WorldWideScience

Sample records for androgen regulated genes

  1. Androgens regulate gene expression in avian skeletal muscles.

    Directory of Open Access Journals (Sweden)

    Matthew J Fuxjager

    Full Text Available Circulating androgens in adult reproductively active male vertebrates influence a diversity of organ systems and thus are considered costly. Recently, we obtained evidence that androgen receptors (AR are expressed in several skeletal muscles of three passeriform birds, the golden-collared manakin (Manacus vitellinus, zebra finch (Taenopygia guttata, and ochre-bellied flycatcher (Mionectes oleagieus. Because skeletal muscles that control wing movement make up the bulk of a bird's body mass, evidence for widespread effects of androgen action on these muscles would greatly expand the functional impact of androgens beyond their well-characterized effects on relatively discrete targets throughout the avian body. To investigate this issue, we use quantitative PCR (qPCR to determine if androgens alter gene mRNA expression patterns in wing musculature of wild golden-collared manakins and captive zebra finches. In manakins, the androgen testosterone (T up-regulated expression of parvalbumin (PV and insulin-like growth factor I (IGF-I, two genes whose products enhance cellular Ca(2+ cycling and hypertrophy of skeletal muscle fibers. In T-treated zebra finches, the anti-androgen flutamide blunted PV and IGF-I expression. These results suggest that certain transcriptional effects of androgen action via AR are conserved in passerine skeletal muscle tissue. When we examined wing muscles of manakins, zebra finches and ochre-bellied flycatchers, we found that expression of PV and IGF-I varied across species and in a manner consistent with a function for AR-dependent gene regulation. Together, these findings imply that androgens have the potential to act on avian muscle in a way that may enhance the physicality required for successful reproduction.

  2. Identification and characterization of the minimal androgen-regulated kidney-specific kidney androgen-regulated protein gene promoter

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The kidney androgen-regulated protein (Kap) gene is tissue specific and regulated by androgen in mouse kidney proximal tubule cells (PTCs). In the present study, we aimed to identify the minimal PTC-specific androgen-regulated Kap promoter and analyze its androgen response elements (AREs).Adeletion series of the Kap1542 promoter/luciferase constructs were assayed in opossum kidney (OK) PTCs in the presence or absence of 15 nM dihydrotestosterone (DHT). Kap 1542 and Kap637 had low activity and no androgen induction; Kap224 had a basal activity that was 4- to 5-fold higher than that of Kap 1542, but was only sfightly induced by DHT. Kap 147 had a basal activity that was 2- to 3-fold higher than that of Kap 1542 and was induced by DHT 4- to 6-fold. Kap77 abol-ished basal promoter activity but was still induced by DHT. Results showed that, in vitro, Kap147 was a minimal androgen-regulated promoter. Transient transfection in different cells demonstrated that Kap147 specifically initi-ated reporter gene expression in PTCs. Sequence analysis revealed two potential AREs located at positions -124 and -39 of Kap147. Mutational assays showed that only the ARE at -124 was involved in androgen response in OK cells. Electrophoretic mobility shift assay also verified -124 ARE bound specifically to androgen receptor. In conclusion, we defined the minimal Kap 147 promoter that may be a good model for the study of kidney PTC-specific expression and molecular mechanisms that lead to an androgen-specific responsiveness in vivo.

  3. Androgen regulation of the TMPRSS2 gene and the effect of a SNP in an androgen response element.

    Science.gov (United States)

    Clinckemalie, Liesbeth; Spans, Lien; Dubois, Vanessa; Laurent, Michaël; Helsen, Christine; Joniau, Steven; Claessens, Frank

    2013-12-01

    More than 50% of prostate cancers have undergone a genomic reorganization that juxtaposes the androgen-regulated promoter of TMPRSS2 and the protein coding parts of several ETS oncogenes. These gene fusions lead to prostate-specific and androgen-induced ETS expression and are associated with aggressive lesions, poor prognosis, and early-onset prostate cancer. In this study, we showed that an enhancer at 13 kb upstream of the TMPRSS2 transcription start site is crucial for the androgen regulation of the TMPRSS2 gene when tested in bacterial artificial chromosomal vectors. Within this enhancer, we identified the exact androgen receptor binding sequence. This newly identified androgen response element is situated next to two binding sites for the pioneer factor GATA2, which were identified by DNase I footprinting. Both the androgen response element and the GATA-2 binding sites are involved in the enhancer activity. Importantly, a single nucleotide polymorphism (rs8134378) within this androgen response element reduces binding and transactivation by the androgen receptor. The presence of this SNP might have implications on the expression and/or formation levels of TMPRSS2 fusions, because both have been shown to be influenced by androgens.

  4. Identification of testosterone-/androgen receptor-regulated genes in mouse Sertoli cells

    Institute of Scientific and Technical Information of China (English)

    Qiao-Xia Zhang; Xiao-Yan Zhang; Zhen-Ming Zhang; Wei Lu; Ling Liu; Gang Li; Zhi-Ming Cai; Yao-Ting Gui; Chawnshang Chang

    2012-01-01

    Androgen and androgen receptor (AR) play important roles in male spermatogenesis and fertility,yet detailed androgenlAR signals in Sertoli cells remain unclear.To identify AR target genes in Sertoli cells,we analyzed the gene expression profiles of testis between mice lacking AR in Sertoli cells (S-AR-/y) and their littermate wild-type (WT) mice.Digital gene expression analysis identified 2276 genes downregulated and 2865 genes upregulated in the S-AR-/y mice testis compared to WT ones.To further nail down the difference within Sertoli cells,we first constructed Sertoli cell line TM4 with stably transfected AR (named as TM4/AR) and found androgens failed to transactivate AR in Sertoli TM4 and TM4/AR cells.Interestingly,additional transient transfection of AR-cDNA resulted in significant androgen responsiveness with TM4/AR cells showing 10 times more androgen sensitivity than TM4 cells.In the condition where maximal androgen response was demonstrated,we then analyzed gene expression and found the expression levels of 2313 genes were changed more than twofold by transient transfection of AR-cDNA in the presence of testosterone.Among these genes,603 androgen-/ AR-regulated genes,including 164 upregulated and 439 downregulated,were found in both S-AR-/y mice testis and TM4/AR cells.Using informatics analysis,the gene ontology was applied to analyze these androgen-/AR-regulated genes to predict the potential roles of androgen/AR in the process of spermatogenesis.Together,using gene analysis in both S-AR-/y mice testis and TM4/AR cells may help us to better understand the androgen/AR signals in Sertoli cells and their influences in spermatogenesis.

  5. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Harold D Love

    Full Text Available Benign prostatic hyperplasia (BPH and prostate carcinoma (CaP are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1 highly expressed in prostate, 2 had significant expression changes in response to androgens, and, 3 encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  6. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Science.gov (United States)

    Love, Harold D; Booton, S Erin; Boone, Braden E; Breyer, Joan P; Koyama, Tatsuki; Revelo, Monica P; Shappell, Scott B; Smith, Jeffrey R; Hayward, Simon W

    2009-12-21

    Benign prostatic hyperplasia (BPH) and prostate carcinoma (CaP) are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ) human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1) highly expressed in prostate, 2) had significant expression changes in response to androgens, and, 3) encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  7. Identification of androgen-responsive genes that are alternatively regulated in androgen-dependent and androgen-independent rat prostate tumors.

    NARCIS (Netherlands)

    Pfundt, R.; Smit, F.P.; Jansen, Corine; Aalders, T.W.; Straatman, H.M.P.M.; Vliet, W. van der; Isaacs, J.; Geurts van Kessel, A.H.M.; Schalken, J.A.

    2005-01-01

    The vast majority of androgen-dependent prostate tumors progress toward incurable, androgen-independent tumors. The identification of androgen-responsive genes, which are still actively transcribed in the tumors of patients who have undergone androgen ablation, may shed light on the molecular mechan

  8. Androgen receptor regulation of the seladin-1/DHCR24 gene: altered expression in prostate cancer.

    Science.gov (United States)

    Bonaccorsi, Lorella; Luciani, Paola; Nesi, Gabriella; Mannucci, Edoardo; Deledda, Cristiana; Dichiara, Francesca; Paglierani, Milena; Rosati, Fabiana; Masieri, Lorenzo; Serni, Sergio; Carini, Marco; Proietti-Pannunzi, Laura; Monti, Salvatore; Forti, Gianni; Danza, Giovanna; Serio, Mario; Peri, Alessandro

    2008-10-01

    Prostate cancer (CaP) represents a major leading cause of morbidity and mortality in the Western world. Elevated cholesterol levels, resulting from altered cholesterol metabolism, have been found in CaP cells. Seladin-1 (SELective Alzheimer Disease INdicator-1)/DHCR24 is a recently described gene involved in cholesterol biosynthesis. Here, we demonstrated the androgen regulation of seladin-1/DHCR24 expression, due to the presence of androgen responsive element sequences in its promoter region. In metastatic androgen receptor-negative CaP cells seladin-1/DHCR24 expression and cholesterol amount were reduced compared to androgen receptor-positive cells. In tumor samples from 61 patients who underwent radical prostatectomy the expression of seladin-1/DHCR24 was significantly higher with respect to normal tissues. In addition, in cancer tissues mRNA levels were positively related to T stage. In tumor specimens from 23 patients who received androgen ablation treatment for 3 months before surgery seladin-1/DHCR24 expression was significantly lower with respect to patients treated by surgery only. In conclusion, our study demonstrated for the first time the androgen regulation of the seladin-1/DHCR24 gene and the presence of a higher level of expression in CaP tissues, compared to the normal prostate. These findings, together with the results previously obtained in metastatic disease, suggest an involvement of this gene in CaP.

  9. Differentially expressed androgen-regulated genes in androgen-sensitive tissues reveal potential biomarkers of early prostate cancer.

    Directory of Open Access Journals (Sweden)

    Dogus Murat Altintas

    Full Text Available BACKGROUND: Several data favor androgen receptor implication in prostate cancer initiation through the induction of several gene activation programs. The aim of the study is to identify potential biomarkers for early diagnosis of prostate cancer (PCa among androgen-regulated genes (ARG and to evaluate comparative expression of these genes in normal prostate and normal prostate-related androgen-sensitive tissues that do not (or rarely give rise to cancer. METHODS: ARG were selected in non-neoplastic adult human prostatic epithelial RWPE-1 cells stably expressing an exogenous human androgen receptor, using RNA-microarrays and validation by qRT-PCR. Expression of 48 preselected genes was quantified in tissue samples (seminal vesicles, prostate transitional zones and prostate cancers, benign prostatic hypertrophy obtained from surgical specimens using TaqMan® low-density arrays. The diagnostic performances of these potential biomarkers were compared to that of genes known to be associated with PCa (i.e. PCA3 and DLX1. RESULTS AND DISCUSSION: By crossing expression studies in 26 matched PCa and normal prostate transitional zone samples, and 35 matched seminal vesicle and PCa samples, 14 genes were identified. Similarly, 9 genes were overexpressed in 15 benign prostatic hypertrophy samples, as compared to PCa samples. Overall, we selected 8 genes of interest to evaluate their diagnostic performances in comparison with that of PCA3 and DLX1. Among them, 3 genes: CRYAB, KCNMA1 and SDPR, were overexpressed in all 3 reference non-cancerous tissues. The areas under ROC curves of these genes reached those of PCA3 (0.91 and DLX1 (0.94. CONCLUSIONS: We identified ARG with reduced expression in PCa and with significant diagnostic values for discriminating between cancerous and non-cancerous prostatic tissues, similar that of PCA3. Given their expression pattern, they could be considered as potentially protective against prostate cancer. Moreover, they could

  10. Estrogen and androgen regulate actin-remodeling and endocytosis-related genes during rat spermiation.

    Science.gov (United States)

    Kumar, Anita; Dumasia, Kushaan; Gaonkar, Reshma; Sonawane, Shobha; Kadam, Leena; Balasinor, N H

    2015-03-15

    Spermiation, the sperm release process, is imperative to male fertility and reproduction. Morphologically, it is characterized by removal of atypical adherens junctions called ectoplasmic specializations, and formation of transient endocytic devices called tubulobulbar complexes requiring cytoskeleton remodeling and recruitment of proteins needed for endocytosis. Earlier, estrogen administration to adult male rats was seen to cause spermiation failure due to disruption of tubulobulbar complexes. This was accompanied by reduction in intratesticular testosterone levels and increase in intratesticular estrogen along with deregulation of genes involved in cytoskeleton remodeling (Arpc1b, Evl and Capg) and endocytosis (Picalm, Eea1 and Stx5a). In the present study, we aim to understand the role of estrogen and androgen in regulating these genes independently using seminiferous tubule culture system treated with estrogen, androgen or agonists and antagonists of estrogen receptors. We find that transcripts of Arpc1b, Evl and Picalm are responsive to estrogen while those of Picalm, Eea1 and Stx5a are responsive to androgen. We also find that the estrogen regulation of Arpc1b and Evl is mediated through estrogen receptor β and that of Picalm occurs through estrogen receptors α and β. Localization of these proteins at or in the vicinity of tubulobulbar complexes reveals that ARPC1B, EVL, PICALM, EEA1 and STX5A seem to be involved in spermiation. Thus, estrogen and androgen regulate specific genes in seminiferous tubules that could play a role in spermiation.

  11. Microarray analysis of androgen-regulated gene expression in testis: the use of the androgen-binding protein (ABP-transgenic mouse as a model

    Directory of Open Access Journals (Sweden)

    Grossman Gail

    2005-12-01

    Full Text Available Abstract Background Spermatogenesis is an androgen-dependent process, yet the molecular mechanisms of androgens' actions in testis are poorly understood. Transgenic mice overexpressing rat androgen-binding protein (ABP in their testes have reduced levels of intratesticular androgens and, as a result, show a progressive impairment of spermatogenesis. We used this model to characterize changes in global gene expression in testis in response to reduced bioavailability of androgens. Methods Total RNA was extracted from testes of 30-day old transgenic and wild-type control mice, converted to cRNA, labeled with biotin, and hybridized to oligonucleotide microarrays. Microarray results were confirmed by real-time reverse transcription polymerase chain reaction. Results Three-hundred-eighty-one genes (3.05% of all transcripts represented on the chips were up-regulated and 198 genes (1.59% were down-regulated by at least a factor of 2 in the androgen-deficient animals compared to controls. Genes encoding membrane proteins, intracellular signaling molecules, enzymes, proteins participating in the immune response, and those involved in cytoskeleton organization were significantly overrepresented in the up-regulated group. Among the down-regulated transcripts, those coding for extracellular proteins were overrepresented most dramatically, followed by those related to proteolysis, cell adhesion, immune response, and growth factor, cytokine, and ion channel activities. Transcripts with the greatest potential impact on cellular activities included several transcription factors, intracellular signal transducers, secreted signaling molecules and enzymes, and various cell surface molecules. Major nodes in the up-regulated network were IL-6, AGT, MYC, and A2M, those in the down-regulated network were IL-2, -4, and -10, MAPK8, SOCS1, and CREB1. Conclusion Microarray analysis followed by gene ontology profiling and connectivity analysis identified several functional

  12. Androgen receptor- and PIAS1-regulated gene programs in molecular apocrine breast cancer cells.

    Science.gov (United States)

    Malinen, Marjo; Toropainen, Sari; Jääskeläinen, Tiina; Sahu, Biswajyoti; Jänne, Olli A; Palvimo, Jorma J

    2015-10-15

    We have analyzed androgen receptor (AR) chromatin binding sites (ARBs) and androgen-regulated transcriptome in estrogen receptor negative molecular apocrine breast cancer cells. These analyses revealed that 42% of ARBs and 39% androgen-regulated transcripts in MDA-MB453 cells have counterparts in VCaP prostate cancer cells. Pathway analyses showed a similar enrichment of molecular and cellular functions among AR targets in both breast and prostate cancer cells, with cellular growth and proliferation being among the most enriched functions. Silencing of the coregulator SUMO ligase PIAS1 in MDA-MB453 cells influenced AR function in a target-selective fashion. An anti-apoptotic effect of the silencing suggests involvement of the PIAS1 in the regulation of cell death and survival pathways. In sum, apocrine breast cancer and prostate cancer cells share a core AR cistrome and target gene signature linked to cancer cell growth, and PIAS1 plays a similar coregulatory role for AR in both cancer cell types.

  13. A protein in rat prostatic chromatin interacting with androgen regulated gene

    Institute of Scientific and Technical Information of China (English)

    XUYOUHAI; RONGCHANG; 等

    1992-01-01

    2M NaCl-insoluble fraction of rat ventral Prostate chromatin(residual proteins)contain proteins able to interact specifically with androgen-receptor complex and is ,therefore,a part of the aceptor complex.Among residual proteins a 98 KDa protein has been found which binds significantly to a genomic fiagment containing an androgen-regulated gene coding for a 22 KDa protein The biological significance of this binding in androgen action need to be further studied.A mini-plasmid clone containing 22 KDa protein coding sequence was cloned into charon 4A genomic library from which a 5.7 Kb genomic fragment was isolated,identified by hybridization with a 5' and a 3' cDNA probes,and shown to contain the 3' flanking sequence.Restriction enzyme treatment of this fragment yielded a 4.7 Kb restriction fragmwent representing the 5' upstream region and a 1.0 Kb containing part of the coding sequence.Deletion studies indicated that the 97 KDa protein bound only to a subclone of about 300 bp segment .Furthermore,gel shifting experiment supported its DNA-protein binding.

  14. Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.

    Science.gov (United States)

    Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao

    2009-11-01

    Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.

  15. Down-regulation of Zac1 gene expression in rat white adipose tissue by androgens.

    Science.gov (United States)

    Mirowska, Agnieszka; Sledzinski, Tomasz; Smolenski, Ryszard T; Swierczynski, Julian

    2014-03-01

    ZAC1 is a zinc-finger protein transcription factor, a transcriptional cofactor for nuclear receptors, and a co-activator of nuclear receptors, which interacts with multiple signaling pathways affecting apoptosis, cell cycle arrest, and metabolism. Some data suggest that ZAC1 regulates the expression of genes associated with function of adipose tissue. Since there is no information about the levels of Zac1 gene expression in white adipose tissue (WAT), and the expression of several genes associated with metabolic function of WAT is significantly lower in male than female animals, we have examined: (a) the relative ZAC1 mRNA levels in some organs/tissues, including three main depots of WAT, in 3-month-old male rats; (b) the relative ZAC1 mRNA levels in WAT of male and female rats; (c) the effect of orchidectomy and orchidectomy with concomitant testosterone treatment on ZAC1 mRNA and protein levels; (d) the effect of ovariectomy and ovariectomy with concomitant 17β-estradiol treatment on ZAC1 mRNA levels; (e) the effect of dihydrotestosterone on ZAC1 mRNA levels in isolated adipocytes. Our results indicate that: (a) ZAC1 mRNA levels are relatively high in WAT in comparison with other organs/tissues; (b) ZAC1 mRNA levels in subcutaneous WAT are approximately 2-fold lower than in epididymal and retroperitoneal adipose tissue; (c) ZAC1 mRNA levels in WAT of adult female rats are approximately 2-fold higher than in male rats; (d) testosterone is inversely related to ZAC1 mRNA and protein levels in WAT of male rats; and (e) dihydrotestosterone decreases the ZAC1 mRNA levels in adipocytes in dose dependent manner. In conclusion, Zac1 gene is highly expressed in white adipose tissue of adult rats. Androgens could play an important role in down-regulation of the ZAC1 mRNA and protein levels in rats.

  16. Development of an androgen reporter gene assay (AR-LUX) utilizing a human cell line with an endogenously regulated androgen receptor

    NARCIS (Netherlands)

    Blankvoort, B.M.G.; Groene, E.M. de; Meeteren-Kreikamp, A.P. van; Witkamp, R.F.; Rodenburg, R.J.T.; Aarts, J.M.M.J.G.

    2001-01-01

    The aim of the work described in this report is to develop and characterize a cell-based androgen reporter assay. For this purpose, the androgen receptor (AR) expressing human breast cancer cell line T47D was stably transfected with a luciferase gene under transcriptional control of the PB-ARE-2 and

  17. Development of an androgen reporter gene assay (AR-LUX) utilizing a human cell line with an endogenously regulated androgen receptor.

    Science.gov (United States)

    Blankvoort, B M; de Groene, E M; van Meeteren-Kreikamp, A P; Witkamp, R F; Rodenburg, R J; Aarts, J M

    2001-11-01

    The aim of the work described in this report is to develop and characterize a cell-based androgen reporter assay. For this purpose, the androgen receptor (AR) expressing human breast cancer cell line T47D was stably transfected with a luciferase gene under transcriptional control of the PB-ARE-2 androgen response element. The application of this cell line in an endogenous Androgen Receptor-mediated LUciferase eXpression assay (AR-LUX) was validated. An EC50 value of 86 pM was determined for the standard androgen R1881 with a detection limit of 46 pM. Other androgens like dihydrotestosterone, 17beta-trenbolone, and bolasterone also induced luciferase expression, while anti-androgens suppressed these responses. As expected, AR-mediated responses were also elicited by high concentrations of the steroids progesterone, 17beta-estradiol, d-aldosterone, and dexamethasone, with observed EC50 values 10 to 350,000 times higher than that for R1881. A unique feature of the AR-LUX assay is that effects on modulation of active endogenous AR-levels are reliably reflected in the luciferase induction response, as exemplified by vitamin D, all-trans-retinoic acid, epigallocatechin gallate, and forskolin. This feature is especially useful when assessing complex mixtures, e.g., environmental samples or natural compound libraries. From these data it is concluded that the AR-LUX assay is a reliable in vitro test system for the detection and quantification of AR-mediated biological effects. The 96-well plate format makes the assay particularly suitable for high-throughput screening.

  18. Androgen-androgen receptor system improves chronic inflammatory conditions by suppressing monocyte chemoattractant protein-1 gene expression in adipocytes via transcriptional regulation.

    Science.gov (United States)

    Morooka, Nobukatsu; Ueguri, Kei; Yee, Karen Kar Lye; Yanase, Toshihiko; Sato, Takashi

    2016-09-02

    Age-related decreases in sex hormones are closely related to chronic inflammation in obesity and metabolic diseases. Particularly, the molecular basis of androgen activity in regulating inflammation and controlling metabolism remains largely unknown. Obese adipocytes secrete monocyte chemoattractant protein-1 (MCP-1), a key chemokine that promotes the infiltration of monocytes/macrophages into adipose tissue, thereby leading to metabolic disorders. Here, we studied the role of androgen-androgen receptor (AR) action in regulating MCP-1 expression in adipose tissue. We observed the induction of Mcp-1 expression in 3T3-L1 adipocytes co-cultured with RAW264.7 macrophages. Additionally, Mcp-1 expression was upregulated by culturing in conditioned medium derived from inflammatory macrophages (M1-Mφ) containing tumor necrosis factor-alpha (TNF-α). We found that sex hormones downregulated TNF-α-induced Mcp-1 and interleukin (Il)-6 expression in 3T3-L1 adipocytes. Furthermore, luciferase-reporter analysis indicated that MCP-1 promoter activity was predominantly suppressed by dihydrotestosterone (DHT)-AR interactions through functional canonical nuclear factor-kappa B (NF-κB) sites, whereas non-canonical NF-κB site containing important flanking sequences exhibited minor contributions to DHT-AR transcriptional repression. These findings suggested that androgen-AR suppressed obesity-induced chronic inflammation in adipose tissue.

  19. Androgen receptor and its splice variant, AR-V7, differentially regulate FOXA1 sensitive genes in LNCaP prostate cancer cells.

    Science.gov (United States)

    Krause, William C; Shafi, Ayesha A; Nakka, Manjula; Weigel, Nancy L

    2014-09-01

    Prostate cancer (PCa) is an androgen-dependent disease, and tumors that are resistant to androgen ablation therapy often remain androgen receptor (AR) dependent. Among the contributors to castration-resistant PCa are AR splice variants that lack the ligand-binding domain (LBD). Instead, they have small amounts of unique sequence derived from cryptic exons or from out of frame translation. The AR-V7 (or AR3) variant is constitutively active and is expressed under conditions consistent with CRPC. AR-V7 is reported to regulate a transcriptional program that is similar but not identical to that of AR. However, it is unknown whether these differences are due to the unique sequence in AR-V7, or simply to loss of the LBD. To examine transcriptional regulation by AR-V7, we have used lentiviruses encoding AR-V7 (amino acids 1-627 of AR with the 16 amino acids unique to the variant) to prepare a derivative of the androgen-dependent LNCaP cells with inducible expression of AR-V7. An additional cell line was generated with regulated expression of AR-NTD (amino acids 1-660 of AR); this mutant lacks the LBD but does not have the AR-V7 specific sequence. We find that AR and AR-V7 have distinct activities on target genes that are co-regulated by FOXA1. Transcripts regulated by AR-V7 were similarly regulated by AR-NTD, indicating that loss of the LBD is sufficient for the observed differences. Differential regulation of target genes correlates with preferential recruitment of AR or AR-V7 to specific cis-regulatory DNA sequences providing an explanation for some of the observed differences in target gene regulation.

  20. Complex modulation of androgen responsive gene expression by methoxyacetic acid

    Directory of Open Access Journals (Sweden)

    Stanley Kerri A

    2011-03-01

    Full Text Available Abstract Background Optimal androgen signaling is critical for testicular development and spermatogenesis. Methoxyacetic acid (MAA, the primary active metabolite of the industrial chemical ethylene glycol monomethyl ether, disrupts spermatogenesis and causes testicular atrophy. Transcriptional trans-activation studies have indicated that MAA can enhance androgen receptor activity, however, whether MAA actually impacts the expression of androgen-responsive genes in vivo, and which genes might be affected is not known. Methods A mouse TM3 Leydig cell line that stably expresses androgen receptor (TM3-AR was prepared and analyzed by transcriptional profiling to identify target gene interactions between MAA and testosterone on a global scale. Results MAA is shown to have widespread effects on androgen-responsive genes, affecting processes ranging from apoptosis to ion transport, cell adhesion, phosphorylation and transcription, with MAA able to enhance, as well as antagonize, androgenic responses. Moreover, testosterone is shown to exert both positive and negative effects on MAA gene responses. Motif analysis indicated that binding sites for FOX, HOX, LEF/TCF, STAT5 and MEF2 family transcription factors are among the most highly enriched in genes regulated by testosterone and MAA. Notably, 65 FOXO targets were repressed by testosterone or showed repression enhanced by MAA with testosterone; these include 16 genes associated with developmental processes, six of which are Hox genes. Conclusions These findings highlight the complex interactions between testosterone and MAA, and provide insight into the effects of MAA exposure on androgen-dependent processes in a Leydig cell model.

  1. Antioxidants Abrogate Alpha-Tocopherylquinone-Mediated Down-Regulation of the Androgen Receptor in Androgen-Responsive Prostate Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Alexandra M Fajardo

    Full Text Available Tocopherylquinone (TQ, the oxidation product of alpha-tocopherol (AT, is a bioactive molecule with distinct properties from AT. In this study, AT and TQ are investigated for their comparative effects on growth and androgenic activity in prostate cancer cells. TQ potently inhibited the growth of androgen-responsive prostate cancer cell lines (e.g., LAPC4 and LNCaP cells, whereas the growth of androgen-independent prostate cancer cells (e.g., DU145 cells was not affected by TQ. Due to the growth inhibitory effects induced by TQ on androgen-responsive cells, the anti-androgenic properties of TQ were examined. TQ inhibited the androgen-induced activation of an androgen-responsive reporter and inhibited the release of prostate specific antigen from LNCaP cells. TQ pretreatment was also found to inhibit AR activation as measured using the Multifunctional Androgen Receptor Screening assay. Furthermore, TQ decreased androgen-responsive gene expression, including TM4SF1, KLK2, and PSA over 5-fold, whereas AT did not affect the expression of androgen-responsive genes. Of importance, the antiandrogenic effects of TQ on prostate cancer cells were found to result from androgen receptor protein down-regulation produced by TQ that was not observed with AT treatment. Moreover, none of the androgenic endpoints assessed were affected by AT. The down-regulation of androgen receptor protein by TQ was abrogated by co-treatment with antioxidants. Overall, the biological actions of TQ were found to be distinct from AT, where TQ was found to be a potent inhibitor of cell growth and androgenic activity in androgen-responsive prostate cancer cells.

  2. Expression of androgen receptor target genes in skeletal muscle

    OpenAIRE

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR)-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (ARΔZF2 ) versus w...

  3. Androgenic Regulation of White Adipose Tissue-Prostate Cancer Interactions

    Science.gov (United States)

    2015-08-01

    oncogenes; inactivation of tumor suppression genes; and interaction between cancer cells and tumor-associated stroma and tumor- associated macrophages ...into inflamed tissue and dif- ferentiate into macrophages , which coordinate inflammatory re- sponses by producing chemokines and clearing debris by...AWARD NUMBER: W81XWH-10-1-0275 TITLE: Androgenic Regulation of White Adipose Tissue-Prostate Cancer Interactions PRINCIPAL INVESTIGATOR

  4. Testicular steroidogenesis is locally regulated by androgen via suppression of Nur77.

    Science.gov (United States)

    Song, Chin-Hee; Gong, Eun-Yeung; Park, Ji soo; Lee, Keesook

    2012-06-01

    Steroidogenesis in the testis is regulated by a negative feedback mechanism through the hypothalamus-pituitary-testis axis. Recent studies suggest that besides this long-loop regulation, testicular steroidogenesis is also locally regulated by androgen. However, the molecular mechanism behind this additional regulatory pathway has been poorly addressed. In the present study, we demonstrate that liganded androgen receptor (AR) suppresses the transcriptional activity of Nur77 on steroidogenic enzyme gene promoters, affecting testicular steroidogenesis. AR physically interacts and colocalizes with Nur77 in the nucleus in the presence of androgen. AR inhibits Nur77 transactivation by competing mainly with coactivators such as SRC-1 for Nur77 binding. These results suggest that androgen, through binding to AR, directly acts as a signal inhibiting the expression of steroidogenic enzyme genes in Leydig cells, eventually resulting in decreased testicular steroidogenesis. These findings strongly support the hypothesis that androgen acts locally to regulate testicular steroidogenesis, and may provide its action mechanism.

  5. A competitive inhibitor that reduces recruitment of androgen receptor to androgen-responsive genes.

    Science.gov (United States)

    Cherian, Milu T; Wilson, Elizabeth M; Shapiro, David J

    2012-07-01

    The androgen receptor (AR) has a critical role in the growth and progression of androgen-dependent and castration-resistant prostate cancers. To identify novel inhibitors of AR transactivation that block growth of prostate cancer cells, a luciferase-based high-throughput screen of ~160,000 small molecules was performed in cells stably expressing AR and a prostate-specific antigen (PSA)-luciferase reporter. CPIC (1-(3-(2-chlorophenoxy) propyl)-1H-indole-3-carbonitrile) was identified as a small molecule that blocks AR transactivation to a greater extent than other steroid receptors. CPIC inhibited AR-mediated proliferation of androgen-sensitive prostate cancer cell lines, with minimal toxicity in AR-negative cell lines. CPIC treatment also reduced the anchorage-independent growth of LAPC-4 prostate cancer cells. CPIC functioned as a pure antagonist by inhibiting the expression of AR-regulated genes in LAPC-4 cells that express wild-type AR and exhibited weak agonist activity in LNCaP cells that express the mutant AR-T877A. CPIC treatment did not reduce AR levels or alter its nuclear localization. We used chromatin immunoprecipitation to identify the site of action of CPIC. CPIC inhibited recruitment of androgen-bound AR to the PSA promoter and enhancer sites to a greater extent than bicalutamide. CPIC is a new therapeutic inhibitor that targets AR-mediated gene activation with potential to arrest the growth of prostate cancer.

  6. Expression of androgen receptor target genes in skeletal muscle

    Directory of Open Access Journals (Sweden)

    Kesha Rana

    2014-10-01

    Full Text Available We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (ARΔZF2 versus wildtype mice, demonstrating that myogenin is repressed by the androgen/AR pathway. The ubiquitin ligase Fbxo32 was repressed by 12 h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, and c-Myc expression was decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR∆ZF2 muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7 , p57 Kip2, Igf2 and calcineurin Aa, was increased in AR∆ZF2 muscle, and the expression of all but p57 Kip2 was also decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase-mediated atrophy pathways to preserve muscle mass in adult muscle.

  7. Expression of androgen receptor target genes in skeletal muscle

    Institute of Scientific and Technical Information of China (English)

    Kesha Rana; Nicole KL Lee; Jeffrey D Zajac; Helen E MacLean

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor(AR)‑regulated genes ininvitroandinvivomodels. The expression of the myogenic regulatory factormyogenin was signiifcantly decreased in skeletal muscle from testosterone‑treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity(ARΔZF2) versus wildtype mice, demonstrating thatmyogenin is repressed by the androgen/AR pathway. The ubiquitin ligaseFbxo32 was repressed by 12h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, andc‑Myc expression was decreased in testosterone‑treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR∆ZF2 muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7, p57Kip2, Igf2 andcalcineurin Aa, was increased in AR∆ZF2 muscle, and the expression of all butp57Kip2was also decreased in testosterone‑treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase‑mediated atrophy pathways to preserve muscle mass in adult muscle.

  8. Expression of androgen receptor target genes in skeletal muscle.

    Science.gov (United States)

    Rana, Kesha; Lee, Nicole K L; Zajac, Jeffrey D; MacLean, Helen E

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR)-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (AR(ΔZF2)) versus wildtype mice, demonstrating that myogenin is repressed by the androgen/AR pathway. The ubiquitin ligase Fbxo32 was repressed by 12 h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, and c-Myc expression was decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR(∆ZF2) muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7 , p57(Kip2), Igf2 and calcineurin Aa, was increased in AR(∆ZF2) muscle, and the expression of all but p57(Kip2) was also decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase-mediated atrophy pathways to preserve muscle mass in adult muscle.

  9. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  10. Androgen receptor gene polymorphism in zebra species

    Directory of Open Access Journals (Sweden)

    Hideyuki Ito

    2015-09-01

    Full Text Available Androgen receptor genes (AR have been found to have associations with reproductive development, behavioral traits, and disorders in humans. However, the influence of similar genetic effects on the behavior of other animals is scarce. We examined the loci AR glutamine repeat (ARQ in 44 Grevy's zebras, 23 plains zebras, and three mountain zebras, and compared them with those of domesticated horses. We observed polymorphism among zebra species and between zebra and horse. As androgens such as testosterone influence aggressiveness, AR polymorphism among equid species may be associated with differences in levels of aggression and tameness. Our findings indicate that it would be useful to conduct further studies focusing on the potential association between AR and personality traits, and to understand domestication of equid species.

  11. Fenofibrate down-regulates the expressions of androgen receptor (AR) and AR target genes and induces oxidative stress in the prostate cancer cell line LNCaP

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Hu; Zhu, Chen; Qin, Chao [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Tao, Tao [Department of Neurosurgery, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Li, Jie; Cheng, Gong; Li, Pu; Cao, Qiang; Meng, Xiaoxin; Ju, Xiaobing; Shao, Pengfei; Hua, Lixin [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Gu, Min, E-mail: medzhao1980@163.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Yin, Changjun, E-mail: drcjyin@gmail.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China)

    2013-03-08

    Highlights: ► Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells. ► Fenofibrate reduces the expressions of androgen receptor in LNCaP cells. ► Fenofibrate induces oxidative stress in the prostate cancer cell line LNCaP. -- Abstract: Fenofibrate, a peroxisome proliferator-androgen receptor-alpha agonist, is widely used in treating different forms of hyperlipidemia and hypercholesterolemia. Recent reports have indicated that fenofibrate exerts anti-proliferative and pro-apoptotic properties. This study aims to investigate the effects of fenofibrate on the prostate cancer (PCa) cell line LNCaP. The effects of fenofibrate on LNCaP cells were evaluated by flow cytometry, reverse transcription-polymerase chain reaction, enzyme-linked immunosorbent assays, Western blot analysis, and dual-luciferase reporter assay. Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells, reduces the expressions of androgen receptor (AR) and AR target genes (prostate-specific antigen and TMPRSS2), and inhibits Akt phosphorylation. Fenofibrate can induce the accumulation of intracellular reactive oxygen species and malondialdehyde, and decrease the activities of total anti-oxidant and superoxide dismutase in LNCaP cells. Fenofibrate exerts an anti-proliferative property by inhibiting the expression of AR and induces apoptosis by causing oxidative stress. Therefore, our data suggest fenofibrate may have beneficial effects in fenofibrate users by preventing prostate cancer growth through inhibition of androgen activation and expression.

  12. Identification of novel androgen receptor target genes in prostate cancer

    Directory of Open Access Journals (Sweden)

    Gerald William L

    2007-06-01

    Full Text Available Abstract Background The androgen receptor (AR plays critical roles in both androgen-dependent and castrate-resistant prostate cancer (PCa. However, little is known about AR target genes that mediate the receptor's roles in disease progression. Results Using Chromatin Immunoprecipitation (ChIP Display, we discovered 19 novel loci occupied by the AR in castrate resistant C4-2B PCa cells. Only four of the 19 AR-occupied regions were within 10-kb 5'-flanking regulatory sequences. Three were located up to 4-kb 3' of the nearest gene, eight were intragenic and four were in gene deserts. Whereas the AR occupied the same loci in C4-2B (castrate resistant and LNCaP (androgen-dependent PCa cells, differences between the two cell lines were observed in the response of nearby genes to androgens. Among the genes strongly stimulated by DHT in C4-2B cells – D-dopachrome tautomerase (DDT, Protein kinase C delta (PRKCD, Glutathione S- transferase theta 2 (GSTT2, Transient receptor potential cation channel subfamily V member 3 (TRPV3, and Pyrroline-5-carboxylate reductase 1 (PYCR1 – most were less strongly or hardly stimulated in LNCaP cells. Another AR target gene, ornithine aminotransferase (OAT, was AR-stimulated in a ligand-independent manner, since it was repressed by AR siRNA knockdown, but not stimulated by DHT. We also present evidence for in vivo AR-mediated regulation of several genes identified by ChIP Display. For example, PRKCD and PYCR1, which may contribute to PCa cell growth and survival, are expressed in PCa biopsies from primary tumors before and after ablation and in metastatic lesions in a manner consistent with AR-mediated stimulation. Conclusion AR genomic occupancy is similar between LNCaP and C4-2B cells and is not biased towards 5' gene flanking sequences. The AR transcriptionally regulates less than half the genes nearby AR-occupied regions, usually but not always, in a ligand-dependent manner. Most are stimulated and a few are

  13. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  14. Regulation of androgen action during establishment of pregnancy.

    Science.gov (United States)

    Gibson, Douglas A; Simitsidellis, Ioannis; Saunders, Philippa T K

    2016-07-01

    During the establishment of pregnancy, the ovarian-derived hormones progesterone and oestradiol regulate remodelling of the endometrium to promote an environment that is able to support and maintain a successful pregnancy. Decidualisation is characterised by differentiation of endometrial stromal cells that secrete growth factors and cytokines that regulate vascular remodelling and immune cell influx. This differentiation process is critical for reproduction, and inadequate decidualisation is implicated in the aetiology of pregnancy disorders such as foetal growth restriction and preeclampsia. In contrast to progesterone and oestradiol, the role of androgens in regulating endometrial function is poorly understood. Androgen receptors are expressed in the endometrium, and androgens are reported to regulate both the transcriptome and the secretome of endometrial stromal cells. In androgen-target tissues, circulating precursors are activated to mediate local effects, and recent studies report that steroid concentrations detected in endometrial tissue are distinct to those detected in the peripheral circulation. New evidence suggests that decidualisation results in dynamic changes in the expression of androgen biosynthetic enzymes, highlighting a role for pre-receptor regulation of androgen action during the establishment of pregnancy. These results suggest that such enzymes could be future therapeutic targets for the treatment of infertility associated with endometrial dysfunction. In conclusion, these data support the hypothesis that androgens play a beneficial role in regulating the establishment and maintenance of pregnancy. Future studies should be focussed on investigating the safety and efficacy of androgen supplementation with the potential for utilisation of novel therapeutics, such as selective androgen receptor modulators, to improve reproductive outcomes in women.

  15. SUMOylation modulates the transcriptional activity of androgen receptor in a target gene and pathway selective manner.

    Science.gov (United States)

    Sutinen, Päivi; Malinen, Marjo; Heikkinen, Sami; Palvimo, Jorma J

    2014-07-01

    Androgen receptor (AR) plays an important regulatory role in prostate cancer. AR's transcriptional activity is regulated by androgenic ligands, but also by post-translational modifications, such as SUMOylation. To study the role of AR SUMOylation in genuine chromatin environment, we compared androgen-regulated gene expression and AR chromatin occupancy in PC-3 prostate cancer cell lines stably expressing wild-type (wt) or doubly SUMOylation site-mutated AR (AR-K386R,K520R). Our genome-wide gene expression analyses reveal that the SUMOylation modulates the AR function in a target gene and pathway selective manner. The transcripts that are differentially regulated by androgen and SUMOylation are linked to cellular movement, cell death, cellular proliferation, cellular development and cell cycle. Fittingly, SUMOylation mutant AR cells proliferate faster and are more sensitive to apoptosis. Moreover, ChIP-seq analyses show that the SUMOylation can modulate the chromatin occupancy of AR on many loci in a fashion that parallels their differential androgen-regulated expression. De novo motif analyses reveal that FOXA1, C/EBP and AP-1 motifs are differentially enriched at the wtAR- and the AR-K386R,K520R-preferred genomic binding positions. Taken together, our data indicate that SUMOylation does not simply repress the AR activity, but it regulates AR's interaction with the chromatin and the receptor's target gene selection.

  16. Gene expression profile of androgen modulated genes in the murine fetal developing lung

    Directory of Open Access Journals (Sweden)

    Côté Mélissa

    2010-01-01

    Full Text Available Abstract Background Accumulating evidences suggest that sex affects lung development. Indeed, a higher incidence of respiratory distress syndrome is observed in male compared to female preterm neonates at comparable developmental stage and experimental studies demonstrated an androgen-related delay in male lung maturation. However, the precise mechanisms underlying these deleterious effects of androgens in lung maturation are only partially understood. Methods To build up a better understanding of the effect of androgens on lung development, we analyzed by microarrays the expression of genes showing a sexual difference and those modulated by androgens. Lungs of murine fetuses resulting from a timely mating window of 1 hour were studied at gestational day 17 (GD17 and GD18, corresponding to the period of surge of surfactant production. Using injections of the antiandrogen flutamide to pregnant mice, we hunted for genes in fetal lungs which are transcriptionally modulated by androgens. Results Results revealed that 1844 genes were expressed with a sexual difference at GD17 and 833 at GD18. Many genes were significantly modulated by flutamide: 1597 at GD17 and 1775 at GD18. Datasets were analyzed by using in silico tools for reconstruction of cellular pathways. Between GD17 and GD18, male lungs showed an intensive transcriptional activity of proliferative pathways along with the onset of lung differentiation. Among the genes showing a sex difference or an antiandrogen modulation of their expression, we specifically identified androgen receptor interacting genes, surfactant related genes in particularly those involved in the pathway leading to phospholipid synthesis, and several genes of lung development regulator pathways. Among these latter, some genes related to Shh, FGF, TGF-beta, BMP, and Wnt signaling are modulated by sex and/or antiandrogen treatment. Conclusion Our results show clearly that there is a real delay in lung maturation between

  17. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    Center, Kansas City, KS 66160, USA Introduction Prostate cancer is the most common cancer diagnosed after skin cancers and the... cancer cell growth: androgen regulation of CDK2, CDK4 , and CKI p16 genes. Cancer Res. 1997; 57:4511-4516. 109. Gregory CW, Hamil KG, Kim D, Hall SH...the most diagnosed non- skin cancer and the second leading cause of cancer -related death [2]. Currently, prostate-specific antigen (PSA) is the most

  18. Androgen receptor gene mutation, rearrangement, polymorphism.

    Science.gov (United States)

    Eisermann, Kurtis; Wang, Dan; Jing, Yifeng; Pascal, Laura E; Wang, Zhou

    2013-09-01

    Genetic aberrations of the androgen receptor (AR) caused by mutations, rearrangements, and polymorphisms result in a mutant receptor that has varied functions compared to wild type AR. To date, over 1,000 mutations have been reported in the AR with most of these being associated with androgen insensitivity syndrome (AIS). While mutations of AR associated with prostate cancer occur less often in early stage localized disease, mutations in castration-resistant prostate cancer (CRPC) patients treated with anti-androgens occur more frequently with 10-30% of these patients having some form of mutation in the AR. Resistance to anti-androgen therapy usually results from gain-of-function mutations in the LBD such as is seen with bicalutamide and more recently with enzalutamide (MDV3100). Thus, it is crucial to investigate these new AR mutations arising from drug resistance to anti-androgens and other small molecule pharmacological agents.

  19. Androgen insensitivity syndrome: do trinucleotide repeats in androgen receptor gene have any role?

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Nalini J. Gupta; Baidyanath Chakravarty; Lalji Singh; Kumarasamy Thangaraj

    2008-01-01

    Aim: To investigate the role of CAG and GGN repeats as genetic background affecting androgen insensitivity syn- drome (AIS) phenotype. Methods: We analyzed lengths of androgen receptor (AR)-CAG and GGN repeats in 69 AIS cases, along with 136 unrelated normal male individuals. The lengths of repeats were analyzed using polymerase chain reaction (PCR) amplification followed by allelic genotyping to determine allele length. Results: Our study revealed significantly shorter mean lengths of CAG repeats in patients (mean 18.25 repeats, range 14-26 repeats) in comparison to the controls (mean 22.57 repeats, range 12-39 repeats) (two-tailed P < 0.0001). GGN repeats, however, did not differ significantly between patients (mean 21.48 repeats) and controls (mean 21.21 repeats) (two- tailed P = 0.474). Among patients' groups, the mean number of CAG repeats in partial androgen insensitivity cases (mean 15.83 repeats) was significantly less than in complete androgen insensitivity cases (mean 19.46 repeats) (two- tailed P < 0.0001). Conclusion: The findings suggest that shorter lengths of repeats in the AR gene might act as low penetrance genetic background in varying manifestation of androgen insensitivity. (Asian J Androl 2008 Jul; 10: 616-624)

  20. Androgens regulate Hedgehog signalling and proliferation in androgen-dependent prostate cells.

    Science.gov (United States)

    Sirab, Nanor; Terry, Stéphane; Giton, Frank; Caradec, Josselin; Chimingqi, Mihelaiti; Moutereau, Stéphane; Vacherot, Francis; de la Taille, Alexandre; Kouyoumdjian, Jean-Claude; Loric, Sylvain

    2012-09-15

    Prostate cancer (PCa) is androgen sensitive in its development and progression to metastatic disease. Hedgehog (Hh) pathway activation is important in the initiation and growth of various carcinomas including PCa. We and others have observed aberrations of Hh pathway during the progression of PCa to the castration-resistant state. The involvement of androgen signalling in Hh pathway activation, however, remains largely elusive. Here we investigate the direct role of androgen signalling on Hh pathway. We examined the effect of Dihydrosterone (DHT), antiandrogen, bicalutamide, and Hh pathway inhibitor, KAAD-cyclopamine in four human prostate cell lines (two cancerous: LNCaP, VCaP, and two normal: PNT2 and PNT2-ARm which harbours a mutant version of androgen receptor (AR) that is commonly found in LNCaP). Cell proliferation as well as Hh pathway members (SHH, IHH, DHH, GLI, PTCH) mRNA expression levels were assessed. We showed that KAAD-cyclopamine decreased cell proliferation of DHT-stimulated LNCaP, VCaP and PNT2-ARm cells. SHH expression was found to be downregulated by DHT in all AR posititve cells. The negative effect of DHT on SHH expression was counteracted when cells were treated by bicalutamide. Importantly, KAAD-cyclopamine treatment seemed to inhibit AR activity. Moreover, bicalutamide as well as KAAD-cyclopamine treatments induced GLI and PTCH expression in VCaP and PNT2-ARm. Our results suggest that Hh pathway activity can be regulated by androgen signalling. Specifically, we show that the DHT-induced inhibition of Hh pathway is AR dependent. The mutual interaction between these two pathways might be important in the regulation of cell proliferation in PCa.

  1. Expression of novel genes linked to the androgen-induced, proliferative shutoff in prostate cancer cells.

    Science.gov (United States)

    Geck, P; Szelei, J; Jimenez, J; Lin, T M; Sonnenschein, C; Soto, A M

    1997-01-01

    Androgens control cell numbers in the prostate through three separate pathways: (a) inhibition of cell death, (b) induction of cell proliferation (Step-1) and (c) inhibition of cell proliferation (Step-2, proliferative shutoff). The mechanisms underlying these phenomena are incompletely understood. The human prostate carcinoma LNCaP variants express these pathways as follows: LNCaP-FGC express both steps, LNCaP-LNO expresses Step-2, LNCaP-TAC expresses Step-1, and LNCaP-TJA cells express neither step. These cells facilitated the search for mediators of the androgen-induced proliferative shutoff pathway. Androgen exposure for 24 h or longer induced an irreversible proliferative shutoff in LNCaP-FGC cells. The Wang and Brown approach for identifying differentially expressed mRNAs was used to search for mediators of Step-2. Ten unique inserts were identified and from those ten, three genes were further studied. The basal expression of these genes in shutoff-negative variants was not affected by androgen exposure. They were induced by androgens in shutoff-positive LNCaP variants and the androgen receptor-transfected, shutoff-positive, MCF7-AR1 cells. These genes were induced only in the range of androgen concentrations that elicited the shutoff response. Time course analysis showed that their induction precedes the commitment point by 12-18 h. In addition, they were expressed in the normal prostate during proliferative shutoff. These features suggest that the candidate genes have a role in the regulation cascade for proliferative shutoff.

  2. Castration induces up-regulation of intratumoral androgen biosynthesis and androgen receptor expression in an orthotopic VCaP human prostate cancer xenograft model.

    Science.gov (United States)

    Knuuttila, Matias; Yatkin, Emrah; Kallio, Jenny; Savolainen, Saija; Laajala, Teemu D; Aittokallio, Tero; Oksala, Riikka; Häkkinen, Merja; Keski-Rahkonen, Pekka; Auriola, Seppo; Poutanen, Matti; Mäkelä, Sari

    2014-08-01

    Androgens are key factors involved in the development and progression of prostate cancer (PCa), and PCa growth can be suppressed by androgen deprivation therapy. In a considerable proportion of men receiving androgen deprivation therapy, however, PCa progresses to castration-resistant PCa (CRPC), making the development of efficient therapies challenging. We used an orthotopic VCaP human PCa xenograft model to study cellular and molecular changes in tumors after androgen deprivation therapy (castration). Tumor growth was monitored through weekly serum prostate-specific antigen measurements, and mice with recurrent tumors after castration were randomized to treatment groups. Serum prostate-specific antigen concentrations showed significant correlation with tumor volume. Castration-resistant tumors retained concentrations of intratumoral androgen (androstenedione, testosterone, and 5α-dihydrotestosterone) at levels similar to tumors growing in intact hosts. Accordingly, castration induced up-regulation of enzymes involved in androgen synthesis (CYP17A1, AKR1C3, and HSD17B6), as well as expression of full-length androgen receptor (AR) and AR splice variants (AR-V1 and AR-V7). Furthermore, AR target gene expression was maintained in castration-resistant xenografts. The AR antagonists enzalutamide (MDV3100) and ARN-509 suppressed PSA production of castration-resistant tumors, confirming the androgen dependency of these tumors. Taken together, the findings demonstrate that our VCaP xenograft model exhibits the key characteristics of clinical CRPC and thus provides a valuable tool for identifying druggable targets and for testing therapeutic strategies targeting AR signaling in CRPC.

  3. Nrf1 and Nrf2 transcription factors regulate androgen receptor transactivation in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Michelle A Schultz

    Full Text Available Despite androgen deprivation therapy (ADT, persistent androgen receptor (AR signaling enables outgrowth of castration resistant prostate cancer (CRPC. In prostate cancer (PCa cells, ADT may enhance AR activity through induction of oxidative stress. Herein, we investigated the roles of Nrf1 and Nrf2, transcription factors that regulate antioxidant gene expression, on hormone-mediated AR transactivation using a syngeneic in vitro model of androgen dependent (LNCaP and castration resistant (C4-2B PCa cells. Dihydrotestosterone (DHT stimulated transactivation of the androgen response element (ARE was significantly greater in C4-2B cells than in LNCaP cells. DHT-induced AR transactivation was coupled with higher nuclear translocation of p65-Nrf1 in C4-2B cells, as compared to LNCaP cells. Conversely, DHT stimulation suppressed total Nrf2 levels in C4-2B cells but elevated total Nrf2 levels in LNCaP cells. Interestingly, siRNA mediated silencing of Nrf1 attenuated AR transactivation while p65-Nrf1 overexpression enhanced AR transactivation. Subsequent studies showed that Nrf1 physically interacts with AR and enhances AR's DNA-binding activity, suggesting that the p65-Nrf1 isoform is a potential AR coactivator. In contrast, Nrf2 suppressed AR-mediated transactivation by stimulating the nuclear accumulation of the p120-Nrf1 which suppressed AR transactivation. Quantitative RT-PCR studies further validated the inductive effects of p65-Nrf1 isoform on the androgen regulated genes, PSA and TMPRSS2. Therefore, our findings implicate differential roles of Nrf1 and Nrf2 in regulating AR transactivation in PCa cells. Our findings also indicate that the DHT-stimulated increase in p65-Nrf1 and the simultaneous suppression of both Nrf2 and p120-Nrf1 ultimately facilitates AR transactivation in CRPC cells.

  4. Up-Regulation of Hepatic Alpha-2-HS-Glycoprotein Transcription by Testosterone via Androgen Receptor Activation

    Directory of Open Access Journals (Sweden)

    Jakob Voelkl

    2014-06-01

    Full Text Available Background/Aims: Fetuin-A (alpha-2-HS-glycoprotein, AHSG, a liver borne plasma protein, contributes to the prevention of soft tissue calcification, modulates inflammation, reduces insulin sensitivity and fosters weight gain following high fat diet or ageing. In polycystic ovary syndrome, fetuin-A levels correlate with free androgen levels, an observation pointing to androgen sensitivity of fetuin-A expression. The present study thus explored whether the expression of hepatic fetuin-A is modified by testosterone. Methods: HepG2 cells were treated with testosterone and androgen receptor antagonist flutamide, and were silenced with androgen receptor siRNA. To test the in vivo relevance, male mice were subjected to androgen deprivation therapy (ADT for 7 weeks. AHSG mRNA levels were determined by quantitative RT-PCR and fetuin-A protein abundance by Western blotting. Results: In HepG2 cells, AHSG mRNA expression and fetuin-A protein abundance were both up-regulated following testosterone treatment. The human alpha-2-HS-glycoprotein gene harbors putative androgen receptor response elements in the proximal 5 kb promoter sequence relative to TSS. The effect of testosterone on AHSG mRNA levels was abrogated by silencing of the androgen receptor in HepG2 cells. Moreover, treatment of HepG2 cells with the androgen receptor antagonist flutamide in presence of endogenous ligands in the medium significantly down-regulated AHSG mRNA expression and fetuin-A protein abundance. In addition, ADT of male mice was followed by a significant decrease of hepatic Ahsg mRNA expression and fetuin-A protein levels. Conclusions: Testosterone participates in the regulation of hepatic fetuin-A expression, an effect mediated, at least partially, by androgen receptor activation.

  5. Wnt inhibitory factor 1 (Wif1) is regulated by androgens and enhances androgen-dependent prostate development.

    Science.gov (United States)

    Keil, Kimberly P; Mehta, Vatsal; Branam, Amanda M; Abler, Lisa L; Buresh-Stiemke, Rita A; Joshi, Pinak S; Schmitz, Christopher T; Marker, Paul C; Vezina, Chad M

    2012-12-01

    Fetal prostate development from urogenital sinus (UGS) epithelium requires androgen receptor (AR) activation in UGS mesenchyme (UGM). Despite growing awareness of sexually dimorphic gene expression in the UGS, we are still limited in our knowledge of androgen-responsive genes in UGM that initiate prostate ductal development. We found that WNT inhibitory factor 1 (Wif1) mRNA is more abundant in male vs. female mouse UGM in which its expression temporally and spatially overlaps androgen-responsive steroid 5α-reductase 2 (Srd5a2). Wif1 mRNA is also present in prostatic buds during their elongation and branching morphogenesis. Androgens are necessary and sufficient for Wif1 expression in mouse UGS explant mesenchyme, and testicular androgens remain necessary for normal Wif1 expression in adult mouse prostate stroma. WIF1 contributes functionally to prostatic bud formation. In the presence of androgens, exogenous WIF1 protein increases prostatic bud number and UGS basal epithelial cell proliferation without noticeably altering the pattern of WNT/β-catenin-responsive Axin2 or lymphoid enhancer binding factor 1 (Lef1) mRNA. Wif1 mutant male UGSs exhibit increased (Sfrp)2 and (Sfrp)3 expression and form the same number of prostatic buds as the wild-type control males. Collectively our results reveal Wif1 as one of the few known androgen-responsive genes in the fetal mouse UGM and support the hypothesis that androgen-dependent Wif1 expression is linked to the mechanism of androgen-induced prostatic bud formation.

  6. Prostate specific antigen gene expression in androgen insensitive prostate carcinoma subculture cell line.

    Science.gov (United States)

    Tsui, Ke-Hung; Feng, Tsui-Hsia; Chung, Li-Chuan; Chao, Chun-Hsiang; Chang, Phei-Lang; Juang, Horng-Heng

    2008-01-01

    A novel prostate cancer cell line (PC-J) was isolated from an androgen independent non-prostate specific antigen (non-PSA) producing carcinoma cell line. The homologous correlation between PC-J and PC-3 was determined by short tandem repeat analysis. The PSA promoter activity was detected by transient expression assay in the PC-J and LNCaP cells but not in androgen insensitive PC-3 cells. When the PC-J cells were cotransfected with androgen receptor, androgen receptor coactivators and PSA reporter vector cells, the reporter assays indicated that nuclear receptor coactivator 4 (NCOA4) but not androgen receptor activator 24 (ARA24) increased the sensitivity and maximum stimulation of dihydrotestosterone (DHT)-inducing PSA promoter activity. The RT-PCR assays revealed that the expression of several tumor markers, including interleukin-6, prostate stem cell antigen (PSCA), prostate epithelium-specific Ets transcription factor (PDEF) and matriptase, was lower in the PC-J cells than in the PC-3 cells. This cell model elucidated the regulation of PSA expression and enabled comparison of the gene profile at different stages of metastasis in prostatic carcinoma.

  7. Changes in gene expression following androgen receptor blockade is not equivalent to androgen ablation by castration in the rat ventral prostate

    Indian Academy of Sciences (India)

    Anil M Limaye; Irfan Asangani; Thyagarajan Kalyani; Paturu Kondaiah

    2008-06-01

    Involution of the rat ventral prostate and concomitant modulation of gene expression post-castration is a well-documented phenomenon. While the rat castration model has been extensively used to study androgen regulation of gene expression in the ventral prostate, it is not clear whether all the gene expression changes post-castration are due to androgen depletion alone. To obtain insights into this, we performed differential display reverse transcriptase polymerase chain reaction (DD-RT-PCR) which resulted in the identification of castration and/or flutamide-regulated genes in the rat ventral prostate. These include clusterin, methionine adenosyl transferase II, and prostate-specific transcripts such as PBPC1BS, S100RVP and A7. While clusterin, PBPC1BS and methionine adenosyl transferase II are regulated by both castration and flutamide, S100 RVP and A7 are regulated by castration alone. Interestingly, we show that flutamide, unlike castration, does not induce apoptosis in the rat ventral prostate epithelium, which could be an underlying cause for the differential effects of castration and flutamide treatment. We propose that castration leads to enrichment and depletion of stromal and epithelial cell types, respectively, resulting in erroneous conclusions on some of the cell type-specific transcripts as being androgen regulated.

  8. A PRACTICAL APPROACH TO THE DETECTION OF ANDROGEN RECEPTOR GENE-MUTATIONS AND PEDIGREE ANALYSIS IN FAMILIES WITH X-LINKED ANDROGEN INSENSITIVITY

    NARCIS (Netherlands)

    RISSTALPERS, C; HOOGENBOEZEM, T; SLEDDENS, HFBM; VERLEUNMOOIJMAN, MCT; DEGENHART, HJ; DROP, SLS; HALLEY, DJJ; Oosterwijk, Jan; HODGINS, MB; TRAPMAN, J; BRINKMANN, AO

    1994-01-01

    Androgen insensitivity syndrome (AIS) is an X-linked disorder in which defects in the androgen receptor gene have prevented the normal development of both internal and external male structures in 46,XY individuals. This survey reports the analysis of 11 AIS subjects. The androgen receptor gene of th

  9. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  10. L712V mutation in the androgen receptor gene causes complete androgen insensitivity syndrome due to severe loss of androgen function.

    Science.gov (United States)

    Rajender, Singh; Gupta, Nalini J; Chakrabarty, Baidyanath; Singh, Lalji; Thangaraj, Kumarasamy

    2013-12-11

    Inability to respond to the circulating androgens is named as androgen insensitivity syndrome (AIS). Mutations in the androgen receptor (AR) gene are the most common cause of AIS. A cause and effect relationship between some of these mutations and the AIS phenotype has been proven by in vitro studies. Several other mutations have been identified, but need to be functionally validated for pathogenicity. Screening of the AR mutations upon presumptive diagnosis of AIS is recommended. We analyzed a case of complete androgen insensitivity syndrome (CAIS) for mutations in the AR gene. Sequencing of the entire coding region revealed C>G mutation (CTT-GTT) at codon 712 (position according to the NCBI database) in exon 4 of the gene, resulting in replacement of leucine with valine in the ligand-binding domain of the AR protein. No incidence of this mutation was observed in 230 normal male individuals analyzed for comparison. In vitro androgen binding and transactivation assays using mutant clone showed approximately 71% loss of ligand binding and about 76% loss of transactivation function. We conclude that CAIS in this individual was due to L712V substitution in the androgen receptor protein.

  11. Transcriptional regulation of myotrophic actions by testosterone and trenbolone on androgen-responsive muscle.

    Science.gov (United States)

    Ye, Fan; McCoy, Sean C; Ross, Heather H; Bernardo, Joseph A; Beharry, Adam W; Senf, Sarah M; Judge, Andrew R; Beck, Darren T; Conover, Christine F; Cannady, Darryl F; Smith, Barbara K; Yarrow, Joshua F; Borst, Stephen E

    2014-09-01

    Androgens regulate body composition and skeletal muscle mass in males, but the molecular mechanisms are not fully understood. Recently, we demonstrated that trenbolone (a potent synthetic testosterone analogue that is not a substrate for 5-alpha reductase or for aromatase) induces myotrophic effects in skeletal muscle without causing prostate enlargement, which is in contrast to the known prostate enlarging effects of testosterone. These previous results suggest that the 5α-reduction of testosterone is not required for myotrophic action. We now report differential gene expression in response to testosterone versus trenbolone in the highly androgen-sensitive levator ani/bulbocavernosus (LABC) muscle complex of the adult rat after 6weeks of orchiectomy (ORX), using real time PCR. The ORX-induced expression of atrogenes (Muscle RING-finger protein-1 [MuRF1] and atrogin-1) was suppressed by both androgens, with trenbolone producing a greater suppression of atrogin-1 mRNA compared to testosterone. Both androgens elevated expression of anabolic genes (insulin-like growth factor-1 and mechano-growth factor) after ORX. ORX-induced increases in expression of glucocorticoid receptor (GR) mRNA were suppressed by trenbolone treatment, but not testosterone. In ORX animals, testosterone promoted WNT1-inducible-signaling pathway protein 2 (WISP-2) gene expression while trenbolone did not. Testosterone and trenbolone equally enhanced muscle regeneration as shown by increases in LABC mass and in protein expression of embryonic myosin by western blotting. In addition, testosterone increased WISP-2 protein levels. Together, these findings identify specific mechanisms by which testosterone and trenbolone may regulate skeletal muscle maintenance and growth.

  12. Lestaurtinib inhibits histone phosphorylation and androgen-dependent gene expression in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Jens Köhler

    Full Text Available BACKGROUND: Epigenetics is defined as heritable changes in gene expression that are not based on changes in the DNA sequence. Posttranslational modification of histone proteins is a major mechanism of epigenetic regulation. The kinase PRK1 (protein kinase C related kinase 1, also known as PKN1 phosphorylates histone H3 at threonine 11 and is involved in the regulation of androgen receptor signalling. Thus, it has been identified as a novel drug target but little is known about PRK1 inhibitors and consequences of its inhibition. METHODOLOGY/PRINCIPAL FINDING: Using a focused library screening approach, we identified the clinical candidate lestaurtinib (also known as CEP-701 as a new inhibitor of PRK1. Based on a generated 3D model of the PRK1 kinase using the homolog PKC-theta (protein kinase c theta protein as a template, the key interaction of lestaurtinib with PRK1 was analyzed by means of molecular docking studies. Furthermore, the effects on histone H3 threonine phosphorylation and androgen-dependent gene expression was evaluated in prostate cancer cells. CONCLUSIONS/SIGNIFICANCE: Lestaurtinib inhibits PRK1 very potently in vitro and in vivo. Applied to cell culture it inhibits histone H3 threonine phosphorylation and androgen-dependent gene expression, a feature that has not been known yet. Thus our findings have implication both for understanding of the clinical activity of lestaurtinib as well as for future PRK1 inhibitors.

  13. Androgen receptor-dependent transactivation of growth arrest-specific gene 6 mediates inhibitory effects of testosterone on vascular calcification.

    Science.gov (United States)

    Son, Bo-Kyung; Akishita, Masahiro; Iijima, Katsuya; Ogawa, Sumito; Maemura, Koji; Yu, Jing; Takeyama, Kenichi; Kato, Shigeaki; Eto, Masato; Ouchi, Yasuyoshi

    2010-03-05

    Recent epidemiological studies have found that androgen deficiency is associated with a higher incidence of cardiovascular disease in men. However, little is known about the mechanism underlying the cardioprotective effects of androgens. Here we show the inhibitory effects of testosterone on vascular calcification and a critical role of androgen receptor (AR)-dependent transactivation of growth arrest-specific gene 6 (Gas6), a key regulator of inorganic phosphate (P(i))-induced calcification of vascular smooth muscle cells (VSMC). Testosterone and nonaromatizable androgen dihydrotestosterone inhibited P(i)-induced calcification of human aortic VSMC in a concentration-dependent manner. Androgen inhibited P(i)-induced VSMC apoptosis, an essential process for VSMC calcification. The effects on VSMC calcification were mediated by restoration of P(i)-induced down-regulation of Gas6 expression and a subsequent reduction of Akt phosphorylation. These effects of androgen were blocked by an AR antagonist, flutamide, but not by an estrogen receptor antagonist, ICI 182,780. We then explored the mechanistic role of the AR in Gas6 expression and found an abundant expression of AR predominantly in the nucleus of VSMC and two consensus ARE sequences in the Gas6 promoter region. Dihydrotestosterone stimulated Gas6 promoter activity, and this effect was abrogated by flutamide and by AR siRNA. Site-specific mutation revealed that the proximal ARE was essential for androgen-dependent transactivation of Gas6. Furthermore, chromatin immunoprecipitation assays demonstrated ligand-dependent binding of the AR to the proximal ARE of Gas6. These results indicate that AR signaling directly regulates Gas6 transcription, which leads to inhibition of vascular calcification, and provides a mechanistic insight into the cardioprotective action of androgens.

  14. "Topological significance" analysis of gene expression and proteomic profiles from prostate cancer cells reveals key mechanisms of androgen response.

    Directory of Open Access Journals (Sweden)

    Adaikkalam Vellaichamy

    Full Text Available BACKGROUND: The problem of prostate cancer progression to androgen independence has been extensively studied. Several studies systematically analyzed gene expression profiles in the context of biological networks and pathways, uncovering novel aspects of prostate cancer. Despite significant research efforts, the mechanisms underlying tumor progression are poorly understood. We applied a novel approach to reconstruct system-wide molecular events following stimulation of LNCaP prostate cancer cells with synthetic androgen and to identify potential mechanisms of androgen-independent progression of prostate cancer. METHODOLOGY/PRINCIPAL FINDINGS: We have performed concurrent measurements of gene expression and protein levels following the treatment using microarrays and iTRAQ proteomics. Sets of up-regulated genes and proteins were analyzed using our novel concept of "topological significance". This method combines high-throughput molecular data with the global network of protein interactions to identify nodes which occupy significant network positions with respect to differentially expressed genes or proteins. Our analysis identified the network of growth factor regulation of cell cycle as the main response module for androgen treatment in LNCap cells. We show that the majority of signaling nodes in this network occupy significant positions with respect to the observed gene expression and proteomic profiles elicited by androgen stimulus. Our results further indicate that growth factor signaling probably represents a "second phase" response, not directly dependent on the initial androgen stimulus. CONCLUSIONS/SIGNIFICANCE: We conclude that in prostate cancer cells the proliferative signals are likely to be transmitted from multiple growth factor receptors by a multitude of signaling pathways converging on several key regulators of cell proliferation such as c-Myc, Cyclin D and CREB1. Moreover, these pathways are not isolated but constitute an

  15. Testosterone increases renal anti-aging klotho gene expression via the androgen receptor-mediated pathway.

    Science.gov (United States)

    Hsu, Shih-Che; Huang, Shih-Ming; Lin, Shih-Hua; Ka, Shuk-Man; Chen, Ann; Shih, Meng-Fu; Hsu, Yu-Juei

    2014-12-01

    Gender is known to be associated with longevity and oestrogen administration induced longevity-associated gene expression is one of the potential mechanisms underlying the benefits of oestrogen on lifespan, whereas the role of testosterone in the regulation of longevity-associated gene expressions remains largely unclear. The klotho gene, predominantly expressed in the kidney, has recently been discovered to be an aging suppressor gene. In the present study, we investigated the regulatory effects of testosterone on renal klotho gene expression in vivo and in vitro. In testosterone-administered mouse kidney and NRK-52E cells, increased klotho expression was accompanied by the up-regulation of the nuclear androgen receptor (AR). Overexpression of AR enhanced the expression of klotho mRNA and protein. Conversely, testosterone-induced klotho expression was attenuated in the presence of flutamide, an AR antagonist. A reporter assay and a chromatin immunoprecipitation (ChIP) assay demonstrated that AR directly binds to the klotho promoter via androgen response elements (AREs) which reconfirmed its importance for AR binding via the element mutation. In summary, our study demonstrates that testosterone up-regulates anti-aging klotho together with AR expression in the kidney in vivo and in vitro by recruiting AR on to the AREs of the klotho promoter.

  16. Up-regulation of Bcl-2 is required for the progression of prostate cancer cells from an androgen-dependent to an androgen-independent growth stage

    Institute of Scientific and Technical Information of China (English)

    Yuting Lin; Junichi Fukuchi; Richard A Hiipakka; John M Kokontis; Jialing Xiang

    2007-01-01

    Bcl-2 is an anti-apoptotic oncoprotein and its protein levels are inversely correlated with prognosis in many cancers.However, the role of Bcl-2 in the progression of prostate cancer is not clear. Here we report that Bcl-2 is required for the progression of LNCaP prostate cancer cells from an androgen-dependent to an androgen-independent growth stage. The mRNA and protein levels of Bcl-2 are significantly increased in androgen-independent prostate cancer cells, shRNA-mediated gene silencing of Bcl-2 in androgen-independent prostate cancer cells promotes UV-induced apoptosis and suppresses the growth of prostate tumors in vivo. Growing androgen-dependent cells under androgen-deprivation conditions results in formation of androgen-independent colonies; and the transition from androgen-dependent to androgen-independent growth is blocked by ectopic expression of the Bcl-2 antagonist Bax or Bcl-2 shRNA. Thus, our results demonstrate that Bcl-2 is not only critical for the survival of androgen-independent prostate cancer cells, but is also required for the progression of prostate cancer cells from an androgen-dependent to an androgen-independent growth stage.

  17. Androgen-mediated regulation of skeletal muscle protein balance.

    Science.gov (United States)

    Rossetti, Michael L; Steiner, Jennifer L; Gordon, Bradley S

    2017-02-22

    Androgens significantly alter muscle mass in part by shifting protein balance in favor of net protein accretion. During various atrophic conditions, the clinical impact of decreased production or bioavailability of androgens (termed hypogonadism) is important as a loss of muscle mass is intimately linked with survival outcome. While androgen replacement therapy increases muscle mass in part by restoring protein balance, this is not a comprehensive treatment option due to potential side effects. Therefore, an understanding of the mechanisms by which androgens alter protein balance is needed for the development of androgen-independent therapies. While the data in humans suggest androgens alter protein balance (both synthesis and breakdown) in the fasted metabolic state, a predominant molecular mechanism(s) behind this observation is still lacking. This failure is likely due in part to inconsistent experimental design between studies including failure to control nutrient/feeding status, the method of altering androgens, and the model systems utilized.

  18. Androgens Regulate T47D Cells Motility and Invasion through Actin Cytoskeleton Remodeling

    Science.gov (United States)

    Montt-Guevara, Maria Magdalena; Shortrede, Jorge Eduardo; Giretti, Maria Silvia; Giannini, Andrea; Mannella, Paolo; Russo, Eleonora; Genazzani, Alessandro David; Simoncini, Tommaso

    2016-01-01

    The relationship between androgens and breast cancer is controversial. Androgens have complex effects on breast cancer progression and metastasis. Moreover, androgen receptor (AR) is expressed in approximately 70 to 90% of invasive breast carcinomas, which has prognostic relevance in basal-like cancers and in triple-negative breast cancers. Recent studies have associated the actin-binding proteins of the ezrin–radixin–moesin (ERM) family with metastasis in endocrine-sensitive cancers. We studied on T47D breast cancer cells whether androgens with different characteristics, such as testosterone (T), dihydrotestosterone (DHT), and dehydroepiandrosterone (DHEA) may regulate breast cancer cell motility and invasion through the control of actin remodeling. We demonstrate that androgens promote migration and invasion in T47D via Moesin activation. We show that T and DHEA exert their actions via the AR and estrogen receptor (ER), while the non-aromatizable androgen – DHT – only recruits AR. We further report that androgen induced significant changes in actin organization with pseudopodia along with membrane ruffles formation, and this process is mediated by Moesin. Our work identifies novel mechanisms of action of androgens on breast cancer cells. Through the modulation of Moesin, androgens alter the architecture of cytoskeleton in T47D breast cancer cell and promote cell migration and invasion. These results could help to understand the biological actions of androgens on breast cancer and, eventually, to develop new strategies for breast cancer treatment. PMID:27746764

  19. ANDROGENS REGULATE T47D CELLS MOTILITY AND INVASION THROUGH ACTIN CYTOSKELETON REMODELLING

    Directory of Open Access Journals (Sweden)

    Maria Magdalena Montt-Guevara

    2016-09-01

    Full Text Available The relationship between androgens and breast cancer is controversial. Androgens have complex effects on breast cancer progression and metastasis. Moreover, androgens receptor (AR is expressed in approximately 70% to 90% of invasive breast carcinomas, which has prognostic relevance in basal-like cancers and in triple negative breast cancers. Recent studies have associated the actin-binding proteins of the Ezrin-Radixin-Moesin (ERM family with metastasis in endocrine-sensitive cancers. We studied on T47D breast cancer cells whether androgens with different characteristics, such as testosterone (T, dihydrotestosterone (DHT and dehydroepiandrosterone (DHEA may regulate breast cancer cell motility and invasion through the control of actin remodelling. We demonstrate that androgens promote migration and invasion in T47D via Moesin activation. We show that T and DHEA exert their actions via the AR and estrogen receptor (ER, while the non aromatizable androgen – DHT only recruits AR. We further report that androgen induced significant changes in actin organization with pseudopodia along with membrane ruffles formation, and this process is mediated by Moesin. Our work identifies novel mechanisms of action of androgens on breast cancer cells. Through the modulation of Moesin, androgens alter the architecture of cytoskeleton in T47D breast cancer cell and promote cell migration and invasion. These results could help to understand the biological actions of androgens on breast cancer, and eventually to develop new strategies for treatment of breast cancer.

  20. Androgen resistance.

    Science.gov (United States)

    Hughes, Ieuan A; Deeb, Asma

    2006-12-01

    Androgen resistance causes the androgen insensitivity syndrome in its variant forms and is a paradigm of clinical syndromes associated with hormone resistance. In its complete form, the syndrome causes XY sex reversal and a female phenotype. Partial resistance to androgens is a common cause of ambiguous genitalia of the newborn, but a similar phenotype may result from several other conditions, including defects in testis determination and androgen biosynthesis. The biological actions of androgens are mediated by a single intracellular androgen receptor encoded by a gene on the long arm of the X chromosome. Mutations in this gene result in varying degrees of androgen receptor dysfunction and phenotypes that often show poor concordance with the genotype. Functional characterization and three-dimensional modelling of novel mutant receptors has been informative in understanding the mechanism of androgen action. Management issues in syndromes of androgen insensitivity include decisions on sex assignment, timing of gonadectomy in relation to tumour risk, and genetic and psychological counselling.

  1. Larger trinucleotide repeat size in the androgen receptor gene of infertile men with extremely severe oligozoospermia.

    Science.gov (United States)

    Patrizio, P; Leonard, D G; Chen, K L; Hernandez-Ayup, S; Trounson, A O

    2001-01-01

    Androgens are significant regulators of human spermatogenesis. Their action is mediated through the androgen receptor (AR), which binds to the androgen responsive element on DNA and regulates gene transcription. Men become infertile with spinobulbar muscular atrophy (Kennedy disease) caused by a trinucleotide repeat expansion, > or = 40 CAG repeats, in the AR gene located on the X chromosome. In this prospective study, we investigated whether the variable size, larger repeats, of this trinucleotide could alter AR function and result in impaired spermatogenesis. A total of 69 infertile men were studied. Clinical and laboratory analysis showed idiopathic, nonobstructive azoospermia in 16 men, extremely severe oligozoospermia in 27 men (PCR) amplification across the AR repeat region. Accurate size determination of the PCR product using an ABI 373 DNA sequencer allowed precise calculation of CAG repeat sizes. The AR gene was not analyzed for other types of mutations. The difference in CAG repeat size between infertile men and proven fertile controls was statistically significant, P = .03. Patients with extremely severe oligozoospermia had significantly longer CAG repeat tracts (mean, 25.4 +/- 4.0; P = .0005; range 20-39) than controls (mean, 22 +/- 2.8; range 12-30) or patients with severe oligozoospermia (mean, 22.2 +/- 2.3; range 18-26). None of the 26 infertile men with sperm counts CAG repeats compared with 6 out of 45 controls (13%; P = .06). This study suggests that some men with severe impairment of spermatogenesis have longer trinucleotide repeats in the AR gene. Although direct evidence is missing, lower affinity between androgen and the AR protein or decreased AR protein availability with longer repeats could be responsible for a diminished androgen effect on spermatogenesis. Two of the patients in the extremely severe oligozoospermia group had 35 and 39 CAG repeats, respectively (normal range is 11 to 33). Although not yet considered a mutation, longer

  2. Single strand conformation polymorphism analysis of androgen receptor gene mutations in patients with androgen insensitivity syndromes: Application for diagnosis, genetic counseling, and therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hiort, O. (Medizinische Universitaet zu Luebeck (Germany) Tufts-New England Medical Center, Boston, MA (United States)); Huang, Q. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States)); Sinnecker, G.H.G.; Kruse, K. (Medizinische Universitaet zu Luebeck (Germany)); Sadeghi-Nejad, A.; Wolfe, H.J. (Tufts-New England Medical Center, Boston, MA (United States)); Yandell, D.W. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States))(Harvard Medical School, Boston, MA (United States) Harvard School of Public Health, Boston, MA (United States))

    1993-07-01

    Recent studies indicate that mutations in the androgen receptor gene are associated with androgen insensitivity syndromes, a heterogeneous group of related disorders involving defective sexual differentiation in karyotypic males. In this report, the authors address the possibility of rapid mutational analysis of the androgen receptor gene for initial diagnosis, genetic counseling, and molecular subclassification of affected patients and their families. DNA from peripheral blood leukocytes of six patients from five families with various degrees of androgen insensitivity was studied. Exons 2 to 8 of the androgen receptor gene were analyzed using a combination of single strand conformation polymorphism analysis and direct DNA sequencing. Female family members were also studied to identify heterozygote carriers. Point mutations in the AR gene were identified in all six patients, and all mutations caused amino acid substitutions. One patient with incomplete androgen insensitivity was a mosaic for the mutation. Four of the five mothers, as well as a young sister of one patient, were carriers of the mutation present in the affected child. The data show that new mutations may occur in the androgen receptor gene leading to sporadic androgen insensitivity syndrome. Molecular genetic characterization of the variant allele can serve as a primary tool for diagnosis and subsequent therapy, and can provide a basis for distinguishing heterozygous carriers in familial androgen resistance. The identification of carriers is of substantial clinical importance for genetic counseling. 29 refs., 2 figs., 1 tab.

  3. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    OpenAIRE

    Lobaccaro, J.M.; Lumbroso, S.; Poujol, Nicolas; Georget, V.; Brinkmann, Albert; Malpuech, Georges; Sultan, C.

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for a predictive frameshift in the open reading frame and introduction of a premature stop codon at position 783 instead of 919. The deletion was reproduced in androgen receptor wildtype cDNA and tran...

  4. Photoperiod and testosterone regulate androgen receptor immunostaining in the Siberian hamster brain.

    Science.gov (United States)

    Bittman, Eric L; Ehrlich, David A; Ogdahl, Justyne L; Jetton, Amy E

    2003-09-01

    Day length regulates the effects of gonadal steroids on gonadotropin secretion and behavior in seasonal breeders. To determine whether this influence of photoperiod results from changes in androgen receptor expression in Siberian hamster brain regions that regulate neuroendocrine function, androgen receptor immunostaining was examined in castrated animals given either no androgen replacement or one of three doses of testosterone (T) resulting in physiological serum concentrations. Half of the animals were housed under inhibitory photoperiod conditions, and immunostaining was quantified 11 days later. Measurement of serum gonadotropin and prolactin concentrations confirmed that androgen exerted graded effects on pituitary function but that the animals were killed before photoperiodic influences had fully developed. T significantly increased the numbers of androgen receptor-immunoreactive cells in every brain region examined. Photoperiod exerted no significant influence on androgen receptor-immunoreactive cell number in the arcuate nucleus, bed nucleus of the stria terminalis (BNST), medial preoptic nucleus, or in medial amygdala. An interaction between T and photoperiod was observed in the BNST and in the rostral and middle portions of the arcuate nucleus. Although increasing concentrations of T resulted in more intense cellular immunostaining in the BNST and arcuate, this effect was not influenced by day length. These results indicate that relatively short-duration (11 days) exposure to inhibitory photoperiod triggers localized and regionally specific changes in androgen receptor expression.

  5. Androgen receptor gene mutations in hormone-refractory prostate cancer.

    Science.gov (United States)

    Wallén, M J; Linja, M; Kaartinen, K; Schleutker, J; Visakorpi, T

    1999-12-01

    Prostate cancer is considered to be one of the most hormone-dependent human malignancies. As a key mediator of hormonal response, the androgen receptor (AR) is believed to have an important role in the progression of prostate cancer. Mutations in the coding region of the AR gene have been found in both untreated and hormone-refractory prostate cancer, but the frequency of such mutations at different stages of the disease is poorly documented and even contradictory results have been published. In the present study, the frequency of AR gene mutations was determined in 30 locally recurrent and two metastatic hormone-refractory prostate tumours using the polymerase chain reaction (PCR), non-radioactive single strand conformation polymorphism (SSCP), and sequencing. The length of the polymorphic CAG repeat, which is inversely correlated with the ability of the AR to activate transcription, was also analysed as well as the GGC repeat. Twelve samples were known to contain an AR gene amplification. Altogether, one point mutation (Gly(674)-->Ala) and one microsatellite mutation (CAG(20)-->CAG(18)) were found, both in cancers containing the AR gene amplification. The mean lengths of the polymorphic CAG and GGC repeats were similar to those observed in the normal population. These results favour the view that mutations in the AR gene are rare in hormone-refractory prostate cancer and do not play an important role, at least, in local relapse. Instead, the amplification and consequent overexpression of the wild-type AR gene seem to be the most common alteration involving the AR in hormone-refractory prostate cancer.

  6. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    NARCIS (Netherlands)

    J.M. Lobaccaro; S. Lumbroso; N. Poujol (Nicolas); V. Georget; A.O. Brinkmann (Albert); G. Malpuech (Georges); C. Sultan

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for

  7. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  8. ERG Cooperates with Androgen Receptor in Regulating Trefoil Factor 3 in Prostate Cancer Disease Progression

    Directory of Open Access Journals (Sweden)

    David S. Rickman

    2010-12-01

    Full Text Available To elucidate the role of ETS gene fusions in castration-resistant prostate cancer (CRPC, we characterized the transcriptome of 54 CRPC tumor samples from men with locally advanced or metastatic disease. Trefoil factor 3 (TFF3 emerged as the most highly differentially regulated gene with respect to ERG rearrangement status and resistance to hormone ablation therapy. Conventional chromatin immunoprecipitation (ChIP-polymerase chain reaction and ChIP followed by DNA sequencing (ChIP-seq revealed direct binding of ERG to ETS binding sites in the TFF3 promoter in ERG-rearranged prostate cancer cell lines. These results were confirmed in ERG-rearranged hormone-naive prostate cancer (HNPC and CRPC tissue samples. Functional studies demonstrated that ERG has an inhibitory effect on TFF3 expression in hormone-naive cancer but not in the castration-resistant state. In addition, we provide evidence suggesting an effect of androgen receptor signaling on ERG-regulated TFF3 expression. Furthermore, TFF3 overexpression enhances ERG-mediated cell invasion in CRPC prostate cancer cells. Taken together, our findings reveal a novel mechanism for enhanced tumor cell aggressiveness resulting from ERG rearrangement in the castration-resistant setting through TFF3 gene expression.

  9. ERG cooperates with androgen receptor in regulating trefoil factor 3 in prostate cancer disease progression.

    Science.gov (United States)

    Rickman, David S; Chen, Ying-Bei; Banerjee, Samprit; Pan, Yihang; Yu, Jindan; Vuong, Terry; Perner, Sven; Lafargue, Christopher J; Mertz, Kirsten D; Setlur, Sunita R; Sircar, Kanishka; Chinnaiyan, Arul M; Bismar, Tarek A; Rubin, Mark A; Demichelis, Francesca

    2010-12-01

    To elucidate the role of ETS gene fusions in castration-resistant prostate cancer (CRPC), we characterized the transcriptome of 54 CRPC tumor samples from men with locally advanced or metastatic disease. Trefoil factor 3 (TFF3) emerged as the most highly differentially regulated gene with respect to ERG rearrangement status and resistance to hormone ablation therapy. Conventional chromatin immunoprecipitation (ChIP)-polymerase chain reaction and ChIP followed by DNA sequencing (ChIP-seq) revealed direct binding of ERG to ETS binding sites in the TFF3 promoter in ERG-rearranged prostate cancer cell lines. These results were confirmed in ERG-rearranged hormone-naive prostate cancer (HNPC) and CRPC tissue samples. Functional studies demonstrated that ERG has an inhibitory effect on TFF3 expression in hormone-naive cancer but not in the castration-resistant state. In addition, we provide evidence suggesting an effect of androgen receptor signaling on ERG-regulated TFF3 expression. Furthermore, TFF3 overexpression enhances ERG-mediated cell invasion in CRPC prostate cancer cells. Taken together, our findings reveal a novel mechanism for enhanced tumor cell aggressiveness resulting from ERG rearrangement in the castration-resistant setting through TFF3 gene expression.

  10. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer

    OpenAIRE

    Madjunkova, S.; Eftimov, A.; Georgiev, V.; Petrovski, D; Dimovski, AJ; Plaseska-Karanfilska, D

    2012-01-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5′ end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. Th...

  11. Gene expression profiling of the androgen receptor antagonists flutamide and vinclozolin in zebrafish (Danio rerio) gonads

    Energy Technology Data Exchange (ETDEWEB)

    Martinovic-Weigelt, Dalma, E-mail: dalma@stthomas.edu [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); University of St. Thomas, 2115 Summit Ave, Saint Paul, MN 55105 (United States); Wang Ronglin [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Villeneuve, Daniel L. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); Bencic, David C.; Lazorchak, Jim [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Ankley, Gerald T. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States)

    2011-01-25

    The studies presented in this manuscript focus on characterization of transcriptomic responses to anti-androgens in zebrafish (Danio rerio). Research on the effects of anti-androgens in fish has been characterized by a heavy reliance on apical endpoints, and molecular mechanisms of action (MOA) of anti-androgens remain poorly elucidated. In the present study, we examined effects of a short term exposure (24-96 h) to the androgen receptor antagonists flutamide (FLU) and vinclozolin (VZ) on gene expression in gonads of sexually mature zebrafish, using commercially available zebrafish oligonucleotide microarrays (4 x 44 K platform). We found that VZ and FLU potentially impact reproductive processes via multiple pathways related to steroidogenesis, spermatogenesis, and fertilization. Observed changes in gene expression often were shared by VZ and FLU, as demonstrated by overlap in differentially-expressed genes and enrichment of several common key pathways including: (1) integrin and actin signaling, (2) nuclear receptor 5A1 signaling, (3) fibroblast growth factor receptor signaling, (4) polyamine synthesis, and (5) androgen synthesis. This information should prove useful to elucidating specific mechanisms of reproductive effects of anti-androgens in fish, as well as developing biomarkers for this important class of endocrine-active chemicals.

  12. Genetic and Functional Analysis of Androgen Receptor Gene Mutations

    NARCIS (Netherlands)

    H.T. Brüggenwirth (Hennie)

    1998-01-01

    textabstractNuclear hormone receptors (NHRs) are intermediary factors through which extracellular signals regulate expression of genes that are involved in homeostasis, development, and differentiation (Beato et al. '995, Mangelsdorf and Evans 1995). These receptors are characterized by a modular st

  13. 苯丙酸诺龙对烫伤模型大鼠雄激素受体介导靶基因转录调控的影响%Effect of nandrolone phenylpropionate on androgen receptor-mediated transcriptional regulation of target genes in rat scald models

    Institute of Scientific and Technical Information of China (English)

    李凯; 岑瑛

    2015-01-01

    BACKGROUND:Moderate to severe burn and trauma, treatment of which has been paid equal attention to wound surface, is always a difficulty of clinical systemic treatment and has a poor prognosis. Anabolic hormones have acquired secure and good results in the treatment of burns in both animals and clinical patients. Although use of anabolic hormones is restricted by the doping management, but its androgen receptor and nuclear receptor coregulators are the newly emerging areas of interests in the field of gene regulation mechanism in recent years. OBJECTIVE:To investigate the effect of nandrolone phenylpropionate on androgen receptor-mediated transcriptional regulation of target gene in rat scald models. METHODS: Thirty-six rats were randomly divided into nandrolone phenylpropionate, model and control groups. In the nandrolone phenylpropionate and model groups, rats were subjected to a 20% total body surface area second-degree scald injury by hot water. Two days after model preparation, rats in these two groups were intramuscularly injected with nandrolone phenylpropionate and saline, once every other day, for a total of 21 days. RESULTS AND CONCLUSION:The gene expression levels of steroid receptor coactivator-1 and insulin-like growth factor 1 in the rat livers and gonads (testes, ovaries) were significantly different between the nandrolone phenylpropionate and model groups (P 0.05)。说明在不同组织不同生理病理条件下苯丙酸诺龙对类固醇受体辅助活化因子1、c-myc、胰岛素样生长因子1基因表达的作用是不同的。

  14. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  15. Neural androgen receptors modulate gene expression and social recognition but not social investigation

    Directory of Open Access Journals (Sweden)

    Sara A Karlsson

    2016-03-01

    Full Text Available The role of sex and androgen receptors (ARs for social preference and social memory is rather unknown. In this study of mice we compared males, females and males lacking ARs specifically in the nervous system, ARNesDel, with respect to social preference, assessed with the three-chambered apparatus test, and social recognition, assessed with the social discrimination procedure. In the social discrimination test we also evaluated the tentative importance of the sex of the stimulus animal. Novel object recognition and olfaction were investigated to complement the results from the social tests. Gene expression analysis was performed to reveal molecules involved in the effects of sex and androgens on social behaviors. All three test groups showed social preference in the three-chambered apparatus test. In both social tests an AR-independent sexual dimorphism was seen in the persistence of social investigation of female conspecifics, whereas the social interest towards male stimuli mice was similar in all groups. Male and female controls recognized conspecifics independent of their sex, whereas ARNesDel males recognized female but not male stimuli mice. Moreover, the non-social behaviors were not affected by AR deficiency. The gene expression analyses of hypothalamus and amygdala indicated that Oxtr, Cd38, Esr1, Cyp19a1, Ucn3, Crh and Gtf2i were differentially expressed between the three groups. In conclusion, our results suggest that ARs are required for recognition of male but not female conspecifics, while being dispensable for social investigation towards both sexes. In addition, the AR seems to regulate genes related to oxytocin, estrogen and William’s syndrome.

  16. Testosterone regulates keratin 33B expression in rat penis growth through androgen receptor signaling.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Dang, Qiang; Shi, Qi; Gao, Yang; Guo, Peng; Xu, Shan; Wang, Xin-Yang; He, Da-Lin; Gong, Yong-Guang

    2014-01-01

    Androgen therapy is the mainstay of treatment for the hypogonadotropic hypogonadal micropenis because it obviously enhances penis growth in prepubescent microphallic patients. However, the molecular mechanisms of androgen treatment leading to penis growth are still largely unknown. To clarify this well-known phenomenon, we successfully generated a castrated male Sprague Dawley rat model at puberty followed by testosterone administration. Interestingly, compared with the control group, testosterone treatment stimulated a dose-dependent increase of penis weight, length, and width in castrated rats accompanied with a dramatic recovery of the pathological changes of the penis. Mechanistically, testosterone administration substantially increased the expression of androgen receptor (AR) protein. Increased AR protein in the penis could subsequently initiate transcription of its target genes, including keratin 33B (Krt33b). Importantly, we demonstrated that KRT33B is generally expressed in the rat penis and that most KRT33B expression is cytoplasmic. Furthermore, AR could directly modulate its expression by binding to a putative androgen response element sequence of the Krt33b promoter. Overall, this study reveals a novel mechanism facilitating penis growth after testosterone treatment in precastrated prepubescent animals, in which androgen enhances the expression of AR protein as well as its target genes, such as Krt33b.

  17. Rescue of Metabolic Alterations in AR113Q Skeletal Muscle by Peripheral Androgen Receptor Gene Silencing

    Directory of Open Access Journals (Sweden)

    Elisa Giorgetti

    2016-09-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA, a progressive degenerative disorder, is caused by a CAG/glutamine expansion in the androgen receptor (polyQ AR. Recent studies demonstrate that skeletal muscle is an important site of toxicity that contributes to the SBMA phenotype. Here, we sought to identify critical pathways altered in muscle that underlie disease manifestations in AR113Q mice. This led to the unanticipated identification of gene expression changes affecting regulators of carbohydrate metabolism, similar to those triggered by denervation. AR113Q muscle exhibits diminished glycolysis, altered mitochondria, and an impaired response to exercise. Strikingly, the expression of genes regulating muscle energy metabolism is rescued following peripheral polyQ AR gene silencing by antisense oligonucleotides (ASO, a therapeutic strategy that alleviates disease. Our data establish the occurrence of a metabolic imbalance in SBMA muscle triggered by peripheral expression of the polyQ AR and indicate that alterations in energy utilization contribute to non-neuronal disease manifestations.

  18. Transcriptional network of androgen receptor in prostate cancer progression.

    Science.gov (United States)

    Takayama, Ken-ichi; Inoue, Satoshi

    2013-08-01

    The androgen receptor belongs to the nuclear receptor superfamily and functions as a ligand-dependent transcription factor. It binds to the androgen responsive element and recruits coregulatory factors to modulate gene transcription. In addition, the androgen receptor interacts with other transcription factors, such as forkhead box A1, and other oncogenic signaling pathway molecules that bind deoxyribonucleic acid and regulate transcription. Androgen receptor signaling plays an important role in the development of prostate cancer. Prostate cancer cells proliferate in an androgen-dependent manner, and androgen receptor blockade is effective in prostate cancer therapy. However, patients often progress to castration-resistant prostate cancer with elevated androgen receptor expression and hypersensitivity to androgen. Recently, comprehensive analysis tools, such as complementary DNA microarray, chromatin immunoprecipitation-on-chip and chromatin immunoprecipitation-sequence, have described the androgen-mediated diverse transcriptional program and gene networks in prostate cancer. Furthermore, functional and clinical studies have shown that some of the androgen receptor-regulated genes could be prognostic markers and potential therapeutic targets for the treatment of prostate cancer, particularly castration-resistant prostate cancer. Thus, identifying androgen receptor downstream signaling events and investigating the regulation of androgen receptor activity is critical for understanding the mechanism of carcinogenesis and progression to castration-resistant prostate cancer.

  19. Cryptotanshinone Regulates Androgen Synthesis through the ERK/c-Fos/CYP17 Pathway in Porcine Granulosa Cells

    Directory of Open Access Journals (Sweden)

    Danfeng Ye

    2017-01-01

    Full Text Available The aim of the study is to investigate the molecular mechanism behind androgen reduction in porcine granulosa cells (pGCs with Salvia miltiorrhiza Bunge extract cryptotanshinone. PGCs were isolated from porcine ovaries and identified. Androgen excess model of the pGCs was induced with the MAPK inhibitor PD98059 and then treated with cryptotanshinone. The testosterone level was measured by radioimmunoassay in the culture media. The protein levels of P-ERK1/2, c-Fos, and CYP17 in the cells were measured by western blot. Cryptotanshinone decreased the concentration of testosterone and the protein level of CYP17 and increased the protein levels of P-ERK1/2 and c-Fos in the androgen excess mode. After the c-Fos gene was silenced by infection with c-Fos shRNA lentivirus, we measured the mRNA expression by quantitative RT-PCR and protein level by western blot of P-ERK1/2, c-Fos, and CYP17. This showed that the mRNA expression and protein level of P-ERK1/2 and c-Fos were significantly reduced in the shRNA–c-Fos group compared to the scrambled group, while those of CYP17 were significantly increased. So we concluded that cryptotanshinone can significantly reduce the androgen excess induced by PD98059 in pGCs. The possible molecular mechanism for this activity is regulating the ERK/c-Fos/CYP17 pathway.

  20. Cryptotanshinone Regulates Androgen Synthesis through the ERK/c-Fos/CYP17 Pathway in Porcine Granulosa Cells

    Science.gov (United States)

    Ye, Danfeng; Li, Meifang; Zhang, Yuehui; Wang, Xinhua; Liu, Hua; Wu, Wanting; Ma, Wanying; Quan, Kewei; Ng, Ernest H. Y.

    2017-01-01

    The aim of the study is to investigate the molecular mechanism behind androgen reduction in porcine granulosa cells (pGCs) with Salvia miltiorrhiza Bunge extract cryptotanshinone. PGCs were isolated from porcine ovaries and identified. Androgen excess model of the pGCs was induced with the MAPK inhibitor PD98059 and then treated with cryptotanshinone. The testosterone level was measured by radioimmunoassay in the culture media. The protein levels of P-ERK1/2, c-Fos, and CYP17 in the cells were measured by western blot. Cryptotanshinone decreased the concentration of testosterone and the protein level of CYP17 and increased the protein levels of P-ERK1/2 and c-Fos in the androgen excess mode. After the c-Fos gene was silenced by infection with c-Fos shRNA lentivirus, we measured the mRNA expression by quantitative RT-PCR and protein level by western blot of P-ERK1/2, c-Fos, and CYP17. This showed that the mRNA expression and protein level of P-ERK1/2 and c-Fos were significantly reduced in the shRNA–c-Fos group compared to the scrambled group, while those of CYP17 were significantly increased. So we concluded that cryptotanshinone can significantly reduce the androgen excess induced by PD98059 in pGCs. The possible molecular mechanism for this activity is regulating the ERK/c-Fos/CYP17 pathway. PMID:28167972

  1. Regulated Gene Therapy.

    Science.gov (United States)

    Breger, Ludivine; Wettergren, Erika Elgstrand; Quintino, Luis; Lundberg, Cecilia

    2016-01-01

    Gene therapy represents a promising approach for the treatment of monogenic and multifactorial neurological disorders. It can be used to replace a missing gene and mutated gene or downregulate a causal gene. Despite the versatility of gene therapy, one of the main limitations lies in the irreversibility of the process: once delivered to target cells, the gene of interest is constitutively expressed and cannot be removed. Therefore, efficient, safe and long-term gene modification requires a system allowing fine control of transgene expression.Different systems have been developed over the past decades to regulate transgene expression after in vivo delivery, either at transcriptional or post-translational levels. The purpose of this chapter is to give an overview on current regulatory system used in the context of gene therapy for neurological disorders. Systems using external regulation of transgenes using antibiotics are commonly used to control either gene expression using tetracycline-controlled transcription or protein levels using destabilizing domain technology. Alternatively, specific promoters of genes that are regulated by disease mechanisms, increasing expression as the disease progresses or decreasing expression as disease regresses, are also examined. Overall, this chapter discusses advantages and drawbacks of current molecular methods for regulated gene therapy in the central nervous system.

  2. CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

    Directory of Open Access Journals (Sweden)

    O. B. Loran

    2014-07-01

    Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

  3. CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

    Directory of Open Access Journals (Sweden)

    O. B. Loran

    2009-01-01

    Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

  4. Androgen Depletion Induces Senescence in Prostate Cancer Cells through Down-regulation of Skp2

    Directory of Open Access Journals (Sweden)

    Zuzana Pernicová

    2011-06-01

    Full Text Available Although the induction of senescence in cancer cells is a potent mechanism of tumor suppression, senescent cells remain metabolically active and may secrete a broad spectrum of factors that promote tumorigenicity in neighboring malignant cells. Here we show that androgen deprivation therapy (ADT, a widely used treatment for advanced prostate cancer, induces a senescence-associated secretory phenotype in prostate cancer epithelial cells, indicated by increases in senescence-associated β-galactosidase activity, heterochromatin protein 1β foci, and expression of cathepsin B and insulin-like growth factor binding protein 3. Interestingly, ADT also induced high levels of vimentin expression in prostate cancer cell lines in vitro and in human prostate tumors in vivo. The induction of the senescence-associated secretory phenotype by androgen depletion was mediated, at least in part, by down-regulation of S-phase kinase-associated protein 2, whereas the neuroendocrine differentiation of prostate cancer cells was under separate control. These data demonstrate a previously unrecognized link between inhibition of androgen receptor signaling, down-regulation of S-phase kinase-associated protein 2, and the appearance of secretory, tumor-promoting senescent cells in prostate tumors. We propose that ADT may contribute to the development of androgen-independent prostate cancer through modulation of the tissue microenvironment by senescent cells.

  5. Regulation of GLUT transporters by flavonoids in androgen-sensitive and -insensitive prostate cancer cells.

    Science.gov (United States)

    Gonzalez-Menendez, Pedro; Hevia, David; Rodriguez-Garcia, Aida; Mayo, Juan C; Sainz, Rosa M

    2014-09-01

    Cancer cells show different metabolic requirements from normal cells. In prostate cancer, particularly, glycolytic metabolism differs in androgen-responsive and nonresponsive cells. In addition, some natural compounds with antiproliferative activities are able to modify glucose entry into cells by either modulating glucose transporter (GLUT) expression or by altering glucose binding. The aim of this work was to study the regulation of some GLUTs (GLUT1 and GLUT4) in both androgen-sensitive (LNCaP) and -insensitive (PC-3) prostate cancer cells by 4 structurally different flavonoids (ie, genistein, phloretin, apigenin, and daidzein). Glucose uptake was measured using nonradiolabeled 2-deoxyglucose. The evaluation of protein levels as well as subcellular distribution of GLUT1/4 were analyzed by Western blot and immunocytochemistry, respectively. Androgen-insensitive LNCaP-R and androgen-sensitive PC-3-AR cells were used to study the effect of androgen signaling. Additionally, a docking simulation was employed to compare interactions between flavonoids and XylE, a bacterial homolog of GLUT1 to -4. Results show for the first time the presence of functionally relevant GLUT4 in prostate cancer cells. Furthermore, differences in GLUT1 and GLUT4 levels and glucose uptake were found, without differences on subcellular distribution, after incubation with flavonoids. Docking simulation showed that all compounds interact with the same location of transporters. More importantly, differences between androgen-sensitive and -insensitive prostate cancer cells were found in both GLUT protein levels and glucose uptake. Thus, phenotypic characteristics of prostate cancer cells are responsible for the different effects of these flavonoids in glucose uptake and in GLUT expression rather than their structural differences, with the most effective in reducing cell growth being the highest in modifying glucose uptake and GLUT levels.

  6. CAG repeat polymorphism in the androgen receptor (AR) gene of SBMA patients and a control group.

    Science.gov (United States)

    Sułek, Anna; Hoffman-Zacharska, Dorota; Krysa, Wioletta; Szirkowiec, Walentyna; Fidziańska, Elzbieta; Zaremba, Jacek

    2005-01-01

    Spinobulbar muscular atrophy (SBMA) is an X-linked form of motor neuron disease characterized by progressive atrophy of the muscles, dysphagia, dysarthria and mild androgen insensitivity. SBMA is caused by CAG repeat expansion in the androgen receptor gene. CAG repeat polymorphism was analysed in a Polish control group (n = 150) and patients suspected of SBMA (n = 60). Normal and abnormal ranges of CAG repeats were established in the control group and in 21 patients whose clinical diagnosis of SBMA was molecularly confirmed. The ranges are similar to those reported for other populations.

  7. Androgen Receptor-Target Genes in African American Prostate Cancer Disparities

    Directory of Open Access Journals (Sweden)

    Bi-Dar Wang

    2013-01-01

    Full Text Available The incidence and mortality rates of prostate cancer (PCa are higher in African American (AA compared to Caucasian American (CA men. To elucidate the molecular mechanisms underlying PCa disparities, we employed an integrative approach combining gene expression profiling and pathway and promoter analyses to investigate differential transcriptomes and deregulated signaling pathways in AA versus CA cancers. A comparison of AA and CA PCa specimens identified 1,188 differentially expressed genes. Interestingly, these transcriptional differences were overrepresented in signaling pathways that converged on the androgen receptor (AR, suggesting that the AR may be a unifying oncogenic theme in AA PCa. Gene promoter analysis revealed that 382 out of 1,188 genes contained cis-acting AR-binding sequences. Chromatin immunoprecipitation confirmed STAT1, RHOA, ITGB5, MAPKAPK2, CSNK2A,1 and PIK3CB genes as novel AR targets in PCa disparities. Moreover, functional screens revealed that androgen-stimulated AR binding and upregulation of RHOA, ITGB5, and PIK3CB genes were associated with increased invasive activity of AA PCa cells, as siRNA-mediated knockdown of each gene caused a loss of androgen-stimulated invasion. In summation, our findings demonstrate that transcriptional changes have preferentially occurred in multiple signaling pathways converging (“transcriptional convergence” on AR signaling, thereby contributing to AR-target gene activation and PCa aggressiveness in AAs.

  8. Differential regulation of glutathione S—transferase Yb1 mRNA levels in rat prostate,liver and brain by androgen

    Institute of Scientific and Technical Information of China (English)

    ZHANGYUAN; CHAWNSHANGCHANG; 等

    1995-01-01

    Northern blot analysis of glutathione S-transferase (GST)Yb1 mRNA in different tissues of male and female rate revealed that its tissue-specific transcription patterns were highly sex hormone related.Although the GST Yb1 mRNA could be detected in most of the tissues examined at various levels,the highest abundance was observed in the ventral prostate,uterus and liver,which were the main the ventral prostate,uterus and liver,which were the main target tissue for androgen,estrogen and glucocorticoid respectively.The effect of androgen on the transcription of GST YB1 was also tissue-specific.Since androgen with drawal by castration caused the up-regulation of GST Yb1 mRNA in the ventral prostate but down-regulation in the liver and no effect in the brain,evalution of this system for studying the regulation mechanisms of gene expression by which androgen exerts its differential effects has been discussed.

  9. Effect of androgen withdrawal on activation of ERKs and expression of cell cycle regulation molecules in human prostate carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    YE Ding-wei; LI Hui; TSENG Jane; CHAUVIN Priscilla; QIAN Song-xi; ZHENG Jia-fu; SUN Ying-hao; MA Yong-jiang

    2002-01-01

    Objective: To explore the possible mechanisms of growth regression of human androgen dependentprostate carcinoma cells caused by androgen withdrawal. Methods: After 24 h of treatment with 1×10-9mol/L dihydrotestosterone (DHT), the expression of phosphorylated ERK proteins and cell cycle regulationmolecules including CDK2, CDK4, CDK6 and P27kip1 in human androgen dependent prostate carcinoma cellline LNCaP was measured by Western blot analysis 0 h, 8 h and 24 h of after androgen withdrawal. Humanandrogen independent prostate carcinoma cell line PC-3 was also examined as control. Results: Down-regula-tion of phosphorylated ERK, CDK2, CDK4 and CDK6 and up-regulation of P27kip1 were found initially inLNCaP cell line 8 h after androgen withdrawal. The levels of phosphorylated ERK and CDKs decreased con-tinuously and reached the lowest after 24 h, while continuous elevation of P27kip1 was detected thereafter to 24h. No expression change of phosphorylated ERK, CDKs and P27kip1 were detected in PC-3 cell line. Conclu-sion: The androgen withdrawal can cause ERKs activation decrease and cell cycle regulation moleculeschanges, which may be one of the mechanisms for inhibited growth of androgen dependent prostate carcinomaafter androgen ablation by either operative or medicine methods.

  10. Gene expression changes in rat prostate after activation or blocking of the androgen and estrogen receptor

    DEFF Research Database (Denmark)

    Nellemann, Christine Lydia; Dalgaard, Majken; Holst, Bjørn;

    2005-01-01

    Several endpoints of different molecular complexity were studied in the Hershberger assay in order to evaluate the specificity and suitability of this test as a broad screening model. Androgen and estrogen receptors were activated or blocked, and expression of typical estrogen- or androgen...... and the anti-estrogen, ICI 182780, only affected ODC expression. Therefore, estrogenic or anti-estrogenic compounds would not be expected to seriously affect the outcome of a Hershberger test. However, EB given alone to castrated rats resulted in various effects. EB increased seminal vesicle weight, an effect...... reversed by ICI 182780, and affected TRPM-2, PBP C3, ODC, IGF-1, AR, and ERa mRNA levels. AR expression in the prostate seemed to be under regulation of both estrogens and androgens, as ICI 182780 inhibited the testosterone-induced AR expression, and flutamide inhibited the EB-induced AR expression...

  11. Relationships between androgens, serotonin gene expression and innervation in male macaques.

    Science.gov (United States)

    Bethea, C L; Coleman, K; Phu, K; Reddy, A P; Phu, A

    2014-08-22

    Androgen administration to castrated individuals was purported to decrease activity in the serotonin system. However, we found that androgen administration to castrated male macaques increased fenfluramine-induced serotonin release as reflected by increased prolactin secretion. In this study, we sought to define the effects of androgens and aromatase inhibition on serotonin-related gene expression in the dorsal raphe, as well as serotonergic innervation of the LC. Male Japanese macaques (Macaca fuscata) were castrated for 5-7 months and then treated for 3 months with (1) placebo, (2) testosterone (T), (3) dihydrotestosterone (DHT; non-aromatizable androgen) and ATD (steroidal aromatase inhibitor), or (4) Flutamide (FLUT; androgen antagonist) and ATD (n=5/group). This study reports the expression of serotonin-related genes: tryptophan hydroxylase 2 (TPH2), serotonin reuptake transporter (SERT) and the serotonin 1A autoreceptor (5HT1A) using digoxigenin-ISH and image analysis. To examine the production of serotonin and the serotonergic innervation of a target area underlying arousal and vigilance, we measured the serotonin axon density entering the LC with ICC and image analysis. TPH2 and SERT expression were significantly elevated in T- and DHT + ATD-treated groups over placebo- and FLUT + ATD-treated groups in the dorsal raphe (p expression between the groups. There was a significant decrease in the pixel area of serotonin axons and in the number of varicosities in the LC across the treatment groups with T > placebo > DHT + ATD = FLUT + ATD treatments. Comparatively, T- and DHT + ATD-treated groups had elevated TPH2 and SERT gene expression, but the DHT + ATD group had markedly suppressed serotonin axon density relative to the T-treated group. Further comparison with previously published data indicated that TPH2 and SERT expression reflected yawning and basal prolactin secretion. The serotonin axon density in the LC agreed with the area under the fenfluramine

  12. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol

    Energy Technology Data Exchange (ETDEWEB)

    Elo, J.P.; Kvist, L.; Leinonen, K.; Isomaa, V. [Univ. of Oulu (Finland)] [and others

    1995-12-01

    Androgens are necessary for the development of prostatic cancer. The mechanisms by which the originally androgen-dependent prostatic cancer cells are relieved of the requirement to use androgen for their growth are largely unknown. The human prostatic cancer cell line LNCaP has been shown to contain a point mutation in the human androgen receptor gene (hAR), suggesting that changes in the hAR may contribute to the abnormal hormone response of prostatic cells. To search for point mutations in the hAR, we used single strand conformation polymorphism analysis and a polymerase chain reaction direct sequencing method to screen 23 prostatic cancer specimens from untreated patients, 6 prostatic cancer specimens from treated patients, and 11 benign prostatic hyperplasia specimens. One mutation was identified in DNA isolated from prostatic cancer tissue, and the mutation was also detected in the leukocyte DNA of the patient and his offspring. The mutation changed codon 726 in exon E from arginine to leucine and was a germ line mutation. The mutation we found in exon E of the hAR gene does not alter the ligand binding specificity of the AR, but the mutated receptor was activated by estradiol to a significantly greater extent than the wild-type receptor. The AR gene mutation described in this study might be one explanation for the altered biological activity of prostatic cancer. 36 refs., 4 figs.

  13. A large deletion/insertion-induced frameshift mutation of the androgen receptor gene in a family with a familial complete androgen insensitivity syndrome.

    Science.gov (United States)

    Cong, Peikuan; Ye, Yinghui; Wang, Yue; Lu, Lingping; Yong, Jing; Yu, Ping; Joseph, Kimani Kagunda; Jin, Fan; Qi, Ming

    2012-06-01

    Androgen insensitivity syndrome (AIS) is an X-linked recessive genetic disorder with a normal 46, XY karyotype caused by abnormality of the androgen receptor (AR) gene. One Chinese family consisting of the proband and 5 other members with complete androgen insensitivity syndrome (CAIS) was investigated. Mutation analysis by DNA sequencing on all 8 exons and flanking intron regions of the AR gene revealed a unique large deletion/insertion mutation in the family. A 287 bp deletion and 77 bp insertion (c.933_1219delins77) mutation at codon 312 resulted in a frameshift which caused a premature stop (p.Phe312Aspfs*7) of polypeptide formation. The proband's mother and grandmother were heterozygous for the mutant allele. The proband's father, uncle and grandfather have the normal allele. From the pedigree constructed from mutational analysis of the family, it is revealed that the probably pathogenic mutation comes from the maternal side.

  14. Regulation of human androgen receptor by corepressors and signal transduction in prostate cancer

    OpenAIRE

    2006-01-01

    The thesis primarily addresses the role of transcriptional corepressor and signal transduction cascades in regulating androgen receptor (AR) activity. AR is a ligand-activated transcription factor and is important for the development of male phenotype. Malfunctioning of AR function has been implicated in the progression of the prostate cancer (CaP). Clinical management of the CaP most often involves the administration of anti-hormones (Cas, CPA) that bind to AR and turn it transcr...

  15. Photoperiodic regulation of androgen receptor and steroid receptor coactivator-1 in Siberian hamster brain.

    Science.gov (United States)

    Tetel, Marc J; Ungar, Todd C; Hassan, Brett; Bittman, Eric L

    2004-11-24

    Seasonal changes in the neuroendocrine actions of gonadal steroid hormones are triggered by fluctuations in daylength. The mechanisms responsible for photoperiodic influences upon the feedback and behavioral effects of testosterone in Siberian hamsters are poorly understood. We hypothesized that daylength regulates the expression of androgen receptor (AR) and/or steroid receptor coactivator-1 (SRC-1) in specific forebrain regions. Hamsters were castrated and implanted with either oil-filled capsules or low doses of testosterone; half of the animals remained in 16L/8D and the rest were kept in 10L/14D for the ensuing 70 days. The number of AR-immunoreactive (AR-ir) cells was regulated by testosterone in medial amygdala and caudal arcuate, and by photoperiod in the medial preoptic nucleus and the posterodorsal medial amygdala. A significant interaction between photoperiod and androgen treatment was found in medial preoptic nucleus and posterodorsal medial amygdala. The molecular weight and distribution of SRC-1 were similar to reports in other rodent species, and short days reduced the number of SRC-1-ir cells in posteromedial bed nucleus of the stria terminalis (BNST) and posterodorsal medial amygdala. A significant interaction between androgen treatment and daylength in regulation of SRC-1-ir was found in anterior medial amygdala. The present results indicate that daylength-induced fluctuations in SRC-1 and AR expression may contribute to seasonally changing effects of testosterone.

  16. Prostate Cell Specific Regulation of Androgen Receptor Phosphorylation In Vivo

    Science.gov (United States)

    2006-11-01

    analysis indicates that the screen is preferentially isolating proteins with a known role in gene transcription and we are currently assessing the phosphorylation- dependence of the putative AR interacting proteins .

  17. Aberrant splicing of androgenic receptor mRNA results in synthesis of a nonfunctional receptor protein in a patient with androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Ris-Stalpers, C.; Kuiper, G.G.J.M.; Faber, P.W.; van Rooij, H.C.J.; Degenhart, H.J.; Trapman, J.; Brinkmann, A.O. (Erasmus Univ., Rotterdam (Netherlands)); Schweikert, H.U. (Univ. of Bonn (Germany)); Zegers, N.D. (Medical Biological Laboratory-Organization for Applied Scientific Research, Rijswijk (Netherlands)); Hodgins, M.B. (Glasgow Univ. (United Kingdom))

    1990-10-01

    Androgen insensitivity is a disorder in which the correct androgen response in an androgen target cell is impaired. The clinical symtpoms of this X chromosome-linked syndrome are presumed to be caused by mutations in the androgen receptor gene. The authors report a G {r arrow} T mutation in the splice donor site of intron 4 of the androgen receptor gene of a 46, XY subject lacking detectable androgen binding to the receptor and with the complete form of androgen insensitivity. This point mutation completely abolishes normal RNA splicing at the exon 4/intron 4 boundary and results in the activation of a cryptic splice donor site in exon 4, which leads to the deletion of 123 nucleotides from the mRNA. Translation of the mutant mRNA results in an androgen receptor protein {approx}5 kDa smaller than the wild type. This mutated androgen receptor protein was unable to bind androgens and unable to activate transcription of an androgen-regulated reporter gene construct. This mutation in the human androgen receptor gene demonstrates the importance of an intact steroid-binding domain for proper androgen receptor functioning in vivo.

  18. Expanding the therapeutic use of androgens via selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Gao, Wenqing; Dalton, James T

    2007-03-01

    Selective androgen receptor modulators (SARMs) are a novel class of androgen receptor (AR) ligands that might change the future of androgen therapy dramatically. With improved pharmacokinetic characteristics and tissue-selective pharmacological activities, SARMs are expected to greatly extend the clinical applications of androgens to osteoporosis, muscle wasting, male contraception and diseases of the prostate. Mechanistic studies with currently available SARMs will help to define the contributions of differential tissue distribution, tissue-specific expression of 5alpha-reductase, ligand-specific regulation of gene expression and AR interactions with tissue-specific coactivators to their observed tissue selectivity, and lead to even greater expansion of selective anabolic therapies.

  19. Androgen regulates development of the sexually dimorphic gastrin-releasing peptide neuron system in the lumbar spinal cord: evidence from a mouse line lacking androgen receptor in the nervous system.

    Science.gov (United States)

    Sakamoto, Hirotaka; Saito, Kazuhiro; Marie-Luce, Clarisse; Raskin, Kalina; Oti, Takumi; Satoh, Keita; Tamura, Kei; Sakamoto, Tatsuya; Mhaouty-Kodja, Sakina

    2014-01-13

    Androgens including testosterone, organize the nervous system as well as masculine external and internal genitalia during the perinatal period. Androgen organization involves promotion of masculine body features, usually by acting through androgen receptors (ARs). We have recently demonstrated that the gastrin-releasing peptide (GRP) system in the lumbar spinal cord also mediates spinal centers promoting penile reflexes during male sexual behavior in rats. Testosterone may induce sexual differentiation of this spinal GRP system during development and maintain its activation in adulthood. In the present study, we examined the role of ARs in the nervous system regulating the development of the sexually dimorphic GRP system. For this purpose, we used a conditional mouse line selectively lacking the AR gene in the nervous system. AR floxed males carrying (mutants) or not (controls) the nestin-Cre transgene were castrated in adulthood and supplemented with physiological amounts of testosterone. Loss of AR expression in the nervous system resulted in a significant decrease in the number of GRP neurons compared to control littermates. Consequently, the intensity of GRP axonal projections onto the lower lumbar and upper sacral spinal cord was greater in control males than in mutant males. These results suggest that ARs expressed in the nervous system play a significant role in the development of the GRP system in the male lumbar spinal cord. The AR-deletion mutation may attenuate sexual behavior and activity of mutant males via spinal GRP system-mediated neural mechanisms.

  20. The agonistic adrenal: melatonin elicits female aggression via regulation of adrenal androgens.

    Science.gov (United States)

    Rendon, Nikki M; Rudolph, Lauren M; Sengelaub, Dale R; Demas, Gregory E

    2015-11-22

    Classic findings have demonstrated an important role for sex steroids as regulators of aggression, but this relationship is lacking within some environmental contexts. In mammals and birds, the adrenal androgen dehydroepiandrosterone (DHEA), a non-gonadal precursor of biologically active steroids, has been linked to aggression. Although females, like males, use aggression when competing for limited resources, the mechanisms underlying female aggression remain understudied. Here, we propose a previously undescribed endocrine mechanism regulating female aggression via direct action of the pineal hormone melatonin on adrenal androgens. We examined this in a solitary hamster species, Phodopus sungorus, in which both sexes are highly territorial across the seasons, and display increased aggression concomitant with decreased serum levels of sex steroids in short 'winter-like' days. Short- but not long-day females had increased adrenal DHEA responsiveness co-occurring with morphological changes in the adrenal gland. Further, serum DHEA and total adrenal DHEA content were elevated in short days. Lastly, melatonin increased DHEA and aggression and stimulated DHEA release from cultured adrenals. Collectively, these findings demonstrate that DHEA is a key peripheral regulator of aggression and that melatonin coordinates a 'seasonal switch' from gonadal to adrenal regulation of aggression by direct action on the adrenal glands.

  1. Trichosanthes kirilowii Exerts Androgenic Activity via Regulation of PSA and KLK2 in 22Rv1 Prostate Cancer Cells

    Science.gov (United States)

    Jeong, Soo-Jin; Choi, Ji-Yoon; Dong, Mi-Sook; Seo, Chang-Seob; Shin, Hyeun-Kyoo

    2017-01-01

    Background: The androgen comprises a group of hormones that play roles in male reproductive activity as well as personal characteristics. Objective: We investigated the androgenic activity of various herbal medicines in human prostate cancer 22Rv1 cells. Materials and Methods: Herbal extracts of Trichosanthes kirilowii (TK), Asarum sieboldii (AS), Sanguisorba officinalis (SO), and Xanthium strumarium (XS) were selected to have androgenic effects based on a preliminary in vitro screening system. Results: TK, AS, SO, and XS enhanced the proliferation of 22Rv1 cells without having cytotoxic effects. All tested herbal extracts increased androgen receptor (AR)-induced transcriptional activity in the absence or presence of dihydrotestosterone (DHT). In an AR-binding assay, TK, but not AS, SO, or XS, produced a significant inhibition of AR binding activity, indicating it has androgenic activity. Additionally, TK treatment positively regulated mRNA expression of the AR-related molecular targets prostate-specific antigen (PSA) and kallikrein 2 (KLK2) compared with untreated control. Conclusion: Taken together, TK-enhanced AR-mediated transcriptional activity might be an attractive candidate drug for treating androgen-related diseases. SUMMARY Trichosantheskirilowii (TK), Asarumsieboldii (AS), Sanguisorbaofficinalis (SO), and Xanthium strumarium (XS) enhanced the proliferation of 22Rv1 cells without having cytotoxic effects.TK, AS, SO, and XS increased androgen receptor (AR)-induced transcriptional activity.TK, but not AS, SO, or XS, produced a significant inhibition against AR-binding activity.TK treatment positively regulated mRNA expression of the AR-related molecular targets prostate-specific antigen and kallikrein 2. Abbreviations used: BPH: benign prostatic hyperplasia; AR: androgen receptor; DHT: dihydrotestosterone; PSA: prostate-specific antigen; TK: Trichosanthes kirilowii; AS: Asarum sieboldii; SO: Sanguisorba officinalis; XS: Xanthium strumarium; ATCC: American

  2. The AhR Ligand, TCDD, Regulates Androgen Receptor Activity Differently in Androgen-Sensitive versus Castration-Resistant Human Prostate Cancer Cells.

    Science.gov (United States)

    Ghotbaddini, Maryam; Powell, Joann B

    2015-07-06

    The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR). TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to induce degradation of hormone receptors. The studies reported here, evaluate the effect of TCDD exposure on androgen receptor (AR) expression and activity in androgen-sensitive LNCaP and castration-resistant C4-2 prostate cancer cells. Our results show that TCDD exposure does not induce AhR or AR degradation in C4-2 cells. However, both AhR and AR are degraded in LNCaP cells following TCDD exposure. In addition, TCDD enhances AR phosphorylation and induces expression of AR responsive genes in LNCaP cells. Our data reveals that TCDD effect on AR expression and activity differs in androgen-sensitive and castration-resistant prostate cancer cell models.

  3. The AhR Ligand, TCDD, Regulates Androgen Receptor Activity Differently in Androgen-Sensitive versus Castration-Resistant Human Prostate Cancer Cells

    Directory of Open Access Journals (Sweden)

    Maryam Ghotbaddini

    2015-07-01

    Full Text Available The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR. TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to induce degradation of hormone receptors. The studies reported here, evaluate the effect of TCDD exposure on androgen receptor (AR expression and activity in androgen-sensitive LNCaP and castration-resistant C4-2 prostate cancer cells. Our results show that TCDD exposure does not induce AhR or AR degradation in C4-2 cells. However, both AhR and AR are degraded in LNCaP cells following TCDD exposure. In addition, TCDD enhances AR phosphorylation and induces expression of AR responsive genes in LNCaP cells. Our data reveals that TCDD effect on AR expression and activity differs in androgen-sensitive and castration-resistant prostate cancer cell models.

  4. Research Resource: Androgen Receptor Activity Is Regulated Through the Mobilization of Cell Surface Receptor Networks.

    Science.gov (United States)

    Hsiao, Jordy J; Ng, Brandon H; Smits, Melinda M; Martinez, Harryl D; Jasavala, Rohini J; Hinkson, Izumi V; Fermin, Damian; Eng, Jimmy K; Nesvizhskii, Alexey I; Wright, Michael E

    2015-08-01

    The aberrant expression of androgen receptor (AR)-dependent transcriptional programs is a defining pathology of the development and progression of prostate cancers. Transcriptional cofactors that bind AR are critical determinants of prostate tumorigenesis. To gain a deeper understanding of the proteins linked to AR-dependent gene transcription, we performed a DNA-affinity chromatography-based proteomic screen designed to identify proteins involved in AR-mediated gene transcription in prostate tumor cells. Functional experiments validated the coregulator roles of known AR-binding proteins in AR-mediated transcription in prostate tumor cells. More importantly, novel coregulatory functions were detected in components of well-established cell surface receptor-dependent signal transduction pathways. Further experimentation demonstrated that components of the TNF, TGF-β, IL receptor, and epidermal growth factor signaling pathways modulated AR-dependent gene transcription and androgen-dependent proliferation in prostate tumor cells. Collectively, our proteomic dataset demonstrates that the cell surface receptor- and AR-dependent pathways are highly integrated, and provides a molecular framework for understanding how disparate signal-transduction pathways can influence AR-dependent transcriptional programs linked to the development and progression of human prostate cancers.

  5. Complete androgen insensitivity syndrome caused by a novel splice donor site mutation and activation of a cryptic splice donor site in the androgen receptor gene.

    Science.gov (United States)

    Infante, Joana B; Alvelos, Maria I; Bastos, Margarida; Carrilho, Francisco; Lemos, Manuel C

    2016-01-01

    The androgen insensitivity syndrome is an X-linked recessive genetic disorder characterized by resistance to the actions of androgens in an individual with a male karyotype. We evaluated a 34-year-old female with primary amenorrhea and a 46,XY karyotype, with normal secondary sex characteristics, absence of uterus and ovaries, intra-abdominal testis, and elevated testosterone levels. Sequence analysis of the androgen receptor (AR) gene revealed a novel splice donor site mutation in intron 4 (c.2173+2T>C). RT-PCR analysis showed that this mutation resulted in the activation of a cryptic splice donor site located in the second half of exon 4 and in the synthesis of a shorter mRNA transcript and an in-frame deletion of 41 amino acids. This novel mutation associated with a rare mechanism of abnormal splicing further expands the spectrum of mutations associated with the androgen insensitivity syndrome and may contribute to the understanding of the molecular mechanisms involved in splicing defects.

  6. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer.

    Science.gov (United States)

    Madjunkova, S; Eftimov, A; Georgiev, V; Petrovski, D; Dimovski, Aj; Plaseska-Karanfilska, D

    2012-06-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5' end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. This retrospective case-control study evaluates the possible effect of short CAG repeats on the AR gene in prostate cancer risk in Macedonian males. A total of 392 male subjects, 134 PC patients, 106 patients with benign prostatic hyperplasia (BPH) and 152 males from the general Macedonian population were enrolled in this study. The CAG repeat length was determined by fluorescent polymerase chain reaction (PCR) amplification of exon1 of the AR gene followed by capillary electrophoresis (CE) on a genetic analyzer. The mean repeat length in PC patients was 21.5 ± 2.65, in controls 22.28 ± 2.86 (p = 0.009) and in BPH patients 22.1 ± 2.52 (p = 0.038). Short CAG repeats (CAG repeat (CAG repeat length. These results suggest that reduced CAG repeat length may be associated with increased prostate cancer risk in Macedonian men.

  7. Mutations of androgen receptor gene in Brazilian patients with male pseudohermaphroditism

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    1998-06-01

    Full Text Available We describe the identification of point mutations in the androgen receptor gene in five Brazilian patients with female assignment and behavior. The eight exons of the gene were amplified by the polymerase chain reaction (PCR and analyzed for single-strand conformation polymorphism (SSCP to detect the mutations. Direct sequencing of the mutant PCR products demonstrated single transitions in three of these cases: G®A in case 1, within exon C, changing codon 615 from Arg to His; G®A in case 2, within exon E, changing codon 752 from Arg to Gln, and C®T in case 3, within exon B, but without amino acid change.

  8. Nonmyocytic androgen receptor regulates the sexually dimorphic development of the embryonic bulbocavernosus muscle.

    Science.gov (United States)

    Ipulan, Lerrie Ann; Suzuki, Kentaro; Sakamoto, Yuki; Murashima, Aki; Imai, Yuuki; Omori, Akiko; Nakagata, Naomi; Nishinakamura, Ryuichi; Valasek, Petr; Yamada, Gen

    2014-07-01

    The bulbocavernosus (BC) is a sexually dimorphic muscle observed only in males. Androgen receptor knockout mouse studies show the loss of BC formation. This suggests that androgen signaling plays a vital role in its development. Androgen has been known to induce muscle hypertrophy through satellite cell activation and myonuclei accretion during muscle regeneration and growth. Whether the same mechanism is present during embryonic development is not yet elucidated. To identify the mechanism of sexual dimorphism during BC development, the timing of morphological differences was first established. It was revealed that the BC was morphologically different between male and female mice at embryonic day (E) 16.5. Differences in the myogenic process were detected at E15.5. The male BC possesses a higher number of proliferating undifferentiated myoblasts. To identify the role of androgen signaling in this process, muscle-specific androgen receptor (AR) mutation was introduced, which resulted in no observable phenotypes. Hence, the expression of AR in the BC was examined and found that the AR did not colocalize with any muscle markers such as Myogenic differentiation 1, Myogenin, and paired box transcription factor 7. It was revealed that the mesenchyme surrounding the BC expressed AR and the BC started to express AR at E15.5. AR mutation on the nonmyocytic cells using spalt-like transcription factor 1 (Sall1) Cre driver mouse was performed, which resulted in defective BC formation. It was revealed that the number of proliferating undifferentiated myoblasts was reduced in the Sall1 Cre:AR(L-/Y) mutant embryos, and the adult mutants were devoid of BC. The transition of myoblasts from proliferation to differentiation is mediated by cyclin-dependent kinase inhibitors. An increased expression of p21 was observed in the BC myoblast of the Sall1 Cre:AR(L-/Y) mutant and wild-type female. Altogether this study suggests that the nonmyocytic AR may paracrinely regulate the

  9. Validation and application of reporter gene assays for the determination of estrogenic and androgenic endocrine disruptor activity in sport supplements.

    Science.gov (United States)

    Plotan, Monika; Elliott, Christopher T; Oplatowska, Michalina; Connolly, Lisa

    2012-07-01

    Previously developed estrogen and androgen mammalian reporter gene assays (RGAs) were assessed for their potential use as a quantitative screening method in the detection of estrogenic and androgenic endocrine disruptors (EDs) in sport supplements. The validation of both RGAs coupled with dispersive solid phase extraction (dSPE) was performed in accordance with European Commission Decision EC/2002/6579 for biological screening methods. Decision limits (CCα) and detection capabilities (CCβ) were established for both the estrogen and androgen RGAs. All samples were compliant with CCα and CCβ in both bioassays. Recovery rates were 96 % for 17β-estradiol and 115 % for dihydrotestosterone as obtained in their corresponding RGA. Both estrogens and androgens were stable in samples for more than 3 weeks, when stored at -20 °C. Specificity, good repeatability (coefficients of variation (CV), 12-25 %), reproducibility and robustness of both bioassays were also observed. Four different ED modes of action were determined for estrogens and androgens in 53 sport supplements, using the validated RGAs. This study revealed that 89 % of the investigated sport supplements contained estrogenic EDs and 51 % contained androgenic compounds. In conclusion, both bioassays are suitable for sport supplement screening of estrogenic and androgenic EDs.

  10. Proteomic analysis of androgen-regulated protein expression in a mouse fetal vas deferens cell line

    NARCIS (Netherlands)

    A. Umar (Arzu); T.M. Luider (Theo); C.A. Berrevoets (Cor); J.A. Grootegoed (Anton); A.O. Brinkmann (Albert)

    2003-01-01

    textabstractDuring sex differentiation, androgens are essential for development of the male genital tract. The Wolffian duct is an androgen-sensitive target tissue that develops into the epididymis, vas deferens, and seminal vesicle. The present study aimed to identify androgen-reg

  11. Identification of a mutant allele of the androgen receptor gene in a family with androgen insensitivity syndrome: detection of carriers and prenatal diagnosis.

    Science.gov (United States)

    Fogu, G; Bertini, V; Dessole, S; Bandiera, P; Campus, P M; Capobianco, G; Sanna, R; Soro, G; Montella, A

    2004-05-01

    We report the results of a molecular study of a large family segregating the complete form of the Androgen Insensitivity Syndrome (CAIS) in several family members from three generations. We identified the mutant allele by polymerase chain reaction (PCR) amplification of the short tandem repeat (CAG)n, highly polymorphic in the population, present in the first exon of the androgen receptor (AR) gene. In this family four different alleles were detected and one of these showed a perfect segregation with the disease. This study enabled us to identify the heterozygous females in this family. We think that this simple, indirect test, is also suitable for prenatal diagnosis of Morris' syndrome when the mother is heterozygous for the size of the short tandem repeat and one affected subject in the family may be studied.

  12. Reduced CAG repeats length in androgen receptor gene is associated with violent criminal behavior.

    Science.gov (United States)

    Rajender, Singh; Pandu, Guguluth; Sharma, J D; Gandhi, K P C; Singh, Lalji; Thangaraj, Kumarasamy

    2008-09-01

    Androgens mediate their functions through androgen receptors (AR). The two triplet repeats in the AR gene (CAG and GGN) are highly polymorphic among various populations and have been extensively studied in diverse clinical conditions and antisocial personality disorders. Several studies have reported either higher levels of testosterone among rapists or the correlation of shorter CAG repeats with criminal activities. However, to date, no study has analyzed AR gene in rapists worldwide, and no study has been conducted on criminals from Indian subcontinent. Therefore, we have analyzed the AR-CAG repeat length in 645 men, of which 241 were convicted for rape, 107 for murder, 26 for both murder and rape, and 271 were control males. The aim was to explore if there was any correlation between CAG repeat length and criminal behavior. The study revealed significantly shorter CAG repeats in the rapists (mean 18.44 repeats) and murderers (mean 17.59 repeats) compared to the control men (mean 21.19 repeats). The criminals who committed murder after rape had a far shorter mean repeat length (mean 17.31 repeats) in comparison to the controls or those convicted of rape or murder alone. In short, our study suggests that the reduced CAG repeats in the AR gene are associated with criminal behavior. This, along with other studies, would help in understanding the biological factors associated with the antisocial or criminal activities.

  13. Development of selective androgen receptor modulators and their therapeutic applications.

    Science.gov (United States)

    Chen, Fang; Rodan, Gideon A; Schmidt, Azi

    2002-01-01

    Androgens control a broad range of physiological functions. The androgen receptor (AR), a steroid receptor that mediates the diverse biological actions of androgens, is a ligand inducible transcription factor. Abnormalities in the androgen signaling system result in many disturbances ranging from changes in gender determination and sexual development to psychiatric and emotional disorders. Androgen replacement therapy can improve many clinical conditions including hypogonadism and osteoporosis, but is limited by the lack of efficacious and safe therapeutic agents with easy delivery options. Recent progress in the area of gene regulation by steroid receptors and by selective receptor modulators provides an opportunity to examine if selective androgen receptor modulators (SARMs) could address some of the problems associated with current androgen therapy. Since the composition of the transcriptional initiation complex recruited by liganded AR determines the specificity of gene regulation, synthetic ligands aimed at initiating transcription of tissue and promoter specific genes offers hope for developing better androgen therapy. Establishment of assays that predict synthetic ligand activity is critical for SARM development. Advancement in high throughput compound screening and gene fingerprinting technologies, such as microarrays and proteomics, will facilitate and accelerate identification of effective SARMs.

  14. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    2004-12-01

    Full Text Available The human androgen receptor (AR gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  15. Peripheral androgen receptor gene suppression rescues disease in mouse models of spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Lieberman, Andrew P; Yu, Zhigang; Murray, Sue; Peralta, Raechel; Low, Audrey; Guo, Shuling; Yu, Xing Xian; Cortes, Constanza J; Bennett, C Frank; Monia, Brett P; La Spada, Albert R; Hung, Gene

    2014-05-01

    Spinal and bulbar muscular atrophy (SBMA) is caused by the polyglutamine androgen receptor (polyQ-AR), a protein expressed by both lower motor neurons and skeletal muscle. Although viewed as a motor neuronopathy, data from patients and mouse models suggest that muscle contributes to disease pathogenesis. Here, we tested this hypothesis using AR113Q knockin and human bacterial artificial chromosome/clone (BAC) transgenic mice that express the full-length polyQ-AR and display androgen-dependent weakness, muscle atrophy, and early death. We developed antisense oligonucleotides that suppressed AR gene expression in the periphery but not the CNS after subcutaneous administration. Suppression of polyQ-AR in the periphery rescued deficits in muscle weight, fiber size, and grip strength, reversed changes in muscle gene expression, and extended the lifespan of mutant males. We conclude that polyQ-AR expression in the periphery is an important contributor to pathology in SBMA mice and that peripheral administration of therapeutics should be explored for SBMA patients.

  16. Peripheral Androgen Receptor Gene Suppression Rescues Disease in Mouse Models of Spinal and Bulbar Muscular Atrophy

    Directory of Open Access Journals (Sweden)

    Andrew P. Lieberman

    2014-05-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA is caused by the polyglutamine androgen receptor (polyQ-AR, a protein expressed by both lower motor neurons and skeletal muscle. Although viewed as a motor neuronopathy, data from patients and mouse models suggest that muscle contributes to disease pathogenesis. Here, we tested this hypothesis using AR113Q knockin and human bacterial artificial chromosome/clone (BAC transgenic mice that express the full-length polyQ-AR and display androgen-dependent weakness, muscle atrophy, and early death. We developed antisense oligonucleotides that suppressed AR gene expression in the periphery but not the CNS after subcutaneous administration. Suppression of polyQ-AR in the periphery rescued deficits in muscle weight, fiber size, and grip strength, reversed changes in muscle gene expression, and extended the lifespan of mutant males. We conclude that polyQ-AR expression in the periphery is an important contributor to pathology in SBMA mice and that peripheral administration of therapeutics should be explored for SBMA patients.

  17. Androgen receptor gene polymorphisms lean mass and performance in young men.

    Science.gov (United States)

    Guadalupe-Grau, Amelia; Rodríguez-González, F Germán; Dorado, Cecilia; Olmedillas, Hugo; Fuentes, Teresa; Pérez-Gómez, Jorge; Delgado-Guerra, Safira; Vicente-Rodríguez, Germán; Ara, Ignacio; Guerra, Borja; Arteaga-Ortiz, Rafael; Calbet, José A L; Díaz-Chico, B Nicolás

    2011-02-01

    The exon-1 of the androgen receptor (AR) gene contains two repeat length polymorphisms which modify either the amount of AR protein inside the cell (GGN(n), polyglycine) or its transcriptional activity (CAG(n), polyglutamine). Shorter CAG and/or GGN repeats provide stronger androgen signalling and vice versa. To test the hypothesis that CAG and GGN repeat AR polymorphisms affect muscle mass and various variables of muscular strength phenotype traits, the length of CAG and GGN repeats was determined by PCR and fragment analysis and confirmed by DNA sequencing of selected samples in 282 men (28.6 ± 7.6 years). Individuals were grouped as CAG short (CAG(S)) if harbouring repeat lengths of ≤ 21 and CAG long (CAG(L)) if CAG >21. GGN was considered short (GGN(S)) or long (GGN(L)) if GGN ≤ 23 or >23, respectively. No significant differences in lean body mass or fitness were observed between the CAG(S) and CAG(L) groups, or between GGN(S) and GGN(L) groups, but a trend for a correlation was found for the GGN repeat and lean mass of the extremities (r=-0.11, p=0.06). In summary, the lengths of CAG and GGN repeat of the AR gene do not appear to influence lean mass or fitness in young men.

  18. Androgen receptor gene polymorphisms and risk of prostate cancer: a meta-analysis

    Science.gov (United States)

    Weng, Hong; Li, Sheng; Huang, Jing-Yu; He, Zi-Qi; Meng, Xiang-Yu; Cao, Yue; Fang, Cheng; Zeng, Xian-Tao

    2017-01-01

    Although the association between CAG and GGN repeats in the androgen receptor gene and prostate cancer risk has been widely studied, it remains controversial from previous meta-analyses and narrative reviews. Therefore, we performed this meta-analysis to provide more precise estimates with sufficient power. A total of 51 publications with 61 studies for CAG repeats and 14 publications with 16 studies for GGN repeats were identified in the meta-analysis. The results showed that short CAG repeats (repeats) carriers presented an elevated risk of prostate cancer than long CAG repeats (≥22) carriers (OR = 1.31, 95% CI 1.16 to 1.47). Prostate cancer cases presented an average fewer CAG repeats (MD = −0.85, 95% CI −1.28 to −0.42) than controls. Short GGN repeats (≤16) carriers presented an increased risk of prostate cancer than long GGN repeats (>16) carriers (OR = 1.38, 95% CI 1.05 to 1.82). In subgroup analyses, the abovementioned significant association was predominantly observed in Caucasian populations. The meta-analysis showed that short CAG and GGN repeats in androgen receptor gene were associated with increased risk of prostate cancer, especially in Caucasians. PMID:28091563

  19. Activation of P-TEFb by Androgen Receptor-Regulated Enhancer RNAs in Castration-Resistant Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2016-04-01

    Full Text Available The androgen receptor (AR is required for castration-resistant prostate cancer (CRPC progression, but the function and disease relevance of AR-bound enhancers remain unclear. Here, we identify a group of AR-regulated enhancer RNAs (e.g., PSA eRNA that are upregulated in CRPC cells, patient-derived xenografts (PDXs, and patient tissues. PSA eRNA binds to CYCLIN T1, activates P-TEFb, and promotes cis and trans target gene transcription by increasing serine-2 phosphorylation of RNA polymerase II (Pol II-Ser2p. We define an HIV-1 TAR RNA-like (TAR-L motif in PSA eRNA that is required for CYCLIN T1 binding. Using TALEN-mediated gene editing we further demonstrate that this motif is essential for increased Pol II-Ser2p occupancy levels and CRPC cell growth. We have uncovered a P-TEFb activation mechanism and reveal altered eRNA expression that is related to abnormal AR function and may potentially be a therapeutic target in CRPC.

  20. Three novel and two known androgen receptor gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients

    Indian Academy of Sciences (India)

    BALACHANDRAN SARANYA; GUNASEKARAN BHAVANI; BRINDHA ARUMUGAM; MEENA JAYASHANKAR; SATHIYAVEDU THYAGARAJAN SANTHIYA

    2016-12-01

    Molecular characterization of 23 cytogenetically confirmed XY females was attempted by screening coding regions of SRY and androgen receptor (AR) genes. Five of the index cases showed sequence variations in various exons of the AR gene: a deletion (n.1911delG) and substitutions n.1761G>A and n.1317C>T in exon 1; n.3510C>T transition in exon 6 and deletion mutation (n.3672delT) in exon 7. Four mutations identified here lead to the formation of truncated receptor protein, involving a substantial loss of AR functional domains which explains the phenotype in the subjects. The n.1761G>A substitution has been previously reported in cases with mild androgen insensitivity. Although the ligand-binding domain was considered as the mutational hot spot in AR gene, we report here 3/5 variations in the N-terminal domain emphasizing the significance of considering the N-terminal domain of AR as well for mutation screening. Our present observation also strengthens the role of AR gene and its direct association with AIS.

  1. Molecular cell biology of androgen receptor signalling.

    Science.gov (United States)

    Bennett, Nigel C; Gardiner, Robert A; Hooper, John D; Johnson, David W; Gobe, Glenda C

    2010-06-01

    The classical action of androgen receptor (AR) is to regulate gene transcriptional processes via AR nuclear translocation, response element binding and recruitment of, or crosstalk with, transcription factors. AR also utilises non-classical, non-genomic mechanisms of signal transduction. These precede gene transcription or protein synthesis, and involve steroid-induced modulation of cytoplasmic or cell membrane-bound regulatory proteins. Despite many decades of investigation, the role of AR in gene regulation of cells and tissues remains only partially characterised. AR exerts most of its effects in sex hormone-dependent tissues of the body, but the receptor is also expressed in many tissues not previously thought to be androgen sensitive. Thus it is likely that a complex, more over-arching, role for AR exists. Each AR domain co-ordinates a multitude of individual and vital roles via a diverse array of interacting partner molecules that are necessary for cellular and tissue development and maintenance. Aberrant AR activity, promoted by mutations or binding partner misregulation, can present as many clinical manifestations including androgen insensitivity syndrome and prostate cancer. In the case of malignant prostate cancer, treatment generally revolves around androgen deprivation therapies designed to interfere with AR action and the androgen signalling axis. Androgen therapies for prostate cancer often fail, highlighting a real need for increased research into AR function.

  2. Androgens and bone.

    Science.gov (United States)

    Vanderschueren, Dirk; Vandenput, Liesbeth; Boonen, Steven; Lindberg, Marie K; Bouillon, Roger; Ohlsson, Claes

    2004-06-01

    Loss of estrogens or androgens increases the rate of bone remodeling by removing restraining effects on osteoblastogenesis and osteoclastogenesis, and also causes a focal imbalance between resorption and formation by prolonging the lifespan of osteoclasts and shortening the lifespan of osteoblasts. Conversely, androgens, as well as estrogens, maintain cancellous bone mass and integrity, regardless of age or sex. Although androgens, via the androgen receptor (AR), and estrogens, via the estrogen receptors (ERs), can exert these effects, their relative contribution remains uncertain. Recent studies suggest that androgen action on cancellous bone depends on (local) aromatization of androgens into estrogens. However, at least in rodents, androgen action on cancellous bone can be directly mediated via AR activation, even in the absence of ERs. Androgens also increase cortical bone size via stimulation of both longitudinal and radial growth. First, androgens, like estrogens, have a biphasic effect on endochondral bone formation: at the start of puberty, sex steroids stimulate endochondral bone formation, whereas they induce epiphyseal closure at the end of puberty. Androgen action on the growth plate is, however, clearly mediated via aromatization in estrogens and interaction with ERalpha. Androgens increase radial growth, whereas estrogens decrease periosteal bone formation. This effect of androgens may be important because bone strength in males seems to be determined by relatively higher periosteal bone formation and, therefore, greater bone dimensions, relative to muscle mass at older age. Experiments in mice again suggest that both the AR and ERalpha pathways are involved in androgen action on radial bone growth. ERbeta may mediate growth-limiting effects of estrogens in the female but does not seem to be involved in the regulation of bone size in males. In conclusion, androgens may protect men against osteoporosis via maintenance of cancellous bone mass and

  3. Molecular analysis of the androgen receptor gene in Kennedy's disease. Report of two families and review of the literature.

    Science.gov (United States)

    Lumbroso, S; Lobaccaro, J M; Vial, C; Sassolas, G; Ollagnon, B; Belon, C; Pouget, J; Sultan, C

    1997-01-01

    We have performed a molecular analysis of the androgen receptor gene in two families with suspected Kennedy's disease (spinal and bulbar muscular atrophy, SBMA) with the aim of making a firm diagnosis of the disease. The 2 patients studied were sporadic cases. Both presented clinical signs compatible with the diagnosis of SBMA: limb and facial muscular weakness of adult onset progressing toward muscular atrophy. Clinical signs of partial androgen insensitivity syndrome usually observed in SBMA were present only in patient 2. Enzymatic amplification of the CAG repeat region of exon 1 of the androgen receptor gene was performed on genomic DNA. PCR products were submitted to agarose or acrylamide electrophoresis for size evaluation. Precise determination of the CAG number was performed by direct sequencing of purified amplification products. Androgen receptor gene analysis was also performed in 2 sisters of patient 1 and in the mother, sisters and daughter of patient 2. Androgen receptor-binding activity was also determined on cultured genital skin fibroblasts of patient 1. Analysis of PCR products showed in both patients a single band that was much larger in size than the control. The expansion of the CAG repeat number was confirmed by direct sequencing: the exact number of CAG was 47 in patient 1 and 42 in patient 2 (n = 12-32). The 2 studied sisters of patient 1 did not present the abnormal fragment, demonstrating they are not carriers for the disease. Conversely, the mother, sisters and daughter of patient 2 presented both normal and mutated alleles. The migration of the labelled PCR products on a sequencing gel revealed a meiotic instability of expanded CAG repeat in family 2. Moreover, patient 1 had a decreased androgen-binding capacity on cultured genital skin fibroblasts. In both families, analysis of the androgen receptor gene permitted us to diagnose SBMA in the patients and to establish the carrier status in siblings. These results correspond to the

  4. Inhibition of Androgen-Independent Prostate Cancer by Estrogenic Compounds Is Associated with Increased Expression of Immune-Related Genes

    Directory of Open Access Journals (Sweden)

    Ilsa M. Coleman

    2006-10-01

    Full Text Available The clinical utility of estrogens for treating prostate cancer (CaP was established in the 1940s by Huggins. The classic model of the anti-CaP activity of estrogens postulates an indirect mechanism involving the suppression of androgen production. However, clinical, preclinical studies have shown that estrogens exert growth-inhibitory effects on CaP under low-androgen conditions, suggesting additional modes whereby estrogens affect CaP cells and/or the microenvironment. Here we have investigated the activity of 17β estradiol (E2 against androgen-independent CaP, identified molecular alterations in tumors exposed to E2. E2 treatment inhibited the growth of all four androgen-independent CaP xenografts studied (LuCaP 35V, LuCaP 23.1AI, LuCaP 49, LuCaP 58 in castrated male mice. The molecular basis of growth suppression was studied by cDNA microarray analysis, which indicated that multiple pathways are altered by E2 treatment. Of particular interest are changes in transcripts encoding proteins that mediate immune responses, regulate androgen receptor signaling. In conclusion, our data show that estrogens have powerful inhibitory effects on CaP in vivo in androgendepleted environments, suggest novel mechanisms of estrogen-mediated antitumor activity. These results indicate that incorporating estrogens into CaP treatment protocols could enhance therapeutic efficacy even in cases of advanced disease.

  5. Up-regulation of insulin-like growth factor-binding protein 3 by 5-fluorouracil (5-FU) leads to the potent anti-proliferative effect of androgen deprivation therapy combined with 5-FU in human prostate cancer cell lines.

    Science.gov (United States)

    Kawabata, Rumi; Oie, Shinji; Takahashi, Masayuki; Kanayama, Hiroomi; Oka, Toshinori; Itoh, Kohji

    2011-06-01

    In this study, we investigated the synergistic mechanism of anti-androgen and 5-fluorouracil (5-FU) combination therapy against castration-resistant prostate cancer (CRPC). Four prostate cancer cell lines, LNCaP, 22Rv1, DU145 and PC3, were examined for their growth dependency on androgens and the insulin-like growth factor 1 (IGF1). We assessed the expression changes of certain growth factor receptors and regulating proteins when treated with 5-FU, and found that 5-FU increased the expression of the IGF-binding protein 3 (IGFBP3). Furthermore, 5-FU inhibited the phosphorylation of Akt and p70 S6K, while the knockdown of IGFBP3 reduced the levels of poly (ADP-ribose) polymerase cleaved by 5-FU in PC3 cells. Therefore, the up-regulation of IGFBP3 by 5-FU not only inhibits cell growth by reducing the IGF1 signal but also induces apoptosis in PC3 cells. The synergistic effect of bicalutamide and 5-FU on 22Rv1 cells was reduced by IGFBP3 gene silencing using small-interfering RNA. These results suggest that the up-regulation of IGFBP3 induced by 5-FU plays an important role in the potent anti-tumor effect of 5-FU combined with anti-androgens on CRPC. Androgen-deprivation therapy combined with 5-FU could therefore be an appropriate therapy for CRPC patients.

  6. Preliminary study on androgen dependence of calcitonin gene-related peptide in rat penis

    Institute of Scientific and Technical Information of China (English)

    Zhou-Jun Shen; Shan-Wen Chen; Ying-Li Lu; Liao-Yuan Li; Xie-Lai Zhou; Ming-Guang Zhang; Zhao-Dian Chen

    2005-01-01

    Aim: To study the androgen dependence of the neurotransmitter, calcitonin gene-related peptide (CGRP) in rat penis.Methods: Forty-four Sprague-Dawley rats were randomly divided into Group A (intact controls), Group B (castrated)group were anaesthetized. Blood samples were taken for the measurement of serum testosterone and dihydrotestosterone (DHT) by means of radioimmunoassay. Penile samples were harvested for the investigation of calcitonin gene related peptide (CGRP)-immunoreactive nerve fibers with immunohistochemistry. The computer-assisted imaging analysis system was applied to calculate the area proportion of the CGRP-positive nerve fibers (CGRP-PNF) in each group.Results: 1) Both 4 and 10 weeks later, testosterone and DHT levels in Group B decreased significantly compared with those in Group A, (P<0.05, P<0.01, respectively); DHT level in Group C was also significantly decreased in comparison with that in Group A for both 4- and 10- week animals (P < 0.05); 2) There was no significant differences in area proportion of CGRP-PNF among Groups A, B and C 4 weeks after treatments (P > 0.05); However, 10weeks later, the proportion of CGRP-PNF in Groups B and C was significantly less than that in Group A (P < 0.01);3) The proportion of CGRP-PNF of 4-week animals in Groups B and C was significantly higher than that of 10-week animals (P<0.05). Conclusion: The expression of neurotransmitter, CGRP may depend on androgens, including testosterone and DHT in rat penis.

  7. Selective Gene Regulation by Androgen Receptor in Prostate Cancer

    Science.gov (United States)

    2014-07-01

    DNA and disrupt topoisomerase II action resulting in DNA double strand breaks. This activates the DNA damage response ( DDR ) to repair the DNA break...enhancing nucleosome turnover or histone eviction at promoters and this occurs independent of its ability to cause DNA strand breaks and initiating DDR

  8. ANDROGEN REGULATION OF PROSTATIC STEROID BINDING PROTEIN GENE TRANSCRIPTION

    Institute of Scientific and Technical Information of China (English)

    ZHANGYong-Lian; ZHOUZong-Xun; ZHANGYou-Duan; PARKERMalcolmG

    1989-01-01

    Prostatic steroid binding protein (PSBP) is a major protein secreted in the rat ventral prostate (V.P.) and also one of the components in seminal fluid, The potential importance of this protein in male fertility emerged from its ability of binding cholesterol which might modulate the proportion of phospholipids and cholesterol in sperm making it suitable

  9. Polymorphic CAG Repeat and Protein Expression of Androgen Receptor Gene in Colorectal Cancer.

    Science.gov (United States)

    Huang, Rui; Wang, Guiyu; Song, Yanni; Wang, Feng; Zhu, Bing; Tang, Qingchao; Liu, Zheng; Chen, Yinggang; Zhang, Qian; Muhammad, Shan; Wang, Xishan

    2015-04-01

    Although somatic alterations in CAG repeats in the androgen receptor (AR) gene have been suggested to predispose to colorectal cancer, less is known about AR in colorectal cancer carcinogenesis. Because of lack of relevant analysis on CAG repeat length and AR expression in colorectal cancer, we aimed to investigate the prognostic value of polymorphic CAG and protein expression of the AR gene in patients with colorectal cancer. A case-control study was carried out on 550 patients with colorectal cancer and 540 healthy controls to investigate whether polymorphic CAG within the AR gene is linked to increased risk for colorectal cancer. Polymorphic CAG and AR expression were analyzed to clarify their relationship with clinicopathologic and prognostic factors in patients with colorectal cancer. The study showed that the AR gene in patients with colorectal cancer had a longer CAG repeat sequence than those in the control group, as well as increased risk for colorectal cancer among females (P = 0.013), males (P = 0.002), and total colorectal cancer population (P CAG repeat sequence among males (P CAG repeat sequence and negative AR expression were associated with a short 5-year overall survival (OS) rate in colorectal cancer. Long CAG repeat sequences and the absence of AR expression were closely related to the development of colorectal cancer. Both long CAG and decreased AR expression were correlated with the poor 5-year OS in patients with colorectal cancer.

  10. Androgens and the skeleton.

    Science.gov (United States)

    Lindberg, M K; Vandenput, L; Movèrare Skrtic, S; Vanderschueren, D; Boonen, S; Bouillon, R; Ohlsson, C

    2005-03-01

    Loss of estrogens or androgens causes bone loss by increasing the rate of bone remodeling, and also causes an imbalance between resorption and formation by prolonging the lifespan of osteoclasts and shortening the lifespan of osteoblasts. Conversely, treatment with androgens, as well as estrogens, maintains cancellous bone mass and integrity, regardless of age or sex. Both androgens, via the androgen receptor (AR), and estrogens, via the estrogen receptors (ERs) can exert these effects, but the relative contribution of these 2 pathways remains uncertain. Androgens, like estrogens, stimulate endochondral bone formation at the start of puberty, whereas they induce epiphyseal closure at the end of puberty, thus, they have a biphasic effect. Androgen action on the growth plate is, however, clearly mediated via aromatization into estrogens and interaction with ER alpha. Androgens increase, while estrogens decrease radial growth. This differential effect of the sex steroids may be important because bone strength in males seems to be determined by higher periosteal bone formation and, therefore, greater bone dimensions. Experiments in mice suggest that both the AR and ER alpha pathways are involved in androgen action on radial bone growth. ER beta may mediate growth-limiting effects of estrogens in the female but does not seem to be involved in the regulation of bone size in males. In conclusion, androgens may protect men against osteoporosis via maintenance of cancellous bone mass and expansion of cortical bone. This androgen action on bone is mediated by the AR and ER alpha.

  11. A unique mosaic Turner syndrome patient with androgen receptor gene derived marker chromosome.

    Science.gov (United States)

    Kalkan, Rasime; Özdağ, Nermin; Bundak, Rüveyde; Çirakoğlu, Ayşe; Serakinci, Nedime

    2016-01-01

    Patients with Turner syndrome are generally characterized by having short stature with no secondary sexual characteristics. Some abnormalities, such as webbed neck, renal malformations (>50%) and cardiac defects (10%) are less common. The intelligence of these patients is considered normal. Non-mosaic monosomy X is observed in approximately 45% of postnatal patients with Turner syndrome and the rest of the patients have structural abnormalities or mosaicism involving 46,X,i(Xq), 45,X/46,XX, 45,X and other variants. The phenotype of 45,X/46,X,+mar individuals varies by the genetic continent and degree of the mosaicism. The gene content of the marker chromosome is the most important when correlating the phenotype with the genotype. Here we present an 11-year-old female who was referred for evaluation of her short stature and learning disabilities. Conventional cytogenetic investigation showed a mosaic 45,X/46,X,+mar karyotype. Fluorescence in situ hybridization showed that the marker chromosome originated from the X chromosome within the androgen receptor (AR) and X-inactive specific transcript (XIST) genes. Therefore, it is possible that aberrant activation of the marker chromosome, compromising the AR and XIST genes, may modify the Turner syndrome phenotype.

  12. Stromal androgen receptor regulates the composition of the microenvironment to influence prostate cancer outcome

    Science.gov (United States)

    Leach, Damien A.; Need, Eleanor F.; Toivanen, Roxanne; Trotta, Andrew P.; Palenthorpe, Helen M.; Tamblyn, David J.; Kopsaftis, Tina; England, Georgina M.; Smith, Eric; Drew, Paul A.; Pinnock, Carole B.; Lee, Peng; Holst, Jeff; Risbridger, Gail P.; Chopra, Samarth; DeFranco, Donald B.; Taylor, Renea A.; Buchanan, Grant

    2015-01-01

    Androgen receptor (AR) signaling in stromal cells is important in prostate cancer, yet the mechanisms underpinning stromal AR contribution to disease development and progression remain unclear. Using patient-matched benign and malignant prostate samples, we show a significant association between low AR levels in cancer associated stroma and increased prostate cancer-related death at one, three and five years post-diganosis, and in tissue recombination models with primary prostate cancer cells that low stromal AR decreases castration-induced apoptosis. AR-regulation was found to be different in primary human fibroblasts isolated from adjacent to cancerous and non-cancerous prostate epithelia, and to represent altered activation of myofibroblast pathways involved in cell cycle, adhesion, migration, and the extracellular matrix (ECM). Without AR signaling, the fibroblast-derived ECM loses the capacity to promote attachment of both myofibroblasts and cancer cells, is less able to prevent cell-matrix disruption, and is less likely to impede cancer cell invasion. AR signaling in prostate cancer stroma appears therefore to alter patient outcome by maintaining an ECM microenvironment inhibitory to cancer cell invasion. This paper provides comprehensive insight into AR signaling in the non-epithelial prostate microenvironment, and a resource from which the prognostic and therapeutic implications of stromal AR levels can be further explored. PMID:25965833

  13. Androgen receptor and histone lysine demethylases in ovine placenta.

    Directory of Open Access Journals (Sweden)

    Ellane R Cleys

    Full Text Available Sex steroid hormones regulate developmental programming in many tissues, including programming gene expression during prenatal development. While estradiol is known to regulate placentation, little is known about the role of testosterone and androgen signaling in placental development despite the fact that testosterone rises in maternal circulation during pregnancy and in placenta-induced pregnancy disorders. We investigated the role of testosterone in placental gene expression, and focused on androgen receptor (AR. Prenatal androgenization decreased global DNA methylation in gestational day 90 placentomes, and increased placental expression of AR as well as genes involved in epigenetic regulation, angiogenesis, and growth. As AR complexes with histone lysine demethylases (KDMs to regulate AR target genes in human cancers, we also investigated if the same mechanism is present in the ovine placenta. AR co-immunoprecipitated with KDM1A and KDM4D in sheep placentomes, and AR-KDM1A complexes were recruited to a half-site for androgen response element (ARE in the promoter region of VEGFA. Androgenized ewes also had increased cotyledonary VEGFA. Finally, in human first trimester placental samples KDM1A and KDM4D immunolocalized to the syncytiotrophoblast, with nuclear KDM1A and KDM4D immunostaining also present in the villous stroma. In conclusion, placental androgen signaling, possibly through AR-KDM complex recruitment to AREs, regulates placental VEGFA expression. AR and KDMs are also present in first trimester human placenta. Androgens appear to be an important regulator of trophoblast differentiation and placental development, and aberrant androgen signaling may contribute to the development of placental disorders.

  14. Phytochrome-regulated Gene Expression

    Institute of Scientific and Technical Information of China (English)

    Peter H. Quail

    2007-01-01

    Identification of all genes involved in the phytochrome (phy)-mediated responses of plants to their light environment is an important goal in providing an overall understanding of light-regulated growth and development. This article highlights and integrates the central findings of two recent comprehensive studies in Arabidopsis that have identified the genome-wide set of phy-regulated genes that respond rapidly to red-light signals upon first exposure of dark-grown seedlings, and have tested the functional relevance to normal seedling photomorphogenesis of an initial subset of these genes. The data: (a) reveal considerable complexity in the channeling of the light signals through the different phy-family members (phyA to phyE) to responsive genes; (b) identify a diversity of transcription-factor-encoding genes as major early, if not primary, targets of phy signaling, and, therefore, as potentially important regulators in the transcriptional-network hierarchy; and (c) identify auxin-related genes as the dominant class among rapidly-regulated, hormone-related genes. However, reverse-genetic functional profiling of a selected subset of these genes reveals that only a limited fraction are necessary for optimal phy-induced seedling deetiolation.

  15. Androgen receptor non-nuclear regulation of prostate cancer cell invasion mediated by Src and matriptase.

    Science.gov (United States)

    Zarif, Jelani C; Lamb, Laura E; Schulz, Veronique V; Nollet, Eric A; Miranti, Cindy K

    2015-03-30

    Castration-resistant prostate cancers still depend on nuclear androgen receptor (AR) function despite their lack of dependence on exogenous androgen. Second generation anti-androgen therapies are more efficient at blocking nuclear AR; however resistant tumors still develop. Recent studies indicate Src is highly active in these resistant tumors. By manipulating AR activity in several different prostate cancer cell lines through RNAi, drug treatment, and the use of a nuclear-deficient AR mutant, we demonstrate that androgen acting on cytoplasmic AR rapidly stimulates Src tyrosine kinase via a non-genomic mechanism. Cytoplasmic AR, acting through Src enhances laminin integrin-dependent invasion. Active Matriptase, which cleaves laminin, is elevated within minutes after androgen stimulation, and is subsequently shed into the medium. Matriptase activation and shedding induced by cytoplasmic AR is dependent on Src. Concomitantly, CDCP1/gp140, a Matriptase and Src substrate that controls integrin-based migration, is activated. However, only inhibition of Matriptase, but not CDCP1, suppresses the AR/Src-dependent increase in invasion. Matriptase, present in conditioned medium from AR-stimulated cells, is sufficient to enhance invasion in the absence of androgen. Thus, invasion is stimulated by a rapid but sustained increase in Src activity, mediated non-genomically by cytoplasmic AR, leading to rapid activation and shedding of the laminin protease Matriptase.

  16. Integrative transcriptomics-based identification of cryptic drivers of taxol-resistance genes in ovarian carcinoma cells: Analysis of the androgen receptor.

    Science.gov (United States)

    Sun, Nian-Kang; Huang, Shang-Lang; Lu, Hsing-Pang; Chang, Ting-Chang; Chao, Chuck C-K

    2015-09-29

    A systematic analysis of the genes involved in taxol resistance (txr) has never been performed. In the present study, we created txr ovarian carcinoma cell lines to identify the genes involved in chemoresistance. Transcriptome analysis revealed 1,194 overexpressed genes in txr cells. Among the upregulated genes, more than 12 cryptic transcription factors were identified using MetaCore analysis (including AR, C/EBPβ, ERα, HNF4α, c-Jun/AP-1, c-Myc, and SP-1). Notably, individual silencing of these transcription factors (except HNF4`)sensitized txr cells to taxol. The androgen receptor (AR) and its target genes were selected for further analysis. Silencing AR using RNA interference produced a 3-fold sensitization to taxol in txr cells, a response similar to that produced by silencing abcb1. AR silencing also downregulated the expression of prominent txr gene candidates (including abcb1, abcb6, abcg2, bmp5, fat3, fgfr2, h1f0, srcrb4d, and tmprss15). In contrast, AR activation using the agonist DHT upregulated expression of the target genes. Individually silencing seven out of nine (78%) AR-regulated txr genes sensitized txr cells to taxol. Inhibition of AKT and JNK cellular kinases using chemical inhibitors caused a dramatic suppression of AR expression. These results indicate that the AR represents a critical driver of gene expression involved in txr.

  17. A preliminary case study of androgen receptor gene polymorphism association with impulsivity in women with alcoholism

    Directory of Open Access Journals (Sweden)

    Mettman DJ

    2014-03-01

    Full Text Available Daniel J Mettman, Merlin G Butler, Albert B Poje, Elizabeth C Penick, Ann M Manzardo Departments of Psychiatry and Behavioral Sciences and Pediatrics, MS 4015, Kansas University Medical Center, Kansas City, KS, USA Objective: The androgen receptor (AR gene, located on the X chromosome, contains a common polymorphism involving cytosine-adenine-guanine (CAG repeats, which impacts disease and could contribute to the unequal sex ratio in alcoholism. CAG repeats in the AR gene are known to correlate with impulsivity in males. We report the first preliminary study examining the association between the number of CAG repeats and measures of impulsivity in females with chronic alcoholism. Methods: A total of 35 women and 85 men with chronic alcoholism were previously recruited for a nutritional clinical trial, and 26 well-characterized females (19 African–American and seven Caucasian with alcoholism agreed to participate for genetic testing. Genomic deoxyribonucleic acid (DNA was isolated from peripheral blood and CAG repeats determined by analyzing polymerase chain reaction (PCR-amplified products, using the polymorphic AR gene assay. CAG repeat length was correlated with raw scores from the Barratt Impulsivity Scale, version 11 and the Alcoholism Severity Scale. Results: CAG repeat lengths were significantly longer in Caucasian alcoholic women compared with African–Americans, and the average number of CAG repeats were significantly, positively correlated (P<0.05 with impulsivity scores. Women with average CAG repeat length (CAGave ≥18, representing the upper quartile of the repeat range, showed significantly greater mean raw impulsivity scores. CAG repeat length appeared to have less effect in African–American compared with Caucasian women, possibly due to a shorter average repeat length. Conclusion: We found an association between the number of CAG repeats and impulsivity in females with chronic alcoholism, specifically in women with CAGave

  18. Effect of testosterone on insulin-like growth factor-I, androgen receptor, and myostatin gene expression in splenius and semitendinosus muscles in sheep.

    Science.gov (United States)

    Mateescu, R G; Thonney, M L

    2005-04-01

    Testosterone is known to act differentially on skeletal muscle from different regions. Two genes likely to mediate the testosterone effect are IGF-I, an important growth regulator acting in an autocrine and paracrine way, and androgen receptor (AR), as receptor density could account for differential muscle growth. Another muscle-specific gene that may play a role in differential muscle growth is myostatin, a member of the transforming growth factor-beta superfamily, shown to be a negative regulator of skeletal muscle mass. The objective of this study was to quantify and compare the expression of these three genes in two different skeletal muscles in sheep. East Friesian x Dorset-sired ram lambs from Dorset ewes were used in a 2 x 4 factorial experiment. Eighteen sets of twins were assigned to four age groups corresponding to 77, 105, 133, and 161 d of age, and one individual from each set was castrated at birth. Total RNA was extracted from samples of splenius (SP) and semitendinosus muscles collected at the time of slaughter. Insulin-like growth factor-I mRNA was measured using competitive reverse-transcription PCR. Androgen receptor and myostatin mRNA were measured by ribonuclease protection assay with standard curves. Weight of SP was greater than semitendinosus in rams compared with wethers at 105, 133, and 161 d (P = 0.05, P = 0.04, and P = 0.02, respectively). The difference in IGF-I mRNA levels between the two muscles was greater in rams than in wethers at 133 (P = 0.001) and 161 d (P = 0.014), and the difference in AR mRNA levels was greater in rams than in wethers at 105, 133, and 161 d (P = 0.002, P muscles in rams and wethers at any age. These results suggest that locally produced IGF-I and the regulation of AR expression are important for sexually dimorphic muscle growth patterns.

  19. Cell Adhesion Regulates Expression of the Androgen Receptor and Coregulators in Different Prostate Cancer Cells

    Directory of Open Access Journals (Sweden)

    Sheng Li

    2007-02-01

    Full Text Available Prostate cancer cells adhere to a tumor basement membrane, while secretoryepithelial cells reside in a suprabasal cell compartment. Since tumor cells are derived fromsuprabasal epithelial cells, they experience de-novo substratum adhesion in the context ofoncogenesis. We therefore analyzed whether cell-matrix adhesion could affect the proteinexpression and activity of the AR. In this study, AR protein expression declined uponsuspension of BPH-1-AR cells, but not in PC-3-AR cells shown by Western blot. In a timecourse study, BPH-1 cell lost AR expression within 6 hours, and the synthetic androgen,R1881 reduced the loss of AR expression. We further explored the mechanism of AR loss insuspended BPH-1 cells. BPH-1-AR cells underwent apoptosis (anoikis when suspended for2 - 5 hours. Suspension did not induce significant apoptosis or decreasing of AR expressionin PC-3 cells. Inhibition of apoptosis in suspended BPH-1-AR cells, either by expression ofBcl-2 or Bcl-xl or by treatment with Z-VAD, a caspase inhibitor, prevented loss of ARprotein. In contrast, the calpain protease inhibitor , ALLN, accelerated the loss of AR proteinexpression. Additionally, cell-matrix adhesion changed the expression of coregulators of ARin the mRNA level of prostate cancer cells. Our results demonstrate that AR proteinexpression was reduced through activation of cell death pathways, and thus indirectly through cell suspension in BPH-AR cells. The activity of AR can also be regulated by adhesion in PC-3-AR and LNCaP cells through affecting the coregulators level.

  20. Selective androgen receptor modulators (SARMs negatively regulate triple-negative breast cancer growth and epithelial:mesenchymal stem cell signaling.

    Directory of Open Access Journals (Sweden)

    Ramesh Narayanan

    Full Text Available The androgen receptor (AR is the most highly expressed steroid receptor in breast cancer with 75-95% of estrogen receptor (ER-positive and 40-70% of ER-negative breast cancers expressing AR. Though historically breast cancers were treated with steroidal androgens, their use fell from favor because of their virilizing side effects and the emergence of tamoxifen. Nonsteroidal, tissue selective androgen receptor modulators (SARMs may provide a novel targeted approach to exploit the therapeutic benefits of androgen therapy in breast cancer.Since MDA-MB-453 triple-negative breast cancer cells express mutated AR, PTEN, and p53, MDA-MB-231 triple-negative breast cancer cells stably expressing wildtype AR (MDA-MB-231-AR were used to evaluate the in vitro and in vivo anti-proliferative effects of SARMs. Microarray analysis and epithelial:mesenchymal stem cell (MSC co-culture signaling studies were performed to understand the mechanisms of action.Dihydrotestosterone and SARMs, but not bicalutamide, inhibited the proliferation of MDA-MB-231-AR. The SARMs reduced the MDA-MB-231-AR tumor growth and tumor weight by greater than 90%, compared to vehicle-treated tumors. SARM treatment inhibited the intratumoral expression of genes and pathways that promote breast cancer development through its actions on the AR. SARM treatment also inhibited the metastasis-promoting paracrine factors, IL6 and MMP13, and subsequent migration and invasion of epithelial:MSC co-cultures.1. AR stimulation inhibits paracrine factors that are important for MSC interactions and breast cancer invasion and metastasis. 2. SARMs may provide promise as novel targeted therapies to treat AR-positive triple-negative breast cancer.

  1. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome

    OpenAIRE

    G Bhaskararao; Himabindu, Y; Samir Ranjan Nayak; M Sriharibabu

    2014-01-01

    Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen ...

  2. CAG repeat length in androgen receptor gene and male infertility in Egyptian patients.

    Science.gov (United States)

    Mosaad, Y M; Shahin, D; Elkholy, A A-M; Mosbah, A; Badawy, W

    2012-02-01

    The CAG repeat and its association with infertility has been debatable. Therefore, this study was planned to assess the distribution of CAG repeat expansion in Egyptian patients and to investigate its association with male infertility. Forty-five infertile men were eligible for the study in addition to 20 aged-matched fertile males as control. Semen analysis, scrotal sonography, assay of serum testosterone, follicle-stimulating hormone (FSH) and luteinising hormone (LH), and determination of the CAG repeat number within exon 1 of the androgen receptor (AR) gene were carried out. Statistically significant difference was found between infertile and control groups regarding sperm count, sperm motility, serum FSH level and CAG repeats (P CAG repeats (P = 1.0) was found between oligozoospermic and asthenospermic groups; negative correlation was found between CAG repeat length and sperm count, and a positive correlation was found between CAG repeat length and serum FSH (P CAG repeat may be associated with lower AR function with derangement of sperm production, and this may contribute to male infertility in Egyptian men.

  3. Novel Role for p110β PI 3-Kinase in Male Fertility through Regulation of Androgen Receptor Activity in Sertoli Cells

    Science.gov (United States)

    Guillermet-Guibert, Julie; Smith, Lee B.; Halet, Guillaume; Whitehead, Maria A.; Pearce, Wayne; Rebourcet, Diane; León, Kelly; Crépieux, Pascale; Nock, Gemma; Strömstedt, Maria; Enerback, Malin; Chelala, Claude; Graupera, Mariona; Carroll, John; Cosulich, Sabina; Saunders, Philippa T. K.; Huhtaniemi, Ilpo; Vanhaesebroeck, Bart

    2015-01-01

    The organismal roles of the ubiquitously expressed class I PI3K isoform p110β remain largely unknown. Using a new kinase-dead knockin mouse model that mimics constitutive pharmacological inactivation of p110β, we document that full inactivation of p110β leads to embryonic lethality in a substantial fraction of mice. Interestingly, the homozygous p110β kinase-dead mice that survive into adulthood (maximum ~26% on a mixed genetic background) have no apparent phenotypes, other than subfertility in females and complete infertility in males. Systemic inhibition of p110β results in a highly specific blockade in the maturation of spermatogonia to spermatocytes. p110β was previously suggested to signal downstream of the c-kit tyrosine kinase receptor in germ cells to regulate their proliferation and survival. We now report that p110β also plays a germ cell-extrinsic role in the Sertoli cells (SCs) that support the developing sperm, with p110β inactivation dampening expression of the SC-specific Androgen Receptor (AR) target gene Rhox5, a homeobox gene critical for spermatogenesis. All extragonadal androgen-dependent functions remain unaffected by global p110β inactivation. In line with a crucial role for p110β in SCs, selective inactivation of p110β in these cells results in male infertility. Our study is the first documentation of the involvement of a signalling enzyme, PI3K, in the regulation of AR activity during spermatogenesis. This developmental pathway may become active in prostate cancer where p110β and AR have previously been reported to functionally interact. PMID:26132308

  4. Novel Role for p110β PI 3-Kinase in Male Fertility through Regulation of Androgen Receptor Activity in Sertoli Cells.

    Directory of Open Access Journals (Sweden)

    Julie Guillermet-Guibert

    2015-07-01

    Full Text Available The organismal roles of the ubiquitously expressed class I PI3K isoform p110β remain largely unknown. Using a new kinase-dead knockin mouse model that mimics constitutive pharmacological inactivation of p110β, we document that full inactivation of p110β leads to embryonic lethality in a substantial fraction of mice. Interestingly, the homozygous p110β kinase-dead mice that survive into adulthood (maximum ~26% on a mixed genetic background have no apparent phenotypes, other than subfertility in females and complete infertility in males. Systemic inhibition of p110β results in a highly specific blockade in the maturation of spermatogonia to spermatocytes. p110β was previously suggested to signal downstream of the c-kit tyrosine kinase receptor in germ cells to regulate their proliferation and survival. We now report that p110β also plays a germ cell-extrinsic role in the Sertoli cells (SCs that support the developing sperm, with p110β inactivation dampening expression of the SC-specific Androgen Receptor (AR target gene Rhox5, a homeobox gene critical for spermatogenesis. All extragonadal androgen-dependent functions remain unaffected by global p110β inactivation. In line with a crucial role for p110β in SCs, selective inactivation of p110β in these cells results in male infertility. Our study is the first documentation of the involvement of a signalling enzyme, PI3K, in the regulation of AR activity during spermatogenesis. This developmental pathway may become active in prostate cancer where p110β and AR have previously been reported to functionally interact.

  5. Zipper-interacting protein kinase is involved in regulation of ubiquitination of the androgen receptor, thereby contributing to dynamic transcription complex assembly.

    Science.gov (United States)

    Felten, A; Brinckmann, D; Landsberg, G; Scheidtmann, K H

    2013-10-10

    We have recently identified apoptosis-antagonizing transcription factor (AATF), tumor-susceptibility gene 101 (TSG101) and zipper-interacting protein kinase (ZIPK) as novel coactivators of the androgen receptor (AR). The mechanisms of coactivation remained obscure, however. Here we investigated the interplay and interdependence between these coactivators and the AR using the endogenous prostate specific antigen (PSA) gene as model for AR-target genes. Chromatin immunoprecipitation in combination with siRNA-mediated knockdown revealed that recruitment of AATF and ZIPK to the PSA enhancer was dependent on AR, whereas recruitment of TSG101 was dependent on AATF. Association of AR and its coactivators with the PSA enhancer or promoter occurred in cycles. Dissociation of AR-transcription complexes was due to degradation because inhibition of the proteasome system by MG132 caused accumulation of AR at enhancer/promoter elements. Moreover, inhibition of degradation strongly reduced transcription, indicating that continued and efficient transcription is based on initiation, degradation and reinitiation cycles. Interestingly, knockdown of ZIPK by siRNA had a similar effect as MG132, leading to reduced transcription but enhanced accumulation of AR at androgen-response elements. In addition, knockdown of ZIPK, as well as overexpression of a dominant-negative ZIPK mutant, diminished polyubiquitination of AR. Furthermore, ZIPK cooperated with the E3 ligase Mdm2 in AR-dependent transactivation, assembled into a single complex on chromatin and phosphorylated Mdm2 in vitro. These results suggest that ZIPK has a crucial role in regulation of ubiquitination and degradation of the AR, and hence promoter clearance and efficient transcription.

  6. Mechanism of Transcriptional Regulation by Androgen Receptor and its Coactivators in the Context of Chromatin

    Science.gov (United States)

    2002-07-01

    caso - reaction and the mixture was incubated for 20 min at roomteprtr.In co petition says, unlabeled ARE or TRE 󈧎 dex and flutamide. We are...activation and nuclear targeting sig- nals of the human androgen receptor. J Biol Chem 266: LNCaP cells were culture in Roswell Park Memorial Institute 510

  7. Genotype versus phenotype in families with androgen insensitivity syndrome

    NARCIS (Netherlands)

    Boehmer, ALM; Bruggenwirth, H; Van Assendelft, C; Otten, BJ; Verleun-Mooijman, MCT; Niermeijer, MF; Brunner, HG; Rouwe, CW; Waelkens, JJ; Oostdijk, W; Kleijer, WJ; Van der Kwast, TH; De Vroede, MA; Drop, SLS

    2001-01-01

    Androgen insensitivity syndrome encompasses a wide range of phenotypes, which are caused by numerous different mutations in the AR gene. Detailed information on the genotype/ phenotype relationship in androgen insensitivity syndrome is important for sex assignment, treatment of androgen insensitivit

  8. Members of the murine Pate family are predominantly expressed in the epididymis in a segment-specific fashion and regulated by androgens and other testicular factors

    Directory of Open Access Journals (Sweden)

    Damdimopoulos Anastasios E

    2011-09-01

    Full Text Available Abstract Background Spermatozoa leaving the testis are not able to fertilize the egg in vivo. They must undergo further maturation in the epididymis. Proteins secreted to the epididymal lumen by the epithelial cells interact with the spermatozoa and enable these maturational changes, and are responsible for proper storage conditions before ejaculation. The present study was carried out in order to characterize the expression of a novel Pate (prostate and testis expression gene family, coding for secreted cysteine-rich proteins, in the epididymis. Methods Murine genome databases were searched and sequence comparisons were performed to identify members of the Pate gene family, and their expression profiles in several mouse tissues were characterized by RT-PCR. Alternate transcripts were identified by RT-PCR, sequencing and Northern hybridization. Also, to study the regulation of expression of Pate family genes by the testis, quantitative (q RT-PCR analyses were performed to compare gene expression levels in the epididymides of intact mice, gonadectomized mice, and gonadectomized mice under testosterone replacement treatment. Results A revised family tree of Pate genes is presented, including a previously uncharacterized Pate gene named Pate-X, and the data revealed that Acrv1 and Sslp1 should also be considered as members of the Pate family. Alternate splicing was observed for Pate-X, Pate-C and Pate-M. All the Pate genes studied are predominantly expressed in the epididymis, whereas expression in the testis and prostate is notably lower. Loss of androgens and/or testicular luminal factors was observed to affect the epididymal expression of several Pate genes. Conclusions We have characterized a gene cluster consisting of at least 14 expressed Pate gene members, including Acrv1, Sslp1 and a previously uncharacterized gene which we named Pate-X. The genes code for putatively secreted, cysteine-rich proteins with a TFP/Ly-6/uPAR domain. Members of

  9. Enhanced evaluation of selective androgen receptor modulators in vivo.

    Science.gov (United States)

    Otto-Duessel, M; He, M; Adamson, T W; Jones, J O

    2013-01-01

    Selective androgen receptor modulators (SARMs) are a class of drugs that control the activity of the androgen receptor (AR), which mediates the response to androgens, in a tissue-selective fashion. They are specifically designed to reduce the possible complications that result from the systemic inhibition or activation of AR in patients with diseases that involve androgen signalling. However, there are no ideal in vivo models for evaluating candidate SARMs. Therefore, we created a panel of androgen-responsive genes in clinically relevant AR expressing tissues including prostate, skin, bone, fat, muscle, brain and kidney. We used select genes from this panel to compare transcriptional changes in response to the full agonist dihydrotestosterone (DHT) and the SARM bolandiol at 16 h and 6 weeks. We identified several genes in each tissue whose expression at each of these time points correlates with the known tissue-specific effects of these compounds. For example, in the prostate we found four genes whose expression was much lower in animals treated with bolandiol compared with animals treated with DHT for 6 weeks, which correlated well with differences in prostate weight. We demonstrate that adding molecular measurements (androgen-regulated gene expression) to the traditional physiological measurements (tissue weights, etc.) makes the evaluation of potential SARMs more accurate, thorough and perhaps more rapid by allowing measurement of selectivity after only 16 h of drug treatment.

  10. The CAG repeat polymorphism of androgen receptor gene and prostate cancer: a meta-analysis.

    Science.gov (United States)

    Gu, Mingliang; Dong, Xiaoqun; Zhang, Xuezhi; Niu, Wenquan

    2012-03-01

    The association between the polymorphic CAG repeat in androgen receptor gene (AR) and prostate cancer susceptibility has been studied extensively. However, the results are contradictory. The purpose of our meta-analysis was to investigate whether CAG repeat related to prostate cancer risk and had genetic heterogeneity across different geographic regions and study designs. Random-effects model was performed irrespective of between-study heterogeneity. Data and study quality were assessed in duplicate. Publication bias was assessed by the fail-safe number and Egger's test. There were 16 (patients/controls: 2972/3792), 19 (3835/4908) and 12 (3372/2631) study groups for comparisons of ≥ 20, 22 and 23 repeats of CAG sequence, respectively. Compared with CAG repeat repeats had 21% (95% CI: 0.61-1.02; P = 0.076), 5% (95% CI: 0.81-1.11; P = 0.508) and 5% (95% CI: 0.76-1.20; P = 0.681) decreased risk of prostate cancer. After classifying studies by geographic areas, carriers of ≥ 20 repeats had 11% decreased risk in populations from USA, 53% from Europe, and 20% from Asia (P > 0.05), whereas comparison of ≥ 23 repeats with others generated a significant prediction in European populations (OR = 1.17; P = 0.039). Stratification by study designs revealed no material changes in risk estimation. Meta-regression analysis found no significant sources of between-study heterogeneity for age, study design and geographic region for all comparisons. There was no identified publication bias. Taken together, our results demonstrated that AR CAG repeat polymorphism with ≥ 20 repeats might confer a protective effect among the prostate cancer patients with 45 years older but not all the prostate cancer patients.

  11. HDAC6 regulates androgen receptor hypersensitivity and nuclear localization via modulating Hsp90 acetylation in castration-resistant prostate cancer.

    Science.gov (United States)

    Ai, Junkui; Wang, Yujuan; Dar, Javid A; Liu, June; Liu, Lingqi; Nelson, Joel B; Wang, Zhou

    2009-12-01

    The development of castration-resistant prostate cancer (PCa) requires that under castration conditions, the androgen receptor (AR) remains active and thus nuclear. Heat shock protein 90 (Hsp90) plays a key role in androgen-induced and -independent nuclear localization and activation of AR. Histone deacetylase 6 (HDAC6) is implicated, but has not been proven, in regulating AR activity via modulating Hsp90 acetylation. Here, we report that knockdown of HDAC6 in C4-2 cells using short hairpin RNA impaired ligand-independent nuclear localization of endogenous AR and inhibited PSA expression and cell growth in the absence or presence of dihydrotestosterone (DHT). The dose-response curve of DHT-stimulated C4-2 colony formation was shifted by shHDAC6 such that approximately 10-fold higher concentration of DHT is required, indicating a requirement for HDAC6 in AR hypersensitivity. HDAC6 knockdown also inhibited C4-2 xenograft tumor establishment in castrated, but not in testes-intact, nude mice. Studies using HDAC6-deficient mouse embryonic fibroblasts cells showed that inhibition of AR nuclear localization by HDAC6 knockdown can be largely alleviated by expressing a deacetylation mimic Hsp90 mutant. Taken together, our studies suggest that HDAC6 regulates AR hypersensitivity and nuclear localization, mainly via modulating HSP90 acetylation. Targeting HDAC6 alone or in combination with other therapeutic approaches is a promising new strategy for prevention and/or treatment of castration-resistant PCa.

  12. Androgen receptor expression in the rat prostate is down-regulated by dietary phytoestrogens

    OpenAIRE

    Handa Robert J; Adlercreutz Herman; Lund Trent D; Munson Daniel J; Lephart Edwin D

    2004-01-01

    Abstract Background It is well established that the growth of the prostate gland is a hormone-dependent phenomenon involving both androgenic and estrogenic control. Proliferation of prostate cells is, at least in part, under control of estrogen receptor beta (ER-beta). Phytoestrogens bind ER-beta with high affinity and therefore may have antiproliferative effects in the prostate. Methods The prostates of male Long-Evans rats fed a diet high in phytoestrogens (Phyto-600) or very low levels of ...

  13. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome.

    Science.gov (United States)

    Bhaskararao, G; Himabindu, Y; Nayak, Samir Rajan; Sriharibabu, M

    2014-07-01

    Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen insensitivity syndrome, and partial androgen insensitivity syndrome. Management of androgen insensitivity syndrome includes multidisciplinary approach and involves gonedectomy to avoid gonadal tumors in later life. Hormone replacement therapy (HRT) and psychological support are required in long-term basis.

  14. Polymorphic CAG and GGC repeat lengths in the androgen receptor gene and prostate cancer risk: analysis of a Brazilian population.

    Science.gov (United States)

    Silva Neto, Brasil; Koff, Walter J; Biolchi, Vanderlei; Brenner, Cleber; Biolo, Karlo D; Spritzer, Poli Mara; Brum, Ilma S

    2008-02-01

    Variations in transcriptional activity of the androgen receptor (AR) are related to polymorphic CAG and GGC repeats in exon 1 of the AR gene. We investigated the association between CAG and GGC repeat length and the risk of prostate cancer in a case-control study from a Brazilian population. We evaluated 49 patients and 51 healthy controls. DNA was extracted from peripheral leukocytes and the AR gene was analyzed by fragment analysis (GeneMapper software, Applied Biosystems, Foster City, California, USA). CAG and GGC mean lengths were not different between cases and controls. The risk for prostate cancer was higher for CAG repeats repeat lengths (CAG + GGC) repeats ( 17) were not associated with risk for prostate cancer (OR = 1.13 [95% CI 0.47-2.75]). In conclusion, fewer number of CAG repeats and total repeats (CAG + GGC) in the AR gene may be associated with increased risk for prostate cancer.

  15. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis

    OpenAIRE

    Pan, Bihui; Li, Rui; CHEN, YAO; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Hongjuan DING; Xia,Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-01-01

    Abstract The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports. We searched for reports published before August 2015 using PubMed, CNKI, VIP, an...

  16. The mouse salivary androgen-binding protein (ABP) gene cluster on chromosomes 7: characterization and evolutionary relationships.

    Science.gov (United States)

    Laukaitis, Christina M; Dlouhy, Stephen R; Karn, Robert C

    2003-10-01

    Mouse salivary androgen-binding protein (ABP) is a pair of dimers, composed of an alpha subunit disulfide bridged to either a beta or a gamma subunit. It has been proposed that each subunit is encoded by a distinct gene: Abpa, Abpb, and Abpg for the alpha, beta, and gamma subunits, respectively. We report here the structures and sequences of the genes that encode these three subunits. Each gene has three exons separated by two introns. Mouse salivary ABP is a member of the secretoglobin family, and we compare the structure of the three ABP subunit genes to those of 18 other mammalian secretoglobins. We map the three genes as a gene cluster located 10 cM from the centromere of Chromosome (Chr) 7 and show that Abpa is the closest of the three to the gene for glucose phosphate isomerase (GPI) and that Abpg is the closest to the centromere, with Abpb mapping between them. Abpa is oriented in the opposite direction to Abpb and Abpg, with its 5' end directed toward their 5' ends. We compare the location of these genes with other secretoglobin genes in the mouse genome and with the known locations of secretoglobin genes in the human genome and present evidence that strong positive selection has driven the divergence of the coding regions of Abpb and Abpg since the putative duplication event that created them.

  17. Hypochlorite Oxidation of Select Androgenic Steroids

    Science.gov (United States)

    Steroid hormones are vital for regulation of various biological functions including sexual development. Elevated concentrations of natural and synthetic androgenic steroids have been shown to adversely affect normal development in indigenous aqueous species. Androgens and their s...

  18. Chromatin structure regulates gene conversion.

    Directory of Open Access Journals (Sweden)

    W Jason Cummings

    2007-10-01

    Full Text Available Homology-directed repair is a powerful mechanism for maintaining and altering genomic structure. We asked how chromatin structure contributes to the use of homologous sequences as donors for repair using the chicken B cell line DT40 as a model. In DT40, immunoglobulin genes undergo regulated sequence diversification by gene conversion templated by pseudogene donors. We found that the immunoglobulin Vlambda pseudogene array is characterized by histone modifications associated with active chromatin. We directly demonstrated the importance of chromatin structure for gene conversion, using a regulatable experimental system in which the heterochromatin protein HP1 (Drosophila melanogaster Su[var]205, expressed as a fusion to Escherichia coli lactose repressor, is tethered to polymerized lactose operators integrated within the pseudo-Vlambda donor array. Tethered HP1 diminished histone acetylation within the pseudo-Vlambda array, and altered the outcome of Vlambda diversification, so that nontemplated mutations rather than templated mutations predominated. Thus, chromatin structure regulates homology-directed repair. These results suggest that histone modifications may contribute to maintaining genomic stability by preventing recombination between repetitive sequences.

  19. The Nrf1 and Nrf2 Balance in Oxidative Stress Regulation and Androgen Signaling in Prostate Cancer Cells

    Directory of Open Access Journals (Sweden)

    Michelle A. Schultz

    2010-06-01

    Full Text Available Reactive oxygen species (ROS signaling has recently sparked a surge of interest as being the molecular underpinning for cancer cell survival, but the precise mechanisms involved have not been completely elucidated. This review covers the possible roles of two ROS-induced transcription factors, Nrf1 and Nrf2, and the antioxidant proteins peroxiredoxin-1 (Prx-1 and Thioredoxin-1 (Txn-1 in modulating AR expression and signaling in aggressive prostate cancer (PCa cells. In androgen independent (AI C4-2B cells, in comparison to the parental androgen dependent (AD LNCaP cells, we present evidence of high Nrf1 and Prx-1 expression and low Nrf2 expression in these aggressive PCa cells. Furthermore, in DHT treated C4-2B cells, increased expression of the p65 (active isoform of Nrf1 correlated with enhanced AR transactivation. Our findings implicate a crucial balance of Nrf1 and Nrf2 signaling in regulating AR activity in AI-PCa cells. Here we will discuss how understanding the mechanisms by which oxidative stress may affect AR signaling may aid in developing novel therapies for AI-PCa.

  20. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    cells are capable of regulating their gene expression, so that each cell can only express a particular set of genes yielding limited numbers of proteins with specialized functions. Therefore a rigid control of differential gene expression is necessary for cellular diversity. On the other hand, aberrant...... gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis......, genome-wide assays have increased our understanding of gene regulation significantly. This thesis describes the integration and analysis of HTS data across different important aspects of gene regulation. Gene expression can be regulated at different stages when the genetic information is passed from gene...

  1. Selective Androgen Receptor Down-Regulators (SARDs): A New Prostate Cancer Therapy

    Science.gov (United States)

    2007-10-01

    sensitive as well as in androgen independent prostate cancer cells. J Steroid Biochem Mol Biol, 96: 251-258, 2005. 18. Hung, T. T. and Gibbons, W. E...G-G., Suh, S.W., Stern, P.H. Prostate cancer cell conditioned media have anabolic effects on bone in vitro. Second Joint Meeting of the American...Stern, P.H. Mechanisms of anabolic action of LNCaP prostate cancer cells on bone. 24 nnual Meeting of the American Society for Bone and Mineral

  2. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  3. Exposure to paper mill effluent at a site in North Central Florida elicits molecular-level changes in gene expression indicative of progesterone and androgen exposure.

    Science.gov (United States)

    Brockmeier, Erica K; Jayasinghe, B Sumith; Pine, William E; Wilkinson, Krystan A; Denslow, Nancy D

    2014-01-01

    Endocrine disrupting compounds (EDCs) are chemicals that negatively impact endocrine system function, with effluent from paper mills one example of this class of chemicals. In Florida, female Eastern mosquitofish (Gambusia holbrooki) have been observed with male secondary sexual characteristics at three paper mill-impacted sites, indicative of EDC exposure, and are still found at one site on the Fenholloway River. The potential impacts that paper mill effluent exposure has on the G. holbrooki endocrine system and the stream ecosystem are unknown. The objective of this study was to use gene expression analysis to determine if exposure to an androgen receptor agonist was occurring and to couple this analysis with in vitro assays to evaluate the presence of androgen and progesterone receptor active chemicals in the Fenholloway River. Focused gene expression analyses of masculinized G. holbrooki from downstream of the Fenholloway River paper mill were indicative of androgen exposure, while genes related to reproduction indicated potential progesterone exposure. Hepatic microarray analysis revealed an increase in the expression of metabolic genes in Fenholloway River fish, with similarities in genes and biological processes compared to G. holbrooki exposed to androgens. Water samples collected downstream of the paper mill and at a reference site indicated that progesterone and androgen receptor active chemicals were present at both sites, which corroborates previous chemical analyses. Results indicate that G. holbrooki downstream of the Fenholloway River paper mill are impacted by a mixture of both androgens and progesterones. This research provides data on the mechanisms of how paper mill effluents in Florida are acting as endocrine disruptors.

  4. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  5. Elevated expression of steroidogenesis pathway genes; CYP17, GATA6 and StAR in prenatally androgenized rats.

    Science.gov (United States)

    Jahromi, Marziyeh Salehi; Tehrani, Fahimeh Ramezani; Noroozzadeh, Mahsa; Zarkesh, Maryam; Ghasemi, Asghar; Zadeh-Vakili, Azita

    2016-11-15

    It is believed that excess androgen exposure of the fetus, via altered gene expression, causes hyperandrogenism a key feature of polycystic ovary syndrome (PCOS). The aim of this study was to evaluate expression of Cytochrome P450-17 (CYP17), GATA-binding protein (GAGT6) and Steroidogenic acute regulatory protein (StAR), genes of adult female rats prenatally exposed to androgen excess, closely reflect endocrine and ovarian disturbances of PCOS in women, by comparing them during different phases of estrus cycle with those of non-treated rats. Both the adult prenatally testosterone exposed and control rats (n=23, each) were divided into four groups based on their observed vaginal smear (proestrus, estrus, metestrus and diestrus) and the relative expression of CYP17, GATA6 and StAR genes was measured in ovarian theca cells using Cyber-green Real-Time PCR. Serum sex steroid hormones and gonadotropins levels were measured using the ELISA method; a comparison of these two groups showed that there was an overall increase in the studied genes (CYP17; 2.39 fold change, 95% CI: 1.23-3.55; P<0.05, GATA6; 2.08 fold change, 95% CI: 1.62-2.55; P<0.0001, and StAR; 1.4 fold change, 95% CI: 1.02-1.78; P<0.05), despite variations in different phases with maximum elevation for all genes in diestrus. The changes observed may impair the normal development of ovaries that mediate the programming of adult PCOS.

  6. Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance

    DEFF Research Database (Denmark)

    Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun;

    2014-01-01

    Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity...... in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls....... Glucose transport in myotubes was comparable in patients with PCOS vs. controls and was unchanged by testosterone treatment (p=0.21 PCOS vs. controls). These results suggest that testosterone treatment of myotubes increases the aromatase and androgen receptor gene expression without affecting insulin...

  7. Androgen receptor function links human sexual dimorphism to DNA methylation.

    Directory of Open Access Journals (Sweden)

    Ole Ammerpohl

    Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.

  8. Androgen receptor gene CAG and GGN repeat polymorphisms in Chilean men with primary severe spermatogenic failure.

    Science.gov (United States)

    Castro-Nallar, Eduardo; Bacallao, Ketty; Parada-Bustamante, Alexis; Lardone, María C; López, Patricia V; Madariaga, Marcia; Valdevenito, Raúl; Piottante, Antonio; Ebensperger, Mauricio; Castro, Andrea

    2010-01-01

    There is ample documentation supporting the fact that androgens are required for normal spermatogenesis. A minority of infertile men have abnormal testosterone blood levels or mild androgen receptor mutations. We investigated the androgen receptor CAG and GGN repeat lengths in Chilean men with spermatogenic impairment. We studied 117 secretory azoospermic/oligozoospermic men (93 idiopathic and 24 excryptorchidic), without Y-chromosome microdeletions, and 121 controls with normal spermatogenesis (42 obstructive and 79 normozoospermic men). Peripheral blood was drawn to obtain genomic DNA for polymerase chain reaction and automated sequencing of CAG and GGN repeats. Testicular characterization included hormonal studies, physical evaluation, and seminal and biopsy analysis. The CAG and GGN polymorphism distributions were similar among idiopathic men, excryptorchidic men, and controls and among the different types of spermatogenic impairment. However, the proportion of the CAG 21 allele was significantly increased in idiopathic cases compared to controls (P = .012 by Bonferroni test, odds ratio = 2.99, 95% confidence interval, 1.27-7.0) and the CAG 32 allele only was observed in excryptorchidic patients (P CAG 21 allele (P = .024, χ(2) test). On the other hand, in idiopathic cases and controls the most common GGN allele was 23, followed by 24, but an inverse relation was found among excryptorchidic cases. The joint distribution of CAG and GGN in control, idiopathic, and excryptorchidic groups did not show an association between the 2 allele repeat polymorphisms (P > 0.05, χ(2) test). Our results suggest that the CAG 21 allele seems to increase the risk of idiopathic Sertoli cell-only syndrome. Moreover, the GGN 24 allele could be contributing to deranged androgen receptor function, associated with cryptorchidism and spermatogenic failure.

  9. A Role for the Androgen Metabolite, 5alpha androstane, 3beta, 17beta Diol (3b-DIol in the regulation of the hypothalamo-pituitary-adrenal axis.

    Directory of Open Access Journals (Sweden)

    Robert James Handa

    2011-11-01

    Full Text Available Activation of the hypothalamo-pituitary-adrenal (HPA axis is a basic reaction of animals to environmental perturbations that threaten homeostasis. These responses are ultimately regulated by neurons residing within the paraventricular nucleus of the hypothalamus (PVN. Within the PVN, corticotropin-releasing hormone (CRH, vasopressin (AVP and oxytocin (OT expressing neurons are critical as they can regulate both neuroendocrine and autonomic responses. Estradiol (E2 and testosterone (T are well known reproductive hormones, however, they have also been shown to modulate stress reactivity. In rodent models, evidence shows that under some conditions E2 enhances stress activated ACTH and corticosterone secretion. In contrast, T decreases the gain of the HPA axis. The modulatory role of testosterone was originally thought to be via 5 alpha reduction to the potent androgen, dihydrotestosterone, whereas E2 effects were thought to be mediated by both estrogen receptors alpha (ERα and beta (ERβ. However, DHT has been shown to be metabolized to the ERβ agonist, 5alpha- androstane 3beta,17beta diol (3b-Diol. The actions of 3β-Diol on the HPA axis are mediated by ERbeta which inhibits the PVN response to stressors. In gonadectomized rats, ERbeta agonists reduce CORT and ACTH responses to restraint stress, an effect that is also present in wild-type but not ERbeta knockout mice. The neurobiological mechanisms underlying the actions of ERbeta to alter HPA reactivity are not currently known. CRH, AVP and OT have all been shown to be regulated by estradiol and recent studies indicate an important role of ERbeta in these regulatory processes. Moreover, activation of the CRH and AVP promoters have been shown by 3β-Diol binding to ERbeta and this is thought to be through alternate pathways of gene regulation. Based on available data, a novel and important role for 3beta Diol in the regulation of the HPA axis is suggested.

  10. CAG repeat polymorphism in androgen receptor gene is not directly associated with polycystic ovary syndrome but influences serum testosterone levels.

    Science.gov (United States)

    Skrgatic, L; Baldani, D Pavicic; Cerne, J Z; Ferk, P; Gersak, K

    2012-02-01

    Hyperandrogenemia has been the most consistent feature of polycystic ovary syndrome (PCOS). Androgens exert their effects through androgen receptors (ARs). The expansion of the codon CAG trinucleotide repeat polymorphism in exon 1 of the AR gene represents a type of genetic alteration associated with changes in the AR gene function. The purpose of this study was to establish a possible association of the AR gene CAG repeat length polymorphism with PCOS, and its influence on clinical and biochemical androgen traits. Two hundred and fourteen Croatian women with PCOS and 209 healthy control women of reproductive age were enrolled. Phenotypic hyperandrogenism, BMI and waist to hip ratio were recorded. Hormonal profiles, fasting insulin and glucose levels were measured on cycle days 3-5. Genotyping of the CAG repeat polymorphism in the AR gene was performed. We found no significant difference in the mean CAG repeat number between the PCOS patients and controls (22.1±3.4 vs. 21.9±3.2, P=0.286). There was a positive correlation between the CAG repeat length and total testosterone (TT) in the PCOS group (R=0.225, P=0.015). A multiple linear regression model using mean CAG repeat length, BMI, age and HOMA-IR as predictors explained 8.5% (adjusted R²) of the variability in serum TT levels. In this model the CAG repeat polymorphism was found to be a significant predictor of serum TT levels in PCOS patients (P=0.015). The logistic regression analysis revealed that the CAG repeat length is not a significant predictor of hirsutism and acne status (P=0.921 and P=0.437, respectively). The model was adjusted for serum TT, free testosterone, androstendione and DHEAS levels as independent variables, which were also not found to be significant predictors of hirsutism (P=0.687, P=0.194, P=0.675 and P=0.938, respectively) or acne status (P=0.594, P=0.095, P=0.290 and P=0.151, respectively). In conclusion, the AR CAG repeat polymorphism is not a major determinant of PCOS in the

  11. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis.

    Science.gov (United States)

    Pan, Bihui; Li, Rui; Chen, Yao; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-03-01

    The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports.We searched for reports published before August 2015 using PubMed, CNKI, VIP, and WanFang. Data on sample size, mean, and standard deviation (SD) of AR-CAG repeat length were extracted independently by 3 investigators.Forty-four reports were selected based on criteria. The overall infertile patients and azoospermic patients were found to have longer AR-CAG repeat length (standard mean difference (SMD) = 0.19, 95% confidence interval (CI): 0.10-0.28, P CAG repeat length was longer in infertile men in Asian, Caucasian, and mixed races (SMD = 0.25, 95% CI: 0.08-0.43, P CAG repeat length was associated with male infertility. The subgroup study on races shows that increased AR-CAG repeat length was associated with male infertility in Asian, Caucasian, and mixed races. Increased AR-CAG repeat length was also associated with azoospermia.This meta-analysis supports that increased androgen receptor CAG length is capable of causing male infertility susceptibility.

  12. Dynamics of bacterial gene regulation

    Science.gov (United States)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  13. 雄激素受体基因的表型异种突变%Phenotypic heterogeneity of mutations in androgen receptor gene

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Lalji Singh; Kumarasamy Thangaraj

    2007-01-01

    Androgen receptor (AR) gene has been extensively studied in diverse clinical conditions. In addition to the point mutations, trinucleotide repeat (CAG and GGN) length polymorphisms have been an additional subject of interest and controversy among geneticists. The polymorphic variations in triplet repeats have been associated with a number of disorders, but at the same time contradictory findings have also been reported. Further, studies on the same disorder in different populations have generated different results. Therefore, combined analysis or review of the published studies has been of much value to extract information on the significance of variations in the gene in various clinical conditions. AR genetics has been reviewed extensively but until now review articles have focused on individual clinical categories such as androgen insensitivity, male infertility, prostate cancer, and so on. We have made the first effort to review most the aspects of AR genetics. The impact of androgens in various disorders and polymorphic variations in the AR gene is the main focus of this review. Additionally, the correlations observed in various studies have been discussed in the light of in vitro evidences available for the effect of AR gene variations on the action of androgens.

  14. Analysis of the CAG repeat number in exon 1 of the androgen receptor gene in Slovene men with idiopathic azoospermia and oligoasthenoteratozoospermia

    Institute of Scientific and Technical Information of China (English)

    Borut Peterlin; Branko Zorn; Natasa Teran; Tanja Kunej

    2007-01-01

    @@ Dear Sir, I am Borut Peterlin, from Division of Medical Genetics,Department of Obstetrics and Gynaecology, University Medical Center, Ljubljana, Slovenia. We write to you to discuss if the number of CAG repeats in the androgen receptor (AR) gene is associated with male infertility in a group of 190 Slovene infertile men compared to 137 men with proven fertility.

  15. New knockout model confirms a role for androgen receptors in regulating anxiety-like behaviors and HPA response in mice.

    Science.gov (United States)

    Chen, Chieh V; Brummet, Jennifer L; Lonstein, Joseph S; Jordan, Cynthia L; Breedlove, S Marc

    2014-03-01

    Men are less likely than women to suffer from anxiety disorders. Because gonadal hormones play a crucial role in many behavioral sex differences, they may underlie sex differences in human anxiety. In rodents, testosterone (T) exerts anxiolytic effects via the androgen receptor (AR): we found that male mice with a naturally-occurring mutation rendering the AR dysfunctional, referred to as spontaneous testicular feminization mutation (sTfm), showed more anxiety-like behaviors than wildtype (WT) males. Here, we used Cre-lox recombination technology to create another dysfunctional allele for AR. These induced Tfm (iTfm) animals also displayed more anxiety-like behaviors than WTs. We further found that AR-modulation of these behaviors interacts with circadian phase. When tested in the resting phase, iTfms appeared more anxious than WTs in the open field, novel object and elevated plus maze tests, but not the light/dark box. However, when tested during the active phase (lights off), iTfms showed more anxiety-related behavior than WTs in all four tests. Finally, we confirmed a role of T acting via AR in regulating HPA axis activity, as WT males with T showed a lower baseline and overall corticosterone response, and a faster return to baseline following mild stress than did WT males without T or iTfms. These findings demonstrate that this recombined AR allele is a valuable model for studying androgenic modulation of anxiety, that the anxiolytic effects of AR in mice are more prominent in the active phase, and that HPA axis modulation by T is AR dependent.

  16. Regulation of the transcriptional coactivator FHL2 licenses activation of the androgen receptor in castrate-resistant prostate cancer.

    Science.gov (United States)

    McGrath, Meagan J; Binge, Lauren C; Sriratana, Absorn; Wang, Hong; Robinson, Paul A; Pook, David; Fedele, Clare G; Brown, Susan; Dyson, Jennifer M; Cottle, Denny L; Cowling, Belinda S; Niranjan, Birunthi; Risbridger, Gail P; Mitchell, Christina A

    2013-08-15

    It is now clear that progression from localized prostate cancer to incurable castrate-resistant prostate cancer (CRPC) is driven by continued androgen receptor (AR), signaling independently of androgen. Thus, there remains a strong rationale to suppress AR activity as the single most important therapeutic goal in CRPC treatment. Although the expression of ligand-independent AR splice variants confers resistance to AR-targeted therapy and progression to lethal castrate-resistant cancer, the molecular regulators of AR activity in CRPC remain unclear, in particular those pathways that potentiate the function of mutant AR in CRPC. Here, we identify FHL2 as a novel coactivator of ligand-independent AR variants that are important in CRPC. We show that the nuclear localization of FHL2 and coactivation of the AR is driven by calpain cleavage of the cytoskeletal protein filamin, a pathway that shows differential activation in prostate epithelial versus prostate cancer cell lines. We further identify a novel FHL2-AR-filamin transcription complex, revealing how deregulation of this axis promotes the constitutive, ligand-independent activation of AR variants, which are present in CRPC. Critically, the calpain-cleaved filamin fragment and FHL2 are present in the nucleus only in CRPC and not benign prostate tissue or localized prostate cancer. Thus, our work provides mechanistic insight into the enhanced AR activation, most notably of the recently identified AR variants, including AR-V7 that drives CRPC progression. Furthermore, our results identify the first disease-specific mechanism for deregulation of FHL2 nuclear localization during cancer progression. These results offer general import beyond prostate cancer, given that nuclear FHL2 is characteristic of other human cancers where oncogenic transcription factors that drive disease are activated like the AR in prostate cancer.

  17. Androgen-regulated microRNA-135a decreases prostate cancer cell migration and invasion through downregulating ROCK1 and ROCK2.

    Science.gov (United States)

    Kroiss, A; Vincent, S; Decaussin-Petrucci, M; Meugnier, E; Viallet, J; Ruffion, A; Chalmel, F; Samarut, J; Allioli, N

    2015-05-28

    Androgen signaling, via the androgen receptor (AR), is crucial in mediating prostate cancer (PCa) initiation and progression. Identifying new downstream effectors of the androgens/AR pathway will allow a better understanding of these mechanisms and could reveal novel biomarkers and/or therapeutic agents to improve the rate of patient survival. We compared the microRNA expression profiles in androgen-sensitive LNCaP cells stimulated or not with 1 nM R1881 by performing a high-throughput reverse transcriptase-quantitative PCR and found that miR-135a was upregulated. After androgen stimulation, we showed that AR directly activates the transcription of miR-135a2 gene by binding to an androgen response element in the promoter region. Our findings identify miR-135a as a novel effector in androgens/AR signaling. Using xenograft experiments in chick embryos and adult male mice, we showed that miR-135a overexpression decreases in vivo invasion abilities of prostate PC-3 cells. Through in vitro wound-healing migration and invasion assays, we demonstrated that this effect is mediated through downregulating ROCK1 and ROCK2 expression, two genes that we characterized as miR-135a direct target genes. In human surgical samples from prostatectomy, we observed that miR-135a expression was lower in tumoral compared with paired adjacent normal tissues, mainly in tumors classified with a high Gleason score (⩾8). Moreover, miR-135a expression is lower in invasive tumors, showing extraprostatic extension, as compared with intraprostatic localized tumors. In tumor relative to normal glands, we also showed a more frequently higher ROCK1 protein expression determined using a semi-quantitative immunohistochemistry analysis. Therefore, in tumor cells, the lower miR-135a expression could lead to a higher ROCK1 protein expression, which could explain their invasion abilities. The highlighted relationship between miR-135a expression level and the degree of disease aggressiveness suggests

  18. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    Science.gov (United States)

    Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M

    2014-01-01

    The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  19. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    Directory of Open Access Journals (Sweden)

    Robert C Karn

    Full Text Available The Androgen-binding protein (Abp region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1 no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2 substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3 that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  20. Mutations in the ligand-binding domain of the androgen receptor gene cluster in two regions of the gene.

    Science.gov (United States)

    McPhaul, M J; Marcelli, M; Zoppi, S; Wilson, C M; Griffin, J E; Wilson, J D

    1992-11-01

    We have analyzed the nucleotide sequence of the androgen receptor from 22 unrelated subjects with substitution mutations of the hormone-binding domain. Eleven had the phenotype of complete testicular feminization, four had incomplete testicular feminization, and seven had Reifenstein syndrome. The underlying functional defect in cultured skin fibroblasts included individuals with absent, qualitative, or quantitative defects in ligand binding. 19 of the 21 substitution mutations (90%) cluster in two regions that account for approximately 35% of the hormone-binding domain, namely, between amino acids 726 and 772 and between amino acids 826 and 864. The fact that one of these regions is homologous to a region of the human thyroid hormone receptor (hTR-beta) which is a known cluster site for mutations that cause thyroid hormone resistance implies that this localization of mutations is not a coincidence. These regions of the androgen receptor may be of particular importance for the formation and function of the hormone-receptor complex.

  1. Human heterochromatin protein 1 isoforms regulate androgen receptor signaling in prostate cancer.

    Science.gov (United States)

    Itsumi, Momoe; Shiota, Masaki; Yokomizo, Akira; Kashiwagi, Eiji; Takeuchi, Ario; Tatsugami, Katsunori; Inokuchi, Junichi; Song, Yoohyun; Uchiumi, Takeshi; Naito, Seiji

    2013-06-01

    Androgen receptor (AR) signaling is critical for the tumorigenesis and development of prostate cancer, as well as the progression to castration-resistant prostate cancer. We previously showed that the heterochromatin protein 1 (HP1) β isoform plays a critical role in transactivation of AR signaling as an AR coactivator that promotes prostate cancer cell proliferation. However, the roles of other HP1 isoforms, HP1α and HP1γ, in AR expression and prostate cancer remain unclear. Here, we found that knockdown of HP1γ, but not HP1α, reduced AR expression and cell proliferation by inducing cell cycle arrest at G1 phase in LNCaP cells. Conversely, overexpression of full-length HP1α and its C-terminal deletion mutant increased AR expression and cell growth, whereas overexpression of HP1γ had no effect. Similarly, HP1α overexpression promoted 22Rv1 cell growth, whereas HP1γ knockdown reduced the proliferation of CxR cells, a castration-resistant LNCaP derivative. Taken together, HP1 isoforms distinctly augment AR signaling and cell growth in prostate cancer. Therefore, silencing of HP1β and HP1γ may be a promising therapeutic strategy for treatment of prostate cancer.

  2. Mutations in the ligand-binding domain of the androgen receptor gene cluster in two regions of the gene.

    OpenAIRE

    McPhaul, M J; Marcelli, M; Zoppi, S; Wilson, C. M.; Griffin, J E; Wilson, J. D.

    1992-01-01

    We have analyzed the nucleotide sequence of the androgen receptor from 22 unrelated subjects with substitution mutations of the hormone-binding domain. Eleven had the phenotype of complete testicular feminization, four had incomplete testicular feminization, and seven had Reifenstein syndrome. The underlying functional defect in cultured skin fibroblasts included individuals with absent, qualitative, or quantitative defects in ligand binding. 19 of the 21 substitution mutations (90%) cluster ...

  3. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S. (Univ. of North Carolina, Chapel Hill (USA)); Brown, T.R.; Migeon, C.J. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (USA))

    1989-12-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development.

  4. Tandem CAG repeats of the androgen receptor gene and prostate cancer risk in black and white men.

    Science.gov (United States)

    Panz, V R; Joffe, B I; Spitz, I; Lindenberg, T; Farkas, A; Haffejee, M

    2001-07-01

    The most common malignancy in men worldwide is cancer of the prostate. Androgens play a direct role in normal and malignant growth of prostate cells via the androgen receptor (AR). This study analyzed the polymorphic CAG repeat sequence in exon 1 of the AR gene to determine if the number of repeats might be an indicator of prostate cancer risk or aggressive disease. DNA was extracted from blood samples of 20 black and 20 white men with well-documented prostate cancer and 40 healthy controls (20 blacks and 20 whites). PCR amplification was followed by gel electrophoresis and DNA sequencing. This region normally contains between 9 and 29 repeats. Patients and controls both had minor variations in the number of repeats, which ranged from 13 to 27 with 21 being the most frequent allele. Black controls and patients both had a mean of 20 +/- 3 repeats; in whites the mean was significantly lower in patients than controls (21 +/- 2 versus 23 +/- 2; p = 0.004). Combined black and white patients also had a lower number than the combined group of controls (20 +/- 3 versus 22 +/- 3; p = 0.02). Similarly, black and white patients with aggressive disease had a lower number than patients whose disease was more slowly progressive (19 +/- 2 versus 22 +/- 3; p = 0.02). We conclude that the small differences in the number of CAG repeats in both black and white patients do not appear to be a strong indicator of risk or aggressive disease but that this size polymorphism may be one of many genetic and environmental risk factors involved in prostate cancer.

  5. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam;

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  6. Androgen suppresses the proliferation of androgen receptor-positive castration-resistant prostate cancer cells via inhibition of Cdk2, CyclinA, and Skp2.

    Directory of Open Access Journals (Sweden)

    John M Kokontis

    Full Text Available The majority of prostate cancer (PCa patient receiving androgen ablation therapy eventually develop castration-resistant prostate cancer (CRPC. We previously reported that androgen treatment suppresses Skp2 and c-Myc through androgen receptor (AR and induced G1 cell cycle arrest in androgen-independent LNCaP 104-R2 cells, a late stage CRPC cell line model. However, the mechanism of androgenic regulation of Skp2 in CRPC cells was not fully understood. In this study, we investigated the androgenic regulation of Skp2 in two AR-positive CRPC cell line models, the LNCaP 104-R1 and PC-3AR Cells. The former one is an early stage androgen-independent LNCaP cells, while the later one is PC-3 cells re-expressing either wild type AR or mutant LNCaP AR. Proliferation of LNCaP 104-R1 and PC-3AR cells is not dependent on but is suppressed by androgen. We observed in this study that androgen treatment reduced protein expression of Cdk2, Cdk7, Cyclin A, cyclin H, Skp2, c-Myc, and E2F-1; lessened phosphorylation of Thr14, Tyr15, and Thr160 on Cdk2; decreased activity of Cdk2; induced protein level of p27(Kip1; and caused G1 cell cycle arrest in LNCaP 104-R1 cells and PC-3AR cells. Overexpression of Skp2 protein in LNCaP 104-R1 or PC-3AR cells partially blocked accumulation of p27(Kip1 and increased Cdk2 activity under androgen treatment, which partially blocked the androgenic suppressive effects on proliferation and cell cycle. Analyzing on-line gene array data of 214 normal and PCa samples indicated that gene expression of Skp2, Cdk2, and cyclin A positively correlates to each other, while Cdk7 negatively correlates to these genes. These observations suggested that androgen suppresses the proliferation of CRPC cells partially through inhibition of Cyclin A, Cdk2, and Skp2.

  7. Androgen suppresses the proliferation of androgen receptor-positive castration-resistant prostate cancer cells via inhibition of Cdk2, CyclinA, and Skp2.

    Science.gov (United States)

    Kokontis, John M; Lin, Hui-Ping; Jiang, Shih Sheng; Lin, Ching-Yu; Fukuchi, Junichi; Hiipakka, Richard A; Chung, Chi-Jung; Chan, Tzu-Min; Liao, Shutsung; Chang, Chung-Ho; Chuu, Chih-Pin

    2014-01-01

    The majority of prostate cancer (PCa) patient receiving androgen ablation therapy eventually develop castration-resistant prostate cancer (CRPC). We previously reported that androgen treatment suppresses Skp2 and c-Myc through androgen receptor (AR) and induced G1 cell cycle arrest in androgen-independent LNCaP 104-R2 cells, a late stage CRPC cell line model. However, the mechanism of androgenic regulation of Skp2 in CRPC cells was not fully understood. In this study, we investigated the androgenic regulation of Skp2 in two AR-positive CRPC cell line models, the LNCaP 104-R1 and PC-3AR Cells. The former one is an early stage androgen-independent LNCaP cells, while the later one is PC-3 cells re-expressing either wild type AR or mutant LNCaP AR. Proliferation of LNCaP 104-R1 and PC-3AR cells is not dependent on but is suppressed by androgen. We observed in this study that androgen treatment reduced protein expression of Cdk2, Cdk7, Cyclin A, cyclin H, Skp2, c-Myc, and E2F-1; lessened phosphorylation of Thr14, Tyr15, and Thr160 on Cdk2; decreased activity of Cdk2; induced protein level of p27(Kip1); and caused G1 cell cycle arrest in LNCaP 104-R1 cells and PC-3AR cells. Overexpression of Skp2 protein in LNCaP 104-R1 or PC-3AR cells partially blocked accumulation of p27(Kip1) and increased Cdk2 activity under androgen treatment, which partially blocked the androgenic suppressive effects on proliferation and cell cycle. Analyzing on-line gene array data of 214 normal and PCa samples indicated that gene expression of Skp2, Cdk2, and cyclin A positively correlates to each other, while Cdk7 negatively correlates to these genes. These observations suggested that androgen suppresses the proliferation of CRPC cells partially through inhibition of Cyclin A, Cdk2, and Skp2.

  8. Differential effects of androgens on coronary blood flow regulation and arteriolar diameter in intact and castrated swine

    Directory of Open Access Journals (Sweden)

    O’Connor Erin K

    2012-05-01

    Full Text Available Abstract Background Low endogenous testosterone levels have been shown to be a risk factor for the development of cardiovascular disease and cardiovascular benefits associated with testosterone replacement therapy are being advocated; however, the effects of endogenous testosterone levels on acute coronary vasomotor responses to androgen administration are not clear. The objective of this study was to compare the effects of acute androgen administration on in vivo coronary conductance and in vitro coronary microvascular diameter in intact and castrated male swine. Methods Pigs received intracoronary infusions of physiologic levels (1–100 nM of testosterone, the metabolite 5α-dihydrotestosterone, and the epimer epitestosterone while left anterior descending coronary blood flow and mean arterial pressure were continuously monitored. Following sacrifice, coronary arterioles were isolated, cannulated, and exposed to physiologic concentrations (1–100 nM of testosterone, 5α-dihydrotestosterone, and epitestosterone. To evaluate effects of the androgen receptor on acute androgen dilation responses, real-time PCR and immunohistochemistry for androgen receptor were performed on conduit and resistance coronary vessels. Results In vivo, testosterone and 5α-dihydrotestosterone produced greater increases in coronary conductance in the intact compared to the castrated males. In vitro, percent maximal dilation of microvessels was similar between intact and castrated males for testosterone and 5α-dihydrotestosterone. In both studies epitestosterone produced significant increases in conductance and microvessel diameter from baseline in the intact males. Androgen receptor mRNA expression and immunohistochemical staining were similar in intact and castrated males. Conclusions Acute coronary vascular responses to exogenous androgen administration are increased by endogenous testosterone, an effect unrelated to changes in androgen receptor expression.

  9. Disruption of androgen metabolism, regulation and effects : involvement of steroidogenic enzymes

    OpenAIRE

    Fürstenberger, Cornelia

    2014-01-01

    Communication between organs and tissues is predominately controlled by hormones. Hormones regulate a vast variety of physiological and behavioural activities, including metabolism, growth and development, reproduction, sleep and mood. Steroid hormones are characterized by their sterane backbone and are regulated by distinct enzymes which control the balance between their active and their inactive forms. The present studies of this thesis focus on the enzymes which selectively...

  10. LSD1 controls metastasis of androgen-independent prostate cancer cells through PXN and LPAR6.

    Science.gov (United States)

    Ketscher, A; Jilg, C A; Willmann, D; Hummel, B; Imhof, A; Rüsseler, V; Hölz, S; Metzger, E; Müller, J M; Schüle, R

    2014-10-06

    Lysine-specific demethylase 1 (LSD1) was shown to control gene expression and cell proliferation of androgen-dependent prostate cancer (PCa) cells, whereas the role of LSD1 in androgen-independent metastatic prostate cancer remains elusive. Here, we show that depletion of LSD1 leads to increased migration and invasion of androgen-independent PCa cells. Transcriptome and cistrome analyses reveal that LSD1 regulates expression of lysophosphatidic acid receptor 6 (LPAR6) and cytoskeletal genes including the focal adhesion adaptor protein paxillin (PXN). Enhanced LPAR6 signalling upon LSD1 depletion promotes migration with concomitant phosphorylation of PXN. In mice LPAR6 overexpression enhances, whereas knockdown of LPAR6 abolishes metastasis of androgen-independent PCa cells. Taken together, we uncover a novel mechanism of how LSD1 controls metastasis and identify LPAR6 as a promising therapeutic target to treat metastatic prostate cancer.

  11. A common deletion in the uridine diphosphate glucuronyltransferase (UGT) 2B17 gene is a strong determinant of androgen excretion in healthy pubertal boys

    DEFF Research Database (Denmark)

    Juul, A; Sørensen, K; Aksglaede, L;

    2008-01-01

    BACKGROUND: Testosterone (T) is excreted in urine as water-soluble glucuronidated and sulfated conjugates. The ability to glucuronidate T and other steroids depends on a number of different glucuronidases (UGT) of which UGT2B17 is essential. The aim of the study was to evaluate the influence of UGT......2B17 genotypes on urinary excretion of androgen metabolites in pubertal boys. STUDY DESIGN: A clinical study of 116 healthy boys aged 8-19 yr. UGT2B17 genotyping was performed using quantitative PCR. Serum FSH, LH, T, estradiol (E2), and SHBG were analyzed by immunoassays, and urinary levels...... of androgen metabolites were quantitated by gas chromatography/mass spectrometry in all subjects. RESULTS: Ten of 116 subjects (9%) presented with a homozygote deletion of the UGT2B17 gene (del/del), whereas 52 and 54 boys were hetero- and homozygous carriers of the UGT2B17 gene (del/ins and ins...

  12. Androgen receptor gene CAG repeat polymorphism and ovarian cancer risk: A meta-analysis.

    Science.gov (United States)

    Deng, Yang; Wang, Jue; Wang, Ling; Du, Yan

    2017-02-28

    Ovarian cancer is one of the common gynecological malignancies worldwide. It is usually diagnosed at a later stage, thus missing the best opportunity for treatment. Despite the advancement of ovarian cancer treatment, the prognosis is still poor. Androgen receptor (AR) may play a role in ovarian carcinogenesis. Previous studies regarding the association between AR CAG repeat length and ovarian cancer risk reported inconsistent results. Therefore, we conducted a meta-analysis to evaluate the association between AR CAG repeat length and ovarian cancer risk following the MOOSE guidelines. PubMed, Web of Science, EBSCO and other databases were searched up to September 15(th) 2016. Case control studies with clear definition of CAG repeat length and detailed genotype information were included. Two authors independently reviewed and extracted data. Pooled analysis and subgroup analysis stratified by ethnicity were performed for different genetic models. Begg's funnel plot and Egger's test were performed for publication bias estimation. Overall, there was no association between the AR CAG repeat polymorphism and ovarian cancer risk. However, short CAG repeat polymorphism was associated with increased ovarian cancer risk in African Americans and Chinese under the dominant model, whereas a reverse association was observed in Caucasians and Italians under the other three models. Our study results should be interpreted with caution. Further well-designed epidemiological and functional studies are needed to elucidate the role of AR in ovarian carcinogenesis.

  13. MR Guided Pulsed High Intensity Focused Ultrasound Enhancement of Gene Therapy Combined with Androgen Deprivation and Radiotherapy for Prostate Cancer Treatment

    Science.gov (United States)

    2012-09-01

    the observed enhancement are not well understood. It is thought mainly due to the nonthermal effects of ultrasound —mechanical streaming and cavitation ...AD ________________ Award Number: W81XWH-08-1-0469 TITLE: MR Guided Pulsed High Intensity Focused Ultrasound Enhancement of (Enter title of award...Intensity Focused Ultrasound Enhancement of 5b. GRANT NUMBER Gene Therapy Combined with Androgen Deprivation and Radiotherapy W81XWH-08-1-0469 for Prostate

  14. Survival Signaling in Prostate Cancer: Role of Androgen Receptor and Integrins in Regulating Survival

    Science.gov (United States)

    2011-01-01

    negative regulator of PI3K signaling, is lost in ~30% of clinical prostate cancers and in ~60% of metastatic cancers, resulting in constitutive...AR1 cells treated with vehicle (Etoh), 10nM Casodex ( Caso ), or 10nM RU486 (RU). F) Viability of PC3-AR1 or AR2 cells treated with Casodex in the

  15. Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance.

    Science.gov (United States)

    Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun; Jakobsen, Marianne Antonius; Brusgaard, Klaus; Tan, Qihua; Gaster, Michael

    2014-09-05

    Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity is conserved in cultured myotubes (in vitro) from patients with PCOS, but the effect of testosterone on this insulin sensitivity is unknown. We investigated the effect of 7days testosterone treatment (100nmol/l) on glucose transport and gene expression levels of hormone receptors and enzymes involved in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls. Glucose transport in myotubes was comparable in patients with PCOS vs. controls and was unchanged by testosterone treatment (p=0.21 PCOS vs. controls). These results suggest that testosterone treatment of myotubes increases the aromatase and androgen receptor gene expression without affecting insulin sensitivity and if testosterone is implicated in muscular insulin resistance in PCOS, this is by and indirect mechanism.

  16. Variation in CAG and GGN repeat lengths and CAG/GGN haplotype in androgen receptor gene polymorphism and prostate carcinoma in Nigerians.

    Science.gov (United States)

    Akinloye, O; Gromoll, J; Simoni, M

    2011-01-01

    Prostate cancer has become the most common cancer in Nigerian men. The growth of the prostate gland depends on circulating androgens and intracellular steroid signalling pathways. The effects of androgens are mediated through the androgen receptor (AR), a nuclear transcription factor encoded by the AR gene. The common polymorphisms, CAG and GGN repeats, in exon 1 of this gene have been implicated as possible risk factors. Thus far, existing supporting data are scanty and none are from sub-Saharan African populations. Therefore, this study investigates the possible association between AR polymorphism repeat length (CAG and GGN) and prostate cancer in Nigerians. A total of 261 subjects (70 with prostate cancer, 68 with benign prostate hyperplasia [BPH], 123 age-matched apparently normal subjects as controls) were studied. CAG and GGN repeats length were determined by fragment length analysis using GeneScan. The CAG repeat length in prostate cancer and in BPH compared to the controls was significantly different (P CAG repeats showing a significant odds ratio (OR) in both cases. However, this was not observed in GGN repeat length, which showed no significant difference between cases and controls (P > 0.05). CAG and GGN haplotype variation showed no significant difference between cases and controls (P > 0.05), except that the haplotypes CAG > or =21 and GGN CAG repeat length is a risk factor for prostate cancer, and also suggests an association with BPH.

  17. Inhibition of the Akt, cyclooxygenase-2, and matrix metalloproteinase-9 pathways in combination with androgen deprivation therapy: potential therapeutic approaches for prostate cancer.

    Science.gov (United States)

    Miyamoto, Hiroshi; Altuwaijri, Saleh; Cai, Yi; Messing, Edward M; Chang, Chawnshang

    2005-09-01

    Prostate cancer cells are generally dependent on androgen stimulation mediated by the androgen receptor (AR) for growth and survival, and, therefore, hormonal manipulation, such as castration and/or the use of AR antagonists, results in a regression of the cancer. However, this treatment very rarely leads to the "cure" of advanced disease, and cancers eventually become androgen-independent. A number of genes/pathways have been reported to be activated in prostate cancer, most of which are possibly associated with disease progression. In this article, among them, we focus on Akt (also known as protein kinase B), cyclooxygenase (COX)-2, and matrix metalloproteinase (MMP)-9, whose activities or expressions have been found to be regulated by androgens/AR. Previous studies by us and others, with androgen-sensitive prostate cancer cell lines, have demonstrated that androgen deprivation results in activation/overexpression of Akt, COX-2, and MMP-9 in cells. This suggests that androgen deprivation in clinical settings activates the Akt, COX-2, and MMP-9 pathways in prostate cancer, which may increase cell growth and in turn promote the transition to the androgen-independent state. We hypothesize that androgen deprivation, in combination with inhibition of the Akt, COX-2, and MMP-9 pathways, delays the androgen-independent transition and has more beneficial effects than hormonal therapy alone.

  18. Integrative genomic analyses reveal an androgen-driven somatic alteration landscape in early-onset prostate cancer

    DEFF Research Database (Denmark)

    Weischenfeldt, Joachim; Simon, Ronald; Feuerbach, Lars;

    2013-01-01

    comparative assessments with seven elderly-onset PCA genomes. Remarkable age-related differences in structural rearrangement (SR) formation became evident, suggesting distinct disease pathomechanisms. Whereas EO-PCAs harbored a prevalence of balanced SRs, with a specific abundance of androgen-regulated ETS......Early-onset prostate cancer (EO-PCA) represents the earliest clinical manifestation of prostate cancer. To compare the genomic alteration landscapes of EO-PCA with "classical" (elderly-onset) PCA, we performed deep sequencing-based genomics analyses in 11 tumors diagnosed at young age, and pursued...... gene fusions including TMPRSS2:ERG, elderly-onset PCAs displayed primarily non-androgen-associated SRs. Data from a validation cohort of > 10,000 patients showed age-dependent androgen receptor levels and a prevalence of SRs affecting androgen-regulated genes, further substantiating the activity...

  19. Androgens regulate sex differences in signaling but are not associated with male variation in morphology in the weakly electric fish Parapteronotus hasemani.

    Science.gov (United States)

    Petzold, Jacquelyn M; Smith, G Troy

    2016-02-01

    Sexually dimorphic signaling is widespread among animals and can act as an honest indicator of mate quality. Additionally, differences in signaling and morphology within a sex can be associated with different strategies for acquiring mates. Weakly electric fish communicate via self-generated electrical fields that transmit information about sex, reproductive state, and social status. The weakly electric knifefish Parapteronotus hasemani exhibits sexual dimorphism in body size as well as substantial within-male variation in body size and jaw length. We asked whether P. hasemani exhibits hormonally mediated sexual dimorphism in electrocommunication behavior. We also asked whether males with short versus long jaws differed significantly from each other in morphology, behavior, hormone levels, or reproductive maturity. Males produced longer chirps than females, but other signal parameters (electric organ discharge frequency; chirp rate and frequency modulation) were sexually monomorphic. Pharmacologically blocking androgen receptors in males reduced chirp duration, suggesting that this sexually dimorphic trait is regulated at least in part by the activational effects of androgens. Males sorted into two distinct morphological categories but did not differ in circulating 11-ketotestosterone or testosterone. Short-jawed males and long-jawed males also did not differ in any aspects of signaling. Thus, chirping and high levels of 11-ketotestosterone were reliably associated with reproductively active males but do not necessarily indicate male type or quality. This contrasts with other alternative male morph systems in which males that differ in morphology also differ in androgen profiles and signaling behavior.

  20. Negative association between androgen receptor gene CAG repeat polymorphism and polycystic ovary syndrome? A systematic review and meta-analysis.

    Science.gov (United States)

    Wang, Rui; Goodarzi, Mark O; Xiong, Ting; Wang, Di; Azziz, Ricardo; Zhang, Hanwang

    2012-10-01

    A number of studies focusing on the association between the exon 1 CAG repeat polymorphism of the androgen receptor (AR) gene and polycystic ovary syndrome (PCOS) have revealed conflicting results. The current systematic review and meta-analysis was conducted to quantify the strength of the association and to explore potential sources of heterogeneity that may have influenced the results. Studies matched to search terms from PubMed, EMBASE and HuGE Navigator published through to 31 January 2012 were retrieved. Data extraction from the included studies was carried out by two authors independently. Weighted mean differences (WMDs) of biallelic mean and odds ratios (ORs) of alleles and genotypes were pooled for meta-analysis. Sixteen articles reporting on 17 studies were included. In continuous data analysis, the summary WMD was -0.06 (95% confidence interval -0.29 to 0.16). In dichotomous data analysis, we divided the alleles into short and long alleles and calculated the summary ORs. No statistically significant results were identified by different comparison models or different cut-off point definitions. No publication bias was observed in continuous and dichotomous data analysis. In summary, the current systematic review and meta-analysis found that the AR CAG microsatellite repeat polymorphism is unlikely to be a major determining factor in the development of PCOS.

  1. Androgen receptor gene CAG repeat polymorphism and risk of isolated hypospadias: results from a meta-analysis.

    Science.gov (United States)

    Huang, G; Shan, W; Zeng, L; Huang, L

    2015-03-06

    Studies investigating the association between the CAG repeat polymorphism and the risk of isolated hypospadias have reported conflicting results. The aim of this study was to quantitatively summarize the evidence for such a relationship. Two investigators independently searched the Medline, Embase, CNKI, and Wanfang databases. Weighted mean difference and 95% confidence intervals for the CAG repeat polymorphism and isolated hypospadias were calculated using a random-effects model. Subgroup analyses were performed by race, study design, sample for DNA extraction, and hypospadias classifications. This meta-analysis included 6 case-control studies, including 444 isolated hypospadias cases and 727 controls. The results showed that patients with isolated hypospadias had longer CAG repeats in their androgen receptor gene sequence (weighted mean difference = 1.36, 95% confidence interval = 0.60-2.13; P = 0.0005). Similarly, stratified analyses also detected significant associations in all subgroups, excluding the group with severe hypospadias (weighted mean difference = 0.35, 95% confidence interval = -0.42-1.12; P = 0.38). This meta-analysis indicated that longer CAG repeats were associated with the risk of isolated hypospadias, and that longer CAG polymorphisms may be related to the etiology of isolated hypospadias. Future studies based on Asian and African-American patients should be performed to re-evaluate this association.

  2. Impact of CAG repeat length in the androgen receptor gene on male infertility - a meta-analysis.

    Science.gov (United States)

    Xiao, Feifan; Lan, Aihua; Lin, Zhidi; Song, Jianfei; Zhang, Yuening; Li, Jiatong; Gu, Kailong; Lv, Baihao; Zhao, Dong; Zeng, Siping; Zhang, Ruoheng; Zhao, Wei; Pan, Zhengyan; Deng, Xiaozhen; Yang, Xiaoli

    2016-07-01

    CAG repeats are polymorphic nucleotide repeats present in the androgen receptor gene. Many studies have estimated the association between CAG repeat length and male infertility, but the conclusions are controversial. Previous meta-analyses have come to different conclusions; however, new studies have been published. An updated meta-analysis was conducted. PubMed, CBM, CNKI and Web of Science databases were systematically searched for studies published from 1 January 2000 to 1 October 2015. Case-control studies on the association between CAG repeat length and male infertility using appropriate methodology were included. Forty studies were selected, including 3858 cases and 3161 controls. Results showed statistically significantly longer CAG repeat length among cases compared with controls (SMD = 0.14; 95% CI, 0.02-0.26). Shorter repeat length was associated with a lower risk of male infertility compared with a longer repeat length in the overall analysis (OR = 0.79, 95% CI: 0.66-0.95). Moreover, CAG repeat length was associated with male infertility in Caucasian populations, but not Asian or Egyptian populations. Subgroup analysis revealed no significant difference in German populations, but CAG repeat length was associated with male infertility in China and the USA. There were no significant differences between cases and controls in azoospermia and severe oligozoospermia.

  3. PDE7B is involved in nandrolone decanoate hydrolysis in liver cytosol and its transcription is up-regulated by androgens in HepG2

    Directory of Open Access Journals (Sweden)

    Emmanuel eStrahm

    2014-05-01

    Full Text Available Most androgenic drugs are available as esters for a prolonged depot action. However the enzymes involved in the hydrolysis of the esters have not been identified. There is one study indicating that PDE7B may be involved in the activation of testosterone enanthate. The aims are to identify the cellular compartments where the hydrolysis of testosterone enanthate and nandrolone decanoate occurs, and to investigate the involvement of PDE7B in the activation. We also determined if testosterone and nandrolone affect the expression of the PDE7B gene. The hydrolysis studies were performed in isolated human liver cytosolic and microsomal preparations with and without specific PDE7B inhibitor. The gene expression was studied in human hepatoma cells (HepG2 exposed to testosterone and nandrolone. We show that PDE7B serves as a catalyst of the hydrolysis of testosterone enanthate and nandrolone decanoate in liver cytosol. The gene expression of PDE7B was significantly induced 3- and 5- fold after 2 hours exposure to 1 µM testosterone enanthate and nandrolone decanoate, respectively. These results show that PDE7B is involved in the activation of esterified nandrolone and testosterone and that the gene expression of PDE7B is induced by supra-physiological concentrations of androgenic drugs.

  4. Influence of the glutation S-transferases T1 and M1 gene polymorphisms on androgenic status and semen quality after surgical treatment of varicocele

    Directory of Open Access Journals (Sweden)

    P. V. Glybochko

    2013-01-01

    Full Text Available Aim: to examine androgenic status in men after surgical treatment of varicocele; to investigate genotype GSTT1 and GSTM1 in patients with pathozoospermia. Thirty men after surgical treatment of varicocele were recruited to this study. All subjects were evaluated by history, physical examination, semen analysis, serum FSH, LH, E2, PL, inhibin B and total testosterone determination. GSTT1, CSTM1 gene polymorphisms were determined by polymerase chain reaction. Total testosterone and inhibin B levels were significantly lower in patients with pathozoospermia. Patients with the GSTM1(- genotype had lower sperm concentrations than those with the GSTM1(+ genotype.Our results suggest that the GSTM1(- genotype is risk factor for androgen deficiency and pathozoospermia.

  5. Crosstalk between androgen and pro-inflammatory signaling remodels androgen receptor and NF-κB cistrome to reprogram the prostate cancer cell transcriptome

    Science.gov (United States)

    Malinen, Marjo; Niskanen, Einari A.; Kaikkonen, Minna U.; Palvimo, Jorma J.

    2017-01-01

    Inflammatory processes and androgen signaling are critical for the growth of prostate cancer (PC), the most common cancer among males in Western countries. To understand the importance of potential interplay between pro-inflammatory and androgen signaling for gene regulation, we have interrogated the crosstalk between androgen receptor (AR) and NF-κB, a key transcriptional mediator of inflammatory responses, by utilizing genome-wide chromatin immunoprecipitation sequencing and global run-on sequencing in PC cells. Co-stimulation of LNCaP cells with androgen and pro-inflammatory cytokine TNFα invoked a transcriptome which was very distinct from that induced by either stimulation alone. The altered transcriptome that included gene programs linked to cell migration and invasiveness was orchestrated by significant remodeling of NF-κB and AR cistrome and enhancer landscape. Although androgen multiplied the NF-κB cistrome and TNFα restrained the AR cistrome, there was no general reciprocal tethering of the AR to the NF-κB on chromatin. Instead, redistribution of FOXA1, PIAS1 and PIAS2 contributed to the exposure of latent NF-κB chromatin-binding sites and masking of AR chromatin-binding sites. Taken together, concomitant androgen and pro-inflammatory signaling significantly remodels especially the NF-κB cistrome, reprogramming the PC cell transcriptome in fashion that may contribute to the progression of PC. PMID:27672034

  6. Regulation of gene expression by Goodwin's loop with many genes

    Science.gov (United States)

    Sielewiesiuk, Jan; Łopaciuk, Agata

    2012-01-01

    The paper presents a simple analysis of a long Goodwin's loop containing many genes. The genes form a closed series. The rate of transcription of any gene is up or down regulated by theprotein product of the preceding gene. We describe the loop with a system of ordinary differential equations of order s. Oscillatory solutions of the system are possible at the odd number of repressions and any number of inductions if the product of all Hill's coefficients, related to both repressions and inductions, is larger than:

  7. N-myc Downstream Regulated Gene 1 (NDRG1 Is Fused to ERG in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Dorothee Pflueger

    2009-08-01

    Full Text Available A step toward the molecular classification of prostate cancer was the discovery of recurrent erythroblast transformation. specific rearrangements, most commonly fusing the androgen-regulated TMPRSS2 promoter to ERG. The TMPRSS2-ERG fusion is observed in around 90% of tumors that overexpress the oncogene ERG. The goal of the current study was to complete the characterization of these ERG-overexpressing prostate cancers. Using fluorescence in situ hybridization and reverse transcription.polymerase chain reaction assays, we screened 101 prostate cancers, identifying 34 cases (34% with the TMPRSS2-ERG fusion. Seven cases demonstrated ERG rearrangement by fluorescence in situ hybridization without the presence of TMPRSS2-ERG fusion messenger RNA transcripts. Screening for known 5' partners, we determined that three cases harbored the SLC45A3-ERG fusion. To discover novel 5' partners in these ERG-overexpressing and ERG-rearranged cases, we used paired-end RNA sequencing. We first confirmed the utility of this approach by identifying the TMPRSS2-ERG fusion in a known positive prostate cancer case and then discovered a novel fusion involving the androgen-inducible tumor suppressor, NDRG1 (N-myc downstream regulated gene 1, and ERG in two cases. Unlike TMPRSS2-ERG and SCL45A3-ERG fusions, the NDRG1-ERG fusion is predicted to encode a chimeric protein. Like TMPRSS2, SCL45A3 and NDRG1 are inducible not only by androgen but also by estrogen. This study demonstrates that most ERG-overexpressing prostate cancers harbor hormonally regulated TMPRSS2-ERG, SLC45A3-ERG, or NDRG1-ERG fusions. Broader implications of this study support the use of RNA sequencing to discover novel cancer translocations.

  8. Androgen responsiveness of the new human endometrial cancer cell line MFE-296.

    Science.gov (United States)

    Hackenberg, R; Beck, S; Filmer, A; Hushmand Nia, A; Kunzmann, R; Koch, M; Slater, E P; Schulz, K D

    1994-04-01

    MFE-296 endometrial cancer cells express androgen receptors in vitro. These cells, which are tumorigenic in nude mice, are derived from a moderately differentiated human endometrial adenocarcinoma. They express vimentin and the cytokeratins 7, 8, 18, and 19. Karyotyping revealed near-tetraploidy for most of the cells. No marker chromosomes were observed. DNA analyses confirmed the genetic identity of the cell line and the patient from whom the cell line was derived. Proliferation of MFE-296 cells was inhibited by the progestin R5020 and the androgen dihydrotestosterone (DHT). The inhibition of proliferation by DHT was antagonized by the antiandrogen Casodex, demonstrating the involvement of the androgen receptor. Androgen binding was determined at 22,000 binding sites per cell using a whole-cell assay (KD = 0.05 nM) and 30 fmol/mg protein with the dextran charcoal method; 7 fmol/mg protein of progesterone receptors were found, whereas estrogen receptors were below 5 fmol/mg protein. The androgen receptor was functionally intact, as demonstrated by transfection experiments with a reporter-gene construct, containing an androgen-responsive element. In MFE-296 cells the content of the androgen receptor was up-regulated by its own ligand.

  9. In vivo modulation of androgen receptor by androgens

    Institute of Scientific and Technical Information of China (English)

    V·L·Kumar; V·Kumar

    2002-01-01

    Aim:To study the effect of androgen and antiandrogen on the level of androgen receptor(AR)mRNA.Methods:The totalRNA was extracted from the prostate and analyzed by slot blot analysis,The blots were hybrid-ized with ARcDNA probe and 1Aprobe(internal control)and autoradionraphy was performed.The intensity of signal was measured with a densitometer and the ratio of AR RNAand1ARNAwas calculated.Results:Androgenic deprivation produced by castration decreased the weight of the prostate and increased the levels of ARmRNA.Treatment of the castrated rats with testostrone increased the weight of prostate and decreased the levels of ARmRNA.Treatment of normal rats with flutamide decreased the weight of the gland and increased the levels of AR mRNA.Conclusion:Androgens produce proliferative effect on the prostate and negatively regulate the AR transcription.

  10. ANDROGEN INSENSITIVITY SYNDROME

    OpenAIRE

    Kanan; Sonali

    2014-01-01

    The condition is inherited as X - linked recessive gene 1 . The underlying pathology is the inability of end organs to respond to androgens. These cases are phenotypically and psychologically female with adequate breast development , normal external genitalia , a vagina with variable depth , absent /sparse pubic hair and axillary hair. The exact incidence in India is not known but the reported incidence is 1 in 2 , 000 to 1 in 62 ,400 worldwi...

  11. Regulation of noise in gene expression.

    Science.gov (United States)

    Sanchez, Alvaro; Choubey, Sandeep; Kondev, Jane

    2013-01-01

    The biochemical processes leading to the synthesis of new proteins are random, as they typically involve a small number of diffusing molecules. They lead to fluctuations in the number of proteins in a single cell as a function of time and to cell-to-cell variability of protein abundances. These in turn can lead to phenotypic heterogeneity in a population of genetically identical cells. Phenotypic heterogeneity may have important consequences for the development of multicellular organisms and the fitness of bacterial colonies, raising the question of how it is regulated. Here we review the experimental evidence that transcriptional regulation affects noise in gene expression, and discuss how the noise strength is encoded in the architecture of the promoter region. We discuss how models based on specific molecular mechanisms of gene regulation can make experimentally testable predictions for how changes to the promoter architecture are reflected in gene expression noise.

  12. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  13. Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines.

    Science.gov (United States)

    Wilson, Stephen; Qi, Jianfei; Filipp, Fabian V

    2016-09-14

    Sequence motifs are short, recurring patterns in DNA that can mediate sequence-specific binding for proteins such as transcription factors or DNA modifying enzymes. The androgen response element (ARE) is a palindromic, dihexameric motif present in promoters or enhancers of genes targeted by the androgen receptor (AR). Using chromatin immunoprecipitation sequencing (ChIP-Seq) we refined AR-binding and AREs at a genome-scale in androgen-insensitive and androgen-responsive prostate cancer cell lines. Model-based searches identified more than 120,000 ChIP-Seq motifs allowing for expansion and refinement of the ARE. We classified AREs according to their degeneracy and their transcriptional involvement. Additionally, we quantified ARE utilization in response to somatic copy number amplifications, AR splice-variants, and steroid treatment. Although imperfect AREs make up 99.9% of the motifs, the degree of degeneracy correlates negatively with validated transcriptional outcome. Weaker AREs, particularly ARE half sites, benefit from neighboring motifs or cooperating transcription factors in regulating gene expression. Taken together, ARE full sites generate a reliable transcriptional outcome in AR positive cells, despite their low genome-wide abundance. In contrast, the transcriptional influence of ARE half sites can be modulated by cooperating factors.

  14. Insulin gene: organisation, expression and regulation.

    Science.gov (United States)

    Dumonteil, E; Philippe, J

    1996-06-01

    Insulin, a major hormone of the endocrine pancreas, plays a key role in the control of glucose homeostasis. This review discusses the mechanisms of cell-specific expression and regulation of the insulin gene. Whereas expression is restricted to islet beta-cells in adults, the insulin gene is more widely expressed at several embryonic stages, although the role of extrapancreatic expression is still unclear. beta-cell-specific expression relies on the interactions of 5'-flanking sequence motifs of the promoter with a number of ubiquitous and islet-specific transcription factors. IEF1 and IPF-1, by their binding to the E and A boxes, respectively, of the insulin gene promoter, appear to be the major determinants of beta-cell-specific expression. IEF1 is a heterodimer of the basic helix-loop-helix family of transcription factors, whereas IPF-1 belongs to the homeodomain-containing family. beta-cell specific determinants are conserved throughout evolution, although the human insulin gene 5'-flanking sequence also contains a polymorphic minisatellite which is unique to primates and may play a role in insulin gene regulation. Glucose modulates insulin gene transcription, with multiple elements of the promoter involved in glucose responsiveness. Remarkably, IPF-1 and IEF1 are involved in both beta-cell-specific expression and glucose regulation of the insulin gene. cAMP also regulates insulin gene transcription through a CRE, in response to various hormonal stimuli. On the whole, recent studies have provided a better understanding of beta-cell differentiation and function.

  15. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome

    Directory of Open Access Journals (Sweden)

    G Bhaskararao

    2014-01-01

    Full Text Available Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen insensitivity syndrome, and partial androgen insensitivity syndrome. Management of androgen insensitivity syndrome includes multidisciplinary approach and involves gonedectomy to avoid gonadal tumors in later life. Hormone replacement therapy (HRT and psychological support are required in long-term basis.

  16. Expression of two vitellogenin genes (vg1 and vg3) in fathead minnow (Pimephales promelas) liver in response to exposure to steroidal estrogens and androgens.

    Energy Technology Data Exchange (ETDEWEB)

    Miracle, Ann L.; Ankley, Gerald; Lattier, David

    2006-03-01

    In this study, we describe the sequence for the fathead minnow (Pimephales promelas) vitellogenin 3 gene (vg3), and compare the response of vg1 and vg3 following exposure to steroidal estrogens and androgens. The fathead minnow vg3 sequence is only the second nucleotide sequence described in teleosts, following the original description of this isoform in zebrafish (Danio rerio). Following a brief exposure (24 hours) to 2, 5, and 10 ng/L 17 alpha-ethynylestradiol (EE2), both vg1and vg3 are upregulated in male liver. However, levels of vg3 induction are 4 orders of magnitude lower than induction of vg1. Suppression of vg in female liver following androgenic exposure with 50 or 500 ng/L 17 beta-trenbolone occurs at similar significance levels for both vg1 and vg3 isoforms. The results of this study confirm the use of vg1 as an indicator of estrogenic exposure in male fish, and present the potential for vg1 and /or vg3 for use as indicators of androgenic exposure.

  17. Androgen receptor gene methylation and exon one CAG repeat length in ovarian cancer: differences from breast cancer.

    Science.gov (United States)

    Kassim, Samar; Zoheiry, Nivan M; Hamed, Wael M; Going, James J; Craft, John A

    2004-07-01

    More than one neoplastic founder clone can exist in benign epithelial tumours. Although theories of clonal selection make pluriclonality appear unlikely in carcinomas, published data do not exclude this possibility. This study looked for evidence of multiclonal X inactivation in ovarian carcinoma using AR methylation as a marker. Fifteen unifocal ovarian carcinomas and 14 multifocal carcinomas all in Scottish patients were studied. One representative formalin-fixed paraffin-embedded tumour block was chosen for each of the former and two for the latter. From each of these 43 tumour blocks three samples each of approximately 10(4) carcinoma cells were obtained by microdissection (129 in all). DNA released by proteinase K digestion was subjected to PCR amplification of the androgen receptor gene AR exon I CAG repeat polymorphism with and without prior digestion with methylation-sensitive restriction enzymes HpaII and HhaI. Complex amplification patterns were consistent with mosaic X inactivation in some ovarian carcinomas but acquired anomalies of AR methylation cannot be excluded. Parallel analysis of other X-linked polymorphic loci would strengthen the inference of clonality status from DNA methylation data in tumour X studies. Strikingly, the number of CAG repeats in the 29 ovarian tumour patients (median 16, range 11 - 20) was substantially fewer than in 34 previously studied breast cancer patients from the same scottish population (median 21, range 14 - 26; P CAG repeat were over-represented in the ovarian cancer patients but not in the breast cancer series. These findings reinforce recent suggestions that AR may have a role in ovarian carcinogenesis.

  18. The TRANSFAC system on gene expression regulation.

    Science.gov (United States)

    Wingender, E; Chen, X; Fricke, E; Geffers, R; Hehl, R; Liebich, I; Krull, M; Matys, V; Michael, H; Ohnhäuser, R; Prüss, M; Schacherer, F; Thiele, S; Urbach, S

    2001-01-01

    The TRANSFAC database on transcription factors and their DNA-binding sites and profiles (http://www.gene-regulation.de/) has been quantitatively extended and supplemented by a number of modules. These modules give information about pathologically relevant mutations in regulatory regions and transcription factor genes (PathoDB), scaffold/matrix attached regions (S/MARt DB), signal transduction (TRANSPATH) and gene expression sources (CYTOMER). Altogether, these distinct database modules constitute the TRANSFAC system. They are accompanied by a number of program routines for identifying potential transcription factor binding sites or for localizing individual components in the regulatory network of a cell.

  19. Androgen deprivation of the PC-310 [correction of prohormone convertase-310] human prostate cancer model system induces neuroendocrine differentiation

    NARCIS (Netherlands)

    J. Jongsma (Johan); M.H. Oomen; M.A. Noordzij (Marinus); W.M. van Weerden (Wytske); G.J. Martens; Th.H. van der Kwast (Theo); F.H. Schröder (Fritz); G.J. van Steenbrugge (Gert Jan)

    2000-01-01

    textabstractNeuroendocrine (NE) cells are androgen-independent cells and secrete growth-modulating neuropeptides via a regulated secretory pathway (RSP). We studied NE differentiation after androgen withdrawal in the androgen-dependent prostate cancer xenograft PC-310.

  20. High Throughput Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    Science.gov (United States)

    2005-02-01

    molecule Soc. 2002, 124, 544. agonists. Bioorg. Med. Chem. 2001, 9, 557. 33. Berg , T.; Cohen, S. B.; Desharnais, J.; Sonderegger, C.; 18. Chen, Y.; Bilban...Kaldor, M. G. Siegel, Cure. Opin. C/tern. Biol. 1997, 1, [80] T. Berg , S. B. Cohen, J. Desharnais, C. Sonderegger, D. J. 101-106. Maslyar, J. Goldberg...251, 1211 [322] l. A. Wilson, L K. Joliffe, Curr. Opin. Struct. Biol. 1999,9,696- 1217. 702 [289] E. M. Blackwood, B. Luscher , R. N. Eisenman, Genes

  1. The AhR Ligand, TCDD, Regulates Androgen Receptor Activity Differently in Androgen-Sensitive versus Castration-Resistant Human Prostate Cancer Cells

    OpenAIRE

    2015-01-01

    The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR). TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to i...

  2. Effects of androgen-binding protein (ABP) on spermatid Tnp1 gene expression in vitro.

    Science.gov (United States)

    Della-Maria, Julie; Gerard, Anne; Franck, Patricia; Gerard, Hubert

    2002-12-30

    In vitro studies were designed to determine whether Sertoli cell-delivered ABP could act on spermatogenetic events, whether such an action could occur via a paracrine or a juxtacrine pathway and whether sex steroids could be involved in this action. ABP delivery to germ cells was achieved using an in vitro model based on recombinant rat ABP-producing mouse Sertoli cells cocultivated with rat spermatids. Using semi-quantitative RT-PCR, the expression of the Tnp 1 gene encoding the Transition Protein 1, involved in the histone to protamine replacement during spermatid nuclear transformation, was analyzed. Our results provide clear evidence that Sertoli cell-derived ABP acts on spermatids by modifying the TP1 mRNA level. This outcome, strictly requiring juxtacrine conditions, is obtained in the absence of sex steroid hormones. To our knowledge this is the first evidence of an effect of ABP itself on male germ cells.

  3. A codon-usage variant in the (GGN){sub n} trinucleotide polymorphism of the androgen receptor gene as an aid in the prenatal diagnosis of ambiguous genitalia due to partial androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Lumbroso, R.; Vasiliou, M.; Beitel, L.K. [McGill Univ., Montreal, Quebec (Canada)] [and others

    1994-09-01

    Exon 1 at the X-linked androgen receptor (AR) locus encodes an N-terminal modulatory domain that contains two large homopolyamino acid tracts: (CAG;glutamine;Gln){sub 11-33} and (GGN;Glycine;Cly){sub 15-27}. Certain AR mutations cause partial androgen insensitivity (PAI) with frank genital ambiguity that may engender appreciable parental anxiety and patient morbidity. If the AR mutation in a PAI family is unknown, the AR`s intragenic trinucleotide repeat polymorphisms may be used for prenatal diagnosis. However, intergenerational instability of repeat-size may be worrisome, particularly when the information alleles differ by only a few repeats. Here, we report the discovery of a codon-usage (silent substitution) variant in the GGN repeat, and describe its use as a source of complementary information for prenatal diagnosis. The standard sense sequence of the (GGN){sub n} tract is (GGT){sub 3} GGG(GGT){sub 2} (GGC){sub 9-21}. On 4 of 27 X chromosomes we noted that the internal GGT sequence was expanded to 3 or 4 repeats. We used an internal (GGT){sub 4} repeat in a total (GGN){sub 24} tract together with a (CAG){sub 20} tract to distinguish an X chromosome with a mutant AR allele from another X chromosome, bearing a normal allele, that had an internal (GGT){sub 2} repeat in a total (GGN){sub 23} tract together with a (CAG){sub 21} tract. Subsequently, we found the base change leading to a pathogenic amino acid substitution (M779I) in codon 6 of the mutant AR gene in an affected maternal aunt and the fetus at risk. This confirmed the prenatal diagnosis based on the intragenic trinucleotide repeat polymorphisms, and it strengthened the prediction of external genital ambiguity using our previous experience with M779I in another family.

  4. Gene expression regulation in roots under drought.

    Science.gov (United States)

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona

    2016-02-01

    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots.

  5. Linker histones in hormonal gene regulation.

    Science.gov (United States)

    Vicent, G P; Wright, R H G; Beato, M

    2016-03-01

    In the present review, we summarize advances in our knowledge on the role of the histone H1 family of proteins in breast cancer cells, focusing on their response to progestins. Histone H1 plays a dual role in gene regulation by hormones, both as a structural component of chromatin and as a dynamic modulator of transcription. It contributes to hormonal regulation of the MMTV promoter by stabilizing a homogeneous nucleosome positioning, which reduces basal transcription whereas at the same time promoting progesterone receptor binding and nucleosome remodeling. These combined effects enhance hormone dependent gene transcription, which eventually requires H1 phosphorylation and displacement. Various isoforms of histone H1 have specific functions in differentiated breast cancer cells and compact nucleosomal arrays to different extents in vitro. Genome-wide studies show that histone H1 has a key role in chromatin dynamics of hormone regulated genes. A complex sequence of enzymatic events, including phosphorylation by CDK2, PARylation by PARP1 and the ATP-dependent activity of NURF, are required for H1 displacement and gene de-repression, as a prerequisite for further nucleosome remodeling. Similarly, during hormone-dependent gene repression a dedicated enzymatic mechanism controls H1 deposition at promoters by a complex containing HP1γ, LSD1 and BRG1, the ATPase of the BAF complex. Thus, a broader vision of the histone code should include histone H1, as the linker histone variants actively participate in the regulation of the chromatin structure. How modifications of the core histones tails affect H1 modifications and vice versa is one of the many questions that remains to be addressed to provide a more comprehensive view of the histone cross-talk mechanisms.

  6. Transcriptome analysis of androgenic gland for discovery of novel genes from the oriental river prawn, Macrobrachium nipponense, using Illumina Hiseq 2000.

    Directory of Open Access Journals (Sweden)

    Shubo Jin

    Full Text Available BACKGROUND: The oriental river prawn, Macrobrachium nipponense, is an important aquaculture species in China, even in whole of Asia. The androgenic gland produces hormones that play crucial roles in sexual differentiation to maleness. This study is the first de novo M. nipponense transcriptome analysis using cDNA prepared from mRNA isolated from the androgenic gland. Illumina/Solexa was used for sequencing. METHODOLOGY AND PRINCIPAL FINDING: The total volume of RNA sample was more than 5 ug. We generated 70,853,361 high quality reads after eliminating adapter sequences and filtering out low-quality reads. A total of 78,408 isosequences were obtained by clustering and assembly of the clean reads, producing 57,619 non-redundant transcripts with an average length of 1244.19 bp. In total 70,702 isosequences were matched to the Nr database, additional analyses were performed by GO (33,203, KEGG (17,868, and COG analyses (13,817, identifying the potential genes and their functions. A total of 47 sex-determination related gene families were identified from the M. nipponense androgenic gland transcriptome based on the functional annotation of non-redundant transcripts and comparisons with the published literature. Furthermore, a total of 40 candidate novel genes were found, that may contribute to sex-determination based on their extremely high expression levels in the androgenic compared to other sex glands,. Further, 437 SSRs and 65,535 high-confidence SNPs were identified in this EST dataset from which 14 EST-SSR markers have been isolated. CONCLUSION: Our study provides new sequence information for M. nipponense, which will be the basis for further genetic studies on decapods crustaceans. More importantly, this study dramatically improves understanding of sex-determination mechanisms, and advances sex-determination research in all crustacean species. The huge number of potential SSR and SNP markers isolated from the transcriptome may shed the lights

  7. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  8. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  9. The population genetics of cooperative gene regulation

    Directory of Open Access Journals (Sweden)

    Stewart Alexander J

    2012-09-01

    Full Text Available Abstract Background Changes in gene regulatory networks drive the evolution of phenotypic diversity both within and between species. Rewiring of transcriptional networks is achieved either by changes to transcription factor binding sites or by changes to the physical interactions among transcription factor proteins. It has been suggested that the evolution of cooperative binding among factors can facilitate the adaptive rewiring of a regulatory network. Results We use a population-genetic model to explore when cooperative binding of transcription factors is favored by evolution, and what effects cooperativity then has on the adaptive re-writing of regulatory networks. We consider a pair of transcription factors that regulate multiple targets and overlap in the sets of target genes they regulate. We show that, under stabilising selection, cooperative binding between the transcription factors is favoured provided the amount of overlap between their target genes exceeds a threshold. The value of this threshold depends on several population-genetic factors: strength of selection on binding sites, cost of pleiotropy associated with protein-protein interactions, rates of mutation and population size. Once it is established, we find that cooperative binding of transcription factors significantly accelerates the adaptive rewiring of transcriptional networks under positive selection. We compare our qualitative predictions to systematic data on Saccharomyces cerevisiae transcription factors, their binding sites, and their protein-protein interactions. Conclusions Our study reveals a rich set of evolutionary dynamics driven by a tradeoff between the beneficial effects of cooperative binding at targets shared by a pair of factors, and the detrimental effects of cooperative binding for non-shared targets. We find that cooperative regulation will evolve when transcription factors share a sufficient proportion of their target genes. These findings help to

  10. Coactivators in PPAR-Regulated Gene Expression

    Directory of Open Access Journals (Sweden)

    Navin Viswakarma

    2010-01-01

    Full Text Available Peroxisome proliferator-activated receptor (PPARα, β (also known as δ, and γ function as sensors for fatty acids and fatty acid derivatives and control important metabolic pathways involved in the maintenance of energy balance. PPARs also regulate other diverse biological processes such as development, differentiation, inflammation, and neoplasia. In the nucleus, PPARs exist as heterodimers with retinoid X receptor-α bound to DNA with corepressor molecules. Upon ligand activation, PPARs undergo conformational changes that facilitate the dissociation of corepressor molecules and invoke a spatiotemporally orchestrated recruitment of transcription cofactors including coactivators and coactivator-associated proteins. While a given nuclear receptor regulates the expression of a prescribed set of target genes, coactivators are likely to influence the functioning of many regulators and thus affect the transcription of many genes. Evidence suggests that some of the coactivators such as PPAR-binding protein (PBP/PPARBP/thyroid hormone receptor-associated protein 220 (TRAP220/mediator complex subunit 1 (MED1 may exert a broader influence on the functions of several nuclear receptors and their target genes. Investigations into the role of coactivators in the function of PPARs should strengthen our understanding of the complexities of metabolic diseases associated with energy metabolism.

  11. Gene therapy on demand: site specific regulation of gene therapy.

    Science.gov (United States)

    Jazwa, Agnieszka; Florczyk, Urszula; Jozkowicz, Alicja; Dulak, Jozef

    2013-08-10

    Since 1990 when the first clinical gene therapy trial was conducted, much attention and considerable promise have been given to this form of treatment. Gene therapy has been used with success in patients suffering from severe combined immunodeficiency syndromes (X-SCID and ADA-deficiency), Leber's congenital amaurosis, hemophilia, β-thalassemia and adrenoleukodystrophy. Last year, the first therapeutic vector (Glybera) for treatment of lipoprotein lipase deficiency has been registered in the European Union. Nevertheless, there are still several numerous issues that need to be improved to make this technique more safe, effective and easily accessible for patients. Introduction of the therapeutic gene to the given cells should provide the level of expression which will restore the production of therapeutic protein to normal values or will provide therapeutic efficacy despite not fully physiological expression. However, in numerous diseases the expression of therapeutic genes has to be kept at certain level for some time, and then might be required to be switched off to be activated again when worsening of the symptoms may aggravate the risk of disease relapse. In such cases the promoters which are regulated by local conditions may be more required. In this article the special emphasis is to discuss the strategies of regulation of gene expression by endogenous stimuli. Particularly, the hypoxia- or miRNA-regulated vectors offer the possibilities of tight but, at the same time, condition-dependent and cell-specific expression. Such means have been already tested in certain pathophysiological conditions. This creates the chance for the translational approaches required for development of effective treatments of so far incurable diseases.

  12. Redox regulation, gene expression and longevity.

    Science.gov (United States)

    Honda, Yoko; Tanaka, Masashi; Honda, Shuji

    2010-07-01

    Lifespan can be lengthened by genetic and environmental modifications. Study of these might provide valuable insights into the mechanism of aging. Low doses of radiation and short-term exposure to heat and high concentrations of oxygen prolong the lifespan of the nematode Caenorhabditis elegans. These might be caused by adaptive responses to harmful environmental conditions. Single-gene mutations have been found to extend lifespan in C. elegans, Drosophila and mice. So far, the best-characterized system is the C. elegans mutant in the daf-2, insulin/IGF-I receptor gene that is the component of the insulin/IGF-I signaling pathway. The mutant animals live twice as long as the wild type. The insulin/IGF-I signaling pathway regulates the activity of DAF-16, a FOXO transcription factor. However, the unified explanation for the function of DAF-16 transcription targets in the lifespan extension is not yet fully established. As both of the Mn superoxide dismutase (MnSOD) isoforms (sod-2 and sod-3) are found to be targets of DAF-16, we attempted to assess their functions in regulating lifespan and oxidative stress responsivity. We show that the double deletions of sod-2 and sod-3 genes induced oxidative-stress sensitivity but do not shorten lifespan in the daf-2 mutant background, indicating that oxidative stress is not necessarily a limiting factor for longevity. Furthermore, the deletion in the sod-3 gene lengthens lifespan in the daf-2 mutant. We conclude that the MnSOD systems in C. elegans fine-tune the insulin/IGF-I-signaling based regulation of longevity by acting not as anti-oxidants but as physiological-redox-signaling modulators.

  13. Gene expression regulators--MicroRNAs

    Institute of Scientific and Technical Information of China (English)

    CHEN Fang; YIN Q. James

    2005-01-01

    A large class of non-coding RNAs found in small molecule RNAs are closely associated with the regulation of gene expression, which are called microRNA (miRNA). MiRNAs are coded in intergenic or intronic regions and can be formed into foldback hairpin RNAs. These transcripts are cleaved by Dicer, generating mature miRNAs that can silence their target genes in different modes of action. Now, research on small molecule RNAs has gotten breakthrough advance in biology. To discover miRNA genes and their target genes has become hot topics in RNA research. This review attempts to look back the history of miRNA discovery, to introduce the methods of screening miRNAs, to localize miRNA loci in genome, to seek miRNA target genes and the biological function, and to discuss the working mechanisms of miRNAs. Finally, we will discuss the potential important roles of miRNAs in modulating the genesis, development, growth, and differentiation of organisms. Thus, it can be predicted that a complete understanding of miRNA functions will bring us some new concepts, approaches and strategies for the study of living beings.

  14. A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

    DEFF Research Database (Denmark)

    Ottesen, A M; Garn, I D; Aksglaede, L;

    2007-01-01

    Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....

  15. Systems Pharmacology Modeling of Prostate‐Specific Antigen in Patients With Prostate Cancer Treated With an Androgen Receptor Antagonist and Down‐Regulator

    Science.gov (United States)

    Mistry, HB; Young, J; Clack, G; Dickinson, PA

    2016-01-01

    First‐in‐human (FIH) studies with AZD3514, a selective androgen receptor (AR) down‐regulator, showed decreases of >30% in the prostate‐specific antigen (PSA) in some patients. A modeling approach was adopted to understand these observations and define the optimum clinical use hypothesis for AZD3514 for clinical testing. Initial empirical modeling showed that only baseline PSA correlated significantly with this biological response, whereas drug concentration did not. To identify the mechanistic cause of this observation, a mechanism‐based model was first developed, which described the effects of AZD3514 on AR protein and PSA mRNA levels in LNCaP cells with and without dihydrotestosterone (DHT). Second, the mechanism‐based model was linked to a population pharmacokinetic (PK) model; PSA effects of clinical doses were subsequently simulated under different clinical conditions. This model was used to adjust the design of the ongoing clinical FIH study and direct the backup program. PMID:27299938

  16. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Fang, Lusheng; Li, Bo; Tong, Shurong

    2011-01-01

    is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed......To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  17. The CXCL12/CXCR4 axis promotes ligand-independent activation of the androgen receptor.

    Science.gov (United States)

    Kasina, Sathish; Macoska, Jill A

    2012-04-01

    The molecular mechanisms responsible for the transition of some prostate cancers from androgen ligand-dependent to androgen ligand-independent are incompletely established. Molecules that are ligands for G protein coupled receptors (GPCRs) have been implicated in ligand-independent androgen receptor (AR) activation. The purpose of this study was to examine whether CXCL12, the ligand for the GPCR, CXCR4, might mediate prostate cancer cell proliferation through AR-dependent mechanisms involving functional transactivation of the AR in the absence of androgen. The results of these studies showed that activation of the CXCL12/CXCR4 axis promoted: The nuclear accumulation of both wild-type and mutant AR in several prostate epithelial cell lines; AR-dependent proliferative responses; nuclear accumulation of the AR co-regulator SRC-1 protein; SRC-1:AR protein:protein association; co-localization of AR and SRC-1 on the promoters of AR-regulated genes; AR- and SRC-1 dependent transcription of AR-regulated genes; AR-dependent secretion of the AR-regulated PSA protein; P13K-dependent phosphorylation of AR; MAPK-dependent phosphorylation of SRC-1, and both MAPK- and P13K-dependent secretion of the PSA protein, in the absence of androgen. Taken together, these studies identify CXCL12 as a novel, non-steroidal growth factor that promotes the growth of prostate epithelial cells through AR-dependent mechanisms in the absence of steroid hormones. These findings support the development of novel therapeutics targeting the CXCL12/CXCR4 axis as an ancillary to those targeting the androgen/AR axis to effectively treat castration resistant/recurrent prostate tumors.

  18. Analysis of the CAG repeat region of the androgen receptor gene in a kindred with X-linked spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Belsham, D D; Yee, W C; Greenberg, C R; Wrogemann, K

    1992-10-01

    Herein we describe a family with X-linked spinal and bulbar muscular atrophy (SBMA or Kennedy's disease), an adult onset neuromuscular disease characterized by slow progression, predominant proximal and bulbar muscle weakness. One frequent association is the appearance of gynecomastia. This disorder was previously shown to be linked to the locus DXYS1 on the proximal long arm of the X chromosome. Recently, a report implicated a mutation at the N-terminus of the androgen receptor gene involving amplification of CAG repeats as the cause of X-linked SBMA. We studied this region of the androgen receptor in a kindred clinically suspected but not confirmed of having X-linked SBMA by the polymerase chain reaction (PCR) followed by Southern analysis and DNA sequencing. The mutated allele was found to have an increased number of 51 CAG repeats confirming the clinical diagnosis of SBMA. Normal individuals revealed 23 repeat numbers within the normal range, while another unrelated X-linked SBMA patient had an enlarged CAG repeat region. The carrier or disease status could be established or confirmed in 12 individuals of this family on the basis of detecting normal and disease alleles reflected by the number of CAG repeats.

  19. Sexual Dimorphism in the Regulation of Estrogen, Progesterone, and Androgen Receptors by Sex Steroids in the Rat Airway Smooth Muscle Cells

    Directory of Open Access Journals (Sweden)

    Abraham Zarazúa

    2016-01-01

    Full Text Available The role of sex hormones in lung is known. The three main sex steroid receptors, estrogen, progesterone, and androgen, have not been sufficiently studied in airway smooth muscle cells (ASMC, and the sex hormone regulation on these receptors is unknown. We examined the presence and regulation of sex hormone receptors in female and male rat ASMC by Western blotting and flow cytometry. Gonadectomized rats were treated with 17β-estradiol, progesterone, 17β-estradiol + progesterone, or testosterone. ASMC were enzymatically isolated from tracheas and bronchi. The experiments were performed with double staining flow cytometry (anti-α-actin smooth muscle and antibodies to each hormone receptor. ERα, ERβ, tPR, and AR were detected in females or males. ERα was upregulated by E2 and T and downregulated by P4 in females; in males, ERα was downregulated by P4, E + P, and T. ERβ was downregulated by each treatment in females, and only by E + P and T in males. tPR was downregulated by P4, E + P, and T in females. No hormonal regulation was observed in male receptors. AR was downregulated in males treated with E + P and T. We have shown the occurrence of sex hormone receptors in ASMC and their regulation by the sex hormones in female and male rats.

  20. Sexual Dimorphism in the Regulation of Estrogen, Progesterone, and Androgen Receptors by Sex Steroids in the Rat Airway Smooth Muscle Cells

    Science.gov (United States)

    Zarazúa, Abraham; González-Arenas, Aliesha; Ramírez-Vélez, Gabriela; Bazán-Perkins, Blanca; Guerra-Araiza, Christian; Campos-Lara, María G.

    2016-01-01

    The role of sex hormones in lung is known. The three main sex steroid receptors, estrogen, progesterone, and androgen, have not been sufficiently studied in airway smooth muscle cells (ASMC), and the sex hormone regulation on these receptors is unknown. We examined the presence and regulation of sex hormone receptors in female and male rat ASMC by Western blotting and flow cytometry. Gonadectomized rats were treated with 17β-estradiol, progesterone, 17β-estradiol + progesterone, or testosterone. ASMC were enzymatically isolated from tracheas and bronchi. The experiments were performed with double staining flow cytometry (anti-α-actin smooth muscle and antibodies to each hormone receptor). ERα, ERβ, tPR, and AR were detected in females or males. ERα was upregulated by E2 and T and downregulated by P4 in females; in males, ERα was downregulated by P4, E + P, and T. ERβ was downregulated by each treatment in females, and only by E + P and T in males. tPR was downregulated by P4, E + P, and T in females. No hormonal regulation was observed in male receptors. AR was downregulated in males treated with E + P and T. We have shown the occurrence of sex hormone receptors in ASMC and their regulation by the sex hormones in female and male rats. PMID:27110242

  1. Identification of an anabolic selective androgen receptor modulator that actively induces death of androgen-independent prostate cancer cells.

    Science.gov (United States)

    Schmidt, Azriel; Meissner, Robert S; Gentile, Michael A; Chisamore, Michael J; Opas, Evan E; Scafonas, Angela; Cusick, Tara E; Gambone, Carlo; Pennypacker, Brenda; Hodor, Paul; Perkins, James J; Bai, Chang; Ferraro, Damien; Bettoun, David J; Wilkinson, Hilary A; Alves, Stephen E; Flores, Osvaldo; Ray, William J

    2014-09-01

    Prostate cancer (PCa) initially responds to inhibition of androgen receptor (AR) signaling, but inevitably progresses to hormone ablation-resistant disease. Much effort is focused on optimizing this androgen deprivation strategy by improving hormone depletion and AR antagonism. However we found that bicalutamide, a clinically used antiandrogen, actually resembles a selective AR modulator (SARM), as it partially regulates 24% of endogenously 5α-dihydrotestosterone (DHT)-responsive genes in AR(+) MDA-MB-453 breast cancer cells. These data suggested that passive blocking of all AR functions is not required for PCa therapy. Hence, we adopted an active strategy that calls for the development of novel SARMs, which induce a unique gene expression profile that is intolerable to PCa cells. Therefore, we screened 3000 SARMs for the ability to arrest the androgen-independent growth of AR(+) 22Rv1 and LNCaP PCa cells but not AR(-) PC3 or DU145 cells. We identified only one such compound; the 4-aza-steroid, MK-4541, a potent and selective SARM. MK-4541 induces caspase-3 activity and cell death in both androgen-independent, AR(+) PCa cell lines but spares AR(-) cells or AR(+) non-PCa cells. This activity correlates with its promoter context- and cell-type dependent transcriptional effects. In rats, MK-4541 inhibits the trophic effects of DHT on the prostate, but not the levator ani muscle, and triggers an anabolic response in the periosteal compartment of bone. Therefore, MK-4541 has the potential to effectively manage prostatic hypertrophic diseases owing to its antitumor SARM-like mechanism, while simultaneously maintaining the anabolic benefits of natural androgens.

  2. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  3. Relation of androgen receptor gene polymorphism to bone mineral density and fracture risk in early postmenopausal women during a 5-year randomized hormone replacement therapy trial.

    Science.gov (United States)

    Salmén, Timo; Heikkinen, Anna-Mari; Mahonen, Anitta; Kröger, Heikki; Komulainen, Marja; Pallonen, Heli; Saarikoski, Seppo; Honkanen, Risto; Mäenpää, Pekka H

    2003-02-01

    In women, the influence of androgens on bone health is not clear. It has been suggested that the androgen receptor (AR) genotype is associated with bone mineral density and serum androgen levels in pre- and perimenopausal women, but the association between AR genotype, bone mineral density, and fracture risk has not been studied in postmenopausal women. Therefore, we studied whether AR polymorphism affects bone mineral density, bone mineral density change, or fracture risk in a 5-year randomized hormone replacement therapy (HRT) trial on 331 early postmenopausal women (mean baseline age, 52.7 +/- 2.3 years). The participants consisted of two treatment groups: the HRT group (n = 151) received a sequential combination of 2 mg estradiol valerate and 1 mg cyproterone acetate with or without vitamin D3, 100-300 IU + 93 mg calcium as lactate/day, and the non-HRT group (n = 180) received 93 mg calcium alone or in combination with vitamin D3, 100-300 IU/day for 5 years. Bone mineral density was measured from lumbar spine and proximal femur (DXA) before and after the 5-year trial. All new symptomatic, radiographically defined fractures were recorded during the follow-up. The length of CAG repeat in exon 1 of AR gene was evaluated after polymerase chain reaction (PCR) amplification. The subjects were divided into three repeat groups according to AR alleles. None of the baseline characteristics were associated with AR gene polymorphism and HRT treatment. The polymorphism did not influence the calculated annual changes of lumbar or femoral neck bone mineral density during the 5-year follow-up in the HRT (p = 0.926 and 0.146, respectively) or non-HRT (p = 0.818 and 0.917, respectively) groups. In all, 28 women sustained 33 fractures during the follow-up. Thus, the numbers of fractures were limited. The AR repeat length variation was not significantly associated with fracture risk in the HRT or non-HRT groups (p = 0.632 and 0.459, respectively; Cox proportional hazards model

  4. Androgen priming using aromatase inhibitor and hCG during early-follicular-phase GnRH antagonist down-regulation in modified antagonist protocols

    DEFF Research Database (Denmark)

    Løssl, Kristine; Andersen, A N; Loft, A;

    2006-01-01

    Temporary exposure of follicles to increased levels of androgens may enhance their sensitivity to FSH. The aim of this study was to increase the intraovarian androgen level using aromatase inhibitors and hCG before controlled ovarian stimulation (COH) and to test this concept clinically.......Temporary exposure of follicles to increased levels of androgens may enhance their sensitivity to FSH. The aim of this study was to increase the intraovarian androgen level using aromatase inhibitors and hCG before controlled ovarian stimulation (COH) and to test this concept clinically....

  5. Androgen signaling in myocytes contributes to the maintenance of muscle mass and fiber type regulation but not to muscle strength or fatigue.

    Science.gov (United States)

    Ophoff, Jill; Van Proeyen, Karen; Callewaert, Filip; De Gendt, Karel; De Bock, Katrien; Vanden Bosch, An; Verhoeven, Guido; Hespel, Peter; Vanderschueren, Dirk

    2009-08-01

    Muscle frailty is considered a major cause of disability in the elderly and chronically ill. However, the exact role of androgen receptor (AR) signaling in muscle remains unclear. Therefore, a postmitotic myocyte-specific AR knockout (mARKO) mouse model was created and investigated together with a mouse model with ubiquitous AR deletion. Muscles from mARKO mice displayed a marked reduction in AR protein (60-88%). Interestingly, body weights and lean body mass were lower in mARKO vs. control mice (-8%). The weight of the highly androgen-sensitive musculus levator ani was significantly reduced (-46%), whereas the weights of other peripheral skeletal muscles were not or only slightly reduced. mARKO mice had lower intra-abdominal fat but did not demonstrate a cortical or trabecular bone phenotype, indicating that selective ablation of the AR in myocytes affected male body composition but not skeletal homeostasis. Furthermore, muscle contractile performance in mARKO mice did not differ from their controls. Myocyte-specific AR ablation resulted in a conversion of fast toward slow fibers, without affecting muscle strength or fatigue. Similar results were obtained in ubiquitous AR deletion, showing lower body weight, whereas some but not all muscle weights were reduced. The percent slow fibers was increased, but no changes in muscle strength or fatigue could be detected. Together, our findings show that myocyte AR signaling contributes to the maintenance of muscle mass and fiber type regulation but not to muscle strength or fatigue. The levator ani weight remains the most sensitive and specific marker of AR-mediated anabolic action on muscle.

  6. PSA and androgen-related gene (AR, CYP17, and CYP19) polymorphisms and the risk of adenocarcinoma at prostate biopsy

    DEFF Research Database (Denmark)

    dos Santos, Rodrigo Mattos; de Jesus, Carlos Márcio Nóbrega; Trindade Filho, José Carlos Souza;

    2008-01-01

    The aim of the present study was to examine the impact of polymorphisms in prostate-specific antigen (PSA) and androgen-related genes (AR, CYP17, and CYP19) on prostate cancer (PCa) risk in selected high-risk patients who underwent prostate biopsy. Blood samples and prostate tissues were obtained...... for DNA analysis. Single-nucleotide polymorphisms in the 50-untranslated regions (UTRs) of the PSA (substitution A>G at position-158) and CYP17 (substitution T>C at 50-UTR) genes were detected by polymerase chain reaction (PCR)-restriction fragment length polymorphism assays. The CAG and TTTA repeats...... in the AR and CYP19 genes, respectively, were genotyped by PCR-based GeneScan analysis. Patients with the GG genotype of the PSA gene had a higher risk of PCa than those with the AG or AA genotype (OR=3.79, p=0.00138). The AA genotype was associated with lower PSA levels (6.44 +/- 1.64 ng=mL) compared...

  7. Endogenous methanol regulates mammalian gene activity.

    Directory of Open Access Journals (Sweden)

    Tatiana V Komarova

    Full Text Available We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  8. Observation of Androgen Receptor Gene and Sex Hormone Binding Protein Gene in PCOS Patients%PCOS患者雄激素受体基因和性激素结合蛋白基因情况观察

    Institute of Scientific and Technical Information of China (English)

    马娟; 周俊; 田贵聪; 石华

    2016-01-01

    目的:研究观察多囊卵巢综合征(polycystic ovary syndrome,PCOS)患者的雄激素受体基因和性激素结合蛋白基因的情况。方法:选取2014年11月-2015年7月本院接诊的62例PCOS患者为观察组,同一时期由于生殖系统发生异常导致不孕的62例患者为对照组。提取所有患者血液标本的DNA进行基因扩增、琼脂糖凝胶、毛细管电泳等检测,观察研究PCOS患者的雄激素受体和性激素结合蛋白基因的情况。结果:观察组SHBG-TAAAA基因型多态性与胰岛素抵抗的研究中,发现9/9基因型的分布在胰岛素抵抗和非胰岛素抵抗两组中存在统计学差异(P<0.05);观察组中,短重复组在高雄激素血症组的分布为52.94%,在雄激素正常组分布为42.86%;而长重复组在高雄激素血症组的分布为61.76%,在雄激素正常组的分布为39.29%,两组数据比较差异有统计学意义(P<0.05)。结论:雄激素受体基因和性激素结合蛋白基因与PCOS相关,可对PCOS的检查指标、PCOS防治、及早诊断起重要作用。%Objective:To investigate the status of androgen receptor gene and sex hormone binding protein gene in patients with polycystic ovary syndrome(PCOS).Method:A total of 62 PCOS patients were selected as the observation group from November 2014 to July 2015 in our hospital,the control group were choosed from the same period due to the occurrence of reproductive system abnormalities lead to infertility in 62 patients.DNA gene amplification,agarose gel electrophoresis and capillary electrophoresis were performed to detect the expression of androgen receptor and sex hormone binding protein gene in PCOS patients.Result:SHBG-TAAAA gene type of polymorphic and insulin resistance of the observation group in the study,found that 9/9 genotype distribution in insulin resistance and insulin resistance had a significant difference in two groups(P<0.05).In the observation group

  9. Global analysis of transcription in castration-resistant prostate cancer cells uncovers active enhancers and direct androgen receptor targets.

    Science.gov (United States)

    Toropainen, Sari; Niskanen, Einari A; Malinen, Marjo; Sutinen, Päivi; Kaikkonen, Minna U; Palvimo, Jorma J

    2016-09-19

    Androgen receptor (AR) is a male sex steroid-activated transcription factor (TF) that plays a critical role in prostate cancers, including castration-resistant prostate cancers (CRPC) that typically express amplified levels of the AR. CRPC-derived VCaP cells display an excessive number of chromatin AR-binding sites (ARBs) most of which localize to distal inter- or intragenic regions. Here, we analyzed direct transcription programs of the AR in VCaP cells using global nuclear run-on sequencing (GRO-seq) and integrated the GRO-seq data with the ARB and VCaP cell-specific TF-binding data. Androgen immediately activated transcription of hundreds of protein-coding genes, including IGF-1 receptor and EGF receptor. Androgen also simultaneously repressed transcription of a large number of genes, including MYC. As functional enhancers have been postulated to produce enhancer-templated non-coding RNAs (eRNAs), we also analyzed the eRNAs, which revealed that only a fraction of the ARBs reside at functional enhancers. Activation of these enhancers was most pronounced at the sites that also bound PIAS1, ERG and HDAC3, whereas binding of HDAC3 and PIAS1 decreased at androgen-repressed enhancers. In summary, our genome-wide data of androgen-regulated enhancers and primary target genes provide new insights how the AR can directly regulate cellular growth and control signaling pathways in CPRC cells.

  10. Mechanism and Regulation of Gene Expression by Androgen Receptor in Prostate Cancer

    Science.gov (United States)

    2004-07-01

    receptor modu- 47, Shen, E. C., M. F. Henry , V. H. Weiss, S. R. Valentini, P. A. Silver, and M. S. lates transcriptional activity and is influenced by...Kim, M. J., R. D. Cardiff, N. Desai, W. A. Banach- Petrosky , R. Parsons, Trans. 28:415-418. M. M. Shen, and C. Abate-Shen. 2002. Cooperativity of

  11. GIT2 Gene: Androgenic Regulation of White Adipose Tissue-Prostate Cancer Interactions

    Science.gov (United States)

    2014-05-01

    G, Plotnikov A, Tzimas C, Yang N, Rui H, Fuchs SY. Prolactin inhibits activity of pyruvate kinase M2 to stimulate cell proliferation. Mol Endocrinol. 2010 Dec;24(12):2356-65. Epub 2010 Oct 20. ...REPORTABLE OUTCOMES 1. Floryk D, Kurosaka S, Tanimoto R , Yang G, Goltsov A, Park S, Thompson TC. Castration- induced changes in mouse...migration and invasion. Clin Cancer Res. 2004 Dec 15;10(24):8743-50. 5. Johnson-Holiday C, Singh R , Johnson E, Singh S, Stockard CR, Grizzle WE, Lillard

  12. Evaluation of Roles of Interferon Gamma Regulated Genes in Inhibition of Androgen-Independent Prostate Cancer

    Science.gov (United States)

    2006-08-01

    containing: 20 mM Tris, pH 8, 10 mM NaCl, 3 mM EDTA, 0.05% Nonidet P-40, 2 mM DTT, 4% glycerol, 1 mM MgCl2, 1μg poly dI-dC (Amersham). The binding...Transcribed locus, strongly similar to XP_496055.1 PREDICTED: similar to p40 AW452111 2.3 C1orf43 hromosome 1 open reading frame 43 BQ900746 25912 1.9

  13. Cytogenetic and molecular analysis of infertile Chinese men: karyotypic abnormalities, Y-chromosome microdeletions, and CAG and GGN repeat polymorphisms in the androgen receptor gene.

    Science.gov (United States)

    Han, T T; Ran, J; Ding, X P; Li, L J; Zhang, L Y; Zhang, Y P; Nie, S S; Chen, L

    2013-07-08

    Chromosome abnormalities, Y-chromosome microdeletions, and androgen receptor gene CAG and GGN repeat polymorphisms in infertile Chinese men featuring severe oligospermia and azoospermia were analyzed. Ninety-six fertile men and 189 non-obstructive infertile men, including 125 patients with azoospermia and 64 with severe oligozoospermia, were studied. Seventeen infertile men (9.0%) carried a chromosome abnormality. Twenty (10.6%) carried a Y-chromosome microdeletion. In the remainder of the patients and controls, GGN and CAG repeats were sequenced. Short GGN repeats (n repeats strongly correlated with sperm counts. No significant difference in CAG repeats was found between patients and controls, nor were CAG repeats correlated with sperm counts. However, for CAG repeats ranging between 24 and 25, there was a >2.5-fold risk (OR = 2.539, 95%CI = 1.206-5.344, P repeats in Chinese male infertility.

  14. The Presence of Clitoromegaly in the Nonclassical Form of 21-Hydroxylase Deficiency Could Be Partially Modulated by the CAG Polymorphic Tract of the Androgen Receptor Gene

    Science.gov (United States)

    Garcia Gomes, Larissa; Bugano Diniz Gomes, Diogo; Marcondes, José Antônio Miguel; Madureira, Guiomar; de Mendonca, Berenice Bilharinho; Bachega, Tânia A. Sartori Sanchez

    2016-01-01

    Background In the nonclassical form (NC), good correlation has been observed between genotypes and 17OH-progesterone (17-OHP) levels. However, this correlation was not identified with regard to the severity of hyperandrogenic manifestations, which could depend on interindividual variability in peripheral androgen sensitivity. Androgen action is modulated by the polymorphic CAG tract (nCAG) of the androgen receptor (AR) gene and by polymorphisms in 5α-reductase type 2 (SRD5A2) enzyme, both of which are involved in the severity of hyperandrogenic disorders. Objectives To analyze whether nCAG-AR and SRD5A2 polymorphisms influence the severity of the nonclassical phenotype. Patients NC patients (n = 114) diagnosed by stimulated-17OHP ≥10 ng/mL were divided into groups according to the beginning of hyperandrogenic manifestations (pediatric and adolescent/adult) and CYP21A2 genotypes (C/C: homozygosis for mild mutations; A/C: compound heterozygosis for severe/mild mutations). Methods CYP21A2 mutations were screened by allelic-specific PCR, MLPA and/or sequencing. HpaII-digested and HpaII-undigested DNA samples underwent GeneScan analysis to study nCAG, and the SRD5A2 polymorphisms were screened by RLFP. Results Mean nCAG did not differ among pediatric, adolescent/adult and asymptomatic subjects. In the C/C genotype, we observed a significantly lower frequency of longer CAG alleles in pediatric patients than in adolescent/adults (p = 0.01). In patients carrying the A/C genotype, the frequencies of shorter and longer CAG alleles did not differ between pediatric patients and adolescent/adults (p>0.05). Patients with clitoromegaly had significantly lower weighted CAG biallelic mean than those without it: 19.1±2.7 and 21.6±2.5, respectively (p = 0.007), independent of the CYP21A2 genotype's severity. The SRD5A2 polymorphisms were not associated with the variability of hyperandrogenic NC phenotypes. Conclusions In this series, we observed a modulatory effect of the CAG

  15. Ovarian overproduction of androgens

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001165.htm Ovarian overproduction of androgens To use the sharing features on this page, please enable JavaScript. Ovarian overproduction of androgens is a condition in which the ...

  16. Androgen priming using aromatase inhibitor and hCG during early-follicular-phase GnRH antagonist down-regulation in modified antagonist protocols

    DEFF Research Database (Denmark)

    Løssl, Kristine; Andersen, A N; Loft, A;

    2006-01-01

    Temporary exposure of follicles to increased levels of androgens may enhance their sensitivity to FSH. The aim of this study was to increase the intraovarian androgen level using aromatase inhibitors and hCG before controlled ovarian stimulation (COH) and to test this concept clinically....

  17. Androgen receptor mutations

    NARCIS (Netherlands)

    A.O. Brinkmann (Albert); G.W. Jenster (Guido); C. Ris-Stalpers (Carolyn); J.A.G.M. van der Korput (J. A G M); H.T. Brüggenwirth (Hennie); A.L.M. Boehmer (Annemie); J. Trapman (Jan)

    1995-01-01

    textabstractMale sexual differentiation and development proceed under direct control of androgens. Androgen action is mediated by the intracellular androgen receptor, which belongs to the superfamily of ligand-dependent transcription factors. At least three pathological situations are associated wit

  18. Androgen and bone mass in men

    Institute of Scientific and Technical Information of China (English)

    AnnieW.C.Kung

    2003-01-01

    Androgens have multiple actions on the skeleton throughout life. Androgens promote skeletal growth and accumulation of minerals during puberty and adolescence and stimulate osteoblast but suppress osteoclast function,activity and lifespan through complex mechanisms. Also androgens increase periosteal bone apposition, resulting in larger bone size and thicker cortical bone in men. There is convincing evidence to show that aromatization to estrogens was an important pathway for mediating the action of testosterone on bone physiology. Estrogen is probably the dominant sex steroid regulating bone resorption in men, but both testosterone and estrogen are important in maintaining bone formation. ( Asian J Androl 2003 Jun; 5: 148-154)

  19. The neuroendocrine-derived peptide parathyroid hormone-related protein promotes prostate cancer cell growth by stabilizing the androgen receptor.

    Science.gov (United States)

    DaSilva, John; Gioeli, Daniel; Weber, Michael J; Parsons, Sarah J

    2009-09-15

    During progression to an androgen-independent state following androgen ablation therapy, prostate cancer cells continue to express the androgen receptor (AR) and androgen-regulated genes, indicating that AR is critical for the proliferation of hormone-refractory prostate cancer cells. Multiple mechanisms have been proposed for the development of AR-dependent hormone-refractory disease, including changes in expression of AR coregulatory proteins, AR mutation, growth factor-mediated activation of AR, and AR protein up-regulation. The most prominent of these progressive changes is the up-regulation of AR that occurs in >90% of prostate cancers. A common feature of the most aggressive hormone-refractory prostate cancers is the accumulation of cells with neuroendocrine characteristics that produce paracrine factors and may provide a novel mechanism for the regulation of AR during advanced stages of the disease. In this study, we show that neuroendocrine-derived parathyroid hormone-related protein (PTHrP)-mediated signaling through the epidermal growth factor receptor (EGFR) and Src pathways contributes to the phenotype of advanced prostate cancer by reducing AR protein turnover. PTHrP-induced accumulation of AR depended on the activity of Src and EGFR and consequent phosphorylation of the AR on Tyr(534). PTHrP-induced tyrosine phosphorylation of AR resulted in reduced AR ubiquitination and interaction with the ubiquitin ligase COOH terminus of Hsp70-interacting protein. These events result in increased accumulation of AR and thus enhanced growth of prostate cancer cells at low levels of androgen.

  20. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    1993-01-01

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from cul

  1. Detection of androgen receptor gene mutation in two pedigrees with an-drogen insensitivity syndrome%两个雄激素不敏感综合征家系中 AR基因突变检测

    Institute of Scientific and Technical Information of China (English)

    信艳萍; 吴庆华; 张毅; 史惠蓉

    2015-01-01

    目的:对两个疑似雄激素不敏感综合征( AIS)家系进行基因诊断和其他临床相关检查,旨在发现其致病基因并进行遗传咨询。方法:对两个AIS家系的先证者及相关成员行体格检查、染色体核型分析、内分泌检测及超声检查后,提取外周血全基因组DNA,扩增位于X染色体上AR基因的8个外显子,扩增产物测序后与基因库中正常人的序列进行比对,查找是否存在致病突变。结果:两个AIS家系的先证者均检测到AR基因突变,分别为c.2042T>C(p.681I>T)和c.1822C>T(p.608R>X),家系中女性携带者中检测出了上述位点的杂合突变。家系1先证者行腹腔镜性腺切除术后证实性腺为睾丸。结论:AR基因的p.681 I>T和p.608 R>X是两个AIS家系患者的致病性突变;对AR基因进行基因检测是46,XY性发育异常,特别是AIS有效的诊断方式。%Aim:Clinical and genetic tests were performed in two pedigrees suspected of androgen insensitivity syndrome ( AIS) to get the diagnosis and provide genetic counseling .Methods:Physical examination , karyotyping ,endocrinal tests and ultrasonography were performed in the probands and their relatives .Eight encoding exons of AR gene extracted from peripher-al blood were amplified by PCR .The products were compared with the normal gene sequences and further analyzed by direct DNA sequencing to find possible mutant gene .Results:Different mutations of AR gene were detected in both pedigrees , re-spectively, c.2042T>C(p.681I>T) and c.1822C>T(p.608R>X).Heterozygous double peaks at the same position were found in female carriers.In pedigree 1, the laparoscopic surgery was performed in the proband and the sex gland was con-firmed to be testis.Conclusion:These two types of mutation of AR gene may be the pathologic causes of AIS .Direct sequen-cing of AR gene is a rapid method to diagnose 46,XY disorder of sex development , especially for

  2. Inactivation by UDP-glucuronosyltransferase enzymes: the end of androgen signaling.

    Science.gov (United States)

    Chouinard, Sarah; Yueh, Mei-Fei; Tukey, Robert H; Giton, Frank; Fiet, Jean; Pelletier, Georges; Barbier, Olivier; Bélanger, Alain

    2008-04-01

    Conjugation by UDP-Glucuronosyltransferase (UGT) is the major pathway of androgen metabolism and elimination in the human. High concentrations of glucuronide conjugates of androsterone (ADT) and androstane-3alpha,17beta-diol (3alpha-diol) are present in circulation and several studies over the last 30 years have concluded that the serum levels of these metabolites might reflect the androgen metabolism in several tissues, including the liver and androgen target tissues. Three UGT2B enzymes are responsible for the conjugation of DHT and its metabolites ADT and 3alpha-diol: UGT2B7, B15 and B17. UGT2B7 is expressed in the liver and skin whereas UGT2B15 and B17 were found in the liver, prostate and skin. Very specific antibodies against each UGT2B enzyme have been obtained and used for immunohistochemical studies in the human prostate. It was shown that UGT2B17 is expressed in basal cells whereas UGT2B15 is only localized in luminal cells, where it inactivates DHT. By using LNCaP cells, we have also demonstrated that the expression and activity of UGT2B15 and B17 are modulated by several endogenous prostate factors including androgen. Finally, to study the physiological role of UGT2B enzymes, transgenic mice bearing the human UGT2B15 gene were recently obtained. A decrease in reproductive tissue weight from transgenic animals compared to those from control animals was observed. In conclusion, the conjugation by UGT2B7, B15 and B17, which represents a non-reversible step in androgen metabolism, is an important means by which androgens are regulated locally. It is also postulated that UGT enzymes protect the tissue from deleteriously high concentrations of active androgen.

  3. Androgen Receptor-Mediated Escape Mechanisms from Androgen Ablation Therapy

    Science.gov (United States)

    2005-10-01

    of CAG repeats in the Machado-Joseph disease , spinocerebellar ataxia type 1 and androgen receptor genes. Hum. Mol. Genet. 4, 1585-1590. Rundlett, S . E... diseases such as Huntington disease and spinal and bulbar muscular atro- phy, which is commonly called Kennedy’s disease . This finding has been attributed...STATEMENT: Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author( s ) and

  4. Hormonal status of male reproductive system: androgens and estrogens in the testis and epididymis. In vivo and in vitro approaches.

    Science.gov (United States)

    Bilińska, Barbara; Wiszniewska, Barbara; Kosiniak-Kamysz, Kazimierz; Kotula-Balak, Małgorzata; Gancarczyk, Monika; Hejmej, Anna; Sadowska, Jolanta; Marchlewicz, Mariola; Kolasa, Agnieszka; Wenda-Rózewicka, Lidia

    2006-01-01

    The purpose of this article was to summarize our results on the role of androgens and estrogens in human, rodent and equine testes and epididymides, in both, physiological and patological conditions, obtained in the space of the Solicited Project (084/PO6/2002) financially supported by the State Committee for Scientific Research during the last three years. Testosterone produced by Leydig cells of the testes is clearly the major androgen in the circulation of men and adult males of most mammalian species. However, androgen metabolites make up a significant fraction of total circulating steroids. Moreover, androgen metabolism may proceed to amplify the action of testosterone through its conversion to dihydrotestosterone (DHT) or its aromatization to estradiol. The distribution of androgen and estrogen receptors (ARs and ERs) within male reproductive tissues is important because of their crucial role in mediating androgen and/or estrogen action. Attempts were undertaken to discuss not only the role of aromatase and ERs in mediating the action of estrogens in the male, but also the importance of DHT in hormonal regulation of the epididymis. In the latter, alterations caused by finasteride treatment and lead-induced oxidative stress are described. Male reproductive function of the testis and epididymis reflected by the alterations in enzymatic activity, distribution of steroid hormone receptors, differences in steroid hormone levels and altered gene expression of antioxidant enzymes are also discussed.

  5. Non-Genomic Actions of the Androgen Receptor in Prostate Cancer

    Science.gov (United States)

    Leung, Jacky K.; Sadar, Marianne D.

    2017-01-01

    Androgen receptor (AR) is a validated drug target for prostate cancer based on its role in proliferation, survival, and metastases of prostate cancer cells. Unfortunately, despite recent improvements to androgen deprivation therapy and the advent of better antiandrogens with a superior affinity for the AR ligand-binding domain (LBD), most patients with recurrent disease will eventually develop lethal metastatic castration-resistant prostate cancer (CRPC). Expression of constitutively active AR splice variants that lack the LBD contribute toward therapeutic resistance by bypassing androgen blockade and antiandrogens. In the canonical pathway, binding of androgen to AR LBD triggers the release of AR from molecular chaperones which enable conformational changes and protein–protein interactions to facilitate its nuclear translocation where it regulates the expression of target genes. However, preceding AR function in the nucleus, initial binding of androgen to AR LBD in the cytoplasm may already initiate signal transduction pathways to modulate cellular proliferation and migration. In this article, we review the significance of signal transduction pathways activated by rapid, non-genomic signaling of the AR during the progression to metastatic CRPC and put into perspective the implications for current and novel therapies that target different domains of AR.

  6. Polyamine analogues targeting epigenetic gene regulation.

    Science.gov (United States)

    Huang, Yi; Marton, Laurence J; Woster, Patrick M; Casero, Robert A

    2009-11-04

    Over the past three decades the metabolism and functions of the polyamines have been actively pursued as targets for antineoplastic therapy. Interactions between cationic polyamines and negatively charged nucleic acids play a pivotal role in DNA stabilization and RNA processing that may affect gene expression, translation and protein activity. Our growing understanding of the unique roles that the polyamines play in chromatin regulation, and the discovery of novel proteins homologous with specific regulatory enzymes in polyamine metabolism, have led to our interest in exploring chromatin remodelling enzymes as potential therapeutic targets for specific polyamine analogues. One of our initial efforts focused on utilizing the strong affinity that the polyamines have for chromatin to create a backbone structure, which could be combined with active-site-directed inhibitor moieties of HDACs (histone deacetylases). Specific PAHAs (polyaminohydroxamic acids) and PABAs (polyaminobenzamides) polyamine analogues have demonstrated potent inhibition of the HDACs, re-expression of p21 and significant inhibition of tumour growth. A second means of targeting the chromatin-remodelling enzymes with polyamine analogues was facilitated by the recent identification of flavin-dependent LSD1 (lysine-specific demethylase 1). The existence of this enzyme demonstrated that histone lysine methylation is a dynamic process similar to other histone post-translational modifications. LSD1 specifically catalyses demethylation of mono- and di-methyl Lys4 of histone 3, key positive chromatin marks associated with transcriptional activation. Structural and catalytic similarities between LSD1 and polyamine oxidases facilitated the identification of biguanide, bisguanidine and oligoamine polyamine analogues that are potent inhibitors of LSD1. Cellular inhibition of LSD1 by these unique compounds led to the re-activation of multiple epigenetically silenced genes important in tumorigenesis. The use of

  7. Correlation study between the polymorphism of repetitive sequence in gene CAG of androgen receptor and the occurrence and progression of prostate cancer

    Institute of Scientific and Technical Information of China (English)

    Xiao-Lei Zhai; Xiao-Wei Qu; Liang Guo; Qian-He Ha

    2014-01-01

    Objective: To explore the relation between the polymorphism of repetitive sequence in gene CAG of androgen receptor (AR) and the susceptibility and clinical stages as well as pathological grading of prostate cancer among Han population. Method: Sixty-eight cases with prostate cancer hospitalized in Urinary Surgery Department from Feb. 2010 to Feb. 2012 and 60 healthy cases were chosen as research subjects. Methods of PCR and direct sequencing were adopted to detect DNA sequence of AR gene and the length of repetitive sequence in CAG. Results: The lengths of repetitive sequence in CAG of patients with prostate cancer and healthy people were (22.3±4.6) and (23.0±4.9), respectively showing no statistical significance. Comparing length (repetitive sequence of CAG)>22, those with that ﹤ 22 suffer a remarkably higher risk of prostate cancer (P﹤0.05). The number of repetitive sequence in CAG of patients at clinical stage C-D was less than that of patients at stage B, and the number of repetitive sequence in CAG of patients with poorly differentiated prostate cancer was also less than that of patients with moderately and highly differentiated prostate cancer. But there was no statistical significance int the difference (P>0.05); the proportion of patients with length ﹤22 at clinical stage C-D was much larger than that of patients at clinical stage B (P﹤0.05), and as the aggravation of pathological grading, the proportion of patients with the length ﹤22 was also remarkably increased and there was significant difference between patients with highly differentiated prostate cancer and those with poorly differentiated prostate cancer (P﹤0.05). Conclusions: There is correlation between the occurrence and development of prostate cancer in Han population and the polymorphism of repetitive sequence in gene CAG of androgen receptor. The less the number of repetitive sequence in CAG is, the higher the risk of prostate cancer will be and the more severe the clinical

  8. Regulation of the pentose phosphate pathway by an androgen receptor-mTOR-mediated mechanism and its role in prostate cancer cell growth.

    Science.gov (United States)

    Tsouko, E; Khan, A S; White, M A; Han, J J; Shi, Y; Merchant, F A; Sharpe, M A; Xin, L; Frigo, D E

    2014-05-26

    Cancer cells display an increased demand for glucose. Therefore, identifying the specific aspects of glucose metabolism that are involved in the pathogenesis of cancer may uncover novel therapeutic nodes. Recently, there has been a renewed interest in the role of the pentose phosphate pathway in cancer. This metabolic pathway is advantageous for rapidly growing cells because it provides nucleotide precursors and helps regenerate the reducing agent NADPH, which can contribute to reactive oxygen species (ROS) scavenging. Correspondingly, clinical data suggest glucose-6-phosphate dehydrogenase (G6PD), the rate-limiting enzyme of the pentose phosphate pathway, is upregulated in prostate cancer. We hypothesized that androgen receptor (AR) signaling, which plays an essential role in the disease, mediated prostate cancer cell growth in part by increasing flux through the pentose phosphate pathway. Here, we determined that G6PD, NADPH and ribose synthesis were all increased by AR signaling. Further, this process was necessary to modulate ROS levels. Pharmacological or molecular inhibition of G6PD abolished these effects and blocked androgen-mediated cell growth. Mechanistically, regulation of G6PD via AR in both hormone-sensitive and castration-resistant models of prostate cancer was abolished following rapamycin treatment, indicating that AR increased flux through the pentose phosphate pathway by the mammalian target of rapamycin (mTOR)-mediated upregulation of G6PD. Accordingly, in two separate mouse models of Pten deletion/elevated mTOR signaling, Pb-Cre;Pten(f/f) and K8-CreER(T2);Pten(f/f), G6PD levels correlated with prostate cancer progression in vivo. Importantly, G6PD levels remained high during progression to castration-resistant prostate cancer. Taken together, our data suggest that AR signaling can promote prostate cancer through the upregulation of G6PD and therefore, the flux of sugars through the pentose phosphate pathway. Hence, these findings support a

  9. Sequence Evolution and Expression of the Androgen Receptor and Other Pathway-Related Genes in a Unisexual Fish, the Amazon Molly, Poecilia formosa, and Its Bisexual Ancestors.

    Directory of Open Access Journals (Sweden)

    Fangjun Zhu

    Full Text Available The all-female Amazon molly (Poecilia formosa originated from a single hybridization of two bisexual ancestors, Atlantic molly (Poecilia mexicana and sailfin molly (Poecilia latipinna. As a gynogenetic species, the Amazon molly needs to copulate with a heterospecific male, but the genetic information of the sperm-donor does not contribute to the next generation, as the sperm only acts as the trigger for the diploid eggs' embryogenesis. Here, we study the sequence evolution and gene expression of the duplicated genes coding for androgen receptors (ars and other pathway-related genes, i.e., the estrogen receptors (ers and cytochrome P450, family19, subfamily A, aromatase genes (cyp19as, in the Amazon molly, in comparison to its bisexual ancestors. Mollies possess-as most other teleost fish-two copies of the ar, er, and cyp19a genes, i.e., arα/arβ, erα/erβ1, and cyp19a1 (also referred as cyp19a1a/cyp19a2 (also referred to as cyp19a1b, respectively. Non-synonymous single nucleotide polymorphisms (SNPs among the ancestral bisexual species were generally predicted not to alter protein function. Some derived substitutions in the P. mexicana and one in P. formosa are predicted to impact protein function. We also describe the gene expression pattern of the ars and pathway-related genes in various tissues (i.e., brain, gill, and ovary and provide SNP markers for allele specific expression research. As a general tendency, the levels of gene expression were lowest in gill and highest in ovarian tissues, while expression levels in the brain were intermediate in most cases. Expression levels in P. formosa were conserved where expression did not differ between the two bisexual ancestors. In those cases where gene expression levels significantly differed between the bisexual species, P. formosa expression was always comparable to the higher expression level among the two ancestors. Interestingly, erβ1 was expressed neither in brain nor in gill in the

  10. Sequence Evolution and Expression of the Androgen Receptor and Other Pathway-Related Genes in a Unisexual Fish, the Amazon Molly, Poecilia formosa, and Its Bisexual Ancestors

    Science.gov (United States)

    Zhu, Fangjun; Schlupp, Ingo; Tiedemann, Ralph

    2016-01-01

    The all-female Amazon molly (Poecilia formosa) originated from a single hybridization of two bisexual ancestors, Atlantic molly (Poecilia mexicana) and sailfin molly (Poecilia latipinna). As a gynogenetic species, the Amazon molly needs to copulate with a heterospecific male, but the genetic information of the sperm-donor does not contribute to the next generation, as the sperm only acts as the trigger for the diploid eggs’ embryogenesis. Here, we study the sequence evolution and gene expression of the duplicated genes coding for androgen receptors (ars) and other pathway-related genes, i.e., the estrogen receptors (ers) and cytochrome P450, family19, subfamily A, aromatase genes (cyp19as), in the Amazon molly, in comparison to its bisexual ancestors. Mollies possess–as most other teleost fish—two copies of the ar, er, and cyp19a genes, i.e., arα/arβ, erα/erβ1, and cyp19a1 (also referred as cyp19a1a)/cyp19a2 (also referred to as cyp19a1b), respectively. Non-synonymous single nucleotide polymorphisms (SNPs) among the ancestral bisexual species were generally predicted not to alter protein function. Some derived substitutions in the P. mexicana and one in P. formosa are predicted to impact protein function. We also describe the gene expression pattern of the ars and pathway-related genes in various tissues (i.e., brain, gill, and ovary) and provide SNP markers for allele specific expression research. As a general tendency, the levels of gene expression were lowest in gill and highest in ovarian tissues, while expression levels in the brain were intermediate in most cases. Expression levels in P. formosa were conserved where expression did not differ between the two bisexual ancestors. In those cases where gene expression levels significantly differed between the bisexual species, P. formosa expression was always comparable to the higher expression level among the two ancestors. Interestingly, erβ1 was expressed neither in brain nor in gill in the analyzed

  11. Impact of physical activity and doping on epigenetic gene regulation.

    Science.gov (United States)

    Schwarzenbach, Heidi

    2011-10-01

    To achieve success in sports, many athletes consume doping substances, such as anabolic androgenic steroids and growth hormones, and ignore the negative influence of these drugs on their health. Apart from the unethical aspect of doping in sports, it is essential to consider the tremendous risk it represents to their physical condition. The abuse of pharmaceuticals which improve athletic performance may alter the expression of specific genes involved in muscle and bone metabolism by epigenetic mechanisms, such as DNA methylation and histone modifications. Moreover, excessive and relentless training to increase the muscle mass, may also have an influence on the health of the athletes. This stress releases neurotransmitters and growth factors, and may affect the expression of endogenous genes by DNA methylation, too. This paper focuses on the relationship between epigenetic mechanisms and sports, highlights the potential consequences of abuse of doping drugs on gene expression, and describes methods to molecularly detect epigenetic changes of gene markers reflecting the physiological or metabolic effects of doping agents.

  12. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  13. Androgens and women's health.

    Science.gov (United States)

    Redmond, G P

    1998-01-01

    Androgenic disorders are those conditions in women characterized by excessive androgen action. They are the most common endocrinopathy of women, affecting from 10% to 20%. Signs are: persistent acne, hirsutism and androgenic alopecia, which is the female equivalent of male pattern baldness. A subgroup, those traditionally labeled as having polycystic ovary syndrome (PCOS), additionally have anovulation, as well as menstrual abnormalities and, often, obesity. Although women with androgenic disorders usually present themselves for help with the skin or menstrual changes, there are other important implications regarding their health. Women with PCOS have varying degrees of insulin resistance, and an increased incidence of Type II diabetes mellitus, as well as unfavorable lipid patterns. The presence of these risk factors is suggested by upper segment obesity, darkening of the skin, and the other skin changes that make up acanthosis nigricans. Diagnosis involves measurement of circulating androgens (of which free testosterone is most important), together with prolactin and FSH when menstrual dysfunction is present. Many women with androgenic skin changes have normal serum androgen levels, suggesting increased end organ sensitivity to androgens. Others have hyperandrogenism (of ovarian or adrenal origin). Treatment is usually successful in controlling acne, reducing hirsutism and stabilizing, or partially reversing, androgenic alopecia. Pharmacological approaches involve suppressing androgen levels, for example, the use of an appropriate oral contraceptive, or antagonizing androgen action with several medications that have this activity. Unfortunately, most women with androgenic disorders are frustrated in their efforts to obtain medical help. Understanding androgenic disorders will enable the physician to significantly help the majority of women with these conditions.

  14. Pluralistic and stochastic gene regulation: examples, models and consistent theory.

    Science.gov (United States)

    Salas, Elisa N; Shu, Jiang; Cserhati, Matyas F; Weeks, Donald P; Ladunga, Istvan

    2016-06-01

    We present a theory of pluralistic and stochastic gene regulation. To bridge the gap between empirical studies and mathematical models, we integrate pre-existing observations with our meta-analyses of the ENCODE ChIP-Seq experiments. Earlier evidence includes fluctuations in levels, location, activity, and binding of transcription factors, variable DNA motifs, and bursts in gene expression. Stochastic regulation is also indicated by frequently subdued effects of knockout mutants of regulators, their evolutionary losses/gains and massive rewiring of regulatory sites. We report wide-spread pluralistic regulation in ≈800 000 tightly co-expressed pairs of diverse human genes. Typically, half of ≈50 observed regulators bind to both genes reproducibly, twice more than in independently expressed gene pairs. We also examine the largest set of co-expressed genes, which code for cytoplasmic ribosomal proteins. Numerous regulatory complexes are highly significant enriched in ribosomal genes compared to highly expressed non-ribosomal genes. We could not find any DNA-associated, strict sense master regulator. Despite major fluctuations in transcription factor binding, our machine learning model accurately predicted transcript levels using binding sites of 20+ regulators. Our pluralistic and stochastic theory is consistent with partially random binding patterns, redundancy, stochastic regulator binding, burst-like expression, degeneracy of binding motifs and massive regulatory rewiring during evolution.

  15. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    2013-01-01

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an experiment

  16. Mechanisms of mammalian zinc-regulated gene expression.

    Science.gov (United States)

    Jackson, Kelly A; Valentine, Ruth A; Coneyworth, Lisa J; Mathers, John C; Ford, Dianne

    2008-12-01

    Mechanisms through which gene expression is regulated by zinc are central to cellular zinc homoeostasis. In this context, evidence for the involvement of zinc dyshomoeostasis in the aetiology of diseases, including Type 2 diabetes, Alzheimer's disease and cancer, highlights the importance of zinc-regulated gene expression. Mechanisms elucidated in bacteria and yeast provide examples of different possible modes of zinc-sensitive gene regulation, involving the zinc-regulated binding of transcriptional activators and repressors to gene promoter regions. A mammalian transcriptional regulatory mechanism that mediates zinc-induced transcriptional up-regulation, involving the transcription factor MTF1 (metal-response element-binding transcription factor 1), has been studied extensively. Gene responses in the opposite direction (reduced mRNA levels in response to increased zinc availability) have been observed in mammalian cells, but a specific transcriptional regulatory process responsible for such a response has yet to be identified. Examples of single zinc-sensitive transcription factors regulating gene expression in opposite directions are emerging. Although zinc-induced transcriptional repression by MTF1 is a possible explanation in some specific instances, such a mechanism cannot account for repression by zinc of all mammalian genes that show this mode of regulation, indicating the existence of as yet uncharacterized mechanisms of zinc-regulated transcription in mammalian cells. In addition, recent findings reveal a role for effects of zinc on mRNA stability in the regulation of specific zinc transporters. Our studies on the regulation of the human gene SLC30A5 (solute carrier 30A5), which codes for the zinc transporter ZnT5, have revealed that this gene provides a model system by which to study both zinc-induced transcriptional down-regulation and zinc-regulated mRNA stabilization.

  17. Androgen and prostatic stroma

    Institute of Scientific and Technical Information of China (English)

    Yuan-JieNIU; Teng-XiangMA; IuZHANG; YongXU; Rui-FaHAN; GuangSUN

    2003-01-01

    90,The expression of ER remained unchanged in the whole course.The prostatic stromal cells,including SMCs and fibroblasts,diminished and underwent serial pathological changes of atrophy and apoptosis after castration.The atrophic cells were filled with huge intracellular lipofuscin.The expression of SMC myosin declined after castration,coincident with the increase in TGFβ mRNA level and decline in bFGF mRNA level.In vitro,DHT caused a weak increase in the proliferation and expression of SMC-specific proteins(P<0.05).However,DHT and bFGF together stimulated the proliferation of stromal cells significantly more than either agent alone(P<0.01).The combination of DHT and TGFβgreatly enhanced the expression of SMC-specific proteins(P<0.01)more strongly than either alone(P<0.01.Conclusions:The whole prostate gland is an androgen-sensitive organ with both the epithelium and stroma under the control of androgen.Androgen may direct the proliferation,differentiation and regression of stromal cells by regulating the expression of TGFβ,bFGF ,AR and smooth muscle cell specific proteins.

  18. The CAG repeat polymorphism in the androgen receptor gene (AR) and its relationship to head and neck cancer.

    Science.gov (United States)

    dos Santos, M L; Sibov, T T; Nishimoto, I N; Kowalski, L P; Miracca, E C; Nagai, M A

    2004-02-01

    Sex hormones may play an important role in the tumorigenic process of the head and neck. The aim of our work was to investigate whether the androgen receptor (AR) CAG repeat polymorphism is associated with an increased relative risk for head and neck cancer. Genomic DNA from 103 male patients with head and neck carcinomas and 100 male controls were analyzed for the AR CAG polymorphism by PCR amplification and direct sequencing or denaturing polyacrilamide gel electrophoresis. Logistic regression analysis showed a significant association between CAG repeat length and risk of head and neck cancer in individuals with more than 20 CAG repeats [OR=2.54 (95% CI, 1.3-4.8)]. For the group of individuals with oral and laryngeal cancer the estimated relative risk was increased to 2.79 (95% CI, 1.2-6.3) and 3.06 (95% CI, 1.0-9.6), respectively, in men with CAG repeat length >20. These results suggest, for the first time, that shorter AR CAG repeat alleles have a protective effect for head and neck cancer development.

  19. Regulated genes in mesenchymal stem cells and gastriccancer

    Institute of Scientific and Technical Information of China (English)

    Shihori Tanabe; Kazuhiko Aoyagi; Hiroshi Yokozaki; Hiroki Sasaki

    2015-01-01

    AIM To investigate the genes regulated in mesenchymalstem cells (MSCs) and diffuse-type gastric cancer (GC),gene expression was analyzed.METHODS: Gene expression of MSCs and diffuse-typeGC cells were analyzed by microarray. Genes relatedto stem cells, cancer and the epithelial-mesenchymaltransition (EMT) were extracted from human genelists using Gene Ontology and reference information.Gene panels were generated, and messenger RNAgene expression in MSCs and diffuse-type GC cells wasanalyzed. Cluster analysis was performed using the NCSSsoftware.RESULTS: The gene expression of regulator of G-proteinsignaling 1 (RGS1) was up-regulated in diffuse-type GCcells compared with MSCs. A panel of stem-cell relatedgenes and genes involved in cancer or the EMT wereexamined. Stem-cell related genes, such as growtharrest-specific 6, musashi RNA-binding protein 2 andhairy and enhancer of split 1 (Drosophila), NOTCHfamily genes and Notch ligands, such as delta-like 1(Drosophila) and Jagged 2, were regulated.CONCLUSION: Expression of RGS1 is up-regulated,and genes related to stem cells and NOTCH signalingare altered in diffuse-type GC compared with MSCs.

  20. Androgens and skeletal muscle: cellular and molecular action mechanisms underlying the anabolic actions.

    Science.gov (United States)

    Dubois, Vanessa; Laurent, Michaël; Boonen, Steven; Vanderschueren, Dirk; Claessens, Frank

    2012-05-01

    Androgens increase both the size and strength of skeletal muscle via diverse mechanisms. The aim of this review is to discuss the different cellular targets of androgens in skeletal muscle as well as the respective androgen actions in these cells leading to changes in proliferation, myogenic differentiation, and protein metabolism. Androgens bind and activate a specific nuclear receptor which will directly affect the transcription of target genes. These genes encode muscle-specific transcription factors, enzymes, structural proteins, as well as microRNAs. In addition, anabolic action of androgens is partly established through crosstalk with other signaling molecules such as Akt, myostatin, IGF-I, and Notch. Finally, androgens may also exert non-genomic effects in muscle by increasing Ca(2+) uptake and modulating kinase activities. In conclusion, the anabolic effect of androgens on skeletal muscle is not only explained by activation of the myocyte androgen receptor but is also the combined result of many genomic and non-genomic actions.

  1. Regulation of male fertility by X-linked genes.

    Science.gov (United States)

    Zheng, Ke; Yang, Fang; Wang, Peijing Jeremy

    2010-01-01

    Infertility is a worldwide reproductive health problem, affecting men and women about equally. Mouse genetic studies demonstrate that more than 200 genes specifically or predominantly regulate fertility. However, few genetic causes of infertility in humans have been identified. Here, we focus on the regulation of male fertility by X-linked, germ cell-specific genes. Previous genomic studies reveal that the mammalian X chromosome is enriched for genes expressed in early spermatogenesis. Recent genetic studies in mice show that X-linked, germ cell-specific genes, such as A-kinase anchor protein 4 (Akap4), nuclear RNA export factor 2 (Nxf2), TBP-associated factor 7l (Taf7l), and testis-expressed gene 11 (Tex11), indeed play important roles in the regulation of male fertility. Moreover, we find that the Taf7l Tex11 double-mutant males exhibit much more severe defects in meiosis than either single mutant, suggesting that these 2 X-linked genes regulate male meiosis synergistically. The X-linked, germ cell-specific genes are particularly attractive in the study of male infertility in humans. Because males are hemizygous for X-linked genes, loss-of-function mutations in the single-copy X-linked genes, unlike in autosomal genes, would not be masked by a normal allele. The genetic studies of X-linked, germ cell-specific genes in mice have laid a foundation for mutational analysis of their human orthologues in infertile men.

  2. Identification of an AR mutation-negative class of androgen insensitivity by determining endogenous AR activity

    NARCIS (Netherlands)

    Hornig, N.C.; Ukat, M.; H.U. Schweikert (H.); O. Hiort (Olaf); Werner, R.; S.L.S. Drop (Stenvert); M.L. Cools (Martine); I.A. Hughes (Ieuan A.); L. Audí (Laura); S.F. Ahmed (S. Faisal); Demiri, J.; Rodens, P.; Worch, L.; Wehner, G.; Kulle, A.E.; Dunstheimer, D.; Müller-Roßberg, E.; T. Reinehr (Thomas); Hadidi, A.T.; Eckstein, A.K.; Van Der Horst, C.; Seif, C.; R. Siebert (Reiner); O. Ammerpohl (Ole); P-M. Holterhus (Paul-Martin)

    2016-01-01

    textabstractContext: Only approximately 85%of patients with a clinical diagnosis complete androgen insensitivity syndrome and less than 30%with partial androgen insensitivity syndrome can be explained by inactivating mutations in the androgen receptor (AR) gene. Objective: The objective of the study

  3. Contribution of allelic variability in prostate specific antigen (PSA & androgen receptor (AR genes to serum PSA levels in men with prostate cancer

    Directory of Open Access Journals (Sweden)

    Sushant V Chavan

    2014-01-01

    Full Text Available Background & objectives: Wide variability in serum prostate specific antigen (PSA levels exists in malignant conditions of the prostate. PSA is expressed in normal range in 20 to 25 per cent of prostate cancer cases even in presence of high grade Gleason score. This study was aimed to assess the influence of genetic variants exhibited by PSA and androgen receptor (AR genes towards the variable expression of PSA in prostate cancer. Methods: Pre-treatment serum PSA levels from 101 prostate cancer cases were retrieved from medical record. PSA genotype analysis in promoter region and AR gene microsatellite Cytosine/Adenine/Guanine (CAG repeat analysis in exon 1 region was performed using DNA sequencing and fragment analysis techniques. Results: A total of seven single nucleotide polymorphisms (SNPs in the PSA promoter region were noted. Only two SNPs viz., 158G/A (P<0.001 in the proximal promoter region and -3845G/A (P<0.001 in enhancer region showed significant association with serum PSA levels. The carriers of homozygous GG genotype (P<0.001 at both of these polymorphic sites showed higher expression of PSA whereas homozygous AA genotype (P<0.001 carriers demonstrated lower PSA levels. The combination effect of PSA genotypes along with stratified AR CAG repeats lengths (long, intermediate and short was also studied. The homozygous GG genotype along with AR long CAG repeats and homozygous AA genotype along with AR short CAG repeats at position -3845 and -158 showed strong interaction and thus influenced serum PSA levels. Interpretation & conclusions: The genetic variants exhibited by PSA gene at positions -3845G/A and -158G/A may be accountable towards wide variability of serum PSA levels in prostate cancer. Also the preferential binding of G and A alleles at these polymorphic sites along with AR long and short CAG repeats may contribute towards PSA expression.

  4. Federal Regulation of Gene Therapy: Who Will Save our Germline?

    OpenAIRE

    2003-01-01

    This paper will attempt to address some of these more complex issues involving human gene therapy and the encompassing regulations. The first section will deal with the science of gene therapy and will briefly touch upon the scientific hurdles that remain for scientists in this field, as this is important to understanding many of the ethical issues. This section will be divided into a basic genetic overview, a description of somatic gene therapy, and a summary of germline gene therapy. The se...

  5. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Allen, R.C.; Zoghbi, H.Y.; Moseley, A.B.; Rosenblatt, H.M.; Belmont, J.W. (Baylor College of Medicine, Houston (United States))

    1992-12-01

    The human androgen-receptor gene (HUMARA; GenBank) contains a highly polymorphic trinucleotide repeat in the first exon. The authors have found that the methylation of HpaII and HhaI sites less than 100 pb away from this polymorphic short tandem repeat (STR) correlates with X inactivation. The close proximity of the restriction-enzyme sites to the STR allows the development of a PCR assay that distinguishes between the maternal and paternal alleles and identifies their methylation status. The accuracy of this assay was tested on (a) DNA from hamster/human hybrid cell lines containing either an active or inactive human X chromosome; (b) DNA from normal males and females; and (c) DNA from females showing nonrandom patterns of X inactivation. Data obtained using this assay correlated substantially with those obtained using the PGK, HPRT, and M27[beta] probes, which detect X inactivation patterns by Southern blot analysis. In order to demonstrate one application of this assay, the authors examined X inactivation patterns in the B lymphocytes of potential and obligate carriers of X-linked agammaglobulinemia. 42 refs., 5 figs., 1 tab.

  6. [Tissue variability of androgen receptor gene in bulbospinal muscular atrophy--comparison of the number of CAG repeats between muscles and peripheral blood leukocytes].

    Science.gov (United States)

    Nakajima, H; Kimura, F; Shinoda, K; Ohsawa, N; Nakagawa, T; Shimizu, A

    1993-10-01

    We investigated an expansion of CAG repeats in exon 1 of androgen receptor gene in skeletal muscle tissue obtained from the patients with various neuro-muscular disorders (5 BSMA, 33 patients with amyotrophic lateral sclerosis, 3 patients with spinal progressive muscular atrophy and 2 patients with hereditary motor sensory neuropathy), by polymerase chain reaction (PCR) amplification according to LaSpadas' description. These muscle tissues had been stored at -70 degrees C freezer during 7 years. We also studied the tissue variation of CAG repeats size between muscles and peripheral blood leukocytes in 4 patients with BSMA. And we confirmed the increased number of CAG repeats in all 5 BSMA except for other patients with neurogenic muscular atrophy. In the 4 BSMA patients, we subcloned the PCR products from muscles tissues and peripheral blood leukocytes, and we determined the number of CAG repeats by sequencing. The repeats of them were 43-51, and all BSMA patients showed the same number of CAG repeats in muscles tissues and peripheral blood leukocytes. The CAG repeats fragment of BSMA may be stable region in frozen storage state for 7 years, and we didn't recognized the somatic variation at least between muscles tissues and peripheral blood leukocytes.

  7. Potentially harmful advantage to athletes: a putative connection between UGT2B17 gene deletion polymorphism and renal disorders with prolonged use of anabolic androgenic steroids

    Directory of Open Access Journals (Sweden)

    Barker James

    2010-04-01

    Full Text Available Abstract Background and objective With prolonged use of anabolic androgenic steroids (AAS, occasional incidents of renal disorders have been observed. Independently, it has also been established that there are considerable inter-individual and inter-ethnic differences, in particular with reference to the uridine diphosphate-glucuronosyltransferase 2B17 (UGT2B17 gene, in metabolising these compounds. This report postulates the association of deletion polymorphism in the UGT2B17 gene with the occurrence of renal disorders on chronic exposure to AAS. Presentation of the hypothesis The major deactivation and elimination pathway of AASs is through glucuronide conjugation, chiefly catalyzed by the UGT2B17 enzyme, followed by excretion in urine. Excretion of steroids is affected in individuals with a deletion mutation in the UGT2B17 gene. We hypothesize that UGT2B17 deficient individuals are more vulnerable to developing renal disorders with prolonged use of AAS owing to increases in body mass index and possible direct toxic effects of steroids on the kidneys. Elevated serum levels of biologically active steroids due to inadequate elimination can lead to prolonged muscle build up. An increase in body mass index may cause renal injuries due to sustained elevated glomerular pressure and flow rate. Testing the hypothesis In the absence of controlled clinical trials in humans, observational studies can be carried out. Real time PCR with allelic discrimination should be employed to examine the prevalence of different UGT2B17 genotypes in patients with impaired renal function and AAS abuse. In individuals with the UGT2B17 deletion polymorphism, blood tests, biofluid analyses, urinalysis, and hair analyses following the administration of an anabolic steroid can be used to determine the fate of the substance once in the body. Implications of the hypothesis If the hypothesis is upheld, anabolic steroid users with a deletion mutation in the UGT2B17 gene may be

  8. Specific changes in the expression of imprinted genes in prostate cancer-implications for cancer progression and epigenetic regulation

    Institute of Scientific and Technical Information of China (English)

    Teodora Ribarska; Klaus-Marius Bastian; Annemarie Koch; Wolfgang A Schulz

    2012-01-01

    Epigenetic dysregulation comprising DNA hypermethylation and hypomethylation,enhancer of zeste homologue 2 (EZH2)overexpression and altered patterns of histone modifications is associated with the progression of prostate cancer.DNA methylation,EZH2 and histone modifications also ensure the parental-specific monoallelic expression of at least 62 imprinted genes.Although it is therefore tempting to speculate that epigenetic dysregulation may extend to imprinted genes,expression changes in cancerous prostates are only well documented for insulin-like growth factor 2 (IGF2).A literature and database survey on imprinted genes in prostate cancer suggests that the expression of most imprinted genes remains unchanged despite global disturbances in epigenetic mechanisms.Instead,selective genetic and epigenetic changes appear to lead to the inactivation of a sub-network of imprinted genes,which might function in the prostate to limit cell growth induced viathe PI3K/Akt pathway,modulate androgen responses and regulate differentiation.Whereas dysregulation of IG F2 may constitute an early change in prostate carcinogenesis,inactivation of this imprinted gene network is rather associated with cancer progression.

  9. Classifying chemical mode of action using gene networks and machine learning: a case study with the herbicide linuron.

    Science.gov (United States)

    Ornostay, Anna; Cowie, Andrew M; Hindle, Matthew; Baker, Christopher J O; Martyniuk, Christopher J

    2013-12-01

    The herbicide linuron (LIN) is an endocrine disruptor with an anti-androgenic mode of action. The objectives of this study were to (1) improve knowledge of androgen and anti-androgen signaling in the teleostean ovary and to (2) assess the ability of gene networks and machine learning to classify LIN as an anti-androgen using transcriptomic data. Ovarian explants from vitellogenic fathead minnows (FHMs) were exposed to three concentrations of either 5α-dihydrotestosterone (DHT), flutamide (FLUT), or LIN for 12h. Ovaries exposed to DHT showed a significant increase in 17β-estradiol (E2) production while FLUT and LIN had no effect on E2. To improve understanding of androgen receptor signaling in the ovary, a reciprocal gene expression network was constructed for DHT and FLUT using pathway analysis and these data suggested that steroid metabolism, translation, and DNA replication are processes regulated through AR signaling in the ovary. Sub-network enrichment analysis revealed that FLUT and LIN shared more regulated gene networks in common compared to DHT. Using transcriptomic datasets from different fish species, machine learning algorithms classified LIN successfully with other anti-androgens. This study advances knowledge regarding molecular signaling cascades in the ovary that are responsive to androgens and anti-androgens and provides proof of concept that gene network analysis and machine learning can classify priority chemicals using experimental transcriptomic data collected from different fish species.

  10. Androgens and the breast.

    Science.gov (United States)

    Dimitrakakis, Constantine; Bondy, Carolyn

    2009-01-01

    Androgens have important physiological effects in women while at the same time they may be implicated in breast cancer pathologies. However, data on the effects of androgens on mammary epithelial proliferation and/or breast cancer incidence are not in full agreement. We performed a literature review evaluating current clinical, genetic and epidemiological data regarding the role of androgens in mammary growth and neoplasia. Epidemiological studies appear to have significant methodological limitations and thus provide inconclusive results. The study of molecular defects involving androgenic pathways in breast cancer is still in its infancy. Clinical and nonhuman primate studies suggest that androgens inhibit mammary epithelial proliferation and breast growth while conventional estrogen treatment suppresses endogenous androgens. Abundant clinical evidence suggests that androgens normally inhibit mammary epithelial proliferation and breast growth. Suppression of androgens using conventional estrogen treatment may thus enhance estrogenic breast stimulation and possibly breast cancer risk. Addition of testosterone to the usual hormone therapy regimen may diminish the estrogen/progestin increase in breast cancer risk but the impact of this combined use on mammary gland homeostasis still needs evaluation.

  11. Androgen receptor abnormalities

    NARCIS (Netherlands)

    A.O. Brinkmann (Albert); G.G.J.M. Kuiper (George); C. Ris-Stalpers (Carolyn); H.C.J. van Rooij (Henri); G. Romalo (G.); G. Trifiro (Gianluca); E. Mulder (Eppo); L. Pinsky (L.); H.U. Schweikert (H.); J. Trapman (Jan)

    1991-01-01

    markdownabstract__Abstract__ The human androgen receptor is a member of the superfamily of steroid hormone receptors. Proper functioning of this protein is a prerequisite for normal male sexual differentiation and development. The cloning of the human androgen receptor cDNA and the elucidation of t

  12. Prediction of epigenetically regulated genes in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  13. Prediction of epigenetically regulated genes in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Lu Yontao

    2010-06-01

    Full Text Available Abstract Background Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP. The pipeline (i reduces the dimensionality of the methylation data, (ii associates the reduced methylation data with gene expression data, and (iii ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i methylation sites are grouped across the genome to identify regions of interest, and (ii methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Results Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between

  14. Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

    Directory of Open Access Journals (Sweden)

    Takahashi Takashi

    2007-04-01

    Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

  15. Hydrogen sulfide represses androgen receptor transactivation by targeting at the second zinc finger module.

    Science.gov (United States)

    Zhao, Kexin; Li, Shuangshuang; Wu, Lingyun; Lai, Christopher; Yang, Guangdong

    2014-07-25

    Androgen receptor (AR) signaling is indispensable for the development of prostate cancer from the initial androgen-dependent state to a later aggressive androgen-resistant state. This study examined the role of hydrogen sulfide (H(2)S), a novel gasotransmitter, in the regulation of AR signaling as well as its mediation in androgen-independent cell growth in prostate cancer cells. Here we found that H(2)S inhibits cell proliferation of both androgen-dependent (LNCaP) and antiandrogen-resistant prostate cancer cells (LNCaP-B), with more significance on the latter, which was established by long term treatment of parental LNCaP cells with bicalutamide. The expression of cystathionine γ-lyase (CSE), a major H(2)S producing enzyme in prostate tissue, was reduced in both human prostate cancer tissues and LNCaP-B cells. LNCaP-B cells were resistant to bicalutamide-induced cell growth inhibition, and CSE overexpression could rebuild the sensitivity of LNCaP-B cells to bicalutamide. H(2)S significantly repressed the expression of prostate-specific antigen (PSA) and TMPRSS2, two AR-targeted genes. In addition, H(2)S inhibited AR binding with PSA promoter and androgen-responsive element (ARE) luciferase activity. We further found that AR is post-translationally modified by H(2)S through S-sulfhydration. Mutation of cysteine 611 and cysteine 614 in the second zinc finger module of AR-DNA binding domain diminished the effects of H(2)S on AR S-sulfhydration and AR dimerization. These data suggest that reduced CSE/H2S signaling contributes to antiandrogen-resistant status, and sufficient level of H(2)S is able to inhibit AR transactivation and treat castration-resistant prostate cancer.

  16. Transcriptionally regulated, prostate-targeted gene therapy for prostate cancer.

    Science.gov (United States)

    Lu, Yi

    2009-07-02

    Prostate cancer is the most frequently diagnosed cancer and the second leading cause of cancer deaths in American males today. Novel and effective treatment such as gene therapy is greatly desired. The early viral based gene therapy uses tissue-nonspecific promoters, which causes unintended toxicity to other normal tissues. In this chapter, we will review the transcriptionally regulated gene therapy strategy for prostate cancer treatment. We will describe the development of transcriptionally regulated prostate cancer gene therapy in the following areas: (1) Comparison of different routes for best viral delivery to the prostate; (2) Study of transcriptionally regulated, prostate-targeted viral vectors: specificity and activity of the transgene under several different prostate-specific promoters were compared in vitro and in vivo; (3) Selection of therapeutic transgenes and strategies for prostate cancer gene therapy (4) Oncolytic virotherapy for prostate cancer. In addition, the current challenges and future directions in this field are also discussed.

  17. Tissue Specific and Hormonal Regulation of Gene Expression

    Science.gov (United States)

    1998-07-01

    cAMP responsive region located at -200 to -99 bp in CRH. 14. SUBJECT TERMS 15. NUMfER OF PAGES Breast Cancer gene regulation, transcription, placenta...known mediators of labor, and it may also the stress response. The peptide sequence and expression of potentiate the effect of oxytocin on uterine...regulation of other rodent trophoblast genes has 220 not yet been investigated. 2. Robinson BG, Arbiser JL, Emanuel RL, Majzoub JA 1989 Species- 3008

  18. De-regulation of common housekeeping genes in hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Wurmbach Elisa

    2007-07-01

    Full Text Available Abstract Background Tumorigenesis is associated with changes in gene expression and involves many pathways. Dysregulated genes include "housekeeping" genes that are often used for normalization for quantitative real-time RT-PCR (qPCR, which may lead to unreliable results. This study assessed eight stages of hepatitis C virus (HCV induced hepatocellular carcinoma (HCC to search for appropriate genes for normalization. Results Gene expression profiles using microarrays revealed differential expression of most "housekeeping" genes during the course of HCV-HCC, including glyceraldehyde-3-phosphate dehydrogenase (GAPDH and beta-actin (ACTB, genes frequently used for normalization. QPCR reactions confirmed the regulation of these genes. Using them for normalization had strong effects on the extent of differential expressed genes, leading to misinterpretation of the results. Conclusion As shown here in the case of HCV-induced HCC, the most constantly expressed gene is the arginine/serine-rich splicing factor 4 (SFRS4. The utilization of at least two genes for normalization is robust and advantageous, because they can compensate for slight differences of their expression when not co-regulated. The combination of ribosomal protein large 41 (RPL41 and SFRS4 used for normalization led to very similar results as SFRS4 alone and is a very good choice for reference in this disease as shown on four differentially expressed genes.

  19. Androgen circle of polycystic ovary syndrome.

    Science.gov (United States)

    Homburg, Roy

    2009-07-01

    Although the aetiology of polycystic ovary syndrome (PCOS) is still not known and the search for causative genes is proving elusive, it is generally agreed that hyperandrogenism is at the heart of the syndrome. Here, it is proposed that excess androgens are the root cause of PCOS starting from their influence on the female fetus in programming gene expression, producing the characteristic signs and symptoms which are then exacerbated by a propagation of excess ovarian androgen production from multiple small follicles, anovulation and insulin resistance in the reproductive life-span, thus setting up a vicious perpetual circle of androgen excess. This opinion paper, rather than being a full-scale review, is intentionally biased in support of this hypothesis that androgen excess is the 'root of all evil' in PCOS; in the hope that its acceptance could lead to more direct treatment of the syndrome in all its facets rather than the symptomatic treatment of side effects of androgen excess that we are addressing today.

  20. Gene regulation by mRNA editing

    Energy Technology Data Exchange (ETDEWEB)

    Ashkenas, J. [Univ. of Washington, Seattle, WA (United States)

    1997-02-01

    The commonly cited figure of 10{sup 5} genes in the human genome represents a tremendous underestimate of our capacity to generate distinct gene products with unique functions. Our cells possess an impressive collection of tools for altering the products of a single gene to create a variety of proteins. The different gene products may have related but distinct functions, allowing cells of different types or at different developmental stages to fine-tune their patterns of gene expression. These tools may act in the cytoplasm, as when proteins undergo post-translational modifications, or in the nucleus, in the processing of pre-mRNA. Two forms of intranuclear fine-tuning are well established and widely studied: alternative splicing of pre-mRNAs and alternative polyadenylation site selection. In recent years it has become clear that cells possess yet another tool to create RNA sequence diversity, mRNA editing. The term {open_quotes}editing{close_quotes} is applied to posttranscriptional modifications of a purine or pyrimidine, which alter an mRNA sequence as it is read, for example, by ribosomes. Covalent changes to the structure of nucleotide bases are well known to occur on tRNA and rRNA molecules, but such changes in mRNA sequence are novel in that they have the capacity to change specific protein sequences. 43 refs., 1 fig.

  1. Androgen receptor gene CAG repeat length as modifier of the association between Persistent Organohalogen Pollutant exposure markers and semen characteristics

    DEFF Research Database (Denmark)

    Giwercman, Aleksander; Rylander, Lars; Rignell-Hydbom, Anna;

    2007-01-01

    OBJECTIVES: Exposure to persistent organohalogen pollutants was suggested to impair male reproductive function. A gene-environment interaction has been proposed. No genes modifying the effect of persistent organohalogen pollutants on reproductive organs have yet been identified. We aimed...... and morphology) and DNA fragmentation index (DFI) were determined. CAG and GGN repeat lengths were determined by direct sequencing of leukocyte DNA. RESULTS: A statistically significant interaction was found between the CB-153 group and CAG repeat category in relation to sperm concentration and total sperm count...

  2. PRK1/PKN1 controls migration and metastasis of androgen-independent prostate cancer cells.

    Science.gov (United States)

    Jilg, Cordula A; Ketscher, Anett; Metzger, Eric; Hummel, Barbara; Willmann, Dominica; Rüsseler, Vanessa; Drendel, Vanessa; Imhof, Axel; Jung, Manfred; Franz, Henriette; Hölz, Stefanie; Krönig, Malte; Müller, Judith M; Schüle, Roland

    2014-12-30

    The major threat in prostate cancer is the occurrence of metastases in androgen-independent tumor stage, for which no causative cure is available. Here we show that metastatic behavior of androgen-independent prostate tumor cells requires the protein-kinase-C-related kinase (PRK1/PKN1) in vitro and in vivo. PRK1 regulates cell migration and gene expression through its kinase activity, but does not affect cell proliferation. Transcriptome and interactome analyses uncover that PRK1 regulates expression of migration-relevant genes by interacting with the scaffold protein sperm-associated antigen 9 (SPAG9/JIP4). SPAG9 and PRK1 colocalize in human cancer tissue and are required for p38-phosphorylation and cell migration. Accordingly, depletion of either ETS domain-containing protein Elk-1 (ELK1), an effector of p38-signalling or p38 depletion hinders cell migration and changes expression of migration-relevant genes as observed upon PRK1-depletion. Importantly, a PRK1 inhibitor prevents metastases in mice, showing that the PRK1-pathway is a promising target to hamper prostate cancer metastases in vivo. Here we describe a novel mechanism controlling the metastatic behavior of PCa cells and identify PRK1 as a promising therapeutic target to treat androgen-independent metastatic prostate cancer.

  3. Gene regulation: hacking the network on a sugar high.

    Science.gov (United States)

    Ellis, Tom; Wang, Xiao; Collins, James J

    2008-04-11

    In a recent issue of Molecular Cell, Kaplan et al. (2008) determine the input functions for 19 E. coli sugar-utilization genes by using a two-dimensional high-throughput approach. The resulting input-function map reveals that gene network regulation follows non-Boolean, and often nonmonotonic, logic.

  4. Pharmacogenomics genes show varying perceptibility to microRNA regulation

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Vinther, Jeppe; Shomron, Noam

    2011-01-01

    The aim of pharmacogenomics is to identify individual differences in genome and transcriptome composition and their effect on drug efficacy. MicroRNAs (miRNAs) are short noncoding RNAs that negatively regulate expression of the majority of animal genes, including many genes involved in drug...

  5. 完全型雄激素不敏感综合征雄激素受体基因突变的鉴定与分析%Identification of a novel frameshift mutation of human androgen receptor gene in a patient featuring complete androgen insensitivity syndrome

    Institute of Scientific and Technical Information of China (English)

    谢建红; 瞿京辉; 肖奇志; 周玉球

    2013-01-01

    目的 对l例完全型雄激素不敏感综合征(complete androgen insensitivity syndrome,CAIS)患者的雄激素受体(androgen receptor,AR)基因进行分析,寻找潜在的突变位点,并进一步分析其发病原因.方法 提取患者外周血全基因组DNA,扩增位于X染色体AR基因8个外显子及邻近外显子与内含子剪切位点DNA序列,对扩增产物直接进行DNA序列测定,与GenBank中的基因序列进行比对.结果 该患者AR基因在第6外显子核苷酸序列3507位点缺失一个碱基C而引起移码突变,致使在第808位密码子出现终止密码子(TGA)使得翻译提前终止形成截短的雄激素受体蛋白.该突变可能诱导雄激素受体结合能力发生功能上的变异,导致CAIS的发生.结论 AR基因第6外显子核苷酸序列3507位点缺失碱基C引起的移码突变是一种导致CAIS新的基因突变方式,该研究丰富了AR基因突变谱,为了解CAIS的发病机制提供了新的依据.%Objective To identify potential mutation of human androgen receptor (AR) gene in a patient with complete androgen insensitivity syndrome (CAIS).Methods DNA sequences of 8 exons and exon/intron boundaries of the AR gene were amplified with PCR and directly sequenced.Results DNA sequencing revealed a frameshift mutation due to deletion of nucleotide C at position 3507 in exon 6,which gave rise to a stop codon resulting premature termination for translation.Conclusion A novel frameshift mutation in exon 6 of AR gene probably underlies the disease in our patient.

  6. Regulation of human protein S gene (PROS1) transcription

    NARCIS (Netherlands)

    Wolf, Cornelia de

    2006-01-01

    This thesis describes the investigation of the transcriptional regulation of the gene for anticoagulant plasma Protein S, PROS1. Protein S is a cofactor for Protein C in the Protein C anticoagulant pathway. The coagulation cascade is negatively regulated by this pathway through inactivation of activ

  7. IGF-Regulated Genes in Prostate Cancer

    Science.gov (United States)

    2006-02-01

    Burgess, A.W., and Ward, C.W. (2002) Cell 110(6), 763-773 53. Sambrook, J., Maniatis , T., and Fritsch, E.F. (1989) Molecular cloning : a laboratory...triplicate arrays that each contain >12,000 sequence-verified, non-redundant human cDNA clones . Data were analyzed by accepted means of normalization...this award. Review of the field-published in Genes, Chromosomes, and Cancer 36: 113-120 (2003) The IGFI Receptor Gene: A Molecular Target for

  8. Does the Androgen Receptor (AR)-Regulated Map Kinase Phosphatase 1 (MKP-1) Enhance Castration-Resistant Prostate Cancer Survival under Therapeutic Stress?

    Science.gov (United States)

    2016-03-01

    modulators. Identification of a mediator of resistance across therapy classes is a critically unmet need and would be a significant innovation in...prostate cancer (mCRPC) is clinically treated with both taxane chemotherapy and androgen pathway modulators. Identification of a mediator of resistance

  9. Selective androgen receptor modulator RAD140 is neuroprotective in cultured neurons and kainate-lesioned male rats.

    Science.gov (United States)

    Jayaraman, Anusha; Christensen, Amy; Moser, V Alexandra; Vest, Rebekah S; Miller, Chris P; Hattersley, Gary; Pike, Christian J

    2014-04-01

    The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed "selective androgen receptor modulators" (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in select androgen-responsive tissues. The efficacy of SARMs in brain is largely unknown. In this study, we investigate the SARM RAD140 in cultured rat neurons and male rat brain for its ability to provide neuroprotection, an important neural action of endogenous androgens that is relevant to neural health and resilience to neurodegenerative diseases. In cultured hippocampal neurons, RAD140 was as effective as testosterone in reducing cell death induced by apoptotic insults. Mechanistically, RAD140 neuroprotection was dependent upon MAPK signaling, as evidenced by elevation of ERK phosphorylation and inhibition of protection by the MAPK kinase inhibitor U0126. Importantly, RAD140 was also neuroprotective in vivo using the rat kainate lesion model. In experiments with gonadectomized, adult male rats, RAD140 was shown to exhibit peripheral tissue-specific androgen action that largely spared prostate, neural efficacy as demonstrated by activation of androgenic gene regulation effects, and neuroprotection of hippocampal neurons against cell death caused by systemic administration of the excitotoxin kainate. These novel findings demonstrate initial preclinical efficacy of a SARM in neuroprotective actions relevant to Alzheimer's disease and related neurodegenerative diseases.

  10. Differential regulation of LncRNA-SARCC suppresses VHL-mutant RCC cell proliferation yet promotes VHL-normal RCC cell proliferation via modulating androgen receptor/HIF-2α/C-MYC axis under hypoxia.

    Science.gov (United States)

    Zhai, W; Sun, Y; Jiang, M; Wang, M; Gasiewicz, T A; Zheng, J; Chang, C

    2016-09-15

    It is well established that hypoxia contributes to tumor progression in a hypoxia inducible factor-2α (HIF-2α)-dependent manner in renal cell carcinoma (RCC), yet the role of long noncoding RNAs (LncRNAs) involved in hypoxia-mediated RCC progression remains unclear. Here we demonstrate that LncRNA-SARCC (Suppressing Androgen Receptor in Renal Cell Carcinoma) is differentially regulated by hypoxia in a von Hippel-Lindau (VHL)-dependent manner both in RCC cell culture and clinical specimens. LncRNA-SARCC can suppress hypoxic cell cycle progression in the VHL-mutant RCC cells while derepress it in the VHL-restored RCC cells. Mechanism dissection reveals that LncRNA-SARCC can post-transcriptionally regulate androgen receptor (AR) by physically binding and destablizing AR protein to suppress AR/HIF-2α/C-MYC signals. In return, HIF-2α can transcriptionally regulate the LncRNA-SARCC expression via binding to hypoxia-responsive elements on the promoter of LncRNA-SARCC. The negative feedback modulation between LncRNA-SARCC/AR complex and HIF-2α signaling may then lead to differentially modulated RCC progression in a VHL-dependent manner. Together, these results may provide us a new therapeutic approach via targeting this newly identified signal from LncRNA-SARCC to AR-mediated HIF-2α/C-MYC signals against RCC progression.

  11. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  12. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    OpenAIRE

    M. Ananda Chitra; Jayanthy, C.; Nagarajan, B.

    2015-01-01

    Background: Staphylococcus pseudintermedius (SP) is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr) locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objecti...

  13. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  14. Cost benefit theory and optimal design of gene regulation functions

    Science.gov (United States)

    Kalisky, Tomer; Dekel, Erez; Alon, Uri

    2007-12-01

    Cells respond to the environment by regulating the expression of genes according to environmental signals. The relation between the input signal level and the expression of the gene is called the gene regulation function. It is of interest to understand the shape of a gene regulation function in terms of the environment in which it has evolved and the basic constraints of biological systems. Here we address this by presenting a cost-benefit theory for gene regulation functions that takes into account temporally varying inputs in the environment and stochastic noise in the biological components. We apply this theory to the well-studied lac operon of E. coli. The present theory explains the shape of this regulation function in terms of temporal variation of the input signals, and of minimizing the deleterious effect of cell-cell variability in regulatory protein levels. We also apply the theory to understand the evolutionary tradeoffs in setting the number of regulatory proteins and for selection of feed-forward loops in genetic circuits. The present cost-benefit theory can be used to understand the shape of other gene regulatory functions in terms of environment and noise constraints.

  15. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  16. Increased risk of breast cancer in women bearing a combination of large CAG and GGN repeats in the exon 1 of the androgen receptor gene.

    Science.gov (United States)

    González, Ana; Javier Dorta, F; Rodriguez, Germán; Brito, Buenaventura; Rodríguez, M A Del Cristo; Cabrera, Antonio; Díaz-Chico, Juan C; Reyes, Ricardo; Aguirre-Jaime, Armando; Nicolás Díaz-Chico, B

    2007-11-01

    The exon 1 of the human androgen receptor gene (AR) contains both CAG (polyglutamine) and GGN (polyglycine) repeat length polymorphisms. Large CAG repeats have been related to an increased risk of breast cancer (BC), whereas the influence of the GGN repeats is still unclear. Here, we have studied how the length of CAG and GGN repeats is associated with the risk of BC in a population from Tenerife (Canary Islands, Spain). The study was carried out on 257 woman diagnosed with BC and 393 controls, nesting in the 'CDC of the Canary Islands' cohort study. The AR CAG and GGN genotyping was performed by means of PCR amplification with specific fluorescently labelled primers followed by a capillary electrophoresis. The allelic distribution of CAG and GGN polymorphisms was similar in cases and controls. The mean of short and long CAG and GGN alleles did not show differences between cases and controls and the same was true when the average length of both CAG alleles (CAG(n)) and GGN alleles (GGN(n)) was considered. However, when CAG(n) and GGN(n) were categorised using 22 and 24 repeats as the cut-off point, respectively, significant differences between cases and controls were observed. The CAG(n)>22 repeats were more frequent in cases than in controls, being associated with an increased risk of BC (OR=1.49; CI(95%)=1.06-2.09; p=0.021). No significant differences were found for categorised GGN(n). For CAG(n)/GGN(n) combinations, the highest BC risk was found to be associated with the CAG(n)>22/GGN(n)24 combination (OR=2.47; CI(95%)=1.37-4.46; p=0.003). In conclusion, our results indicate that longer CAG(n)/GGN(n) combinations increase the risk of BC and suggest that CAG and GGN AR polymorphisms should be considered in order to assess the BC risk.

  17. Transcription dynamics of inducible genes modulated by negative regulations.

    Science.gov (United States)

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  18. Hypoxia-regulated target genes implicated in tumor metastasis

    Directory of Open Access Journals (Sweden)

    Tsai Ya-Ping

    2012-12-01

    Full Text Available Abstract Hypoxia is an important microenvironmental factor that induces cancer metastasis. Hypoxia/hypoxia-inducible factor-1α (HIF-1α regulates many important steps of the metastatic processes, especially epithelial-mesenchymal transition (EMT that is one of the crucial mechanisms to cause early stage of tumor metastasis. To have a better understanding of the mechanism of hypoxia-regulated metastasis, various hypoxia/HIF-1α-regulated target genes are categorized into different classes including transcription factors, histone modifiers, enzymes, receptors, kinases, small GTPases, transporters, adhesion molecules, surface molecules, membrane proteins, and microRNAs. Different roles of these target genes are described with regards to their relationship to hypoxia-induced metastasis. We hope that this review will provide a framework for further exploration of hypoxia/HIF-1α-regulated target genes and a comprehensive view of the metastatic picture induced by hypoxia.

  19. Regulation of immunoglobulin gene rearrangement and expression.

    Science.gov (United States)

    Taussig, M J; Sims, M J; Krawinkel, U

    1989-05-01

    The molecular genetic events leading to Ig expression and their control formed the topic of a recent EMBO workshop. This report by Michael Taussig, Martin Sims and Ulrich Krawinkel discusses contributions dealing with genes expressed in early pre-B cells, the mechanism of rearrangement, aberrant rearrangements seen in B cells of SCID mice, the feedback control of rearrangement as studied in transgenic mice, the control of Ig expression at the transcriptional and post-transcriptional levels, and class switching.

  20. ANDROGEN INSENSITIVITY SYNDROME

    Directory of Open Access Journals (Sweden)

    Kanan

    2014-01-01

    Full Text Available The condition is inherited as X - linked recessive gene 1 . The underlying pathology is the inability of end organs to respond to androgens. These cases are phenotypically and psychologically female with adequate breast development , normal external genitalia , a vagina with variable depth , absent /sparse pubic hair and axillary hair. The exact incidence in India is not known but the reported incidence is 1 in 2 , 000 to 1 in 62 ,400 worldwide . These patients have male karyotyping (XY wi th negative sex chromatin with undescended gonads. These cases are rarely diagnosed before puberty. Though rare , these are extremely distressing to the concerned individuals requiring expert handling. Management should include psychological counseling not only to determine the sexual mentation but also to help those individuals to cope with their problems. The chance of malignancy developing in the gonad with Y chromosome are about 20%.Surgical removal of the gonad is mandatory but can be delayed till 18 ye ars to permit breast development and epiphyseal closure. The aim of presenting this case is to develop awareness regarding this rare syndrome X - linked genetic disorder which runs in families

  1. The NSL complex regulates housekeeping genes in Drosophila.

    Directory of Open Access Journals (Sweden)

    Kin Chung Lam

    Full Text Available MOF is the major histone H4 lysine 16-specific (H4K16 acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP-seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2 throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5% of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP-seq analyses of RNA polymerase II (Pol II in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication-related Element (DRE. Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription.

  2. Development of a small-molecule serum- and glucocorticoid-regulated kinase-1 antagonist and its evaluation as a prostate cancer therapeutic.

    Science.gov (United States)

    Sherk, Andrea B; Frigo, Daniel E; Schnackenberg, Christine G; Bray, Jeffrey D; Laping, Nicholas J; Trizna, Walter; Hammond, Marlys; Patterson, Jaclyn R; Thompson, Scott K; Kazmin, Dmitri; Norris, John D; McDonnell, Donald P

    2008-09-15

    Androgens, through their actions on the androgen receptor (AR), are required for the development of the prostate and contribute to the pathologic growth dysregulation observed in prostate cancers. Consequently, androgen ablation has become an essential component of the pharmacotherapy of prostate cancer. In this study, we explored the utility of targeting processes downstream of AR as an alternate approach for therapy. Specifically, we show that the serum and glucocorticoid-regulated kinase 1 (SGK1) gene is an androgen-regulated target gene in cellular models of prostate cancer. Furthermore, functional serum- and glucocorticoid-regulated kinase 1 (SGK1) protein, as determined by the phosphorylation of its target Nedd4-2, was also increased with androgen treatment. Importantly, we determined that RNA interference-mediated knockdown of SGK1 expression attenuates the androgen-mediated growth of the prostate cancer cell line LNCaP. Given these findings, we explored the utility of SGK1 as a therapeutic target in prostate cancer by developing and evaluating a small-molecule inhibitor of this enzyme. From these studies emerged GSK650394, a competitive inhibitor that quantitatively blocks the effect of androgens on LNCaP cell growth. Thus, in addition to androgen ablation, inhibition of pathways downstream of AR is likely to have therapeutic utility in prostate cancer.

  3. No evidence that 2D:4D is related to the number of CAG repeats in the androgen receptor gene

    Directory of Open Access Journals (Sweden)

    Johannes eHönekopp

    2013-12-01

    Full Text Available The length ratio of the second to the fourth digit (2D:4D is a putative marker of prenatal testosterone (T effects. The number of CAG repeats (CAGn in the AR gene is negatively correlated with T sensitivity in vitro. Results regarding the relationship between 2D:4D and CAGn are mixed but have featured prominently in arguments for and against the validity of 2D:4D. Here, I present random-effects meta-analyses on 14 relevant samples with altogether 1,904 subjects. Results were homogeneous across studies. Even liberal estimates (upper limit of the 95% CI were close to zero and therefore suggested no substantial relationship of CAGn with either right-hand 2D:4D, left-hand 2D:4D, or the difference between the two. However, closer analysis of the effects of CAGn on T dependent gene activation in vitro and of relationships between CAGn and T dependent phenotypic characteristics suggest that normal variability of CAGn has mostly no, very small, or inconsistent effects. Therefore, the lack of a clear association between CAGn and 2D:4D has no negative implications for the latter’s validity as a marker of prenatal T effects.

  4. Identification of Genes Regulated by Proteolysis

    Science.gov (United States)

    2005-07-01

    phase entry, M., Kanai, F., Zhou, B.B., Chung, J.H., and Rathbun, G.A. histone gene expression, and Cajal Body maintenance in hu- 2002. Determination...substrates of ubiquitin ligases. 6 Body Development of a library of F-box proteins We previously reported the identification of 33 human F-box proteins...FLAG anti- effect of the T62A mutation on cyclin E degradation through bodies , and immune complexes were immunoblotted with anti-Myc the Thr35 ° degron

  5. Pancreatic regeneration: basic research and gene regulation.

    Science.gov (United States)

    Okita, Kenji; Mizuguchi, Toru; Shigenori, Ota; Ishii, Masayuki; Nishidate, Toshihiko; Ueki, Tomomi; Meguro, Makoto; Kimura, Yasutoshi; Tanimizu, Naoki; Ichinohe, Norihisa; Torigoe, Toshihiko; Kojima, Takashi; Mitaka, Toshihiro; Sato, Noriyuki; Sawada, Norimasa; Hirata, Koichi

    2016-06-01

    Pancreatic regeneration (PR) is an interesting phenomenon that could provide clues as to how the control of diabetes mellitus might be achieved. Due to the different regenerative abilities of the pancreas and liver, the molecular mechanism responsible for PR is largely unknown. In this review, we describe five representative murine models of PR and thirteen humoral mitogens that stimulate β-cell proliferation. We also describe pancreatic ontogenesis, including the molecular transcriptional differences between α-cells and β-cells. Furthermore, we review 14 murine models which carry defects in genes related to key transcription factors for pancreatic ontogenesis to gain further insight into pancreatic development.

  6. Identification of the NAC1-regulated genes in ovarian cancer.

    Science.gov (United States)

    Gao, Min; Wu, Ren-Chin; Herlinger, Alice L; Yap, Kailee; Kim, Jung-Won; Wang, Tian-Li; Shih, Ie-Ming

    2014-01-01

    Nucleus accumbens-associated protein 1 (NAC1), encoded by the NACC1 gene, is a transcription co-regulator that plays a multifaceted role in promoting tumorigenesis. However, the NAC1-regulated transcriptome has not been comprehensively defined. In this study, we compared the global gene expression profiles of NAC1-overexpressing SKOV3 ovarian cancer cells and NAC1-knockdown SKOV3 cells. We found that NAC1 knockdown was associated with up-regulation of apoptotic genes and down-regulation of genes involved in cell movement, proliferation, Notch signaling, and epithelial-mesenchymal transition. Among NAC1-regulated genes, FOXQ1 was further characterized because it is involved in cell motility and epithelial-mesenchymal transition. NAC1 knockdown decreased FOXQ1 expression and promoter activity. Similarly, inactivation of NAC1 by expression of a dominant-negative construct of NAC1 suppressed FOXQ1 expression. Ectopic expression of NAC1 in NACC1 null cells induced FOXQ1 expression. NAC1 knockdown resulted in decreased cell motility and invasion, whereas constitutive expression of FOXQ1 rescued motility in cells after NAC1 silencing. Moreover, in silico analysis revealed a significant co-up-regulation of NAC1 and FOXQ1 in ovarian carcinoma tissues. On the basis of transcription profiling, we report a group of NAC1-regulated genes that may participate in multiple cancer-related pathways. We further demonstrate that NAC1 is essential and sufficient for activation of FOXQ1 transcription and that the role of NAC1 in cell motility is mediated, at least in part, by FOXQ1.

  7. Epigenetic regulation of transposable element derived human gene promoters.

    Science.gov (United States)

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome.

  8. Androgen receptor signaling is required for androgen-sensitive human prostate cancer cell proliferation and survival

    Directory of Open Access Journals (Sweden)

    Day Wanda V

    2005-04-01

    Full Text Available Abstract Background Androgens and androgen receptors (AR regulate normal prostate development and growth. They also are involved in pathological development of prostatic diseases, including benign prostatic hyperplasia (BPH and prostate cancer (PCa. Antiandrogen therapy for PCa, in conjunction with chemical or surgical castration, offers initial positive responses and leads to massive prostate cell death. However, cancer cells later appear as androgen-independent PCa. To investigate the role of AR in prostate cell proliferation and survival, we introduced a vector-based small interfering RNA (siRNA. This siRNA targeted 5'-untranslated region of AR mRNA for extended suppression of AR expression in androgen-sensitive human prostate LNCaP cells. Results The siRNA design successfully suppressed endogenous AR expression, as revealed by western blotting and immunofluorescence staining in LNCaP cells. LNCaP cells did not proliferate in the absence of AR and underwent apoptosis, based on elevated phospho-Histone H2B expression and higher number of apoptotic body as compared to control cells. Conclusion We demonstrated that AR is vital for prostate cell proliferation and survival in this androgen-sensitive prostate cell line. These results further strengthen the hypothesis that AR can be a therapeutic target for treating androgen-sensitive stages of PCa. Unlike antiandorgens, however, siRNA targeting AR provides a direct inactivation of AR function through the suppression of AR protein expression.

  9. Quantitative characteristics of gene regulation by small RNA.

    Directory of Open Access Journals (Sweden)

    Erel Levine

    2007-09-01

    Full Text Available An increasing number of small RNAs (sRNAs have been shown to regulate critical pathways in prokaryotes and eukaryotes. In bacteria, regulation by trans-encoded sRNAs is predominantly found in the coordination of intricate stress responses. The mechanisms by which sRNAs modulate expression of its targets are diverse. In common to most is the possibility that interference with the translation of mRNA targets may also alter the abundance of functional sRNAs. Aiming to understand the unique role played by sRNAs in gene regulation, we studied examples from two distinct classes of bacterial sRNAs in Escherichia coli using a quantitative approach combining experiment and theory. Our results demonstrate that sRNA provides a novel mode of gene regulation, with characteristics distinct from those of protein-mediated gene regulation. These include a threshold-linear response with a tunable threshold, a robust noise resistance characteristic, and a built-in capability for hierarchical cross-talk. Knowledge of these special features of sRNA-mediated regulation may be crucial toward understanding the subtle functions that sRNAs can play in coordinating various stress-relief pathways. Our results may also help guide the design of synthetic genetic circuits that have properties difficult to attain with protein regulators alone.

  10. Activation of two mutant androgen receptors from human prostatic carcinoma by adrenal androgens and metabolic derivatives of testosterone.

    Science.gov (United States)

    Culig, Z; Stober, J; Gast, A; Peterziel, H; Hobisch, A; Radmayr, C; Hittmair, A; Bartsch, G; Cato, A C; Klocker, H

    1996-01-01

    The androgen receptor (AR) plays a central regulatory role in prostatic carcinoma and is a target of androgen ablation therapy. Recent detection of mutant receptors in tumor specimens suggest a contribution of AR alterations to progression towards androgen independence. In a specimen derived from metastatic prostate cancer we have reported a point mutation in the AR gene that leads to a single amino acid exchange in the ligand binding domain of the receptor. Another amino acid exchange resulting from a point mutation was also identified 15 amino acids away from our mutation. This mutation was detected in the AR gene isolated from an organ-confined prostatic tumor. Here we report the functional characterization of the two mutant receptors in the presence of adrenal androgens and testosterone metabolites. These studies were performed by cotransfecting androgen-responsive reporter genes and either the wild-type or mutant AR expression vectors into receptor negative DU-145 and CV-1 cells. The indicator genes used consisted of the promoter of the androgen-inducible prostate-specific antigen gene or the C' Delta9 enhancer fragment from the promoter of the mouse sex-limited protein driving the expression of the bacterial chloramphenicol acetyl transferase gene. Cotransfection-transactivation assays revealed that the adrenal androgen androstenedione and two products of testosterone metabolism, androsterone and androstandiol, induced reporter gene activity more efficiently in the presence of the mutant receptors than in the presence of the wild-type receptor. No difference between wild-type and mutant receptors was observed in the presence of the metabolite androstandione. The interaction of receptor-hormone complexes with target DNA was studied in vitro by electrophoretic mobility shift assays (EMSA). Dihydrotestosterone and the synthetic androgen mibolerone induced a faster migrating complex with all receptors, whereas the androgen metabolite androstandione induced this

  11. Hormonal regulation of gluconeogenic gene transcription in the liver

    Indian Academy of Sciences (India)

    Nirmala Yabaluri; Murali D Bashyam

    2010-09-01

    Glucose homeostasis in mammals is achieved by the actions of counterregulatory hormones, namely insulin, glucagon and glucocorticoids. Glucose levels in the circulation are regulated by the liver, the metabolic centre which produces glucose when it is scarce in the blood. This process is catalysed by two rate-limiting enzymes, phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6Pase) whose gene expression is regulated by hormones. Hormone response units (HRUs) present in the two genes integrate signals from various signalling pathways triggered by hormones. How such domains are arranged in the regulatory region of these two genes, how this complex regulation is accomplished and the latest advancements in the field are discussed in this review.

  12. Different Polycomb group complexes regulate common target genes in Arabidopsis.

    Science.gov (United States)

    Makarevich, Grigory; Leroy, Olivier; Akinci, Umut; Schubert, Daniel; Clarenz, Oliver; Goodrich, Justin; Grossniklaus, Ueli; Köhler, Claudia

    2006-09-01

    Polycomb group (PcG) proteins convey epigenetic inheritance of repressed transcriptional states. Although the mechanism of the action of PcG is not completely understood, methylation of histone H3 lysine 27 (H3K27) is important in establishing PcG-mediated transcriptional repression. We show that the plant PcG target gene PHERES1 is regulated by histone trimethylation on H3K27 residues mediated by at least two different PcG complexes in plants, containing the SET domain proteins MEDEA or CURLY LEAF/SWINGER. Furthermore, we identify FUSCA3 as a potential PcG target gene and show that FUSCA3 is regulated by MEDEA and CURLY LEAF/SWINGER. We propose that different PcG complexes regulate a common set of target genes during the different stages of plant development.

  13. Information Integration and Energy Expenditure in Gene Regulation.

    Science.gov (United States)

    Estrada, Javier; Wong, Felix; DePace, Angela; Gunawardena, Jeremy

    2016-06-30

    The quantitative concepts used to reason about gene regulation largely derive from bacterial studies. We show that this bacterial paradigm cannot explain the sharp expression of a canonical developmental gene in response to a regulating transcription factor (TF). In the absence of energy expenditure, with regulatory DNA at thermodynamic equilibrium, information integration across multiple TF binding sites can generate the required sharpness, but with strong constraints on the resultant "higher-order cooperativities." Even with such integration, there is a "Hopfield barrier" to sharpness; for n TF binding sites, this barrier is represented by the Hill function with the Hill coefficient n. If, however, energy is expended to maintain regulatory DNA away from thermodynamic equilibrium, as in kinetic proofreading, this barrier can be breached and greater sharpness achieved. Our approach is grounded in fundamental physics, leads to testable experimental predictions, and suggests how a quantitative paradigm for eukaryotic gene regulation can be formulated.

  14. Absence of canonical active chromatin marks in developmentally regulated genes

    Science.gov (United States)

    Ruiz-Romero, Marina; Corominas, Montserrat; Guigó, Roderic

    2015-01-01

    The interplay of active and repressive histone modifications is assumed to play a key role in the regulation of gene expression. In contrast to this generally accepted view, we show that transcription of genes temporally regulated during fly and worm development occurs in the absence of canonically active histone modifications. Conversely, strong chromatin marking is related to transcriptional and post-transcriptional stability, an association that we also observe in mammals. Our results support a model in which chromatin marking is associated to stable production of RNA, while unmarked chromatin would permit rapid gene activation and de-activation during development. In this case, regulation by transcription factors would play a comparatively more important regulatory role. PMID:26280901

  15. Differential regulation of genes by retrotransposons in rice promoters.

    Science.gov (United States)

    Dhadi, Surendar Reddy; Xu, Zijun; Shaik, Rafi; Driscoll, Kyle; Ramakrishna, Wusirika

    2015-04-01

    Rice genome harbors genes and promoters with retrotransposon insertions. There is very little information about their function. The effect of retrotransposon insertions in four rice promoter regions on gene regulation, was investigated using promoter-reporter gene constructs with and without retrotransposons. Differences in expression levels of gus and egfp reporter genes in forward orientation and rfp in reverse orientation were evaluated in rice plants with transient expression employing quantitative RT-PCR analysis, histochemical GUS staining, and eGFP and RFP fluorescent microscopy. The presence of SINE in the promoter 1 (P1) resulted in higher expression levels of the reporter genes, whereas the presence of LINE in P2 or gypsy LTR retrotransposon in P3 reduced expression of the reporter genes. Furthermore, the SINE in P1 acts as an enhancer in contrast with the LINE in P2 and the gypsy LTR retrotransposon in P3 which act as silencers. CTAA and CGG motifs in these retrotransposons are the likely candidates for the downregulation compared to TCTT motif (SINE) which is a candidate for the upregulation of gene expression. The effect of retrotransposons on gene regulation correlated with the earlier investigation of conservation patterns of these four retrotransposon insertions in several rice accessions implying their evolutionary significance.

  16. An Epigenetic Perspective on Developmental Regulation of Seed Genes

    Institute of Scientific and Technical Information of China (English)

    Heng Zhang; Joe Ogas

    2009-01-01

    The developmental program of seeds is promoted by master regulators that are expressed in a seed-specific manner.Ectopic expression studies reveal that expression of these master regulators and other transcriptional regulators is sufficient to promote seed-associated traits,including generation of somatic embryos.Recent work highlights the importance of chromatin-associated factors in restricting expression of seed-specific genes,in particular PcG proteins and ATP-dependent remodelers.This review summarizes what is known regarding factors that promote zygotic and/or somatic embryogenesis and the chromatin machinery that represses their expression.Characterization of the regulation of seedspecific genes reveals that plant chromatin-based repression systems exhibit broad conservation with and surprising differences from animal repression systems.

  17. Regulation of Insulin Gene Transcription by Multiple Histone Acetyltransferases

    OpenAIRE

    2012-01-01

    Glucose-stimulated insulin gene transcription is mainly regulated by a 340-bp promoter region upstream of the transcription start site by beta-cell-enriched transcription factors Pdx-1, MafA, and NeuroD1. Previous studies have shown that histone H4 hyperacetylation is important for acute up-regulation of insulin gene transcription. Until now, only the histone acetyltransferase (HAT) protein p300 has been shown to be involved in this histone H4 acetylation event. In this report we investigated...

  18. Every which way--nanos gene regulation in echinoderms.

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M

    2014-03-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio binds to and changes the fate of several known transcripts. We summarize here the documented functions of Nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way.

  19. Transcriptional regulation of human thromboxane synthase gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K.D.; Baek, S.J.; Fleischer, T [Univ. of Maryland Medical School, Baltimore, MD (United States)] [and others

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  20. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  1. Differential regulation of GS-GOGAT gene expression by plant growth regulators in Arabidopsis seedlings

    Directory of Open Access Journals (Sweden)

    Dragićević Milan

    2016-01-01

    Full Text Available Primary and secondary ammonium assimilation is catalyzed by the glutamine synthetase-glutamate synthase (GS-GOGAT pathway in plants. The Arabidopsis genome contains five cytosolic GS1 genes (GLN1;1 - GLN1;5, one nuclear gene for chloroplastic GS2 isoform (GLN2, two Fd-GOGAT genes (GLU1 and GLU2 and a GLT1 gene coding for NADH-GOGAT. Even though the regulation of GS and GOGAT isoforms has been extensively studied in response to various environmental and metabolic cues in many plant species, little is known about the effects of phytohormones on their regulation. The objective of this study was to investigate the impact of representative plant growth regulators, kinetin (KIN, abscisic acid (ABA, gibberellic acid (GA3 and 2,4-dichlorophenoxyacetic acid (2,4-D, on the expression of A. thaliana GS and GOGAT genes. The obtained results indicate that GS and GOGAT genes are differentially regulated by growth regulators in shoots and roots. KIN and 2,4-D repressed GS and GOGAT expression in roots, with little effect on transcript levels in shoots. KIN affected all tested genes; 2,4-D was apparently more selective and less potent. ABA induced the expression of GLN1;1 and GLU2 in whole seedlings, while GA3 enhanced the expression of all tested genes in shoots, except GLU2. The observed expression patterns are discussed in relation to physiological roles of investigated plant growth regulators and N-assimilating enzymes. [Projekat Ministarstva nauke Republike Srbije, br. ON173024

  2. Global identification of target genes regulated by APETALA3 and PISTILLATA floral homeotic gene action.

    Science.gov (United States)

    Zik, Moriyah; Irish, Vivian F

    2003-01-01

    Identifying the genes regulated by the floral homeotic genes APETALA3 (AP3) and PISTILLATA (PI) is crucial for understanding the molecular mechanisms that lead to petal and stamen formation. We have used microarray analysis to conduct a broad survey of genes whose expression is affected by AP3 and PI activity. DNA microarrays consisting of 9216 Arabidopsis ESTs were screened with probes corresponding to mRNAs from different mutant and transgenic lines that misexpress AP3 and/or PI. The microarray results were further confirmed by RNA gel blot analyses. Our results suggest that AP3 and PI regulate a relatively small number of genes, implying that many genes used in petal and stamen development are not tissue specific and likely have roles in other processes as well. We recovered genes similar to previously identified petal- and stamen-expressed genes as well as genes that were not implicated previously in petal and stamen development. A very low percentage of the genes recovered encoded transcription factors. This finding suggests that AP3 and PI act relatively directly to regulate the genes required for the basic cellular processes responsible for petal and stamen morphogenesis.

  3. Gene regulation by engineered CRISPR-Cas systems.

    Science.gov (United States)

    Fineran, Peter C; Dy, Ron L

    2014-04-01

    The clustered regularly interspaced short palindromic repeat (CRISPR) arrays and their CRISPR associated (Cas) proteins constitute adaptive immune systems in bacteria and archaea that provide protection from bacteriophages, plasmids and other mobile genetic elements (MGEs). Recently, the ability to direct these systems to DNA in a sequence-specific manner has led to the emergence of new technologies for engineered gene regulation in bacteria and eukaryotes. These systems have the potential to enable facile high-throughput functional genomics studies aimed at identifying gene function and will be a crucial tool for synthetic biology. Here, we review the recent engineering of these systems for controlling gene expression.

  4. TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes.

    Science.gov (United States)

    Matys, V; Kel-Margoulis, O V; Fricke, E; Liebich, I; Land, S; Barre-Dirrie, A; Reuter, I; Chekmenev, D; Krull, M; Hornischer, K; Voss, N; Stegmaier, P; Lewicki-Potapov, B; Saxel, H; Kel, A E; Wingender, E

    2006-01-01

    The TRANSFAC database on transcription factors, their binding sites, nucleotide distribution matrices and regulated genes as well as the complementing database TRANSCompel on composite elements have been further enhanced on various levels. A new web interface with different search options and integrated versions of Match and Patch provides increased functionality for TRANSFAC. The list of databases which are linked to the common GENE table of TRANSFAC and TRANSCompel has been extended by: Ensembl, UniGene, EntrezGene, HumanPSD and TRANSPRO. Standard gene names from HGNC, MGI and RGD, are included for human, mouse and rat genes, respectively. With the help of InterProScan, Pfam, SMART and PROSITE domains are assigned automatically to the protein sequences of the transcription factors. TRANSCompel contains now, in addition to the COMPEL table, a separate table for detailed information on the experimental EVIDENCE on which the composite elements are based. Finally, for TRANSFAC, in respect of data growth, in particular the gain of Drosophila transcription factor binding sites (by courtesy of the Drosophila DNase I footprint database) and of Arabidopsis factors (by courtesy of DATF, Database of Arabidopsis Transcription Factors) has to be stressed. The here described public releases, TRANSFAC 7.0 and TRANSCompel 7.0, are accessible under http://www.gene-regulation.com/pub/databases.html.

  5. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  6. Plant microRNAs: master regulator of gene expression mechanism.

    Science.gov (United States)

    Datta, Riddhi; Paul, Soumitra

    2015-11-01

    Several signaling molecules critically regulate the physiological responses in plants. Among them, miRNAs, generally 21-24 nucleotides long, are widely distributed in different plant species and play as key signaling intermediates in diverse physiological responses. The mature miRNAs are synthesized from MIR genes by RNA polymerase II and processed by Dicer-like (DCL) protein family members associated with some accessory protein molecules. The processed miRNAs are transported to the cytoplasm from the nucleus by specific group of transporters and incorporated into RNA-induced silencing complex (RISC) for specific mRNA cleavage. MicroRNAs can suppress the diverse gene expression, depending on the sequence complementarity of the target transcript except of its own gene. Besides, miRNAs can modulate the gene expression by DNA methylation and translational inhibition of the target transcript. Different classes of DCLs and Argonaute proteins (AGOs) help the miRNAs-mediated gene silencing mechanism in plants.

  7. 青少年痤疮患者雄激素受体水平、雄激素受体基因 CAG 多态性的研究%Research on adolescent androgen receptor level in patients with acne,androgen receptor gene CAG polymorphism

    Institute of Scientific and Technical Information of China (English)

    吴波; 邵晓珊; 吴文锦

    2014-01-01

    目的:探讨青少年痤疮患者雄激素受体(A R )水平的变化情况以及患者雄激素受体基因CAG多态性的分布情况。方法选择100例(其中男性50例、女性50例)面部明显痤疮在校高中生作为观察组,再按照1∶1匹配原则选择100例面部无痤疮的在校高中生作为对照组,检查患者外周血雄激素水平、白细胞雄激素受体(AR)以及雄激素受体基因CAG多态性。结果男性和女性痤疮患者其血浆睾酮水平、AR水平比正常对照组均升高,差异具有统计学意义(P<0.05);随着男性痤疮患者其痤疮越严重,其血浆睾酮有所升高,但是差异不具有统计学意义(P>0.05),而不同程度女性痤疮患者其血浆睾酮水平具有统计学意义(P<0.05);随着痤疮患者其痤疮越严重,AR水平有所升高,差异具有统计学意义(P<0.05);痤疮患者携带CAG短片段的比例显著高于对照组携带比例(P<0.05)。结论痤疮发生与发展过程中,雄激素以及雄激素受体增高起着重要的作用,特别对于女性痤疮患者而言,其影响更为显著;携带雄激素受体基因CAG短片段的人群,其患痤疮的危险性更大。%Objective To investigate the adolescent patients with acne androgen receptor (AR) levels and the distribution of androgen receptor gene CAG polymorphism .Methods 100 cases (inclu-ding 50 male and 50 female) the obvious facial acne high school student as the observation group ,1∶1 according to the matching principle to select 100 cases of facial acne free high school students as the control group .Patients were examined for peripheral androgen levels ,androgen receptor (AR) and androgen receptor gene CAG polymorphism .Results The male and female patients with acne and the plasma levels of testosterone ,AR levels were higher than the normal control group ,there were statis-tically significant differences (P0 .05) ,and in pa

  8. Development of a small molecule serum and glucocorticoid-regulated kinase 1 antagonist and its evaluation as a prostate cancer therapeutic

    Science.gov (United States)

    Sherk, Andrea B.; Frigo, Daniel E.; Schnackenberg, Christine G.; Bray, Jeffrey D.; Laping, Nicholas J.; Trizna, Walter; Hammond, Marlys; Patterson, Jaclyn R.; Thompson, Scott K.; Kazmin, Dmitri; Norris, John D.; McDonnell, Donald P.

    2008-01-01

    Androgens, through their actions on the androgen receptor (AR), are required for the development of the prostate and contribute to the pathological growth dysregulation observed in prostate cancers. Consequently, androgen ablation has become an essential component of the pharmacotherapy of prostate cancer. In this study, we explored the utility of targeting processes downstream of AR as an alternate approach for therapy. Specifically, we demonstrate that the serum and glucocorticoid-regulated kinase 1 (sgk1) gene is an androgen-regulated target gene in cellular models of prostate cancer. Furthermore, functional SGK1 protein, as determined by the phosphorylation of its target Nedd4-2, was also increased with androgen treatment. Importantly, we determined that RNAi-mediated knockdown of SGK1 expression attenuates androgen-mediated growth of the prostate cancer cell line, LNCaP. Given these findings, we explored the utility of SGK1 as a therapeutic target in prostate cancer by developing and evaluating a small molecule inhibitor of this enzyme. From these studies emerged GSK650394, a competitive inhibitor that quantitatively blocks the effect of androgens on LNCaP cell growth. Thus, in addition to androgen ablation, inhibition of pathways downstream of AR are likely to have therapeutic utility in prostate cancer. PMID:18794135

  9. Nitrogen regulates chitinase gene expression in a marine bacterium

    DEFF Research Database (Denmark)

    Delpin, Marina; Goodman, A.E.

    2009-01-01

    Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures con...

  10. 平衡阴阳法对多囊卵巢综合征雌雄激素的调节%The Regulation of the Balance of Yin and Yang Method on the Estrogen and Androgen of Polycystic Ovary Syndrome

    Institute of Scientific and Technical Information of China (English)

    贺晓霞; 王若光

    2016-01-01

    According to the menstrual cycle evolution and growth and decline of yin and Yang change rules, under the guidance of the basic theory of traditional Chinese medicine, this paper explained the disorder mechanism of the elevated androgen and reduced estrogen induced by irregular menstrual cycle in polycystic ovary syndrome (PCOS). We also follow the aim of "observe the location of Yin and Yang to regulate and balance Yin-Yang" in Neijing. "Yin and Yang in equilibrium"can make PCOS patients reach the balance of Yin and Yang and elevated estrogen and reduced androgen, and ultimately restore the natural rhythm of the menstrual cycle.%本文依据月经周期节律演变和阴阳消长变化的规律,在中医基础理论的指导下,用阴阳失衡来阐释多囊卵巢综合征(polycystic ovary syndrome, PCOS)女性周期节律失序导致高雄、低雌激素血症内分泌失调的机制;并遵循《内经》"谨察阴阳所在而调之, 以平为期"的宗旨,说明"阴平阳秘"可使PCOS患者达到阴阳平衡及升雌降雄,最终恢复月经周期自然节律的目的.

  11. Transcriptional regulation of cathelicidin genes in chicken bone marrow cells.

    Science.gov (United States)

    Lee, Sang In; Jang, Hyun June; Jeon, Mi-hyang; Lee, Mi Ock; Kim, Jeom Sun; Jeon, Ik-Soo; Byun, Sung June

    2016-04-01

    Cathelicidins form a family of vertebrate-specific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription factors (TFs) that bind to the 5'-flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5'-flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.

  12. Peptide nucleic acid (PNA) binding-mediated gene regulation

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    Peptide nucleic acids (PNAs) are synthetic oligonucleotides with chemically modified backbones. PNAs can bind to both DNA and RNA targets in a sequence-specific manner to form PNA/DNA and PNA/RNA duplex structures. When bound to double-stranded DNA (dsDNA) targets, the PNA molecule replaces one DNA strand in the duplex by strand invasion to form a PNA/DNA/PNA [or (PNA)2/DNA] triplex structure and the displaced DNA strand exists as a singlestranded D-loop. PNA has been used in many studies as research tools for gene regulation and gene targeting. The Dloops generated from the PNA binding have also been demonstrated for its potential in initiating transcription and inducing gene expression. PNA provides a powerful tool to study the mechanism of transcription and an innovative strategy to regulate target gene expression. An understanding of the PNA-mediated gene regulation will have important clinical implications in treatment of many human diseases including genetic, cancerous, and age-related diseases.

  13. Loss of androgen receptor-dependent growth suppression by prostate cancer cells can occur independently from acquiring oncogenic addiction to androgen receptor signaling.

    Directory of Open Access Journals (Sweden)

    Jason M D'Antonio

    Full Text Available The conversion of androgen receptor (AR signaling as a mechanism of growth suppression of normal prostate epithelial cells to that of growth stimulation in prostate cancer cells is often associated with AR mutation, amplification and over-expression. Thus, down-regulation of AR signaling is commonly therapeutic for prostate cancer. The E006AA cell line was established from a hormone naïve, localized prostate cancer. E006AA cells are genetically aneuploid and grow equally well when xenografted into either intact or castrated male NOG but not nude mice. These cells exhibit: 1 X chromosome duplication and AR gene amplification, although paradoxically not coupled with increased AR expression, and 2 somatic, dominant-negative Serine-599-Glycine loss-of-function mutation within the dimerization surface of the DNA binding domain of the AR gene. No effect on the growth of E006AA cells is observed using targeted knockdown of endogenous mutant AR, ectopic expression of wild-type AR, or treatment with androgens or anti-androgens. E006AA cells represent a prototype for a newly identified subtype of prostate cancer cells that exhibit a dominant-negative AR loss-of-function in a hormonally naïve patient. Such loss-of-function eliminates AR-mediated growth suppression normally induced by normal physiological levels of androgens, thus producing a selective growth advantage for these malignant cells in hormonally naïve patients. These data highlight that loss of AR-mediated growth suppression is an independent process, and that, without additional changes, is insufficient for acquiring oncogene addiction to AR signaling. Thus, patients with prostate cancer cells harboring such AR loss-of-function mutations will not benefit from aggressive hormone or anti-AR therapies even though they express AR protein.

  14. Visualising androgen receptor activity in male and female mice.

    Directory of Open Access Journals (Sweden)

    D Alwyn Dart

    Full Text Available Androgens, required for normal development and fertility of males and females, have vital roles in the reproductive tract, brain, cardiovascular system, smooth muscle and bone. Androgens function via the androgen receptor (AR, a ligand-dependent transcription factor. To assay and localise AR activity in vivo we generated the transgenic "ARE-Luc" mouse, expressing a luciferase reporter gene under the control of activated endogenous AR. In vivo imaging of androgen-mediated luciferase activity revealed several strongly expressing tissues in the male mouse as expected and also in certain female tissues. In males the testes, prostate, seminal vesicles and bone marrow all showed high AR activity. In females, strong activity was seen in the ovaries, uterus, omentum tissue and mammary glands. In both sexes AR expression and activity was also found in salivary glands, the eye (and associated glands, adipose tissue, spleen and, notably, regions of the brain. Luciferase protein expression was found in the same cell layers as androgen receptor expression. Additionally, mouse AR expression and activity correlated well with AR expression in human tissues. The anti-androgen bicalutamide reduced luciferase signal in all tissues. Our model demonstrates that androgens can act in these tissues directly via AR, rather than exclusively via androgen aromatisation to estrogens and activation of the estrogen receptor. Additionally, it visually demonstrates the fundamental importance of AR signalling outside the normal role in the reproductive organs. This model represents an important tool for physiological and developmental analysis of androgen signalling, and for characterization of known and novel androgenic or antiandrogenic compounds.

  15. Deciphering c-MYC-regulated genes in two distinct tissues

    Directory of Open Access Journals (Sweden)

    Hunter Ewan

    2011-09-01

    Full Text Available Abstract Background The transcription factor MYC is a critical regulator of diverse cellular processes, including both replication and apoptosis. Differences in MYC-regulated gene expression responsible for such opposing outcomes in vivo remain obscure. To address this we have examined time-dependent changes in global gene expression in two transgenic mouse models in which MYC activation, in either skin suprabasal keratinocytes or pancreatic islet β-cells, promotes tissue expansion or involution, respectively. Results Consistent with observed phenotypes, expression of cell cycle genes is increased in both models (albeit enriched in β-cells, as are those involved in cell growth and metabolism, while expression of genes involved in cell differentiation is down-regulated. However, in β-cells, which unlike suprabasal keratinocytes undergo prominent apoptosis from 24 hours, there is up-regulation of genes associated with DNA-damage response and intrinsic apoptotic pathways, including Atr, Arf, Bax and Cycs. In striking contrast, this is not the case for suprabasal keratinocytes, where pro-apoptotic genes such as Noxa are down-regulated and key anti-apoptotic pathways (such as Igf1-Akt and those promoting angiogenesis are up-regulated. Moreover, dramatic up-regulation of steroid hormone-regulated Kallikrein serine protease family members in suprabasal keratinocytes alone could further enhance local Igf1 actions, such as through proteolysis of Igf1 binding proteins. Conclusions Activation of MYC causes cell growth, loss of differentiation and cell cycle entry in both β-cells and suprabasal keratinocytes in vivo. Apoptosis, which is confined to β-cells, may involve a combination of a DNA-damage response and downstream activation of pro-apoptotic signalling pathways, including Cdc2a and p19Arf/p53, and downstream targets. Conversely, avoidance of apoptosis in suprabasal keratinocytes may result primarily from the activation of key anti

  16. Vocal area-related expression of the androgen receptor in the budgerigar (Melopsittacus undulatus) brain.

    Science.gov (United States)

    Matsunaga, Eiji; Okanoya, Kazuo

    2008-05-01

    The androgen receptor is a steroid hormone receptor widely expressed in the vocal control nuclei in songbirds. Here, we analysed androgen receptor expression in the brains of juvenile and adult budgerigars. With a species-specific probe for budgerigar androgen receptor mRNA, we found that the androgen receptor was expressed in the vocal areas, such as the central nucleus of the lateral nidopallium, the anterior arcopallium, the oval nucleus of the mesopallium, the oval nucleus of the anterior nidopallium and the tracheosyringeal hypoglossal nucleus. With the present data, together with previous reports, it turned out that the androgen receptor expression in telencephalic vocal control areas is similar amongst three groups of vocal learners--songbirds, hummingbirds and parrots, suggesting the possibility that the androgen receptor might play a role in vocal development and that the molecular mechanism regulating the androgen receptor expression in the vocal areas might be important in the evolution of vocal learning.

  17. ApoM: gene regulation and effects on HDL metabolism

    DEFF Research Database (Denmark)

    Nielsen, Lars B; Christoffersen, Christina; Ahnström, Josefin;

    2009-01-01

    The recently discovered apolipoprotein M (apoM) is a plasma protein of the lipocalin family associated with the lipoproteins (mainly high-density lipoproteins, or HDLs). Expression of the apoM gene in the liver is regulated by transcription factors that control key steps in hepatic lipid and gluc......The recently discovered apolipoprotein M (apoM) is a plasma protein of the lipocalin family associated with the lipoproteins (mainly high-density lipoproteins, or HDLs). Expression of the apoM gene in the liver is regulated by transcription factors that control key steps in hepatic lipid...... changes in HDLs, and overexpression of the apoM gene reduced atherosclerosis. In conclusion, it seems that apoM plays a part in lipoprotein metabolism; however, the biological impact of apoM in humans remains to be determined....

  18. Markers for sebaceoma show a spectrum of cell cycle regulators, tumor suppressor genes, and oncogenes

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2015-01-01

    Full Text Available Background: Sebaceoma is a tumor for which the causative oncogenes are not well-understood. Sebaceomas demonstrate some histopathologic features similar to basal cell carcinoma (BCC, such as palisading borders and basaloid cells with additional features, including foamy cytoplasm and indented nuclei. Aims: We examine multiple cell-cycle, oncogene, and tumor suppressor gene markers in sebaceomas, to try to find some suitable biological markers for this tumor, and compare with other published studies. Materials and Methods: We investigated a panel of immunohistochemical (IHC stains that are important for cellular signaling, including a cell cycle regulator, tumor suppressor gene, oncogene, hormone receptor, and genomic stability markers in our cohort of sebaceomas. We collected 30 sebaceomas from three separate USA dermatopathology laboratories. The following IHC panel: Epithelial membrane antigen (EMA/CD227, cytokeratin AE1/AE3, cyclin D1, human breast cancer 1 protein (BRCA-1, C-erb-2, Bcl-2, human androgen receptor (AR, cyclin-dependent kinase inhibitor 1B (p27 kip1 , p53, topoisomerase II alpha, proliferating cell nuclear antigen, and Ki-67 were tested in our cases. Results: EMA/CD227 was positive in the well-differentiated sebaceomas (13/30. Cyclin-dependent kinase inhibitor 1B was positive in tumors with intermediate differentiation (22/30. The less well-differentiated tumors failed to stain with EMA and AR. Most of the tumors with well-differentiated palisaded areas demonstrated positive staining for topoisomerase II alpha, p27 kip1 , and p53, with positive staining in tumoral basaloid areas (22/30. Numerous tumors were focally positive with multiple markers, indicating a significant degree of variability in the complete group. Conclusions: Oncogenes, tumor suppressor genes, cell cycle regulators, and hormone receptors are variably expressed in sebaceomas. Our results suggest that in these tumors, selected marker staining seems to correlate

  19. The cell cycle-regulated genes of Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Anna Oliva

    2005-07-01

    Full Text Available Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast. The 750 genes with the most significant oscillations were identified and analyzed. There were two broad waves of cell cycle transcription, one in early/mid G2 phase, and the other near the G2/M transition. The early/mid G2 wave included many genes involved in ribosome biogenesis, possibly explaining the cell cycle oscillation in protein synthesis in S. pombe. The G2/M wave included at least three distinctly regulated clusters of genes: one large cluster including mitosis, mitotic exit, and cell separation functions, one small cluster dedicated to DNA replication, and another small cluster dedicated to cytokinesis and division. S. pombe cell cycle genes have relatively long, complex promoters containing groups of multiple DNA sequence motifs, often of two, three, or more different kinds. Many of the genes, transcription factors, and regulatory mechanisms are conserved between S. pombe and S. cerevisiae. Finally, we found preliminary evidence for a nearly genome-wide oscillation in gene expression: 2,000 or more genes undergo slight oscillations in expression as a function of the cell cycle, although whether this is adaptive, or incidental to other events in the cell, such as chromatin condensation, we do not know.

  20. Pathway-specific regulation revisited: cross-regulation of multiple disparate gene clusters by PAS-LuxR transcriptional regulators.

    Science.gov (United States)

    Vicente, Cláudia M; Payero, Tamara D; Santos-Aberturas, Javier; Barreales, Eva G; de Pedro, Antonio; Aparicio, Jesús F

    2015-06-01

    PAS-LuxR regulators are highly conserved proteins devoted to the control of antifungal production by binding to operators located in given promoters of polyene biosynthetic genes. The canonical operator of PimM, archetype of this class of regulators, has been used here to search for putative targets of orthologous protein PteF in the genome of Streptomyces avermitilis, finding 97 putative operators outside the pentaene filipin gene cluster (pte). The processes putatively affected included genetic information processing; energy, carbohydrate, and lipid metabolism; DNA replication and repair; morphological differentiation; secondary metabolite biosynthesis; and transcriptional regulation, among others. Seventeen of these operators were selected, and their binding to PimM DNA-binding domain was assessed by electrophoretic mobility shift assays. Strikingly, the protein bound all predicted operators suggesting a direct control over targeted processes. As a proof of concept, we studied the biosynthesis of the ATP-synthase inhibitor oligomycin whose gene cluster included two operators. Regulator mutants showed a severe loss of oligomycin production, whereas gene complementation of the mutant restored phenotype, and gene duplication in the wild-type strain boosted oligomycin production. Comparative gene expression analyses in parental and mutant strains by reverse transcription-quantitative polymerase chain reaction of selected olm genes corroborated production results. These results demonstrate that PteF is able to cross-regulate the biosynthesis of two related secondary metabolites, filipin and oligomycin, but might be extended to all the processes indicated above. This study highlights the complexity of the network of interactions in which PAS-LuxR regulators are involved and opens new possibilities for the manipulation of metabolite production in Streptomycetes.

  1. Identifying disease feature genes based on cellular localized gene functional modules and regulation networks

    Institute of Scientific and Technical Information of China (English)

    ZHANG Min; ZHU Jing; GUO Zheng; LI Xia; YANG Da; WANG Lei; RAO Shaoqi

    2006-01-01

    Identifying disease-relevant genes and functional modules, based on gene expression profiles and gene functional knowledge, is of high importance for studying disease mechanisms and subtyping disease phenotypes. Using gene categories of biological process and cellular component in Gene Ontology, we propose an approach to selecting functional modules enriched with differentially expressed genes, and identifying the feature functional modules of high disease discriminating abilities. Using the differentially expressed genes in each feature module as the feature genes, we reveal the relevance of the modules to the studied diseases. Using three datasets for prostate cancer, gastric cancer, and leukemia, we have demonstrated that the proposed modular approach is of high power in identifying functionally integrated feature gene subsets that are highly relevant to the disease mechanisms. Our analysis has also shown that the critical disease-relevant genes might be better recognized from the gene regulation network, which is constructed using the characterized functional modules, giving important clues to the concerted mechanisms of the modules responding to complex disease states. In addition, the proposed approach to selecting the disease-relevant genes by jointly considering the gene functional knowledge suggests a new way for precisely classifying disease samples with clear biological interpretations, which is critical for the clinical diagnosis and the elucidation of the pathogenic basis of complex diseases.

  2. Update on androgenicity.

    Science.gov (United States)

    Thorneycroft, I H

    1999-02-01

    The development of a new generation of progestins deemed less androgenic than their earlier counterparts has led to a number of misconceptions regarding their possible benefits in combination oral contraceptives. All combination oral contraceptives are beneficial for treating such androgenic conditions as acne and hirsutism. The only expressed androgenic effect of some first- and second-generation combined oral contraceptives are changes in plasma lipid and lipoprotein levels. However, the overall effect of today's low-dose oral contraceptives is largely lipid neutral, and human and monkey studies have shown that oral contraceptive use is associated with reduced, not increased, atherosclerosis rates. Myocardial infarction rates are not increased among oral contraceptive users, except among those who are heavy smokers.

  3. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    Full Text Available BACKGROUND: The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis. CONCLUSIONS/SIGNIFICANCE: Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  4. Reinforcing aspects of androgens.

    Science.gov (United States)

    Wood, Ruth I

    2004-11-15

    Are androgens reinforcing? Androgenic-anabolic steroids (AAS) are drugs of abuse. They are taken in large quantities by athletes and others to increase performance, often with negative long-term health consequences. As a result, in 1991, testosterone was declared a controlled substance. Recently, Brower [K.J. Brower, Anabolic steroid abuse and dependence. Curr. Psychiatry Rep. 4 (2002) 377-387.] proposed a two-stage model of AAS dependence. Users initiate steroid use for their anabolic effects on muscle growth. With continued exposure, dependence on the psychoactive effects of AAS develops. However, it is difficult in humans to separate direct psychoactive effects of AAS from the user's psychological dependence on the anabolic effects of AAS. Thus, studies in laboratory animals are useful to explore androgen reinforcement. Testosterone induces a conditioned place preference in rats and mice, and is voluntarily consumed through oral, intravenous, and intracerebroventricular self-administration in hamsters. Active, gonad-intact male and female hamsters will deliver 1 microg/microl testosterone into the lateral ventricles. Indeed, some individuals self-administer testosterone intracerebroventricularly to the point of death. Male rats develop a conditioned place preference to testosterone injections into the nucleus accumbens, an effect blocked by dopamine receptor antagonists. These data suggest that androgen reinforcement is mediated by the brain. Moreover, testosterone appears to act through the mesolimbic dopamine system, a common substrate for drugs of abuse. Nonetheless, androgen reinforcement is not comparable to that of cocaine or heroin. Instead, testosterone resembles other mild reinforcers, such as caffeine, nicotine, or benzodiazepines. The potential for androgen addiction remains to be determined.

  5. Red Maca (Lepidium meyenii) did not affect cell viability despite increased androgen receptor and prostate-specific antigen gene expression in the human prostate cancer cell line LNCaP.

    Science.gov (United States)

    Díaz, P; Cardenas, H; Orihuela, P A

    2016-10-01

    We examined whether aqueous extract of Lepidium meyenii (red Maca) could inhibit growth, potentiate apoptotic activity of two anticancer drugs Taxol and 2-methoxyestradiol (2ME) or change mRNA expression for the androgen target genes, androgen receptor (Ar) and prostate-specific antigen (Psa) in the human prostate cancer cell line LNCaP. Red Maca aqueous extract at 0, 10, 20, 40 or 80 μg/ml was added to LNCaP cells, and viability was evaluated by the MTS assay at 24 or 48 hr after treatment. Furthermore, LNCaP cells were treated with 80 μg/ml of red Maca plus Taxol or 2ME 5 μM and viability was assessed 48 hr later. Finally, LNCaP cells were treated with red Maca 0, 20, 40 or 80 μg/ml, and 12 hr later, mRNA level for Ar or Psa was assessed by real-time PCR. Treatment with red Maca did not affect viability of LNCaP cells. Apoptotic activity induced by Taxol and 2ME in LNCaP cells was not altered with red Maca treatment. Relative expression of the mRNA for Ar and Psa increased with red Maca 20 and 40 μg/ml, but not at 80 μg/ml. We conclude that red Maca aqueous extract does not have toxic effects, but stimulates androgen signalling in LNCaP cells.

  6. Achieving HIV-1 Control through RNA-Directed Gene Regulation

    Directory of Open Access Journals (Sweden)

    Vera Klemm

    2016-12-01

    Full Text Available HIV-1 infection has been transformed by combined anti-retroviral therapy (ART, changing a universally fatal infection into a controllable infection. However, major obstacles for an HIV-1 cure exist. The HIV latent reservoir, which exists in resting CD4+ T cells, is not impacted by ART, and can reactivate when ART is interrupted or ceased. Additionally, multi-drug resistance can arise. One alternate approach to conventional HIV-1 drug treatment that is being explored involves gene therapies utilizing RNA-directed gene regulation. Commonly known as RNA interference (RNAi, short interfering RNA (siRNA induce gene silencing in conserved biological pathways, which require a high degree of sequence specificity. This review will provide an overview of the silencing pathways, the current RNAi technologies being developed for HIV-1 gene therapy, current clinical trials, and the challenges faced in progressing these treatments into clinical trials.

  7. Cytotoxic Effects and Androgen Receptor Expression According to Concentrations of Genistein with Silencing Cyclooxygenase–2 Gene Expression in Prostate Cancer Cells

    OpenAIRE

    Kim, Jin Woo; Gotoh, Takafumi; Lim, Hyoun–Sub; Song, Ki Hak; Sul, Chong Koo

    2014-01-01

    COX–2 has major roles in inflammatory reaction, and COX–2 inhibitor and genistein have a chemopreventive effect on some cancers such as colorectal, breast, and prostate cancer (PCa). The aims of this study was to investigate combined effect of COX–2 inhibition and genistein treatment. To address this issue, we tested the degree of cell survival and the changes of androgen receptor in PCa cells with silencing of COX–2 according to concentrations of genistein. DU–145 PCa cells were transfected ...

  8. Reconstructing a network of stress-response regulators via dynamic system modeling of gene regulation.

    Science.gov (United States)

    Wu, Wei-Sheng; Li, Wen-Hsiung; Chen, Bor-Sen

    2008-02-10

    Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs) that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene's expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA) to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specific stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably sufficient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.

  9. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  10. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  11. Doublesex: a conserved downstream gene controlled by diverse upstream regulators

    Indian Academy of Sciences (India)

    J. N. Shukla; J. Nagaraju

    2010-09-01

    Sex determination, an integral precursor to sexual reproduction, is required to generate morphologically distinct sexes. The molecular components of sex-determination pathways regulating sexual differentiation have been identified and characterized in different organisms. The Drosophila doublesex (dsx) gene at the bottom of the sex-determination cascade is the best characterized candidate so far, and is conserved from worms (mab3 of Caenorhabditis elegans) to mammals (Dmrt-1). Studies of dsx homologues from insect species belonging to different orders position them at the bottom of their sex-determination cascade. The dsx homologues are regulated by a series of upstream regulators that show amazing diversity in different insect species. These results support the Wilkin’s hypothesis that evolution of the sex-determination cascade has taken place in reverse order, the bottom most gene being most conserved and the upstream genes having been recruited at different times during evolution. The pre-mRNA of dsx is sex-specifically spliced to encode male or female-specific transcription factors that play an important role in the regulation of sexually dimorphic characters in different insect species. The generalization that dsx is required for somatic sexual differentiation culminated with its functional analysis through transgenesis and knockdown experiments in diverse species of insects. This brief review will focus on the similarities and variations of dsx homologues that have been investigated in insects to date.

  12. Gene Regulation System of Vasopressin and Corticotoropin-Releasing Hormone

    Directory of Open Access Journals (Sweden)

    Masanori Yoshida

    2008-01-01

    Full Text Available The neurohypophyseal hormones, arginine vasopressin and corticotropin-releasing hormone (CRH, play a crucial role in the physiological and behavioral response to various kinds of stresses. Both neuropeptides activate the hypophysialpituitary-adrenal (HPA axis, which is a central mediator of the stress response in the body. Conversely, they receive the negative regulation by glucocorticoid, which is an end product of the HPA axis. Vasopressin and CRH are closely linked to immune response; they also interact with pro-inflammatory cytokines. Moreover, as for vasopressin, it has another important role, which is the regulation of water balance through its potent antidiuretic effect. Hence, it is conceivable that vasopressin and CRH mediate the homeostatic responses for survival and protect organisms from the external world. A tight and elaborate regulation system of the vasopressin and CRH gene is required for the rapid and flexible response to the alteration of the surrounding environments. Several important regulatory elements have been identified in the proximal promoter region in the vasopressin and CRH gene. Many transcription factors and intracellular signaling cascades are involved in the complicated gene regulation system. This review focuses on the current status of the basic research of vasopressin and CRH. In addition to the numerous known facts about their divergent physiological roles, the recent topics of promoter analyses will be discussed.

  13. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  14. Alternative splicing of the androgen receptor in polycystic ovary syndrome

    OpenAIRE

    Wang, Fangfang; Pan, Jiexue; Liu, Ye; Meng, Qing; Lv, Pingping; Qu, Fan; Ding, Guo-Lian; Klausen, Christian; Leung, Peter C. K.; Chan, Hsiao Chang; Yao, Weimiao; Zhou, Cai-Yun; Shi, Biwei; ZHANG, JUNYU; Sheng, Jianzhong

    2015-01-01

    Excess androgens and abnormal follicle development, largely due to ovarian granulosa cell (GC) dysfunction, characterize polycystic ovary syndrome (PCOS), a common endocrinopathy of women predisposing to infertility. Thus, it is important to understand GC dysfunction. The androgen receptor (AR) is widely believed to be an essential regulator of GC biology. High expression of AR in GCs is primarily considered to associate with PCOS. However, we show that AR alternative splice variants in GCs d...

  15. 雄激素受体基因动态突变及线粒体基因分析诊断Kennedy病1例报告%A case report on Kennedy' s disease diagnosed by dynamic mutation of androgen receptor gene and mitochondrial gene analysis

    Institute of Scientific and Technical Information of China (English)

    梁晓瑜; 勾晨雨

    2013-01-01

    目的 通过对一例肌肉活检提示线粒体肌病的患者进行雄激素受体基因(androgen receptor gene,AR)进行动态突变分析和全线粒体(mtDNA)基因扫描明确诊断.方法 使用PCR方法分析患者雄激素受体(androgen receptor gene,AR)基因的CAG重复序列数,使用Touch Down PCR方法分析患者全线粒体基因突变.结果 该患者雄激素受体基因第一个外显子(Xqll-12)上存在46个三核普酸(CAG)重复,确诊Kennedy病.全线粒体(mtDNA)基因分析未显示线粒体疾病的相关致病突变.结论 AR基因CAG动态突变分析和全mtDNA基因扫描是KD与线粒体脑肌病鉴别诊断或KD并发线粒体脑肌病诊断的重要依据.%Objective To diagnose a patient Kennedy' s disease,who was considered as mitochondrial myopathy by dynamic mutation of androgen receptor gene (AR) and mitochondrial gene analysis.Methods Dynamic mutation of AR gene was analyzed by PCR and sequencing,and mtDNA gene was analyzed by touch down PCR and sequencing.Results trinucleotide repeats of CAG were up to 46,and no pathological mutation of mtDNA was found.Conclusion Dynamic mutation analysis of AR gene and mitochondrial gene analysis are indispensable in diagnosing Kennedy' s disease.

  16. Cadmium-regulated gene fusions in Pseudomonas fluorescens.

    Science.gov (United States)

    Rossbach, S; Kukuk, M L; Wilson, T L; Feng, S F; Pearson, M M; Fisher, M A

    2000-08-01

    To study the mechanisms soil bacteria use to cope with elevated concentrations of heavy metals in the environment, a mutagenesis with the lacZ-based reporter gene transposon Tn5B20 was performed. Random gene fusions in the genome of the common soil bacterium Pseudomonas fluorescens strain ATCC 13525 were used to create a bank of 5,000 P. fluorescens mutants. This mutant bank was screened for differential gene expression in the presence of the toxic metal cadmium. Fourteen mutants were identified that responded with increased or reduced gene expression to the presence of cadmium. The mutants were characterized with respect to their metal-dependent gene expression and their metal tolerance. Half the identified mutants reacted with differential gene expression specifically to the metal cadmium, whereas some of the other mutants also responded to elevated concentrations of copper and zinc ions. One of the mutants, strain C8, also showed increased gene expression in the presence of the solvent ethanol, but otherwise no overlap between cadmium-induced gene expression and general stress response was detected. Molecular analysis of the corresponding genetic loci was performed using arbitrary polymerase chain reaction (PCR), DNA sequencing and comparison of the deduced protein products with sequences deposited in genetic databases. Some of the genetic loci targeted by the transposon did not show any similarities to any known genes; thus, they may represent 'novel' loci. The hypothesis that genes that are differentially expressed in the presence of heavy metals play a role in metal tolerance was verified for one of the mutants. This mutant, strain C11, was hypersensitive to cadmium and zinc ions. In mutant C11, the transposon had inserted into a genetic region displaying similarity to genes encoding the sensor/regulator protein pairs of two-component systems that regulate gene expression in metal-resistant bacteria, including czcRS of Ralstonia eutropha, czrRS of Pseudomonas

  17. Differential gene regulation by the SRC family of coactivators

    Institute of Scientific and Technical Information of China (English)

    HuaZhang; XiaYi; Xiaojingsun; NaYin; BinShi; HuijianWu; DanWang; GeWu; YongfengShang

    2005-01-01

    SRCs (steroid receptor coactivatorsl are required for nuclear receptor-mediated transcription and are also implicated in the transcription initiation by other transcription factors, such as STATs and NFKB. Despite phenotypic manifestations in gene knockout mice for SRC-1, GRIP1, and AIB1 of the SRC (Steroid Receptor Coactivator) family indicating their differential roles in animal physiology, there is no clear evidence, at the molecular level, to support a functional specificity for these proteins. We demonstrated in this report that two species of SRC coactivators, either as AIBI:GRIP1 or as AIBI:SRC-1 are recruited, possibly through heterodimerization, on the promoter of genes that contain a classical hormone responsive element (HRE). In contrast, on non-HRE-containing gene promoters, on which steroid receptors bind indirectly, either GRIP1 orSRC-1 is recruited as a monomer, depending on the cellular abundance of the protein. Typically, non-HRE-containing genes are early genes activated by steroid receptors, whereas HRE-containing genes are activated later. Our results also showed that SRC proteins contribute to the temporal regulation of gene transcription. In addition, our experiments revealed a positive correlation between AIB1/c-myc overexpression in ER+ breast carcinoma samples, suggesting a possible mechanism for AIB1/n breast cancer carcinogenesis.

  18. The Regulation of Exosporium-Related Genes in Bacillus thuringiensis

    Science.gov (United States)

    Peng, Qi; Kao, Guiwei; Qu, Ning; Zhang, Jie; Li, Jie; Song, Fuping

    2016-01-01

    Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis (Bt) are spore-forming members of the Bacillus cereus group. Spores of B. cereus group species are encircled by exosporium, which is composed of an external hair-like nap and a paracrystalline basal layer. Despite the extensive studies on the structure of the exosporium-related proteins, little is known about the transcription and regulation of exosporium gene expression in the B. cereus group. Herein, we studied the regulation of several exosporium-related genes in Bt. A SigK consensus sequence is present upstream of genes encoding hair-like nap proteins (bclA and bclB), basal layer proteins (bxpA, bxpB, cotB, and exsY ), and inosine hydrolase (iunH). Mutation of sigK decreased the transcriptional activities of all these genes, indicating that the transcription of these genes is controlled by SigK. Furthermore, mutation of gerE decreased the transcriptional activities of bclB, bxpB, cotB, and iunH but increased the expression of bxpA, and GerE binds to the promoters of bclB, bxpB, cotB, bxpA, and iunH. These results suggest that GerE directly regulates the transcription of these genes, increasing the expression of bclB, bxpB, cotB, and iunH and decreasing that of bxpA. These findings provide insight into the exosporium assembly process at the transcriptional level. PMID:26805020

  19. Translational regulation of human p53 gene expression.

    OpenAIRE

    Fu, L.; Minden, M D; Benchimol, S

    1996-01-01

    In blast cells obtained from patients with acute myelogenous leukemia, p53 mRNA was present in all the samples examined while the expression of p53 protein was variable from patient to patient. Mutations in the p53 gene are infrequent in this disease and, hence, variable protein expression in the majority of the samples cannot be accounted for by mutation. In this study, we examined the regulation of p53 gene expression in human leukemic blasts and characterized the p53 transcripts in these c...

  20. Multiple Catalase Genes Are Differentially Regulated in Aspergillus nidulans

    OpenAIRE

    Kawasaki, Laura; Aguirre, Jesús

    2001-01-01

    Detoxification of hydrogen peroxide is a fundamental aspect of the cellular antioxidant responses in which catalases play a major role. Two differentially regulated catalase genes, catA and catB, have been studied in Aspergillus nidulans. Here we have characterized a third catalase gene, designated catC, which predicts a 475-amino-acid polypeptide containing a peroxisome-targeting signal. With a molecular mass of 54 kDa, CatC shows high similarity to other small-subunit monofunctional catalas...

  1. Genes regulated by AoXlnR, the xylanolytic and cellulolytic transcriptional regulator, in Aspergillus oryzae.

    Science.gov (United States)

    Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo

    2009-11-01

    XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.

  2. Identification of miR-30b-3p and miR-30d-5p as direct regulators of androgen receptor signaling in prostate cancer by complementary functional microRNA library screening.

    Science.gov (United States)

    Kumar, Binod; Khaleghzadegan, Salar; Mears, Brian; Hatano, Koji; Kudrolli, Tarana A; Chowdhury, Wasim H; Yeater, David B; Ewing, Charles M; Luo, Jun; Isaacs, William B; Marchionni, Luigi; Lupold, Shawn E

    2016-11-08

    The Androgen Receptor (AR) plays a key role in prostate biology and in the progression of prostate cancer (PCa) to castration resistance. The role of microRNAs (miRNAs) in aberrant AR signaling have not been fully characterized. Here we screened a library of 810 miRNA mimics to identify miRNAs that alter AR activity in complementary functional assays including protein lysate microarray (LMA) quantification of AR and PSA protein levels, AR transcriptional reporter activity, and AR-positive PCa cell viability. Candidate AR-regulating miRNAs were verified through AR transcriptional reporter and cell viability assays. MiRNA binding sites were found within the AR 3'-untranslated region (UTR) and within the AR and AR-V7 coding regions. MiRNA activity was characterized by western blotting, 3'-UTR reporter assay, and AR-GFP and AR-V7-GFP reporter assays. Results uncovered miR-30 family members as direct AR inhibitors. Inhibition of endogenous miR-30b-3p and miR-30d-5p enhanced AR expression and androgen-independent cell growth. Droplet digital RT-PCR quantification of miR-30c-5p and miR-30d-5p revealed significantly reduced levels in metastatic castration resistant PCa (CRPC), when compared to healthy prostate tissues. MiR-30d-5p levels were inversely correlated with AR activity, as measured by PSA mRNA, in metastatic CRPC. Collectively, these studies provide a comprehensive evaluation of AR-regulating miRNAs in PCa.

  3. Partial Androgen Insensitivity Syndrome

    OpenAIRE

    Sindhu Sharma, Kuldeep Singh, Sanjay Dhar*,Yudhvir Gupta

    2010-01-01

    Androgen insensitivity syndrome (AIS) present at several differentiation from genetic defects to endorgan resistance thereby producing gender dilema dispelled by sex hormones signature.It is quite traumaticfor the patients and family of the affected baby. Extreme sensitivity and awareness on the part of thecaring doctor is necessary for early diagnosis of case of AIS &for successful outcome.

  4. Partial Androgen Insensitivity Syndrome

    Directory of Open Access Journals (Sweden)

    Sindhu Sharma, Kuldeep Singh, Sanjay Dhar*,Yudhvir Gupta

    2010-01-01

    Full Text Available Androgen insensitivity syndrome (AIS present at several differentiation from genetic defects to endorgan resistance thereby producing gender dilema dispelled by sex hormones signature.It is quite traumaticfor the patients and family of the affected baby. Extreme sensitivity and awareness on the part of thecaring doctor is necessary for early diagnosis of case of AIS &for successful outcome.

  5. Androgen insensitivity syndrome

    Science.gov (United States)

    ... syndrome URL of this page: //medlineplus.gov/ency/article/001180.htm Androgen insensitivity syndrome To use the ... a condition in which the opening of the urethra is on the underside of the penis, instead of ... they can develop cancer, just like any undescended testicle. Estrogen replacement is ...

  6. Micro-RNA: A New Kind of Gene Regulators

    Institute of Scientific and Technical Information of China (English)

    WU Dan; HU Lan

    2006-01-01

    A group of small RNA molecules, distinct from but related to siRNAs (small interference RNAs) have been identified in a variety of organisms. These small RNAs, called microRNAs (miRNAs), are endogenously encoded approximately 20-24 nt long single-stranded RNAs. They are generally expressed in a highly tissue- or developmental-stage-specific fashion and are post-transcriptional regulator of gene expression in animals and plants. This article summarizes the character, mechanism and analysis method about miRNAs. The current view that miRNAs represent a newly discovered, hidden layer of gene regulation has resulted in high interest among researchers in the discovery of miRNAs, their targets, expression mechanism of action and analysis methods.

  7. A satellite cell-specific knockout of the androgen receptor reveals myostatin as a direct androgen target in skeletal muscle.

    Science.gov (United States)

    Dubois, Vanessa; Laurent, Michaël R; Sinnesael, Mieke; Cielen, Nele; Helsen, Christine; Clinckemalie, Liesbeth; Spans, Lien; Gayan-Ramirez, Ghislaine; Deldicque, Louise; Hespel, Peter; Carmeliet, Geert; Vanderschueren, Dirk; Claessens, Frank

    2014-07-01

    Androgens have well-established anabolic actions on skeletal muscle, although the direct effects of the androgen receptor (AR) in muscle remain unclear. We generated satellite cell-specific AR-knockout (satARKO) mice in which the AR is selectively ablated in satellite cells, the muscle precursor cells. Total-limb maximal grip strength is decreased by 7% in satARKO mice, with soleus muscles containing ∼10% more type I fibers and 10% less type IIa fibers than the corresponding control littermates. The weight of the perineal levator ani muscle is markedly reduced (-52%). Thus, muscle AR is involved in fiber-type distribution and force production of the limb muscles, while it is a major determinant of the perineal muscle mass. Surprisingly, myostatin (Mstn), a strong inhibitor of skeletal muscle growth, is one of the most androgen-responsive genes (6-fold reduction in satARKO) through direct transcription activation by the AR. Consequently, muscle hypertrophy in response to androgens is augmented in Mstn-knockout mice. Our finding that androgens induce Mstn signaling to restrain their own anabolic actions has implications for the treatment of muscle wasting disorders.-Dubois, V., Laurent, M. R., Sinnesael, M., Cielen, N., Helsen, C., Clinckemalie, L., Spans, L., Gayan-Ramirez, G., Deldicque, L., Hespel, P., Carmeliet, G., Vanderschueren, D., and Claessens, F. A satellite cell-specific knockout of the androgen receptor reveals myostatin as a direct androgen target in skeletal muscle.

  8. Oxygen regulated gene expression in facultatively anaerobic bacteria.

    Science.gov (United States)

    Unden, G; Becker, S; Bongaerts, J; Schirawski, J; Six, S

    1994-01-01

    In facultatively anaerobic bacteria such as Escherichia coli, oxygen and other electron acceptors fundamentally influence catabolic and anabolic pathways. E. coli is able to grow aerobically by respiration and in the absence of O2 by anaerobic respiration with nitrate, nitrite, fumarate, dimethylsulfoxide and trimethylamine N-oxide as acceptors or by fermentation. The expression of the various catabolic pathways occurs according to a hierarchy with 3 or 4 levels. Aerobic respiration at the highest level is followed by nitrate respiration (level 2), anaerobic respiration with the other acceptors (level 3) and fermentation. In other bacteria, different regulatory cascades with other underlying principles can be observed. Regulation of anabolism in response to O2 availability is important, too. It is caused by different requirements of cofactors or coenzymes in aerobic and anaerobic metabolism and by the requirement for different O2-independent biosynthetic routes under anoxia. The regulation mainly occurs at the transcriptional level. In E. coli, 4 global regulatory systems are known to be essential for the aerobic/anaerobic switch and the described hierarchy. A two-component sensor/regulator system comprising ArcB (sensor) and ArcA (transcriptional regulator) is responsible for regulation of aerobic metabolism. The FNR protein is a transcriptional sensor-regulator protein which regulates anaerobic respiratory genes in response to O2 availability. The gene activator FhlA regulates fermentative formate and hydrogen metabolism with formate as the inductor. ArcA/B and FNR directly respond to O2, FhlA indirectly by decreased levels of formate in the presence of O2. Regulation of nitrate/nitrite catabolism is effected by two 2-component sensor/regulator systems NarX(Q)/NarL(P) in response to nitrate/nitrite. Co-operation of the different regulatory systems at the target promoters which are in part under dual (or manifold) transcriptional control causes the expression

  9. Reconstructing a Network of Stress-Response Regulators via Dynamic System Modeling of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Wei-Sheng Wu

    2008-01-01

    Full Text Available Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene’s expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specifi c stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably suffi cient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.

  10. Cognitive analysis of schizophrenia risk genes that function as epigenetic regulators of gene expression.

    Science.gov (United States)

    Whitton, Laura; Cosgrove, Donna; Clarkson, Christopher; Harold, Denise; Kendall, Kimberley; Richards, Alex; Mantripragada, Kiran; Owen, Michael J; O'Donovan, Michael C; Walters, James; Hartmann, Annette; Konte, Betina; Rujescu, Dan; Gill, Michael; Corvin, Aiden; Rea, Stephen; Donohoe, Gary; Morris, Derek W

    2016-12-01

    Epigenetic mechanisms are an important heritable and dynamic means of regulating various genomic functions, including gene expression, to orchestrate brain development, adult neurogenesis, and synaptic plasticity. These processes when perturbed are thought to contribute to schizophrenia pathophysiology. A core feature of schizophrenia is cognitive dysfunction. For genetic disorders where cognitive impairment is more severe such as intellectual disability, there are a disproportionally high number of genes involved in the epigenetic regulation of gene transcription. Evidence now supports some shared genetic aetiology between schizophrenia and intellectual disability. GWAS have identified 108 chromosomal regions associated with schizophrenia risk that span 350 genes. This study identified genes mapping to those loci that have epigenetic functions, and tested the risk alleles defining those loci for association with cognitive deficits. We developed a list of 350 genes with epigenetic functions and cross-referenced this with the GWAS loci. This identified eight candidate genes: BCL11B, CHD7, EP300, EPC2, GATAD2A, KDM3B, RERE, SATB2. Using a dataset of Irish psychosis cases and controls (n = 1235), the schizophrenia risk SNPs at these loci were tested for effects on IQ, working memory, episodic memory, and attention. Strongest associations were for rs6984242 with both measures of IQ (P = 0.001) and episodic memory (P = 0.007). We link rs6984242 to CHD7 via a long range eQTL. These associations were not replicated in independent samples. Our study highlights that a number of genes mapping to risk loci for schizophrenia may function as epigenetic regulators of gene expression but further studies are required to establish a role for these genes in cognition. © 2016 Wiley Periodicals, Inc.

  11. The evolution of combinatorial gene regulation in fungi.

    OpenAIRE

    Tuch, Brian B.; Galgoczy, David J.; Hernday, Aaron D.; Hao Li; Johnson, Alexander D.

    2008-01-01

    It is widely suspected that gene regulatory networks are highly plastic. The rapid turnover of transcription factor binding sites has been predicted on theoretical grounds and has been experimentally demonstrated in closely related species. We combined experimental approaches with comparative genomics to focus on the role of combinatorial control in the evolution of a large transcriptional circuit in the fungal lineage. Our study centers on Mcm1, a transcriptional regulator that, in combinati...

  12. Regulation of cry Gene Expression in Bacillus thuringiensis

    OpenAIRE

    Chao Deng; Qi Peng; Fuping Song; Didier Lereclus

    2014-01-01

    Bacillus thuringiensis differs from the closely related Bacillus cereus group species by its ability to produce crystalline inclusions. The production of these crystals mainly results from the expression of the cry genes, from the stability of their transcripts and from the synthesis, accumulation and crystallization of large amounts of insecticidal Cry proteins. This process normally coincides with sporulation and is regulated by various factors operating at the transcriptional, post-transcr...

  13. Regulation of cry Gene Expression in Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Chao Deng

    2014-07-01

    Full Text Available Bacillus thuringiensis differs from the closely related Bacillus cereus group species by its ability to produce crystalline inclusions. The production of these crystals mainly results from the expression of the cry genes, from the stability of their transcripts and from the synthesis, accumulation and crystallization of large amounts of insecticidal Cry proteins. This process normally coincides with sporulation and is regulated by various factors operating at the transcriptional, post-transcriptional, metabolic and post-translational levels.

  14. The role of master regulators in gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Enrique Hernández Lemus

    2015-05-01

    Full Text Available Gene regulatory networks present a wide variety of dynamical responses to intrinsic and extrinsic perturbations. Arguably, one of the most important of such coordinated responses is the one of amplification cascades, in which activation of a few key-responsive transcription factors (termed master regulators, MRs lead to a large series of transcriptional activation events. This is so since master regulators are transcription factors controlling the expression of other transcription factor molecules and so on. MRs hold a central position related to transcriptional dynamics and control of gene regulatory networks and are often involved in complex feedback and feedforward loops inducing non-trivial dynamics. Recent studies have pointed out to the myocyte enhancing factor 2C (MEF2C, also known as MADS box transcription enhancer factor 2, polypeptide C as being one of such master regulators involved in the pathogenesis of primary breast cancer. In this work, we perform an integrative genomic analysis of the transcriptional regulation activity of MEF2C and its target genes to evaluate to what extent are these molecules inducing collective responses leading to gene expression deregulation and carcinogenesis. We also analyzed a number of induced dynamic responses, in particular those associated with transcriptional bursts, and nonlinear cascading to evaluate the influence they may have in malignant phenotypes and cancer. Received: 20 Novembre 2014, Accepted: 24 June 2015; Edited by: C. A. Condat, G. J. Sibona; DOI: http://dx.doi.org/10.4279/PIP.070011 Cite as: E Hernández-Lemus, K Baca-López, R Lemus, R García-Herrera, Papers in Physics 7, 070011 (2015

  15. [Insect antimicrobial peptides: structures, properties and gene regulation].

    Science.gov (United States)

    Wang, Yi-Peng; Lai, Ren

    2010-02-01

    Insect antimicrobial peptides (AMPs) are an important group of insect innate immunity effectors. Insect AMPs are cationic and contain less than 100 amino acid residues. According to structure, insect AMPs can be divided into a limited number of families. The diverse antimicrobial spectrum of insect AMPs may indicate different modes of action. Research on the model organism Drosophila indicate that insect AMPs gene regulation involves multiple signaling pathways and a large number of signaling molecules.

  16. Complete Androgen Insensitivity Syndrome: A Rare Case of Disorder of Sex Development

    OpenAIRE

    Alfonsa Pizzo; Antonio Simone Laganà; Irene Borrielli; Nella Dugo

    2013-01-01

    Androgen Insensitivity Syndrome (AIS) could be considered as a disease that causes resistance to androgens actions, influencing both the morphogenesis and differentiation of the body structures, and systems in which this hormone exerts its effects. It depends on an X-linked mutations in the Androgen Receptor (AR) gene that express a variety of phenotypes ranging from male infertility to completely normal female external genitalia. The clinical phenotypes of AIS could vary and be classified in...

  17. Statistical modelling of transcript profiles of differentially regulated genes

    Directory of Open Access Journals (Sweden)

    Sergeant Martin J

    2008-07-01

    Full Text Available Abstract Background The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. Results Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t = A + (B + CtRt + ε. This non-linear regression approach allowed the expression patterns for different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data

  18. Mechanisms of post-transcriptional gene regulation in bacterial biofilms

    Directory of Open Access Journals (Sweden)

    Viveka eVadyvaloo

    2014-03-01

    Full Text Available Abstract Biofilms are characterized by a dense multicellular community of microorganisms that can be formed by the attachment of bacteria to an inert surface and to each other. The development of biofilm involves the initial attachment of planktonic bacteria to a surface, followed by replication, cell-to-cell adhesion to form microcolonies, maturation and detachment. Mature biofilms are embedded in a self-produced extracellular polymeric matrix composed primarily of bacterial-derived exopolysaccharides, specialized proteins, adhesins and occasionally DNA. Because the synthesis and assembly of biofilm matrix components is an exceptionally complex process, the transition between its different phases requires the coordinate expression and simultaneous regulation of many genes by complex genetic networks involving all levels of gene regulation. The finely controlled intracellular level of the chemical second messenger molecule, cyclic-di-GMP is central to the post-transcriptional mechanisms governing the switch between the motile planktonic lifestyle and the sessile biofilm forming state in many bacteria. Several other post-transcriptional regulatory mechanisms are known to dictate biofilm development and assembly and these include RNA-binding proteins, small non-coding RNAs, toxin-antitoxin systems, riboswitches and RNases. Post-transcriptional regulation is therefore a powerful molecular mechanism employed by bacteria to rapidly adjust to the changing environment and to fine tune gene expression to the developmental needs of the cell. In this review, we discuss post-transcriptional mechanisms that influence the biofilm developmental cycle in a variety of pathogenic bacteria.

  19. Inducible gene expression and environmentally regulated genes in lactic acid bacteria.

    Science.gov (United States)

    Kok, J

    1996-10-01

    Relatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their transcription was studied and found to be regulatable. Examples are the lactose operon, the operon for nisin production, and genes in the proteolytic pathway of Lactococcus lactis, as well as xylose metabolism in Lactobacillus pentosus. Some other operons were specifically targetted with the aim to compare their mode of regulation with known regulatory mechanisms in other well-studied bacteria. These studies, dealing with the biosynthesis of histidine, tryptophan, and of the branched chain amino acids in L. lactis, have given new insights in gene regulation and in the occurrence of auxotrophy in these bacteria. Also, nucleotide sequence analyses of a number of lactococcal bacteriophages was recently initiated to, among other things, specifically learn more about regulation of the phage life cycle. Yet another approach in the analysis of regulated genes is the 'random' selection of genetic elements that respond to environmental stimuli and the first of such sequences from lactic acid bacteria have been identified and characterized. The potential of these regulatory elements in fundamental research and practical (industrial) applications will be discussed.

  20. Development and exploitation of a novel mutant androgen receptor modelling strategy to identify new targets for advanced prostate cancer therapy.

    Science.gov (United States)

    O'Neill, Daniel; Jones, Dominic; Wade, Mark; Grey, James; Nakjang, Sirintra; Guo, Wenrui; Cork, David; Davies, Barry R; Wedge, Steve R; Robson, Craig N; Gaughan, Luke

    2015-09-22

    The persistence of androgen receptor (AR) signalling in castrate-resistant prostate cancer (CRPC) highlights the unmet clinical need for the development of more effective AR targeting therapies. A key mechanism of therapy-resistance is by selection of AR mutations that convert anti-androgens to agonists enabling the retention of androgenic signalling in CRPC. To improve our understanding of these receptors in advanced disease we developed a physiologically-relevant model to analyse the global functionality of AR mutants in CRPC. Using the bicalutamide-activated AR(W741L/C) mutation as proof of concept, we demonstrate that this mutant confers an androgenic-like signalling programme and growth promoting phenotype in the presence of bicalutamide. Transcriptomic profiling of AR(W741L) highlighted key genes markedly up-regulated by the mutant receptor, including TIPARP, RASD1 and SGK1. Importantly, SGK1 expression was found to be highly expressed in the KUCaP xenograft model and a CRPC patient biopsy sample both of which express the bicalutamide-activated receptor mutant. Using an SGK1 inhibitor, AR(W741L) transcriptional and growth promoting activity was reduced indicating that exploiting functional distinctions between receptor isoforms in our model may provide new and effective therapies for CRPC patients.

  1. Globalisation reaches gene regulation: the case for vertebrate limb development.

    Science.gov (United States)

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  2. MTA3 regulates CGB5 and Snail genes in trophoblast

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  3. Normal phenotype in conditional androgen receptor (AR) exon 3-floxed neomycin-negative male mice.

    Science.gov (United States)

    Rana, Kesha; Clarke, Michele V; Zajac, Jeffrey D; Davey, Rachel A; MacLean, Helen E

    2014-01-01

    Androgens (testosterone and dihydrotestosterone) acting via the androgen receptor (AR) are required for male sexual differentiation, and also regulate the development of many other tissues including muscle, fat and bone. We previously generated an AR(lox) mouse line with exon 3 of the AR gene targeted by loxP sites. The deletion of exon 3 is in-frame, so only the DNA binding-dependent actions of the AR are deleted, but non-DNA binding-dependent actions are retained. This line also contained an antibiotic resistance selection cassette, neomycin (neo) in intron 3, which was also flanked by loxP sites. Hemizygous AR(lox) male mice demonstrated a phenotype of hyperandrogenization, with increased mass of androgen-dependent tissues. We hypothesized that this hyperandrogenization was likely to be due to the presence of the neo cassette. In this study, we have generated an AR(lox) neo-negative mouse line, using the EIIa-cre deleter mouse line to remove the neo cassette. Hemizygous AR(lox) neo-negative male mice have a normal phenotype, with normal body mass and normal mass of androgen-dependent tissues including the testis, seminal vesicles, kidney, spleen, heart and retroperitoneal fat. This neo-negative exon 3-targeted mouse line is the only floxed AR mouse line available to study the DNA binding-dependent actions of the AR in a tissue-specific manner, and is suitable for investigation in all tissues. This study demonstrates the importance of removing the selection cassette, which can potentially alter the phenotype of floxed mouse lines even in the absence of detectable effects on target gene expression.

  4. An optimized, chemically regulated gene expression system for Chlamydomonas.

    Directory of Open Access Journals (Sweden)

    Paola Ferrante

    Full Text Available BACKGROUND: Chlamydomonas reinhardtii is a model system for algal and cell biology and is used for biotechnological applications, such as molecular farming or biological hydrogen production. The Chlamydomonas metal-responsive CYC6 promoter is repressed by copper and induced by nickel ions. However, induction by nickel is weak in some strains, poorly reversible by chelating agents like EDTA, and causes, at high concentrations, toxicity side effects on Chlamydomonas growth. Removal of these bottlenecks will encourage the wide use of this promoter as a chemically regulated gene expression system. METHODOLOGY: Using a codon-optimized Renilla luciferase as a reporter gene, we explored several strategies to improve the strength and reversibility of CYC6 promoter induction. Use of the first intron of the RBCS2 gene or of a modified TAP medium increases the strength of CYC6 induction up to 20-fold. In the modified medium, induction is also obtained after addition of specific copper chelators, like TETA. At low concentrations (up to 10 microM TETA is a more efficient inducer than Ni, which becomes a very efficient inducer at higher concentrations (50 microM. Neither TETA nor Ni show toxicity effects at the concentrations used. Unlike induction by Ni, induction by TETA is completely reversible by micromolar copper concentrations, thus resulting in a transient "wave" in luciferase activity, which can be repeated in subsequent growth cycles. CONCLUSIONS: We have worked out a chemically regulated gene expression system that can be finely tuned to produce temporally controlled "waves" in gene expression. The use of cassettes containing the CYC6 promoter, and of modified growth media, is a reliable and economically sustainable system for the temporally controlled expression of foreign genes in Chlamydomonas.

  5. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  6. Effects of bidirectional regulation on noises in gene networks.

    Science.gov (United States)

    Zheng, Xiudeng; Tao, Yi

    2010-03-14

    To investigate the effects of bidirectional regulation on the noise in protein concentration, a theoretical and simple three-gene network model is considered. The basic idea behind this model is from Paulsson's proposition (J. Paulsson, Phys. Life Rev. 2005, 2, 157-175), where the synthesis and degradation of a mRNA species corresponding to a target protein are regulated directly and indirectly by a certain sigma-factor, and a random increase in the concentration of the sigma-factor should increase both the synthesis and degradation rates of the mRNA species (bidirectional regulation). Using the standard Omega-expansion technique (linear noise approximation) and Monte Carlo simulation, our main results show clearly that for the steady-state statistics the effects of the noise of the sigma-factor on the stochastic fluctuation of the target protein could partially cancel out.

  7. Mechanisms of microRNA-mediated gene regulation

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    microRNAs (miRNAs) are identified as a class of non-protein regulators and a new source for broad control of gene expression in eukaryotes. The past years have witnessed substantial progress in understanding miRNA functions and mechanisms, although a few controversies remain. Various hypotheses and models have been suggested for the mechanisms of miRNA repression, including translational inhibition at the level of initiation or elongation, rapid degradation of the nascent peptide, mRNA degradation, and mRNA sequestration into P bodies (processing bodies) and SGs (stress granules) for degradation or/and storage. Recently, some noncanonical miRNA regulation, such as miRNA activation and de-repression of miRNA inhibition, have been uncovered. This review discusses some recent advances about how miRNAs regulate their targets and various modes of miRNA function.

  8. Neonatal androgenization exacerbates alcohol-induced liver injury in adult rats, an effect abrogated by estrogen.

    Directory of Open Access Journals (Sweden)

    Whitney M Ellefson

    Full Text Available Alcoholic liver disease (ALD affects millions of people worldwide and is a major cause of morbidity and mortality. However, fewer than 10% of heavy drinkers progress to later stages of injury, suggesting other factors in ALD development, including environmental exposures and genetics. Females display greater susceptibility to the early damaging effects of ethanol. Estrogen (E2 and ethanol metabolizing enzymes (cytochrome P450, CYP450 are implicated in sex differences of ALD. Sex steroid hormones are developmentally regulated by the hypothalamic-pituitary-gonadal (HPG axis, which controls sex-specific cycling of gonadal steroid production and expression of hepatic enzymes. The aim of this study was to determine if early postnatal inhibition of adult cyclic E2 alters ethanol metabolizing enzyme expression contributing to the development of ALD in adulthood. An androgenized rat model was used to inhibit cyclic E2 production. Control females (Ctrl, androgenized females (Andro and Andro females with E2 implants were administered either an ethanol or isocalorically-matched control Lieber-DeCarli diet for four weeks and liver injury and CYP450 expression assessed. Androgenization exacerbated the deleterious effects of ethanol demonstrated by increased steatosis, lipid peroxidation, profibrotic gene expression and decreased antioxidant defenses compared to Ctrl. Additionally, CYP2E1 expression was down-regulated in Andro animals on both diets. No change was observed in CYP1A2 protein expression. Further, continuous exogenous administration of E2 to Andro in adulthood attenuated these effects, suggesting that E2 has protective effects in the androgenized animal. Therefore, early postnatal inhibition of cyclic E2 modulates development and progression of ALD in adulthood.

  9. Synthetic androgens as designer supplements.

    Science.gov (United States)

    Joseph, Jan Felix; Parr, Maria Kristina

    2015-01-01

    Anabolic androgenic steroids (AAS) are some of the most common performance enhancing drugs (PED) among society. Despite the broad spectrum of adverse effects and legal consequences, AAS are illicitly marketed and distributed in many countries. To circumvent existing laws, the chemical structure of AAS is modified and these designer steroids are sold as nutritional supplements mainly over the Internet. Several side effects are linked with AAS abuse. Only little is known about the pharmacological effects and metabolism of unapproved steroids due to the absence of clinical studies. The large number of designer steroid findings in dietary supplements and the detection of new compounds combined with legal loopholes for their distribution in many countries show that stricter regulations and better information policy are needed.

  10. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  11. CHD8, A Novel Beta-Catenin Associated Chromatin Remodeling Enzyme, Regulates Androgen Receptor Mediated Gene Transcription

    Science.gov (United States)

    2010-03-01

    NP- 40 , Nonidet P - 40 ; PPAR, peroxisome prolif- erator-activated receptor; PSA, prostate-specific antigen; SDS, sodium dodecyl sulfate; siRNA, small... Nonidet P - 40 (NP- 40 ). Cell lysates were cleared by centrifugation at 20,800 g for 10 min at 4 C and used for protein interaction studies as...or therapeutic target in prostate cancer. REFERENCES 1. Mulholland, D. J., Cheng, H., Reid, K., Rennie, P . S., and Nelson, C. C. (2002) J Biol

  12. One and the same androgen for all? towards designer androgens

    Institute of Scientific and Technical Information of China (English)

    LouisJGGooren; NhuThanhNguyen

    1999-01-01

    The introduction of designer oestrogens as a treatment medality in hormone replacement in women has invited to consider the concept of compounds with selective androgenic effects for male honnone replacement therapy. The full spectrum of the actions of testosterone may not be necessary of even undesired for certain indications for testosterone treatment, To define for what indications certain androgenic properties are desired and undesired more insight in basic androgen (patho)physiology is required. There is convincing evidence that aromatization of androgenic compounds to nestrogens might be an advantage for maintenance of bone mass and it might also mitigate negative effects of androgens on bichemical parameters of cardiovascular risks: the potentially negative effects of oestmgens on prostate pathology in ageing men needs further elucidation. While the role of dihydro-testosterone (DHT) for the male sexual differentiation and for pubertal sexual maturation is evident, its role in mature and ageing males seems less significant or may even be harmful. It is, however, of note that a negative effect of DHT on prostate pathophysiolog~ is certainly not proven.For male contraception a progestational agent with strong androgenic properties might be an asset. For most of the androgenic actions the critical levels of androgens are not well established. The latter is relevant since the large amount of androgen molecules required for its biological actions (as compared to oestrogens) is an impediment in androgen replacement medalities. There may be room for more biopotent androgens since delivery of large amounts of androgen molecules to the circulation poses problems fur treatment modalities. ( Asian J Andro11999 Jun; 1:21 -28)

  13. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    DEFF Research Database (Denmark)

    Kaur, Simranjeet; Pociot, Flemming

    2015-01-01

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate...... genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune......-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures...

  14. Identification of differentially regulated genes in human patent ductus arteriosus.

    Science.gov (United States)

    Parikh, Pratik; Bai, Haiqing; Swartz, Michael F; Alfieris, George M; Dean, David A

    2016-07-27

    In order to identify differentially expressed genes that are specific to the ductus arteriosus, 18 candidate genes were evaluated in matched ductus arteriosus and aortic samples from infants with coarctation of the aorta. The cell specificity of the gene's promoters was assessed by performing transient transfection studies in primary cells derived from several patients. Segments of ductus arteriosus and aorta were isolated from infants requiring repair for coarctation of the aorta and used for mRNA quantitation and culturing of cells. Differences in expression were determined by quantitative PCR using the ΔΔCt method. Promoter regions of six of these genes were cloned into luciferase reporter plasmids for transient transfection studies in matched human ductus arteriosus and aorta cells. Transcription factor AP-2b and phospholipase A2 were significantly up-regulated in ductus arteriosus compared to aorta in whole tissues and cultured cells, respectively. In transient transfection experiments, Angiotensin II type 1 receptor and Prostaglandin E receptor 4 promoters consistently gave higher expression in matched ductus arteriosus versus aorta cells from multiple patients. Taken together, these results demonstrate that several genes are differentially expressed in ductus arteriosus and that their promoters may be used to drive ductus arteriosus-enriched transgene expression.

  15. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  16. Turning the gene tap off; implications of regulating gene expression for cancer therapeutics.

    Science.gov (United States)

    Curtin, James F; Candolfi, Marianela; Xiong, Weidong; Lowenstein, Pedro R; Castro, Maria G

    2008-03-01

    Cancer poses a tremendous therapeutic challenge worldwide, highlighting the critical need for developing novel therapeutics. A promising cancer treatment modality is gene therapy, which is a form of molecular medicine designed to introduce into target cells genetic material with therapeutic intent. Anticancer gene therapy strategies currently used in preclinical models, and in some cases in the clinic, include proapoptotic genes, oncolytic/replicative vectors, conditional cytotoxic approaches, inhibition of angiogenesis, inhibition of growth factor signaling, inactivation of oncogenes, inhibition of tumor invasion and stimulation of the immune system. The translation of these novel therapeutic modalities from the preclinical setting to the clinic has been driven by encouraging preclinical efficacy data and advances in gene delivery technologies. One area of intense research involves the ability to accurately regulate the levels of therapeutic gene expression to achieve enhanced efficacy and provide the capability to switch gene expression off completely if adverse side effects should arise. This feature could also be implemented to switch gene expression off when a successful therapeutic outcome ensues. Here, we will review recent developments related to the engineering of transcriptional switches within gene delivery systems, which could be implemented in clinical gene therapy applications directed at the treatment of cancer.

  17. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  18. Epigenetic mechanisms of gene expression regulation in neurological diseases.

    Science.gov (United States)

    Gos, Monika

    2013-01-01

    Neurological diseases are a heterogenous group of disorders that are related to alterations in nervous system function. The genetic background of neurological diseases is heterogenous and may include chromosomal aberrations, specific gene mutations and epigenetic defects. This review is aimed at presenting of selected diseases that are associated with different epigenetic alterations. The imprinting defects on chromosome 15 are the cause of Prader-Willi and Angelman syndromes that both are characterized by intellectual disability, developmental delay and specific behavioral phenotype. Besides the imprinting defect, these diseases can also be caused by deletion of chromosome 15 or uniparental disomy. Aberrant epigenetic regulation is also specific for Fragile X syndrome that is caused by expansion of CGG repeats in the FMR1 gene that leads to global methylation of the promoter region and repression of FMR1 transcription. A number of neurological diseases, mainly associated with intellectual impairment, may be caused by mutations in genes encoding proteins involved in epigenetic regulation. The number of such diseases is rapidly growing thanks to the implementation of genomic sequencing for the identification of their molecular causes. One of the best known diseases linked to defects in epigenetic modifiers is Rett syndrome caused by a mutation in the MECP2 gene or its variant - Rett-like syndrome caused by a mutation in CDKL5 or FOXG1 genes. As the epigenetic signature is potentially reversible, much attention is focused on possible therapies with drugs that influence DNA or histone modifications. This is especially important in the case of neurological disorders in which epigenetic changes are observed as the effect of the disease.

  19. Adrenal glucocorticoids regulate adipsin gene expression in genetically obese mice.

    Science.gov (United States)

    Spiegelman, B M; Lowell, B; Napolitano, A; Dubuc, P; Barton, D; Francke, U; Groves, D L; Cook, K S; Flier, J S

    1989-01-25

    Adipsin expression at the protein and mRNA levels is greatly reduced in several distinct syndromes of obesity in the mouse: genetic obesity due to the db/db and ob/ob genes, and a chemically induced model secondary to neonatal exposure to monosodium glutamate. We considered first the possibility that the adipsin gene might be identical to the db or ob locus and the lowered expression of this protein might result from a mutation in this gene. We show here that the adipsin structural gene is located on chromosome 10 and hence is physically distinct from any obesity genes so far identified in the mouse. A major role for the adrenal gland and adrenal glucocorticoids in the aberrant regulation of adipsin in these models of obesity is indicated by several experiments. Adrenalectomy of the ob/ob mouse raises the circulating levels of adipsin protein and the amount of this mRNA in epididymal fat pads (5-fold), although neither is increased to the levels seen in lean controls. Exogenous administration of corticosterone completely blocks the effects of adrenalectomy on adipsin, suggesting that the effect of this endocrine ablation is through reduction of adrenal glucocorticoids. Corticosterone administration also causes suppression in the levels of adipsin mRNA and protein in lean mice, although this decrease is never as severe as that seen in obese mice. The effect of exogenous corticosterone in lean mice occurs within 2 days and hence is not secondary to the obesity which these hormones eventually elicit. These results indicate that glucocorticoids can regulate adipsin expression in vivo and strongly suggest that the hyperglucocorticoid state seen in certain obese models plays a significant role in lowering adipsin mRNA and protein levels. Quantitative analysis of these experiments suggests that other as yet unknown neuroendocrine factors also function to suppress adipsin in obesity.

  20. Growth phase-dependent gene regulation in vivo in Sulfolobus solfataricus

    NARCIS (Netherlands)

    DeYoung, M.; Oost, van der J.

    2011-01-01

    Ribosomal genes are strongly regulated dependent on growth phase in all organisms, but this regulation is poorly understood in Archaea. Moreover, very little is known about growth phase-dependent gene regulation in Archaea. SSV1-based lacS reporter gene constructs containing the Sulfolobus 16S/23S r

  1. Estrogen and prostate cancer: an eclipsed truth in an androgen-dominated scenario.

    Science.gov (United States)

    Carruba, Giuseppe

    2007-11-01

    estrogens, combined with androgens, appear to be required for the malignant transformation of prostate epithelial cells. Although the mechanisms underlying the hormonal induction of prostate cancer in experimental animals remain uncertain, there is however evidence to support the assumption that long term administration of androgens and estrogens results in an estrogenic milieu in rat prostates and in the ensuing development of dysplasia and cancer. Both androgen and estrogen have been reported to stimulate proliferation of cultured prostate cancer cells, primarily through receptor-mediated effects. As for estrogens, the two major receptor types, ERalpha and ERbeta, are expressed in both normal and diseased human prostate, though with a different cellular localization. Since these two receptors are different in terms of ligand binding, heterodimerization, transactivation, and estrogen response element activity, it is likely that an imbalance of their expression may be critical to determine the ultimate estrogen effects on prostate cancer cells. In prostate cancer, ERbeta activation appears to limit cell proliferation directly or through ERalpha inhibition, and loss of ERbeta has been consistently associated with tumor progression. Several splicing variants of both ERalpha and ERbeta exist. Little is known about their expression and function in the human prostate, although reciprocal regulation and interaction with gene promoter both warrant further investigation. In summary, although multiple consistent evidence suggests that estrogens are critical players in human prostate cancer, their role has been only recently reconsidered, being eclipsed for years by an androgen-dominated interest.

  2. Metabolic syndrome, androgens, and hypertension.

    Science.gov (United States)

    Moulana, Mohadetheh; Lima, Roberta; Reckelhoff, Jane F

    2011-04-01

    Obesity is one of the constellation of factors that make up the definition of the metabolic syndrome. Metabolic syndrome is also associated with insulin resistance, dyslipidemia, hypertriglyceridemia, and type 2 diabetes mellitus. The presence of obesity and metabolic syndrome in men and women is also associated with increased risk of cardiovascular disease and hypertension. In men, obesity and metabolic syndrome are associated with reductions in testosterone levels. In women, obesity and metabolic syndrome are associated with increases in androgen levels. In men, reductions in androgen levels are associated with inflammation, and androgen supplements reduce inflammation. In women, increases in androgens are associated with increases in inflammatory cytokines, and reducing androgens reduces inflammation. This review discusses the possibility that the effects of androgens on metabolic syndrome and its sequelae may differ between males and females.

  3. Gene Regulation, Modulation, and Their Applications in Gene Expression Data Analysis

    Directory of Open Access Journals (Sweden)

    Mario Flores

    2013-01-01

    Full Text Available Common microarray and next-generation sequencing data analysis concentrate on tumor subtype classification, marker detection, and transcriptional regulation discovery during biological processes by exploring the correlated gene expression patterns and their shared functions. Genetic regulatory network (GRN based approaches have been employed in many large studies in order to scrutinize for dysregulation and potential treatment controls. In addition to gene regulation and network construction, the concept of the network modulator that has significant systemic impact has been proposed, and detection algorithms have been developed in past years. Here we provide a unified mathematic description of these methods, followed with a brief survey of these modulator identification algorithms. As an early attempt to extend the concept to new RNA regulation mechanism, competitive endogenous RNA (ceRNA, into a modulator framework, we provide two applications to illustrate the network construction, modulation effect, and the preliminary finding from these networks. Those methods we surveyed and developed are used to dissect the regulated network under different modulators. Not limit to these, the concept of “modulation” can adapt to various biological mechanisms to discover the novel gene regulation mechanisms.

  4. Synthetic RNAs for gene regulation: design principles and computational tools

    Directory of Open Access Journals (Sweden)

    Alessandro eLaganà

    2014-12-01

    Full Text Available The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies, but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis and the evaluation of RNAi agents such as small-interfering RNA (siRNA, short-hairpin RNA (shRNA, artificial microRNA (a-miR and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats, was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  5. Regulation of the Saccharomyces cerevisiae DNA repair gene RAD16.

    Science.gov (United States)

    Bang, D D; Timmermans, V; Verhage, R; Zeeman, A M; van de Putte, P; Brouwer, J

    1995-05-25

    The RAD16 gene product has been shown to be essential for the repair of the silenced mating type loci [Bang et al. (1992) Nucleic Acids Res. 20, 3925-3931]. More recently we demonstrated that the RAD16 and RAD7 proteins are also required for repair of non-transcribed strands of active genes in Saccharomyces cerevisiae [Waters et al. (1993) Mol. Gen. Genet. 239, 28-32]. We have studied the regulation of the RAD16 gene and found that the RAD16 transcript levels increased up to 7-fold upon UV irradiation. Heat shock at 42 degrees C also results in elevated levels of RAD16 mRNA. In sporulating MAT alpha/MATa diploid cells RAD16 mRNA is also induced. The basal level of the RAD16 transcript is constant during the mitotic cell cycle. G1-arrested cells show normal induction of RAD16 mRNA upon UV irradiation demonstrating that the induction is not a secondary consequence of G2 cell cycle arrest following UV irradiation. However, in cells arrested in G1 the induction of RAD16 mRNA after UV irradiation is not followed by a rapid decline as occurs in normal growing cells suggesting that the down regulation of RAD16 transcription is dependent on progression into the cell cycle.

  6. Strategies to identify long noncoding RNAs involved in gene regulation

    Directory of Open Access Journals (Sweden)

    Lee Catherine

    2012-11-01

    Full Text Available Abstract Long noncoding RNAs (lncRNAs have been detected in nearly every cell type and found to be fundamentally involved in many biological processes. The characterization of lncRNAs has immense potential to advance our comprehensive understanding of cellular processes and gene regulation, along with implications for the treatment of human disease. The recent ENCODE (Encyclopedia of DNA Elements study reported 9,640 lncRNA loci in the human genome, which corresponds to around half the number of protein-coding genes. Because of this sheer number and their functional diversity, it is crucial to identify a pool of potentially relevant lncRNAs early on in a given study. In this review, we evaluate the methods for isolating lncRNAs by immunoprecipitation and review the advantages, disadvantages, and applications of three widely used approaches – microarray, tiling array, and RNA-seq – for identifying lncRNAs involved in gene regulation. We also look at ways in which data from publicly available databases such as ENCODE can support the study of lncRNAs.

  7. Regulation of virulence gene expression in pathogenic Listeria.

    Science.gov (United States)

    Brehm, K; Kreft, J; Ripio, M T; Vázquez-Boland, J A

    1996-06-01

    Dynamic interactions between host and pathogen are characteristic of infections caused by intracellular bacteria. This has favoured the evolution of highly effective control systems by which these pathogens regulate the expression of different virulence factors during sequential steps of the infection process. In the case of the facultative intracellular bacterium Listeria monocytogenes, these steps involve internalization by eukaryotic cells, lysis of the resulting phagosome, replication as well as movement within the host cytoplasm, direct cell-to-cell spread, and subsequent lysis of a double-membrane vacuole when entering neighbouring cells. Virulence factors which are involved in each of these steps have been identified and the expression of these factors is subject to a co-ordinate and differential control exerted by the major listerial virulence regulator PrfA. This protein belongs to the Crp/Fnr-family of transcriptional activators and recognizes specific target sequences in promoter regions of several listerial virulence genes. Differential expression of these genes during sequential steps of the infection seems to be at least partially mediated by different binding affinities of PrfA to its target sequences. Activity of PrfA-dependent genes and of prfA itself is under the control of several environmental variables which are used by the pathogen to recognize its transition from the free environment into a eukaryotic host.

  8. ETS gene fusions in prostate cancer: from discovery to daily clinical practice.

    NARCIS (Netherlands)

    Tomlins, S.A.; Bjartell, A.; Chinnaiyan, A.M.; Jenster, G.; Nam, R.K.; Rubin, M.A.; Schalken, J.A.

    2009-01-01

    CONTEXT: In 2005, fusions between the androgen-regulated transmembrane protease serine 2 gene, TMPRSS2, and E twenty-six (ETS) transcription factors were discovered in prostate cancer. OBJECTIVE: To review advances in our understanding of ETS gene fusions, focusing on challenges affecting translatio

  9. Complete Androgen Insensitivity Syndrome: A Rare Case of Disorder of Sex Development

    Directory of Open Access Journals (Sweden)

    Alfonsa Pizzo

    2013-01-01

    Full Text Available Androgen Insensitivity Syndrome (AIS could be considered as a disease that causes resistance to androgens actions, influencing both the morphogenesis and differentiation of the body structures, and systems in which this hormone exerts its effects. It depends on an X-linked mutations in the Androgen Receptor (AR gene that express a variety of phenotypes ranging from male infertility to completely normal female external genitalia. The clinical phenotypes of AIS could vary and be classified into three categories, as complete (CAIS, partial (PAIS, and mild (MAIS forms, according to the severity of androgen resistance. We will describe a case of CAIS in a 16-year-old patient.

  10. Androgen Receptor Coactivator ARID4B Is Required for the Function of Sertoli Cells in Spermatogenesis.

    Science.gov (United States)

    Wu, Ray-Chang; Zeng, Yang; Pan, I-Wen; Wu, Mei-Yi

    2015-09-01

    Defects in spermatogenesis, a process that produces spermatozoa inside seminiferous tubules of the testis, result in male infertility. Spermatogenic progression is highly dependent on a microenvironment provided by Sertoli cells, the only somatic cells and epithelium of seminiferous tubules. However, genes that regulate such an important activity of Sertoli cells are poorly understood. Here, we found that AT-rich interactive domain 4B (ARID4B), is essential for the function of Sertoli cells to regulate spermatogenesis. Specifically, we generated Sertoli cell-specific Arid4b knockout (Arid4bSCKO) mice, and showed that the Arid4bSCKO male mice were completely infertile with impaired testis development and significantly reduced testis size. Importantly, severe structural defects accompanied by loss of germ cells and Sertoli cell-only phenotype were found in many seminiferous tubules of the Arid4bSCKO testes. In addition, maturation of Sertoli cells was significantly delayed in the Arid4bSCKO mice, associated with delayed onset of spermatogenesis. Spermatogenic progression was also defective, showing an arrest at the round spermatid stage in the Arid4bSCKO testes. Interestingly, we showed that ARID4B functions as a "coactivator" of androgen receptor and is required for optimal transcriptional activation of reproductive homeobox 5, an androgen receptor target gene specifically expressed in Sertoli cells and critical for spermatogenesis. Together, our study identified ARID4B to be a key regulator of Sertoli cell function important for male germ cell development.

  11. Complete androgen insensitivity syndrome

    Directory of Open Access Journals (Sweden)

    Tančić-Gajić Milina

    2015-01-01

    Full Text Available Introduction. Androgen insensitivity syndrome (AIS belongs to disorders of sex development, resulting from complete or partial resistance to the biological actions of androgens in persons who are genetically males (XY with normally developed testes and age-appropriate for males of serum testosterone concentration. Case Outline. A 21-year-old female patient was admitted at our Clinic further evaluation and treatment of testicular feminization syndrome, which was diagnosed at the age of 16 years. The patient had never menstruated. On physical examination, her external genitalia and breast development appeared as completely normal feminine structures but pubic and axillary hair was absent. Cytogenetic analysis showed a 46 XY karyotype. The values of sex hormones were as in adult males. The multisliced computed tomography (MSCT showed structures on both sides of the pelvic region, suggestive of testes. Bilateral orchiectomy was performed. Hormone replacement therapy was prescribed after gonadectomy. Vaginal dilatation was advised to avoid dyspareunia. Conclusion. The diagnosis of complete androgen insensitivity is based on clinical findigs, hormonal analysis karyotype, visualization methods and genetic analysis. Bilateral gonadectomy is generally recommended in early adulthood to avoid the risk of testicular malignancy. Vaginal length may be short requiring dilatation in an effort to avoid dyspareunia. Vaginal surgery is rarely indicated for the creation of a functional vagina. [Projekat Ministarstva nauke Republike Srbije, br. 175067

  12. Inflammation-related genes up-regulated in schizophrenia brains

    Directory of Open Access Journals (Sweden)

    Kreuger Johan

    2007-09-01

    Full Text Available Abstract Background Multiple studies have shown that brain gene expression is disturbed in subjects suffering from schizophrenia. However, disentangling disease effects from alterations caused by medication is a challenging task. The main goal of this study is to find transcriptional alterations in schizophrenia that are independent of neuroleptic treatment. Methods We compared the transcriptional profiles in brain autopsy samples from 55 control individuals with that from 55 schizophrenic subjects, subdivided according to the type of antipsychotic medication received. Results Using global and high-resolution mRNA quantification techniques, we show that genes involved in immune response (GO:0006955 are up regulated in all groups of patients, including those not treated at the time of death. In particular, IFITM2, IFITM3, SERPINA3, and GBP1 showed increased mRNA levels in schizophrenia (p-values from qPCR ≤ 0.01. These four genes were co-expressed in both schizophrenic subjects and controls. In-vitro experiments suggest that these genes are expressed in both oligodendrocyte and endothelial cells, where transcription is inducible by the inflammatory cytokines TNF-α, IFN-α and IFN-γ. Conclusion Although the modified genes are not classical indicators of chronic or acute inflammation, our results indicate alterations of inflammation-related pathways in schizophrenia. In addition, the observation in oligodendrocyte cells suggests that alterations in inflammatory-related genes may have consequences for myelination. Our findings encourage future research to explore whether anti-inflammatory agents can be used in combination with traditional antipsychotics for a more efficient treatment of schizophrenia.

  13. Lipocalin 2: a new mechanoresponding gene regulating bone homeostasis.

    Science.gov (United States)

    Rucci, Nadia; Capulli, Mattia; Piperni, Sara Gemini; Cappariello, Alfredo; Lau, Patrick; Frings-Meuthen, Petra; Heer, Martina; Teti, Anna

    2015-02-01

    Mechanical loading represents a crucial factor in the regulation of skeletal homeostasis. Its reduction causes loss of bone mass, eventually leading to osteoporosis. In a previous global transcriptome analysis performed in mouse calvarial osteoblasts subjected to simulated microgravity, the most upregulated gene compared to unit gravity condition was Lcn2, encoding the adipokine Lipocalin 2 (LCN2), whose function in bone metabolism is poorly known. To investigate the mechanoresponding properties of LCN2, we evaluated LCN2 levels in sera of healthy volunteers subjected to bed rest, and found a significant time-dependent increase of this adipokine compared to time 0. We then evaluated the in vivo LCN2 regulation in mice subjected to experimentally-induced mechanical unloading by (1) tail suspension, (2) muscle paralysis by botulin toxin A (Botox), or (3) genetically-induced muscular dystrophy (MDX mice), and observed that Lcn2 expression was upregulated in the long bones of all of them, whereas physical exercise counteracted this increase. Mechanistically, in primary osteoblasts transfected with LCN2-expression-vector (OBs-Lcn2) we observed that Runx2 and its downstream genes, Osterix and Alp, were transcriptionally downregulated, and alkaline phosphatase (ALP) activity was less prominent versus empty-vector transduced osteoblasts (OBs-empty). OBs-Lcn2 also exhibited an increase of the Rankl/Opg ratio and IL-6 mRNA, suggesting that LCN2 could link poor differentiation of osteoblasts to enhanced osteoclast stimulation. In fact, incubation of purified mouse bone marrow mononuclear cells with conditioned media from OBs-Lcn2 cultures, or their coculture with OBs-Lcn2, improved osteoclastogenesis compared to OBs-empty, whereas treatment with recombinant LCN2 had no effect. In conclusion, our data indicate that LCN2 is a novel osteoblast mechanoresponding gene and that its regulation could be central to the pathological response of the bone tissue to low mechanical forces.

  14. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    for maintaining genomic integrity. The aim of the present study was to characterize the pattern of cerebral DNA repair enzyme regulation after stress through the quantification of a targeted range of gene products involved in different types of DNA repair. 72 male Sprague-Dawley rats were subjected to either......Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  15. Combinatorial Gene Regulation through Kinetic Control of the Transcription Cycle.

    Science.gov (United States)

    Scholes, Clarissa; DePace, Angela H; Sánchez, Álvaro

    2017-01-25

    Cells decide when, where, and to what level to express their genes by "computing" information from transcription factors (TFs) binding to regulatory DNA. How is the information contained in multiple TF-binding sites integrated to dictate the rate of transcription? The dominant conceptual and quantitative model is that TFs combinatorially recruit one another and RNA polymerase to the promoter by direct physical interactions. Here, we develop a quantitative framework to explore kinetic control, an alternative model in which combinatorial gene regulation can result from TFs working on different kinetic steps of the transcription cycle. Kinetic control can generate a wide range of analog and Boolean computations without requiring the input TFs to be simultaneously bound to regulatory DNA. We propose experiments that will illuminate the role of kinetic control in transcription and discuss implications for deciphering the cis-regulatory "code."

  16. Cholera toxin structure, gene regulation and pathophysiological and immunological aspects.

    Science.gov (United States)

    Sánchez, J; Holmgren, J

    2008-05-01

    Many notions regarding the function, structure and regulation of cholera toxin expression have remained essentially unaltered in the last 15 years. At the same time, recent findings have generated additional perspectives. For example, the cholera toxin genes are now known to be carried by a non-lytic bacteriophage, a previously unsuspected condition. Understanding of how the expression of cholera toxin genes is controlled by the bacterium at the molecular level has advanced significantly and relationships with cell-density-associated (quorum-sensing) responses have recently been discovered. Regarding the cell intoxication process, the mode of entry and intracellular transport of cholera toxin are becoming clearer. In the immunological field, the strong oral immunogenicity of the non-toxic B subunit of cholera toxin (CTB) has been exploited in the development of a now widely licensed oral cholera vaccine. Additionally, CTB has been shown to induce tolerance against co-administered (linked) foreign antigens in some autoimmune and allergic diseases.

  17. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  18. Glycerophosphorylcholine regulates Haemophilus influenzae glpQ gene expression.

    Science.gov (United States)

    Alrousan, Enas; Fan, Xin

    2015-05-01

    An important virulence strategy adopted by Haemophilus influenzae to establish a niche on the mucosal surface of the host is the phosphorylcholine (ChoP) decoration of its lipopolysaccharides, which promotes adherence to the host cells. Haemophilus influenzae is able to use glycerophosphorylcholine (GPC) from host for ChoP synthesis. Utilization of GPC requires glpQ, which encodes a glycerophosphodiester phosphodiesterase enzyme. In this study, we investigate the transcriptional regulation of glpQ gene using real-time PCR and transcriptional fusion of H. influenzae glpQ promoter to the Escherichia coli lacZ reporter gene. The glpQ promoter activities were examined under environmental conditions including changes in temperature, oxygen, high salt and minimal growth medium. Our data showed that under room temperature and anaerobic conditions, the glpQ gene expression levels were significantly higher than under other growth conditions. In addition, the glpQ gene expression levels were upregulated in the presence of GPC. These results suggest that H. influenzae may upregulate glpQ expression in response to different environments it encounters during infection, from the airway surfaces (room temperature) to deep tissues (anaerobic). Upregulation of glpQ by GPC may allow efficient use of abundant GPC from mammalian cells by H. influenzae as a source of nutrient and for ChoP decoration of lipopolysaccharide that facilitates bacterial adhesion to host cells and growth during infection.

  19. Gene regulation and noise reduction by coupling of stochastic processes

    Science.gov (United States)

    Ramos, Alexandre F.; Hornos, José Eduardo M.; Reinitz, John

    2015-02-01

    Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

  20. Role of histone deacetylases in gene regulation at nuclear lamina.

    Directory of Open Access Journals (Sweden)

    Beatrice C Milon

    Full Text Available Theoretical models suggest that gene silencing at the nuclear periphery may involve "closing" of chromatin by transcriptional repressors, such as histone deacetylases (HDACs. Here we provide experimental evidence confirming these predictions. Histone acetylation, chromatin compactness, and gene repression in lamina-interacting multigenic chromatin domains were analyzed in Drosophila S2 cells in which B-type lamin, diverse HDACs, and lamina-associated proteins were downregulated by dsRNA. Lamin depletion resulted in decreased compactness of the repressed multigenic domain associated with its detachment from the lamina and enhanced histone acetylation. Our data reveal the major role for HDAC1 in mediating deacetylation, chromatin compaction, and gene silencing in the multigenic domain, and an auxiliary role for HDAC3 that is required for retention of the domain at the lamina. These findings demonstrate the manifold and central involvement of class I HDACs in regulation of lamina-associated genes, illuminating a mechanism by which these enzymes can orchestrate normal and pathological development.

  1. Glycogen synthesis correlates with androgen-dependent growth arrest in prostate cancer

    Directory of Open Access Journals (Sweden)

    Gorin Frederic A

    2005-03-01

    Full Text Available Abstract Background Androgen withdrawal in normal prostate or androgen-dependent prostate cancer is associated with the downregulation of several glycolytic enzymes and with reduced glucose uptake. Although glycogen metabolism is known to regulate the intracellular glucose level its involvement in androgen response has not been studied. Methods We investigated the effects of androgen on glycogen phosphorylase (GP, glycogen synthase (GS and on glycogen accumulation in the androgen-receptor (AR reconstituted PC3 cell line containing either an empty vector (PC3-AR-V or vector with HPV-E7 (PC3-AR-E7 and the LNCaP cell line. Results Androgen addition in PC3 cells expressing the AR mimics androgen ablation in androgen-dependent prostate cells. Incubation of PC3-AR-V or PC3-AR-E7 cells with the androgen R1881 induced G1 cell cycle arrest within 24 hours and resulted in a gradual cell number reduction over 5 days thereafter, which was accompanied by a 2 to 5 fold increase in glycogen content. 24 hours after androgen-treatment the level of Glucose-6-P (G-6-P had increased threefold and after 48 hours the GS and GP activities increased twofold. Under this condition inhibition of glycogenolysis with the selective GP inhibitor CP-91149 enhanced the increase in glycogen content and further reduced the cell number. The androgen-dependent LNCaP cells that endogenously express AR responded to androgen withdrawal with growth arrest and increased glycogen content. CP-91149 further increased glycogen content and caused a reduction of cell number. Conclusion Increased glycogenesis is part of the androgen receptor-mediated cellular response and blockage of glycogenolysis by the GP inhibitor CP-91149 further increased glycogenesis. The combined use of a GP inhibitor with hormone therapy may increase the efficacy of hormone treatment by decreasing the survival of prostate cancer cells and thereby reducing the chance of cancer recurrence.

  2. Dynamic Post-Transcriptional Regulation of HIV-1 Gene Expression

    Science.gov (United States)

    Kula, Anna; Marcello, Alessandro

    2012-01-01

    Gene expression of the human immunodeficiency virus type 1 (HIV-1) is a highly regulated process. Basal transcription of the integrated provirus generates early transcripts that encode for the viral products Tat and Rev. Tat promotes the elongation of RNA polymerase while Rev mediates the nuclear export of viral RNAs that contain the Rev-responsive RNA element (RRE). These RNAs are exported from the nucleus to allow expression of Gag-Pol and Env proteins and for the production of full-length genomic RNAs. A balance exists between completely processed mRNAs and RRE-containing RNAs. Rev functions as an adaptor that recruits cellular factors to re-direct singly spliced and unspliced viral RNAs to nuclear export. The aim of this review is to address the dynamic regulation of this post-transcriptional pathway in light of recent findings that implicate several novel cellular cofactors of Rev function. PMID:24832221

  3. Dynamic Post-Transcriptional Regulation of HIV-1 Gene Expression

    Directory of Open Access Journals (Sweden)

    Alessandro Marcello

    2012-07-01

    Full Text Available Gene expression of the human immunodeficiency virus type 1 (HIV-1 is a highly regulated process. Basal transcription of the integrated provirus generates early transcripts that encode for the viral products Tat and Rev. Tat promotes the elongation of RNA polymerase while Rev mediates the nuclear export of viral RNAs that contain the Rev-responsive RNA element (RRE. These RNAs are exported from the nucleus to allow expression of Gag-Pol and Env proteins and for the production of full-length genomic RNAs. A balance exists between completely processed mRNAs and RRE-containing RNAs. Rev functions as an adaptor that recruits cellular factors to re-direct singly spliced and unspliced viral RNAs to nuclear export. The aim of this review is to address the dynamic regulation of this post-transcriptional pathway in light of recent findings that implicate several novel cellular cofactors of Rev function.

  4. From biophysics to evolutionary genetics: statistical aspects of gene regulation

    Directory of Open Access Journals (Sweden)

    Lässig Michael

    2007-09-01

    Full Text Available Abstract This is an introductory review on how genes interact to produce biological functions. Transcriptional interactions involve the binding of proteins to regulatory DNA. Specific binding sites can be identified by genomic analysis, and these undergo a stochastic evolution process governed by selection, mutations, and genetic drift. We focus on the links between the biophysical function and the evolution of regulatory elements. In particular, we infer fitness landscapes of binding sites from genomic data, leading to a quantitative evolutionary picture of regulation.

  5. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  6. The molecular clock regulates circadian transcription of tissue factor gene.

    Science.gov (United States)

    Oishi, Katsutaka; Koyanagi, Satoru; Ohkura, Naoki

    2013-02-01

    Tissue factor (TF) is involved in endotoxin-induced inflammation and mortality. We found that the circadian expression of TF mRNA, which peaked at the day to night transition (activity onset), was damped in the liver of Clock mutant mice. Luciferase reporter and chromatin immunoprecipitation analyses using embryonic fibroblasts derived from wild-type or Clock mutant mice showed that CLOCK is involved in transcription of the TF gene. Furthermore, the results of real-time luciferase reporter experiments revealed that the circadian expression of TF mRNA is regulated by clock molecules through a cell-autonomous mechanism via an E-box element located in the promoter region.

  7. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis.

    Science.gov (United States)

    Bowman, J L; Sakai, H; Jack, T; Weigel, D; Mayer, U; Meyerowitz, E M

    1992-03-01

    We describe a locus, SUPERMAN, mutations in which result in extra stamens developing at the expense of the central carpels in the Arabidopsis thaliana flower. The development of superman flowers, from initial primordium to mature flower, is described by scanning electron microscopy. The development of doubly and triply mutant strains, constructed with superman alleles and previously identified homeotic mutations that cause alterations in floral organ identity, is also described. Essentially additive phenotypes are observed in superman agamous and superman apetala2 double mutants. The epistatic relationships observed between either apetala3 or pistillata and superman alleles suggest that the SUPERMAN gene product could be a regulator of these floral homeotic genes. To test this, the expression patterns of AGAMOUS and APETALA3 were examined in superman flowers. In wild-type flowers, APETALA3 expression is restricted to the second and third whorls where it is required for the specification of petals and stamens. In contrast, in superman flowers, APETALA3 expression expands to include most of the cells that would normally constitute the fourth whorl. This ectopic APETALA3 expression is proposed to be one of the causes of the development of the extra stamens in superman flowers. The spatial pattern of AGAMOUS expression remains unaltered in superman flowers as compared to wild-type flowers. Taken together these data indicate that one of the functions of the wild-type SUPERMAN gene product is to negatively regulate APETALA3 in the fourth whorl of the flower. In addition, superman mutants exhibit a loss of determinacy of the floral meristem, an effect that appears to be mediated by the APETALA3 and PISTILLATA gene products.

  8. Shh regulates chick Ebf1 gene expression in somite development.

    Science.gov (United States)

    El-Magd, Mohammed Abu; Allen, Steve; McGonnell, Imelda; Mansour, Ali A; Otto, Anthony; Patel, Ketan

    2015-01-01

    The chick early B-cell factor 1 (cEbf1) is a member of EBF family of helix loop helix transcription factors. Recently, we have proved that cEbf1 expression in feather is regulated by Shh. It is therefore possible that the somitic expression of cEbf1 is controlled by Shh signals from the notochord. To assess this hypothesis, the expression profile of cEbf1 was first detailed in somites of chick embryos (from HH8 to HH28). cEbf1 expression was mainly localised in the medial sclerotome and later around the vertebral cartilage anlagen of body and pedicles. Tissue manipulations (notochord ablation) and Shh gain and loss of function experiments were then performed to analyse whether the notochord and/or Shh regulate cEbf1 expression. Results from these experiments confirmed our hypothesis that the medial somitic expression of cEbf1 is regulated by Shh from the notochord. In conclusion, cEbf1 gene is considered as a medial sclerotome marker, downstream to and regulated by the notochord derived Shh, which may be functionally involved in somitogenesis.

  9. Neuronal identity genes regulated by super-enhancers are preferentially down-regulated in the striatum of Huntington's disease mice.

    Science.gov (United States)

    Achour, Mayada; Le Gras, Stéphanie; Keime, Céline; Parmentier, Frédéric; Lejeune, François-Xavier; Boutillier, Anne-Laurence; Néri, Christian; Davidson, Irwin; Merienne, Karine

    2015-06-15

    Huntington's disease (HD) is a neurodegenerative disease associated with extensive down-regulation of genes controlling neuronal function, particularly in the striatum. Whether altered epigenetic regulation underlies transcriptional defects in HD is unclear. Integrating RNA-sequencing (RNA-seq) and chromatin-immunoprecipitation followed by massively parallel sequencing (ChIP-seq), we show that down-regulated genes in HD mouse striatum associate with selective decrease in H3K27ac, a mark of active enhancers, and RNA Polymerase II (RNAPII). In addition, we reveal that decreased genes in HD mouse striatum display a specific epigenetic signature, characterized by high levels and broad patterns of H3K27ac and RNAPII. Our results indicate that this signature is that of super-enhancers, a category of broad enhancers regulating genes defining tissue identity and function. Specifically, we reveal that striatal super-enhancers display extensive H3K27 acetylation within gene bodies, drive transcription characterized by low levels of paused RNAPII, regulate neuronal function genes and are enriched in binding motifs for Gata transcription factors, such as Gata2 regulating striatal identity genes. Together, our results provide evidence for preferential down-regulation of genes controlled by super-enhancers in HD striatum and indicate that enhancer topography is a major parameter determining the propensity of a gene to be deregulated in a neurodegenerative disease.

  10. Identification of Comamonas testosteroni as an androgen degrader in sewage

    Science.gov (United States)

    Chen, Yi-Lung; Wang, Chia-Hsiang; Yang, Fu-Chun; Ismail, Wael; Wang, Po-Hsiang; Shih, Chao-Jen; Wu, Yu-Ching; Chiang, Yin-Ru

    2016-01-01

    Numerous studies have reported the masculinization of freshwater wildlife exposed to androgens in polluted rivers. Microbial degradation is a crucial mechanism for eliminating steroid hormones from contaminated ecosystems. The aerobic degradation of testosterone was observed in various bacterial isolates. However, the ecophysiological relevance of androgen-degrading microorganisms in the environment is unclear. Here, we investigated the biochemical mechanisms and corresponding microorganisms of androgen degradation in aerobic sewage. Sewage samples collected from the Dihua Sewage Treatment Plant (Taipei, Taiwan) were aerobically incubated with testosterone (1 mM). Androgen metabolite analysis revealed that bacteria adopt the 9, 10-seco pathway to degrade testosterone. A metagenomic analysis indicated the apparent enrichment of Comamonas spp. (mainly C. testosteroni) and Pseudomonas spp. in sewage incubated with testosterone. We used the degenerate primers derived from the meta-cleavage dioxygenase gene (tesB) of various proteobacteria to track this essential catabolic gene in the sewage. The amplified sequences showed the highest similarity (87–96%) to tesB of C. testosteroni. Using quantitative PCR, we detected a remarkable increase of the 16S rRNA and catabolic genes of C. testosteroni in the testosterone-treated sewage. Together, our data suggest that C. testosteroni, the model microorganism for aerobic testosterone degradation, plays a role in androgen biodegradation in aerobic sewage. PMID:27734937

  11. Androgen receptor: structure, role in prostate cancer and drug discovery.

    Science.gov (United States)

    Tan, M H Eileen; Li, Jun; Xu, H Eric; Melcher, Karsten; Yong, Eu-leong

    2015-01-01

    Androgens and androgen receptors (AR) play a pivotal role in expression of the male phenotype. Several diseases, such as androgen insensitivity syndrome (AIS) and prostate cancer, are associated with alterations in AR functions. Indeed, androgen blockade by drugs that prevent the production of androgens and/or block the action of the AR inhibits prostate cancer growth. However, resistance to these drugs often occurs after 2-3 years as the patients develop castration-resistant prostate cancer (CRPC). In CRPC, a functional AR remains a key regulator. Early studies focused on the functional domains of the AR and its crucial role in the pathology. The elucidation of the structures of the AR DNA binding domain (DBD) and ligand binding domain (LBD) provides a new framework for understanding the functions of this receptor and leads to the development of rational drug design for the treatment of prostate cancer. An overview of androgen receptor structure and activity, its actions in prostate cancer, and how structural information and high-throughput screening have been or can be used for drug discovery are provided herein.

  12. [Ribozyme riboswitch based gene expression regulation systems for gene therapy applications: progress and challenges].

    Science.gov (United States)

    Feng, Jing-Xian; Wang, Jia-wen; Lin, Jun-sheng; Diao, Yong

    2014-11-01

    Robust and efficient control of therapeutic gene expression is needed for timing and dosing of gene therapy drugs in clinical applications. Ribozyme riboswitch provides a promising building block for ligand-controlled gene-regulatory system, based on its property that exhibits tunable gene regulation, design modularity, and target specificity. Ribozyme riboswitch can be used in various gene delivery vectors. In recent years, there have been breakthroughs in extending ribozyme riboswitch's application from gene-expression control to cellular function and fate control. High throughput screening platforms were established, that allow not only rapid optimization of ribozyme riboswitch in a microbial host, but also straightforward transfer of selected devices exhibiting desired activities to mammalian cell lines in a predictable manner. Mathematical models were employed successfully to explore the performance of ribozyme riboswitch quantitively and its rational design predictably. However, to progress toward gene therapy relevant applications, both precision rational design of regulatory circuits and the biocompatibility of regulatory ligand are still of crucial importance.

  13. Major enzymes controlling the androgenic pressure in the developing lung.

    Science.gov (United States)

    Tremblay, Yves; Provost, Pierre R

    2013-09-01

    A sex difference is observed in the incidence and morbidity of respiratory distress syndrome (RDS) of the neonate and in bronchopulmonary dysplasia (BPD). The involvement of androgens is well evidenced in RDS and it is suspected in BPD. Interestingly, the developing lung is not an inert tissue just exposed to circulating androgens, but is rather an active androgen metabolizing tissue, expressing enzymes involved in both androgen synthesis and inactivation. The present review focuses on the major enzymes involved in androgen metabolism within the developing lung. Testosterone synthesis and inactivation by AKR1C3/Akr1c6 (human/mouse 17β-hydroxysteroid dehydrogenases (HSDs) type 5) and HSD17B2 (17β-HSD type 2), respectively, play an important role in the developing lung. Akr1c14 (3α-HSD) shows a strong increase in expression according to developmental time. The canalicular stage of lung development corresponding to the surge of surfactant lipid synthesis, which is linked to RDS, as well as saccularization/alveolarization, which are linked to BPD, are covered by this review for the mouse and human species. The androgen metabolizing enzymes expressed within the developing lung can become potential pharmaceutical targets in the objective of accelerating lung maturation by specific treatments. The classic deleterious effects of androgens on lung maturation and the surge of surfactant synthesis in males are well known. Conversely, androgens also have positive impacts on the development of both male and female lungs. Steroidogenic enzymes are key regulators of these positive effects. This article is part of a Special Issue entitled 'CSR 2013'.

  14. MicroRNAs related to androgen metabolism and polycystic ovary syndrome.

    Science.gov (United States)

    Sørensen, Anja E; Udesen, Pernille B; Wissing, Marie Louise; Englund, Anne Lis M; Dalgaard, Louise T

    2016-11-25

    Polycystic ovary syndrome (PCOS) is a frequent endocrine disorder in women. PCOS is associated with altered features of androgen metabolism, increased insulin resistance and impaired fertility. Furthermore, PCOS, being a syndrome diagnosis, is heterogeneous and characterized by polycystic ovaries, chronic anovulation and evidence of hyperandrogenism, as well as being associated with chronic low-grade inflammation and an increased life time risk of type 2 diabetes. A number of androgen species contribute to the symptoms of increased androgen exposure seen in many, though not all, cases of PCOS: Testosterone, androstenedione, dehydroepiandrosterone (DHEA) and dehydroepiandrosterone sulfate (DHEAS), where the quantitatively highest amount of androgen is found as DHEAS. The sulfation of DHEA to DHEAS depends on a number of enzymes, and altered sulfate metabolism may be associated with and contribute to the pathogenesis of PCOS. MicroRNAs (miRNAs) are small, non-coding RNAs that are able to regulate gene expression at the post-transcriptional level. Altered miRNA levels have been associated with diabetes, insulin resistance, inflammation and various cancers. Studies have shown that circulating miRNAs are present in whole blood, serum, plasma and the follicular fluid of PCOS patients and that these might serve as potential biomarkers and a new approach for the diagnosis of PCOS. In this review, recent work on miRNAs with respect to PCOS will be summarized. Our understanding of miRNAs, particularly in relation to PCOS, is currently at a very early stage, and additional studies will yield important insight into the molecular mechanisms behind this complex and heterogenic syndrome.

  15. Altered theca and cumulus oocyte complex gene expression, follicular arrest and reduced fertility in cows with dominant follicle follicular fluid androgen excess.

    Directory of Open Access Journals (Sweden)

    Adam F Summers

    Full Text Available Aspiration of bovine follicles 12-36 hours after induced corpus luteum lysis serendipitously identified two populations of cows, one with High androstenedione (A4; >40 ng/ml; mean = 102 and another with Low A4 (<20 ng/ml; mean = 9 in follicular fluid. We hypothesized that the steroid excess in follicular fluid of dominant follicles in High A4 cows would result in reduced fertility through altered follicle development and oocyte maternal RNA abundance. To test this hypothesis, estrous cycles of cows were synchronized and ovariectomy was performed 36 hours later. HPLC MS/MS analysis of follicular fluid showed increased dehydroepiandrosterone (6-fold, A4 (158-fold and testosterone (31-fold in the dominant follicle of High A4 cows. However, estrone (3-fold and estradiol (2-fold concentrations were only slightly elevated, suggesting a possible inefficiency in androgen to estrogen conversion in High A4 cows. Theca cell mRNA expression of LHCGR, GATA6, CYP11A1, and CYP17A1 was greater in High A4 cows. Furthermore, abundance of ZAR1 was decreased 10-fold in cumulus oocyte complexes from High A4 cows, whereas NLRP5 abundance tended to be 19.8-fold greater (P = 0.07. There was a tendency for reduction in stage 4 follicles in ovarian cortex samples from High A4 cows suggesting that progression to antral stages were impaired. High A4 cows tended (P<0.07 to have a 17% reduction in calving rate compared with Low A4 cows suggesting reduced fertility in the High A4 population. These data suggest that the dominant follicle environment of High A4 cows including reduced estrogen conversion and androgen excess contributes to infertility in part through altered follicular and oocyte development.

  16. Sarcosine Up-Regulates Expression of Genes Involved in Cell Cycle Progression of Metastatic Models of Prostate Cancer

    Science.gov (United States)

    Heger, Zbynek; Merlos Rodrigo, Miguel Angel; Michalek, Petr; Polanska, Hana; Masarik, Michal; Vit, Vitezslav; Plevova, Mariana; Pacik, Dalibor; Eckschlager, Tomas; Stiborova, Marie

    2016-01-01

    The effects of sarcosine on the processes driving prostate cancer (PCa) development remain still unclear. Herein, we show that a supplementation of metastatic PCa cells (androgen independent PC-3 and androgen dependent LNCaP) with sarcosine stimulates cells proliferation in vitro. Similar stimulatory effects were observed also in PCa murine xenografts, in which sarcosine treatment induced a tumor growth and significantly reduced weight of treated mice (p < 0.05). Determination of sarcosine metabolism-related amino acids and enzymes within tumor mass revealed significantly increased glycine, serine and sarcosine concentrations after treatment accompanied with the increased amount of sarcosine dehydrogenase. In both tumor types, dimethylglycine and glycine-N-methyltransferase were affected slightly, only. To identify the effects of sarcosine treatment on the expression of genes involved in any aspect of cancer development, we further investigated expression profiles of excised tumors using cDNA electrochemical microarray followed by validation using the semi-quantitative PCR. We found 25 differentially expressed genes in PC-3, 32 in LNCaP tumors and 18 overlapping genes. Bioinformatical processing revealed strong sarcosine-related induction of genes involved particularly in a cell cycle progression. Our exploratory study demonstrates that sarcosine stimulates PCa metastatic cells irrespectively of androgen dependence. Overall, the obtained data provides valuable information towards understanding the role of sarcosine in PCa progression and adds another piece of puzzle into a picture of sarcosine oncometabolic potential. PMID:27824899

  17. Molecular Basis of Gene-Gene Interaction: Cyclic Cross-Regulation of Gene Expression and Post-GWAS Gene-Gene Interaction Involved in Atrial Fibrillation.

    Directory of Open Access Journals (Sweden)

    Yufeng Huang

    2015-08-01

    Full Text Available Atrial fibrillation (AF is the most common cardiac arrhythmia at the clinic. Recent GWAS identified several variants associated with AF, but they account for <10% of heritability. Gene-gene interaction is assumed to account for a significant portion of missing heritability. Among GWAS loci for AF, only three were replicated in the Chinese Han population, including SNP rs2106261 (G/A substitution in ZFHX3, rs2200733 (C/T substitution near PITX2c, and rs3807989 (A/G substitution in CAV1. Thus, we analyzed the interaction among these three AF loci. We demonstrated significant interaction between rs2106261 and rs2200733 in three independent populations and combined population with 2,020 cases/5,315 controls. Compared to non-risk genotype GGCC, two-locus risk genotype AATT showed the highest odds ratio in three independent populations and the combined population (OR=5.36 (95% CI 3.87-7.43, P=8.00×10-24. The OR of 5.36 for AATT was significantly higher than the combined OR of 3.31 for both GGTT and AACC, suggesting a synergistic interaction between rs2106261 and rs2200733. Relative excess risk due to interaction (RERI analysis also revealed significant interaction between rs2106261 and rs2200733 when exposed two copies of risk alleles (RERI=2.87, P<1.00×10-4 or exposed to one additional copy of risk allele (RERI=1.29, P<1.00×10-4. The INTERSNP program identified significant genotypic interaction between rs2106261 and rs2200733 under an additive by additive model (OR=0.85, 95% CI: 0.74-0.97, P=0.02. Mechanistically, PITX2c negatively regulates expression of miR-1, which negatively regulates expression of ZFHX3, resulting in a positive regulation of ZFHX3 by PITX2c; ZFHX3 positively regulates expression of PITX2C, resulting in a cyclic loop of cross-regulation between ZFHX3 and PITX2c. Both ZFHX3 and PITX2c regulate expression of NPPA, TBX5 and NKX2.5. These results suggest that cyclic cross-regulation of gene expression is a molecular basis for gene-gene

  18. Systematic structure modifications of multitarget prostate cancer drug candidate galeterone to produce novel androgen receptor down-regulating agents as an approach to treatment of advanced prostate cancer.

    Science.gov (United States)

    Purushottamachar, Puranik; Godbole, Abhijit M; Gediya, Lalji K; Martin, Marlena S; Vasaitis, Tadas S; Kwegyir-Afful, Andrew K; Ramalingam, Senthilmurugan; Ates-Alagoz, Zeynep; Njar, Vincent C O

    2013-06-27

    As part of our program to explore the influence of small structural modifications of our drug candidate 3β-(hydroxy)-17-(1H-benzimidazol-1-yl)androsta-5,16-diene (galeterone, 5) on the modulation of the androgen receptor (AR), we have prepared and evaluated a series of novel C-3, C-16, and C-17 analogues. Using structure activity analysis, we established that the benzimidazole moiety at C-17 is essential and optimal and also that hydrophilic and heteroaromatic groups at C-3 enhance both antiproliferative (AP) and AR degrading (ARD) activities. The most potent antiproliferative compounds were 3β-(1H-imidazole-1-carboxylate)-17-(1H-benzimidazol-1-yl)androsta-5,16-diene (47), 3-((EZ)-hydroximino)-17-(1H-benzimidazol-1-yl)androsta-4,16-diene (36), and 3β-(pyridine-4-carboxylate)-17-(1H-benzimidazol-1-yl)androsta-5,16-diene (43), with GI50 values of 0.87, 1.91, and 2.57 μM, respectively. Compared to 5, compound 47 was 4- and 8-fold more potent with respect to AP and ARD activities, respectively. Importantly, we also discovered that our compounds, including 5, 36, 43, and 47, could degrade both full-length and truncated ARs in CWR22rv1 human prostate cancer cells. With these activities, they have potential for development as new drugs for the treatment of all forms of prostate cancer.

  19. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  20. In Silico and In Vitro Investigation of the Piperine's Male Contraceptive Effect: Docking and Molecular Dynamics Simulation Studies in Androgen-Binding Protein and Androgen Receptor.

    Science.gov (United States)

    Chinta, Gopichand; Ramya Chandar Charles, Mariasoosai; Klopčič, Ivana; Sollner Dolenc, Marija; Periyasamy, Latha; Selvaraj Coumar, Mohane

    2015-07-01

    Understanding the molecular mechanism of action of traditional medicines is an important step towards developing marketable drugs from them. Piperine, an active constituent present in the Piper species, is used extensively in Ayurvedic medicines (practiced on the Indian subcontinent). Among others, piperine is known to possess a male contraceptive effect; however, the molecular mechanism of action for this effect is not very clear. In this regard, detailed docking and molecular dynamics simulation studies of piperine with the androgen-binding protein and androgen receptors were carried out. Androgen receptors control male sexual behavior and fertility, while the androgen-binding protein binds testosterone and maintains its concentration at optimal levels to stimulate spermatogenesis in the testis. It was found that piperine docks to the androgen-binding protein, similar to dihydrotestosterone, and to androgen receptors, similar to cyproterone acetate (antagonist). Also, the piperine-androgen-binding protein and piperine-androgen receptors interactions were found to be stable throughout 30 ns of molecular dynamics simulation. Further, two independent simulations for 10 ns each also confirmed the stability of these interactions. Detailed analysis of the piperine-androgen-binding protein interactions shows that piperine interacts with Ser42 of the androgen-binding protein and could block the binding with its natural ligands dihydrotestosterone/testosterone. Moreover, piperine interacts with Thr577 of the androgen receptors in a manner similar to the antagonist cyproterone acetate. Based on the in silico results, piperine was tested in the MDA-kb2 cell line using the luciferase reporter gene assay and was found to antagonize the effect of dihydrotestosterone at nanomolar concentrations. Further detailed biochemical experiments could help to develop piperine as an effective male contraceptive agent in the future.

  1. Xnrs and activin regulate distinct genes during Xenopus development: activin regulates cell division.

    Directory of Open Access Journals (Sweden)

    Joana M Ramis

    Full Text Available BACKGROUND: The mesoderm of the amphibian embryo is formed through an inductive interaction in which vegetal cells of the blastula-staged embryo act on overlying equatorial cells. Candidate mesoderm-inducing factors include members of the transforming growth factor type beta family such as Vg1, activin B, the nodal-related proteins and derrière. METHODOLOGY AND PRINCIPLE FINDINGS: Microarray analysis reveals different functions for activin B and the nodal-related proteins during early Xenopus development. Inhibition of nodal-related protein function causes the down-regulation of regionally expressed genes such as chordin, dickkopf and XSox17alpha/beta, while genes that are mis-regulated in the absence of activin B tend to be more widely expressed and, interestingly, include several that are involved in cell cycle regulation. Consistent with the latter observation, cells of the involuting dorsal axial mesoderm, which normally undergo cell cycle arrest, continue to proliferate when the function of activin B is inhibited. CONCLUSIONS/SIGNIFICANCE: These observations reveal distinct functions for these two classes of the TGF-beta family during early Xenopus development, and in doing so identify a new role for activin B during gastrulation.

  2. Gene expression dosage regulation in an allopolyploid fish.

    Directory of Open Access Journals (Sweden)

    I Matos

    Full Text Available How allopolyploids are able not only to cope but profit from their condition is a question that remains elusive, but is of great importance within the context of successful allopolyploid evolution. One outstanding example of successful allopolyploidy is the endemic Iberian cyprinid Squalius alburnoides. Previously, based on the evaluation of a few genes, it was reported that the transcription levels between diploid and triploid S. alburnoides were similar. If this phenomenon occurs on a full genomic scale, a wide functional ''diploidization'' could