sometido a anestésicos que le pueden causar la muerte, se deben reducir los riesgos posibles por lo que, como mínimo se debe evaluar el estado de la función hepática y renal de los animales. La médica veterinaria no realizó exámenes pre-quirúrgicos que descartaran problemas de función hepática o renal, causándole con esta omisión una violación al deber profesional del artículo…”

  8. Coverage evaluation of universal bacterial primers using the metagenomic datasets

    Directory of Open Access Journals (Sweden)

    Mao Dan-Ping

    2012-05-01

    Full Text Available Abstract Background The coverage of universal primers for the bacterial 16S rRNA gene plays a crucial role in the correct understanding of microbial community structure. However, existing studies on primer coverage are limited by the lack of appropriate databases and are restricted to the domain level. Additionally, most studies do not account for the positional effect of single primer-template mismatches. In this study, we used 7 metagenomic datasets as well as the Ribosomal Database Project (RDP to assess the coverage of 8 widely used bacterial primers. Results The coverage rates for bacterial primers were found to be overestimated by previous studies that only investigated the RDP because of PCR amplification bias in the sequence composition of the dataset. In the RDP, the non-coverage rates for all primers except 27F were ≪6%, while in the metagenomic datasets, most were ≫10%. If one considers that a single mismatch near the 3′ end of the primer might greatly reduce PCR efficiency, then some phylum non-coverage rates would change by more than 20%. Primer binding-site sequence variants that could not pair with their corresponding primers are discussed. Conclusions Our study revealed the potential bias introduced by the use of universal bacterial primers in the assessment of microbial communities. With the development of high-throughput, next-generation sequencing techniques, it will become feasible to sequence more of the hypervariable regions of the bacterial 16S rRNA gene. This, in turn, will lead to the more frequent use of the primers discussed here.

  9. Evaluation of conservation programs: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Soderstrom, E.J.; Berry, L.G.; Hirst, E.; Bronfman, B.H.

    1981-07-01

    This primer is an introduction to the field of program evaluation. A considerable amount of information is included about the actual conduct of an evaluation. No specific activity is addressed, but rather an idea is provided of the issues and constraints characteristic of each phase and activity of an evaluation. Examples of how these issues arise and potential solutions are presented. Chapter 1 provides background on the origins and evolution of evaluation, focusing especially on why evaluation is currently receiving increased emphasis. Chapter 2 is an overview of the field of evaluation, especially as it relates to energy conservation. Chapter 3 is a consideration of the steps involved in conducting an evaluation from the planning stage to data analysis. Chapter 4 discusses managerial considerations in conducting an evaluation. Chapter 5 discusses evaluators as people; both in terms of organizational obstacles likely to be encountered by, and personal characteristics found in, good evaluators. An appendix includes suggested further readings.

  10. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  11. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  12. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  13. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  14. ESTRATEGIAS PICTOFÓNICAS. UN ESTUDIO COMPARATIVO DE EFICACIA EN LA ENSEÑANZA DE LA LECTURA INICIAL PARA EL PRIMER GRADO DE EDUCACIÓN GENERAL BÁSICA EN SEIS ESCUELAS PÚBLICAS EN CARTAGO, COSTA RICA ESTRATEGIAS PICTOFONICAS. (A COMPARATIVE STUDY EFFECTIVENESS IN THE TEACHING OF EARLY READING FIRST GRADE FOR GENERAL BASIC EDUCATION IN SIX PUBLIC SCHOOL IN CARTAGO, COSTA RICA)

    OpenAIRE

    Carpio Brenes María de los Ángeles

    2011-01-01

    Resumen:Este es un artículo que presenta los resultados de un estudio experimental, que se hizo para contrastar la eficacia en la enseñanza de la lectura, en primer grado de Educación Básica, con las estrategias pictofónicas, método que estimula un proceso dual de aprendizaje de la lectura mediante la asociación del grafema con el dibujo que lo representa (proceso logográfica) y el fonema con la palabra clave (proceso alfabético); en tres escuelas públicas costarricenses (grupo experimental),...

  15. Formaldehyde as hypothetical primer of biohomochirality

    Energy Technology Data Exchange (ETDEWEB)

    Goldanskii, V.I. [N. N. Semenov Institute of Chemical Physics of the Russian Academy of Sciences, Kosygin Street 4, Moscow, 117334 (Russia)

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  16. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (keff). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple keff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  17. Benzocaine hydrochloride anesthesia in carp (Cyprinus carpio / Cloridrato de benzocaína na anestesia de carpas (Cyprinus carpio

    Directory of Open Access Journals (Sweden)

    Marco Antonio da Rocha

    2008-08-01

    Full Text Available Fish anesthesia is indicated to allow the accomplishment of several procedures such as biometry, tagging, transportation, physical examination, surgical procedures, and reproductive management. The doses of benzocaine in the carp anesthesia (Cyprinus carpio were determined, carrying through six phases with 40 fish each. The average weight of carps in each phase was of 147.45±7.99g, 173.32±9.15g, 191.26±14.05g, 269.84±19.24g, 285.25±17.97g, and 300.91±16.45g. In each phase, fish had been captured and placed in four containers each one with different concentrations of benzocaine (100, 140, 180 and 220 mg/L respectively. The induction time (IT was registered for each fish and after that the anesthetic induction biometry was performed. In each phase the minimal dose of benzocaine was calculated using the Linear Response Plateau (LRP, in a model that included dose and IT. The LRP was calculated for each phase: 125.79mg/L in 114.33s, 155.68mg/L in 115.75s, 145.33mg/L in 102.52s, 149.50mg/L in 140.53s, 166.42mg/L in 116.15s, and 158.34mg/L in 102.00s. The optimal dose was related with the weight, resulting in the equation: dose=114.230+0.158 x weight (r2=0.53. The equation shows that an increase in the weight in 1g corresponds to an increase of 0.158 mg/L in the dose of benzocaine hydrochloride for carps.A anestesia em peixes é indicada para permitir a realização de diversos procedimentos como: biometria, marcação, transporte, exame físico, procedimentos cirúrgicos e manejo reprodutivo. Determinou-se a dose de benzocaína na anestesia de carpas (Cyprinus carpio, com a realização de seis etapas com 40 peixes cada. O peso médio das carpas em cada etapa foi de 147,45±7,99g, 173,32±9,15g, 191,26±14,05g, 269,84±19,24g, 285,25±17,97g, e 300,91±16,45g. Em cada etapa, os peixes foram capturados e colocados em quatro recipientes com benzocaína nas concentrações de 100, 140, 180 e 220 mg/L respectivamente. O tempo de indução (TI foi

  18. Atitudes atuais de anestesiologistas e médicos em especialização com relação à anestesia venosa total Actitudes actuales de anestesiólogos y médicos en especialización con relación a la anestesia venosa total Current attitude of anesthesiologists and anesthesiology residents regarding total intravenous anesthesia

    Directory of Open Access Journals (Sweden)

    Fernando Squeff Nora

    2006-08-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: No passado, tempo, custos, informações, treinamento e avaliação da profundidade da anestesia limitavam a aceitação da anestesia venosa total (TIVA. O objetivo deste estudo foi determinar atitudes de anestesiologistas e médicos em especialização com relação à anestesia venosa total. MÉTODO: Um questionário foi enviado a 150 anestesiologistas e 102 residentes. A concordância (C e discordância (D em cada item foram comparadas por testes z (consenso, se p JUSTIFICATIVA Y OBJETIVOS: Antiguamente, tiempo, costes, informaciones, capacitación y evaluación de la profundidad de la anestesia limitaban la aceptación de la anestesia venosa total (TIVA. El objetivo de este estudio fue el de determinar las actitudes de anestesiólogos y médicos en especialización con relación a la anestesia venosa total. MÉTODO: Un cuestionario fue enviado a 150 anestesiólogos y 102 residentes. La concordancia (C y discordancia (D en cada ítem se compararon por pruebas z (consenso, si p BACKGROUND AND OBJECTIVES: In the past, time, cost, information, training, and the evaluation of the plane of anesthesia limited the acceptance of total intravenous anesthesia (TIVA. The objective of this study was to determine the attitude of anesthesiologists and other anesthesiology residents regarding total intravenous anesthesia. METHODS: A questionnaire was sent to 150 anesthesiologists and 102 residents. The concordance (C and disaccord (D of each item were compared by z tests (consensus if p < 0.05. RESULTS: There were 98 responses. The data represent the number of answers for each category. The majority of the participants agreed that the quality of the awakening stimulates the use of the TIVA (C/D = 86/8; p < 0.05; that the future depends on the development of drugs with a fast onset of action and immediate recovery (C/D = 88/5; p < 0.05; that they would like to use TIVA more often (C/D = 72/21; p < 0.05; and to have more information

  19. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    high-schools. We are now producing a second edition, which is an entirely new re-write, and we are making the process of producing the primer a development opportunity in its own right, to strengthen the international community of early-career astrobiologists. We have recruited a large team of writers and editors, 45 people from 11 different countries across North and South America, Europe and Australia. By working together on this joint project we are strengthening links between early-career scientists in these countries. In addition, we have a wider group of early-career astrobiologists who we consulted on the content that the primer should include. We have also recruited early-career scientists from this group, and more widely, to act as 'accessibility reviewers' to check that the primer meets its goal of being clear to people who are not experts in the field. We expect that the primer will be published in 2012, in several different languages. It will be freely available online to all who want it. References 1. Mix LM et al (2006) The Astrobiology Primer : An Outline of General Knowledge - Version 1, 2006 Astrobiology 6(5) : 735-813

  20. Efeitos do óxido nitroso em hipotensão controlada durante anestesia com baixo fluxo Efectos del óxido nitroso en la hipotensión controlada durante la anestesia con bajo flujo The effects of nitrous oxide on controlled hypotension during low flow anesthesia

    OpenAIRE

    Semiha Barçın; Leyla Sahan; Dilsen Ornek; Fazilet Sahin; Oya Kilci; Serpil Deren; Gulay Erdogan; Canan Un; Mehmet Gamli; Bayazit Dikmen

    2013-01-01

    JUSTIFICATIVA E OBJETIVOS: Investigamos o efeito do óxido nitroso (N2O) em hipotensão controlada durante anestesia com baixo fluxo (isoflurano-dexmedetomidina) em termos de hemodinâmica, consumo de anestésico e custos. MÉTODOS: Quarenta pacientes foram randomicamente alocados em dois grupos. Infusão de dexmedetomidina (0,1 µg.kg-1.min-1) foi mantida por 10 minutos. Subsequentemente, essa infusão foi mantida até os últimos 30 minutos de operação a uma dose de 0,7 µg.kg-1.hora-1. Tiopental (4-6...

  1. Levobupivacaína versus bupivacaína em anestesia peridural para cesarianas: estudo comparativo Levobupivacaína versus bupivacaína en anestesia peridural para cesáreas: estudio comparativo Levobupivacaine versus bupivacaine in epidural anesthesia for cesarean section: comparative study

    OpenAIRE

    Felipe Bergamaschi; Vanessa Rezende Balle; Marcos Emanuel Wortmann Gomes; Sheila Braga Machado; Florentino Fernandes Mendes

    2005-01-01

    JUSTIFICATIVA E OBJETIVOS: O anestésico local bupivacaína é encontrado na forma de dois enantiômeros: levobupivacaína - S (-) e dextrobupivacaína - R (+). Baseado em estudos que demonstram que a cardiotoxicidade é menor com o enantiômero S(-), foi difundido o uso deste agente na prática clínica. Este estudo teve por objetivo comparar a eficácia e a efetividade do uso de bupivacaína racêmica com levobupivacaína em anestesia peridural de pacientes submetidas à cesariana eletiva. MÉTODO: Ensaio ...

  2. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  3. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  4. UniFrag and GenomePrimer : selection of primers for genome-wide production of unique amplicons

    NARCIS (Netherlands)

    van Hijum, SAFT; de Jong, A; Buist, G; Kok, J; Kuipers, OP

    2003-01-01

    The complementary programs UniFrag and GenomePrimer were developed to provide a reliable high-throughput method to select the most unique regions within genomic DNA sequence(s) and design primers therein, involving minimal user intervention and maximum flexibility.

  5. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  6. Nuevos materiales ecogénicos y dispositivos de ecoguiado en anestesia regional New materials and devices echogenic ultrasound-assisted regional anesthesia

    OpenAIRE

    J. L. Laguillo Cadenas; J. Fernández Jiménez; F. J. Marques Asin

    2013-01-01

    La anestesia regional y la ecografía parecen ir de la mano en la última década. A la dificultad de la identificación de estructuras nerviosas se añade la de visualizar en el ecógrafo el material de punción conforme se realizan las técnicas analgésicas o anestésicas. La ecogenicidad de agujas y catéteres se debe a la reflexión del ultrasonido en la superficie de Estos. Para incrementar su visualización y facilitar al anestesiólogo la técnica, se han desarrollado nuevos dispositivos y avances e...

  7. Toracotomia em eqüinos sob anestesia com ventilação mecânica controlada Equine thoracotomy under anesthesia with controlled mechanical ventilation (CMV)

    OpenAIRE

    Raquel Yvonne Arantes Baccarin; José de Alvarenga; Denise Tabachi Fantoni; Luís Cláudio Lopes Correia da Silva

    1998-01-01

    Diversos procedimentos cirúrgicos e diagnósticos podem ser realizados através da cirurgia torácica em eqüinos. Para tanto faz-se necessária a utilização da ventilação controlada mecânica (VCM) e a compreensão dos efeitos respiratórios deste tipo de ventilação durante a toracotomia. Foram utilizados seis eqüinos hígidos, sob anestesia com ventilação controlada, para a realização de acesso cirúrgico ao hemitórax direito com o objetivo de se avaliar, através da mensuração dos parâmetros fisiológ...

  8. A primer on climate relevant technology transfer

    International Nuclear Information System (INIS)

    The aim of this primer is to support technology transfer initiatives related to mitigation of emissions of greenhouse gases and adaptation to climate change in developing countries and economies in transition. It is meant to provide guidance to all parties involved in the transfer of climate relevant technologies, micluding government, business organisations and other non-governmental organizations representing all sectors relevant for climate change. The emphasis in this primer is on strategic and organisational issues related to the transfer of climate relevant technologies, in particular with a view to utilise climate-relevant technologies in the development process of developing countries and countries in economic transition. It builds upon insight gained in National Needs Assessments regarding the Transfer of Enviromentally Sound Technologies to developing countries. Chapter 2 deals with the technology transfer process for climate relevant technologies. It provides a framework for co-ordinated action of the stakeholders involved in the technology transfer process, with a view to improve the utilisation of climate relevant technologies in the development process of developing countries. It therefore proposes three main 'pillars' for climate relevant technology transfer, i.e. creating an enabling environment for stakeholders' participation, assessing mitigation and adaptation needs and opportunities, and implementing and evaluating mitigation and adaptation actions. Chapter 3 elaborates on creating an enabling environment for stakeholders' participation. It deals in particular with the selection of priority sectors and obtaining involvement of stakeholders representing these prioritised sectors, in order to start a roundtable process for the preparation of mitigation and adaptation actions. Chapter 4 covers the second pillar 'assessing mitigation and adaptation needs and opportunities'. This encompasses several assessment tasks including: identification and

  9. Modelo de anestesia em coelhos para procedimentos no tórax Anesthesia model in rabbits for thoracic surgery

    Directory of Open Access Journals (Sweden)

    Elias Kallas

    2001-06-01

    Full Text Available A intubação endotraqueal em coelhos é dificil. O risco anestésico não é desprezível pela estreita margem de segurança entre o plano anestésico e o óbito. Tais fatos despertaram nosso interesse por uma solução simples e segura. Dez animais machos receberam por via intramuscular acepromazina, cetamina e xilazina. Após dez minutos procedeu-se exposição do ligamentum cricothyroideum , o qual foi incisado para colocação de tubo endotraqueal iniciando-se a administração de oxigênio e halotano. A punção arterial foi realizada para controle da pressão arterial média. Procedeu-se toracotomia no quinto espaço intercostal esquerdo com biópsia do pulmão e colabamento pulmonar, iniciando-se a ventilação seletiva do pulmão contra-lateral. Amostras sangüíneas, para medida do pH, foram colhidas no início do procedimento, após o colabamento pulmonar e no final, antes da expansão do pulmão, 30 minutos após o colabamento. Fechado o tórax, foi retirado o tubo endotraqueal tão logo o animal apresentasse recuperação dos reflexos e a seguir suturado ligamentum cricothyroideum. Os animais foram submetidos a eutanásia 14 dias após, quando procedeu-se a nova biópsia pulmonar, a retirada da traquéia e da laringe, para exame. Concluiu-se que este é um procedimento simples e seguro de anestesia para cirurgia torácica em coelhos.The endotracheal intubation of rabbits is difficult. The anesthetic risk is high because of the narrow difference between the effective and the lethal dose. We used a safe and simple method. Ten male animals received intramuscular injection of acepromazine, cetamine, and xylazine. Ten minutes later, an endotracheal canula was inserted trough a small cervical incision on the crico-tyroid membrane, to administrate oxigen and halothane. Thoracotomy was performed in the 5th. left intercostal space and a pulmonary biopsy too. The left lung collapsed and ventilation of the right lung remained for the next 30

  10. Incidentes críticos em anestesia no Uruguai - dez anos após: estudo comparativo (1990-2000

    Directory of Open Access Journals (Sweden)

    Bello Manuel da Fonte

    2003-01-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Descreve-se uma pesquisa sobre Incidentes Críticos (IC em Anestesia. Os resultados encontrados em 2000 são comparados aos de 1990, na busca de variações de padrão de IC ao longo da década. MÉTODO: Foram utilizados 2 formulários diferentes. No primeiro (F1, constava uma lista pré-determinada de incidentes críticos para que os pesquisados apontassem com quais tinham tido algum tipo de contato para o estudo de freqüência relativa de cada incidente. No segundo (F2, solicitava-se a descrição de um incidente em particular, a critério do pesquisado. RESULTADOS: No F1 de 2000, foram assinalados 9.482 IC, em que os 13 mais freqüentes constituíram 50% de todas as ocorrências do período. Os resultados foram muito similares aos de 1990, já que dentre os mais freqüentes, 9 repetem-se em ambas as investigações. Os incidentes que alcançaram os primeiro e segundo lugares também se repetem: intubação difícil e disritmia cardíaca. Em F2 foram descritos 20% de IC com conseqüência mortal. Cinqüenta e quatro por cento das mortes deveram-se a 5 IC: parada cardíaca inesperada, tromboembolismo pulmonar, infarto agudo de miocárdio, aspiração de vômito e choque hipovolêmico. Quarenta e seis por cento dos IC foram de origem respiratória e 24% tiveram origem hemodinâmica. Destaca-se um aumento significativo de IC na recuperação e no pós-operatório imediato. A observação clínica do paciente foi responsável pela detecção de 63% dos IC. Comprova-se um aumento substancial dos IC relatados como imprevisíveis. CONCLUSÕES: Manteve-se a diversidade de incidentes críticos com diminuição dos fenômenos respiratórios. Este segue sendo o grupo mais freqüente. Há uma clara redução dos acidentes graves hipóxicos vinculados à intubação esofágica e óxido nitroso como gás único. Manteve-se a gravidade dos incidências hemodinâmicos.

  11. Anestesia intravenosa total utilizando propofol ou propofol/cetamina em cadelas submetidas à ovariossalpingohisterectomia Total intravenous anesthesia using propofol or propofol/ketamine in bitches undergoing ovariohysterectomy

    Directory of Open Access Journals (Sweden)

    Simone Salata Gasparini

    2009-08-01

    Full Text Available Objetivou-se avaliar os efeitos cardiorrespiratório e analgésico da infusão contínua com propofol e propofol/cetamina em cadelas pré-medicadas com atropina e xilazina, submetidas a ovariossalpingohisterectomia (OSH. Em seis cadelas (GP a indução anestésica foi realizada com propofol (5mg kg-1 iv, seguido da manutenção anestésica com o mesmo fármaco em infusão contínua intravenosa na taxa inicial de 0,4mg kg-1.min-1. Outras seis cadelas (GPC receberam a associação de propofol (3,5mg kg-1 iv e cetamina (1mg kg-1 iv como indução anestésica. Depois, foi feita manutenção anestésica em infusão contínua intravenosa inicial com 0,28mg kg-1.min-1 e 0,06mg kg-1.min-1 de propofol e cetamina, respectivamente. Os seguintes parâmetros foram mensurados durante a anestesia a cada 10 minutos: freqüências cardíaca (FC e respiratória (f, pressão arterial sistólica, média e diastólica (PA, concentração final expirada de CO2 (EtCO2, volume minuto (VM, pressão parcial de gás carbônico (PaCO2, pressão parcial de oxigênio (PaO2, saturação de oxigênio na hemoglobina (SatO2, pH, bicarbonato, glicemia e temperatura retal (T. Observou-se redução da pressão arterial média entre 20 e 40 minutos de anestesia no GP. Ocorreu redução da temperatura, hipercapnia e acidose respiratória em ambos os grupos durante a anestesia. A PaO2, o bicarbonato e a glicose aumentaram de forma significativa apenas no GPC durante a anestesia. Houve necessidade de aumentar em 50 e 20% a taxa de infusão de propofol no GP e GPC respectivamente para anestesia cirúrgica satisfatória. Dessa forma, ambos os protocolos mostraram-se seguros e suficientes do ponto de vista de anestesia cirúrgica para realização da OSH em cadelas, desde que a ventilação assistida ou controlada seja instituída quando necessária e a velocidade de infusão do propofol seja 0,6 e 0,34mg kg-1.min-1 nos grupos GP e GPC, respectivamente.This study aimed to investigate the

  12. O tempo e a anestesia obstétrica: da cosmologia caótica à cronobiologia El tiempo y la anestesia obstétrica: de la cosmología caótica a la cronobiología Time and obstetric anesthesia: from chaotic cosmology to chronobiology

    Directory of Open Access Journals (Sweden)

    Nilton Bezerra do Vale

    2009-10-01

    /morir, etc., y las condiciones ambientales (sincronizadores, influyen en la fisiología del parto en función de la existencia de relojes endógenos (osciladores, que interactúan con pistas sociales diuturnas. En esta revisión, fueron abordados los parámetros anestésico-obstétricos cíclicos más importantes en la atención a la parturiente. CONTENIDO: Análisis cronobiológico de los principales eventos de la fisiopatología obstétrica de la Mulier sapiens: I Período de la embriogénesis y riesgo de teratogénesis; II de la prematuridad al postdatismo: del parto eutócico al cerclaje uterino; III La noche y el parto: mayor incidencia nocturna del parto (facilitación fisiológica, y diurna de la cesárea (opción del obstetra; IV La luna y el parto (resultado no conclusivo; V guardia nocturna en la Anestesia Obstétrica: contingencia profesional de más riesgos; VI Tiempos de la cesárea: retirada fetal: tiempo UD (uterotomy - delivery, el más corto posible; corrección eficaz de la hipotensión arterial y valorización del tiempo de ayuno preanestésico; VII Variación circadiana de la distocia: dolor; contracción uterina; pérdida sanguínea; hipertensión arterial sistémica (HAS; riesgo de alergia y asma brónquica. En la fase nocturna, existe una mayor intensidad de contracción y más riesgos de hemorragia, de alergia y de asma. En contraposición, hay una falta de variación circadiana de la HAS en la eclampsia; VIII Cronofarmacología obstétrica: anestésicos locales, analgésicos, hipnóticos, anestésicos generales y bloqueadores neuromusculares. La cronergia explica el pico analgésico matinal de los opioides, el vespertino de los anestésicos locales y el nocturno de los anestésicos generales inhalatorios. CONCLUSIONES: El abordaje cronobiológico de la atención anestésica al parto en la maternidad, enfatiza la importancia obstétrica del ritmo circadiano en la humanización y seguridad del parto.BACKGROUND AND OBJECTIVES: Temporal cycles (dark

  13. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  14. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  15. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  16. Anticorrosion characteristics of a Zn-primer coating in a ballast tank under various chloride concentrations

    International Nuclear Information System (INIS)

    At an open-circuit potential, the anodic polarization curves had very similar values, and no significant differences were observed among the conditions. In the cathodic polarization curves, total residual chloride (TRC) reacted with the Zn-primer coating and created a film that had anticorrosion properties. Therefore, the anticorrosion property improved. With an increase in applied potential in the potentiostatic experiment, the observed surface corrosion occurred due to the dissolution reaction. From Tafel analysis, the corrosion current density had the highest value in natural seawater and the lowest value in the 2 ppm solution. Generally, metals corrode faster with increasing TRC concentration, but with the formation of Zn(OH)2, which has anticorrosion properties, the corrosion resistance of a Zn-primer-coated specimen in seawater can be improved.

  17. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing

    Science.gov (United States)

    Frank, Daniel N

    2009-01-01

    Background Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. Results Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. Conclusion Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at . PMID:19874596

  18. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing

    Directory of Open Access Journals (Sweden)

    Frank Daniel N

    2009-10-01

    Full Text Available Abstract Background Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. Results Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. Conclusion Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at http://www.phyloware.com.

  19. Consideraciones básicas para el manejo del dolor en odontopediatría en la práctica diaria del cirujano dentista general y su relación de interconsulta con el anestesiólogo

    Directory of Open Access Journals (Sweden)

    R. Argueta López

    2015-08-01

    Full Text Available El dolor es un fenómeno complejo y multidimensional mediado por procesos psicoquímicos en el sistema nervioso periférico y central, cuya percepción puede modificarse considerablemente a través de una serie de mecanismos que incluyen, entre otros, fármacos, estímulos ambientales, procesos cognoscitivos y emocionales, así como condiciones sociales y culturales. La gran parte de los agentes farmacológicos que se utiliza en odontología tiene por objeto controlar la angustia y el dolor. En términos generales, la eliminación de la sensación de dolor en el ámbito dental requiere el bloqueo de la percepción del dolor por vía periférica, mediante anestesia local o por vía central, con anestesia general.

  20. Diseño, implementación y evaluación de una propuesta de intervención en alfabetización académica en primer año de Pedagogía General Básica en la sede Villarrica de la UC (Design, implementation and assessment of an academic literacy intervention proposal in first-year of the elementary education program at UC, Villarrica campus

    Directory of Open Access Journals (Sweden)

    María Constanza Errázuriz Cruz

    2012-06-01

    Full Text Available El presente trabajo corresponde a un informe de investigación que busca mejorar los niveles de comprensión y producción de textos en los estudiantes de primer año de Pedagogía General Básica (PGB de la Sede Villarrica de la Pontificia Universidad Católica de Chile (UC. Para esto se llevó a cabo una investigación-acción en la que se intervino la realidad universitaria mediante talleres con alumnos y docentes de primer año. La comprensión de texto es entendida desde una visión cognitivo-constructivista, como un proceso dinámico de construcción de representaciones coherentes e inferencias a múltiples niveles de texto y contexto, dentro de una capacidad limitada de memoria de trabajo. Se incluye también la concepción de estrategia, considerada en la ejecución de la intervención. La producción de textos es vista desde un enfoque constructivo, que propone la representación de construcciones mentales en un texto escrito por medio de los procesos de planificación, traducción, escritura y revisión; adaptado a una situación de comunicación académica. La concepción de alfabetización académica es tomada de Carlino (2005: 13 y se refiere al "conjunto de nociones y estrategias necesarias para participar en la cultura discursiva de las disciplinas…". Se revisan también algunas nociones de tipología textual, especialmente referidas al texto argumentativo, cuyo dominio es un requisito importante en la educación superior actualmente. La metodología corresponde a un modelo de investigación-acción, basado en talleres temáticos y actividades que se implementaron con estudiantes de primer año y, también, talleres periódicos sobre el desarrollo y evaluación de la comprensión lectora y la producción de texto para los docentes de primer año. Para la evaluación de la comprensión y producción de textos se usaron instrumentos propios del sistema escolar chileno. Específicamente, el texto Comprehensive Assessment of Reading

  1. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  2. PRIMER FOR FINANCIAL ANALYSIS OF POLLUTION PREVENTION PROJECTS

    Science.gov (United States)

    This primer will serve as a basic guide to pollution prevention investment -- specifically, the preparation of financial comparisons and justifications for such expenditures. he emphasis is on the basic analytical techniques needed to justify pollution prevention investments. onc...

  3. Loop-Mediated Amplification Accelerated by Stem Primers

    OpenAIRE

    Laurence Tisi; Guy Kiddle; Olga Gandelman; Rebecca Jackson

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites ...

  4. Anestesia em paciente obstétrica portadora de anemia falciforme e traço talassêmico após plasmaféresis: relato de caso Anesthesia in obstetric patient with sickle cell anemia and thalassemic trait after plasmapheresis: case report

    Directory of Open Access Journals (Sweden)

    Eduardo Barbosa Leão

    2005-06-01

    -indicam a anestesia regional; além disto, a plasmaféresis potencialmente depleta os estoques de colinesterases plasmáticas, o que interfere na anestesia. Entretanto, o arsenal medicamentoso disponível permitiu o manuseio seguro desta situação.JUSTIFICATIVA Y OBJETIVOS: La plasmaféresis es una técnica de tratamiento de elección para pacientes con anemia hemolítica grave. Una de sus consecuencias es la depleción de colinesterasa plasmática, lo que interfiere en la metabolización de algunos bloqueadores neuromusculares de uso corriente en la práctica anestesiológica. RELATO DEL CASO: Paciente con 26 años, estado físico ASA IV, gestación de 30 semanas y 3 días, portadora de anemia falciforme, trazo talasémico y alo-inmunización para antígenos de alta frecuencia. Presentó crisis de falcización, siendo transfundida con derivado sanguíneo incompatible. Evolucionó con hemólisis maciza, siendo admitida con hemoglobina de 3 g/dL y hematócrito del 10%, ictericia intensa, taquicardia, apatía y con pérdida de color. En la evaluación hematológica se concluyó ser una situación de inexistencia de sangre compatible para transfusión. Fue tratada con corticoterapia, inmunoglobulinas y plasmaféresis. En el segundo día de internación, evolucionó con insuficiencia renal aguda y edema pulmonar agudo, empeoramiento del estado general e inestabilidad hemodinámica. Indicada la resolución de la gestación como resultado del cuadro clínico de la paciente y del sufrimiento fetal agudo que se sobrepuso. La paciente fue admitida en la sala de operaciones consciente, disneica, pálida, ictérica, SpO2 del 91% en aire ambiente, frecuencia cardiaca de 110 lpm y presión arterial de 110 x 70 mmHg, en uso de dopamina (1 µg.kg-1 min-1 y dobutamina (10 µg.kg-1.min-1. Se optó por anestesia general balanceada, con alfentanil (2,5 mg, etomidato (14 mg y atracúrio (35 mg e isoflurano. No se observó interocurrencias anestésico- quirúrgicas. Al final, la paciente fue

  5. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  6. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  7. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Rearden, Bradley T [ORNL; Mueller, Don [ORNL; Bowman, Stephen M [ORNL; Busch, Robert D. [University of New Mexico, Albuquerque; Emerson, Scott [University of New Mexico, Albuquerque

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  8. Prostate innervation and local anesthesia in prostate procedures Inervação prostática e anestesia local em procedimentos prostáticos

    Directory of Open Access Journals (Sweden)

    Alexandre Oliveira Rodrigues

    2002-01-01

    Full Text Available The nerve supply of the human prostate is very abundant, and knowledge of the anatomy contributes to successful administration of local anesthesia. However, the exact anatomy of extrinsic neuronal cell bodies of the autonomic and sensory innervation of the prostate is not clear, except in other animals. Branches of pelvic ganglia composed of pelvic (parasympathetic and hypogastric (sympathetic nerves innervate the prostate. The autonomic nervous system plays an important role in the growth, maturation, and secretory function of this gland. Prostate procedures under local anesthesia, such as transurethral prostatic resections or transrectal ultrasound-guided prostatic biopsy, are safe, simple, and effective. Local anesthesia can be feasible for many special conditions including uncomplicated prostate surgery and may be particularly useful for the high-risk group of patients for whom inhalation or spinal anesthesia is inadvisable.A prostáta, uma das glândulas sexuais acessórias masculinas, possui inervação muito rica. A anatomia detalhada dos corpos neuronais extrínsecos responsáveis pela inervação autonômica e sensorial da próstata não está totalmente esclarecida, exceto em animais. A próstata é inervada pelos nervos pélvico (parassimpático e hipogástrico (simpático, ramos dos gânglios nervosos pélvicos. O sistema nervoso autonômico possui importante papel no crescimento, maturação e na função secretora desta glândula. Alguns procedimentos prostáticos, como resecção transuretral ou biópsia transretal guiada por ultra-sonografia, são simples, eficazes e seguros com o uso de anestesia local. Esta opção pode ser factível frente à várias condições especiais, como cirurgias prostáticas simples, sendo particularmente útil no grupo de pacientes de alto risco cirúrgico, onde a anestesia inalatória ou espinhal não é aconselhável.

  9. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  10. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  11. Rehabilitación oral de un paciente pediátrico con síndrome de Smith-Lemli-Opitz bajo anestesia general ambulatoria

    OpenAIRE

    Magda Dorado Castro; Carlos Alberto Fregoso Guevara; Ricardo Manuel Sánchez Rubio Carrillo; Miguel Alberto Zamudio Gómez

    2011-01-01

    El síndrome de Smith-Lemli-Opitz es una rara enfermedad hereditaria de transmisión autosómica recesiva. Se caracteriza por presentar hipocolesterolemia como consecuencia de una mutación del gen 7-deshidrocolesterol reductasa (7DHCR), lo que produce retraso mental, retardo en el crecimiento, microcefalia, micrognatismo y otras anomalías neurológicas sistémicas y físicas. Se presenta el caso de un paciente de tres años y nueve meses afectado por este síndrome, quien acudió a la clínica de odont...

  12. Sigmund Freud (1856-1939) e Karl Köller (1857-1944) e a descoberta da anestesia local Sigmund Freud (1856-1939) y Karl Köller (1857-1944) y el Descubrimiento de la anestesia local Sigmund Freud (1856-1939) and Karl Köller (1857-1944) and the Discovery of local anesthesia

    OpenAIRE

    Almiro dos Reis Jr

    2009-01-01

    JUSTIFICATVA E OBJETIVOS: O entendimento por vezes admitido de que Sigmund Freud teve a intuição de utilizar a cocaína como anestésico local para intervenções cirúrgicas, ou mesmo de que ele tenha tido algum papel na descoberta da anestesia local não é verídico. Os objetivos das pesquisas de Freud eram outros e o verdadeiro realizador da descoberta foi Karl Köller, sobre o que há argumentos irrefutáveis. Diante desses fatos, tem importância histórica o conhecimento correto da questão. CONTEÚD...

  13. Manobra de recrutamento alveolar em anestesia: como, quando e por que utilizá-la Maniobra de reclutamiento alveolar en anestesia: como, cuando y por qué utilizarla Alveolar recruitment maneuver in anesthetic practice: how, when and why it may be useful

    OpenAIRE

    Luciana Oliveira Gonçalves; Domingos Dias Cicarelli

    2005-01-01

    JUSTIFICATIVA E OBJETIVOS: A manobra de recrutamento alveolar (MRA) consiste na reabertura de áreas pulmonares colapsadas através do aumento da pressão inspiratória na via aérea, utilizada principalmente em pacientes com Síndrome do Desconforto Respiratório Agudo. O objetivo deste estudo foi avaliar a aplicação da MRA em anestesia, como realizá-la e em quais situações clínicas. MÉTODO: Revisão de literatura através da base de dados MedLine, no período compreendido entre 1993 e 2004. RESULTADO...

  14. Dexmedetomidina associada a propofol em sedação durante anestesia local para cirurgia plástica Dexmedetomidina asociada a propofol en sedación durante anestesia local para cirugía plástica Dexmedetomidine/propofol association for plastic surgery sedation during local anesthesia

    Directory of Open Access Journals (Sweden)

    José Roberto Nociti

    2003-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A dexmedetomidina é um novo agonista alfa2-adrenérgico com propriedades potencialmente úteis em anestesia. Este estudo comparativo tem por finalidade observar os efeitos da dexmedetomidina sobre o consumo de propofol e a evolução dos parâmetros cardiovasculares e respiratórios, quando incluída em técnica de sedação durante anestesia local em cirurgia plástica. MÉTODO: Participaram do estudo 40 pacientes do sexo feminino com idades entre 16 e 60 anos, estado físico ASA I ou II, submetidas a cirurgias plásticas eletivas sob anestesia local. Foram distribuídas aleatoriamente em dois grupos de vinte: C (controle e D (dexmedetomidina. Em ambos, a sedação foi obtida com propofol na dose em bolus inicial de 1 mg.kg-1 seguida de infusão contínua em velocidade ajustada para se obter grau de sedação consciente. No grupo D, as pacientes receberam infusão venosa contínua de dexmedetomidina à velocidade de 0,01 µg.kg-1.min-1, concomitante com a de propofol. Foram avaliados: efeito da dexmedetomidina sobre o consumo de propofol; variação dos parâmetros cardiovasculares (PAS, PAD, PAM, FC e respiratórios (SpO2, P ET CO2; qualidade do controle do sangramento per-operatório e características da recuperação pós-anestésica. RESULTADOS: A velocidade média de infusão de propofol foi menor no grupo D (35,2 ± 5,3 µg.kg-1.min-1 do que no grupo C (72,6 ± 8,5 µg.kg-1.min-1. Os valores médios de PAS, PAD e PAM decresceram em relação ao inicial, a partir dos 30 minutos, no grupo D, mantendo-se a seguir estáveis até o final; no grupo C, aumentaram. A FC manteve-se estável no grupo D e aumentou a partir dos 30 minutos no grupo C. O tempo médio para obedecer ao comando de "abrir os olhos" foi menor no grupo D (6,3 ± 2,5 min em relação ao C (8,9 ± 2,7 min. O controle do sangramento per-operatório foi superior no grupo D em relação ao C. CONCLUSÕES: O emprego da dexmedetomidina associada ao

  15. Anestesia em paciente portadora de síndrome de Mckusick-Kaufman: relato de caso Anestesia en paciente portadora de síndrome de Mckusick-Kaufman: relato de caso Anesthesia in Mckusick-Kaufman syndrome patient: case report

    Directory of Open Access Journals (Sweden)

    Adriano Bechara de Souza Hobaika

    2004-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A síndrome de Mckusick-Kaufman é uma doença rara, caracterizada tipicamente por hidrometrocolpos, polidactilia e defeitos cardíacos congênitos. Pacientes portadores desta doença podem ser submetidos a diversos procedimentos cirúrgicos durante a sua vida e o anestesiologista deve estar preparado para possíveis alterações. O objetivo deste artigo é relatar a conduta anestésica adotada em uma paciente portadora desta síndrome. RELATO DO CASO: Paciente do sexo feminino de 11 anos, 37 kg, portadora da síndrome de Mckusick-Kaufman, insuficiência renal crônica, encefalopatia hipertensiva e asma grave submetida à retirada de cateter peritoneal infectado e confecção de fístula arteriovenosa. História pregressa de intubação prolongada. A anestesia foi induzida com alfentanil (1 mg, propofol (50 mg e atracúrio (25 mg e mantida com sevoflurano (2% a 4% e doses fracionadas de alfentanil. A traquéia foi intubada sem complicações e a extubação foi realizada na sala de cirurgia após o retorno satisfatório da função neuromuscular. CONCLUSÕES: Apesar de a síndrome de Mckusick-Kaufman tratar-se de uma associação variável de defeitos congênitos, alguns cuidados anestésicos comuns podem ser definidos. Este caso apresentou fatores complicadores da anestesia e a indução com propofol e alfentanil e a manutenção com sevoflurano proporcionaram à paciente uma anestesia com mínimas repercussões ventilatórias e hemodinâmicas.JUSTIFICATIVA Y OBJETIVOS: La síndrome de Mckusick-kaufman es una dolencia rara, caracterizada típicamente por hidrometrocolpos, polidactilia y defectos cardiacos congénitos. Pacientes portadores de esta enfermedad pueden ser sometidos a varios procedimientos cirúrgicos durante su vida y el anestesiologista debe estar preparado para posibles alteraciones. El objetivo de este artículo es relatar la conducta anestésica adoptada en una paciente portadora de este s

  16. Anestesia regional e trombocitopenia não pré-eclâmptica; hora de repensar o nível seguro de plaquetas Anestesia regional y trombocitopenia no preclámptica; es hora de pensar de nuevo sobre el nivel seguro de plaquetas Regional anesthesia and non-preeclamptic thrombocytopenia: time to re-think the safe platelet count

    Directory of Open Access Journals (Sweden)

    Motoshi Tanaka

    2009-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Apesar de a anestesia regional ser amplamente utilizada no controle da dor em obstetrícia, seu uso pode não ser apropriado nas pacientes com trombocitopenia por causa do risco de hematoma no neuroeixo. Não existem fortes evidências sugerindo número mínimo de plaquetas necessário para garantir a segurança na realização da anestesia regional. O objetivo deste estudo foi rever a segurança da anestesia regional em pacientes com trombocitopenia não pré-eclâmptica na instituição durante período de cinco anos. MÉTODO: Foi realizada revisão retrospectiva dos prontuários médicos de todas as pacientes obstétricas não pré-eclâmpticas cujo parto foi realizado na instituição entre abril de 2001 e março de 2006 e que apresentaram contagem de plaquetas JUSTIFICATIVA Y OBJETIVOS: A pesar de que la anestesia regional esté siendo muy utilizada en el control del dolor en obstetricia, su uso puede no ser muy apropiado en las pacientes con trombocitopenia, debido al riesgo de hematoma en el neuro eje. No existen fuertes evidencias que sugieran un número mínimo de plaquetas necesario para garantizar la seguridad en la realización de la anestesia regional. El objetivo de este estudio fue analizar la seguridad de la anestesia regional en pacientes con trombocitopenia no preeclámptica en la institución durante un período de cinco años. MÉTODO: Fue realizada revisión retrospectiva de las historias clínicas médicas de todas las pacientes obstétricas no preeclámpticas cuyo parto fue realizado en la institución entre abril de 2001 y marzo de 2006 y que presentaron BACKGROUND AND OBJECTIVES: Although regional anesthesia is widely used for pain control in obstetrics, it may not be appropriate for patients with thrombocytopenia due to the risk of neuraxial hematoma. There is no strong evidence to suggest the minimum platelet count that is necessary to ensure the safe practice of regional anesthesia. The

  17. Drafting International Commercial Agreements - a Primer

    OpenAIRE

    Wautelet, Patrick

    2011-01-01

    This presentation is used as a basis for a course on drafting international commercial agreements. It is complemented by two cases studies. The course is mainly addressed to non lawyers and is hence rather practice than law oriented. The course is not linked to one jurisdiction or one type of contract in particular, but attempts to address general issues related to international commercial agreements.

  18. A Brief Primer on Self-Esteem

    Science.gov (United States)

    Robins, Richard W.; Trzesniewski, Kali H.; Donnellan, M. Brent

    2012-01-01

    Since the construct of "self-esteem" was first introduced over 100 years ago, a wealth of knowledge has been accumulated. Several conclusions about the nature of self-esteem can be reached that provide a foundation for future practice and research. In general, research shows that high self-esteem is associated with the behaviors, goals, and coping…

  19. A Primer on Waste Water Treatment.

    Science.gov (United States)

    Department of the Interior, Washington, DC. Federal Water Pollution Control Administration.

    This information pamphlet is for teachers, students, or the general public concerned with the types of waste water treatment systems, the need for further treatment, and advanced methods of treating wastes. Present day pollution control methods utilizing primary and secondary waste treatment plants, lagoons, and septic tanks are described,…

  20. Nuevos procedimientos en anestesia local en odontología: el sistema Injex® New proceedings in dental anesthesia: the Injex® system

    Directory of Open Access Journals (Sweden)

    C Fernández-Canedo

    2004-06-01

    Full Text Available Una de las circunstancias que han contribuido al desarrollo de la odontología en los últimos tiempos ha sido la mejora en las técnicas anestésicas. Sin embargo, el uso de la aguja en la mayor parte de los sistemas de anestesia dental, a pesar de ser un sistema casi indoloro, constituye un problema por la gran cantidad de pacientes que presentan fobias a la misma. Este hecho empeora cuando las poblaciones que han de ser tratadas son niños o pacientes especiales. En esta revisión bibliográfica se exponen las ventajas e inconvenientes de las técnicas anestésicas sin aguja, y se describe un nuevo sistema aparecido en el mercado español, el sistema Injex®.In the recent years, the improvement of anesthesics methods have been one of the circunstances who had contributed to the development of Odontology. In the other hand, sometimes is an important problem the employrnent of the needle in the most of anethesisc systems, because many patients present fobic situations when the needle is employed. This situation is worst when children or handicapped patients have to be treated. In this review, the advantages and mistakes of dental anesthesia without needle is exposed, and a new method developed, called Injex® is presented.

  1. Anestesia para tratamento intraparto extra-útero em feto com diagnóstico pré-natal de higroma na região cervical: relato de caso Anestesia para tratamiento intraparto extraútero en feto con diagnóstico prenatal de higroma en la región cervical: relato de caso Anesthesia for ex utero intrapartum treatment of fetus with prenatal diagnosis of cervical hygroma: case report

    Directory of Open Access Journals (Sweden)

    Angélica de Fátima de Assunção Braga

    2006-06-01

    ós-operatória. CONCLUSÕES: As principais recomendações para a realização do EXIT são segurança materno-fetal, relaxamento uterino para manutenção do seu volume, da circulação útero-placentária e imobilidade fetal para facilitar o manuseio das vias aéreas.JUSTIFICATIVA Y OBJETIVOS: El tratamiento intraparto extraútero (EXIT constituye un procedimiento realizado durante la cesária, con preservación de la circulación feto-placentaria, que permite el manejo seguro de la vía aérea del feto, con riesgo de obstrucción de las vías aéreas. El objetivo de este relato fue el de presentar un caso de anestesia para EXIT, en feto con higroma cístico en la región cervical. RELATO DEL CASO: Paciente con 22 años, 37 semanas de gestación, sin antecedentes anestésicos, estado físico ASA I, sometida a EXIT para manejo de vía aérea e intubación traqueal en feto con riesgo para obstrucción de vías aéreas. El procedimiento se realizó bajo anestesia general asociada a peridural continua. En el preoperatorio fueron utilizados metoclopramida (10 mg y ranitidina (50 mg, por vía venosa. En el espacio peridural se administró bupivacaína a 0,25% con adrenalina (30 mg asociada a fentanil (100 µg, seguida de la introducción de catéter cefálico, para analgesia postoperatoria. El útero fue desplazado para la izquierda. La inducción anestésica se hizo en secuencia rápida, con fentanil, propofol y rocuronio y el mantenimiento con isoflurano en 2,5% a 3%, en O2 y N2O (50%. Después de la histerotomía, se procedió a la liberación parcial del feto, asegurando la circulación útero placentaria, siguiendo las maniobras de laringoscopia e intubación traqueal fetal. A continuación se realizó la liberación total del feto, con pinzamiento del cordón umbilical, administración de ocitocina (20 UI en infusión venosa continua seguida de metil-ergonovina (0,2 mg por vía venosa. Durante el procedimiento, la presión arterial sistólica materna se mantuvo por encima de 100 mm

  2. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  3. Relativistic astrophysics and cosmology a primer

    CERN Document Server

    Hoyng, Peter

    2006-01-01

    This book offers a succinct and self-contained treatment of general relativity and its application to neutron stars, black holes, gravitational waves and cosmology, at an intermediate level. The required mathematical concepts are introduced informally, following geometrical intuition as much as possible. The approach is theoretical, but there is ample discussion of observational aspects and instrumental issues where appropriate. Topical issues such as the Gravity Probe B mission, and the physics of interferometer detectors of gravitational waves and the angular power spectrum of the Cosmic Microwave Background are included. The book is written for advanced undergraduates and beginning graduate students in (astro)physics. The reader is assumed to be familiar with linear algebra and analysis, ordinary differential equations, special relativity, and basic thermal physics, but prior knowledge of differential geometry and general relativity is not required. Containing 140 exercises with extensive hints for their s...

  4. A Pharmacological Primer of Biased Agonism

    OpenAIRE

    Andresen1, Bradley T.

    2011-01-01

    Biased agonism is one of the fastest growing topics in G protein-coupled receptor pharmacology; moreover, biased agonists are used in the clinic today: carvedilol (Coreg®) is a biased agonist of beta-adrenergic receptors. However, there is a general lack of understanding of biased agonism when compared to traditional pharmacological terminology. Therefore, this review is designed to provide a basic introduction to classical pharmacology as well as G protein-coupled receptor signal transductio...

  5. A primer on the MFA maze

    OpenAIRE

    Faini, Riccardo; de Melo, Jaime; Takacs, Wendy

    1993-01-01

    It is generally agreed that the arrangements that have regulated trade in textiles and clothing have slowed the natural shift in comparative advantage from industrial countries to developing countries. But there is quite a bit of disagreement about how restrictive the Multi-Fibre Agreements (MFA) are. The authors address the potential sources of allocative inefficiency occasioned by the MFA and search for evidence that the MFA has indeed led to such inefficiency. In a theoretical section, the...

  6. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  7. El anarquismo moderado del primer Savater

    OpenAIRE

    Nogueroles, Marta

    2012-01-01

    In this work we will approach the beginning of the intellectual career of Fernando Savater, a still unknown stage by many of the followers of his work, and is characterized by an anarchist posture and a libertarian conception of man and society. This stage begins around 1976 and extends roughly until 1981, year that Spain suffers the attempted of a revolt (coup d'État), led by General Tejero. Influenced by this historical circumstance, Savater leaves the anarchism-nihilism, adopted in his you...

  8. Pensamiento y lenguaje en el primer Wittgenstein

    OpenAIRE

    Defez i Martín, Antoni

    2000-01-01

    En este artículo se analiza el problema de la intencionalidad y la normatividad del lenguaje en el Tractatus da Wittgenstein. La conclusión general alcanzada es que no es posible, sin cometer graves errores hermenéuticos, pretender una interpretación psicológica del concepto de 'pensamiento' como hecho mental. Por el contrario, para Wittgenstein el lenguaje o, mejor, la acción lingüística de los seres humanos ya es en sí misma una acción expresiva y simbólica. En concreto: la intencionalidad ...

  9. Anestesia en la transposición de los grandes vasos ANESTHESIA IN THE TRANSPOSITION OF THE GREAT VESSELS

    Directory of Open Access Journals (Sweden)

    Lincoln de la Parte Pérez

    2005-03-01

    Full Text Available La transposición de los grandes vasos es una cardiopatía compleja que se acompaña de una elevada mortalidad. Se conoce que el 45 % de los pacientes fallece durante el primer mes de vida y alrededor del 90 % antes del año. Las principales causas de la muerte son la hipoxia y la insuficiencia cardíaca. El desarrollo de las especialidades que trabajan en cirugía cardiovascular pediátrica ha permitido aumentar la supervivencia de estos niños, especialmente con el uso de prostaglandinas para mantener el ductus permeable, la técnica de Raskind-Miller ( septostomía de balón y una tendencia cada vez mayor a la corrección anatómica temprana (operación de Jatene en lugar de los clásicos procedimientos paliativos y las técnicas de corrección fisiológica de Senning y Mustard . Se presenta una revisión bibliográfica sobre los factores a tener en cuenta en el manejo anestésico de estos pacientes.The transposition of the great vessels is a complex heart disease accompanied of a high mortality. It is known that 45 % of the patients die during the first month of life and at about 90 % do it before being one year old. The main causes of death are hypoxia and heart failure. The development of the specialties working in pediatric cardiovascular surgery has allowed to increase the survival of these children, specially with the use of prostaglandins to maintain the ductus permeable, the Raskind-Miller's technique (balloon septostomy, and an increasing trend towards an early anatomical correction (Jatene's operation to replace the classical palliative procedures and Senning and Mustartd's techniques of physiological correction. A bibliographic review of the factors to be taken into account in the anesthetic management of these patients is presented.

  10. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer, but not...... with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather...

  11. Anestesia para amigdalectomia em criança portadora de síndrome de Klippel-Feil associada à síndrome de down: Relato de caso Anestesia para amigdalectomía en niño portador de síndrome de Klippel-Feil asociado al síndrome de down: Relato de caso Anesthesia for tonsillectomy in a child with Klippel-Feil syndrome associated with down syndrome: Case report

    Directory of Open Access Journals (Sweden)

    Magda Lourenço Fernandes

    2010-06-01

    discutir los cuidados para el abordaje de la vía aérea y los riesgos de la manipulación cervical en un paciente portador de síndrome de SKF y SD, sometido a la amigdalectomía. RELATO DEL CASO: Niño de cinco años, con diagnóstico previo de SKF, SD e inestabilidad de la articulación atlantocervical, que fue sometido a la amigdalectomía bajo anestesia general balanceada. La ventilación bajo máscara y la intubación traqueal fueron realizadas con la cabeza en posición neutra. La perfecta visualización de la epiglotis y de las cuerdas vocales, permitió la intubación traqueal con laringoscopia convencional. La cirugía también se hizo sin la extensión cervical, y transcurrió sin intercurrencias. CONCLUSIONES: Aunque el acceso a la vía aérea pueda ser fácil, las alteraciones anatómicas nos avisan que existe una vía aérea difícil en pacientes portadores de SKF y SD. Los cuidados diferenciados y los recursos adecuados son indispensables para evitar las complicaciones durante el abordaje de la vía aérea. La manipulación cervical debe ser evitada en presencia de una inestabilidad de la articulación atlanto-occipital, por el riesgo de lesión neurológica.BACKGROUND AND OBJECTIVES: Craniofacial abnormalities present in Klippel-Feil Syndrome (KFS and Down Syndrome (DS can hinder access to the airways. Oropharyngeal surgeries also require special attention with the airways. The association of both syndromes in a patient scheduled for tonsillectomy is a rare condition that imposes challenges to the anesthetic-surgical treatment. The objective of this report was to discuss the approach of the airways and the risks of cervical manipulation in a patient with KFS and DS undergoing tonsillectomy. CASE REPORT: This is a 5 years old child with diagnosis of KFS and DS and instability of the atlantoaxial joint who underwent tonsillectomy under general balanced anesthesia. Ventilation under face mask and tracheal intubation were done with the neck in the neutral

  12. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    OpenAIRE

    Caty Martínez B; Luz Botero A; Oscar Vergara G

    2009-01-01

    Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC) y primer intervalo de parto (PIDP) en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de vari...

  13. Criminal Justice in the United States: A Primer

    OpenAIRE

    James B. Jacobs

    2007-01-01

    In this primer on the U.S. criminal justice system, James B. Jacobs, Warren E. Burger Professor of Law at New York University (NYU) and Director of the Center for Research in Crime and Justice at the NYU School of Law, explains the structure and basic jurisprudence of U.S. criminal law and criminal procedure.

  14. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  15. Detecting Lesch-Nyhan syndrome by solid phase primer extension

    Energy Technology Data Exchange (ETDEWEB)

    Shumaker, J.M.; Caskey, C.T. [Baylor College of Medicine, Houston, TX (United States); Metspalu, A.

    1994-09-01

    A mutation detection method based upon the wild type human HPRT sequence is presented for identification of Lesch Nyhan syndrome. The technique consists of performing a biotinlyated PCR amplification of the region of interest, followed by isolation and purification of single stranded template using magnetic separation. Allele-specific primers are annealed adjacent to the potential mutation site on the template. A terminal fluorescent deoxynucleotide addition is performed with a DNA template-dependent polymerase to distinguish between the mutant and wild-type sequence. The products are purified from unincorporated ddNTPs, eluted and finally analyzed on an ABI 373 to identify the mutation. The length of an extension primer is used as a position signature for mutations. The fidelity of nucleotide incorporation provides an excellent signal-to-noise ratio for the detection of nine HPRT mutations within eight cell lines. This method should detect all types of mutations except for repeated sequences that are longer than the primers. Moreover, the method is being extended to a solid support assay, whereby the extension primers are attached to a two-dimensional glass surface. Following extension, the solid support is analyzed for radioactive incorporation. We have shown the sequence determination of a five base region of a wild-type sequence and two different HPRT mutations. As more dense oligonucleotide arrays are produced, this method could be extended to sequence the complete coding region of HPRT.

  16. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  17. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  18. A primer for Chiral Perturbative Theory

    International Nuclear Information System (INIS)

    Chiral Perturbation Theory, as effective field theory, is a commonly accepted and well established working tool, approximating quantum chromodynamics at energies well below typical hadron masses. This volume, based on a number of lectures and supplemented with additional material, provides a pedagogical introduction for graduate students and newcomers entering the field from related areas of nuclear and particle physics. Starting with the the Lagrangian of the strong interactions and general symmetry principles, the basic concepts of Chiral Perturbation Theory in the mesonic and baryonic sectors are developed. The application of these concepts is then illustrated with a number of examples. A large number of exercises (81, with complete solutions) are included to familiarize the reader with helpful calculational techniques. (orig.)

  19. A primer for Chiral Perturbative Theory

    Energy Technology Data Exchange (ETDEWEB)

    Scherer, Stefan [Mainz Univ. (Germany). Inst. fuer Kernphysik; Schindler, Matthias R. [South Carolina Univ., Columbia, SC (United States). Dept. of Physics; George Washington Univ., Washington, DC (United States). Dept. of Physics

    2012-07-01

    Chiral Perturbation Theory, as effective field theory, is a commonly accepted and well established working tool, approximating quantum chromodynamics at energies well below typical hadron masses. This volume, based on a number of lectures and supplemented with additional material, provides a pedagogical introduction for graduate students and newcomers entering the field from related areas of nuclear and particle physics. Starting with the the Lagrangian of the strong interactions and general symmetry principles, the basic concepts of Chiral Perturbation Theory in the mesonic and baryonic sectors are developed. The application of these concepts is then illustrated with a number of examples. A large number of exercises (81, with complete solutions) are included to familiarize the reader with helpful calculational techniques. (orig.)

  20. A primer for chiral perturbation theory

    CERN Document Server

    Scherer, Stefan

    2012-01-01

    Chiral Perturbation Theory, as effective field theory, is a commonly accepted and well established working tool, approximating quantum chromodynamics at energies well below typical hadron masses. This volume, based on a number of lectures and supplemented with additional material, provides a pedagogical introduction for graduate students and newcomers entering the field from related areas of nuclear and particle physics. Starting with the the Lagrangian of the strong interactions and general symmetry principles, the basic concepts of Chiral Perturbation Theory in the mesonic and baryonic sectors are developed. The application of these concepts is then illustrated with a number of examples. A large number of exercises (81, with complete solutions) are included to familiarize the reader with helpful calculational techniques.

  1. Anestesia para correção de tetralogia de Fallot em paciente adulto: relato de caso Anestesia para corrección de tetralogía de Fallot en paciente adulto: relato de caso Anesthesia for repair of tetralogy of Fallot in an adult patient: case report

    Directory of Open Access Journals (Sweden)

    Michelle Nacur Lorentz

    2007-10-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A cardiopatia congênita é um dos problemas mais comuns ao nascimento acometendo 1 a 1,5 em cada 10.000 nascidos vivos. Atualmente mais de 85% das crianças com cardiopatias congênitas chegam à idade adulta em parte devido aos novos tratamentos, mas sobretudo em virtude da tendência de se realizarem correções cirúrgicas mais precoces. Por outro lado, é raro encontrar um adulto com tetralogia de Fallot (T4F não-corrigida. O objetivo do presente relato foi descrever um caso de T4F submetido à correção cirúrgica na idade adulta. RELATO DO CASO: Paciente de 45 anos, sexo feminino, portadora de T4F internada para realização de correção cirúrgica. Ao exame físico apresentava-se cianótica nas extremidades e com saturação de oxigênio (SpO2 de 73%. Foi realizada anestesia geral balanceada com etomidato, fentanil, pancurônio e sevoflurano. A correção cirúrgica realizada foi o fechamento da comunicação ventricular e interposição de conduto valvado pulmonar n° 24, posteriormente foi fenestrado o septo ventricular. À saída de circulação extracorpórea (CEC foram administradas milrinona e dopamina. A SpO2 ao fim da operação era 97%. Após o procedimento cirúrgico a paciente foi encaminhada ao CTI, onde permaneceu por 72 horas e teve alta hospitalar no oitavo dia pós-operatório em boas condições. CONCLUSÕES: O caso ilustrou sucesso de intervenção cirúrgica em paciente de alto risco com grande interação entre cirurgião, anestesista e terapia intensiva.JUSIFICATIVA Y OBJETIVOS: El síndrome de la infusión del propofol ha sido descrito como un síndrome raro y frecuentemente fatal que ocurre después de la infusión prolongada de ese fármaco. Puede resultar en acidez metabólica grave, rabdomiólisis, colapso cardiovascular y deceso. El objetivo de este artículo fue mostrar aspectos relacionados al síndrome de la infusión del propofol a través de la revisión de la literatura

  2. Agriculture emergencies: a primer for first responders.

    Science.gov (United States)

    Gilpen, Johnnie L; Carabin, Hélène; Regens, James L; Burden, Ray W

    2009-06-01

    Over the past several years, the primary focus of emergency preparedness has been on terrorism, and how a CBRNE event would directly affect human health. Limited emphasis has been placed on the direct (eg, zoonotic infections) and indirect (eg, mental health, financial loss) effects that an agricultural emergency event can have on human health outcomes, and how they relate to emergency preparedness. We critically reviewed the resources and information readily accessible to our target audience, emergency responders; the resources included military and civilian books, personal communications, internet sites, GAO reports, and peer-reviewed journals. Among more than 2,000 bioterrorism-related articles, we found 51 that addressed either agroterrorism and/or veterinary public health: 2 cross-sectional studies, 28 review papers, and 21 commentary papers. In order to properly respond to future agriculture emergencies, emergency response professionals need to understand the nature and implications of the event as well as their roles and responsibilities, but the availability of educational and training opportunities is limited. The results of our review are consistent with the hypothesis that more resources, education, and training opportunities should be available to responders as well as to producers, importers and shippers, international travelers, and the general public. Increased education and training will raise awareness among these groups of the relationship between animal and human health. PMID:19635003

  3. Avaliação do tratamento da hérnia inguinal sob anestesia local e sedação em 1560 pacientes Outcome of groin hernia repair under local anesthesia and sedation in 1560 patients

    Directory of Open Access Journals (Sweden)

    José Carlos de Rezende Pereira

    2006-12-01

    Full Text Available OBJETIVO: Analisar a aplicabilidade da anestesia local da região inguinal no tratamento da hérnia inguinal. MÉTODO: Foram estudados os dados de 1560 pacientes submetidos ao tratamento operatório para cura de hérnia inguinal, entre maio de 1996 e dezembro de 2003, pela técnica de Lichtenstein, sob anestesia local da região inguinal associada à sedação. Foram analisados so seguintes dados: idade,sexo,índice de massa corporal, número de recidivas, as intercorrências pré e pós-operatórias, tempo de permanência hospitalar. Os tipos de hérnia foram classificados segundo Nyhus. RESULTADOS: Todas as operações foram concluídas sob a anestesia local e sedação não sendo necessário nenhuma complementação. As complicações pós-operatórias ocorreram em 7,16 % dos pacientes, nenhum deles necessitou de reinternação. CONCLUSÕES: A anestesia loco-regional da região inguinal na totalidade dos casos produziu conforto para os pacientes e boas condições de operabilidade para os cirurgiões.BACKGROUND: This study aimed at showing the feasibility of local-regional anesthesia in inguinal hernia repair using the technique of Lichtenstein. METHODS: 1560 patients were operated between May 1996 and December 2003. They were submitted to 1560 surgeries by means of the Lichtenstein technique, operated under local-regional anesthesia in inguinal region. Age, gender, Nyhus classification, and body mass index were analyzed. RESULTS: The post-operative complications had occurred in 7,16% of the patients. Hospitalization average were 6:00 hours. CONCLUSION: We concluded that local-regional anesthesia in the inguinal region provides the same level of comfort for patients as well as for surgeons with the advantage of imposing shorter hospital stay.

  4. Anestesia para correção cirúrgica de fístula de artéria coronária sem circulação extracorpórea: relato de caso

    OpenAIRE

    Raquel Reis Soares; Leonardo Ferber Drumond; Leonardo Alves Araújo; Matheus Ferber Drumond; Michelle Nacur Lorentz

    2011-01-01

    JUSTIFICATIVA E OBJETIVOS: Descrita em 1865 por Krause ¹, a fístula de artéria coronária comunicando-se com cavidades cardíacas, artéria pulmonar ou seio coronário é muito rara. Representa 0,2% a 0,4 % das cardiopatias congênitas e 0,1% a 0,2% da população adulta submetida a angiografias coronarianas ². O objetivo deste relato é apresentar anestesia para cirurgia de fechamento de fístula coronária em procedimento eletivo, considerando suas particularidades. RELATO DE CASO: Paciente do sexo ma...

  5. ALTERAÇÕES HEMATOLÓGICAS DURANTE A ANESTESIA GERAL E A UTILIZAÇÃO DE OPIÓIDES: REVISÃO

    Directory of Open Access Journals (Sweden)

    COSTA, P.F

    2014-06-01

    Full Text Available The immune responsein the against ofanesthetics and opioids used in veterinary practice controversy.Studies in animals have shown differences between increased or decreased immunity of patients after surgical procedures. In humans, the results are more consistent and serve as the basis for animal experiments. What is known is that the oxidative reactions are the most responsible for immune suppression,with a decrease in red blood cell counts and lymphocytes, whem it is used anesthetics or opioids.This review aims to group the recent research results on the hematological changes during anesthesia in humans and animals and serve as the reference for new experiments to elucidate some of the questions on this subject so rich and little explored in veterinary medicine. A resposta imune frente aos anestésicos e opióides utilizados na prática veterinária é controversa. Estudos realizados em animais demonstraram divergências entre aumento ou redução da imunidade dos pacientes após os procedimentos cirúrgicos. Em humanos, os resultados são mais consistentes e servem como base aos experimentos com animais. O que se sabe é que as reações oxidativas são as grandes responsáveis pela supressão da imunidade, com queda nas contagens de eritrócitos e linfócitos, quando utiliza-se anestésicos gerais ou opióides. A presente revisão tem como objetivo agrupar os resultados recentes de pesquisas sobre as alterações hematológicas durante a anestesia em humanos e animais e servir de referência para novos experimentos, na tentativa de elucidar algumas das questões acerca deste assunto tão rico e pouco explorado na Medicina Veterinária.

  6. Epidural anesthesia using a 0,75% ropivacaine and subarachnoid anesthesia with a 0,5% bupivacaine associated or not with clonidine in hemorroidectomies Anestesia peridural com ropivacaína a 0,75% e anestesia subaracnóidea com bupivacaína a 0,5% associadas ou não à clonidina em hemorroidectomias

    Directory of Open Access Journals (Sweden)

    João Florêncio de Abreu Baptista

    2008-12-01

    24 horas foram anotados. RESULTADOS: A intensidade da dor, 8 horas após a cirurgia, foi menor no grupo 4, e significantemente menor no grupo 4 em relação aos grupos 1 e 2, 12 horas (p=0,022; p=0,001 e 24 horas (p=0,03; p=0,003. A freqüência do uso de vasoconstritores no transoperatório e de analgésicos no pós-operatório não diferiu entre os grupos. Não houve complicações anestésicas. CONCLUSÕES: A anestesia subaracnóidea com bupivacaína a 0,5%, com clonidina, apresentou melhor analgesia que a anestesia peridural com ropivacaína a 0,75% com ou sem clonidina, porém todas foram seguras e eficazes. A clonidina contribuiu para diminuir a dor na anestesia subracnóidea.

  7. Efeitos do óxido nitroso em hipotensão controlada durante anestesia com baixo fluxo Efectos del óxido nitroso en la hipotensión controlada durante la anestesia con bajo flujo The effects of nitrous oxide on controlled hypotension during low flow anesthesia

    Directory of Open Access Journals (Sweden)

    Semiha Barçın

    2013-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Investigamos o efeito do óxido nitroso (N2O em hipotensão controlada durante anestesia com baixo fluxo (isoflurano-dexmedetomidina em termos de hemodinâmica, consumo de anestésico e custos. MÉTODOS: Quarenta pacientes foram randomicamente alocados em dois grupos. Infusão de dexmedetomidina (0,1 µg.kg-1.min-1 foi mantida por 10 minutos. Subsequentemente, essa infusão foi mantida até os últimos 30 minutos de operação a uma dose de 0,7 µg.kg-1.hora-1. Tiopental (4-6 mg.kg-1 e brometo de vecurônio (0,08 0,12 mg.kg-1 foram administrados na indução de ambos os grupos. Isoflurano (2% foi administrado para manutenção da anestesia. O Grupo N recebeu uma mistura de 50% de O2-N2O e o Grupo A recebeu uma mistura de 50% de O2-ar como gás de transporte. Anestesia com baixo fluxo (1 L.min-1 foi iniciada após um período de 10 minutos de alto fluxo inicial (4,4 L.min-1. Os valores de pressão arterial, frequência cardíaca, saturação periférica de O2, isoflurano inspiratório e expiratório, O2 inspiratório e expiratório, N2O inspiratório e expiratório, CO2 inspiratório, concentração de CO2 após expiração e concentração alveolar mínima foram registrados. Além disso, as taxas de consumo total de fentanil, dexmedetomidina e isoflurano, bem como de hemorragia, foram determinadas. RESULTADOS: A frequência cardíaca diminuiu em ambos os grupos após a carga de dexmedetomidina. Após a intubação, os valores do Grupo A foram maiores nos minutos um, três, cinco, 10 e 15. Após a intubação, os valores de hipotensão desejados foram alcançados em 5 minutos no Grupo N e em 20 minutos no grupo A. Os valores da CAM foram mais altos no Grupo N nos minutos um, três, cinco, 10 e 15 (p JUSTIFICATIVA Y OBJETIVOS: Investigamos el efecto del óxido nitroso (N2O en hipotensión controlada durante anestesia con bajo flujo (isoflurano-dexmedetomidina en términos de hemodinámica, consumo de anestésico y costes

  8. Efeitos da associação da clonidina à bupivacaína hiperbárica na anestesia subaracnóidea alta Efectos de la asociación de la clonidina a la bupivacaína hiperbárica en la anestesia subaracnoidea alta Effects of clonidine associated to hyperbaric bupivacaine during high-level spinal anesthesia

    Directory of Open Access Journals (Sweden)

    José Reinaldo Cerqueira Braz

    2003-09-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Dados da literatura sugerem que a clonidina, um agonista alfa2-adrenérgico, em associação com a bupivacaína, na anestesia subaracnóidea alta pode aumentar a incidência de hipotensão e bradicardia. O objetivo desta pesquisa foi verificar o potencial sinergismo entre diferentes doses de clonidina, de 45 e 75 µg, e bupivacaína hiperbárica nas características e nos efeitos hemodinâmicos do bloqueio subaracnóideo alto (T4. MÉTODO: Em estudo aleatório e duplamente encoberto, foram avaliados 60 pacientes estado físico ASA I, submetidos à cirurgia do abdômen inferior e membros inferiores. Os pacientes foram submetidos à anestesia subaracnóidea, com bupivacaína hiperbárica a 0,5% (17,5 mg - 3,5 ml mais a associação das seguintes drogas: grupo Controle (n = 20 - solução fisiológica (0,5 ml; grupo Clon 45 (n = 20 - clonidina, na dose de 45 µg (0,3 ml, associada à solução fisiológica (0,2 ml; grupo Clon 75 (n = 20 - clonidina, na dose de 75 µg (0,5 ml. A cirurgia somente foi realizada quando o nível do dermátomo atingido pelo bloqueio analgésico foi de T4. RESULTADOS: A latência dos bloqueios analgésico e motor da anestesia subaracnóidea não diferiu significativamente entre os grupos (p > 0,05. Ambas as doses de clonidina prolongaram, de maneira significativa, a duração do bloqueio analgésico em T8 e do bloqueio motor grau 3 (determinado pela escala modificada de Bromage (p 0,05. Ambas as doses de clonidina prolongaram a analgesia pós-operatória (intervalo de tempo decorrido entre o bloqueio subaracnóideo e a primeira solicitação de analgésico pelo paciente no pós-operatório (p JUSTIFICATIVA Y OBJETIVOS: Los datos de la literatura sugieren que la clonidina, un agonista alfa2-adrenérgico, en asociación con la bupivacaína, en la anestesia subaracnoidea alta puede aumentar la incidencia de hipotensión y bradicardia. El objetivo de esta pesquisa fue verificar el potencial

  9. PriSM: a primer selection and matching tool for amplification and sequencing of viral genomes

    OpenAIRE

    Yu, Qing; Ryan, Elizabeth M; Allen, Todd M.; Birren, Bruce W.; Henn, Matthew R.; Lennon, Niall J.

    2010-01-01

    Summary: PriSM is a set of algorithms designed to select and match degenerate primer pairs for the amplification of viral genomes. The design of panels of hundreds of primer pairs takes just hours using this program, compared with days using a manual approach. PriSM allows for rapid in silico optimization of primers for downstream applications such as sequencing. As a validation, PriSM was used to create an amplification primer panel for human immunodeficiency virus (HIV) Clade B.

  10. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    OpenAIRE

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam; Hwang, Chung-Ju

    2015-01-01

    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconi...

  11. Influência da clonidina por via venosa no custo de anestesia com sevoflurano em cirurgias de ouvido médio em regime ambulatorial Influencia de la clonidina por vía venosa en el costeo de anestesia con sevoflurano en cirugías de oído medio en régimen ambulatorial Influence of intravenous clonidine in the cost of sevoflurane anesthesia for outpatient middle ear procedures

    OpenAIRE

    Renato Mestriner Stocche; Luís Vicente Garcia; Jyrson Guilherme Klamt; Marlene Paulino dos Reis; Daniela Rocha Gil; Karin Luiza Magno Mesquita

    2004-01-01

    JUSTIFICATIVA E OBJETIVOS: A clonidina é um agente a2-agonista que diminui o consumo de anestésicos venosos e inalatórios. Este estudo visou avaliar a relação custo-benefício da medicação pré-anestésica com clonidina por via venosa em anestesia geral com sevoflurano em regime ambulatorial. MÉTODO: Trata-se de estudo encoberto, aleatório, controlado com placebo, realizado com pacientes com idade entre 15 e 52 anos. Os pacientes foram divididos em 3 grupos de 15: Grupo S (placebo), Grupo C3 (cl...

  12. Anesthetic strategy during endovascular therapy: General anesthesia or conscious sedation? (GOLIATH - General or Local Anesthesia in Intra Arterial Therapy) A single-center randomized trial

    DEFF Research Database (Denmark)

    Simonsen, Claus Z; Sørensen, Leif H; Juul, Niels;

    2016-01-01

    RATIONALE: Endovascular therapy after acute ischemic stroke due to large vessel occlusion is now standard of care. There is equipoise as to what kind of anesthesia patients should receive during the procedure. Observational studies suggest that general anesthesia is associated with worse outcomes...... compared to conscious sedation. However, the findings may have been biased. Randomized clinical trials are needed to determine whether the choice of anesthesia may influence outcome. AIM AND HYPOTHESIS: The objective of GOLIATH (General or Local Anestesia in Intra Arterial Therapy) is to examine whether...... study. Patients with acute ischemic stroke, scheduled for endovascular therapy, are randomized to receive either general anesthesia or conscious sedation. STUDY OUTCOMES: The primary outcome measure is infarct growth after 48-72 h (determined by serial diffusion-weighted magnetic resonance imaging...

  13. Modified primers for the identification of nonpathogenic Fusarium oxysporum isolates that have biological control potential against Fusarium wilt of cucumber in Taiwan.

    Directory of Open Access Journals (Sweden)

    Chaojen Wang

    Full Text Available Previous investigations demonstrated that Fusarium oxysporum (Fo, which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber.

  14. SPECT single photon emission computed tomography: A primer

    International Nuclear Information System (INIS)

    This book aims to assist nuclear medicine technologists in expanding their knowledge of nuclear medicine to include SPECT. The text of this primer is written with the assumption that the reader is proficient in most elements of nuclear medicine technology; therefore, the information is limited to data that will answer the basic questions of single-photon emission computed tomography .... The authors' goal is to bring the basics of this material together in a manner that would answer the technologist's fundamental questions. The authors have designed this primer in a generic manner to be used as an extension of the manufacturer's operating manual .... A glossary is included which contains some of the terminology relevant to the specialty, and reading lists are provided at the end of each chapter to direct the reader to more comprehensive text on specific subjects

  15. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  18. Constructing the ecstasy of MDMA from its component mental organs: Proposing the primer/probe method.

    Science.gov (United States)

    Ray, Thomas S

    2016-02-01

    medications rilmenidine and moxonidine are selective for imidazoline-1 and can be used to test the hypothesis that the entactogenic mental effects of MDMA are due to loading the imidazoline-1 mental organ into consciousness. The primer/probe method is not limited to testing the specific hypothesis about MDMA and imidazoline, but is a general method for studying the role of mental organs in the mind. For example, the role of dopamine mental organs can be studied by using Parkinson's drugs such as ropinirole or pramipexole as probes. PMID:26826641

  19. MERS-CoV PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ...

  20. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  1. El primer llibre de la Biblioteca de Comunicació

    OpenAIRE

    Moragas Spà, Miquel de,

    2010-01-01

    El primer llibre va ser "El espíritu del tiempo", d'Edgar Morin. Un llibre sobre la cultura de masses i els mitjans de comunicació, mal vist en aquells anys 70 per la sociologia més acadèmica i oficial, però de fet un dels fundadors dels estudis interdisciplinaris de la comunicació

  2. Introduction to Command, Control, and Communications: a primer

    OpenAIRE

    Eidson, Edward H.

    1995-01-01

    This thesis is a primer for students in the Introduction to Command, Control, and Communications Courses at the Naval Postgraduate School. This document provide students a consolidated reference that emphasizes key concepts and ideas presented by the course instructor and required readings. Its organization closely parallels the course outline used for in-class instruction. It supports course objectives by providing an executive overview of a wide variety of C2 topics. These topics include: C...

  3. The Primer for Sports Medicine Professionals on Imaging

    OpenAIRE

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathol...

  4. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  5. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Fundamentals of statistical evidence—a primer for legal professionals

    OpenAIRE

    Aitken, Colin; TARONI, FRANCO

    2008-01-01

    Criminal courts are today frequently confronted with statistical evidence, notably in relation to DNA profiling. Recent experience tends to confirm both widespread perceptions and more systematic research indicating that probability and statistics are not handled confidently, or always competently, by lawyers, judges, jurors or even by forensic scientists. Conceived as a primer for legal professionals, this article reviews basic statistical terminology and its forensic applications, and explo...

  7. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  8. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  9. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  10. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. PMID:21565032

  11. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    Science.gov (United States)

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  12. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  13. Efeito sinérgico entre a dexmedetomidina e a ropivacaína 0,75% na anestesia peridural Synergistic effect between dexmedetomidine and 0.75% ropivacaine in epidural anesthesia

    Directory of Open Access Journals (Sweden)

    Paula Fialho Saraiva Salgado

    2008-04-01

    Full Text Available OBJETIVO: O objetivo deste estudo foi avaliar as características clínicas da anestesia peridural realizada com ropivacaína associada à dexmedetomidina. MÉTODOS: Quarenta pacientes submetidos à correção cirúrgica de hérnia inguinal ou varizes de membros inferiores sob anestesia peridural participaram deste estudo. Os pacientes foram divididos em: Grupo Controle (n = 20, ropivacaína 0,75%, 20 ml (150 mg; e Grupo Dexmedetomidina (n = 20, ropivacaína 0,75%, 20 ml (150 mg, mais dexmedetomidina, 1 µg.kg-1. As variáveis estudadas foram: tempo de latência do bloqueio sensitivo, dermátomo máximo de anestesia, tempo de duração dos bloqueios analgésico e motor, intensidade do bloqueio motor, nível de sedação, variáveis hemodinâmicas, analgesia pós-operatória e ocorrência de efeitos colaterais. RESULTADOS: A dexmedetomidina não influenciou o tempo de latência da anestesia nem o nível máximo do bloqueio sensitivo (p > 0,05, mas prolongou o tempo de duração dos bloqueios analgésico e motor (p 0,05. A ocorrência de efeitos colaterais (tremor, náuseas e SpO2 0,05. CONCLUSÃO: Há sinergismo evidente entre a dexmedetomidina e a ropivacaína na anestesia peridural sem que haja elevação da morbidade relacionada a associação dos fármacos.BACKGROUND: This study aimed to evaluate clinical characteristics of epidural anesthesia performed with 0.75% ropivacaine associated with dexmedetomidine. METHODS: Forty patients scheduled for hernia repair or varicose vein surgeries under epidural anesthesia participated in this study. They were assigned to: Control Group (n = 20, 0.75% ropivacaine, 20 ml (150 mg; and Dexmedetomidine Group (n = 20, 0.75% ropivacaine, 20 ml (150 mg, plus dexmedetomidine, 1 mg.kg-1. The following variables were studied: total analgesic block onset time, upper level of analgesia, analgesic and motor block duration time, intensity of motor block, state of consciousness, hemodynamics, postoperative analgesia

  14. Sequence-related amplified polymorphism primer screening on Chinese fir (Cunninghamia lanceolata (Lamb.) Hook)

    Institute of Scientific and Technical Information of China (English)

    Huiquan Zheng; Hongjing Duan; Dehuo Hu; Ruping Wei; Yun Li

    2015-01-01

    Chinese fir (Cunninghamia lanceolata (Lamb.) Hook) is one of the most important coniferous tree species used for timber production in China. Here, we conducted a sequence-related amplified polymorphism (SRAP) primer screening assay with a total of 594 primer combinations, using 22 forward and 27 reverse primers on four repre-sentative Chinese fir genotypes. The obtained results indicated that Chinese fir genomic DNA has a notable amplification bias on the employed forward or reverse primer nucleotides (3' selection bases). Out of the tested primer sets, 35 primer combinations with clearly distin-guished bands, stable amplification, and rich polymorphism were selected and identified as optimal primer sets. These optimal primer pairs gave a total of 379 scorable bands, including 265 polymorphic bands, with an average of 10.8 bands and 7.6 polymorphic bands per primer combination. The produced band number for each optimal primer set ranged from 7 to 14 with a percentage of polymorphic bands spanning from 33.3 to 100.0%. These primer combinations could facilitate the next SRAP analysis assays in Chinese fir.

  15. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  16. Efedrina versus fenilefrina: prevenção de hipotensão arterial durante anestesia raquídea para cesariana e efeitos sobre o feto Efedrina versus fenilefrina: prevención de hipotensión arterial durante anestesia raquidea para cesárea y efectos sobre el feto Ephedrine versus phenylephrine: prevention of hypotension during spinal block for cesarean section and effects on the fetus

    Directory of Open Access Journals (Sweden)

    Edno Magalhães

    2009-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A hipotensão arterial durante a anestesia raquídea para cesariana deve-se ao bloqueio simpático e compressão aorto-cava pelo útero e pode ocasionar efeitos deletérios para o feto e a mãe. A efedrina e fenilefrina melhoram o retorno venoso após bloqueio simpático durante anestesia raquídea. O objetivo deste estudo foi comparar a eficácia da efedrina e da fenilefrina em prevenir e tratar a hipotensão arterial materna durante anestesia raquídea e avaliar seus efeitos colaterais e alterações fetais. MÉTODO: Sessenta pacientes, submetidas à anestesia raquídea com bupivacaína e sufentanil para cesariana, foram divididas aleatoriamente em dois grupos para receber, profilaticamente, efedrina (Grupo E, n = 30, dose = 10 mg ou fenilefrina (Grupo F, n = 30, dose = 80 µg. Hipotensão arterial (pressão arterial menor ou igual a 80% da medida basal foi tratada com bolus de vasoconstritor com 50% da dose inicial. Foram avaliados: incidência de hipotensão arterial, hipertensão arterial reativa, bradicardia e vômitos, escore de Apgar no primeiro e quinto minutos e gasometria do cordão umbilical. RESULTADOS: A dose média de efedrina foi 14,8 ± 3,8 mg e 186,7 ± 52,9 µg de fenilefrina. Os grupos foram semelhantes quanto aos parâmetros demográficos e incidência de vômitos, bradicardia e hipertensão arterial reativa. A incidência de hipotensão arterial foi de 70% no Grupo E e 93% no Grupo F (p JUSTIFICATIVA Y OBJETIVOS: La hipotensión arterial durante la anestesia raquídea para cesárea se debe al bloqueo simpático y a la compresión aortocava por el útero y puede ocasionar efectos malignos para el feto y su madre. La efedrina y fenilefrina mejoran el retorno venoso después del bloqueo simpático durante la anestesia raquídea. El objetivo de este estudio fue comparar la eficacia de la efedrina y de la fenilefrina en prevenir y tratar la hipotensión arterial materna durante la anestesia raquídea y

  17. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...... and chemically modified antisense oligonucleotides we found that interactions between the anticodon of tRNALys3 and an A-rich loop of viral RNA led to an important destabilization of the pre-primer binding site; this region became accessible to anti-pre-primer binding site oligonucleotides in a...

  18. Evaluation of antibacterial activity of three dentin primers using an in vitro tooth model.

    Science.gov (United States)

    Ohmori, K; Maeda, N; Kohno, A

    1999-01-01

    This study compared the antibacterial activities of three dentin primers and investigated a newly designed experimental system using a bovine tooth model method for evaluating antibacterial activity by comparing this method with a conventional disk diffusion method. The antibacterial activities of SA primer in Clearfil Liner Bond, LB primer in Clearfil Liner Bond II, and ED primer in Panavia 21 were evaluated using the conventional disk diffusion method. The 50 microliters aliquot of each primer was applied to three sterilized paper disks, then placed onto Tryptic Soy agar plates already inoculated with Streptococcus mutans. After anaerobic incubation for 48 hours, the diffusion of antibacterial components was determined using the inhibition zone produced around the paper disk. The diameter of the inhibition zones was measured and the average calculated. Standardized cavities (diameter 5.0 mm, depth 3.0 mm) were prepared on the labial surfaces of bovine teeth and inoculated with S mutans (10(6) CFU/microliter) following sterilization by 60Co gamma rays (50 KGy). The teeth were divided into four groups: SA primer, LB primer, ED primer, and a control group. Except for the control teeth, the cavity preparations were treated with the respective dentin primers, and then firmly sealed with a temporary sealing material. The teeth were placed in bottles containing melted Tryptic Soy agar. Five ml of Tryptic Soy broth was then added to the surface of the hardened Tryptic Soy agar. After 1 week's incubation of the teeth in the bottles at 37 degrees C, the number of bacteria remaining in each cavity was counted, except for eight specimens, which were used for SEM observation. The ED primer showed the widest inhibition zone in the disk diffusion test, which was significantly different from the other primers. Using the bovine tooth model, all dentin primers showed antibacterial activity, with significant differences found among the four groups. The results indicated that ED

  19. ANESTESIA PARA AMPUTACIÓN SUPRACONDÍLEA EN PACIENTE CON SÍNDROME CORONARIO AGUDO / Anesthesia for supracondylar amputation in patient with acute coronary syndrome

    Directory of Open Access Journals (Sweden)

    Marilyn Ramírez Méndez

    2012-03-01

    Full Text Available Resumen La insuficiencia arterial periférica es una enfermedad que se asocia a factores de riesgo aterogénico reconocidos, y es más frecuente en personas con hiperlipidemia, diabetes mellitus y hábito de fumar. Se presenta el caso de una mujer de 67 años de edad, con antecedentes de hipertensión arterial, diabetes mellitus e infarto de miocardio antiguo, que ingresa por signos de inflamación aguda del miembro inferior derecho como consecuencia de una insuficiencia arterial periférica. A los 8 días del ingreso presentó un síndrome coronario agudo sin elevación del segmento ST, con fallo de bomba Killip II, y una vez compensada fue anunciada para amputación supracondílea de urgencia, debido a una gangrena isquémica. Se decidió utilizar anestesia espinal subaracnoidea selectiva del miembro inferior derecho, a cual se aplicó sin complicaciones y favoreció el adecuado desarrollo de la cirugía planificada. A las 72 horas la paciente fue egresada de la UCI, sin síntomas cardiovasculares y compensación metabólica. / Abstract Peripheral arterial insufficiency is a disease that is associated with known atherogenic risk factors, and is more common in people with hyperlipidemia, diabetes mellitus and smoking habit. A case of a 67-year-old woman with a history of hypertension, diabetes mellitus and old myocardial infarction is presented. She was admitted for signs of acute inflammation of the right leg due to peripheral arterial insufficiency. 8 days after admission she presented an acute coronary syndrome without ST segment elevation with pump failure (Killip class II, and once compensated she was scheduled for emergency supracondylar amputation due to ischemic gangrene. It was decided to use selective spinal subarachnoid from the right leg, which was applied without complications and favored the proper development of the planned surgery. At 72 hours, the patient was discharged from the ICU, with metabolic compensation and without

  20. Anestesia por infusão contínua de propofol associado ao remifentanil em gatos pré-tratados com acepromazina

    Directory of Open Access Journals (Sweden)

    Lukiya Birungi Silva Campos Mata

    2010-04-01

    Full Text Available O presente trabalho avaliou a associação anestésica do propofol, um anestésico geral de ação ultracurta e metabolismo rápido, ao remifentanil, opioide de grande poder analgésico, que potencializa os anestésicos gerais. O objetivo principal foi desenvolver um protocolo anestésico de uso intravenoso, por infusão contínua, que proporcione conforto ao paciente, segurança, com grande relaxamento muscular e analgesia em gatos submetidos a cirurgias eletivas como a ovariosalpingoisterectomia e orquiectomia. Foram utilizados 30 gatos, aleatoriamente distribuídos em 3 grupos de 10 animais. Em todos eles realizou-se a tranquilização com acepromazina (0,1 mg/kg, IM e indução anestésica com propofol (6 mg/kg, IV. No grupo 1, a anestesia foi mantida por infusão contínua de propofol (0,6 mg/kg/min, no grupo 2, com propofol (0,4 mg/kg/min e remifentanil (0,1 µg/kg/min, e no grupo 3, com propofol (0,4 mg/kg/min e remifentanil (0,2 µg/kg/min. As variáveis mensuradas foram: temperatura corporal, frequência cardíaca, frequência respiratória, saturação da oxiemoglobina, pressão arterial sistólica, hemogasometria arterial, analgesia e miorrelaxamento. Após análise dos resultados, pode-se concluir que o remifentanil promoveu incremento da analgesia, permitindo redução de 33% na velocidade de infusão do propofol, entretanto a infusão de 0,2 µg/kg/min de remifentanil determinou maior depressão respiratória quando comparada à infusão de 0,1 µg/kg/min.

  1. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  2. An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, M. D.; Higgins, R. H.

    1985-01-01

    The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.

  3. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  4. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  5. Bt-CoV HKU3 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU3 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU3 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU3 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  6. Bt-CoV HKU5 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU5 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU5 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU5 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  7. Debate del primer seminario de investigación

    OpenAIRE

    Ortega, Tomás

    2002-01-01

    Una vez concluidas las intervenciones de los tres ponentes del primer Seminario de Investigación (Dr. Moisés Coriat –U. Granada-, Dr. Alejandro Fernández –U. Valencia y José Carrillo -U. Huelva-), la réplica a sus informes, presentada por la Dra. Joana Brocardo, y la contrarréplica de los ponentes que siguió a la exposición de la Dra. Brocardo, comienza el debate propiamente dicho. en el que intervienen los asistentes presentes en la sala

  8. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  9. The primer for sports medicine professionals on imaging: the shoulder.

    Science.gov (United States)

    Farshad-Amacker, Nadja A; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  10. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  11. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  12. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  13. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  14. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  15. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  16. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  17. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  18. Treatment considerations for early glottic carcinoma: lessons learned and a primer for the general otolaryngologist.

    Science.gov (United States)

    Jamal, Nausheen; Sofer, Elazar; Chhetri, Dinesh K

    2014-02-01

    In this commentary, we review our experience with early glottic carcinomas in an attempt to identify points to consider when developing a treatment protocol and technical considerations in oncologic resection to maintain laryngeal function. We highlight several consistent themes: (1) difficult exposure is not always a contraindication to endoscopic resection; (2) depth of invasion may be apparent only intraoperatively; (3) radiation therapy should be offered for deeply invasive cancers requiring extensive cordectomy or for patients who cannot afford lengthy vocal downtime; however, (4) radiation therapy leads to acute dysphagia and collateral damage to the contralateral vocal fold that is avoided with surgery; (5) good voice can be obtained after healing if resection is limited to intramuscular cordectomy; (6) the key to optimal vocal results is adequate glottal closure; and (7) second look operations are occasionally necessary, and therefore preoperative counseling should include this possibility. Since both surgery and radiation therapy achieve excellent oncologic control, a patient-centered approach is preferred in management. PMID:24201059

  19. Anestesia para ventriculostomia por via endoscópica para tratamento de hidrocefalia: relato de casos Anestesia para ventriculostomía por vía endoscópica para tratamiento de hidrocefalia: relato de casos Anesthesia for endoscopic ventriculostomy for the treatment of hydrocephalus: case report

    Directory of Open Access Journals (Sweden)

    Friederike Wolff Valadares

    2007-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A terceiro-ventriculostomia endoscópica está se tornando um procedimento de rotina entre as intervenções neurocirúrgicas infantis. Entretanto, relatos sobre anestesia para crianças submetidas a tais procedimentos ainda são escassos. O objetivo desta série de casos foi demonstrar os cuidados e a eficácia do método empregado. RELATO DOS CASOS: Foram avaliadas retrospectivamente 38 crianças abaixo de 2 anos que se submeteram à terceiro-ventriculostomia neuroendoscópica para tratamento de hidrocefalia obstrutiva no período de 1999 a 2004 no Biocor Instituto. Foram estudados o diagnóstico, comorbidades, idade, peso, técnica anestésica, monitorização e as complicações intra e pós-operatórias. Todos os pacientes, entre 1 semana e 20 meses, apresentavam hidrocefalia obstrutiva por compressão do aqueduto de etiologia variada. A indução anestésica em 35 crianças foi por via inalatória e por via venosa em três delas. A monitorização de 34 pacientes foi com eletrocardiograma, oxímetro de pulso, capnógrafo e termômetro esofágico, sendo quatro crianças monitorizadas com pressão arterial invasiva contínua. A manutenção da anestesia em 15 pacientes foi balanceada com fentanil e isoflurano e em outros 23 pacientes inalatória com isoflurano. Trinta e cinco crianças foram extubadas após o procedimento na sala cirúrgica e outras três no CTI. Seis pacientes foram encaminhados ao CTI após a extubação. Complicações observadas: disritmias cardíacas sem repercussão hemodinâmica no intra-operatório (seis casos. Dois pacientes tiveram sangramento intra-operatório, mas somente um deles demandou implante de derivação ventricular externa. As complicações no pós-operatório foram: vômitos (6, picos febris (4 convulsões (2, laringoespasmo (1 e estridor laríngeo (1. CONCLUSÕES: A terceiro-ventriculostomia apresenta baixa incidência de complicações mesmo em pacientes com menos de 24

  20. Anestesia para implante de marca-passo em paciente adulto com ventrículo único não-operado: relato de caso Anestesia para implante de marcapaso en paciente adulto con ventrículo único no operado: relato de caso Anesthesia for pacemaker implant in an adult patient with unoperated univentricular heart: case report

    Directory of Open Access Journals (Sweden)

    Adriano Bechara de Souza Hobaika

    2007-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Ventrículo único é anormalidade rara encontrada em cerca de 1% dos pacientes com cardiopatia congênita. Somente 11 casos de pacientes com ventrículo único não-operado e idade acima de 50 anos foram relatados na literatura. Este trabalho teve como objetivo descrever a conduta anestésica em paciente com ventrículo único para implante de marca-passo. RELATO DO CASO: Paciente do sexo feminino, 47 anos, com presença de dupla via de entrada do ventrículo esquerdo, L-transposição de grandes artérias e estenose subpulmonar, sem correção cirúrgica prévia, foi agendada para implante de marca-passo cardíaco definitivo seqüencial de duas câmaras. Ao MAPA apresentava bloqueio atrioventricular de segundo grau e uma freqüência cardíaca média de 45 bpm. Os exames pré-operatórios mostravam hematócrito de 57%, coagulograma normal, função ventricular preservada. A monitorização constou de oxímetro de pulso, ECG nas derivações D II e V5, PIA, capnógrafo e analisador de gases. Um marca-passo temporário transcutâneo foi disponibilizado no caso de bradicardia intensa. A anestesia foi induzida com fentanil (0,25 mg, etomidato (20 mg e atracúrio (35 mg. Quatro minutos após a indução, a freqüência cardíaca diminuiu para 30 bpm, sendo administrado 1 mg de atropina, com reversão da bradicardia. A anestesia foi mantida com sevoflurano a 2,5%, ar 60% e oxigênio 40%. O estado hemodinâmico e a saturação de oxigênio permaneceram estáveis. A paciente foi encaminhada à unidade de terapia intensiva estável e extubada ao final do procedimento. CONCLUSÕES: A conduta anestésica para implante de marca-passo em paciente de 47 anos com dupla via de entrada do ventrículo esquerdo e estenose subpulmonar não-operada foi adequada, haja vista que permitiu a realização do procedimento indicado.JUSTIFICATIVA Y OBJETIVOS: Ventrículo único es una anormalidad rara encontrada en aproximadamente 1% de los

  1. Les primeres locutores de ràdio a Catalunya, dels inicis de l’invent al primer franquisme

    OpenAIRE

    Espinosa i Mirabet, Sílvia

    2009-01-01

    Aquest article posa de manifest el paper preponderant que tingueren les locutores en les emissores de ràdio que operaven a Catalunya sota l’epígraf EAJ durant els anys vint i trenta del segle XX. Les locutores foren les primeres professionals del mitjà que crearen programes (els femenins) amb un format que més endavant es coneixeria com a magazín, en un moment històric (anys vint) en el qual la ràdio estava plena de conferències i xerrades. La segona gran aportació de les dones a la història ...

  2. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  3. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  4. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  5. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  6. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could be...... designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision in...

  7. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  8. Anestesia subaracnóidea para cesariana em paciente portadora de esclerose múltipla: relato de caso Anestesia subaracnoidea para cesárea en paciente portadora de esclerosis múltiple: relato de caso Subarachnoid anesthesia for cesarean section in a patient with multiple sclerosis: case report

    Directory of Open Access Journals (Sweden)

    Fabiano Timbó Barbosa

    2007-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A esclerose múltipla é uma doença adquirida que se caracteriza por áreas desmielinizadas no encéfalo e na medula espinal. O quadro clínico depende das áreas anatômicas acometidas. As principais causas de morte são infecção, falência respiratória e estado de mal epiléptico. Ocorre em pacientes geneticamente predispostos após contato com fatores ambientais, principalmente os vírus. O objetivo desse relato foi apresentar a técnica anestésica adotada em paciente com esclerose múltipla submetida à cesariana. RELATO DO CASO: Paciente com 32 anos, 60 kg, portadora de esclerose múltipla, tratada com metilprednisolona, deu entrada no centro obstétrico para realização de cesariana. Após monitoração foi realizada anestesia subaracnóidea com bupivacaína a 0,5% hiperbárica (12,5 mg associada à morfina (0,1 mg. O procedimento evoluiu sem intercorrências e a paciente recebeu alta hospitalar 48 horas após o parto sem piora dos sintomas preexistentes. CONCLUSÕES: O presente caso sugere que a raquianestesia pode ser administrada em paciente portador de esclerose múltipla sem a ocorrência obrigatória de exacerbações agudas dos sintomas no período pós-operatório.JUSTIFICATIVA Y OBJETIVOS: La esclerosis múltiple es una enfermedad adquirida que se caracteriza por áreas desmielinizadas en el encéfalo y en la médula espinal. El cuadro clínico depende de las áreas anatómicas acometidas. Las principales causas de muerte son infección, falencia respiratoria y estado de mal epiléptico. Ocurre en pacientes genéticamente predispuestos después del contacto con factores ambientales, principalmente los virus. El objetivo de este relato fue presentar la técnica anestésica adoptada en paciente con esclerosis múltiple sometida a cesárea. RELATO DEL CASO: Paciente con 32 anos, 60 kg, portadora de esclerosis múltiple, tratada con metilprednisolona, entró en el centro obstétrico para realizaci

  9. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites....... While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown...

  10. Oferta y demanda de servicios de salud en Manizales. Primer semestre 1995 al primer semestre 1997.

    Directory of Open Access Journals (Sweden)

    Alba Lucía Vélez Arango

    2009-10-01

    Full Text Available Se analizó el comportamiento de los indicadores de cobertura de afiliación al Sistema de Seguridad Social en Salud (SSSS, capacidad instalada de las instituciones del sector en términos de recursos físicos y humano, extensión e intensidad de uso de la consulta externa médica general, consulta odontológica y consulta de urgencia, al igual que la utilización de los servicios hospitalarios en términos de porcentaje ocupacional y productividad, en el período comprendido entre enero, 1995 y diciembre, 1996. En el período de estudio se observó en Manizales un aumento en la afiliación al SSSS en el régimen contributivo, pasando de 262,858 afiliados en 1995 a 311,901 a diciembre de 1996, lo cual representó un aumento de 18% con una cobertura aproximada de 80% del total de la población objetivo. En relación con la cobertura de afiliación en el Régimen Subsidiado a finales de 1996 se informó un total de 37,177 afiliados al SSSS en la ciudad de Manizales, representando una cobertura de 80% de la población identificada mediante el Sistema de Identificación de Población (SISBEN. En lo que tiene que ver con la extensión de uso se observó un aumento en la consulta odontológica, consulta externa médica general y consulta de urgencias durante el período 1995-1997. En relación con la intensidad de uso no se observó una variación significativa en la consulta externa médica general y de urgencias, mientras que la consulta odontológica presentó un ligero aumento en 1997. En cuanto a la utilización de los servicios de hospitalización se observaron diferencias apreciables entre las distintas Empresas Sociales del Estado existentes en la ciudad. Por último, los resultados encontrados en relación con la utilización de los servicios de hospitalización durante el período 1995-1997 tienen gran importancia para el análisis de la oportunidad y calidad de la atención en salud y en la planeación de la infraestructura de servicios

  11. A method for predicting service life of zinc rich primers on carbon steel

    Science.gov (United States)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  12. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    OpenAIRE

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-01-01

    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). ...

  13. Modelo de enseñanza de las habilidades psicomotoras básicas en anestesia para estudiantes de ciencias de la salud: sistematización de una experiencia

    OpenAIRE

    Lizceth Jazmín Ramírez; Myriam Andrea Moreno; Lorena Gartdner; Luz María Gómez; Mauricio Calderón; Ximena Sáenz; Gustavo Reyes; Jaime Jaramillo

    2008-01-01

    Esta investigación, de tipo cualitativo, propone un modelo pedagógico orientado a facilitar los procesos de enseñanza y aprendizaje de las siguientes habilidades psicomotoras básicas en anestesia: intubación oro-traqueal, colocación de máscara laríngea y canalización venosa en niños y adultos. El modelo se elaboró mediante la adopción de algunas teorías y diseños propuestos en la literatura, la recuperación de la experiencia docente y pruebas piloto de los modelos de instrucción con estudiant...

  14. Parada cardíaca súbita em anestesia geral como a primeira manifestação da origem anômala de artéria coronária esquerda

    OpenAIRE

    Maurício Daher; André Rodrigues Zanatta; Benhur David Henz; Marcelo Carneiro da Silva; Simone Nascimento dos Santos; Luiz Roberto Leite

    2012-01-01

    JUSTIFICATIVA E OBJETIVOS: O relato de caso descreve uma situação rara e potencialmente fatal associada à administração de anestesia. Nosso objetivo foi discutir as causas de parada cardíaca súbita no período perioperatório em pacientes aparentemente saudáveis e a fisiopatologia das anomalias de origem das artérias coronárias como uma causa de parada cardíaca súbita. RELATO DE CASO: Uma mulher de 44 anos, sem sintomas prévios de doença coronariana ou arritmias, apresenta parada cardíaca súbit...

  15. Influencia de la anestesia en la recuperación postquirúrgica después de la resección transuretral de próstata frente a adenomectomía prostática abierta

    OpenAIRE

    Corrales Valdivielso, Irene

    2015-01-01

    [ES]El trabajo titulado Influencia de la anestesia en la recuperación postquirúrgica después de la resección transuretral de próstata frente a la adenomectomía prostática abierta consiste en la elaboración de un estudio observacional multicéntrico de carácter restrospectivo de mil ochocientos pacientes en los que en los que se analizan las diferentes variables (edad, variables antropométricas, riesgo anestésico ASA, diagnósticos secundarios, PSA, hábitos tóxicos, medicación concomitante, t...

  16. Explorando la Geometría en el segundo curso del primer ciclo de educación Primaria

    OpenAIRE

    Sedó-Beneyto, Marta

    2016-01-01

    El objetivo general de este trabajo fue crear una propuesta de actividades lúdicas con la finalidad de mejorar el razonamiento geométrico de alumnos de segundo curso de primer ciclo de la etapa Primaria mediante proyectos, talleres y juegos contextualizados en su vida cotidiana. La mayoría de estas actividades fomentan la resolución de problemas para favorecer el desarrollo del pensamiento matemático y, más concretamente, del razonamiento geométrico del niño, potenciando la motivación, la coo...

  17. Enfermedad de Lyme aguda en Costa Rica: Descripción del primer caso autóctono

    Directory of Open Access Journals (Sweden)

    Manuel-Antonio Villalobos-Zúñiga

    2012-03-01

    Full Text Available Paciente masculino de 44 años de edad, vecino de Santa Teresa de Puntarenas con un cuadro agudo de fiebre, escalosfríos, artralgias intensas y malestar general; 15 días después de una picadura de garrapata. Se realizó inmunofluorescencia indirecta para Borrelia burgdorferi, cual fue positiva y el paciente mejoró con 14 días de tratamiento con doxiciclina. Se descartaron otras patologías infecciosas y no infecciosas, por lo que consideramos el caso como el primer caso autóctono de enfermedad de Lyme (EL en Costa Rica.

  18. El primer año de Canadá en la Organización de Estados Americanos

    OpenAIRE

    Bullis, Clayton

    1991-01-01

    El 27 de octubre de 1989, el Primer Ministro, haciendo uso de la palabra durante asamblea de dirigentes del continente en San José de Costa Rica, anunciaba que las relaciones entre Canadá y América Latina tendrían un punto de partida. En efecto, Canadá había decidido adherirse a la OEA a fin de participar plenamente en el desarrollo de las Américas. Es por ello que había solicitado al observador permanente de Canadá en la OEA informar al Secretario General que Canadá había dispuesto firmar...

  19. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  20. Predicting the success of primer extension genotyping assays using statistical modeling

    OpenAIRE

    Yuryev, Anton; Huang, Jianping; Pohl, Mark; Patch, Robert; Watson, Felicia; Bell, Peter; Donaldson, Miriam; Phillips, Michael S.; Boyce-Jacino, Michael T.

    2002-01-01

    Using an empirical panel of more than 20 000 single base primer extension (SNP-IT) assays we have developed a set of statistical scores for evaluating and rank ordering various parameters of the SNP-IT reaction to facilitate high-throughput assay primer design with improved likelihood of success. Each score predicts either signal magnitude from primer extension or signal noise caused by mispriming of primers and structure of the PCR product. All scores have been shown to correlate with the su...

  1. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  2. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  3. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    International Nuclear Information System (INIS)

    Research highlights: → Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. → The solvents of the primer are eco-friendly ones. → The primer adheres on galvanized steel and allows top-coating. → The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  4. Toracotomia em eqüinos sob anestesia com ventilação mecânica controlada Equine thoracotomy under anesthesia with controlled mechanical ventilation (CMV

    Directory of Open Access Journals (Sweden)

    Raquel Yvonne Arantes Baccarin

    1998-06-01

    Full Text Available Diversos procedimentos cirúrgicos e diagnósticos podem ser realizados através da cirurgia torácica em eqüinos. Para tanto faz-se necessária a utilização da ventilação controlada mecânica (VCM e a compreensão dos efeitos respiratórios deste tipo de ventilação durante a toracotomia. Foram utilizados seis eqüinos hígidos, sob anestesia com ventilação controlada, para a realização de acesso cirúrgico ao hemitórax direito com o objetivo de se avaliar, através da mensuração dos parâmetros fisiológicos, ventigrafia, pH e gases sangüíneos, a eficácia da ventilação controlada em otimizar a ventilação e a oxigenação e em prevenir a atelectasia pulmonar durante manipulações intratorácicas. Verificou-se diminuição dos valores da PaCO2 e aumento dos valores de pH durante a ventilação controlada, mesmo com o pneumotórax instalado. A pressão interpleural também apresentou aumento de seus valores durante a VCM. Concluiu-se que o uso da VCM, durante a prática da toracotomia, permite a padronização da freqüência respiratória com melhora da ventilação, e subseqüente normalização das alterações da pressão parcial de dióxido de carbono e pH, bem como mantém visualmente adequada a expansão pulmonar. A VCM promove aumento da pressão interpleural, enquanto o tórax permanece fechado.Several surgical and diagnostic procedures can be performed on thoracic surgery in the equine. To carry out these procedures controlled mechanical ventilation (CMV is necessary, as well as full understanding of the possible side effects of this type of ventilation. Six healthy equine were used under anesthesia wiith CMV to do right hemithorax approach. The goals were to evaluate efficiency of CMV in the improvement of ventilation and oxigenation as well as in the prevention of pulmonar atelectasis during intrathoracic manipulation. For such evaluation of physiologic parameters measurement, ventigraphy and blood gas analysis

  5. INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz

    2013-01-01

    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  6. Some Generalities About Generality

    CERN Document Server

    Barrow, John D

    2015-01-01

    We survey a variety of cosmological problems where the issue of generality has arisen. This is aimed at providing a wider context for many claims and deductions made when philosophers of science choose cosmological problems for investigation. We show how simple counting arguments can be used to characterise parts of the general solution of Einstein's equations when various matter fields are present and with different spatial topologies. Applications are described to the problem of singularities, static cosmological models, cosmic no hair theorems, the late-time isotropisation of cosmological models, and the number of parameters needed to describe a general astronomical universe.

  7. Injeção intravascular acidental de ropivacaína a 0,5% durante a realização de anestesia peridural torácica: relato de casos Inyección intravascular accidental de ropivacaína a 0,5% durante la realización de anestesia peridural torácica: relato de casos Accidental intravascular injection of 0.5% ropivacaine during thoracic epidural anesthesia: case reports

    Directory of Open Access Journals (Sweden)

    Fábio Geraldo Curtis

    2004-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A ropivacaína foi introduzida na prática clínica há pouco mais de dez anos, associando-se a baixo risco de complicações do sistema nervoso central e cardiovascular. O objetivo destes relatos é apresentar um caso de parada cardíaca e outro de toxicidade neurológica, após injeção intravascular acidental da ropivacaína, durante a realização de anestesias peridurais. RELATO DOS CASOS: Trata-se de duas pacientes submetidas a cirurgias plásticas estéticas sob anestesia peridural torácica com ropivacaína a 0,5%. Durante a realização da técnica, uma delas apresentou parada cardíaca em assistolia e a outra, toxicidade neurológica. Prontamente atendidas, ambas apresentaram rápida recuperação, tendo sido possível a realização dos respectivos atos cirúrgicos. CONCLUSÕES: O reconhecimento e o tratamento rápidos da injeção intravascular acidental, bem como as características farmacológicas da ropivacaína foram decisivos, em ambos os casos, na boa recuperação das pacientes.JUSTIFICATIVA Y OBJETIVOS: A ropivacaína fue introducida en la práctica clínica hace poco más de diez años, asociándose a bajo riesgo de complicaciones del sistema nervioso central y cardiovascular. Estos relatos tienen como objetivo presentar un caso de parada cardíaca y otro de toxicidad neurológica, después de inyección intravascular accidental de ropivacaína, durante la realización de anestesias peridurales. RELATO DE LOS CASOS: Se trata de dos pacientes sometidas a cirugías plásticas estéticas bajo anestesia peridural torácica con ropivacaína a 0,5%. Durante la realización de la técnica, una de ellas presentó parada cardíaca en asistolia y la otra, toxicidad neurológica. Prontamente atendidas, ambas presentaron rápida recuperación, habiendo sido posible la realización de los respectivos actos quirúrgicos. CONCLUSIONES: El reconocimiento y el tratamiento rápidos de la inyección intravascular

  8. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  9. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  10. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  11. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  12. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. PMID:27226047

  13. ParaDiS-FEM dislocation dynamics simulation code primer

    International Nuclear Information System (INIS)

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  14. ParaDiS-FEM dislocation dynamics simulation code primer

    Energy Technology Data Exchange (ETDEWEB)

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A

    2011-09-27

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  15. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  16. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik;

    2001-01-01

    Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA or tRNA. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a t...... could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold......-higher titers than those observed for the x2 primer with the tRNA(Pro) backbone. In summary, our results demonstrate flexibility in PBS and primer usage for SIVmac239, with PBS-primer complementarity being the major determinant, in analogy with previous findings for murine leukemia viruses and human...

  17. La Reforma Fiscal Durante el Primer Año de la Administración Bush

    OpenAIRE

    Crane, R

    1991-01-01

    LA REFORMA FISCAL DURANTE EL PRIMER AÑO DE LA ADMINISTRACIÓN BUSH Randall Crane* RESUMEN Este ensayo analiza las reformas de la política económica de Estados Unidos en el primer año de la administración del  ...

  18. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;

    2011-01-01

    goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website for...

  19. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  20. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  1. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking region

  2. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    Science.gov (United States)

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information. PMID:26715801

  3. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    Science.gov (United States)

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  4. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    Science.gov (United States)

    Rhim, Lauren Morando; Kowal, Julie

    2008-01-01

    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  5. Degenerative primer design and gene sequencing validation for select turkey genes.

    Science.gov (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald

    2016-06-01

    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  6. Tratamento do laringoespasmo em anestesia pediátrica por digitopressão retroauricular: relato de casos Tratamiento del laringoespasmo en anestesia pediátrica por digitopresión retroauricular: relato de casos Treatment of laryngeal spasm in pediatric anesthesia by retroauricular digital pressure: case report

    Directory of Open Access Journals (Sweden)

    Raquel Reis Soares

    2008-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Os problemas com a via aérea pediátrica estão entre os maiores desafios que o anestesiologista pode encontrar em sua prática clínica. Dentre eles, destaca-se o laringoespasmo, que ocorre com freqüência duas a três vezes maior na população pediátrica. O objetivo deste trabalho foi relatar o tratamento de laringoespasmo realizado com digitopressão de ponto localizado atrás do lóbulo da orelha. A técnica é fácil, antiga, porém pouco divulgada. Pode ser utilizada de forma segura e rápida, dispensando o acesso venoso periférico que, em algumas situações, pode estar ausente. RELATO DOS CASOS: Dois casos de anestesia pediátrica em pacientes de 3 anos e de 6 meses de idade, nos quais ocorreu laringoespasmo. Ambos foram tratados apenas com a digitopressão da depressão retroauricular e evoluíram com pronta melhora do padrão respiratório e da saturação arterial de oxigênio. Como o laringoespasmo é complicação comum e potencialmente grave pela sua morbimortalidade, é necessário tratamento seguro, eficaz e rápido. CONCLUSÃO: O tratamento clássico do laringoespasmo é a administração de oxigênio a 100% com pressão positiva por unidade ventilatória (balão e máscara e, se não houver resposta, administração venosa de 0,25 a 1 mg.kg-1 de succinilcolina. A técnica apresentada para tratamento do laringoespasmo é fácil, segura e eficaz, e realizada com digitopressão bilateral da região localizada atrás do lóbulo das orelhas. O laringoespasmo cedeu em poucos segundos e os pacientes tiveram evolução favorável.JUSTIFICATIVA Y OBJETIVOS: Los problemas con la vía aérea pediátrica están entre los más grandes retos que el anestesiólogo puede encontrar en su práctica clínica. Entre ellos se destaca el laringoespasmo, que ocurre con frecuencia de dos a tres veces más en la población pediátrica. El objetivo de este trabajo fue relatar el tratamiento de laringoespasmo realizado con

  7. Importância do treinamento de residentes em eventos adversos durante anestesia: experiência com o uso do simulador computadorizado Importancia del entrenamiento de los practicantes (médicos en ejercicio en eventos adversos durante la anestesia: experiencia con el uso del simulador computadorizado Importance of critical events training for anesthesiology residents: experience with computer simulator

    Directory of Open Access Journals (Sweden)

    Domingos Dias Cicarelli

    2005-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Em decorrência da grande evolução da monitorização e do arsenal terapêutico disponível nos últimos anos, houve uma redução na incidência de eventos adversos durante procedimentos anestésicos. Porém, continua importante o treinamento dos médicos residentes para este tipo de ocorrência. O objetivo deste estudo foi avaliar o desempenho prático do residente de Anestesiologia em eventos adversos durante uma anestesia simulada. MÉTODO: Foram avaliados 17 médicos em especialização do primeiro e segundo anos de Anestesiologia (ME1 e ME2 e 5 instrutores do Centro de Ensino e Treinamento (CET do HCFMUSP (Título Superior em Anestesiologia - TSA. Foi utilizado o simulador computadorizado Anesthesia Simulator Consultant (ASC versão 2.0 - 1995/Anesoft para realização das simulações dos eventos. Os incidentes críticos escolhidos foram fibrilação ventricular (FV e choque anafilático. Após a realização da simulação, foram impressos os resultados de cada participante e avaliadas e pontuadas as condutas adotadas para resolver os incidentes críticos pré-determinados. Os participantes avaliaram o simulador através do preenchimento de um questionário. RESULTADOS: Não houve diferença estatística entre as médias obtidas pelos grupos, porém notou-se uma tendência de melhor desempenho dos grupos TSA e ME2 na simulação de FV. Com relação ao choque anafilático, houve uma tendência de melhor desempenho do grupo TSA. CONCLUSÕES: O treinamento para diagnóstico e condutas em eventos adversos deve ser foco de atenção durante o treinamento de médicos residentes e na atualização de anestesiologistas. O uso do simulador pode ser uma das formas de realizar o treinamento nestas situações.JUSTIFICATIVA Y OBJETIVOS: Con la decurrencia de la grande evolución de la monitorización y del arsenal terapéutico disponible en los últimos años, hubo una reducción en la incidencia de eventos adversos

  8. Anestesia para cesariana em paciente com hiperplasia adrenal congênita: relato de caso Anestesia para cesárea en paciente con hiperplasia adrenal congénita: relato de caso Anesthesia for cesarean section in a patient with congenital adrenal hyperplasia: case report

    Directory of Open Access Journals (Sweden)

    Mrinalini Balki

    2004-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O objetivo deste relato de caso é ilustrar a conduta anestésica para cesariana em paciente portadora da forma não clássica de hiperplasia adrenal congênita (HAC e revisar as manifestações clínicas e a conduta nas suas várias formas durante a gestação. RELATO DO CASO: Paciente primigrávida, 32 anos, portadora da forma não clássica de HAC foi admitida com quadro de retardo de crescimento intra-uterino, com 28 semanas de gestação. Suas características clínicas incluíam obesidade mórbida, hipertensão arterial leve e uso crônico de glicocorticóides. Com 29 semanas de gestação, a paciente foi submetida à cesariana de emergência sob raquianestesia, observando-se administração de esteróides no período peri-operatório. Mãe e recém-nascido apresentaram boa evolução. CONCLUSÕES: A conduta clínica em parturientes portadoras de HAC deve incluir no planejamento os efeitos da corticoterapia crônica, os sinais de insuficiência adrenal e a administração peri-operatória de esteróides. Em relação à anestesia é necessário considerar aspectos relacionados à obesidade e à hipertensão arterial. Uma abordagem multidisciplinar é necessária para garantir um bom resultado materno-fetal.JUSTIFICATIVA Y OBJETIVOS: El objetivo de este relato de caso es ilustrar la conducta anestésica para cesárea en paciente portadora de la forma no clásica de hiperplasia adrenal congénita (HAC y revisar las manifestaciones clínicas y la conducta en sus varias formas durante la gestación. RELATO DEL CASO: Paciente primípara, 32 años, portadora de la forma no clásica de HAC fue admitida con cuadro de retardo de crecimiento intrauterino, con 28 semanas de gestación. Sus características clínicas incluían obesidad mórbida, hipertensión arterial leve y uso crónico de glucocorticóides. Con 29 semanas de gestación, la paciente fue sometida a cesárea de emergencia bajo raquianestesia, observ

  9. Levobupivacaína versus bupivacaína em anestesia peridural para cesarianas: estudo comparativo Levobupivacaína versus bupivacaína en anestesia peridural para cesáreas: estudio comparativo Levobupivacaine versus bupivacaine in epidural anesthesia for cesarean section: comparative study

    Directory of Open Access Journals (Sweden)

    Felipe Bergamaschi

    2005-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O anestésico local bupivacaína é encontrado na forma de dois enantiômeros: levobupivacaína - S (- e dextrobupivacaína - R (+. Baseado em estudos que demonstram que a cardiotoxicidade é menor com o enantiômero S(-, foi difundido o uso deste agente na prática clínica. Este estudo teve por objetivo comparar a eficácia e a efetividade do uso de bupivacaína racêmica com levobupivacaína em anestesia peridural de pacientes submetidas à cesariana eletiva. MÉTODO: Ensaio clínico aleatório, duplamente encoberto, com gestantes estado físico ASA I e II. As pacientes foram alocadas para receber 20 mL de bupivacaína a 0,5% racêmica ou 20 mL de levobupivacaína a 0,5%, ambas com 10 µg de sufentanil e vasoconstritor. RESULTADOS: Participaram do estudo 47 pacientes, 24 no grupo da levobupivacaína e 23 no grupo da bupivacaína. Os grupos eram comparáveis entre si quanto às características materno-fetais. Decorridos 15 minutos após o término da punção peridural, 62,5% das pacientes do grupo da levobupivacaína tinham Bromage 2 ou 3 versus 72,7% no grupo da bupivacaína (p = 0,83. Aos 20 minutos, 66,7% das pacientes do grupo da levobupivacaína tinham Bromage 2 ou 3 versus 86,3% do grupo da bupivacaína (p = 0,21. A complicação mais freqüente foi a hipotensão arterial, encontrada em 16 (66,7% pacientes do grupo da levobupivacaína e em 10 (43,5% pacientes do grupo da bupivacaína (p = 0,11. CONCLUSÕES: A levobupivacaína e a bupivacaína foram igualmente efetivas no bloqueio peridural de pacientes submetidas à cesariana.JUSTIFICATIVA Y OBJETIVOS: El anestésico local bupivacaína es encontrado en la forma de dos enantiómeros: levobupivacaína - S (- y dextrobupivacaína - R (+. Basado en estudios que demuestran que la cardiotoxicidad es menor con el enantiómero S(-, fue difundido el uso de este agente en la práctica clínica. El objetivo de este estudio es comparar la eficacia y la efectividad del

  10. Spinal and intravenous midazolan anesthetic effects on fentanyl/ ligdocaine regional anesthesia following back minor orthopedic surgery Midazolan por vía espinal o endovenosa como coadyuvante de la anestesia regional con lidocaína/fentanil en pacientes sometidos a procedimientos quirúrgicos lumbares de pequeño porte Midazolan por via espinal ou endovenosa como coadjuvante da anestesia regional com lidocaína/fentanil em pacientes submetidos a procedimentos cirúrgicos lombares de pequeno porte

    Directory of Open Access Journals (Sweden)

    Gabriela Rocha Lauretti

    2010-03-01

    Full Text Available OBJECTIVES: the present study was designed to evaluate the usefulness of intravenous and intrathecal midazolan as an adjunct to intrathecal ligdocaine, with or without intrathecal fentanyl. METHODS: double-blind study, institutional approval and informed consent; 40 patients scheduled for minor lumbar orthopedic surgery were randomly assigned to one of five groups (n=8. Patients were premedicated with a 4 mL final intravenous volume (saline or midazolan. Spinal anaesthesia was administered to a 3 mL final volume - 75 mg of lidocaina plus either 33 mg fentanyl or 500 mg midazolan diluted in saline (0,9% - with the patient in sitting position. The latency time for onset of the block (LT, time to progress to T10 sensory level (TT10, duration of the block (Bl, duration of effective analgesia (An, the subjective degree of intraoperative sedation, level of alertness, concentration level and degree of anxiety were specifically measured. P0,05. Both intrathecal fentanyl and midazolan increased the duration of analgesia (pOBJETIVOS: el presente estudio visa evaluar la utilidad de la administración del benzodiazepínico midazolan por vía venosa o espinal en pacientes sometidos a procedimientos quirúrgicos de pequeño porte sobre anestesia regional con lidocaína y fentanil. MÉTODOS: después de la aprobación del Comité de Ética en Investigación Formal, 40 pacientes fueron evaluados de forma doble-ciego y prospectivo, siendo divididos de forma aleatoria uno de los cinco grupos del estudio (n=8. Los pacientes fueron pre-medicados con midazolan o solución fisiológica (volumen final 4 mL por vía venosa. La anestesia espinal fue administrada con el paciente sentado, utilizándose 75 mg de lidocaína, 33 mg de fentanil o 500 mg de midazolan diluidos en solución fisiológica (0.9%, siendo el volumen final administrado por vía intratecal 3 mL. Fueron evaluados: el tiempo de latencia, el de bloqueo motor, el de analgesia, lo grado de sedación y de

  11. Midwestern High-Level Radioactive Waste Transportation Primer

    International Nuclear Information System (INIS)

    The Midwestern High-level Radioactive Waste Transportation Primer was prepared for the purpose of identifying and analyzing regional issues pertaining to the transportation of high-level radioactive waste and to inform Midwestern state officials with respect to technical issues and regulatory concerns related to waste transportation. The report contains an introduction which presents historical information and a discussion of public opinion regarding nuclear power and its economic competitiveness. Section 1 discusses the Civilian Radioactive Waste Management Program including the need for a waste disposal program, requirements of the Nuclear Waste Policy Act (NWPA) as amended, and obstacles to implementing the NWPA. Section 2 presents the technical program with discussions of waste generators, the monitored retrievable storage facility, the geologic repository, and the transportation system. Section 3 discusses the institutional program with respect to the federal government; states, tribes, and other interested parties; and transportation issues including modal mix, highway routing, rail routing, safeguarding shipments, accident reporting, transporting defense wastes, emergency preparedness and response, training, liability, inspection and enforcement, and state, tribal, and local regulation of transportation. 165 refs., 20 figs., 29 tabs. (MB)

  12. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  13. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  14. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  15. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-10-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  16. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-12-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  17. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  18. Influence of Ortho Primer Morelli adhesion booster on orthodontic brackets shear bond strength

    Directory of Open Access Journals (Sweden)

    Sabrina de Mendonça Invernici

    2012-06-01

    Full Text Available OBJECTIVE: This work aimed at assessing the bond strength (AS, the site of the flaw and the relation between them and Ortho Primer Morelli® (OPM adhesion optimizer. METHODS: Sixty test specimens, made out of bovine permanent lower incisors, were divided into three groups: TXT Primer (control, in which a conventional adhesive system was applied (primer and paste; OPM, in which TXT primer was replaced by OPM; and TXT without Primer, in which only TXT paste was used. A shear force was applied at a speed of 0,5 mm/min. Failure site was assessed by the Remaining Adhesion Index (RAI. RESULTS: Kruskal-Wallis demonstrated that OPM (8.54 ± 1.86 MPa presented a statistically higher AS (p 0.05 between TXT with or without Primer (6.42 ± 2.12 MPa. Regarding the RAI, the K test demonstrated that TXT Primer and OPM (prevailing scores 2 and 3 showed higher values (p 0.05. CONCLUSION: OPM increases AS and presents the same bond failure location if compared to a conventional adhesive system; the use of the TXT adhesive system paste only was shown to have the same AS if compared to conventional systems, except it does not allow to predict the adhesive failure site; there is no correlation between AS and bond failure location, regardless of the use of any adhesion optimizer.

  19. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  20. Optimization of primer design for the detection of variable genomic lesions in cancer.

    Science.gov (United States)

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  1. Guidelines for the tetra-primer ARMS-PCR technique development.

    Science.gov (United States)

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  2. Bupivacaína racêmica, levobupivacaína e ropivacaína em anestesia loco-regional para oftalmologia: um estudo comparativo Racemic bupivacaine, levobupi vacaine and ropivacaine in regional anesthesia for ophtalmology: a comparative study

    Directory of Open Access Journals (Sweden)

    Edno Magalhães

    2004-04-01

    Full Text Available OBJETIVO: A bupivacaína racêmica, utilizada largamente em anestesia peribulbar devido à boa qualidade de bloqueio motor, apresenta menor margem de segurança para cardiotoxicidade em relação a ropivacaína e bupivacaína levógira. O objetivo deste estudo foi comparar o grau de bloqueio motor e alteração da pressão intra-ocular (PIO em anestesia peribulbar produzida pela bupivacaína racêmica, levobupivacaína e ropivacaína. MÉTODOS: Noventa e sete pacientes, estado físico I e II da classificação da Sociedade Americana de Anestesiologistas, submetidos a anestesia peribulbar, foram divididos em três grupos: grupo A-(n=16 bupivacaína racêmica 0,75% com adrenalina 1:200.000; grupo B -(n=16 bupivacaína levógira 0,75% com adrenalina 1:200.000; grupo C -(n=15 ropivacaína 0,75%. Utilizou-se 7ml da solução anestésica com 280 UI de hialuronidase, em punção única no rebordo orbital inferior. Foram registrados a PIO e grau de bloqueio motor 5 minutos antes da punção e 1, 2, 3, 4, 5 e 10 minutos após a punção. O bloqueio motor foi avaliado pela escala de Nicoll. Para a análise estatística, foram utilizados os testes de Wilcoxon, análise de freqüência simples e t de Student. Foi considerado significativo pBACKGROUND AND OBJECTIVE: Racemic bupivacaine, used in peribulbar anesthesia owing to its high potential to promote motor blockade, presents a smaller safety margin for cardiotoxicity in relation to ropivacaine and levobupivacaine. The objective of this study was to compare the degree of motor blockade and alteration of intraocular pressure (IOP produced by racemic bupivacaine, levobupivacaine and ropivacaine in peribulbar block. METHOD: Ninety seven patients, ASA physical status I and II, submitted to peribulbar anesthesia, were randomly allocated into three groups: group A-(n=16 receiving racemic bupivacaine 0.75% with epinephrine 1:200.000; group B -(n=16 levobupivacaine 0.75% with epinephrine 1:200.000; group C -(n=15

  3. Estado neurológico e cardiorrespiratório de filhotes de cães nascidos de parto normal ou de cesariana sob anestesia geral inalatória com sevofluorano Neurological and cardiocirculatory investigation of dog neonates born by normal parturition or cesarean section on sevoflurane inhalation anesthesia

    Directory of Open Access Journals (Sweden)

    Daniela Tozadore Gabas

    2006-10-01

    Full Text Available A anestesia obstétrica possibilita um procedimento mais seguro para a mãe e para os fetos. Em medicina veterinária, no entanto, a literatura científica a respeito do assunto é deficiente. Este trabalho teve como objetivo avaliar o grau de depressão neurológica, hemodinâmica e respiratória fetais provocado pelo agente anestésico, em que as mães foram submetidas ao parto normal ou à cesariana, utilizando-se sevofluorano como agente de manutenção anestésica, comparando-o com o parto normal. Foram realizados seis partos normais (GN e seis cesarianas (GC, avaliando-se um total de 36 filhotes. As cesarianas foram realizadas utilizando-se acepromazina, propofol e sevofluorano (GC e os neonatos foram avaliados clinicamente ao primeiro, quinto e décimo minuto de nascimento, nos dois grupos. Observou-se maior depressão respiratória nos filhotes nascidos de cesariana. Contudo, apesar dessa depressão, o protocolo anestésico empregado não comprometeu de maneira importante a viabilidade e a saúde das mães e dos filhotes, demonstrando ser seguro em cadelas gestantes.The obstetric anesthesia must be safe for mother and puppies and about this, the literature is pour. This study was aimed at evaluating the neurological, hemodinamic and respiratory changes in neonates provoked by the anestesic agent as a result of normal parturition and cesarean section employing sevoflurane as the maintenance agent. Six deliveries (GN and six cesarean sections (GC were performed. The cesarean sections were performed under general anesthesia using acepromazina maleate, propofol and sevoflurane. Thirty six puppies were evaluated and the neurologic reflexes were worse in that were born through cesarean section. However, we concluded that despite the anesthetic depression, the protocol employed didn,t affect in any important way the viability and health of the mothers and puppies, being suitable for cesarean sections.

  4. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  5. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples 1

    OpenAIRE

    Alexandre R. Zuntini; Fonseca, Luiz Henrique M.; Lúcia G. Lohmann

    2013-01-01

    Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The sta...

  6. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  7. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    OpenAIRE

    Bruce Shiramizu; David Troelstrup; Melissa Agsalda; Ian Kusao

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH) genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer p...

  8. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  9. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  10. Silane primers rather than heat treatment contribute to adhesive bonding between tri-n-butylborane resin and a machinable leucite-reinforced ceramic

    OpenAIRE

    Sakai, Miyuki; Taira, Yohsuke; Sawase, Takashi

    2011-01-01

    The purpose of the present study was to evaluate the effects of silane primers with and without heat treatment on bonding between a resin and a leucite-reinforced ceramic (GN-Ceram). Six dental primers (GC Ceramic Primer, GP; Clearfl Ceramic Primer, CP; RelyX Ceramic Primer, RP; Tokuso Ceramic Primer, TP; Shofu Porcelain Primer, SP; and Porcelain Liner M, PM) and five experimental primers (MDS, MTS, MDES, MTES, and ATS) were evaluated. GN-Ceram specimen was primed, heated at 100°C for 60 min ...

  11. General Dentist

    Science.gov (United States)

    ... to your desktop! more... What Is a General Dentist? Article Chapters What Is a General Dentist? General ... Reviewed: January 2012 ?xml:namespace> Related Articles: General Dentists FAGD and MAGD: What Do These Awards Mean? ...

  12. Estudo clínico prospectivo aleatório sobre o uso da máscara laríngea Supreme® em pacientes submetidos a anestesia geral

    Directory of Open Access Journals (Sweden)

    Sara R. Barreira

    2013-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Dispositivos supraglóticos são cada vez mais usados como opção à intubação traqueal durante procedimentos eletivos de complexidade variável. O objetivo deste estudo foi avaliar prospectivamente o uso clínico da máscara laríngea Supreme® (MLS em pacientes submetidas a procedimentos cirúrgicos eletivos na mama e compará-la ao tubo endotraqueal (TE. MÉTODO: 60 pacientes submetidas a procedimentos cirúrgicos da mama sob anestesia geral foram distribuídas aleatoriamente em dois grupos de acordo com o dispositivo usado (MLS ou TE. Foram avaliados: tempo de inserção, número de tentativas para inserção, resposta hemodinâmica à inserção, presença de sangue no dispositivo usado e incidência de dor de garganta, disfagia, náuseas e vômitos no pós-operatório. RESULTADOS: Não houve diferença entre os grupos com relação ao tempo de inserção, ao número de tentativas para inserção bem-sucedida e à presença de sangue no dispositivo. A frequência cardíaca e a pressão arterial após a inserção foram maiores no grupo TE. A incidência de dor de garganta e disfagia após duas horas de pós-operatório também foi maior no grupo TE. Não houve diferença na incidência e na intensidade das complicações avaliadas após seis horas de pós-operatório. CONCLUSÕES: O uso da MLS como técnica de acesso à via aérea durante a anestesia geral em procedimentos cirúrgicos eletivos na mama é tão seguro e eficiente quanto a intubação traqueal, com a vantagem de desencadear menor resposta hemodinâmica durante a sua execução e menor incidência de dor de garganta e disfagia nas primeiras horas de pós-operatório.

  13. Cloridrato de tiletamina associado com cloridrato de zolazepam na tranqüilização e anestesia de calitriquídeos (Mammalia, Primates Tiletamine hydrochloride in association with zolazepam hydrochloride for the tranquilization and anesthesia of callitrichids

    Directory of Open Access Journals (Sweden)

    F.G.A. Santos

    1999-12-01

    Full Text Available Utilizou-se a associação de cloridrato de tiletamina (125mg e cloridrato de zolazepam (125mg diluídos em água destilada (10ml como tranqüilizante e anestésico em 38 animais pertencentes às espécies Saguinus imperator imperator (N= 21, Saguinus fuscicollis weddeli (N= 15 e Cebuella pygmea (N=2. Indivíduos de ambos os sexos, com pesos entre 130 e 520g, receberam doses de 0,02ml (1,11mg/kg a 0,15ml (8,33mg/kg pela via intramuscular. Na maioria dos casos ocorreu anestesia. Os animais foram libertados no mesmo dia da captura, após recuperação pós-anestésica. Não ocorreu efeito colateral aparente sobre os fetos de duas fêmeas gestantes. Apesar da morte de um animal jovem, os resultados foram considerados satisfatórios na tranqüilização e anestesia de calitriquídeos.Tiletamine hydrochloride (125mg in association with zolazepam hydrochloride (125mg diluted in distilled water (10ml were used as tranquilizer and anesthetic in 38 individuals of three species of callitrichids: 21 black-chinned emperor tamarins (Saguinus imperator imperator, 15 saddleback tamarins (Saguinus fuscicollis weddeli and 2 pygmy marmosets (Cebuella pygmea. Individuals of both sexes that had weighed between 130g and 520g received doses of 0.02ml (1.11mg/kg to 0.15ml (8.33mg/kg. In most of the cases anesthesia occurred. Marmosets were liberated in the same day of the capture, after we had verified the animal’s rehabilitation. Side effects were not apparent in the fetus of the two pregnant females. Despite the death of an young individual, the results were considered satisfactory to produce tranquillity and anesthesia in callitrichids

  14. Parada cardíaca súbita em anestesia geral como a primeira manifestação da origem anômala de artéria coronária esquerda

    Directory of Open Access Journals (Sweden)

    Maurício Daher

    2012-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O relato de caso descreve uma situação rara e potencialmente fatal associada à administração de anestesia. Nosso objetivo foi discutir as causas de parada cardíaca súbita no período perioperatório em pacientes aparentemente saudáveis e a fisiopatologia das anomalias de origem das artérias coronárias como uma causa de parada cardíaca súbita. RELATO DE CASO: Uma mulher de 44 anos, sem sintomas prévios de doença coronariana ou arritmias, apresenta parada cardíaca súbita durante a instalação de anestesia geral em duas situações distintas. No primeiro episódio, a paciente apresentava-se com quadro de abdômen agudo, porém hemodinamicamente estável. Após a indução anestésica, ocorreu bradicardia e hipotensão arterial, refratárias à reposição de volume e vasopressores. O quadro evoluiu para assistolia. A paciente foi reanimada com sucesso e recebeu alta em boas condições. No segundo episódio, um ano após o primeiro, a paciente se encontrava em boas condições clínicas para feitura de uma cirurgia eletiva. Após a indução anestésica, a paciente desenvolveu taquicardia ventricular seguida por assistolia, que foi prontamente revertida. Após extensa investigação, foi identificada uma origem anômala da artéria coronária esquerda. CONCLUSÕES: Nosso relato é ilustrativo ao enfatizar que uma investigação diagnóstica minuciosa deve ser feita nos casos de parada cardíaca súbita perioperatória, mesmo em pacientes aparentemente saudáveis.

  15. Análisis de contenido comparativo del primer nivel curricular de Educación Física en Secundaria

    OpenAIRE

    Jesús Viciana Ramírez; Francisco Salinas Martínez; Armando Cocca

    2007-01-01

    El estudio trata de comparar, a través de un análisis de contenido de frecuencias de categorías temáticas extraídas de manera inductiva, los currículos de primer nivel de la LOGSE y la nueva LOE en la etapa de Secundaria. Analizamos los objetivos generales del área de Educación Física y los principales centros de interés sobre los que se centra el currículo de primer nivel, deduciendo los cambios principales ocurridos a nivel social, y político-educativo. Se pretenden clarificar los cambios l...

  16. SLC primer for Russian translation users. [For IBM 360/195

    Energy Technology Data Exchange (ETDEWEB)

    Jordan, S.R.; Brown, A.F.R.; Hutton, F.C.

    1977-08-01

    Since 1964, a generalized language translation system has been used by the Oak Ridge National Laboratory to translate Russian scientific text to English. The translation system, first implemented at Georgetown University around 1960, has been rewritten and improved through the years as computer models changed. Although the translations lack high literary quality, the system by means of its context-sensitive dictionary nevertheless provides inexpensive, fast, and highly useful translations of scientific literature. The translation system uses a linguistically oriented programing language called SLC (Simulated Linguistic Computer), which permits description of the translation process in linguistic terms. This SLC Primer is written as an aid to users of the Russian-to-English translation system; it describes how the SLC-based translation system works and how to improve the dictionary, both by modifying old dictionary entries and by adding new ones. In the translation process, the complete augmented dictionary entries for all the word units in the sentence are analyzed for interaction so that the correct translation in this context may be produced. Numerous examples of dictionary entries and their use are included in the discussion, and an increasingly sophisticated knowledge of the SLC programing language is developed.

  17. The primer vector in linear, relative-motion equations. [spacecraft trajectory optimization

    Science.gov (United States)

    1980-01-01

    Primer vector theory is used in analyzing a set of linear, relative-motion equations - the Clohessy-Wiltshire equations - to determine the criteria and necessary conditions for an optimal, N-impulse trajectory. Since the state vector for these equations is defined in terms of a linear system of ordinary differential equations, all fundamental relations defining the solution of the state and costate equations, and the necessary conditions for optimality, can be expressed in terms of elementary functions. The analysis develops the analytical criteria for improving a solution by (1) moving any dependent or independent variable in the initial and/or final orbit, and (2) adding intermediate impulses. If these criteria are violated, the theory establishes a sufficient number of analytical equations. The subsequent satisfaction of these equations will result in the optimal position vectors and times of an N-impulse trajectory. The solution is examined for the specific boundary conditions of (1) fixed-end conditions, two-impulse, and time-open transfer; (2) an orbit-to-orbit transfer; and (3) a generalized rendezvous problem. A sequence of rendezvous problems is solved to illustrate the analysis and the computational procedure.

  18. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    OpenAIRE

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; akiyama, Hiroko; Hayatsu, Masahito

    2011-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental sa...

  19. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  20. Melioidosis en Costa Rica: Reporte del primer caso

    Directory of Open Access Journals (Sweden)

    Alfredo Messino Julio

    2000-09-01

    Full Text Available Melioidosis es una enfennedad infecciosa causada por la Burkholderia pseudomallef. Esta enfermedad es endémica en áreas tropicales de Asia y Australia y ha habido reportes aislados en Centro y Sur América. Aquí nosotros informamos del primer caso probado de melioidosis en Costa Rica, correspondiendo a un paciente sin historia de viajes a lugares endémicos. El paciente consultó por una bronconeumonía de adquisición comunitaria y sepsis. El hecho que el aislamiento bacteriano sea tan inusual en nuestro país implicó un retraso subsecuente en el inicio del tratamiento antibiótico específico en este caso, lo cual pudo influir en la evolución tan tórpida del paciente. Esto nos plantea el interrogante de si esta enfermedad debe ser incluida en el diagnóstico diferencial de sepsis de adquisición comunitaria en nuestro país.Melioidosis in an infectious disease caused by Burkholderia pseudomallei. This disease is endemie in areas of tropical Asia and Australia; there have been isolated reports of the disease in Central and South America. Here we report the first documented case of Melioidosis in Costa Rica in a patient without a history of traveling lo endemic areas. The patient was seen at the hospital because of sepsis and a community acquired bronchopneumonia. Due lo the rareness of this bacterial isolation in our country the corroboration of the diagnosis was delayed and subsequently the specific antibiotics were started 5 days later after the admission, this could have influenced the torpid evolution the patient had. This case should alert us and points lo the need of including this rare disease in the differential diagnosis of community acquired sepsis in our country.

  1. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  2. Anestesia para paciente portadora de múltiplas afecções endócrinas: relato de caso Anestesia para paciente portadora de múltiples afecciones endocrinas: relato de caso Anesthesia in a patient with multiple endocrine abnormalities: case report

    Directory of Open Access Journals (Sweden)

    Renato Toledo Maciel

    2008-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O insulinoma é o tumor endócrino pancreático mais comum. Pode estar associado a neoplasias endócrinas múltiplas (NEM. Relatou-se o caso de paciente com distúrbios endócrinos múltiplos que, no entanto, não se enquadram em síndromes (NEM já conhecidas e com particularidades clínico-anestésicas que influenciaram no manuseio de sua anestesia. RELATO DO CASO: Paciente feminina, 23 anos, apresentando hipoglicemias de difícil controle associadas à doença de Cushing e prolactinoma, sem sintomas compressivos hipofisários e com estudos de tireóide e de paratireóides sem alterações. A investigação laboratorial encontrou massa retroperitoneal de etiologia desconhecida que, relacionada à situação clínica, levou a hipótese de insulinoma. Relatava ainda ser testemunha de Jeová. A proposta terapêutica era biópsia da massa por videolaparoscopia e enucleação do insulinoma. Ao exame: obesa, dentes protrusos, Mallampati 3 e sintomas de apnéia obstrutiva do sono. Nos exames laboratoriais, o resultado relevante foi o hematócrito de 58%. Recebeu midazolam (7,5 mg e clonidina (200 µg via oral como medicação pré-anestésica. A indução anestésica foi realizada com fentanil (150 µg, clonidina (90 µg, propofol (150 mg e pancurônio (8 mg, sendo realizada a intubação traqueal sem problemas. Foram estabelecidos acesso venoso central e monitoração invasiva da pressão. Mantida infusão de glicose 5% com eletrólitos e monitorada a glicemia capilar a cada 30 minutos, que não acusou episódios de hipoglicemia durante a intervenção cirúrgica. Manteve-se hemodinamicamente estável mesmo durante o pneumoperitônio. No pós-operatório apresentou episódios de hipoglicemia que motivaram sua reoperação. CONCLUSÕES: A singularidade do caso está na conjunção de múltiplas endocrinopatias e de particularidades do manuseio cirúrgico-anestésico. A exérese do insulinoma deve ser monitorada no intra

  3. Uso do azul de metileno no tratamento de choque anafilático durante anestesia: relato de caso Uso del azul de metileno en el tratamiento de choque anafiláctico durante anestesia: relato de caso Methylene blue to treat anaphylaxis during anesthesia: case report

    Directory of Open Access Journals (Sweden)

    Renato Mestriner Stocche

    2004-12-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: No período peri-operatório, o risco de anafilaxia deve sempre ser considerado. A incidência de reações alérgicas em anestesia é controversa, variando entre 1/3000 a 1/20.000, com mortalidade entre 3% e 9 %. Neste caso, relata-se o uso do azul de metileno como coadjuvante ao tratamento do choque anafilático refratário à terapêutica tradicional. RELATO DO CASO: Paciente do sexo masculino, 53 anos, submetido a herniorrafia inguinal sob raquianestesia. No final do procedimento, ao receber dipirona (1,5 g, por via venosa, o paciente imediatamente apresentou broncoespasmo, cianose, diminuição da SpO2 e da PAS, culminando com parada cardiorrespiratória. Foi iniciada reanimação cardiorrespiratória com massagem cardíaca externa, seguida de IOT e injeção de adrenalina (1 mg, atropina (1 mg, restabelecendo-se FC de 150 bpm, porém sem pulso palpável. Administrou-se mais 1 mg de adrenalina além de 1 g de hidrocortisona, com restabelecimento de pulso central (8 minutos. Apesar de receber dopamina (20 µg.kg-1.min-1, o paciente manteve-se hipotenso (60 mmHg até 80 minutos. Administraram-se 100 mg de azul de metileno por via venosa, quando houve aumento da PAS para 85 e 105 mmHg, após a segunda dose. Seguiu-se da diminuição da dose de dopamina de 20 para 10, 7, 5 e, finalmente, 2 µg.kg-1.min-1. CONCLUSÕES: A anafilaxia tem como principal mediador a liberação de histamina, que induz a produção de óxido nítrico (NO, com conseqüente aumento da guanilato ciclase que promove vasodilatação arteriolar por aumento do GMP cíclico. O azul de metileno pode ser útil nestas situações, pois inibe a guanilato ciclase e conseqüentemente a vasodilatação, o que resulta em melhora hemodinâmica.JUSTIFICATIVA Y OBJETIVOS: En el período peri-operatorio, el riesgo de anafilaxis siempre debe ser considerado. La incidencia de reacciones alérgicas en anestesia es polémica, variando entre 1/3000 a 1/20.000, con

  4. Anestesia para cirurgia bariátrica: avaliação retrospectiva e revisão da literatura Anestesia para cirugía bariátrica: evaluación retrospectiva y revisión de la literatura Anesthesia for bariatric surgery: retrospective evaluation and literature review

    Directory of Open Access Journals (Sweden)

    Airton Bagatini

    2006-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O tratamento cirúrgico para a obesidade mórbida é forma eficaz de manutenção do controle ponderal por longo prazo. O objetivo deste trabalho foi realizar um levantamento das complicações, das comorbidades e dos principais aspectos do manuseio anestésico de pacientes submetidos à cirurgia da obesidade e comparar os resultados com os dados encontrados na literatura. MÉTODO: O trabalho foi realizado por meio de revisão bibliográfica e análise retrospectiva do prontuário dos pacientes submetidos à cirurgia bariátrica entre setembro de 2001 e dezembro de 2004. Todos foram submetidos ao mesmo procedimento, técnica de Capella, por laparotomia, realizada por uma única equipe cirúrgica e no mesmo hospital. RESULTADOS: Houve predomínio de pacientes do sexo feminino, a média de idade foi de 39,6 anos e o índice de massa corporal (IMC médio foi de 44,65 kg/m². A hipertensão arterial sistêmica (HAS foi a doença mais prevalente e as complicações encontradas foram trombose de veia subclávia, infecção pulmonar, bloqueio neuromuscular residual, sangramento gastrintestinal no pós-operatório, obstrução intestinal e deiscência anastomótica. O índice de mortalidade foi de 0,7%. CONCLUSÕES: As doenças como HAS e osteoartrose são muito prevalentes em pacientes obesos. Dentre as complicações do pós-operatório destacam-se as do sistema respiratório. Com isso percebe-se a importância do uso de técnica anestésica e de analgesia pós-operatória, que permita ao paciente a deambulação precoce, bem como a capacidade de respirar e tossir de forma adequada. Observou-se que muitos aspectos da anestesia do paciente obeso já estão definidos como benéficos ou prejudiciais; entretanto, vários assuntos ainda encontram-se indefinidos e cabe estudar e discutir para que se consiga melhorar cada vez mais o manuseio anestésico desses pacientes.JUSTIFICATIVA Y OBJETIVOS: El tratamiento quirúrgico para la

  5. Anestesia para o recém-nascido submetido a cirurgia cardíaca com circulação extracorpórea Anestesia para el recién nacido sometido a cirugía cardiaca con circulación extracorpórea Anesthesia for the newborn submitted to cardiac surgery with cardiopulmonary bypass

    Directory of Open Access Journals (Sweden)

    Sérgio Bernardo Tenório

    2005-02-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: As doenças congênitas do coração atingem 0,8% dos recém-nascidos (RN vivos, sendo que muitos necessitam de correção cirúrgica ainda no período neonatal. A cirurgia cardíaca com circulação extracorpórea (CEC, nesta faixa etária, associa-se a maior incidência de complicações, devido à imaturidade funcional da criança, à falta de equipamentos de CEC que sejam totalmente compatíveis com as dimensões do RN e às dificuldades técnicas para correção da lesão cardíaca. Este artigo tem o propósito de apresentar os aspectos relacionados à técnica anestésica, a CEC e seus efeitos em RN. CONTEÚDO: Elevadas doses de fentanil ou sufentanil provêm adequada anestesia sem interferir na estabilidade cardiocirculatória. A depressão respiratória residual dos opióides não é problema neste grupo de pacientes porque a maioria necessita assistência respiratória no pós-operatório imediato. A entrada em CEC pode ser acompanhada de hipotensão arterial por manipulação do coração e/ou sangramento. O posicionamento inadequado das cânulas venosas e aórtica pode causar sérias complicações, como insuficiente fluxo encefálico ou dificuldade na drenagem venosa. São comuns a utilização de hipotermia profunda e a parada circulatória total durante a CEC. A hipotermia modifica a viscosidade do sangue que é tratada com hemodiluição e traz implicações para a correção do pH (alfa-stat versus pH stat. No desmame da CEC é freqüente ocorrer baixo débito cardíaco e ajustes em um ou em todos os seus componentes ( pré-carga, contratilidade, pós-carga e freqüência cardíaca podem ser necessários. Além das drogas clássicas, como a adrenalina e a dopamina, pode ser necessário o emprego de outras substâncias como a aprotinina, o óxido nítrico ou os inibidores da fosfodiesterase. CONCLUSÕES: O anestesiologista tem papel preponderante no ajuste da homeostasia durante o período peri

  6. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Science.gov (United States)

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  7. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2004-01-01

    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing of...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...... intensities were obtained in the 5500-10 300 m/z mass range by increasing the concentration of the longer SBE primers in the reaction. To validate the technique, 17 Y-chromosome SNPs were analyzed in 200 males. The precision and accuracy of the mass determination were analyzed by parametric statistic, and the...

  8. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere;

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required......, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used to...... investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed to...

  9. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  10. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  11. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  12. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven by...... cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  13. POT1–TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation

    OpenAIRE

    Latrick, Chrysa M; Cech, Thomas R.

    2010-01-01

    Telomerase contributes to chromosome end replication by synthesizing repeats of telomeric DNA, and the telomeric DNA-binding proteins protection of telomeres (POT1) and TPP1 synergistically increase its repeat addition processivity. To understand the mechanism of increased processivity, we measured the effect of POT1–TPP1 on individual steps in the telomerase reaction cycle. Under conditions where telomerase was actively synthesizing DNA, POT1–TPP1 bound to the primer decreased primer dissoci...

  14. Review of the PCR Primer Eesign Method%PCR引物设计方法综述

    Institute of Scientific and Technical Information of China (English)

    尤超; 赵大球; 梁乘榜; 周春华

    2011-01-01

    In order to obtain an ideal method of PCR primer design, the author completed primer design of target gene, using some databases and software tools for primer design, such as NCBI, Primer Premier 5.0 and so on, combined with the principle of primer design.Then made a research on optimization of conditions for PCR reaction after the designed primer was analyzed through BLAST comparison, comprehensive evaluation and gene retest analysis. The results indicated that primers designed through these databases and softwares could basically meet the requirements of following RTPCR reaction, and could make an in-depth study of molecular biology.%为了获得PCR引物设计的理想方法.笔者运用NCBI等数据库与引物设计软件Primer Premier 5.0等工具,结合引物设计的原则,完成目的基因的引物设计,并对设计后的引物进行BLAST比对、综合评价和基因的重新检测等分析,据此对PCR反应条件进行优化研究。结果表明,通过这些数据库和软件所设计的引物能基本满足后续的RT—PCR反应,可以进行进一步的分子生物学研究。

  15. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    OpenAIRE

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chlo...

  16. PCR primers that allow intergeneric differentiation of ascomycetes and their application to Verticillium spp.

    OpenAIRE

    Li, K N; Rouse, D. I.; German, T L

    1994-01-01

    A pair of conserved PCR primers, designated NMS1 and NMS2, that amplify a region in the mitochondrial small rRNA gene region were designed for fungi belonging to the class Ascomycetes. These primers were tested with members of eight fungal genera (Aspergillus, Fusarium, Magnaporthe, Mycospharella, Neurospora, Saccharomyces, Sclerotinia, Verticillium) and 10 Verticillium species (Verticillium albo-atrum, Verticillium chlamydosporium, Verticillium cinnebarium, Verticillium dahliae, Verticillium...

  17. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A;

    1999-01-01

    Retroviral reverse transcription is primed by a cellular tRNA molecule annealed to an 18-bp primer binding site sequence. The sequence of the primer binding site coincides with that of a negatively acting cis element that mediates transcriptional silencing of murine leukemia virus (MLV) in...... undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary to...... findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  18. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  19. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  20. All creatures great and minute: a public policy primer for companion animal zoonoses.

    Science.gov (United States)

    Reaser, J K; Clark, E E; Meyers, N M

    2008-10-01

    Approximately 63% of US households have at least one pet, a large percentage of which are considered family members. Pet owners can derive substantial physical and psychological benefits from interaction with companion animals. However, pet ownership is not without risks; zoonotic diseases are increasingly drawing the attention of healthcare professionals, policy makers and the general public. While zoonoses of 'traditional' pets are widely recognized and their prevention and treatment factors are generally known, the growing popularity of 'non-traditional' pets has the potential to facilitate human exposure to novel zoonoses. However, the greatest risk of zoonoses probably arises from animals taken directly from the wild to serve as pets. Non-governmental organizations, state veterinary associations and others have been calling for increased regulation of animal imports, some proposing that all 'exotics' be banned from the pet trade. Because zoonotic diseases of companion animals are influenced by interacting factors of ecological, technical, socio-economic, and political origin, efforts to minimize their impact need be multi-dimensional, simultaneously addressing both the ecological and socio-political drivers of disease emergence and transmission. This study is intended to serve as a primer for animal care professionals seeking to engage with policy makers and the pet industry on the prevention of companion animal zoonoses. We provide background on the human-animal bond, risks of zoonoses associated with groups of companion animals, and the public policy context, as well as identify the factors needed to build a comprehensive approach to companion animal zoonoses risk management. Also included are examples of innovative, non-regulatory initiatives designed to limit the spread and impact of companion animal zoonoses, including a reptile salmonella poster, the National Reptile Improvement Plan, Habitattitude campaign, Pet Zoonoses Committee, and a wildlife disease

  1. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  2. PRIMER HALLAZGO DE Cyclospora cayetanensis EN CONCEPCION, CHILE 1997

    Directory of Open Access Journals (Sweden)

    NANCY RIVERA

    1997-07-01

    Full Text Available Se describe el hallazgo de Cyclospora cayetanensis en una muestra de deposición, en la cual se observó también formas vacuoladas de Blastocystis hominis y trofozoítos y quistes de Entamoeba coli. La muestra provenía de un paciente de 50 Es importante señalar que la sola observación años de edad, de sexo femenino, quien había visitado Cuba, y que, a los 5 días de regreso a Chile, comenzó con sintomatología. El examen parasitológico seriado de deposición se llevó a cabo 30 días después de su regreso al país. Se realizó observación al fresco de heces preservadas en fijador PAF (fenol, alcohol, formalina con lugol, MIF (merthiolate, lugol, formol, y yodo de D'Antoni; al mismo tiempo se prepararon 3 frotis del sedimento fecal los que fueron teñidos mediante tinción de Ziehl Neelsen modificada, Kinyou y Safranina. Una proporción de los O quistes encontrados fueron medidos. La identificación de C. cayetanensis fue confirmada en esta muestra por el Center for Disease Control and Prevention (CDC Atlanta, Georgia, USA y por el Departamento de Parasitología del Hospital for Tropical Diseases (London UK. Este constituye el primer hallazgo de C. cayetanensis informado en Concepción, ChileThe finding of Cyclospora cayetanensis in a stool sample from a 50 year old Chilean female patient is reported. The patient had recently returned from a visit to Cuba and exhibited diarrhoeal symptons in the fifth day after arriving to Chile. The stool sample was obtained 30 days after her return to the country. Direct microscopic abservation were made in preparations of the stool sample preserved in phenol, alcohol, fonmalin (PAF with iodine, merthiolate, iodine-fonmalin (MIF and iodine de D'Antoni. In addition, three smears of the faecal sedimenl were stained with madified Ziehl-Neelsen, Kinyou, and Safranin. The oocyst sizes were measured. The identification of C. cayetanensis was confinmed in this sample by the Center for Disease control and

  3. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  4. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    Science.gov (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength. PMID:22414522

  5. Mixed Low-Level Radioactive Waste (MLLW) Primer

    International Nuclear Information System (INIS)

    This document presents a general overview of mixed low-level waste, including the regulatory definitions and drivers, the manner in which the various kinds of mixed waste are regulated, and a discussion of the waste treatment options

  6. Mixed Low-Level Radioactive Waste (MLLW) Primer

    Energy Technology Data Exchange (ETDEWEB)

    W. E. Schwinkendorf

    1999-04-01

    This document presents a general overview of mixed low-level waste, including the regulatory definitions and drivers, the manner in which the various kinds of mixed waste are regulated, and a discussion of the waste treatment options.

  7. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    Science.gov (United States)

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  8. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  9. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    Science.gov (United States)

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  10. O Conhecimento de diferenças raciais pode evitar reações idiossincrásicas na anestesia? El conocimiento de diferencias raciales puede evitar reacciones idiosincrásicas en la anestesia? Could the understanding of racial differences prevent idiosyncratic anesthetic reactions?

    Directory of Open Access Journals (Sweden)

    Nilton Bezerra do Vale

    2003-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: No campo da variabilidade inter-étnica da resposta de drogas anestésicas e adjuvantes existem várias questões sem resposta. Estamos na iminência de sermos capazes de identificar diferenças raciais herdadas que podem prever a resposta de cada paciente aos anestésicos pelo atual desenvolvimento farmacogenético. CONTEÚDO: O conhecimento de fatores inter-étnicos que alteram a resposta à droga permitirá ao anestesiologista evitar reações idiossincrásicas: (1 Branco caucasiano - aumento do efeito diurético da dopamina; apnéia prolongada após succinilcolina ou mivacúrio; arritmias cardíacas após uso de halotano e catecolaminas na síndrome de Riley-Day; ataques agudos de porfiria após tiopental. (2 Negro americano: diferentes abordagens terapêuticas, hipertensão arterial essencial advêm da pior resposta aos anti-hipertensivos de IECA, inibidores do AT1, bloqueadores beta e à clonidina, contrastando com a melhor resposta anti-hipertensiva dos diuréticos, antagonistas de canais de cálcio e clarvedilol; ação vasodilatadora atenuada do isoproterenol (beta2 e uma maior resposta vasodilatadora à nitroglicerina sublingual; menor ação fibrinolítica do t-PA; recuperação mais lenta da anestesia venosa pela associação de remifentanil e propofol; menor glicuronidação do paracetamol e menos analgesia da codeína nos fracos metabolizadores (CYP2D6; a melanina retarda o início da analgesia epidérmica do creme anestésico EMLA; menor midríase pela adrenalina; maior broncoespasmo à metacolina em crianças asmáticas; deficit da G-6-PD nas hemácias eleva o risco de hemólise a drogas oxidativas (10% da população negra. (3 Asiáticos: alterações cinéticas tóxicas da meperidina e codeína; maior duração da ansiólise do diazepam; espasmo coronariano pela injeção de metilergonovina no pós-parto; inter-relação do receptor GABA, das desidrogenases e do comportamento de beber nip

  11. Anestesia do tronco encefálico após bloqueio retrobulbar extraconal: é possível evitar? Relato de caso Anestesia del tronco encefálico después de bloqueo retrobulbar extraconal: ¿se puede evitar? Relato de caso Brainstem anesthesia after extraconal retrobulbar block: can it be avoided? Case report

    Directory of Open Access Journals (Sweden)

    Haroldo Maciel Carneiro

    2007-08-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: O CEROF-HC é uma instituição pública especializada em oftalmologia. A realização de bloqueios anestésicos para intervenções cirúrgicas oftálmicas é prática comum e eficiente. Como técnica não é isenta de riscos, há possibilidade de perfuração de meninges e a injeção de anestésico local (AL na região do sistema nervoso central (SNC. O objetivo deste relato foi mostrar um caso de anestesia do tronco encefálico como complicação do bloqueio oftálmico e chamar a atenção para a profilaxia do acidente e o tratamento das complicações. RELATO DO CASO: Paciente do sexo feminino, 60 anos, ASA II, com diagnóstico de catarata grau II, indicada para facectomia com implante de lente intra-ocular no olho direito. Histórico clínico de hipertensão arterial e antecedente de vitrectomia. Exames físicos, laboratoriais e cardiológicos normais. Foi realizado bloqueio retrobulbar extraconal, com anestésico local (lidocaína e bupivacaína e hialuronidase (volume total de 5 mL. Imediatamente após, a paciente apresentou apnéia e perda da consciência. Foi tratada com intubação traqueal (IOT e ventilação mecânica, mantendo-se estável. Foi realizada a operação. Começou a se movimentar 30 minutos após IOT, recuperando-se totalmente, sem apresentar qualquer seqüela. CONCLUSÕES: O bloqueio oftálmico, apesar de seguro, não é isento de riscos. O principal fator de risco é a inadequada realização da técnica anestésica. O anestésico local (AL, no bloqueio oftálmico, pode atingir o SNC por punção inadvertida da artéria oftálmica ou por punção das meninges que envolvem o nervo óptico, com a dispersão para o espaço subaracnóideo. Embora rara, pode levar a complicação grave, com parada respiratória, que, se não diagnosticada e tratada prontamente, pode ser fatal. São apresentadas as possibilidades de ocorrência dessa complicação, assim como a discussão da nomenclatura dos

  12. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  13. Wind Energy and Air Emission Reduction Benefits: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Jacobson, D.; High, C.

    2008-02-01

    This document provides a summary of the impact of wind energy development on various air pollutants for a general audience. The core document addresses the key facts relating to the analysis of emission reductions from wind energy development. It is intended for use by a wide variety of parties with an interest in this issue, ranging from state environmental officials to renewable energy stakeholders. The appendices provide basic background information for the general reader, as well as detailed information for those seeking a more in-depth discussion of various topics.

  14. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan

    2013-01-01

    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  15. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms.

    Science.gov (United States)

    Fonseca, P A S; Rosse, I C; Demiranda, M; Machado, M A; Verneque, R S; Peixoto, M G C D; Carvalho, M R S

    2013-01-01

    Kappa-casein (κ-casein) is one of the most abundant milk proteins. Its main function is to avoid the aggregation of casein micelles, keeping them, and therefore calcium phosphate, in pockets in solution. In bovines, a κ-casein functional polymorphism has been associated with fat, calcium, and protein milk contents and faster curd contraction in cheese production. Quicker curd contraction reduces the loss of milk solids, enhancing cheese yield. This polymorphism induces a double amino acid substitution (Thr136Ile and Ala148Asp). The polymorphism is normally detected by PCR-RFLP, which is a laborious method. An interesting methodological alternative is the tetra-primer amplification refractory mutation system PCR (tetra-primer ARMS-PCR). A tetra-primer ARMS-PCR for the detection of this κ-casein polymorphism has been described. However, specificity was not achieved, probably due to problems with primer design. We developed a new tetra-primer ARMS-PCR for the detection of the κ-casein polymorphism. This new method was validated in a double-blind test, by comparison with the results obtained for 50 Guzerá bulls formerly genotyped by PCR-RFLP. This new method achieved 100% sensitivity and specificity. We conclude that this method is a useful, cost-efficient alternative for the detection of functional κ-casein polymorphisms. PMID:24390998

  16. Primer Screening for Dyera costulata (Miq Hook.f Random Amplified Polymorphic DNA Analyses

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2009-01-01

    Full Text Available Dyera costulata (Miq. Hook.f (Apocynaceae is a large tree of the lowland tropical rain forest of Southeast Asia, Thailand, Malay Peninsula and Indonesia, especially in Sumatra and Kalimantan (Borneo islands. Its economic value was in its copious latex, used as gum in the manufacture of chewing gum. Today the timber of this species is much sought after for the manufacture of pencils and picture frames. Information on genetic diversity of the species is very limited. Hence studies were initiated to screen primers for RAPD analyses of Dyera costulata for use in genetic variation studies. Seventy one Operon primers (10 mer were used to generate a total of 864 consistent and ambiguous amplification products ranging from 200 bp to 2.0 kb. Rare and genotype specific bands were identified which could be effectively used to distinguish the genotypes. 34 highly polymorphic primers (100% are recorded from 71 primers used. Three primers (OPA-04, OPU-06, and OPU-07 produced highest variable RAPD profiles. The dendrogram separated the 8 genotypes into 2 groups. Genetic dissimilarity ranged from 0.07 to 0.71 %.

  17. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. PMID:21445907

  18. Measuring reporting verifying. A primer on MRV for nationally appropriate mitigation actions

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (ed.); Luetken, S.; Holm Olsen, K. (Technical Univ. of Denmark. UNEP Risoe Centre, Roskilde (Denmark)); Aalders, E.; Pretlove, B.; Peters, N. (Det Norske Veritas, Hellerup (Denmark))

    2012-03-15

    The requirements for measurement, reporting and verification (MRV) of nationally appropriate mitigation actions (NAMAs) are one of the crucial topics on the agenda of international negotiations to address climate change mitigation. According to agreements so far, the general guidelines for domestic MRV are to be developed by Subsidiary Body for Scientific and Technological Advice (SBSTA)1. Further, the Subsidiary Body for Implementation (SBI) will be conducting international consultations and analysis (ICA) of biennial update reports (BUR) to improve transparency of mitigation actions, which should be measured, reported and verified. 2. What is clear from undergoing discussions both at SBSTA and at SBI is that MRV for NAMAs should not be a burden for controlling greenhouse gas (GHG) emissions connected to economic activities. Instead, the MRV process should facilitate mitigation actions; encourage the redirection of investments and address concerns regarding carbon content of emission intensive operations of private and public companies and enterprises worldwide. While MRV requirements are being shaped within the Convention, there are a number of initiatives supporting developing countries moving forward with NAMA development and demonstration activities. How these actions shall be measured, reported and verified, however, remain unanswered. MRV is not new. It is present in most existing policies and frameworks related to climate change mitigation. With an aim to contribute to international debate and capacity building on this crucial issue, the UNEP Risoe Centre in cooperation with UNDP, are pleased to present this publication that through the direct collaboration with Det Norske Veritas (DNV) builds on existing MRV practices in current carbon markets; provides insights on how MRV for NAMAs can be performed and identifies elements and drivers to be considered when designing adequate MRV systems for NAMAs in developing countries. This primer is the second

  19. A Primer on Wastewater Treatment, July 1976 Edition.

    Science.gov (United States)

    Environmental Protection Agency, Washington, DC. Office of Public Affairs.

    This general information pamphlet is concerned with the types of wastewater treatment systems, the need for further treatment, and advanced methods of treating waste. Current methods are described, illustrated and evaluated. Pollution problems from oxygen-demanding wastes, disease-causing agents, plant nutrients, synthetic chemicals, inorganic…

  20. Estudo clínico e cardiorrespiratório em cadelas gestantes com parto normal ou submetidas à cesariana sob anestesia inalatória com sevofluorano Clinical and cardiorespiratory study in bitches under normal parturition or underwent to cesarean section using inalatory anesthesia with sevoflurane

    OpenAIRE

    D.T. Gabas; V.N.L.S. Oliva; L.M. Matsuba; PERRI, S H V

    2006-01-01

    Estudaram-se as alterações hemodinâmicas e respiratórias em cadelas, decorrentes do parto normal e da cesariana, utilizando-se sevofluorano como agente de manutenção anestésica. Foram acompanhados seis partos normais e seis cesarianas, sendo as últimas realizadas sob anestesia geral utilizando-se acepromazina, propofol e sevofluorano. Durante o parto normal, ao nascimento de cada filhote, as gestantes foram monitoradas (temperatura retal, pressão arterial não-invasiva, freqüências respiratóri...

  1. Avaliação da analgesia pós-operatória em pacientes submetidos à cirurgia orificial com anestesia local associada ou não à morfina Evaluation of the postoperative analgesia in patients submitted to anorectal surgery with local anesthesia associated or not the morphine

    OpenAIRE

    Juvenal da Rocha Torres Neto; Daniel Carvalho de Menezes; Ana Carolina Lisboa Prudente; Joara Costa Almeida; Jorge Gontran Torres de Menezes

    2007-01-01

    Ainda não esta comprovada a eficácia dos derivados morfínicos ao nível de receptores opióides periféricos. Estudos procuram demonstrar o poder da droga em interferir na intensidade da dor quando infiltrada em nervos periféricos. Avaliamos, então, a infiltração local de morfina associada à anestesia local em cirurgias orificiais proctológicas. Nesse estudo foram analisados 61 pacientes, independentemente do gênero, sendo divididos aleatoriamente em dois grupos: a um grupo foi associada morfina...

  2. Complicações pós-operatórias menores relacionadas à anestesia em pacientes de cirurgias eletivas ginecológicas e ortopédicas em um hospital universitário de Kingston, Jamaica

    Directory of Open Access Journals (Sweden)

    Ingrid Tennant

    2012-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: As complicações anestésicas pós-operatórias menores podem aumentar o desconforto e a insatisfação do paciente e retardar sua recuperação. Este trabalho procurou determinar a frequência das complicações menores relatadas nas primeiras 48 horas do período pós-operatório por pacientes de cirurgias eletivas (ginecológicas e ortopédicas no University Hospital of the West Indies, Jamaica. A satisfação geral com os cuidados anestésicos e os possíveis fatores de risco para desenvolver complicações também foram avaliados. MÉTODOS: Um estudo prospectivo e descritivo de coorte foi realizado por meio de entrevistas com pacientes operados 24 e 48 horas após a anestesia. Os dados foram analisados usando SPSS versão 12 e avaliados pelo teste do χ2-quadrado e modelos de regressão logística múltipla. RESULTADOS: Foram incluídos 505 pacientes, sendo 374 do sexo feminino (74%. A maioria era ASA I (55% ou ASA II (38% e foi submetida à anestesia geral (80%. Um total de 419 (83% pacientes relataram pelo menos uma complicação pós-operatória. As complicações mais relatadas foram dor de garganta (44%, náusea (30%, vômito (24% e tromboflebite (20%. A moda do Índice de Classificação Numérica Verbal (ICNV para cada complicação variou entre 2 e 5, sugerindo que a maioria não causa desconforto grave. Idade inferior a 45 anos (OR 2,22, IC de 95% 1,34-3,69, p = 0,002 e sexo feminino (OR 3,64, IC de 95% 2,14-6,20, p < 0,001 foram identificados como variáveis independentes significativas. A maioria dos pacientes considerou sua experiência anestésica como excelente (51% ou muito boa (22%. CONCLUSÃO: Este estudo mostrou uma incidência relativamente alta de complicações menores pós-operatórias (83%, mas baixa gravidade dos sintomas relatados e um alto grau de satisfação geral. Deve ser dada atenção especial à redução dessas complicações menores por meio de técnicas anestésicas mais

  3. 茎-环RT-PCR法定量miRNA-421的引物设计%Stem-Loop Real-Time Quantitative PCR for Quantification of miRNA-421 by Specific Primers

    Institute of Scientific and Technical Information of China (English)

    赵丽; 杨洋; 温传俊

    2012-01-01

    本研究旨在通过茎环RT-PCR法,建立有效定量miRNA-421的PCR方法,探讨该方法在定量检测miRNA方面的应用价值.利用miRBase数据库获得miRNA-421的成熟序列.设计3条miRNA-421特异性反转录引物,Q-PCR上游引物及通用下游引物.通过10倍梯度稀释RNA后特异性反转录,RT-PCR分析不同引物互相配对PCR的扩增曲线及熔融曲线,鉴定出特异性好、扩增效率高的引物.为进一步鉴定引物的有效性,过表达miRNA-421,用鉴定的成熟引物定量扩增.利用茎-环RT-PCR法设计、鉴定出miRNA-421引物:421RT7、F19,且这对引物特异性好、扩增效率高.通过设计引物组合,茎-环RT-PCR法能够很好地用于miRNA定量分析,并具有准确、快速、节约成本的优点.%This study was to establish a method of quantitative detecting miRNA-421 by stem-loop RT-PCR, and to evaluate the feasibility of this method in quantitative assay miRNA. miRBase database was used to get the mature sequence of miRNA-421. 6 primers were designed, including 3 primers for miRNA-421 specific reverse transcription, 2 forward and 1 general reverse primers for quantitative PCR, respectively. Different RT primers and forward primers were paired in Q-PCR. RNA after 10 times dilution was reverse transcribed and then detected by Q-PCR. Amplification curves and melting curves were analyzed to identify the primers with high specificity and efficiency of amplification. In order to further validate this primer, miRNA^21 was over-expressed in HepG2 and detected by Q-PCR. 2 primers, 421RT7 and 421F19 with high specificity and efficiency of amplification were obtained using stem-loop RT-PCR. Stem-loop RT-PCR provided a method that enabled fast, accurate and sensitive detection of miRNA.

  4. Bloqueo aurículo-ventricular de primer grado en tirotoxicosis aguda First degree atrio-ventricular block in acute thyrotoxicosis

    OpenAIRE

    Antonio R. Vilches; Jorge Lerman

    2004-01-01

    El cuadro clínico de la tirotoxicosis incluye síntomas cardiovasculares variados. La taquicardia sinusal es el trastorno electrocardiográfico más frecuente y los trastornos de conducción son extremadamente raros como modo de presentación. Comunicamos un caso de bloqueo aurículo-ventricular de primer grado en una paciente con hipertiroidismo recién diagnosticado y que comenzó días antes de la consulta con un cuadro general inespecífico. Su evaluación ulterior demostró que se trataba de una tir...

  5. Bioética y calidad en la atención de primer contacto y de salud pública

    OpenAIRE

    Octaviano Domínguez Márquez; Carolina Manrique Nava

    2011-01-01

    Se realiza un estudio de revisión y análisis transdisciplinario respecto de la integración entre la calidad total y los procesos del ámbito de la salud, específicamente en el primer nivel de atención, desde la medicina general y la salud pública. Se revisan los aspectos principales de la calidad total y su enfoque en la atención a la salud, y la pertinencia de que valores, principios y corrientes de pensamiento se reflejen objetivamente en los procesos de la calidad total. El énfasis de la ca...

  6. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for...... automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the...... propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore...

  7. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  8. New primers for promising single-copy genes in fungal phylogenetics and systematics.

    Science.gov (United States)

    Schmitt, I; Crespo, A; Divakar, P K; Fankhauser, J D; Herman-Sackett, E; Kalb, K; Nelsen, M P; Nelson, N A; Rivas-Plata, E; Shimp, A D; Widhelm, T; Lumbsch, H T

    2009-12-01

    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Lichinomycetes and Sordariomycetes, indicate the utility of these loci for fungal phylogenetics at taxonomic levels ranging from genus to class. We also tested the new primers in silico using sequences of Saccharomycotina, Taphrinomycotina and Basidiomycota to predict their potential of amplifying widely across the Fungi. The analyses suggest that the new primers will need no, or only minor sequence modifications to amplify Saccharomycotina, Taphrinomycotina and Basidiomycota. PMID:20198159

  9. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...... most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we...

  10. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann

    2005-01-01

    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  11. Microsatellite primers in the weedy annual herb Anacyclus clavatus (Asteraceae) and four closely related species1

    Science.gov (United States)

    Agudo, Alicia; Picó, F. Xavier; Álvarez, Inés

    2013-01-01

    • Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. • Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. • Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus. PMID:25202498

  12. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  13. Microsatellite Primers in the Weedy Annual Herb Anacyclus clavatus (Asteraceae and Four Closely Related Species

    Directory of Open Access Journals (Sweden)

    Alicia Agudo

    2013-10-01

    Full Text Available Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus.

  14. The effect of dentin primer on the shear bond strength between composite resin and enamel.

    Science.gov (United States)

    Hadavi, F; Hey, J H; Ambrose, E R; Louie, P W; Shinkewski, D J

    1993-01-01

    The purpose of this study was to determine the effect of accidental dentin primer contact with etched enamel on shear bond strength of composite resin to enamel. Four dentin bonding systems were included in this study: GLUMA Dentin Bond, Scotchbond, and Prisma Universal Bond 2 and 3. Eighty extracted human permanent anterior teeth were used and divided in eight test groups. The vestibular surfaces were ground and acid etched. For each dentin bonding system 10 samples were treated with dentin primer prior to placement of resin. Shear bond testing showed that enamel contact with dentin primer in the above two systems decreased the shear bond strength between composite and enamel by 31 to 44%. PMID:8337183

  15. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  16. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  17. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    Science.gov (United States)

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  18. First discussion for fostering the photovoltaic energy in Mexico; Primer coloquio para el fomento de la energia fotovoltaica en Mexico

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-06-15

    The varied spheres (political, environmental, economic, scientific and social) day by day are looking for the key issues, which are going to make them to preserve or disappear either in the present or in the future. Therefore, it was carried out the first conversation in the State of Zacatecas, Mexico. Here there were shown different advances related to the renewable energies by those spheres. Generally speaking, it was in this event where there were gather together private and government organs in order to present every issue related to the use and to the promotion of the renewable energies. By these means, it was probed that the renewable energies are: the current market, the groundbreaking technology, the best option friendly-environment, the panacea for the society and for the improvement of the economy of many countries both developing countries and developed countries. The renewable energy topic is seen from different point of views. [Spanish] Las diferentes esferas que rigen el dia a dia; es decir, la politica, el medio ambiente, la economia, las ciencias y la sociedad, siempre estan en busca de cuestiones que las hagan crecer y evolucionar para asi seguir ocupando un espacio no solo en el presente sino tambien en el futuro. En esta ocasion fue en el primer coloquio, realizado en el Estado de Zacatecas, Mexico, donde dichas esferas se reunieron con el fin de mostrar sus diversos avances acerca de las energias fotovoltaicas. En otras palabras, fue en este coloquio donde se reunieron organos privados y gubernamentales con el fin de mostrar todo lo relacionado con el uso y la promocion de las energias renovables. Comprobando que las energias renovables son tanto: el mercado de hoy, la tecnologia de punta, la mejor opcion ambiental, la panacea para la sociedad y para la mejora de la economia de muchos paises en vias de desarrollo y de primer mundo. En estas ponencias no solo se habla de las energias renovables desde un aspecto cientifico, sino tambien financiero

  19. Theoretical Physics: A Primer for Philosophers of Science

    Directory of Open Access Journals (Sweden)

    Francisco Antonio Doria

    2009-08-01

    Full Text Available We give a overview of the main areas in theoretical physics, with emphasis on their relation to Lagrangian formalism in classical mechanics. This review covers classical mechanics; the road from classical mechanics to Schrödinger’s quantum mechanics; electromagnetism, special and general relativity, and (very briefly gauge field theory and the Higgs mechanism. We shun mathematical rigor in favor of a straightforward presentation.

  20. Radiation Dose from Medical Imaging: A Primer for Emergency Physicians

    Directory of Open Access Journals (Sweden)

    Jesse G.A. Jones, MD

    2012-05-01

    Full Text Available Introduction: Medical imaging now accounts for most of the US population’s exposure to ionizingradiation. A substantial proportion of this medical imaging is ordered in the emergency setting. We aimto provide a general overview of radiation dose from medical imaging with a focus on computedtomography, as well as a literature review of recent efforts to decrease unnecessary radiation exposureto patients in the emergency department setting.Methods: We conducted a literature review through calendar year 2010 for all published articlespertaining to the emergency department and radiation exposure.Results: The benefits of imaging usually outweigh the risks of eventual radiation-induced cancer inmost clinical scenarios encountered by emergency physicians. However, our literature review identified3 specific clinical situations in the general adult population in which the lifetime risks of cancer mayoutweigh the benefits to the patient: rule out pulmonary embolism, flank pain, and recurrent abdominalpain in inflammatory bowel disease. For these specific clinical scenarios, a physician-patientdiscussion about such risks and benefits may be warranted.Conclusion: Emergency physicians, now at the front line of patients’ exposure to ionizing radiation,should have a general understanding of the magnitude of radiation dose from advanced medicalimaging procedures and their associated risks. Future areas of research should include thedevelopment of protocols and guidelines that limit unnecessary patient radiation exposure.