WorldWideScience

Sample records for androgen receptor gene

  1. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  2. Androgen receptor gene polymorphism in zebra species

    Directory of Open Access Journals (Sweden)

    Hideyuki Ito

    2015-09-01

    Full Text Available Androgen receptor genes (AR have been found to have associations with reproductive development, behavioral traits, and disorders in humans. However, the influence of similar genetic effects on the behavior of other animals is scarce. We examined the loci AR glutamine repeat (ARQ in 44 Grevy's zebras, 23 plains zebras, and three mountain zebras, and compared them with those of domesticated horses. We observed polymorphism among zebra species and between zebra and horse. As androgens such as testosterone influence aggressiveness, AR polymorphism among equid species may be associated with differences in levels of aggression and tameness. Our findings indicate that it would be useful to conduct further studies focusing on the potential association between AR and personality traits, and to understand domestication of equid species.

  3. Androgen receptor gene mutation, rearrangement, polymorphism.

    Science.gov (United States)

    Eisermann, Kurtis; Wang, Dan; Jing, Yifeng; Pascal, Laura E; Wang, Zhou

    2013-09-01

    Genetic aberrations of the androgen receptor (AR) caused by mutations, rearrangements, and polymorphisms result in a mutant receptor that has varied functions compared to wild type AR. To date, over 1,000 mutations have been reported in the AR with most of these being associated with androgen insensitivity syndrome (AIS). While mutations of AR associated with prostate cancer occur less often in early stage localized disease, mutations in castration-resistant prostate cancer (CRPC) patients treated with anti-androgens occur more frequently with 10-30% of these patients having some form of mutation in the AR. Resistance to anti-androgen therapy usually results from gain-of-function mutations in the LBD such as is seen with bicalutamide and more recently with enzalutamide (MDV3100). Thus, it is crucial to investigate these new AR mutations arising from drug resistance to anti-androgens and other small molecule pharmacological agents.

  4. Expression of androgen receptor target genes in skeletal muscle

    OpenAIRE

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR)-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (ARΔZF2 ) versus w...

  5. Expression of androgen receptor target genes in skeletal muscle

    Directory of Open Access Journals (Sweden)

    Kesha Rana

    2014-10-01

    Full Text Available We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (ARΔZF2 versus wildtype mice, demonstrating that myogenin is repressed by the androgen/AR pathway. The ubiquitin ligase Fbxo32 was repressed by 12 h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, and c-Myc expression was decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR∆ZF2 muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7 , p57 Kip2, Igf2 and calcineurin Aa, was increased in AR∆ZF2 muscle, and the expression of all but p57 Kip2 was also decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase-mediated atrophy pathways to preserve muscle mass in adult muscle.

  6. Expression of androgen receptor target genes in skeletal muscle

    Institute of Scientific and Technical Information of China (English)

    Kesha Rana; Nicole KL Lee; Jeffrey D Zajac; Helen E MacLean

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor(AR)‑regulated genes ininvitroandinvivomodels. The expression of the myogenic regulatory factormyogenin was signiifcantly decreased in skeletal muscle from testosterone‑treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity(ARΔZF2) versus wildtype mice, demonstrating thatmyogenin is repressed by the androgen/AR pathway. The ubiquitin ligaseFbxo32 was repressed by 12h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, andc‑Myc expression was decreased in testosterone‑treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR∆ZF2 muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7, p57Kip2, Igf2 andcalcineurin Aa, was increased in AR∆ZF2 muscle, and the expression of all butp57Kip2was also decreased in testosterone‑treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase‑mediated atrophy pathways to preserve muscle mass in adult muscle.

  7. Expression of androgen receptor target genes in skeletal muscle.

    Science.gov (United States)

    Rana, Kesha; Lee, Nicole K L; Zajac, Jeffrey D; MacLean, Helen E

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR)-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (AR(ΔZF2)) versus wildtype mice, demonstrating that myogenin is repressed by the androgen/AR pathway. The ubiquitin ligase Fbxo32 was repressed by 12 h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, and c-Myc expression was decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR(∆ZF2) muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7 , p57(Kip2), Igf2 and calcineurin Aa, was increased in AR(∆ZF2) muscle, and the expression of all but p57(Kip2) was also decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase-mediated atrophy pathways to preserve muscle mass in adult muscle.

  8. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  9. Identification of novel androgen receptor target genes in prostate cancer

    Directory of Open Access Journals (Sweden)

    Gerald William L

    2007-06-01

    Full Text Available Abstract Background The androgen receptor (AR plays critical roles in both androgen-dependent and castrate-resistant prostate cancer (PCa. However, little is known about AR target genes that mediate the receptor's roles in disease progression. Results Using Chromatin Immunoprecipitation (ChIP Display, we discovered 19 novel loci occupied by the AR in castrate resistant C4-2B PCa cells. Only four of the 19 AR-occupied regions were within 10-kb 5'-flanking regulatory sequences. Three were located up to 4-kb 3' of the nearest gene, eight were intragenic and four were in gene deserts. Whereas the AR occupied the same loci in C4-2B (castrate resistant and LNCaP (androgen-dependent PCa cells, differences between the two cell lines were observed in the response of nearby genes to androgens. Among the genes strongly stimulated by DHT in C4-2B cells – D-dopachrome tautomerase (DDT, Protein kinase C delta (PRKCD, Glutathione S- transferase theta 2 (GSTT2, Transient receptor potential cation channel subfamily V member 3 (TRPV3, and Pyrroline-5-carboxylate reductase 1 (PYCR1 – most were less strongly or hardly stimulated in LNCaP cells. Another AR target gene, ornithine aminotransferase (OAT, was AR-stimulated in a ligand-independent manner, since it was repressed by AR siRNA knockdown, but not stimulated by DHT. We also present evidence for in vivo AR-mediated regulation of several genes identified by ChIP Display. For example, PRKCD and PYCR1, which may contribute to PCa cell growth and survival, are expressed in PCa biopsies from primary tumors before and after ablation and in metastatic lesions in a manner consistent with AR-mediated stimulation. Conclusion AR genomic occupancy is similar between LNCaP and C4-2B cells and is not biased towards 5' gene flanking sequences. The AR transcriptionally regulates less than half the genes nearby AR-occupied regions, usually but not always, in a ligand-dependent manner. Most are stimulated and a few are

  10. A competitive inhibitor that reduces recruitment of androgen receptor to androgen-responsive genes.

    Science.gov (United States)

    Cherian, Milu T; Wilson, Elizabeth M; Shapiro, David J

    2012-07-01

    The androgen receptor (AR) has a critical role in the growth and progression of androgen-dependent and castration-resistant prostate cancers. To identify novel inhibitors of AR transactivation that block growth of prostate cancer cells, a luciferase-based high-throughput screen of ~160,000 small molecules was performed in cells stably expressing AR and a prostate-specific antigen (PSA)-luciferase reporter. CPIC (1-(3-(2-chlorophenoxy) propyl)-1H-indole-3-carbonitrile) was identified as a small molecule that blocks AR transactivation to a greater extent than other steroid receptors. CPIC inhibited AR-mediated proliferation of androgen-sensitive prostate cancer cell lines, with minimal toxicity in AR-negative cell lines. CPIC treatment also reduced the anchorage-independent growth of LAPC-4 prostate cancer cells. CPIC functioned as a pure antagonist by inhibiting the expression of AR-regulated genes in LAPC-4 cells that express wild-type AR and exhibited weak agonist activity in LNCaP cells that express the mutant AR-T877A. CPIC treatment did not reduce AR levels or alter its nuclear localization. We used chromatin immunoprecipitation to identify the site of action of CPIC. CPIC inhibited recruitment of androgen-bound AR to the PSA promoter and enhancer sites to a greater extent than bicalutamide. CPIC is a new therapeutic inhibitor that targets AR-mediated gene activation with potential to arrest the growth of prostate cancer.

  11. Androgen insensitivity syndrome: do trinucleotide repeats in androgen receptor gene have any role?

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Nalini J. Gupta; Baidyanath Chakravarty; Lalji Singh; Kumarasamy Thangaraj

    2008-01-01

    Aim: To investigate the role of CAG and GGN repeats as genetic background affecting androgen insensitivity syn- drome (AIS) phenotype. Methods: We analyzed lengths of androgen receptor (AR)-CAG and GGN repeats in 69 AIS cases, along with 136 unrelated normal male individuals. The lengths of repeats were analyzed using polymerase chain reaction (PCR) amplification followed by allelic genotyping to determine allele length. Results: Our study revealed significantly shorter mean lengths of CAG repeats in patients (mean 18.25 repeats, range 14-26 repeats) in comparison to the controls (mean 22.57 repeats, range 12-39 repeats) (two-tailed P < 0.0001). GGN repeats, however, did not differ significantly between patients (mean 21.48 repeats) and controls (mean 21.21 repeats) (two- tailed P = 0.474). Among patients' groups, the mean number of CAG repeats in partial androgen insensitivity cases (mean 15.83 repeats) was significantly less than in complete androgen insensitivity cases (mean 19.46 repeats) (two- tailed P < 0.0001). Conclusion: The findings suggest that shorter lengths of repeats in the AR gene might act as low penetrance genetic background in varying manifestation of androgen insensitivity. (Asian J Androl 2008 Jul; 10: 616-624)

  12. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    OpenAIRE

    Lobaccaro, J.M.; Lumbroso, S.; Poujol, Nicolas; Georget, V.; Brinkmann, Albert; Malpuech, Georges; Sultan, C.

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for a predictive frameshift in the open reading frame and introduction of a premature stop codon at position 783 instead of 919. The deletion was reproduced in androgen receptor wildtype cDNA and tran...

  13. A PRACTICAL APPROACH TO THE DETECTION OF ANDROGEN RECEPTOR GENE-MUTATIONS AND PEDIGREE ANALYSIS IN FAMILIES WITH X-LINKED ANDROGEN INSENSITIVITY

    NARCIS (Netherlands)

    RISSTALPERS, C; HOOGENBOEZEM, T; SLEDDENS, HFBM; VERLEUNMOOIJMAN, MCT; DEGENHART, HJ; DROP, SLS; HALLEY, DJJ; Oosterwijk, Jan; HODGINS, MB; TRAPMAN, J; BRINKMANN, AO

    1994-01-01

    Androgen insensitivity syndrome (AIS) is an X-linked disorder in which defects in the androgen receptor gene have prevented the normal development of both internal and external male structures in 46,XY individuals. This survey reports the analysis of 11 AIS subjects. The androgen receptor gene of th

  14. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    NARCIS (Netherlands)

    J.M. Lobaccaro; S. Lumbroso; N. Poujol (Nicolas); V. Georget; A.O. Brinkmann (Albert); G. Malpuech (Georges); C. Sultan

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for

  15. Androgen receptor gene mutations in hormone-refractory prostate cancer.

    Science.gov (United States)

    Wallén, M J; Linja, M; Kaartinen, K; Schleutker, J; Visakorpi, T

    1999-12-01

    Prostate cancer is considered to be one of the most hormone-dependent human malignancies. As a key mediator of hormonal response, the androgen receptor (AR) is believed to have an important role in the progression of prostate cancer. Mutations in the coding region of the AR gene have been found in both untreated and hormone-refractory prostate cancer, but the frequency of such mutations at different stages of the disease is poorly documented and even contradictory results have been published. In the present study, the frequency of AR gene mutations was determined in 30 locally recurrent and two metastatic hormone-refractory prostate tumours using the polymerase chain reaction (PCR), non-radioactive single strand conformation polymorphism (SSCP), and sequencing. The length of the polymorphic CAG repeat, which is inversely correlated with the ability of the AR to activate transcription, was also analysed as well as the GGC repeat. Twelve samples were known to contain an AR gene amplification. Altogether, one point mutation (Gly(674)-->Ala) and one microsatellite mutation (CAG(20)-->CAG(18)) were found, both in cancers containing the AR gene amplification. The mean lengths of the polymorphic CAG and GGC repeats were similar to those observed in the normal population. These results favour the view that mutations in the AR gene are rare in hormone-refractory prostate cancer and do not play an important role, at least, in local relapse. Instead, the amplification and consequent overexpression of the wild-type AR gene seem to be the most common alteration involving the AR in hormone-refractory prostate cancer.

  16. Identification of testosterone-/androgen receptor-regulated genes in mouse Sertoli cells

    Institute of Scientific and Technical Information of China (English)

    Qiao-Xia Zhang; Xiao-Yan Zhang; Zhen-Ming Zhang; Wei Lu; Ling Liu; Gang Li; Zhi-Ming Cai; Yao-Ting Gui; Chawnshang Chang

    2012-01-01

    Androgen and androgen receptor (AR) play important roles in male spermatogenesis and fertility,yet detailed androgenlAR signals in Sertoli cells remain unclear.To identify AR target genes in Sertoli cells,we analyzed the gene expression profiles of testis between mice lacking AR in Sertoli cells (S-AR-/y) and their littermate wild-type (WT) mice.Digital gene expression analysis identified 2276 genes downregulated and 2865 genes upregulated in the S-AR-/y mice testis compared to WT ones.To further nail down the difference within Sertoli cells,we first constructed Sertoli cell line TM4 with stably transfected AR (named as TM4/AR) and found androgens failed to transactivate AR in Sertoli TM4 and TM4/AR cells.Interestingly,additional transient transfection of AR-cDNA resulted in significant androgen responsiveness with TM4/AR cells showing 10 times more androgen sensitivity than TM4 cells.In the condition where maximal androgen response was demonstrated,we then analyzed gene expression and found the expression levels of 2313 genes were changed more than twofold by transient transfection of AR-cDNA in the presence of testosterone.Among these genes,603 androgen-/ AR-regulated genes,including 164 upregulated and 439 downregulated,were found in both S-AR-/y mice testis and TM4/AR cells.Using informatics analysis,the gene ontology was applied to analyze these androgen-/AR-regulated genes to predict the potential roles of androgen/AR in the process of spermatogenesis.Together,using gene analysis in both S-AR-/y mice testis and TM4/AR cells may help us to better understand the androgen/AR signals in Sertoli cells and their influences in spermatogenesis.

  17. L712V mutation in the androgen receptor gene causes complete androgen insensitivity syndrome due to severe loss of androgen function.

    Science.gov (United States)

    Rajender, Singh; Gupta, Nalini J; Chakrabarty, Baidyanath; Singh, Lalji; Thangaraj, Kumarasamy

    2013-12-11

    Inability to respond to the circulating androgens is named as androgen insensitivity syndrome (AIS). Mutations in the androgen receptor (AR) gene are the most common cause of AIS. A cause and effect relationship between some of these mutations and the AIS phenotype has been proven by in vitro studies. Several other mutations have been identified, but need to be functionally validated for pathogenicity. Screening of the AR mutations upon presumptive diagnosis of AIS is recommended. We analyzed a case of complete androgen insensitivity syndrome (CAIS) for mutations in the AR gene. Sequencing of the entire coding region revealed C>G mutation (CTT-GTT) at codon 712 (position according to the NCBI database) in exon 4 of the gene, resulting in replacement of leucine with valine in the ligand-binding domain of the AR protein. No incidence of this mutation was observed in 230 normal male individuals analyzed for comparison. In vitro androgen binding and transactivation assays using mutant clone showed approximately 71% loss of ligand binding and about 76% loss of transactivation function. We conclude that CAIS in this individual was due to L712V substitution in the androgen receptor protein.

  18. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  19. Single strand conformation polymorphism analysis of androgen receptor gene mutations in patients with androgen insensitivity syndromes: Application for diagnosis, genetic counseling, and therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hiort, O. (Medizinische Universitaet zu Luebeck (Germany) Tufts-New England Medical Center, Boston, MA (United States)); Huang, Q. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States)); Sinnecker, G.H.G.; Kruse, K. (Medizinische Universitaet zu Luebeck (Germany)); Sadeghi-Nejad, A.; Wolfe, H.J. (Tufts-New England Medical Center, Boston, MA (United States)); Yandell, D.W. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States))(Harvard Medical School, Boston, MA (United States) Harvard School of Public Health, Boston, MA (United States))

    1993-07-01

    Recent studies indicate that mutations in the androgen receptor gene are associated with androgen insensitivity syndromes, a heterogeneous group of related disorders involving defective sexual differentiation in karyotypic males. In this report, the authors address the possibility of rapid mutational analysis of the androgen receptor gene for initial diagnosis, genetic counseling, and molecular subclassification of affected patients and their families. DNA from peripheral blood leukocytes of six patients from five families with various degrees of androgen insensitivity was studied. Exons 2 to 8 of the androgen receptor gene were analyzed using a combination of single strand conformation polymorphism analysis and direct DNA sequencing. Female family members were also studied to identify heterozygote carriers. Point mutations in the AR gene were identified in all six patients, and all mutations caused amino acid substitutions. One patient with incomplete androgen insensitivity was a mosaic for the mutation. Four of the five mothers, as well as a young sister of one patient, were carriers of the mutation present in the affected child. The data show that new mutations may occur in the androgen receptor gene leading to sporadic androgen insensitivity syndrome. Molecular genetic characterization of the variant allele can serve as a primary tool for diagnosis and subsequent therapy, and can provide a basis for distinguishing heterozygous carriers in familial androgen resistance. The identification of carriers is of substantial clinical importance for genetic counseling. 29 refs., 2 figs., 1 tab.

  20. Gene expression profiling of the androgen receptor antagonists flutamide and vinclozolin in zebrafish (Danio rerio) gonads

    Energy Technology Data Exchange (ETDEWEB)

    Martinovic-Weigelt, Dalma, E-mail: dalma@stthomas.edu [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); University of St. Thomas, 2115 Summit Ave, Saint Paul, MN 55105 (United States); Wang Ronglin [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Villeneuve, Daniel L. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); Bencic, David C.; Lazorchak, Jim [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Ankley, Gerald T. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States)

    2011-01-25

    The studies presented in this manuscript focus on characterization of transcriptomic responses to anti-androgens in zebrafish (Danio rerio). Research on the effects of anti-androgens in fish has been characterized by a heavy reliance on apical endpoints, and molecular mechanisms of action (MOA) of anti-androgens remain poorly elucidated. In the present study, we examined effects of a short term exposure (24-96 h) to the androgen receptor antagonists flutamide (FLU) and vinclozolin (VZ) on gene expression in gonads of sexually mature zebrafish, using commercially available zebrafish oligonucleotide microarrays (4 x 44 K platform). We found that VZ and FLU potentially impact reproductive processes via multiple pathways related to steroidogenesis, spermatogenesis, and fertilization. Observed changes in gene expression often were shared by VZ and FLU, as demonstrated by overlap in differentially-expressed genes and enrichment of several common key pathways including: (1) integrin and actin signaling, (2) nuclear receptor 5A1 signaling, (3) fibroblast growth factor receptor signaling, (4) polyamine synthesis, and (5) androgen synthesis. This information should prove useful to elucidating specific mechanisms of reproductive effects of anti-androgens in fish, as well as developing biomarkers for this important class of endocrine-active chemicals.

  1. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer

    OpenAIRE

    Madjunkova, S.; Eftimov, A.; Georgiev, V.; Petrovski, D; Dimovski, AJ; Plaseska-Karanfilska, D

    2012-01-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5′ end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. Th...

  2. Androgen receptor regulation of the seladin-1/DHCR24 gene: altered expression in prostate cancer.

    Science.gov (United States)

    Bonaccorsi, Lorella; Luciani, Paola; Nesi, Gabriella; Mannucci, Edoardo; Deledda, Cristiana; Dichiara, Francesca; Paglierani, Milena; Rosati, Fabiana; Masieri, Lorenzo; Serni, Sergio; Carini, Marco; Proietti-Pannunzi, Laura; Monti, Salvatore; Forti, Gianni; Danza, Giovanna; Serio, Mario; Peri, Alessandro

    2008-10-01

    Prostate cancer (CaP) represents a major leading cause of morbidity and mortality in the Western world. Elevated cholesterol levels, resulting from altered cholesterol metabolism, have been found in CaP cells. Seladin-1 (SELective Alzheimer Disease INdicator-1)/DHCR24 is a recently described gene involved in cholesterol biosynthesis. Here, we demonstrated the androgen regulation of seladin-1/DHCR24 expression, due to the presence of androgen responsive element sequences in its promoter region. In metastatic androgen receptor-negative CaP cells seladin-1/DHCR24 expression and cholesterol amount were reduced compared to androgen receptor-positive cells. In tumor samples from 61 patients who underwent radical prostatectomy the expression of seladin-1/DHCR24 was significantly higher with respect to normal tissues. In addition, in cancer tissues mRNA levels were positively related to T stage. In tumor specimens from 23 patients who received androgen ablation treatment for 3 months before surgery seladin-1/DHCR24 expression was significantly lower with respect to patients treated by surgery only. In conclusion, our study demonstrated for the first time the androgen regulation of the seladin-1/DHCR24 gene and the presence of a higher level of expression in CaP tissues, compared to the normal prostate. These findings, together with the results previously obtained in metastatic disease, suggest an involvement of this gene in CaP.

  3. Genetic and Functional Analysis of Androgen Receptor Gene Mutations

    NARCIS (Netherlands)

    H.T. Brüggenwirth (Hennie)

    1998-01-01

    textabstractNuclear hormone receptors (NHRs) are intermediary factors through which extracellular signals regulate expression of genes that are involved in homeostasis, development, and differentiation (Beato et al. '995, Mangelsdorf and Evans 1995). These receptors are characterized by a modular st

  4. Androgen receptor mutations

    NARCIS (Netherlands)

    A.O. Brinkmann (Albert); G.W. Jenster (Guido); C. Ris-Stalpers (Carolyn); J.A.G.M. van der Korput (J. A G M); H.T. Brüggenwirth (Hennie); A.L.M. Boehmer (Annemie); J. Trapman (Jan)

    1995-01-01

    textabstractMale sexual differentiation and development proceed under direct control of androgens. Androgen action is mediated by the intracellular androgen receptor, which belongs to the superfamily of ligand-dependent transcription factors. At least three pathological situations are associated wit

  5. Development of an androgen reporter gene assay (AR-LUX) utilizing a human cell line with an endogenously regulated androgen receptor

    NARCIS (Netherlands)

    Blankvoort, B.M.G.; Groene, E.M. de; Meeteren-Kreikamp, A.P. van; Witkamp, R.F.; Rodenburg, R.J.T.; Aarts, J.M.M.J.G.

    2001-01-01

    The aim of the work described in this report is to develop and characterize a cell-based androgen reporter assay. For this purpose, the androgen receptor (AR) expressing human breast cancer cell line T47D was stably transfected with a luciferase gene under transcriptional control of the PB-ARE-2 and

  6. Androgen receptor abnormalities

    NARCIS (Netherlands)

    A.O. Brinkmann (Albert); G.G.J.M. Kuiper (George); C. Ris-Stalpers (Carolyn); H.C.J. van Rooij (Henri); G. Romalo (G.); G. Trifiro (Gianluca); E. Mulder (Eppo); L. Pinsky (L.); H.U. Schweikert (H.); J. Trapman (Jan)

    1991-01-01

    markdownabstract__Abstract__ The human androgen receptor is a member of the superfamily of steroid hormone receptors. Proper functioning of this protein is a prerequisite for normal male sexual differentiation and development. The cloning of the human androgen receptor cDNA and the elucidation of t

  7. SUMOylation modulates the transcriptional activity of androgen receptor in a target gene and pathway selective manner.

    Science.gov (United States)

    Sutinen, Päivi; Malinen, Marjo; Heikkinen, Sami; Palvimo, Jorma J

    2014-07-01

    Androgen receptor (AR) plays an important regulatory role in prostate cancer. AR's transcriptional activity is regulated by androgenic ligands, but also by post-translational modifications, such as SUMOylation. To study the role of AR SUMOylation in genuine chromatin environment, we compared androgen-regulated gene expression and AR chromatin occupancy in PC-3 prostate cancer cell lines stably expressing wild-type (wt) or doubly SUMOylation site-mutated AR (AR-K386R,K520R). Our genome-wide gene expression analyses reveal that the SUMOylation modulates the AR function in a target gene and pathway selective manner. The transcripts that are differentially regulated by androgen and SUMOylation are linked to cellular movement, cell death, cellular proliferation, cellular development and cell cycle. Fittingly, SUMOylation mutant AR cells proliferate faster and are more sensitive to apoptosis. Moreover, ChIP-seq analyses show that the SUMOylation can modulate the chromatin occupancy of AR on many loci in a fashion that parallels their differential androgen-regulated expression. De novo motif analyses reveal that FOXA1, C/EBP and AP-1 motifs are differentially enriched at the wtAR- and the AR-K386R,K520R-preferred genomic binding positions. Taken together, our data indicate that SUMOylation does not simply repress the AR activity, but it regulates AR's interaction with the chromatin and the receptor's target gene selection.

  8. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol

    Energy Technology Data Exchange (ETDEWEB)

    Elo, J.P.; Kvist, L.; Leinonen, K.; Isomaa, V. [Univ. of Oulu (Finland)] [and others

    1995-12-01

    Androgens are necessary for the development of prostatic cancer. The mechanisms by which the originally androgen-dependent prostatic cancer cells are relieved of the requirement to use androgen for their growth are largely unknown. The human prostatic cancer cell line LNCaP has been shown to contain a point mutation in the human androgen receptor gene (hAR), suggesting that changes in the hAR may contribute to the abnormal hormone response of prostatic cells. To search for point mutations in the hAR, we used single strand conformation polymorphism analysis and a polymerase chain reaction direct sequencing method to screen 23 prostatic cancer specimens from untreated patients, 6 prostatic cancer specimens from treated patients, and 11 benign prostatic hyperplasia specimens. One mutation was identified in DNA isolated from prostatic cancer tissue, and the mutation was also detected in the leukocyte DNA of the patient and his offspring. The mutation changed codon 726 in exon E from arginine to leucine and was a germ line mutation. The mutation we found in exon E of the hAR gene does not alter the ligand binding specificity of the AR, but the mutated receptor was activated by estradiol to a significantly greater extent than the wild-type receptor. The AR gene mutation described in this study might be one explanation for the altered biological activity of prostatic cancer. 36 refs., 4 figs.

  9. CAG repeat polymorphism in the androgen receptor (AR) gene of SBMA patients and a control group.

    Science.gov (United States)

    Sułek, Anna; Hoffman-Zacharska, Dorota; Krysa, Wioletta; Szirkowiec, Walentyna; Fidziańska, Elzbieta; Zaremba, Jacek

    2005-01-01

    Spinobulbar muscular atrophy (SBMA) is an X-linked form of motor neuron disease characterized by progressive atrophy of the muscles, dysphagia, dysarthria and mild androgen insensitivity. SBMA is caused by CAG repeat expansion in the androgen receptor gene. CAG repeat polymorphism was analysed in a Polish control group (n = 150) and patients suspected of SBMA (n = 60). Normal and abnormal ranges of CAG repeats were established in the control group and in 21 patients whose clinical diagnosis of SBMA was molecularly confirmed. The ranges are similar to those reported for other populations.

  10. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  11. Androgen Receptor-Target Genes in African American Prostate Cancer Disparities

    Directory of Open Access Journals (Sweden)

    Bi-Dar Wang

    2013-01-01

    Full Text Available The incidence and mortality rates of prostate cancer (PCa are higher in African American (AA compared to Caucasian American (CA men. To elucidate the molecular mechanisms underlying PCa disparities, we employed an integrative approach combining gene expression profiling and pathway and promoter analyses to investigate differential transcriptomes and deregulated signaling pathways in AA versus CA cancers. A comparison of AA and CA PCa specimens identified 1,188 differentially expressed genes. Interestingly, these transcriptional differences were overrepresented in signaling pathways that converged on the androgen receptor (AR, suggesting that the AR may be a unifying oncogenic theme in AA PCa. Gene promoter analysis revealed that 382 out of 1,188 genes contained cis-acting AR-binding sequences. Chromatin immunoprecipitation confirmed STAT1, RHOA, ITGB5, MAPKAPK2, CSNK2A,1 and PIK3CB genes as novel AR targets in PCa disparities. Moreover, functional screens revealed that androgen-stimulated AR binding and upregulation of RHOA, ITGB5, and PIK3CB genes were associated with increased invasive activity of AA PCa cells, as siRNA-mediated knockdown of each gene caused a loss of androgen-stimulated invasion. In summation, our findings demonstrate that transcriptional changes have preferentially occurred in multiple signaling pathways converging (“transcriptional convergence” on AR signaling, thereby contributing to AR-target gene activation and PCa aggressiveness in AAs.

  12. Mutations of androgen receptor gene in Brazilian patients with male pseudohermaphroditism

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    1998-06-01

    Full Text Available We describe the identification of point mutations in the androgen receptor gene in five Brazilian patients with female assignment and behavior. The eight exons of the gene were amplified by the polymerase chain reaction (PCR and analyzed for single-strand conformation polymorphism (SSCP to detect the mutations. Direct sequencing of the mutant PCR products demonstrated single transitions in three of these cases: G®A in case 1, within exon C, changing codon 615 from Arg to His; G®A in case 2, within exon E, changing codon 752 from Arg to Gln, and C®T in case 3, within exon B, but without amino acid change.

  13. Androgen receptor- and PIAS1-regulated gene programs in molecular apocrine breast cancer cells.

    Science.gov (United States)

    Malinen, Marjo; Toropainen, Sari; Jääskeläinen, Tiina; Sahu, Biswajyoti; Jänne, Olli A; Palvimo, Jorma J

    2015-10-15

    We have analyzed androgen receptor (AR) chromatin binding sites (ARBs) and androgen-regulated transcriptome in estrogen receptor negative molecular apocrine breast cancer cells. These analyses revealed that 42% of ARBs and 39% androgen-regulated transcripts in MDA-MB453 cells have counterparts in VCaP prostate cancer cells. Pathway analyses showed a similar enrichment of molecular and cellular functions among AR targets in both breast and prostate cancer cells, with cellular growth and proliferation being among the most enriched functions. Silencing of the coregulator SUMO ligase PIAS1 in MDA-MB453 cells influenced AR function in a target-selective fashion. An anti-apoptotic effect of the silencing suggests involvement of the PIAS1 in the regulation of cell death and survival pathways. In sum, apocrine breast cancer and prostate cancer cells share a core AR cistrome and target gene signature linked to cancer cell growth, and PIAS1 plays a similar coregulatory role for AR in both cancer cell types.

  14. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer.

    Science.gov (United States)

    Madjunkova, S; Eftimov, A; Georgiev, V; Petrovski, D; Dimovski, Aj; Plaseska-Karanfilska, D

    2012-06-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5' end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. This retrospective case-control study evaluates the possible effect of short CAG repeats on the AR gene in prostate cancer risk in Macedonian males. A total of 392 male subjects, 134 PC patients, 106 patients with benign prostatic hyperplasia (BPH) and 152 males from the general Macedonian population were enrolled in this study. The CAG repeat length was determined by fluorescent polymerase chain reaction (PCR) amplification of exon1 of the AR gene followed by capillary electrophoresis (CE) on a genetic analyzer. The mean repeat length in PC patients was 21.5 ± 2.65, in controls 22.28 ± 2.86 (p = 0.009) and in BPH patients 22.1 ± 2.52 (p = 0.038). Short CAG repeats (CAG repeat (CAG repeat length. These results suggest that reduced CAG repeat length may be associated with increased prostate cancer risk in Macedonian men.

  15. Testosterone increases renal anti-aging klotho gene expression via the androgen receptor-mediated pathway.

    Science.gov (United States)

    Hsu, Shih-Che; Huang, Shih-Ming; Lin, Shih-Hua; Ka, Shuk-Man; Chen, Ann; Shih, Meng-Fu; Hsu, Yu-Juei

    2014-12-01

    Gender is known to be associated with longevity and oestrogen administration induced longevity-associated gene expression is one of the potential mechanisms underlying the benefits of oestrogen on lifespan, whereas the role of testosterone in the regulation of longevity-associated gene expressions remains largely unclear. The klotho gene, predominantly expressed in the kidney, has recently been discovered to be an aging suppressor gene. In the present study, we investigated the regulatory effects of testosterone on renal klotho gene expression in vivo and in vitro. In testosterone-administered mouse kidney and NRK-52E cells, increased klotho expression was accompanied by the up-regulation of the nuclear androgen receptor (AR). Overexpression of AR enhanced the expression of klotho mRNA and protein. Conversely, testosterone-induced klotho expression was attenuated in the presence of flutamide, an AR antagonist. A reporter assay and a chromatin immunoprecipitation (ChIP) assay demonstrated that AR directly binds to the klotho promoter via androgen response elements (AREs) which reconfirmed its importance for AR binding via the element mutation. In summary, our study demonstrates that testosterone up-regulates anti-aging klotho together with AR expression in the kidney in vivo and in vitro by recruiting AR on to the AREs of the klotho promoter.

  16. Larger trinucleotide repeat size in the androgen receptor gene of infertile men with extremely severe oligozoospermia.

    Science.gov (United States)

    Patrizio, P; Leonard, D G; Chen, K L; Hernandez-Ayup, S; Trounson, A O

    2001-01-01

    Androgens are significant regulators of human spermatogenesis. Their action is mediated through the androgen receptor (AR), which binds to the androgen responsive element on DNA and regulates gene transcription. Men become infertile with spinobulbar muscular atrophy (Kennedy disease) caused by a trinucleotide repeat expansion, > or = 40 CAG repeats, in the AR gene located on the X chromosome. In this prospective study, we investigated whether the variable size, larger repeats, of this trinucleotide could alter AR function and result in impaired spermatogenesis. A total of 69 infertile men were studied. Clinical and laboratory analysis showed idiopathic, nonobstructive azoospermia in 16 men, extremely severe oligozoospermia in 27 men (PCR) amplification across the AR repeat region. Accurate size determination of the PCR product using an ABI 373 DNA sequencer allowed precise calculation of CAG repeat sizes. The AR gene was not analyzed for other types of mutations. The difference in CAG repeat size between infertile men and proven fertile controls was statistically significant, P = .03. Patients with extremely severe oligozoospermia had significantly longer CAG repeat tracts (mean, 25.4 +/- 4.0; P = .0005; range 20-39) than controls (mean, 22 +/- 2.8; range 12-30) or patients with severe oligozoospermia (mean, 22.2 +/- 2.3; range 18-26). None of the 26 infertile men with sperm counts CAG repeats compared with 6 out of 45 controls (13%; P = .06). This study suggests that some men with severe impairment of spermatogenesis have longer trinucleotide repeats in the AR gene. Although direct evidence is missing, lower affinity between androgen and the AR protein or decreased AR protein availability with longer repeats could be responsible for a diminished androgen effect on spermatogenesis. Two of the patients in the extremely severe oligozoospermia group had 35 and 39 CAG repeats, respectively (normal range is 11 to 33). Although not yet considered a mutation, longer

  17. A large deletion/insertion-induced frameshift mutation of the androgen receptor gene in a family with a familial complete androgen insensitivity syndrome.

    Science.gov (United States)

    Cong, Peikuan; Ye, Yinghui; Wang, Yue; Lu, Lingping; Yong, Jing; Yu, Ping; Joseph, Kimani Kagunda; Jin, Fan; Qi, Ming

    2012-06-01

    Androgen insensitivity syndrome (AIS) is an X-linked recessive genetic disorder with a normal 46, XY karyotype caused by abnormality of the androgen receptor (AR) gene. One Chinese family consisting of the proband and 5 other members with complete androgen insensitivity syndrome (CAIS) was investigated. Mutation analysis by DNA sequencing on all 8 exons and flanking intron regions of the AR gene revealed a unique large deletion/insertion mutation in the family. A 287 bp deletion and 77 bp insertion (c.933_1219delins77) mutation at codon 312 resulted in a frameshift which caused a premature stop (p.Phe312Aspfs*7) of polypeptide formation. The proband's mother and grandmother were heterozygous for the mutant allele. The proband's father, uncle and grandfather have the normal allele. From the pedigree constructed from mutational analysis of the family, it is revealed that the probably pathogenic mutation comes from the maternal side.

  18. Androgen receptor gene polymorphisms and risk of prostate cancer: a meta-analysis

    Science.gov (United States)

    Weng, Hong; Li, Sheng; Huang, Jing-Yu; He, Zi-Qi; Meng, Xiang-Yu; Cao, Yue; Fang, Cheng; Zeng, Xian-Tao

    2017-01-01

    Although the association between CAG and GGN repeats in the androgen receptor gene and prostate cancer risk has been widely studied, it remains controversial from previous meta-analyses and narrative reviews. Therefore, we performed this meta-analysis to provide more precise estimates with sufficient power. A total of 51 publications with 61 studies for CAG repeats and 14 publications with 16 studies for GGN repeats were identified in the meta-analysis. The results showed that short CAG repeats (repeats) carriers presented an elevated risk of prostate cancer than long CAG repeats (≥22) carriers (OR = 1.31, 95% CI 1.16 to 1.47). Prostate cancer cases presented an average fewer CAG repeats (MD = −0.85, 95% CI −1.28 to −0.42) than controls. Short GGN repeats (≤16) carriers presented an increased risk of prostate cancer than long GGN repeats (>16) carriers (OR = 1.38, 95% CI 1.05 to 1.82). In subgroup analyses, the abovementioned significant association was predominantly observed in Caucasian populations. The meta-analysis showed that short CAG and GGN repeats in androgen receptor gene were associated with increased risk of prostate cancer, especially in Caucasians. PMID:28091563

  19. Reduced CAG repeats length in androgen receptor gene is associated with violent criminal behavior.

    Science.gov (United States)

    Rajender, Singh; Pandu, Guguluth; Sharma, J D; Gandhi, K P C; Singh, Lalji; Thangaraj, Kumarasamy

    2008-09-01

    Androgens mediate their functions through androgen receptors (AR). The two triplet repeats in the AR gene (CAG and GGN) are highly polymorphic among various populations and have been extensively studied in diverse clinical conditions and antisocial personality disorders. Several studies have reported either higher levels of testosterone among rapists or the correlation of shorter CAG repeats with criminal activities. However, to date, no study has analyzed AR gene in rapists worldwide, and no study has been conducted on criminals from Indian subcontinent. Therefore, we have analyzed the AR-CAG repeat length in 645 men, of which 241 were convicted for rape, 107 for murder, 26 for both murder and rape, and 271 were control males. The aim was to explore if there was any correlation between CAG repeat length and criminal behavior. The study revealed significantly shorter CAG repeats in the rapists (mean 18.44 repeats) and murderers (mean 17.59 repeats) compared to the control men (mean 21.19 repeats). The criminals who committed murder after rape had a far shorter mean repeat length (mean 17.31 repeats) in comparison to the controls or those convicted of rape or murder alone. In short, our study suggests that the reduced CAG repeats in the AR gene are associated with criminal behavior. This, along with other studies, would help in understanding the biological factors associated with the antisocial or criminal activities.

  20. Development of an androgen reporter gene assay (AR-LUX) utilizing a human cell line with an endogenously regulated androgen receptor.

    Science.gov (United States)

    Blankvoort, B M; de Groene, E M; van Meeteren-Kreikamp, A P; Witkamp, R F; Rodenburg, R J; Aarts, J M

    2001-11-01

    The aim of the work described in this report is to develop and characterize a cell-based androgen reporter assay. For this purpose, the androgen receptor (AR) expressing human breast cancer cell line T47D was stably transfected with a luciferase gene under transcriptional control of the PB-ARE-2 androgen response element. The application of this cell line in an endogenous Androgen Receptor-mediated LUciferase eXpression assay (AR-LUX) was validated. An EC50 value of 86 pM was determined for the standard androgen R1881 with a detection limit of 46 pM. Other androgens like dihydrotestosterone, 17beta-trenbolone, and bolasterone also induced luciferase expression, while anti-androgens suppressed these responses. As expected, AR-mediated responses were also elicited by high concentrations of the steroids progesterone, 17beta-estradiol, d-aldosterone, and dexamethasone, with observed EC50 values 10 to 350,000 times higher than that for R1881. A unique feature of the AR-LUX assay is that effects on modulation of active endogenous AR-levels are reliably reflected in the luciferase induction response, as exemplified by vitamin D, all-trans-retinoic acid, epigallocatechin gallate, and forskolin. This feature is especially useful when assessing complex mixtures, e.g., environmental samples or natural compound libraries. From these data it is concluded that the AR-LUX assay is a reliable in vitro test system for the detection and quantification of AR-mediated biological effects. The 96-well plate format makes the assay particularly suitable for high-throughput screening.

  1. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    2004-12-01

    Full Text Available The human androgen receptor (AR gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  2. Peripheral androgen receptor gene suppression rescues disease in mouse models of spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Lieberman, Andrew P; Yu, Zhigang; Murray, Sue; Peralta, Raechel; Low, Audrey; Guo, Shuling; Yu, Xing Xian; Cortes, Constanza J; Bennett, C Frank; Monia, Brett P; La Spada, Albert R; Hung, Gene

    2014-05-01

    Spinal and bulbar muscular atrophy (SBMA) is caused by the polyglutamine androgen receptor (polyQ-AR), a protein expressed by both lower motor neurons and skeletal muscle. Although viewed as a motor neuronopathy, data from patients and mouse models suggest that muscle contributes to disease pathogenesis. Here, we tested this hypothesis using AR113Q knockin and human bacterial artificial chromosome/clone (BAC) transgenic mice that express the full-length polyQ-AR and display androgen-dependent weakness, muscle atrophy, and early death. We developed antisense oligonucleotides that suppressed AR gene expression in the periphery but not the CNS after subcutaneous administration. Suppression of polyQ-AR in the periphery rescued deficits in muscle weight, fiber size, and grip strength, reversed changes in muscle gene expression, and extended the lifespan of mutant males. We conclude that polyQ-AR expression in the periphery is an important contributor to pathology in SBMA mice and that peripheral administration of therapeutics should be explored for SBMA patients.

  3. Peripheral Androgen Receptor Gene Suppression Rescues Disease in Mouse Models of Spinal and Bulbar Muscular Atrophy

    Directory of Open Access Journals (Sweden)

    Andrew P. Lieberman

    2014-05-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA is caused by the polyglutamine androgen receptor (polyQ-AR, a protein expressed by both lower motor neurons and skeletal muscle. Although viewed as a motor neuronopathy, data from patients and mouse models suggest that muscle contributes to disease pathogenesis. Here, we tested this hypothesis using AR113Q knockin and human bacterial artificial chromosome/clone (BAC transgenic mice that express the full-length polyQ-AR and display androgen-dependent weakness, muscle atrophy, and early death. We developed antisense oligonucleotides that suppressed AR gene expression in the periphery but not the CNS after subcutaneous administration. Suppression of polyQ-AR in the periphery rescued deficits in muscle weight, fiber size, and grip strength, reversed changes in muscle gene expression, and extended the lifespan of mutant males. We conclude that polyQ-AR expression in the periphery is an important contributor to pathology in SBMA mice and that peripheral administration of therapeutics should be explored for SBMA patients.

  4. Androgen receptor gene polymorphisms lean mass and performance in young men.

    Science.gov (United States)

    Guadalupe-Grau, Amelia; Rodríguez-González, F Germán; Dorado, Cecilia; Olmedillas, Hugo; Fuentes, Teresa; Pérez-Gómez, Jorge; Delgado-Guerra, Safira; Vicente-Rodríguez, Germán; Ara, Ignacio; Guerra, Borja; Arteaga-Ortiz, Rafael; Calbet, José A L; Díaz-Chico, B Nicolás

    2011-02-01

    The exon-1 of the androgen receptor (AR) gene contains two repeat length polymorphisms which modify either the amount of AR protein inside the cell (GGN(n), polyglycine) or its transcriptional activity (CAG(n), polyglutamine). Shorter CAG and/or GGN repeats provide stronger androgen signalling and vice versa. To test the hypothesis that CAG and GGN repeat AR polymorphisms affect muscle mass and various variables of muscular strength phenotype traits, the length of CAG and GGN repeats was determined by PCR and fragment analysis and confirmed by DNA sequencing of selected samples in 282 men (28.6 ± 7.6 years). Individuals were grouped as CAG short (CAG(S)) if harbouring repeat lengths of ≤ 21 and CAG long (CAG(L)) if CAG >21. GGN was considered short (GGN(S)) or long (GGN(L)) if GGN ≤ 23 or >23, respectively. No significant differences in lean body mass or fitness were observed between the CAG(S) and CAG(L) groups, or between GGN(S) and GGN(L) groups, but a trend for a correlation was found for the GGN repeat and lean mass of the extremities (r=-0.11, p=0.06). In summary, the lengths of CAG and GGN repeat of the AR gene do not appear to influence lean mass or fitness in young men.

  5. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    Center, Kansas City, KS 66160, USA Introduction Prostate cancer is the most common cancer diagnosed after skin cancers and the... cancer cell growth: androgen regulation of CDK2, CDK4 , and CKI p16 genes. Cancer Res. 1997; 57:4511-4516. 109. Gregory CW, Hamil KG, Kim D, Hall SH...the most diagnosed non- skin cancer and the second leading cause of cancer -related death [2]. Currently, prostate-specific antigen (PSA) is the most

  6. Molecular analysis of the androgen receptor gene in Kennedy's disease. Report of two families and review of the literature.

    Science.gov (United States)

    Lumbroso, S; Lobaccaro, J M; Vial, C; Sassolas, G; Ollagnon, B; Belon, C; Pouget, J; Sultan, C

    1997-01-01

    We have performed a molecular analysis of the androgen receptor gene in two families with suspected Kennedy's disease (spinal and bulbar muscular atrophy, SBMA) with the aim of making a firm diagnosis of the disease. The 2 patients studied were sporadic cases. Both presented clinical signs compatible with the diagnosis of SBMA: limb and facial muscular weakness of adult onset progressing toward muscular atrophy. Clinical signs of partial androgen insensitivity syndrome usually observed in SBMA were present only in patient 2. Enzymatic amplification of the CAG repeat region of exon 1 of the androgen receptor gene was performed on genomic DNA. PCR products were submitted to agarose or acrylamide electrophoresis for size evaluation. Precise determination of the CAG number was performed by direct sequencing of purified amplification products. Androgen receptor gene analysis was also performed in 2 sisters of patient 1 and in the mother, sisters and daughter of patient 2. Androgen receptor-binding activity was also determined on cultured genital skin fibroblasts of patient 1. Analysis of PCR products showed in both patients a single band that was much larger in size than the control. The expansion of the CAG repeat number was confirmed by direct sequencing: the exact number of CAG was 47 in patient 1 and 42 in patient 2 (n = 12-32). The 2 studied sisters of patient 1 did not present the abnormal fragment, demonstrating they are not carriers for the disease. Conversely, the mother, sisters and daughter of patient 2 presented both normal and mutated alleles. The migration of the labelled PCR products on a sequencing gel revealed a meiotic instability of expanded CAG repeat in family 2. Moreover, patient 1 had a decreased androgen-binding capacity on cultured genital skin fibroblasts. In both families, analysis of the androgen receptor gene permitted us to diagnose SBMA in the patients and to establish the carrier status in siblings. These results correspond to the

  7. Androgen receptor-dependent transactivation of growth arrest-specific gene 6 mediates inhibitory effects of testosterone on vascular calcification.

    Science.gov (United States)

    Son, Bo-Kyung; Akishita, Masahiro; Iijima, Katsuya; Ogawa, Sumito; Maemura, Koji; Yu, Jing; Takeyama, Kenichi; Kato, Shigeaki; Eto, Masato; Ouchi, Yasuyoshi

    2010-03-05

    Recent epidemiological studies have found that androgen deficiency is associated with a higher incidence of cardiovascular disease in men. However, little is known about the mechanism underlying the cardioprotective effects of androgens. Here we show the inhibitory effects of testosterone on vascular calcification and a critical role of androgen receptor (AR)-dependent transactivation of growth arrest-specific gene 6 (Gas6), a key regulator of inorganic phosphate (P(i))-induced calcification of vascular smooth muscle cells (VSMC). Testosterone and nonaromatizable androgen dihydrotestosterone inhibited P(i)-induced calcification of human aortic VSMC in a concentration-dependent manner. Androgen inhibited P(i)-induced VSMC apoptosis, an essential process for VSMC calcification. The effects on VSMC calcification were mediated by restoration of P(i)-induced down-regulation of Gas6 expression and a subsequent reduction of Akt phosphorylation. These effects of androgen were blocked by an AR antagonist, flutamide, but not by an estrogen receptor antagonist, ICI 182,780. We then explored the mechanistic role of the AR in Gas6 expression and found an abundant expression of AR predominantly in the nucleus of VSMC and two consensus ARE sequences in the Gas6 promoter region. Dihydrotestosterone stimulated Gas6 promoter activity, and this effect was abrogated by flutamide and by AR siRNA. Site-specific mutation revealed that the proximal ARE was essential for androgen-dependent transactivation of Gas6. Furthermore, chromatin immunoprecipitation assays demonstrated ligand-dependent binding of the AR to the proximal ARE of Gas6. These results indicate that AR signaling directly regulates Gas6 transcription, which leads to inhibition of vascular calcification, and provides a mechanistic insight into the cardioprotective action of androgens.

  8. Neural androgen receptors modulate gene expression and social recognition but not social investigation

    Directory of Open Access Journals (Sweden)

    Sara A Karlsson

    2016-03-01

    Full Text Available The role of sex and androgen receptors (ARs for social preference and social memory is rather unknown. In this study of mice we compared males, females and males lacking ARs specifically in the nervous system, ARNesDel, with respect to social preference, assessed with the three-chambered apparatus test, and social recognition, assessed with the social discrimination procedure. In the social discrimination test we also evaluated the tentative importance of the sex of the stimulus animal. Novel object recognition and olfaction were investigated to complement the results from the social tests. Gene expression analysis was performed to reveal molecules involved in the effects of sex and androgens on social behaviors. All three test groups showed social preference in the three-chambered apparatus test. In both social tests an AR-independent sexual dimorphism was seen in the persistence of social investigation of female conspecifics, whereas the social interest towards male stimuli mice was similar in all groups. Male and female controls recognized conspecifics independent of their sex, whereas ARNesDel males recognized female but not male stimuli mice. Moreover, the non-social behaviors were not affected by AR deficiency. The gene expression analyses of hypothalamus and amygdala indicated that Oxtr, Cd38, Esr1, Cyp19a1, Ucn3, Crh and Gtf2i were differentially expressed between the three groups. In conclusion, our results suggest that ARs are required for recognition of male but not female conspecifics, while being dispensable for social investigation towards both sexes. In addition, the AR seems to regulate genes related to oxytocin, estrogen and William’s syndrome.

  9. Transcriptional network of androgen receptor in prostate cancer progression.

    Science.gov (United States)

    Takayama, Ken-ichi; Inoue, Satoshi

    2013-08-01

    The androgen receptor belongs to the nuclear receptor superfamily and functions as a ligand-dependent transcription factor. It binds to the androgen responsive element and recruits coregulatory factors to modulate gene transcription. In addition, the androgen receptor interacts with other transcription factors, such as forkhead box A1, and other oncogenic signaling pathway molecules that bind deoxyribonucleic acid and regulate transcription. Androgen receptor signaling plays an important role in the development of prostate cancer. Prostate cancer cells proliferate in an androgen-dependent manner, and androgen receptor blockade is effective in prostate cancer therapy. However, patients often progress to castration-resistant prostate cancer with elevated androgen receptor expression and hypersensitivity to androgen. Recently, comprehensive analysis tools, such as complementary DNA microarray, chromatin immunoprecipitation-on-chip and chromatin immunoprecipitation-sequence, have described the androgen-mediated diverse transcriptional program and gene networks in prostate cancer. Furthermore, functional and clinical studies have shown that some of the androgen receptor-regulated genes could be prognostic markers and potential therapeutic targets for the treatment of prostate cancer, particularly castration-resistant prostate cancer. Thus, identifying androgen receptor downstream signaling events and investigating the regulation of androgen receptor activity is critical for understanding the mechanism of carcinogenesis and progression to castration-resistant prostate cancer.

  10. Polymorphic CAG Repeat and Protein Expression of Androgen Receptor Gene in Colorectal Cancer.

    Science.gov (United States)

    Huang, Rui; Wang, Guiyu; Song, Yanni; Wang, Feng; Zhu, Bing; Tang, Qingchao; Liu, Zheng; Chen, Yinggang; Zhang, Qian; Muhammad, Shan; Wang, Xishan

    2015-04-01

    Although somatic alterations in CAG repeats in the androgen receptor (AR) gene have been suggested to predispose to colorectal cancer, less is known about AR in colorectal cancer carcinogenesis. Because of lack of relevant analysis on CAG repeat length and AR expression in colorectal cancer, we aimed to investigate the prognostic value of polymorphic CAG and protein expression of the AR gene in patients with colorectal cancer. A case-control study was carried out on 550 patients with colorectal cancer and 540 healthy controls to investigate whether polymorphic CAG within the AR gene is linked to increased risk for colorectal cancer. Polymorphic CAG and AR expression were analyzed to clarify their relationship with clinicopathologic and prognostic factors in patients with colorectal cancer. The study showed that the AR gene in patients with colorectal cancer had a longer CAG repeat sequence than those in the control group, as well as increased risk for colorectal cancer among females (P = 0.013), males (P = 0.002), and total colorectal cancer population (P CAG repeat sequence among males (P CAG repeat sequence and negative AR expression were associated with a short 5-year overall survival (OS) rate in colorectal cancer. Long CAG repeat sequences and the absence of AR expression were closely related to the development of colorectal cancer. Both long CAG and decreased AR expression were correlated with the poor 5-year OS in patients with colorectal cancer.

  11. Complete androgen insensitivity syndrome caused by a novel splice donor site mutation and activation of a cryptic splice donor site in the androgen receptor gene.

    Science.gov (United States)

    Infante, Joana B; Alvelos, Maria I; Bastos, Margarida; Carrilho, Francisco; Lemos, Manuel C

    2016-01-01

    The androgen insensitivity syndrome is an X-linked recessive genetic disorder characterized by resistance to the actions of androgens in an individual with a male karyotype. We evaluated a 34-year-old female with primary amenorrhea and a 46,XY karyotype, with normal secondary sex characteristics, absence of uterus and ovaries, intra-abdominal testis, and elevated testosterone levels. Sequence analysis of the androgen receptor (AR) gene revealed a novel splice donor site mutation in intron 4 (c.2173+2T>C). RT-PCR analysis showed that this mutation resulted in the activation of a cryptic splice donor site located in the second half of exon 4 and in the synthesis of a shorter mRNA transcript and an in-frame deletion of 41 amino acids. This novel mutation associated with a rare mechanism of abnormal splicing further expands the spectrum of mutations associated with the androgen insensitivity syndrome and may contribute to the understanding of the molecular mechanisms involved in splicing defects.

  12. Rescue of Metabolic Alterations in AR113Q Skeletal Muscle by Peripheral Androgen Receptor Gene Silencing

    Directory of Open Access Journals (Sweden)

    Elisa Giorgetti

    2016-09-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA, a progressive degenerative disorder, is caused by a CAG/glutamine expansion in the androgen receptor (polyQ AR. Recent studies demonstrate that skeletal muscle is an important site of toxicity that contributes to the SBMA phenotype. Here, we sought to identify critical pathways altered in muscle that underlie disease manifestations in AR113Q mice. This led to the unanticipated identification of gene expression changes affecting regulators of carbohydrate metabolism, similar to those triggered by denervation. AR113Q muscle exhibits diminished glycolysis, altered mitochondria, and an impaired response to exercise. Strikingly, the expression of genes regulating muscle energy metabolism is rescued following peripheral polyQ AR gene silencing by antisense oligonucleotides (ASO, a therapeutic strategy that alleviates disease. Our data establish the occurrence of a metabolic imbalance in SBMA muscle triggered by peripheral expression of the polyQ AR and indicate that alterations in energy utilization contribute to non-neuronal disease manifestations.

  13. A unique mosaic Turner syndrome patient with androgen receptor gene derived marker chromosome.

    Science.gov (United States)

    Kalkan, Rasime; Özdağ, Nermin; Bundak, Rüveyde; Çirakoğlu, Ayşe; Serakinci, Nedime

    2016-01-01

    Patients with Turner syndrome are generally characterized by having short stature with no secondary sexual characteristics. Some abnormalities, such as webbed neck, renal malformations (>50%) and cardiac defects (10%) are less common. The intelligence of these patients is considered normal. Non-mosaic monosomy X is observed in approximately 45% of postnatal patients with Turner syndrome and the rest of the patients have structural abnormalities or mosaicism involving 46,X,i(Xq), 45,X/46,XX, 45,X and other variants. The phenotype of 45,X/46,X,+mar individuals varies by the genetic continent and degree of the mosaicism. The gene content of the marker chromosome is the most important when correlating the phenotype with the genotype. Here we present an 11-year-old female who was referred for evaluation of her short stature and learning disabilities. Conventional cytogenetic investigation showed a mosaic 45,X/46,X,+mar karyotype. Fluorescence in situ hybridization showed that the marker chromosome originated from the X chromosome within the androgen receptor (AR) and X-inactive specific transcript (XIST) genes. Therefore, it is possible that aberrant activation of the marker chromosome, compromising the AR and XIST genes, may modify the Turner syndrome phenotype.

  14. Identification of a mutant allele of the androgen receptor gene in a family with androgen insensitivity syndrome: detection of carriers and prenatal diagnosis.

    Science.gov (United States)

    Fogu, G; Bertini, V; Dessole, S; Bandiera, P; Campus, P M; Capobianco, G; Sanna, R; Soro, G; Montella, A

    2004-05-01

    We report the results of a molecular study of a large family segregating the complete form of the Androgen Insensitivity Syndrome (CAIS) in several family members from three generations. We identified the mutant allele by polymerase chain reaction (PCR) amplification of the short tandem repeat (CAG)n, highly polymorphic in the population, present in the first exon of the androgen receptor (AR) gene. In this family four different alleles were detected and one of these showed a perfect segregation with the disease. This study enabled us to identify the heterozygous females in this family. We think that this simple, indirect test, is also suitable for prenatal diagnosis of Morris' syndrome when the mother is heterozygous for the size of the short tandem repeat and one affected subject in the family may be studied.

  15. Gene expression changes in rat prostate after activation or blocking of the androgen and estrogen receptor

    DEFF Research Database (Denmark)

    Nellemann, Christine Lydia; Dalgaard, Majken; Holst, Bjørn;

    2005-01-01

    Several endpoints of different molecular complexity were studied in the Hershberger assay in order to evaluate the specificity and suitability of this test as a broad screening model. Androgen and estrogen receptors were activated or blocked, and expression of typical estrogen- or androgen...... and the anti-estrogen, ICI 182780, only affected ODC expression. Therefore, estrogenic or anti-estrogenic compounds would not be expected to seriously affect the outcome of a Hershberger test. However, EB given alone to castrated rats resulted in various effects. EB increased seminal vesicle weight, an effect...... reversed by ICI 182780, and affected TRPM-2, PBP C3, ODC, IGF-1, AR, and ERa mRNA levels. AR expression in the prostate seemed to be under regulation of both estrogens and androgens, as ICI 182780 inhibited the testosterone-induced AR expression, and flutamide inhibited the EB-induced AR expression...

  16. Three novel and two known androgen receptor gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients

    Indian Academy of Sciences (India)

    BALACHANDRAN SARANYA; GUNASEKARAN BHAVANI; BRINDHA ARUMUGAM; MEENA JAYASHANKAR; SATHIYAVEDU THYAGARAJAN SANTHIYA

    2016-12-01

    Molecular characterization of 23 cytogenetically confirmed XY females was attempted by screening coding regions of SRY and androgen receptor (AR) genes. Five of the index cases showed sequence variations in various exons of the AR gene: a deletion (n.1911delG) and substitutions n.1761G>A and n.1317C>T in exon 1; n.3510C>T transition in exon 6 and deletion mutation (n.3672delT) in exon 7. Four mutations identified here lead to the formation of truncated receptor protein, involving a substantial loss of AR functional domains which explains the phenotype in the subjects. The n.1761G>A substitution has been previously reported in cases with mild androgen insensitivity. Although the ligand-binding domain was considered as the mutational hot spot in AR gene, we report here 3/5 variations in the N-terminal domain emphasizing the significance of considering the N-terminal domain of AR as well for mutation screening. Our present observation also strengthens the role of AR gene and its direct association with AIS.

  17. CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

    Directory of Open Access Journals (Sweden)

    O. B. Loran

    2014-07-01

    Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

  18. CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

    Directory of Open Access Journals (Sweden)

    O. B. Loran

    2009-01-01

    Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

  19. A preliminary case study of androgen receptor gene polymorphism association with impulsivity in women with alcoholism

    Directory of Open Access Journals (Sweden)

    Mettman DJ

    2014-03-01

    Full Text Available Daniel J Mettman, Merlin G Butler, Albert B Poje, Elizabeth C Penick, Ann M Manzardo Departments of Psychiatry and Behavioral Sciences and Pediatrics, MS 4015, Kansas University Medical Center, Kansas City, KS, USA Objective: The androgen receptor (AR gene, located on the X chromosome, contains a common polymorphism involving cytosine-adenine-guanine (CAG repeats, which impacts disease and could contribute to the unequal sex ratio in alcoholism. CAG repeats in the AR gene are known to correlate with impulsivity in males. We report the first preliminary study examining the association between the number of CAG repeats and measures of impulsivity in females with chronic alcoholism. Methods: A total of 35 women and 85 men with chronic alcoholism were previously recruited for a nutritional clinical trial, and 26 well-characterized females (19 African–American and seven Caucasian with alcoholism agreed to participate for genetic testing. Genomic deoxyribonucleic acid (DNA was isolated from peripheral blood and CAG repeats determined by analyzing polymerase chain reaction (PCR-amplified products, using the polymorphic AR gene assay. CAG repeat length was correlated with raw scores from the Barratt Impulsivity Scale, version 11 and the Alcoholism Severity Scale. Results: CAG repeat lengths were significantly longer in Caucasian alcoholic women compared with African–Americans, and the average number of CAG repeats were significantly, positively correlated (P<0.05 with impulsivity scores. Women with average CAG repeat length (CAGave ≥18, representing the upper quartile of the repeat range, showed significantly greater mean raw impulsivity scores. CAG repeat length appeared to have less effect in African–American compared with Caucasian women, possibly due to a shorter average repeat length. Conclusion: We found an association between the number of CAG repeats and impulsivity in females with chronic alcoholism, specifically in women with CAGave

  20. CAG repeat length in androgen receptor gene and male infertility in Egyptian patients.

    Science.gov (United States)

    Mosaad, Y M; Shahin, D; Elkholy, A A-M; Mosbah, A; Badawy, W

    2012-02-01

    The CAG repeat and its association with infertility has been debatable. Therefore, this study was planned to assess the distribution of CAG repeat expansion in Egyptian patients and to investigate its association with male infertility. Forty-five infertile men were eligible for the study in addition to 20 aged-matched fertile males as control. Semen analysis, scrotal sonography, assay of serum testosterone, follicle-stimulating hormone (FSH) and luteinising hormone (LH), and determination of the CAG repeat number within exon 1 of the androgen receptor (AR) gene were carried out. Statistically significant difference was found between infertile and control groups regarding sperm count, sperm motility, serum FSH level and CAG repeats (P CAG repeats (P = 1.0) was found between oligozoospermic and asthenospermic groups; negative correlation was found between CAG repeat length and sperm count, and a positive correlation was found between CAG repeat length and serum FSH (P CAG repeat may be associated with lower AR function with derangement of sperm production, and this may contribute to male infertility in Egyptian men.

  1. Androgen receptor gene CAG and GGN repeat polymorphisms in Chilean men with primary severe spermatogenic failure.

    Science.gov (United States)

    Castro-Nallar, Eduardo; Bacallao, Ketty; Parada-Bustamante, Alexis; Lardone, María C; López, Patricia V; Madariaga, Marcia; Valdevenito, Raúl; Piottante, Antonio; Ebensperger, Mauricio; Castro, Andrea

    2010-01-01

    There is ample documentation supporting the fact that androgens are required for normal spermatogenesis. A minority of infertile men have abnormal testosterone blood levels or mild androgen receptor mutations. We investigated the androgen receptor CAG and GGN repeat lengths in Chilean men with spermatogenic impairment. We studied 117 secretory azoospermic/oligozoospermic men (93 idiopathic and 24 excryptorchidic), without Y-chromosome microdeletions, and 121 controls with normal spermatogenesis (42 obstructive and 79 normozoospermic men). Peripheral blood was drawn to obtain genomic DNA for polymerase chain reaction and automated sequencing of CAG and GGN repeats. Testicular characterization included hormonal studies, physical evaluation, and seminal and biopsy analysis. The CAG and GGN polymorphism distributions were similar among idiopathic men, excryptorchidic men, and controls and among the different types of spermatogenic impairment. However, the proportion of the CAG 21 allele was significantly increased in idiopathic cases compared to controls (P = .012 by Bonferroni test, odds ratio = 2.99, 95% confidence interval, 1.27-7.0) and the CAG 32 allele only was observed in excryptorchidic patients (P CAG 21 allele (P = .024, χ(2) test). On the other hand, in idiopathic cases and controls the most common GGN allele was 23, followed by 24, but an inverse relation was found among excryptorchidic cases. The joint distribution of CAG and GGN in control, idiopathic, and excryptorchidic groups did not show an association between the 2 allele repeat polymorphisms (P > 0.05, χ(2) test). Our results suggest that the CAG 21 allele seems to increase the risk of idiopathic Sertoli cell-only syndrome. Moreover, the GGN 24 allele could be contributing to deranged androgen receptor function, associated with cryptorchidism and spermatogenic failure.

  2. Molecular cell biology of androgen receptor signalling.

    Science.gov (United States)

    Bennett, Nigel C; Gardiner, Robert A; Hooper, John D; Johnson, David W; Gobe, Glenda C

    2010-06-01

    The classical action of androgen receptor (AR) is to regulate gene transcriptional processes via AR nuclear translocation, response element binding and recruitment of, or crosstalk with, transcription factors. AR also utilises non-classical, non-genomic mechanisms of signal transduction. These precede gene transcription or protein synthesis, and involve steroid-induced modulation of cytoplasmic or cell membrane-bound regulatory proteins. Despite many decades of investigation, the role of AR in gene regulation of cells and tissues remains only partially characterised. AR exerts most of its effects in sex hormone-dependent tissues of the body, but the receptor is also expressed in many tissues not previously thought to be androgen sensitive. Thus it is likely that a complex, more over-arching, role for AR exists. Each AR domain co-ordinates a multitude of individual and vital roles via a diverse array of interacting partner molecules that are necessary for cellular and tissue development and maintenance. Aberrant AR activity, promoted by mutations or binding partner misregulation, can present as many clinical manifestations including androgen insensitivity syndrome and prostate cancer. In the case of malignant prostate cancer, treatment generally revolves around androgen deprivation therapies designed to interfere with AR action and the androgen signalling axis. Androgen therapies for prostate cancer often fail, highlighting a real need for increased research into AR function.

  3. Androgen Receptor-Mediated Escape Mechanisms from Androgen Ablation Therapy

    Science.gov (United States)

    2005-10-01

    of CAG repeats in the Machado-Joseph disease , spinocerebellar ataxia type 1 and androgen receptor genes. Hum. Mol. Genet. 4, 1585-1590. Rundlett, S . E... diseases such as Huntington disease and spinal and bulbar muscular atro- phy, which is commonly called Kennedy’s disease . This finding has been attributed...STATEMENT: Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author( s ) and

  4. The CAG repeat polymorphism of androgen receptor gene and prostate cancer: a meta-analysis.

    Science.gov (United States)

    Gu, Mingliang; Dong, Xiaoqun; Zhang, Xuezhi; Niu, Wenquan

    2012-03-01

    The association between the polymorphic CAG repeat in androgen receptor gene (AR) and prostate cancer susceptibility has been studied extensively. However, the results are contradictory. The purpose of our meta-analysis was to investigate whether CAG repeat related to prostate cancer risk and had genetic heterogeneity across different geographic regions and study designs. Random-effects model was performed irrespective of between-study heterogeneity. Data and study quality were assessed in duplicate. Publication bias was assessed by the fail-safe number and Egger's test. There were 16 (patients/controls: 2972/3792), 19 (3835/4908) and 12 (3372/2631) study groups for comparisons of ≥ 20, 22 and 23 repeats of CAG sequence, respectively. Compared with CAG repeat repeats had 21% (95% CI: 0.61-1.02; P = 0.076), 5% (95% CI: 0.81-1.11; P = 0.508) and 5% (95% CI: 0.76-1.20; P = 0.681) decreased risk of prostate cancer. After classifying studies by geographic areas, carriers of ≥ 20 repeats had 11% decreased risk in populations from USA, 53% from Europe, and 20% from Asia (P > 0.05), whereas comparison of ≥ 23 repeats with others generated a significant prediction in European populations (OR = 1.17; P = 0.039). Stratification by study designs revealed no material changes in risk estimation. Meta-regression analysis found no significant sources of between-study heterogeneity for age, study design and geographic region for all comparisons. There was no identified publication bias. Taken together, our results demonstrated that AR CAG repeat polymorphism with ≥ 20 repeats might confer a protective effect among the prostate cancer patients with 45 years older but not all the prostate cancer patients.

  5. Mutations in the ligand-binding domain of the androgen receptor gene cluster in two regions of the gene.

    Science.gov (United States)

    McPhaul, M J; Marcelli, M; Zoppi, S; Wilson, C M; Griffin, J E; Wilson, J D

    1992-11-01

    We have analyzed the nucleotide sequence of the androgen receptor from 22 unrelated subjects with substitution mutations of the hormone-binding domain. Eleven had the phenotype of complete testicular feminization, four had incomplete testicular feminization, and seven had Reifenstein syndrome. The underlying functional defect in cultured skin fibroblasts included individuals with absent, qualitative, or quantitative defects in ligand binding. 19 of the 21 substitution mutations (90%) cluster in two regions that account for approximately 35% of the hormone-binding domain, namely, between amino acids 726 and 772 and between amino acids 826 and 864. The fact that one of these regions is homologous to a region of the human thyroid hormone receptor (hTR-beta) which is a known cluster site for mutations that cause thyroid hormone resistance implies that this localization of mutations is not a coincidence. These regions of the androgen receptor may be of particular importance for the formation and function of the hormone-receptor complex.

  6. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis

    OpenAIRE

    Pan, Bihui; Li, Rui; CHEN, YAO; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Hongjuan DING; Xia,Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-01-01

    Abstract The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports. We searched for reports published before August 2015 using PubMed, CNKI, VIP, an...

  7. Polymorphic CAG and GGC repeat lengths in the androgen receptor gene and prostate cancer risk: analysis of a Brazilian population.

    Science.gov (United States)

    Silva Neto, Brasil; Koff, Walter J; Biolchi, Vanderlei; Brenner, Cleber; Biolo, Karlo D; Spritzer, Poli Mara; Brum, Ilma S

    2008-02-01

    Variations in transcriptional activity of the androgen receptor (AR) are related to polymorphic CAG and GGC repeats in exon 1 of the AR gene. We investigated the association between CAG and GGC repeat length and the risk of prostate cancer in a case-control study from a Brazilian population. We evaluated 49 patients and 51 healthy controls. DNA was extracted from peripheral leukocytes and the AR gene was analyzed by fragment analysis (GeneMapper software, Applied Biosystems, Foster City, California, USA). CAG and GGC mean lengths were not different between cases and controls. The risk for prostate cancer was higher for CAG repeats repeat lengths (CAG + GGC) repeats ( 17) were not associated with risk for prostate cancer (OR = 1.13 [95% CI 0.47-2.75]). In conclusion, fewer number of CAG repeats and total repeats (CAG + GGC) in the AR gene may be associated with increased risk for prostate cancer.

  8. Expanding the therapeutic use of androgens via selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Gao, Wenqing; Dalton, James T

    2007-03-01

    Selective androgen receptor modulators (SARMs) are a novel class of androgen receptor (AR) ligands that might change the future of androgen therapy dramatically. With improved pharmacokinetic characteristics and tissue-selective pharmacological activities, SARMs are expected to greatly extend the clinical applications of androgens to osteoporosis, muscle wasting, male contraception and diseases of the prostate. Mechanistic studies with currently available SARMs will help to define the contributions of differential tissue distribution, tissue-specific expression of 5alpha-reductase, ligand-specific regulation of gene expression and AR interactions with tissue-specific coactivators to their observed tissue selectivity, and lead to even greater expansion of selective anabolic therapies.

  9. Mutations in the ligand-binding domain of the androgen receptor gene cluster in two regions of the gene.

    OpenAIRE

    McPhaul, M J; Marcelli, M; Zoppi, S; Wilson, C. M.; Griffin, J E; Wilson, J. D.

    1992-01-01

    We have analyzed the nucleotide sequence of the androgen receptor from 22 unrelated subjects with substitution mutations of the hormone-binding domain. Eleven had the phenotype of complete testicular feminization, four had incomplete testicular feminization, and seven had Reifenstein syndrome. The underlying functional defect in cultured skin fibroblasts included individuals with absent, qualitative, or quantitative defects in ligand binding. 19 of the 21 substitution mutations (90%) cluster ...

  10. Development of selective androgen receptor modulators and their therapeutic applications.

    Science.gov (United States)

    Chen, Fang; Rodan, Gideon A; Schmidt, Azi

    2002-01-01

    Androgens control a broad range of physiological functions. The androgen receptor (AR), a steroid receptor that mediates the diverse biological actions of androgens, is a ligand inducible transcription factor. Abnormalities in the androgen signaling system result in many disturbances ranging from changes in gender determination and sexual development to psychiatric and emotional disorders. Androgen replacement therapy can improve many clinical conditions including hypogonadism and osteoporosis, but is limited by the lack of efficacious and safe therapeutic agents with easy delivery options. Recent progress in the area of gene regulation by steroid receptors and by selective receptor modulators provides an opportunity to examine if selective androgen receptor modulators (SARMs) could address some of the problems associated with current androgen therapy. Since the composition of the transcriptional initiation complex recruited by liganded AR determines the specificity of gene regulation, synthetic ligands aimed at initiating transcription of tissue and promoter specific genes offers hope for developing better androgen therapy. Establishment of assays that predict synthetic ligand activity is critical for SARM development. Advancement in high throughput compound screening and gene fingerprinting technologies, such as microarrays and proteomics, will facilitate and accelerate identification of effective SARMs.

  11. Aberrant splicing of androgenic receptor mRNA results in synthesis of a nonfunctional receptor protein in a patient with androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Ris-Stalpers, C.; Kuiper, G.G.J.M.; Faber, P.W.; van Rooij, H.C.J.; Degenhart, H.J.; Trapman, J.; Brinkmann, A.O. (Erasmus Univ., Rotterdam (Netherlands)); Schweikert, H.U. (Univ. of Bonn (Germany)); Zegers, N.D. (Medical Biological Laboratory-Organization for Applied Scientific Research, Rijswijk (Netherlands)); Hodgins, M.B. (Glasgow Univ. (United Kingdom))

    1990-10-01

    Androgen insensitivity is a disorder in which the correct androgen response in an androgen target cell is impaired. The clinical symtpoms of this X chromosome-linked syndrome are presumed to be caused by mutations in the androgen receptor gene. The authors report a G {r arrow} T mutation in the splice donor site of intron 4 of the androgen receptor gene of a 46, XY subject lacking detectable androgen binding to the receptor and with the complete form of androgen insensitivity. This point mutation completely abolishes normal RNA splicing at the exon 4/intron 4 boundary and results in the activation of a cryptic splice donor site in exon 4, which leads to the deletion of 123 nucleotides from the mRNA. Translation of the mutant mRNA results in an androgen receptor protein {approx}5 kDa smaller than the wild type. This mutated androgen receptor protein was unable to bind androgens and unable to activate transcription of an androgen-regulated reporter gene construct. This mutation in the human androgen receptor gene demonstrates the importance of an intact steroid-binding domain for proper androgen receptor functioning in vivo.

  12. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis.

    Science.gov (United States)

    Pan, Bihui; Li, Rui; Chen, Yao; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-03-01

    The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports.We searched for reports published before August 2015 using PubMed, CNKI, VIP, and WanFang. Data on sample size, mean, and standard deviation (SD) of AR-CAG repeat length were extracted independently by 3 investigators.Forty-four reports were selected based on criteria. The overall infertile patients and azoospermic patients were found to have longer AR-CAG repeat length (standard mean difference (SMD) = 0.19, 95% confidence interval (CI): 0.10-0.28, P CAG repeat length was longer in infertile men in Asian, Caucasian, and mixed races (SMD = 0.25, 95% CI: 0.08-0.43, P CAG repeat length was associated with male infertility. The subgroup study on races shows that increased AR-CAG repeat length was associated with male infertility in Asian, Caucasian, and mixed races. Increased AR-CAG repeat length was also associated with azoospermia.This meta-analysis supports that increased androgen receptor CAG length is capable of causing male infertility susceptibility.

  13. Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance

    DEFF Research Database (Denmark)

    Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun;

    2014-01-01

    Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity...... in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls....... Glucose transport in myotubes was comparable in patients with PCOS vs. controls and was unchanged by testosterone treatment (p=0.21 PCOS vs. controls). These results suggest that testosterone treatment of myotubes increases the aromatase and androgen receptor gene expression without affecting insulin...

  14. Analysis of the CAG repeat number in exon 1 of the androgen receptor gene in Slovene men with idiopathic azoospermia and oligoasthenoteratozoospermia

    Institute of Scientific and Technical Information of China (English)

    Borut Peterlin; Branko Zorn; Natasa Teran; Tanja Kunej

    2007-01-01

    @@ Dear Sir, I am Borut Peterlin, from Division of Medical Genetics,Department of Obstetrics and Gynaecology, University Medical Center, Ljubljana, Slovenia. We write to you to discuss if the number of CAG repeats in the androgen receptor (AR) gene is associated with male infertility in a group of 190 Slovene infertile men compared to 137 men with proven fertility.

  15. Androgen receptor gene CAG repeat polymorphism and ovarian cancer risk: A meta-analysis.

    Science.gov (United States)

    Deng, Yang; Wang, Jue; Wang, Ling; Du, Yan

    2017-02-28

    Ovarian cancer is one of the common gynecological malignancies worldwide. It is usually diagnosed at a later stage, thus missing the best opportunity for treatment. Despite the advancement of ovarian cancer treatment, the prognosis is still poor. Androgen receptor (AR) may play a role in ovarian carcinogenesis. Previous studies regarding the association between AR CAG repeat length and ovarian cancer risk reported inconsistent results. Therefore, we conducted a meta-analysis to evaluate the association between AR CAG repeat length and ovarian cancer risk following the MOOSE guidelines. PubMed, Web of Science, EBSCO and other databases were searched up to September 15(th) 2016. Case control studies with clear definition of CAG repeat length and detailed genotype information were included. Two authors independently reviewed and extracted data. Pooled analysis and subgroup analysis stratified by ethnicity were performed for different genetic models. Begg's funnel plot and Egger's test were performed for publication bias estimation. Overall, there was no association between the AR CAG repeat polymorphism and ovarian cancer risk. However, short CAG repeat polymorphism was associated with increased ovarian cancer risk in African Americans and Chinese under the dominant model, whereas a reverse association was observed in Caucasians and Italians under the other three models. Our study results should be interpreted with caution. Further well-designed epidemiological and functional studies are needed to elucidate the role of AR in ovarian carcinogenesis.

  16. Role of androgen receptor in prostate cancer

    Institute of Scientific and Technical Information of China (English)

    HiroyoshiSuzuki; HaruoIto

    1999-01-01

    The growth of prostate cancer is sensitive to androgen, and hormonal therapy has been used for treatment of ad-vanced cancer. About 80 % of prostate cancers initially respond to hormonal therapy, howcrver, more than half of the re-sponders gradtmlly become resistant to this therapy. Changes in tumors from an androgen-responsive to an androgen-unre-sponsive state have been widely discussed. Since androgen action is mediated by androgen receptor (AR), abnonnalitiesof AR is believed to play an important role of the loss of androgen responsiveness in prostate cancer. "Ilais article focusedon the role of AR in the progression of prostate cancer.

  17. CAG repeat polymorphism in androgen receptor gene is not directly associated with polycystic ovary syndrome but influences serum testosterone levels.

    Science.gov (United States)

    Skrgatic, L; Baldani, D Pavicic; Cerne, J Z; Ferk, P; Gersak, K

    2012-02-01

    Hyperandrogenemia has been the most consistent feature of polycystic ovary syndrome (PCOS). Androgens exert their effects through androgen receptors (ARs). The expansion of the codon CAG trinucleotide repeat polymorphism in exon 1 of the AR gene represents a type of genetic alteration associated with changes in the AR gene function. The purpose of this study was to establish a possible association of the AR gene CAG repeat length polymorphism with PCOS, and its influence on clinical and biochemical androgen traits. Two hundred and fourteen Croatian women with PCOS and 209 healthy control women of reproductive age were enrolled. Phenotypic hyperandrogenism, BMI and waist to hip ratio were recorded. Hormonal profiles, fasting insulin and glucose levels were measured on cycle days 3-5. Genotyping of the CAG repeat polymorphism in the AR gene was performed. We found no significant difference in the mean CAG repeat number between the PCOS patients and controls (22.1±3.4 vs. 21.9±3.2, P=0.286). There was a positive correlation between the CAG repeat length and total testosterone (TT) in the PCOS group (R=0.225, P=0.015). A multiple linear regression model using mean CAG repeat length, BMI, age and HOMA-IR as predictors explained 8.5% (adjusted R²) of the variability in serum TT levels. In this model the CAG repeat polymorphism was found to be a significant predictor of serum TT levels in PCOS patients (P=0.015). The logistic regression analysis revealed that the CAG repeat length is not a significant predictor of hirsutism and acne status (P=0.921 and P=0.437, respectively). The model was adjusted for serum TT, free testosterone, androstendione and DHEAS levels as independent variables, which were also not found to be significant predictors of hirsutism (P=0.687, P=0.194, P=0.675 and P=0.938, respectively) or acne status (P=0.594, P=0.095, P=0.290 and P=0.151, respectively). In conclusion, the AR CAG repeat polymorphism is not a major determinant of PCOS in the

  18. Androgen-androgen receptor system improves chronic inflammatory conditions by suppressing monocyte chemoattractant protein-1 gene expression in adipocytes via transcriptional regulation.

    Science.gov (United States)

    Morooka, Nobukatsu; Ueguri, Kei; Yee, Karen Kar Lye; Yanase, Toshihiko; Sato, Takashi

    2016-09-02

    Age-related decreases in sex hormones are closely related to chronic inflammation in obesity and metabolic diseases. Particularly, the molecular basis of androgen activity in regulating inflammation and controlling metabolism remains largely unknown. Obese adipocytes secrete monocyte chemoattractant protein-1 (MCP-1), a key chemokine that promotes the infiltration of monocytes/macrophages into adipose tissue, thereby leading to metabolic disorders. Here, we studied the role of androgen-androgen receptor (AR) action in regulating MCP-1 expression in adipose tissue. We observed the induction of Mcp-1 expression in 3T3-L1 adipocytes co-cultured with RAW264.7 macrophages. Additionally, Mcp-1 expression was upregulated by culturing in conditioned medium derived from inflammatory macrophages (M1-Mφ) containing tumor necrosis factor-alpha (TNF-α). We found that sex hormones downregulated TNF-α-induced Mcp-1 and interleukin (Il)-6 expression in 3T3-L1 adipocytes. Furthermore, luciferase-reporter analysis indicated that MCP-1 promoter activity was predominantly suppressed by dihydrotestosterone (DHT)-AR interactions through functional canonical nuclear factor-kappa B (NF-κB) sites, whereas non-canonical NF-κB site containing important flanking sequences exhibited minor contributions to DHT-AR transcriptional repression. These findings suggested that androgen-AR suppressed obesity-induced chronic inflammation in adipose tissue.

  19. Changes in gene expression following androgen receptor blockade is not equivalent to androgen ablation by castration in the rat ventral prostate

    Indian Academy of Sciences (India)

    Anil M Limaye; Irfan Asangani; Thyagarajan Kalyani; Paturu Kondaiah

    2008-06-01

    Involution of the rat ventral prostate and concomitant modulation of gene expression post-castration is a well-documented phenomenon. While the rat castration model has been extensively used to study androgen regulation of gene expression in the ventral prostate, it is not clear whether all the gene expression changes post-castration are due to androgen depletion alone. To obtain insights into this, we performed differential display reverse transcriptase polymerase chain reaction (DD-RT-PCR) which resulted in the identification of castration and/or flutamide-regulated genes in the rat ventral prostate. These include clusterin, methionine adenosyl transferase II, and prostate-specific transcripts such as PBPC1BS, S100RVP and A7. While clusterin, PBPC1BS and methionine adenosyl transferase II are regulated by both castration and flutamide, S100 RVP and A7 are regulated by castration alone. Interestingly, we show that flutamide, unlike castration, does not induce apoptosis in the rat ventral prostate epithelium, which could be an underlying cause for the differential effects of castration and flutamide treatment. We propose that castration leads to enrichment and depletion of stromal and epithelial cell types, respectively, resulting in erroneous conclusions on some of the cell type-specific transcripts as being androgen regulated.

  20. Tandem CAG repeats of the androgen receptor gene and prostate cancer risk in black and white men.

    Science.gov (United States)

    Panz, V R; Joffe, B I; Spitz, I; Lindenberg, T; Farkas, A; Haffejee, M

    2001-07-01

    The most common malignancy in men worldwide is cancer of the prostate. Androgens play a direct role in normal and malignant growth of prostate cells via the androgen receptor (AR). This study analyzed the polymorphic CAG repeat sequence in exon 1 of the AR gene to determine if the number of repeats might be an indicator of prostate cancer risk or aggressive disease. DNA was extracted from blood samples of 20 black and 20 white men with well-documented prostate cancer and 40 healthy controls (20 blacks and 20 whites). PCR amplification was followed by gel electrophoresis and DNA sequencing. This region normally contains between 9 and 29 repeats. Patients and controls both had minor variations in the number of repeats, which ranged from 13 to 27 with 21 being the most frequent allele. Black controls and patients both had a mean of 20 +/- 3 repeats; in whites the mean was significantly lower in patients than controls (21 +/- 2 versus 23 +/- 2; p = 0.004). Combined black and white patients also had a lower number than the combined group of controls (20 +/- 3 versus 22 +/- 3; p = 0.02). Similarly, black and white patients with aggressive disease had a lower number than patients whose disease was more slowly progressive (19 +/- 2 versus 22 +/- 3; p = 0.02). We conclude that the small differences in the number of CAG repeats in both black and white patients do not appear to be a strong indicator of risk or aggressive disease but that this size polymorphism may be one of many genetic and environmental risk factors involved in prostate cancer.

  1. Fenofibrate down-regulates the expressions of androgen receptor (AR) and AR target genes and induces oxidative stress in the prostate cancer cell line LNCaP

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Hu; Zhu, Chen; Qin, Chao [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Tao, Tao [Department of Neurosurgery, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Li, Jie; Cheng, Gong; Li, Pu; Cao, Qiang; Meng, Xiaoxin; Ju, Xiaobing; Shao, Pengfei; Hua, Lixin [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Gu, Min, E-mail: medzhao1980@163.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Yin, Changjun, E-mail: drcjyin@gmail.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China)

    2013-03-08

    Highlights: ► Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells. ► Fenofibrate reduces the expressions of androgen receptor in LNCaP cells. ► Fenofibrate induces oxidative stress in the prostate cancer cell line LNCaP. -- Abstract: Fenofibrate, a peroxisome proliferator-androgen receptor-alpha agonist, is widely used in treating different forms of hyperlipidemia and hypercholesterolemia. Recent reports have indicated that fenofibrate exerts anti-proliferative and pro-apoptotic properties. This study aims to investigate the effects of fenofibrate on the prostate cancer (PCa) cell line LNCaP. The effects of fenofibrate on LNCaP cells were evaluated by flow cytometry, reverse transcription-polymerase chain reaction, enzyme-linked immunosorbent assays, Western blot analysis, and dual-luciferase reporter assay. Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells, reduces the expressions of androgen receptor (AR) and AR target genes (prostate-specific antigen and TMPRSS2), and inhibits Akt phosphorylation. Fenofibrate can induce the accumulation of intracellular reactive oxygen species and malondialdehyde, and decrease the activities of total anti-oxidant and superoxide dismutase in LNCaP cells. Fenofibrate exerts an anti-proliferative property by inhibiting the expression of AR and induces apoptosis by causing oxidative stress. Therefore, our data suggest fenofibrate may have beneficial effects in fenofibrate users by preventing prostate cancer growth through inhibition of androgen activation and expression.

  2. 雄激素受体基因的表型异种突变%Phenotypic heterogeneity of mutations in androgen receptor gene

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Lalji Singh; Kumarasamy Thangaraj

    2007-01-01

    Androgen receptor (AR) gene has been extensively studied in diverse clinical conditions. In addition to the point mutations, trinucleotide repeat (CAG and GGN) length polymorphisms have been an additional subject of interest and controversy among geneticists. The polymorphic variations in triplet repeats have been associated with a number of disorders, but at the same time contradictory findings have also been reported. Further, studies on the same disorder in different populations have generated different results. Therefore, combined analysis or review of the published studies has been of much value to extract information on the significance of variations in the gene in various clinical conditions. AR genetics has been reviewed extensively but until now review articles have focused on individual clinical categories such as androgen insensitivity, male infertility, prostate cancer, and so on. We have made the first effort to review most the aspects of AR genetics. The impact of androgens in various disorders and polymorphic variations in the AR gene is the main focus of this review. Additionally, the correlations observed in various studies have been discussed in the light of in vitro evidences available for the effect of AR gene variations on the action of androgens.

  3. In vivo modulation of androgen receptor by androgens

    Institute of Scientific and Technical Information of China (English)

    V·L·Kumar; V·Kumar

    2002-01-01

    Aim:To study the effect of androgen and antiandrogen on the level of androgen receptor(AR)mRNA.Methods:The totalRNA was extracted from the prostate and analyzed by slot blot analysis,The blots were hybrid-ized with ARcDNA probe and 1Aprobe(internal control)and autoradionraphy was performed.The intensity of signal was measured with a densitometer and the ratio of AR RNAand1ARNAwas calculated.Results:Androgenic deprivation produced by castration decreased the weight of the prostate and increased the levels of ARmRNA.Treatment of the castrated rats with testostrone increased the weight of prostate and decreased the levels of ARmRNA.Treatment of normal rats with flutamide decreased the weight of the gland and increased the levels of AR mRNA.Conclusion:Androgens produce proliferative effect on the prostate and negatively regulate the AR transcription.

  4. Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance.

    Science.gov (United States)

    Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun; Jakobsen, Marianne Antonius; Brusgaard, Klaus; Tan, Qihua; Gaster, Michael

    2014-09-05

    Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity is conserved in cultured myotubes (in vitro) from patients with PCOS, but the effect of testosterone on this insulin sensitivity is unknown. We investigated the effect of 7days testosterone treatment (100nmol/l) on glucose transport and gene expression levels of hormone receptors and enzymes involved in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls. Glucose transport in myotubes was comparable in patients with PCOS vs. controls and was unchanged by testosterone treatment (p=0.21 PCOS vs. controls). These results suggest that testosterone treatment of myotubes increases the aromatase and androgen receptor gene expression without affecting insulin sensitivity and if testosterone is implicated in muscular insulin resistance in PCOS, this is by and indirect mechanism.

  5. Antioxidants Abrogate Alpha-Tocopherylquinone-Mediated Down-Regulation of the Androgen Receptor in Androgen-Responsive Prostate Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Alexandra M Fajardo

    Full Text Available Tocopherylquinone (TQ, the oxidation product of alpha-tocopherol (AT, is a bioactive molecule with distinct properties from AT. In this study, AT and TQ are investigated for their comparative effects on growth and androgenic activity in prostate cancer cells. TQ potently inhibited the growth of androgen-responsive prostate cancer cell lines (e.g., LAPC4 and LNCaP cells, whereas the growth of androgen-independent prostate cancer cells (e.g., DU145 cells was not affected by TQ. Due to the growth inhibitory effects induced by TQ on androgen-responsive cells, the anti-androgenic properties of TQ were examined. TQ inhibited the androgen-induced activation of an androgen-responsive reporter and inhibited the release of prostate specific antigen from LNCaP cells. TQ pretreatment was also found to inhibit AR activation as measured using the Multifunctional Androgen Receptor Screening assay. Furthermore, TQ decreased androgen-responsive gene expression, including TM4SF1, KLK2, and PSA over 5-fold, whereas AT did not affect the expression of androgen-responsive genes. Of importance, the antiandrogenic effects of TQ on prostate cancer cells were found to result from androgen receptor protein down-regulation produced by TQ that was not observed with AT treatment. Moreover, none of the androgenic endpoints assessed were affected by AT. The down-regulation of androgen receptor protein by TQ was abrogated by co-treatment with antioxidants. Overall, the biological actions of TQ were found to be distinct from AT, where TQ was found to be a potent inhibitor of cell growth and androgenic activity in androgen-responsive prostate cancer cells.

  6. Negative association between androgen receptor gene CAG repeat polymorphism and polycystic ovary syndrome? A systematic review and meta-analysis.

    Science.gov (United States)

    Wang, Rui; Goodarzi, Mark O; Xiong, Ting; Wang, Di; Azziz, Ricardo; Zhang, Hanwang

    2012-10-01

    A number of studies focusing on the association between the exon 1 CAG repeat polymorphism of the androgen receptor (AR) gene and polycystic ovary syndrome (PCOS) have revealed conflicting results. The current systematic review and meta-analysis was conducted to quantify the strength of the association and to explore potential sources of heterogeneity that may have influenced the results. Studies matched to search terms from PubMed, EMBASE and HuGE Navigator published through to 31 January 2012 were retrieved. Data extraction from the included studies was carried out by two authors independently. Weighted mean differences (WMDs) of biallelic mean and odds ratios (ORs) of alleles and genotypes were pooled for meta-analysis. Sixteen articles reporting on 17 studies were included. In continuous data analysis, the summary WMD was -0.06 (95% confidence interval -0.29 to 0.16). In dichotomous data analysis, we divided the alleles into short and long alleles and calculated the summary ORs. No statistically significant results were identified by different comparison models or different cut-off point definitions. No publication bias was observed in continuous and dichotomous data analysis. In summary, the current systematic review and meta-analysis found that the AR CAG microsatellite repeat polymorphism is unlikely to be a major determining factor in the development of PCOS.

  7. Androgen receptor gene CAG repeat polymorphism and risk of isolated hypospadias: results from a meta-analysis.

    Science.gov (United States)

    Huang, G; Shan, W; Zeng, L; Huang, L

    2015-03-06

    Studies investigating the association between the CAG repeat polymorphism and the risk of isolated hypospadias have reported conflicting results. The aim of this study was to quantitatively summarize the evidence for such a relationship. Two investigators independently searched the Medline, Embase, CNKI, and Wanfang databases. Weighted mean difference and 95% confidence intervals for the CAG repeat polymorphism and isolated hypospadias were calculated using a random-effects model. Subgroup analyses were performed by race, study design, sample for DNA extraction, and hypospadias classifications. This meta-analysis included 6 case-control studies, including 444 isolated hypospadias cases and 727 controls. The results showed that patients with isolated hypospadias had longer CAG repeats in their androgen receptor gene sequence (weighted mean difference = 1.36, 95% confidence interval = 0.60-2.13; P = 0.0005). Similarly, stratified analyses also detected significant associations in all subgroups, excluding the group with severe hypospadias (weighted mean difference = 0.35, 95% confidence interval = -0.42-1.12; P = 0.38). This meta-analysis indicated that longer CAG repeats were associated with the risk of isolated hypospadias, and that longer CAG polymorphisms may be related to the etiology of isolated hypospadias. Future studies based on Asian and African-American patients should be performed to re-evaluate this association.

  8. Impact of CAG repeat length in the androgen receptor gene on male infertility - a meta-analysis.

    Science.gov (United States)

    Xiao, Feifan; Lan, Aihua; Lin, Zhidi; Song, Jianfei; Zhang, Yuening; Li, Jiatong; Gu, Kailong; Lv, Baihao; Zhao, Dong; Zeng, Siping; Zhang, Ruoheng; Zhao, Wei; Pan, Zhengyan; Deng, Xiaozhen; Yang, Xiaoli

    2016-07-01

    CAG repeats are polymorphic nucleotide repeats present in the androgen receptor gene. Many studies have estimated the association between CAG repeat length and male infertility, but the conclusions are controversial. Previous meta-analyses have come to different conclusions; however, new studies have been published. An updated meta-analysis was conducted. PubMed, CBM, CNKI and Web of Science databases were systematically searched for studies published from 1 January 2000 to 1 October 2015. Case-control studies on the association between CAG repeat length and male infertility using appropriate methodology were included. Forty studies were selected, including 3858 cases and 3161 controls. Results showed statistically significantly longer CAG repeat length among cases compared with controls (SMD = 0.14; 95% CI, 0.02-0.26). Shorter repeat length was associated with a lower risk of male infertility compared with a longer repeat length in the overall analysis (OR = 0.79, 95% CI: 0.66-0.95). Moreover, CAG repeat length was associated with male infertility in Caucasian populations, but not Asian or Egyptian populations. Subgroup analysis revealed no significant difference in German populations, but CAG repeat length was associated with male infertility in China and the USA. There were no significant differences between cases and controls in azoospermia and severe oligozoospermia.

  9. Enhanced evaluation of selective androgen receptor modulators in vivo.

    Science.gov (United States)

    Otto-Duessel, M; He, M; Adamson, T W; Jones, J O

    2013-01-01

    Selective androgen receptor modulators (SARMs) are a class of drugs that control the activity of the androgen receptor (AR), which mediates the response to androgens, in a tissue-selective fashion. They are specifically designed to reduce the possible complications that result from the systemic inhibition or activation of AR in patients with diseases that involve androgen signalling. However, there are no ideal in vivo models for evaluating candidate SARMs. Therefore, we created a panel of androgen-responsive genes in clinically relevant AR expressing tissues including prostate, skin, bone, fat, muscle, brain and kidney. We used select genes from this panel to compare transcriptional changes in response to the full agonist dihydrotestosterone (DHT) and the SARM bolandiol at 16 h and 6 weeks. We identified several genes in each tissue whose expression at each of these time points correlates with the known tissue-specific effects of these compounds. For example, in the prostate we found four genes whose expression was much lower in animals treated with bolandiol compared with animals treated with DHT for 6 weeks, which correlated well with differences in prostate weight. We demonstrate that adding molecular measurements (androgen-regulated gene expression) to the traditional physiological measurements (tissue weights, etc.) makes the evaluation of potential SARMs more accurate, thorough and perhaps more rapid by allowing measurement of selectivity after only 16 h of drug treatment.

  10. Visualising androgen receptor activity in male and female mice.

    Directory of Open Access Journals (Sweden)

    D Alwyn Dart

    Full Text Available Androgens, required for normal development and fertility of males and females, have vital roles in the reproductive tract, brain, cardiovascular system, smooth muscle and bone. Androgens function via the androgen receptor (AR, a ligand-dependent transcription factor. To assay and localise AR activity in vivo we generated the transgenic "ARE-Luc" mouse, expressing a luciferase reporter gene under the control of activated endogenous AR. In vivo imaging of androgen-mediated luciferase activity revealed several strongly expressing tissues in the male mouse as expected and also in certain female tissues. In males the testes, prostate, seminal vesicles and bone marrow all showed high AR activity. In females, strong activity was seen in the ovaries, uterus, omentum tissue and mammary glands. In both sexes AR expression and activity was also found in salivary glands, the eye (and associated glands, adipose tissue, spleen and, notably, regions of the brain. Luciferase protein expression was found in the same cell layers as androgen receptor expression. Additionally, mouse AR expression and activity correlated well with AR expression in human tissues. The anti-androgen bicalutamide reduced luciferase signal in all tissues. Our model demonstrates that androgens can act in these tissues directly via AR, rather than exclusively via androgen aromatisation to estrogens and activation of the estrogen receptor. Additionally, it visually demonstrates the fundamental importance of AR signalling outside the normal role in the reproductive organs. This model represents an important tool for physiological and developmental analysis of androgen signalling, and for characterization of known and novel androgenic or antiandrogenic compounds.

  11. Complex modulation of androgen responsive gene expression by methoxyacetic acid

    Directory of Open Access Journals (Sweden)

    Stanley Kerri A

    2011-03-01

    Full Text Available Abstract Background Optimal androgen signaling is critical for testicular development and spermatogenesis. Methoxyacetic acid (MAA, the primary active metabolite of the industrial chemical ethylene glycol monomethyl ether, disrupts spermatogenesis and causes testicular atrophy. Transcriptional trans-activation studies have indicated that MAA can enhance androgen receptor activity, however, whether MAA actually impacts the expression of androgen-responsive genes in vivo, and which genes might be affected is not known. Methods A mouse TM3 Leydig cell line that stably expresses androgen receptor (TM3-AR was prepared and analyzed by transcriptional profiling to identify target gene interactions between MAA and testosterone on a global scale. Results MAA is shown to have widespread effects on androgen-responsive genes, affecting processes ranging from apoptosis to ion transport, cell adhesion, phosphorylation and transcription, with MAA able to enhance, as well as antagonize, androgenic responses. Moreover, testosterone is shown to exert both positive and negative effects on MAA gene responses. Motif analysis indicated that binding sites for FOX, HOX, LEF/TCF, STAT5 and MEF2 family transcription factors are among the most highly enriched in genes regulated by testosterone and MAA. Notably, 65 FOXO targets were repressed by testosterone or showed repression enhanced by MAA with testosterone; these include 16 genes associated with developmental processes, six of which are Hox genes. Conclusions These findings highlight the complex interactions between testosterone and MAA, and provide insight into the effects of MAA exposure on androgen-dependent processes in a Leydig cell model.

  12. Androgen receptor expression in gastrointestinal stromal tumor.

    Science.gov (United States)

    Lopes, Lisandro F; Bacchi, Carlos E

    2009-03-01

    The aim of this study was to evaluate the expression of estrogen, progesterone, and androgen receptors in a large series of gastrointestinal stromal tumors. Clinical and pathologic data were reviewed in 427 cases of gastrointestinal stromal tumor and the expression of such hormone receptors was investigated by immunohistochemistry using tissue microarray technique. All tumors were negative for estrogen receptor expression. Progesterone and androgen receptors expression was observed in 5.4% and 17.6% of tumors, respectively. We found the higher average age at diagnosis, the lower frequency of tumors located in the small intestine, and the higher frequency of extragastrointestinal tumors to be statistically significant in the group of tumors with androgen receptor expression in contrast to the group showing no androgen receptor expression. There was no statistic difference between such groups regarding sex, tumor size, mitotic count, cell morphology, and risk of aggressive behavior. Considering that the expression of androgen receptors in gastrointestinal stromal tumors is not negligible, further studies are encouraged to establish the role of androgen deprivation therapy for gastrointestinal stromal tumors.

  13. Androgen receptor drives cellular senescence.

    Directory of Open Access Journals (Sweden)

    Yelena Mirochnik

    Full Text Available The accepted androgen receptor (AR role is to promote proliferation and survival of prostate epithelium and thus prostate cancer progression. While growth-inhibitory, tumor-suppressive AR effects have also been documented, the underlying mechanisms are poorly understood. Here, we for the first time link AR anti-cancer action with cell senescence in vitro and in vivo. First, AR-driven senescence was p53-independent. Instead, AR induced p21, which subsequently reduced ΔN isoform of p63. Second, AR activation increased reactive oxygen species (ROS and thereby suppressed Rb phosphorylation. Both pathways were critical for senescence as was proven by p21 and Rb knock-down and by quenching ROS with N-Acetyl cysteine and p63 silencing also mimicked AR-induced senescence. The two pathways engaged in a cross-talk, likely via PML tumor suppressor, whose localization to senescence-associated chromatin foci was increased by AR activation. All these pathways contributed to growth arrest, which resolved in senescence due to concomitant lack of p53 and high mTOR activity. This is the first demonstration of senescence response caused by a nuclear hormone receptor.

  14. Activation of two mutant androgen receptors from human prostatic carcinoma by adrenal androgens and metabolic derivatives of testosterone.

    Science.gov (United States)

    Culig, Z; Stober, J; Gast, A; Peterziel, H; Hobisch, A; Radmayr, C; Hittmair, A; Bartsch, G; Cato, A C; Klocker, H

    1996-01-01

    The androgen receptor (AR) plays a central regulatory role in prostatic carcinoma and is a target of androgen ablation therapy. Recent detection of mutant receptors in tumor specimens suggest a contribution of AR alterations to progression towards androgen independence. In a specimen derived from metastatic prostate cancer we have reported a point mutation in the AR gene that leads to a single amino acid exchange in the ligand binding domain of the receptor. Another amino acid exchange resulting from a point mutation was also identified 15 amino acids away from our mutation. This mutation was detected in the AR gene isolated from an organ-confined prostatic tumor. Here we report the functional characterization of the two mutant receptors in the presence of adrenal androgens and testosterone metabolites. These studies were performed by cotransfecting androgen-responsive reporter genes and either the wild-type or mutant AR expression vectors into receptor negative DU-145 and CV-1 cells. The indicator genes used consisted of the promoter of the androgen-inducible prostate-specific antigen gene or the C' Delta9 enhancer fragment from the promoter of the mouse sex-limited protein driving the expression of the bacterial chloramphenicol acetyl transferase gene. Cotransfection-transactivation assays revealed that the adrenal androgen androstenedione and two products of testosterone metabolism, androsterone and androstandiol, induced reporter gene activity more efficiently in the presence of the mutant receptors than in the presence of the wild-type receptor. No difference between wild-type and mutant receptors was observed in the presence of the metabolite androstandione. The interaction of receptor-hormone complexes with target DNA was studied in vitro by electrophoretic mobility shift assays (EMSA). Dihydrotestosterone and the synthetic androgen mibolerone induced a faster migrating complex with all receptors, whereas the androgen metabolite androstandione induced this

  15. Androgen receptor function links human sexual dimorphism to DNA methylation.

    Directory of Open Access Journals (Sweden)

    Ole Ammerpohl

    Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.

  16. Androgen receptor gene methylation and exon one CAG repeat length in ovarian cancer: differences from breast cancer.

    Science.gov (United States)

    Kassim, Samar; Zoheiry, Nivan M; Hamed, Wael M; Going, James J; Craft, John A

    2004-07-01

    More than one neoplastic founder clone can exist in benign epithelial tumours. Although theories of clonal selection make pluriclonality appear unlikely in carcinomas, published data do not exclude this possibility. This study looked for evidence of multiclonal X inactivation in ovarian carcinoma using AR methylation as a marker. Fifteen unifocal ovarian carcinomas and 14 multifocal carcinomas all in Scottish patients were studied. One representative formalin-fixed paraffin-embedded tumour block was chosen for each of the former and two for the latter. From each of these 43 tumour blocks three samples each of approximately 10(4) carcinoma cells were obtained by microdissection (129 in all). DNA released by proteinase K digestion was subjected to PCR amplification of the androgen receptor gene AR exon I CAG repeat polymorphism with and without prior digestion with methylation-sensitive restriction enzymes HpaII and HhaI. Complex amplification patterns were consistent with mosaic X inactivation in some ovarian carcinomas but acquired anomalies of AR methylation cannot be excluded. Parallel analysis of other X-linked polymorphic loci would strengthen the inference of clonality status from DNA methylation data in tumour X studies. Strikingly, the number of CAG repeats in the 29 ovarian tumour patients (median 16, range 11 - 20) was substantially fewer than in 34 previously studied breast cancer patients from the same scottish population (median 21, range 14 - 26; P CAG repeat were over-represented in the ovarian cancer patients but not in the breast cancer series. These findings reinforce recent suggestions that AR may have a role in ovarian carcinogenesis.

  17. Mechanism and Regulation of Gene Expression by Androgen Receptor in Prostate Cancer

    Science.gov (United States)

    2004-07-01

    receptor modu- 47, Shen, E. C., M. F. Henry , V. H. Weiss, S. R. Valentini, P. A. Silver, and M. S. lates transcriptional activity and is influenced by...Kim, M. J., R. D. Cardiff, N. Desai, W. A. Banach- Petrosky , R. Parsons, Trans. 28:415-418. M. M. Shen, and C. Abate-Shen. 2002. Cooperativity of

  18. Variation in CAG and GGN repeat lengths and CAG/GGN haplotype in androgen receptor gene polymorphism and prostate carcinoma in Nigerians.

    Science.gov (United States)

    Akinloye, O; Gromoll, J; Simoni, M

    2011-01-01

    Prostate cancer has become the most common cancer in Nigerian men. The growth of the prostate gland depends on circulating androgens and intracellular steroid signalling pathways. The effects of androgens are mediated through the androgen receptor (AR), a nuclear transcription factor encoded by the AR gene. The common polymorphisms, CAG and GGN repeats, in exon 1 of this gene have been implicated as possible risk factors. Thus far, existing supporting data are scanty and none are from sub-Saharan African populations. Therefore, this study investigates the possible association between AR polymorphism repeat length (CAG and GGN) and prostate cancer in Nigerians. A total of 261 subjects (70 with prostate cancer, 68 with benign prostate hyperplasia [BPH], 123 age-matched apparently normal subjects as controls) were studied. CAG and GGN repeats length were determined by fragment length analysis using GeneScan. The CAG repeat length in prostate cancer and in BPH compared to the controls was significantly different (P CAG repeats showing a significant odds ratio (OR) in both cases. However, this was not observed in GGN repeat length, which showed no significant difference between cases and controls (P > 0.05). CAG and GGN haplotype variation showed no significant difference between cases and controls (P > 0.05), except that the haplotypes CAG > or =21 and GGN CAG repeat length is a risk factor for prostate cancer, and also suggests an association with BPH.

  19. Environmental polycyclic aromatic hydrocarbons affect androgen receptor activation in vitro

    DEFF Research Database (Denmark)

    Vinggaard, Anne Marie; Hnida, Christina; Larsen, John Christian

    2000-01-01

    Nine structurally different polycyclic aromatic hydrocarbons (PAHs) were tested for their ability to either agonize or antagonize the human androgen receptor (hAR) in a sensitive reporter gene assay based on CHO cells transiently cotransfected with a hAR vector and an MMTV-LUC vector. Benz...

  20. Androgen receptor and its splice variant, AR-V7, differentially regulate FOXA1 sensitive genes in LNCaP prostate cancer cells.

    Science.gov (United States)

    Krause, William C; Shafi, Ayesha A; Nakka, Manjula; Weigel, Nancy L

    2014-09-01

    Prostate cancer (PCa) is an androgen-dependent disease, and tumors that are resistant to androgen ablation therapy often remain androgen receptor (AR) dependent. Among the contributors to castration-resistant PCa are AR splice variants that lack the ligand-binding domain (LBD). Instead, they have small amounts of unique sequence derived from cryptic exons or from out of frame translation. The AR-V7 (or AR3) variant is constitutively active and is expressed under conditions consistent with CRPC. AR-V7 is reported to regulate a transcriptional program that is similar but not identical to that of AR. However, it is unknown whether these differences are due to the unique sequence in AR-V7, or simply to loss of the LBD. To examine transcriptional regulation by AR-V7, we have used lentiviruses encoding AR-V7 (amino acids 1-627 of AR with the 16 amino acids unique to the variant) to prepare a derivative of the androgen-dependent LNCaP cells with inducible expression of AR-V7. An additional cell line was generated with regulated expression of AR-NTD (amino acids 1-660 of AR); this mutant lacks the LBD but does not have the AR-V7 specific sequence. We find that AR and AR-V7 have distinct activities on target genes that are co-regulated by FOXA1. Transcripts regulated by AR-V7 were similarly regulated by AR-NTD, indicating that loss of the LBD is sufficient for the observed differences. Differential regulation of target genes correlates with preferential recruitment of AR or AR-V7 to specific cis-regulatory DNA sequences providing an explanation for some of the observed differences in target gene regulation.

  1. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S. (Univ. of North Carolina, Chapel Hill (USA)); Brown, T.R.; Migeon, C.J. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (USA))

    1989-12-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development.

  2. High Throughput Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    Science.gov (United States)

    2005-02-01

    molecule Soc. 2002, 124, 544. agonists. Bioorg. Med. Chem. 2001, 9, 557. 33. Berg , T.; Cohen, S. B.; Desharnais, J.; Sonderegger, C.; 18. Chen, Y.; Bilban...Kaldor, M. G. Siegel, Cure. Opin. C/tern. Biol. 1997, 1, [80] T. Berg , S. B. Cohen, J. Desharnais, C. Sonderegger, D. J. 101-106. Maslyar, J. Goldberg...251, 1211 [322] l. A. Wilson, L K. Joliffe, Curr. Opin. Struct. Biol. 1999,9,696- 1217. 702 [289] E. M. Blackwood, B. Luscher , R. N. Eisenman, Genes

  3. Androgen receptor and histone lysine demethylases in ovine placenta.

    Directory of Open Access Journals (Sweden)

    Ellane R Cleys

    Full Text Available Sex steroid hormones regulate developmental programming in many tissues, including programming gene expression during prenatal development. While estradiol is known to regulate placentation, little is known about the role of testosterone and androgen signaling in placental development despite the fact that testosterone rises in maternal circulation during pregnancy and in placenta-induced pregnancy disorders. We investigated the role of testosterone in placental gene expression, and focused on androgen receptor (AR. Prenatal androgenization decreased global DNA methylation in gestational day 90 placentomes, and increased placental expression of AR as well as genes involved in epigenetic regulation, angiogenesis, and growth. As AR complexes with histone lysine demethylases (KDMs to regulate AR target genes in human cancers, we also investigated if the same mechanism is present in the ovine placenta. AR co-immunoprecipitated with KDM1A and KDM4D in sheep placentomes, and AR-KDM1A complexes were recruited to a half-site for androgen response element (ARE in the promoter region of VEGFA. Androgenized ewes also had increased cotyledonary VEGFA. Finally, in human first trimester placental samples KDM1A and KDM4D immunolocalized to the syncytiotrophoblast, with nuclear KDM1A and KDM4D immunostaining also present in the villous stroma. In conclusion, placental androgen signaling, possibly through AR-KDM complex recruitment to AREs, regulates placental VEGFA expression. AR and KDMs are also present in first trimester human placenta. Androgens appear to be an important regulator of trophoblast differentiation and placental development, and aberrant androgen signaling may contribute to the development of placental disorders.

  4. Androgen receptor roles in spermatogenesis and infertility.

    Science.gov (United States)

    O'Hara, Laura; Smith, Lee B

    2015-08-01

    Androgens such as testosterone are steroid hormones essential for normal male reproductive development and function. Mutations of androgen receptors (AR) are often found in patients with disorders of male reproductive development, and milder mutations may be responsible for some cases of male infertility. Androgens exert their action through AR and its signalling in the testis is essential for spermatogenesis. AR is not expressed in the developing germ cell lineage so is thought to exert its effects through testicular Sertoli and peri-tubular myoid (PTM) cells. AR signalling in spermatogenesis has been investigated in rodent models where testosterone levels are chemically supressed or models with transgenic disruption of AR. These models have pinpointed the steps of spermatogenesis that require AR signalling, specifically maintenance of spermatogonial numbers, blood-testis barrier integrity, completion of meiosis, adhesion of spermatids and spermiation, together these studies detail the essential nature of androgens in the promotion of male fertility.

  5. Effect of testosterone on insulin-like growth factor-I, androgen receptor, and myostatin gene expression in splenius and semitendinosus muscles in sheep.

    Science.gov (United States)

    Mateescu, R G; Thonney, M L

    2005-04-01

    Testosterone is known to act differentially on skeletal muscle from different regions. Two genes likely to mediate the testosterone effect are IGF-I, an important growth regulator acting in an autocrine and paracrine way, and androgen receptor (AR), as receptor density could account for differential muscle growth. Another muscle-specific gene that may play a role in differential muscle growth is myostatin, a member of the transforming growth factor-beta superfamily, shown to be a negative regulator of skeletal muscle mass. The objective of this study was to quantify and compare the expression of these three genes in two different skeletal muscles in sheep. East Friesian x Dorset-sired ram lambs from Dorset ewes were used in a 2 x 4 factorial experiment. Eighteen sets of twins were assigned to four age groups corresponding to 77, 105, 133, and 161 d of age, and one individual from each set was castrated at birth. Total RNA was extracted from samples of splenius (SP) and semitendinosus muscles collected at the time of slaughter. Insulin-like growth factor-I mRNA was measured using competitive reverse-transcription PCR. Androgen receptor and myostatin mRNA were measured by ribonuclease protection assay with standard curves. Weight of SP was greater than semitendinosus in rams compared with wethers at 105, 133, and 161 d (P = 0.05, P = 0.04, and P = 0.02, respectively). The difference in IGF-I mRNA levels between the two muscles was greater in rams than in wethers at 133 (P = 0.001) and 161 d (P = 0.014), and the difference in AR mRNA levels was greater in rams than in wethers at 105, 133, and 161 d (P = 0.002, P muscles in rams and wethers at any age. These results suggest that locally produced IGF-I and the regulation of AR expression are important for sexually dimorphic muscle growth patterns.

  6. Androgen resistance.

    Science.gov (United States)

    Hughes, Ieuan A; Deeb, Asma

    2006-12-01

    Androgen resistance causes the androgen insensitivity syndrome in its variant forms and is a paradigm of clinical syndromes associated with hormone resistance. In its complete form, the syndrome causes XY sex reversal and a female phenotype. Partial resistance to androgens is a common cause of ambiguous genitalia of the newborn, but a similar phenotype may result from several other conditions, including defects in testis determination and androgen biosynthesis. The biological actions of androgens are mediated by a single intracellular androgen receptor encoded by a gene on the long arm of the X chromosome. Mutations in this gene result in varying degrees of androgen receptor dysfunction and phenotypes that often show poor concordance with the genotype. Functional characterization and three-dimensional modelling of novel mutant receptors has been informative in understanding the mechanism of androgen action. Management issues in syndromes of androgen insensitivity include decisions on sex assignment, timing of gonadectomy in relation to tumour risk, and genetic and psychological counselling.

  7. Analysis of the CAG repeat region of the androgen receptor gene in a kindred with X-linked spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Belsham, D D; Yee, W C; Greenberg, C R; Wrogemann, K

    1992-10-01

    Herein we describe a family with X-linked spinal and bulbar muscular atrophy (SBMA or Kennedy's disease), an adult onset neuromuscular disease characterized by slow progression, predominant proximal and bulbar muscle weakness. One frequent association is the appearance of gynecomastia. This disorder was previously shown to be linked to the locus DXYS1 on the proximal long arm of the X chromosome. Recently, a report implicated a mutation at the N-terminus of the androgen receptor gene involving amplification of CAG repeats as the cause of X-linked SBMA. We studied this region of the androgen receptor in a kindred clinically suspected but not confirmed of having X-linked SBMA by the polymerase chain reaction (PCR) followed by Southern analysis and DNA sequencing. The mutated allele was found to have an increased number of 51 CAG repeats confirming the clinical diagnosis of SBMA. Normal individuals revealed 23 repeat numbers within the normal range, while another unrelated X-linked SBMA patient had an enlarged CAG repeat region. The carrier or disease status could be established or confirmed in 12 individuals of this family on the basis of detecting normal and disease alleles reflected by the number of CAG repeats.

  8. A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

    DEFF Research Database (Denmark)

    Ottesen, A M; Garn, I D; Aksglaede, L;

    2007-01-01

    Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....

  9. Integrative transcriptomics-based identification of cryptic drivers of taxol-resistance genes in ovarian carcinoma cells: Analysis of the androgen receptor.

    Science.gov (United States)

    Sun, Nian-Kang; Huang, Shang-Lang; Lu, Hsing-Pang; Chang, Ting-Chang; Chao, Chuck C-K

    2015-09-29

    A systematic analysis of the genes involved in taxol resistance (txr) has never been performed. In the present study, we created txr ovarian carcinoma cell lines to identify the genes involved in chemoresistance. Transcriptome analysis revealed 1,194 overexpressed genes in txr cells. Among the upregulated genes, more than 12 cryptic transcription factors were identified using MetaCore analysis (including AR, C/EBPβ, ERα, HNF4α, c-Jun/AP-1, c-Myc, and SP-1). Notably, individual silencing of these transcription factors (except HNF4`)sensitized txr cells to taxol. The androgen receptor (AR) and its target genes were selected for further analysis. Silencing AR using RNA interference produced a 3-fold sensitization to taxol in txr cells, a response similar to that produced by silencing abcb1. AR silencing also downregulated the expression of prominent txr gene candidates (including abcb1, abcb6, abcg2, bmp5, fat3, fgfr2, h1f0, srcrb4d, and tmprss15). In contrast, AR activation using the agonist DHT upregulated expression of the target genes. Individually silencing seven out of nine (78%) AR-regulated txr genes sensitized txr cells to taxol. Inhibition of AKT and JNK cellular kinases using chemical inhibitors caused a dramatic suppression of AR expression. These results indicate that the AR represents a critical driver of gene expression involved in txr.

  10. Androgen regulation of the TMPRSS2 gene and the effect of a SNP in an androgen response element.

    Science.gov (United States)

    Clinckemalie, Liesbeth; Spans, Lien; Dubois, Vanessa; Laurent, Michaël; Helsen, Christine; Joniau, Steven; Claessens, Frank

    2013-12-01

    More than 50% of prostate cancers have undergone a genomic reorganization that juxtaposes the androgen-regulated promoter of TMPRSS2 and the protein coding parts of several ETS oncogenes. These gene fusions lead to prostate-specific and androgen-induced ETS expression and are associated with aggressive lesions, poor prognosis, and early-onset prostate cancer. In this study, we showed that an enhancer at 13 kb upstream of the TMPRSS2 transcription start site is crucial for the androgen regulation of the TMPRSS2 gene when tested in bacterial artificial chromosomal vectors. Within this enhancer, we identified the exact androgen receptor binding sequence. This newly identified androgen response element is situated next to two binding sites for the pioneer factor GATA2, which were identified by DNase I footprinting. Both the androgen response element and the GATA-2 binding sites are involved in the enhancer activity. Importantly, a single nucleotide polymorphism (rs8134378) within this androgen response element reduces binding and transactivation by the androgen receptor. The presence of this SNP might have implications on the expression and/or formation levels of TMPRSS2 fusions, because both have been shown to be influenced by androgens.

  11. Computational Investigation on the Allosteric Modulation of Androgen Receptor

    Institute of Scientific and Technical Information of China (English)

    OU Min-Rui; LI Jun-Qian

    2012-01-01

    Androgens have similar structures with different biological activities. To identify molecular determinants responsible for the activity difference, we have docked six steroidal androgens to the binding site or the surface of androgen receptor by using molecular docking with computational investigation. The energy was calculated respectively based on the QM (quantum mechanics) and MM (molecular mechanics) methods. The result shows that the allosteric modulation of androgen receptor plays an important role in the binding process between androgens and receptor. The open state receptor is less stable than the close state one, but the latter is more favorable for binding with androgens. It is worthy of note that when the androgen receptors binding or without binding with androgen are in close state, they are difficult to return to their open state. This phenomenon is an exception of the well known two-state model theory in which the two states are reversible. Whether the internal of close state androgen receptor has a combination of androgen or not, the androgen receptor surface can be combined with another androgen, and their surface binding energies could be very close. The result is consistent with the experimental observations, but this phenomenon of continuous combination from open state is also an exception of the two-state model theory.

  12. Discovery and therapeutic promise of selective androgen receptor modulators.

    Science.gov (United States)

    Chen, Jiyun; Kim, Juhyun; Dalton, James T

    2005-06-01

    Androgens are essential for male development and the maintenance of male secondary characteristics, such as bone mass, muscle mass, body composition, and spermatogenesis. The main disadvantages of steroidal androgens are their undesirable physicochemical and pharmacokinetic properties. The recent discovery of nonsteroidal selective androgen receptor modulators (SARMs) provides a promising alternative for testosterone replacement therapies with advantages including oral bioavailability, flexibility of structural modification, androgen receptor specificity, tissue selectivity, and the lack of steroid-related side effects.

  13. Androgens regulate gene expression in avian skeletal muscles.

    Directory of Open Access Journals (Sweden)

    Matthew J Fuxjager

    Full Text Available Circulating androgens in adult reproductively active male vertebrates influence a diversity of organ systems and thus are considered costly. Recently, we obtained evidence that androgen receptors (AR are expressed in several skeletal muscles of three passeriform birds, the golden-collared manakin (Manacus vitellinus, zebra finch (Taenopygia guttata, and ochre-bellied flycatcher (Mionectes oleagieus. Because skeletal muscles that control wing movement make up the bulk of a bird's body mass, evidence for widespread effects of androgen action on these muscles would greatly expand the functional impact of androgens beyond their well-characterized effects on relatively discrete targets throughout the avian body. To investigate this issue, we use quantitative PCR (qPCR to determine if androgens alter gene mRNA expression patterns in wing musculature of wild golden-collared manakins and captive zebra finches. In manakins, the androgen testosterone (T up-regulated expression of parvalbumin (PV and insulin-like growth factor I (IGF-I, two genes whose products enhance cellular Ca(2+ cycling and hypertrophy of skeletal muscle fibers. In T-treated zebra finches, the anti-androgen flutamide blunted PV and IGF-I expression. These results suggest that certain transcriptional effects of androgen action via AR are conserved in passerine skeletal muscle tissue. When we examined wing muscles of manakins, zebra finches and ochre-bellied flycatchers, we found that expression of PV and IGF-I varied across species and in a manner consistent with a function for AR-dependent gene regulation. Together, these findings imply that androgens have the potential to act on avian muscle in a way that may enhance the physicality required for successful reproduction.

  14. Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.

    Science.gov (United States)

    Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao

    2009-11-01

    Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.

  15. The CAG repeat polymorphism in the androgen receptor gene (AR) and its relationship to head and neck cancer.

    Science.gov (United States)

    dos Santos, M L; Sibov, T T; Nishimoto, I N; Kowalski, L P; Miracca, E C; Nagai, M A

    2004-02-01

    Sex hormones may play an important role in the tumorigenic process of the head and neck. The aim of our work was to investigate whether the androgen receptor (AR) CAG repeat polymorphism is associated with an increased relative risk for head and neck cancer. Genomic DNA from 103 male patients with head and neck carcinomas and 100 male controls were analyzed for the AR CAG polymorphism by PCR amplification and direct sequencing or denaturing polyacrilamide gel electrophoresis. Logistic regression analysis showed a significant association between CAG repeat length and risk of head and neck cancer in individuals with more than 20 CAG repeats [OR=2.54 (95% CI, 1.3-4.8)]. For the group of individuals with oral and laryngeal cancer the estimated relative risk was increased to 2.79 (95% CI, 1.2-6.3) and 3.06 (95% CI, 1.0-9.6), respectively, in men with CAG repeat length >20. These results suggest, for the first time, that shorter AR CAG repeat alleles have a protective effect for head and neck cancer development.

  16. Cytogenetic and molecular analysis of infertile Chinese men: karyotypic abnormalities, Y-chromosome microdeletions, and CAG and GGN repeat polymorphisms in the androgen receptor gene.

    Science.gov (United States)

    Han, T T; Ran, J; Ding, X P; Li, L J; Zhang, L Y; Zhang, Y P; Nie, S S; Chen, L

    2013-07-08

    Chromosome abnormalities, Y-chromosome microdeletions, and androgen receptor gene CAG and GGN repeat polymorphisms in infertile Chinese men featuring severe oligospermia and azoospermia were analyzed. Ninety-six fertile men and 189 non-obstructive infertile men, including 125 patients with azoospermia and 64 with severe oligozoospermia, were studied. Seventeen infertile men (9.0%) carried a chromosome abnormality. Twenty (10.6%) carried a Y-chromosome microdeletion. In the remainder of the patients and controls, GGN and CAG repeats were sequenced. Short GGN repeats (n repeats strongly correlated with sperm counts. No significant difference in CAG repeats was found between patients and controls, nor were CAG repeats correlated with sperm counts. However, for CAG repeats ranging between 24 and 25, there was a >2.5-fold risk (OR = 2.539, 95%CI = 1.206-5.344, P repeats in Chinese male infertility.

  17. Androgen receptor modulators: a marriage of chemistry and biology.

    Science.gov (United States)

    McEwan, Iain J

    2013-06-01

    Androgenic steroids are important for male development in utero and secondary sexual characteristics at puberty. In addition, androgens play a role in non-reproductive tissues, such as bone and muscle in both sexes. The actions of the androgens testosterone and dihydrotestosterone are mediated by a single receptor protein, the androgen receptor. Over the last 60-70 years there has been considerable research interest in the development of inhibitors of androgen receptor for the management of diseases such as prostate cancer. However, more recently, there is also a growing appreciation of the need for selective androgen modulators that would demonstrate tissue-selective agonist or antagonist activity. The chemistry and biology of selective agonists, antagonists and selective androgen receptor modulators will be discussed in this review.

  18. Selective androgen receptor modulators: in pursuit of tissue-selective androgens.

    Science.gov (United States)

    Omwancha, Josephat; Brown, Terry R

    2006-10-01

    The androgen receptor mediates the androgenic and anabolic activity of the endogenous steroids testosterone and 5alpha-dihydrotestosterone. Current knowledge of the androgen receptor protein structure, and the molecular mechanisms surrounding the binding properties and activities of agonists and antagonists has led to the design and development of novel nonsteroidal ligands with selected tissue-specific androgen receptor agonist and antagonist activities. The activity of these compounds, termed selective androgen receptor modulators (SARMs), is directed toward the maintenance or enhancement of anabolic effects on bone and muscle with minimal androgenic effects on prostate growth. SARMs are of potential therapeutic value in the treatment of male hypogonadism, osteoporosis, frailty and muscle wasting, burn injury and would healing, anemia, mood and depression, benign prostatic hyperplasia and prostate cancer.

  19. A satellite cell-specific knockout of the androgen receptor reveals myostatin as a direct androgen target in skeletal muscle.

    Science.gov (United States)

    Dubois, Vanessa; Laurent, Michaël R; Sinnesael, Mieke; Cielen, Nele; Helsen, Christine; Clinckemalie, Liesbeth; Spans, Lien; Gayan-Ramirez, Ghislaine; Deldicque, Louise; Hespel, Peter; Carmeliet, Geert; Vanderschueren, Dirk; Claessens, Frank

    2014-07-01

    Androgens have well-established anabolic actions on skeletal muscle, although the direct effects of the androgen receptor (AR) in muscle remain unclear. We generated satellite cell-specific AR-knockout (satARKO) mice in which the AR is selectively ablated in satellite cells, the muscle precursor cells. Total-limb maximal grip strength is decreased by 7% in satARKO mice, with soleus muscles containing ∼10% more type I fibers and 10% less type IIa fibers than the corresponding control littermates. The weight of the perineal levator ani muscle is markedly reduced (-52%). Thus, muscle AR is involved in fiber-type distribution and force production of the limb muscles, while it is a major determinant of the perineal muscle mass. Surprisingly, myostatin (Mstn), a strong inhibitor of skeletal muscle growth, is one of the most androgen-responsive genes (6-fold reduction in satARKO) through direct transcription activation by the AR. Consequently, muscle hypertrophy in response to androgens is augmented in Mstn-knockout mice. Our finding that androgens induce Mstn signaling to restrain their own anabolic actions has implications for the treatment of muscle wasting disorders.-Dubois, V., Laurent, M. R., Sinnesael, M., Cielen, N., Helsen, C., Clinckemalie, L., Spans, L., Gayan-Ramirez, G., Deldicque, L., Hespel, P., Carmeliet, G., Vanderschueren, D., and Claessens, F. A satellite cell-specific knockout of the androgen receptor reveals myostatin as a direct androgen target in skeletal muscle.

  20. A codon-usage variant in the (GGN){sub n} trinucleotide polymorphism of the androgen receptor gene as an aid in the prenatal diagnosis of ambiguous genitalia due to partial androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Lumbroso, R.; Vasiliou, M.; Beitel, L.K. [McGill Univ., Montreal, Quebec (Canada)] [and others

    1994-09-01

    Exon 1 at the X-linked androgen receptor (AR) locus encodes an N-terminal modulatory domain that contains two large homopolyamino acid tracts: (CAG;glutamine;Gln){sub 11-33} and (GGN;Glycine;Cly){sub 15-27}. Certain AR mutations cause partial androgen insensitivity (PAI) with frank genital ambiguity that may engender appreciable parental anxiety and patient morbidity. If the AR mutation in a PAI family is unknown, the AR`s intragenic trinucleotide repeat polymorphisms may be used for prenatal diagnosis. However, intergenerational instability of repeat-size may be worrisome, particularly when the information alleles differ by only a few repeats. Here, we report the discovery of a codon-usage (silent substitution) variant in the GGN repeat, and describe its use as a source of complementary information for prenatal diagnosis. The standard sense sequence of the (GGN){sub n} tract is (GGT){sub 3} GGG(GGT){sub 2} (GGC){sub 9-21}. On 4 of 27 X chromosomes we noted that the internal GGT sequence was expanded to 3 or 4 repeats. We used an internal (GGT){sub 4} repeat in a total (GGN){sub 24} tract together with a (CAG){sub 20} tract to distinguish an X chromosome with a mutant AR allele from another X chromosome, bearing a normal allele, that had an internal (GGT){sub 2} repeat in a total (GGN){sub 23} tract together with a (CAG){sub 21} tract. Subsequently, we found the base change leading to a pathogenic amino acid substitution (M779I) in codon 6 of the mutant AR gene in an affected maternal aunt and the fetus at risk. This confirmed the prenatal diagnosis based on the intragenic trinucleotide repeat polymorphisms, and it strengthened the prediction of external genital ambiguity using our previous experience with M779I in another family.

  1. Relation of androgen receptor gene polymorphism to bone mineral density and fracture risk in early postmenopausal women during a 5-year randomized hormone replacement therapy trial.

    Science.gov (United States)

    Salmén, Timo; Heikkinen, Anna-Mari; Mahonen, Anitta; Kröger, Heikki; Komulainen, Marja; Pallonen, Heli; Saarikoski, Seppo; Honkanen, Risto; Mäenpää, Pekka H

    2003-02-01

    In women, the influence of androgens on bone health is not clear. It has been suggested that the androgen receptor (AR) genotype is associated with bone mineral density and serum androgen levels in pre- and perimenopausal women, but the association between AR genotype, bone mineral density, and fracture risk has not been studied in postmenopausal women. Therefore, we studied whether AR polymorphism affects bone mineral density, bone mineral density change, or fracture risk in a 5-year randomized hormone replacement therapy (HRT) trial on 331 early postmenopausal women (mean baseline age, 52.7 +/- 2.3 years). The participants consisted of two treatment groups: the HRT group (n = 151) received a sequential combination of 2 mg estradiol valerate and 1 mg cyproterone acetate with or without vitamin D3, 100-300 IU + 93 mg calcium as lactate/day, and the non-HRT group (n = 180) received 93 mg calcium alone or in combination with vitamin D3, 100-300 IU/day for 5 years. Bone mineral density was measured from lumbar spine and proximal femur (DXA) before and after the 5-year trial. All new symptomatic, radiographically defined fractures were recorded during the follow-up. The length of CAG repeat in exon 1 of AR gene was evaluated after polymerase chain reaction (PCR) amplification. The subjects were divided into three repeat groups according to AR alleles. None of the baseline characteristics were associated with AR gene polymorphism and HRT treatment. The polymorphism did not influence the calculated annual changes of lumbar or femoral neck bone mineral density during the 5-year follow-up in the HRT (p = 0.926 and 0.146, respectively) or non-HRT (p = 0.818 and 0.917, respectively) groups. In all, 28 women sustained 33 fractures during the follow-up. Thus, the numbers of fractures were limited. The AR repeat length variation was not significantly associated with fracture risk in the HRT or non-HRT groups (p = 0.632 and 0.459, respectively; Cox proportional hazards model

  2. Androgen receptor expression in human ovarian and uterine tissue of long term androgen-treated transsexual women

    NARCIS (Netherlands)

    D. Chadha; T.D. Pache; F.J. Huikeshoven (Frans); A.O. Brinkmann (Albert); Th.H. van der Kwast (Theo)

    1994-01-01

    textabstractAndrogen receptor (AR) modulation in human uteri and ovaries of long term androgen-treated transsexual female patients was investigated. Androgen receptor expression was evaluated immunohistochemically in the ovaries of 11 and the endometria and myometria of six androgen-treated transsex

  3. Calpain-Dependent Proteolysis of the Androgen Receptor

    Science.gov (United States)

    2009-11-01

    fetal bovine serum, 2 mmol/L L-glutamine, 100 units/mL penicillin , and 100 Ag/mL streptomycin (Invitrogen) at 37jC and 5% CO2. Western immunoblot...mutations Mutation of the AR gene to either a hypersensitive receptor or a receptor with expanded ligand specificity would confer androgen...PC3, DU145 and R1 cells were propagated in RPMI 1640 supplemented with 5% fetal bovine serum, 2 mmol/L L- glutamine, 100 units/mL penicillin , and

  4. A Phase II Study Evaluating the Role of Androgen Receptors as Targets for Therapy of Pre-treated Post-menopausal Patients With ER/PgR-negative/AR-positive or ER and/or PgRpositive/ AR-positive Metastatic Breast Cancer (ARTT)

    Science.gov (United States)

    2016-09-28

    Metastatic Breastcancer; Estrogen Receptor Positive Breast Cancer; Estrogen Receptor Negative Neoplasm; Progesterone Receptor Positive Tumor; Progesterone Receptor Negative Neoplasm; Androgen Receptor Gene Overexpression

  5. The Presence of Clitoromegaly in the Nonclassical Form of 21-Hydroxylase Deficiency Could Be Partially Modulated by the CAG Polymorphic Tract of the Androgen Receptor Gene

    Science.gov (United States)

    Garcia Gomes, Larissa; Bugano Diniz Gomes, Diogo; Marcondes, José Antônio Miguel; Madureira, Guiomar; de Mendonca, Berenice Bilharinho; Bachega, Tânia A. Sartori Sanchez

    2016-01-01

    Background In the nonclassical form (NC), good correlation has been observed between genotypes and 17OH-progesterone (17-OHP) levels. However, this correlation was not identified with regard to the severity of hyperandrogenic manifestations, which could depend on interindividual variability in peripheral androgen sensitivity. Androgen action is modulated by the polymorphic CAG tract (nCAG) of the androgen receptor (AR) gene and by polymorphisms in 5α-reductase type 2 (SRD5A2) enzyme, both of which are involved in the severity of hyperandrogenic disorders. Objectives To analyze whether nCAG-AR and SRD5A2 polymorphisms influence the severity of the nonclassical phenotype. Patients NC patients (n = 114) diagnosed by stimulated-17OHP ≥10 ng/mL were divided into groups according to the beginning of hyperandrogenic manifestations (pediatric and adolescent/adult) and CYP21A2 genotypes (C/C: homozygosis for mild mutations; A/C: compound heterozygosis for severe/mild mutations). Methods CYP21A2 mutations were screened by allelic-specific PCR, MLPA and/or sequencing. HpaII-digested and HpaII-undigested DNA samples underwent GeneScan analysis to study nCAG, and the SRD5A2 polymorphisms were screened by RLFP. Results Mean nCAG did not differ among pediatric, adolescent/adult and asymptomatic subjects. In the C/C genotype, we observed a significantly lower frequency of longer CAG alleles in pediatric patients than in adolescent/adults (p = 0.01). In patients carrying the A/C genotype, the frequencies of shorter and longer CAG alleles did not differ between pediatric patients and adolescent/adults (p>0.05). Patients with clitoromegaly had significantly lower weighted CAG biallelic mean than those without it: 19.1±2.7 and 21.6±2.5, respectively (p = 0.007), independent of the CYP21A2 genotype's severity. The SRD5A2 polymorphisms were not associated with the variability of hyperandrogenic NC phenotypes. Conclusions In this series, we observed a modulatory effect of the CAG

  6. In vitro translation of androgen receptor cRNA results in an activated androgen receptor protein

    NARCIS (Netherlands)

    G.G.J.M. Kuiper (George); P.E. de Ruiter (Petra); J. Trapman (Jan); G.W. Jenster (Guido); A.O. Brinkmann (Albert)

    1993-01-01

    textabstractTranslation of androgen receptor (AR) cRNA in a reticulocyte lysate and subsequent analysis of the translation products by SDS/PAGE showed a protein with an apparent molecular mass of 108 kDa. Scatchard-plot analysis revealed a single binding component with

  7. Selective androgen receptor modulators as improved androgen therapy for advanced breast cancer.

    Science.gov (United States)

    Coss, Christopher C; Jones, Amanda; Dalton, James T

    2014-11-01

    Androgens were at one time a therapeutic mainstay in the treatment of advanced breast cancer. Despite comparable efficacy, SERMs and aromatase inhibitors eventually became the therapies of choice due to in part to preferred side-effect profiles. Molecular characterization of breast tumors has revealed an abundance of androgen receptor expression but the choice of an appropriate androgen receptor ligand (agonist or antagonist) has been confounded by multiple conflicting reports concerning the role of the receptor in the disease. Modern clinical efforts have almost exclusively utilized antagonists. However, the recent clinical development of selective androgen receptor modulators with greatly improved side-effect profiles has renewed interest in androgen agonist therapy for advanced breast cancer.

  8. Correlation study between the polymorphism of repetitive sequence in gene CAG of androgen receptor and the occurrence and progression of prostate cancer

    Institute of Scientific and Technical Information of China (English)

    Xiao-Lei Zhai; Xiao-Wei Qu; Liang Guo; Qian-He Ha

    2014-01-01

    Objective: To explore the relation between the polymorphism of repetitive sequence in gene CAG of androgen receptor (AR) and the susceptibility and clinical stages as well as pathological grading of prostate cancer among Han population. Method: Sixty-eight cases with prostate cancer hospitalized in Urinary Surgery Department from Feb. 2010 to Feb. 2012 and 60 healthy cases were chosen as research subjects. Methods of PCR and direct sequencing were adopted to detect DNA sequence of AR gene and the length of repetitive sequence in CAG. Results: The lengths of repetitive sequence in CAG of patients with prostate cancer and healthy people were (22.3±4.6) and (23.0±4.9), respectively showing no statistical significance. Comparing length (repetitive sequence of CAG)>22, those with that ﹤ 22 suffer a remarkably higher risk of prostate cancer (P﹤0.05). The number of repetitive sequence in CAG of patients at clinical stage C-D was less than that of patients at stage B, and the number of repetitive sequence in CAG of patients with poorly differentiated prostate cancer was also less than that of patients with moderately and highly differentiated prostate cancer. But there was no statistical significance int the difference (P>0.05); the proportion of patients with length ﹤22 at clinical stage C-D was much larger than that of patients at clinical stage B (P﹤0.05), and as the aggravation of pathological grading, the proportion of patients with the length ﹤22 was also remarkably increased and there was significant difference between patients with highly differentiated prostate cancer and those with poorly differentiated prostate cancer (P﹤0.05). Conclusions: There is correlation between the occurrence and development of prostate cancer in Han population and the polymorphism of repetitive sequence in gene CAG of androgen receptor. The less the number of repetitive sequence in CAG is, the higher the risk of prostate cancer will be and the more severe the clinical

  9. Sequence Evolution and Expression of the Androgen Receptor and Other Pathway-Related Genes in a Unisexual Fish, the Amazon Molly, Poecilia formosa, and Its Bisexual Ancestors.

    Directory of Open Access Journals (Sweden)

    Fangjun Zhu

    Full Text Available The all-female Amazon molly (Poecilia formosa originated from a single hybridization of two bisexual ancestors, Atlantic molly (Poecilia mexicana and sailfin molly (Poecilia latipinna. As a gynogenetic species, the Amazon molly needs to copulate with a heterospecific male, but the genetic information of the sperm-donor does not contribute to the next generation, as the sperm only acts as the trigger for the diploid eggs' embryogenesis. Here, we study the sequence evolution and gene expression of the duplicated genes coding for androgen receptors (ars and other pathway-related genes, i.e., the estrogen receptors (ers and cytochrome P450, family19, subfamily A, aromatase genes (cyp19as, in the Amazon molly, in comparison to its bisexual ancestors. Mollies possess-as most other teleost fish-two copies of the ar, er, and cyp19a genes, i.e., arα/arβ, erα/erβ1, and cyp19a1 (also referred as cyp19a1a/cyp19a2 (also referred to as cyp19a1b, respectively. Non-synonymous single nucleotide polymorphisms (SNPs among the ancestral bisexual species were generally predicted not to alter protein function. Some derived substitutions in the P. mexicana and one in P. formosa are predicted to impact protein function. We also describe the gene expression pattern of the ars and pathway-related genes in various tissues (i.e., brain, gill, and ovary and provide SNP markers for allele specific expression research. As a general tendency, the levels of gene expression were lowest in gill and highest in ovarian tissues, while expression levels in the brain were intermediate in most cases. Expression levels in P. formosa were conserved where expression did not differ between the two bisexual ancestors. In those cases where gene expression levels significantly differed between the bisexual species, P. formosa expression was always comparable to the higher expression level among the two ancestors. Interestingly, erβ1 was expressed neither in brain nor in gill in the

  10. Sequence Evolution and Expression of the Androgen Receptor and Other Pathway-Related Genes in a Unisexual Fish, the Amazon Molly, Poecilia formosa, and Its Bisexual Ancestors

    Science.gov (United States)

    Zhu, Fangjun; Schlupp, Ingo; Tiedemann, Ralph

    2016-01-01

    The all-female Amazon molly (Poecilia formosa) originated from a single hybridization of two bisexual ancestors, Atlantic molly (Poecilia mexicana) and sailfin molly (Poecilia latipinna). As a gynogenetic species, the Amazon molly needs to copulate with a heterospecific male, but the genetic information of the sperm-donor does not contribute to the next generation, as the sperm only acts as the trigger for the diploid eggs’ embryogenesis. Here, we study the sequence evolution and gene expression of the duplicated genes coding for androgen receptors (ars) and other pathway-related genes, i.e., the estrogen receptors (ers) and cytochrome P450, family19, subfamily A, aromatase genes (cyp19as), in the Amazon molly, in comparison to its bisexual ancestors. Mollies possess–as most other teleost fish—two copies of the ar, er, and cyp19a genes, i.e., arα/arβ, erα/erβ1, and cyp19a1 (also referred as cyp19a1a)/cyp19a2 (also referred to as cyp19a1b), respectively. Non-synonymous single nucleotide polymorphisms (SNPs) among the ancestral bisexual species were generally predicted not to alter protein function. Some derived substitutions in the P. mexicana and one in P. formosa are predicted to impact protein function. We also describe the gene expression pattern of the ars and pathway-related genes in various tissues (i.e., brain, gill, and ovary) and provide SNP markers for allele specific expression research. As a general tendency, the levels of gene expression were lowest in gill and highest in ovarian tissues, while expression levels in the brain were intermediate in most cases. Expression levels in P. formosa were conserved where expression did not differ between the two bisexual ancestors. In those cases where gene expression levels significantly differed between the bisexual species, P. formosa expression was always comparable to the higher expression level among the two ancestors. Interestingly, erβ1 was expressed neither in brain nor in gill in the analyzed

  11. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  12. RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

    Science.gov (United States)

    Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. WilsonU.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...

  13. Observation of Androgen Receptor Gene and Sex Hormone Binding Protein Gene in PCOS Patients%PCOS患者雄激素受体基因和性激素结合蛋白基因情况观察

    Institute of Scientific and Technical Information of China (English)

    马娟; 周俊; 田贵聪; 石华

    2016-01-01

    目的:研究观察多囊卵巢综合征(polycystic ovary syndrome,PCOS)患者的雄激素受体基因和性激素结合蛋白基因的情况。方法:选取2014年11月-2015年7月本院接诊的62例PCOS患者为观察组,同一时期由于生殖系统发生异常导致不孕的62例患者为对照组。提取所有患者血液标本的DNA进行基因扩增、琼脂糖凝胶、毛细管电泳等检测,观察研究PCOS患者的雄激素受体和性激素结合蛋白基因的情况。结果:观察组SHBG-TAAAA基因型多态性与胰岛素抵抗的研究中,发现9/9基因型的分布在胰岛素抵抗和非胰岛素抵抗两组中存在统计学差异(P<0.05);观察组中,短重复组在高雄激素血症组的分布为52.94%,在雄激素正常组分布为42.86%;而长重复组在高雄激素血症组的分布为61.76%,在雄激素正常组的分布为39.29%,两组数据比较差异有统计学意义(P<0.05)。结论:雄激素受体基因和性激素结合蛋白基因与PCOS相关,可对PCOS的检查指标、PCOS防治、及早诊断起重要作用。%Objective:To investigate the status of androgen receptor gene and sex hormone binding protein gene in patients with polycystic ovary syndrome(PCOS).Method:A total of 62 PCOS patients were selected as the observation group from November 2014 to July 2015 in our hospital,the control group were choosed from the same period due to the occurrence of reproductive system abnormalities lead to infertility in 62 patients.DNA gene amplification,agarose gel electrophoresis and capillary electrophoresis were performed to detect the expression of androgen receptor and sex hormone binding protein gene in PCOS patients.Result:SHBG-TAAAA gene type of polymorphic and insulin resistance of the observation group in the study,found that 9/9 genotype distribution in insulin resistance and insulin resistance had a significant difference in two groups(P<0.05).In the observation group

  14. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Allen, R.C.; Zoghbi, H.Y.; Moseley, A.B.; Rosenblatt, H.M.; Belmont, J.W. (Baylor College of Medicine, Houston (United States))

    1992-12-01

    The human androgen-receptor gene (HUMARA; GenBank) contains a highly polymorphic trinucleotide repeat in the first exon. The authors have found that the methylation of HpaII and HhaI sites less than 100 pb away from this polymorphic short tandem repeat (STR) correlates with X inactivation. The close proximity of the restriction-enzyme sites to the STR allows the development of a PCR assay that distinguishes between the maternal and paternal alleles and identifies their methylation status. The accuracy of this assay was tested on (a) DNA from hamster/human hybrid cell lines containing either an active or inactive human X chromosome; (b) DNA from normal males and females; and (c) DNA from females showing nonrandom patterns of X inactivation. Data obtained using this assay correlated substantially with those obtained using the PGK, HPRT, and M27[beta] probes, which detect X inactivation patterns by Southern blot analysis. In order to demonstrate one application of this assay, the authors examined X inactivation patterns in the B lymphocytes of potential and obligate carriers of X-linked agammaglobulinemia. 42 refs., 5 figs., 1 tab.

  15. [Tissue variability of androgen receptor gene in bulbospinal muscular atrophy--comparison of the number of CAG repeats between muscles and peripheral blood leukocytes].

    Science.gov (United States)

    Nakajima, H; Kimura, F; Shinoda, K; Ohsawa, N; Nakagawa, T; Shimizu, A

    1993-10-01

    We investigated an expansion of CAG repeats in exon 1 of androgen receptor gene in skeletal muscle tissue obtained from the patients with various neuro-muscular disorders (5 BSMA, 33 patients with amyotrophic lateral sclerosis, 3 patients with spinal progressive muscular atrophy and 2 patients with hereditary motor sensory neuropathy), by polymerase chain reaction (PCR) amplification according to LaSpadas' description. These muscle tissues had been stored at -70 degrees C freezer during 7 years. We also studied the tissue variation of CAG repeats size between muscles and peripheral blood leukocytes in 4 patients with BSMA. And we confirmed the increased number of CAG repeats in all 5 BSMA except for other patients with neurogenic muscular atrophy. In the 4 BSMA patients, we subcloned the PCR products from muscles tissues and peripheral blood leukocytes, and we determined the number of CAG repeats by sequencing. The repeats of them were 43-51, and all BSMA patients showed the same number of CAG repeats in muscles tissues and peripheral blood leukocytes. The CAG repeats fragment of BSMA may be stable region in frozen storage state for 7 years, and we didn't recognized the somatic variation at least between muscles tissues and peripheral blood leukocytes.

  16. Androgen Receptor Roles in the Development of Benign Prostate Hyperplasia

    OpenAIRE

    IZUMI, KOUJI; Mizokami, Atsushi; Lin, Wen-Jye; Lai, Kuo-Pao; Chang, Chawnshang

    2013-01-01

    Benign prostate hyperplasia (BPH) is a major cause of lower urinary tract symptoms, with an increased volume of transitional zone and associated with increased stromal cells. It is known that androgen/androgen receptor (AR) signaling plays a key role in development of BPH, and that blockade of this signaling decreases BPH volume and can relieve lower urinary tract symptoms, but the mechanisms of androgen/AR signaling in BPH development remain unclear, and the effectiveness of current drugs fo...

  17. In Silico and In Vitro Investigation of the Piperine's Male Contraceptive Effect: Docking and Molecular Dynamics Simulation Studies in Androgen-Binding Protein and Androgen Receptor.

    Science.gov (United States)

    Chinta, Gopichand; Ramya Chandar Charles, Mariasoosai; Klopčič, Ivana; Sollner Dolenc, Marija; Periyasamy, Latha; Selvaraj Coumar, Mohane

    2015-07-01

    Understanding the molecular mechanism of action of traditional medicines is an important step towards developing marketable drugs from them. Piperine, an active constituent present in the Piper species, is used extensively in Ayurvedic medicines (practiced on the Indian subcontinent). Among others, piperine is known to possess a male contraceptive effect; however, the molecular mechanism of action for this effect is not very clear. In this regard, detailed docking and molecular dynamics simulation studies of piperine with the androgen-binding protein and androgen receptors were carried out. Androgen receptors control male sexual behavior and fertility, while the androgen-binding protein binds testosterone and maintains its concentration at optimal levels to stimulate spermatogenesis in the testis. It was found that piperine docks to the androgen-binding protein, similar to dihydrotestosterone, and to androgen receptors, similar to cyproterone acetate (antagonist). Also, the piperine-androgen-binding protein and piperine-androgen receptors interactions were found to be stable throughout 30 ns of molecular dynamics simulation. Further, two independent simulations for 10 ns each also confirmed the stability of these interactions. Detailed analysis of the piperine-androgen-binding protein interactions shows that piperine interacts with Ser42 of the androgen-binding protein and could block the binding with its natural ligands dihydrotestosterone/testosterone. Moreover, piperine interacts with Thr577 of the androgen receptors in a manner similar to the antagonist cyproterone acetate. Based on the in silico results, piperine was tested in the MDA-kb2 cell line using the luciferase reporter gene assay and was found to antagonize the effect of dihydrotestosterone at nanomolar concentrations. Further detailed biochemical experiments could help to develop piperine as an effective male contraceptive agent in the future.

  18. Contribution of allelic variability in prostate specific antigen (PSA & androgen receptor (AR genes to serum PSA levels in men with prostate cancer

    Directory of Open Access Journals (Sweden)

    Sushant V Chavan

    2014-01-01

    Full Text Available Background & objectives: Wide variability in serum prostate specific antigen (PSA levels exists in malignant conditions of the prostate. PSA is expressed in normal range in 20 to 25 per cent of prostate cancer cases even in presence of high grade Gleason score. This study was aimed to assess the influence of genetic variants exhibited by PSA and androgen receptor (AR genes towards the variable expression of PSA in prostate cancer. Methods: Pre-treatment serum PSA levels from 101 prostate cancer cases were retrieved from medical record. PSA genotype analysis in promoter region and AR gene microsatellite Cytosine/Adenine/Guanine (CAG repeat analysis in exon 1 region was performed using DNA sequencing and fragment analysis techniques. Results: A total of seven single nucleotide polymorphisms (SNPs in the PSA promoter region were noted. Only two SNPs viz., 158G/A (P<0.001 in the proximal promoter region and -3845G/A (P<0.001 in enhancer region showed significant association with serum PSA levels. The carriers of homozygous GG genotype (P<0.001 at both of these polymorphic sites showed higher expression of PSA whereas homozygous AA genotype (P<0.001 carriers demonstrated lower PSA levels. The combination effect of PSA genotypes along with stratified AR CAG repeats lengths (long, intermediate and short was also studied. The homozygous GG genotype along with AR long CAG repeats and homozygous AA genotype along with AR short CAG repeats at position -3845 and -158 showed strong interaction and thus influenced serum PSA levels. Interpretation & conclusions: The genetic variants exhibited by PSA gene at positions -3845G/A and -158G/A may be accountable towards wide variability of serum PSA levels in prostate cancer. Also the preferential binding of G and A alleles at these polymorphic sites along with AR long and short CAG repeats may contribute towards PSA expression.

  19. Cytotoxic Effects and Androgen Receptor Expression According to Concentrations of Genistein with Silencing Cyclooxygenase–2 Gene Expression in Prostate Cancer Cells

    OpenAIRE

    Kim, Jin Woo; Gotoh, Takafumi; Lim, Hyoun–Sub; Song, Ki Hak; Sul, Chong Koo

    2014-01-01

    COX–2 has major roles in inflammatory reaction, and COX–2 inhibitor and genistein have a chemopreventive effect on some cancers such as colorectal, breast, and prostate cancer (PCa). The aims of this study was to investigate combined effect of COX–2 inhibition and genistein treatment. To address this issue, we tested the degree of cell survival and the changes of androgen receptor in PCa cells with silencing of COX–2 according to concentrations of genistein. DU–145 PCa cells were transfected ...

  20. Recent developments in antiandrogens and selective androgen receptor modulators.

    Science.gov (United States)

    Haendler, Bernard; Cleve, Arwed

    2012-04-16

    The androgens testosterone and dihydrotestosterone play an essential role in the development and maintenance of primary and secondary male characteristics. Androgens bind to a specific androgen receptor (AR), a ligand-dependent transcription factor which controls the expression of a large number of downstream target genes. The AR is an essential player in early and late prostate cancer, and may also be involved in some forms of breast cancer. It also represents a drug target for the treatment of hypogonadism. Recent studies furthermore indicate that targeting the AR in pathologies such as frailty syndrome, cachexia or polycystic ovary syndrome may have clinical benefit. Numerous AR ligands with very different pharmacological properties have been identified in the last 40 years and helped to treat several of these diseases. However, progress still needs to be made in order to find compounds with an improved profile with regard to efficacy, differentiation and side-effects. This will only be achieved through a better understanding of the mechanisms involved in normal and aberrant AR signaling.

  1. Identification and characterization of the minimal androgen-regulated kidney-specific kidney androgen-regulated protein gene promoter

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The kidney androgen-regulated protein (Kap) gene is tissue specific and regulated by androgen in mouse kidney proximal tubule cells (PTCs). In the present study, we aimed to identify the minimal PTC-specific androgen-regulated Kap promoter and analyze its androgen response elements (AREs).Adeletion series of the Kap1542 promoter/luciferase constructs were assayed in opossum kidney (OK) PTCs in the presence or absence of 15 nM dihydrotestosterone (DHT). Kap 1542 and Kap637 had low activity and no androgen induction; Kap224 had a basal activity that was 4- to 5-fold higher than that of Kap 1542, but was only sfightly induced by DHT. Kap 147 had a basal activity that was 2- to 3-fold higher than that of Kap 1542 and was induced by DHT 4- to 6-fold. Kap77 abol-ished basal promoter activity but was still induced by DHT. Results showed that, in vitro, Kap147 was a minimal androgen-regulated promoter. Transient transfection in different cells demonstrated that Kap147 specifically initi-ated reporter gene expression in PTCs. Sequence analysis revealed two potential AREs located at positions -124 and -39 of Kap147. Mutational assays showed that only the ARE at -124 was involved in androgen response in OK cells. Electrophoretic mobility shift assay also verified -124 ARE bound specifically to androgen receptor. In conclusion, we defined the minimal Kap 147 promoter that may be a good model for the study of kidney PTC-specific expression and molecular mechanisms that lead to an androgen-specific responsiveness in vivo.

  2. High dose androgen therapy in male pseudohermaphroditism due to 5 alpha-reductase deficiency and disorders of the androgen receptor.

    OpenAIRE

    Price, P; Wass, J. A.; Griffin, J E; Leshin, M; Savage, M O; Large, D. M.; Bu'Lock, D E; Anderson, D. C.; Wilson, J. D.; Besser, G M

    1984-01-01

    We describe the clinical and biochemical features of six men with male pseudohermaphroditism due to androgen resistance. Each of the subjects had male-gender behavior but incomplete virilization. The underlying defects in androgen metabolism were defined by studies of the 5 alpha-reductase enzyme and the androgen receptor in fibroblasts cultured from biopsies of genital skin. Four of the six have 5 alpha-reductase deficiency, and two have defects of the androgen receptor (the Reifenstein synd...

  3. Functional analysis of novel androgen receptor mutations in a unique cohort of Indonesian patients with a disorder of sex development

    NARCIS (Netherlands)

    P. Elfferich (Peter); A.Z. Juniarto (Achmad); H.J. Dubbink (Erik Jan); M.E. Royen (Martin); M. Molier; J.W. Hoogerbrugge (Jos); A.B. Houtsmuller (Adriaan); J. Trapman (Jan); A. Santosa; F.H. de Jong (Frank); S.L.S. Drop (Stenvert); S.M.H. Faradz (Sultana); H.T. Brüggenwirth (Hennie); A.O. Brinkmann (Albert)

    2009-01-01

    textabstractMutations in the androgen receptor (AR) gene, rendering the AR protein partially or completely inactive, cause androgen insensitivity syndrome, which is a form of a 46,XY disorder of sex development (DSD). We present 3 novel AR variants found in a cohort of Indonesian DSD patients: p.I60

  4. Increased risk of breast cancer in women bearing a combination of large CAG and GGN repeats in the exon 1 of the androgen receptor gene.

    Science.gov (United States)

    González, Ana; Javier Dorta, F; Rodriguez, Germán; Brito, Buenaventura; Rodríguez, M A Del Cristo; Cabrera, Antonio; Díaz-Chico, Juan C; Reyes, Ricardo; Aguirre-Jaime, Armando; Nicolás Díaz-Chico, B

    2007-11-01

    The exon 1 of the human androgen receptor gene (AR) contains both CAG (polyglutamine) and GGN (polyglycine) repeat length polymorphisms. Large CAG repeats have been related to an increased risk of breast cancer (BC), whereas the influence of the GGN repeats is still unclear. Here, we have studied how the length of CAG and GGN repeats is associated with the risk of BC in a population from Tenerife (Canary Islands, Spain). The study was carried out on 257 woman diagnosed with BC and 393 controls, nesting in the 'CDC of the Canary Islands' cohort study. The AR CAG and GGN genotyping was performed by means of PCR amplification with specific fluorescently labelled primers followed by a capillary electrophoresis. The allelic distribution of CAG and GGN polymorphisms was similar in cases and controls. The mean of short and long CAG and GGN alleles did not show differences between cases and controls and the same was true when the average length of both CAG alleles (CAG(n)) and GGN alleles (GGN(n)) was considered. However, when CAG(n) and GGN(n) were categorised using 22 and 24 repeats as the cut-off point, respectively, significant differences between cases and controls were observed. The CAG(n)>22 repeats were more frequent in cases than in controls, being associated with an increased risk of BC (OR=1.49; CI(95%)=1.06-2.09; p=0.021). No significant differences were found for categorised GGN(n). For CAG(n)/GGN(n) combinations, the highest BC risk was found to be associated with the CAG(n)>22/GGN(n)24 combination (OR=2.47; CI(95%)=1.37-4.46; p=0.003). In conclusion, our results indicate that longer CAG(n)/GGN(n) combinations increase the risk of BC and suggest that CAG and GGN AR polymorphisms should be considered in order to assess the BC risk.

  5. CHD8, A Novel Beta-Catenin Associated Chromatin Remodeling Enzyme, Regulates Androgen Receptor Mediated Gene Transcription

    Science.gov (United States)

    2010-03-01

    NP- 40 , Nonidet P - 40 ; PPAR, peroxisome prolif- erator-activated receptor; PSA, prostate-specific antigen; SDS, sodium dodecyl sulfate; siRNA, small... Nonidet P - 40 (NP- 40 ). Cell lysates were cleared by centrifugation at 20,800 g for 10 min at 4 C and used for protein interaction studies as...or therapeutic target in prostate cancer. REFERENCES 1. Mulholland, D. J., Cheng, H., Reid, K., Rennie, P . S., and Nelson, C. C. (2002) J Biol

  6. Androgen-induced cell migration: role of androgen receptor/filamin A association.

    Directory of Open Access Journals (Sweden)

    Gabriella Castoria

    Full Text Available BACKGROUND: Androgen receptor (AR controls male morphogenesis, gametogenesis and prostate growth as well as development of prostate cancer. These findings support a role for AR in cell migration and invasiveness. However, the molecular mechanism involved in AR-mediated cell migration still remains elusive. METHODOLOGY/PRINCIPAL FINDINGS: Mouse embryo NIH3T3 fibroblasts and highly metastatic human fibrosarcoma HT1080 cells harbor low levels of transcriptionally incompetent AR. We now report that, through extra nuclear action, AR triggers migration of both cell types upon stimulation with physiological concentrations of the androgen R1881. We analyzed the initial events leading to androgen-induced cell migration and observed that challenging NIH3T3 cells with 10 nM R1881 rapidly induces interaction of AR with filamin A (FlnA at cytoskeleton. AR/FlnA complex recruits integrin beta 1, thus activating its dependent cascade. Silencing of AR, FlnA and integrin beta 1 shows that this ternary complex controls focal adhesion kinase (FAK, paxillin and Rac, thereby driving cell migration. FAK-null fibroblasts migrate poorly and Rac inhibition by EHT impairs motility of androgen-treated NIH3T3 cells. Interestingly, FAK and Rac activation by androgens are independent of each other. Findings in human fibrosarcoma HT1080 cells strengthen the role of Rac in androgen signaling. The Rac inhibitor significantly impairs androgen-induced migration in these cells. A mutant AR, deleted of the sequence interacting with FlnA, fails to mediate FAK activation and paxillin tyrosine phosphorylation in androgen-stimulated cells, further reinforcing the role of AR/FlnA interaction in androgen-mediated motility. CONCLUSIONS/SIGNIFICANCE: The present report, for the first time, indicates that the extra nuclear AR/FlnA/integrin beta 1 complex is the key by which androgen activates signaling leading to cell migration. Assembly of this ternary complex may control organ development

  7. Selective androgen receptor modulators for frailty and osteoporosis.

    Science.gov (United States)

    Kilbourne, Edward J; Moore, William J; Freedman, Leonard P; Nagpal, Sunil

    2007-10-01

    Androgens play an important role not only in male sexual differentiation, puberty, sexual behavior and spermatogenesis, but also in the maintenance of bone architecture and muscle mass and strength. For decades, steroidal androgens have been used by hypogonadal and aging men as hormone replacement therapy, and abused by prominent athletes as anabolic agents for enhancing physical performance. The use of steroidal androgens is associated with hepatotoxicity, potential for prostate stimulation, virilizing actions and other side effects resulting from their cross-reactivity to related steroid receptors. Therefore, to utilize the therapeutic potential of the androgen receptor for the treatment of indications such as osteoporosis and frailty, several pharmaceutical and biotechnology companies are developing non-steroidal tissue-selective androgen receptor modulators (SARMs) that retain the beneficial properties of natural androgens and exhibit better therapeutic indices. This article reviews the mechanism of androgen action, novel non-steroidal ligands under development and future directions of SARM research for the discovery of novel modulators for frailty and osteoporosis.

  8. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  9. Androgen receptor gene CAG repeat length as modifier of the association between Persistent Organohalogen Pollutant exposure markers and semen characteristics

    DEFF Research Database (Denmark)

    Giwercman, Aleksander; Rylander, Lars; Rignell-Hydbom, Anna;

    2007-01-01

    OBJECTIVES: Exposure to persistent organohalogen pollutants was suggested to impair male reproductive function. A gene-environment interaction has been proposed. No genes modifying the effect of persistent organohalogen pollutants on reproductive organs have yet been identified. We aimed...... and morphology) and DNA fragmentation index (DFI) were determined. CAG and GGN repeat lengths were determined by direct sequencing of leukocyte DNA. RESULTS: A statistically significant interaction was found between the CB-153 group and CAG repeat category in relation to sperm concentration and total sperm count...

  10. N-linked glycosylation supports cross-talk between receptor tyrosine kinases and androgen receptor.

    Directory of Open Access Journals (Sweden)

    Harri M Itkonen

    Full Text Available Prostate cancer is the second most common cause of cancer-associated deaths in men and signalling via a transcription factor called androgen receptor (AR is an important driver of the disease. Androgen treatment is known to affect the expression and activity of other oncogenes including receptor tyrosine kinases (RTKs. In this study we report that AR-positive prostate cancer cell-lines express 50% higher levels of enzymes in the hexosamine biosynthesis pathway (HBP than AR-negative prostate cell-lines. HBP produces hexosamines that are used by endoplasmic reticulum and golgi enzymes to glycosylate proteins targeted to plasma-membrane and secretion. Inhibition of O-linked glycosylation by ST045849 or N-linked glycosylation with tunicamycin decreased cell viability by 20%. In addition, tunicamycin inhibited the androgen-induced expression of AR target genes KLK3 and CaMKK2 by 50%. RTKs have been shown to enhance AR activity and we used an antibody array to identify changes in the phosphorylation status of RTKs in response to androgen stimulation. Hormone treatment increased the activity of Insulin like Growth Factor 1-Receptor (IGF-1R ten-fold and this was associated with a concomitant increase in the N-linked glycosylation of the receptor, analyzed by lectin enrichment experiments. Glycosylation is known to be important for the processing and stability of RTKs. Inhibition of N-linked glycosylation resulted in accumulation of IGF-1R pro-receptor with altered mobility as shown by immunoprecipitation. Confocal imaging revealed that androgen induced plasma-membrane localization of IGF-1R was blocked by tunicamycin. In conclusion we have established that the glycosylation of IGF-1R is necessary for the full activation of the receptor in response to androgen treatment and that perturbing this process can break the feedback loop between AR and IGF-1R activation in prostate cells. Achieving similar results selectively in a clinical setting will be an

  11. Molecular mechanisms of androgen receptor functions

    NARCIS (Netherlands)

    K. Steketee (Karine)

    2007-01-01

    textabstractThe androgens testosterone (T) and dihydrotestosterone (DHT) are steroid hormones, which are necessary for development and maintenance of the functions of the male sex organs, including the prostate. Androgens also play an important role in benign abnormalities of the prostate and in the

  12. Expression of Androgen Receptor in Meningiomas

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    In order to investigate the expression of androgen receptor (AR) in meningiomas and its relation to tumor proliferative potential, we examined the expression of AR and proliferating cell nuclear antigen (PCNA) by avidine-biotin complex immunohistochemistry in 39 cases of meningiomas. Of the 39 cases of meningiomas, 20(51 %) showed positive AR immunoreactivity. The AR expression positivity rates were 31 % (6/19) in benign meningiomas, 58 % (7/12) in atypical meningiomas, 87.5 % (7/8) in malignant meningiomas, respectively. In addition to the tumor cells, cells of microvascular endothelial proliferation were frequently AR positive. Malignant meningiomas had a significantly higher percentage of AR positive cells compared with atypical and benign meningiomas (P<0.05). The mean proliferating cell nuclear antigen labeling index (PCNA LI) was significantly higher in the malignant meningiomas when compared with atypical meningiomas (P<0.05) and benign meningiomas (P<0.05). AR positive meningiomas had higher PCNA LI than AR negative meningiomas (P<0.05). The expression of AR in tumor tissues was significantly related with PCNA LI. These data indicated that AR in the meningiomas was correlated with histological grade and AR might participate in the growth of these tumors and tumor angiogenesis. The measurement of AR in these tumors may indirectly represent tumor growth potential.

  13. Study of Androgen and Androgen Receptor in Relation to Insulin Resistance in Polycystic Ovary Syndrome

    Institute of Scientific and Technical Information of China (English)

    初永丽; 孙永玉; 邱红玉

    2003-01-01

    In order to investigate the relationship between serum testosterone level and expression of androgen receptors in ovary in relation to insulin resistance in polycystic ovary syndrome (PCOS). Serum testosterone levels were determined by radioimmunoassay in 17 patients with PCOS and 20 cases as control group. The expression of androgen receptor in ovary was detected by immunohistochemistry method. The results showed that serum testosterone level [ (3. 1± 1.5) nmol/L] and insulin resistance index (0. 85±0. 49) in patients with PCOS were significantly higher than in control group (P<0. 05), and showed a positive relation (r=0. 65, P<0. 01). The expression levels of androgen receptor in ovary of patients with PCOS were significantly higher than that in control group (P<0.05). The optical density value was positively related with insulin resistance index (r=0.59,P<0. 01). It was concluded that androgen and androgen receptor could accelerate insulin resistance and the interaction of them might aggravate the pathophysiological change in PCOS.

  14. 青少年痤疮患者雄激素受体水平、雄激素受体基因 CAG 多态性的研究%Research on adolescent androgen receptor level in patients with acne,androgen receptor gene CAG polymorphism

    Institute of Scientific and Technical Information of China (English)

    吴波; 邵晓珊; 吴文锦

    2014-01-01

    目的:探讨青少年痤疮患者雄激素受体(A R )水平的变化情况以及患者雄激素受体基因CAG多态性的分布情况。方法选择100例(其中男性50例、女性50例)面部明显痤疮在校高中生作为观察组,再按照1∶1匹配原则选择100例面部无痤疮的在校高中生作为对照组,检查患者外周血雄激素水平、白细胞雄激素受体(AR)以及雄激素受体基因CAG多态性。结果男性和女性痤疮患者其血浆睾酮水平、AR水平比正常对照组均升高,差异具有统计学意义(P<0.05);随着男性痤疮患者其痤疮越严重,其血浆睾酮有所升高,但是差异不具有统计学意义(P>0.05),而不同程度女性痤疮患者其血浆睾酮水平具有统计学意义(P<0.05);随着痤疮患者其痤疮越严重,AR水平有所升高,差异具有统计学意义(P<0.05);痤疮患者携带CAG短片段的比例显著高于对照组携带比例(P<0.05)。结论痤疮发生与发展过程中,雄激素以及雄激素受体增高起着重要的作用,特别对于女性痤疮患者而言,其影响更为显著;携带雄激素受体基因CAG短片段的人群,其患痤疮的危险性更大。%Objective To investigate the adolescent patients with acne androgen receptor (AR) levels and the distribution of androgen receptor gene CAG polymorphism .Methods 100 cases (inclu-ding 50 male and 50 female) the obvious facial acne high school student as the observation group ,1∶1 according to the matching principle to select 100 cases of facial acne free high school students as the control group .Patients were examined for peripheral androgen levels ,androgen receptor (AR) and androgen receptor gene CAG polymorphism .Results The male and female patients with acne and the plasma levels of testosterone ,AR levels were higher than the normal control group ,there were statis-tically significant differences (P0 .05) ,and in pa

  15. Identification of androgen-responsive genes that are alternatively regulated in androgen-dependent and androgen-independent rat prostate tumors.

    NARCIS (Netherlands)

    Pfundt, R.; Smit, F.P.; Jansen, Corine; Aalders, T.W.; Straatman, H.M.P.M.; Vliet, W. van der; Isaacs, J.; Geurts van Kessel, A.H.M.; Schalken, J.A.

    2005-01-01

    The vast majority of androgen-dependent prostate tumors progress toward incurable, androgen-independent tumors. The identification of androgen-responsive genes, which are still actively transcribed in the tumors of patients who have undergone androgen ablation, may shed light on the molecular mechan

  16. No evidence that 2D:4D is related to the number of CAG repeats in the androgen receptor gene

    Directory of Open Access Journals (Sweden)

    Johannes eHönekopp

    2013-12-01

    Full Text Available The length ratio of the second to the fourth digit (2D:4D is a putative marker of prenatal testosterone (T effects. The number of CAG repeats (CAGn in the AR gene is negatively correlated with T sensitivity in vitro. Results regarding the relationship between 2D:4D and CAGn are mixed but have featured prominently in arguments for and against the validity of 2D:4D. Here, I present random-effects meta-analyses on 14 relevant samples with altogether 1,904 subjects. Results were homogeneous across studies. Even liberal estimates (upper limit of the 95% CI were close to zero and therefore suggested no substantial relationship of CAGn with either right-hand 2D:4D, left-hand 2D:4D, or the difference between the two. However, closer analysis of the effects of CAGn on T dependent gene activation in vitro and of relationships between CAGn and T dependent phenotypic characteristics suggest that normal variability of CAGn has mostly no, very small, or inconsistent effects. Therefore, the lack of a clear association between CAGn and 2D:4D has no negative implications for the latter’s validity as a marker of prenatal T effects.

  17. [Bone and Men's Health. Bone selective androgen receptor modulators].

    Science.gov (United States)

    Furuya, Kazuyuki

    2010-02-01

    Androgen, one of the sex steroid hormones shows various biological activities on the corresponding various tissues. Many efforts to produce novel drug materials maintaining a desired biological activity with an adequate tissue selectivity, which is so-called selective androgen receptor modulators (SARMs) , are being performed. As one of such efforts, studies on SARMs against bone tissues which possess a significant potential to stimulate a bone formation with reducing undesirable androgenic virilizing activities are in progress all over the world. This review focuses on the research and development activities of such SARMs and discuses their usefulness for the treatment of osteoporosis.

  18. Detection of androgen receptor in human prostatic adenoma by autoradiography

    Energy Technology Data Exchange (ETDEWEB)

    Demura, Takayoshi; Sakashita, Shigeo; Takamura, Takao; Kuroda, Kazuhide (Asahikawa Medical Coll., Hokkaido (Japan))

    1982-09-01

    We developed a new amplified method to detect the localization of androgen receptors within the human prostatic tissue specimens. The tissue sections were treated with 50 ..mu..l of 100 nM tritiated dihydrotestosterone (/sup 3/H-DHT). The binding of /sup 3/H-DHT to receptors was demonstrated as silver grains on the stained tissue sections. The binding of /sup 3/H-DHT to the prostatic tissue was inhibited by additional non-radioactive DHT remarkably and by testosterone partially, but not affected by additional progesterone and 17..beta..-estradiol. No binding of /sup 3/H-DHT to the bladder tissue was found. These results showed that the binding of /sup 3/H-DHT to the prostatic tissue was a specific reaction of /sup 3/H-DHT and androgen receptor. Androgen receptors were seen in the nuclei and the cytoplasmas of glandular epithelial cells of prostate. However, stromal cells contained less abundant androgen receptors. The method reported here has several advantages in detecting the androgen receptor of the prostatic tissue in comparison with the radioreceptor assay and other histochemical methods. 1) The needle biopsied specimens are big enough to examine. 2) Morphological observations are also possible on the same specimen because the specimens are stained with hematoxylin simultaneously. Therefore, we can know the relative ratio of androgen receptor positive cells and negative cells. 3) Binding of /sup 3/H-DHT to the receptor with this method may be more specific than other histochemical methods, since binding of /sup 3/H-DHT to the receptor was inhibited by 200-fold excess of non-radioactive DHT. 4) Treatment of scintillator, fluorographic technique shortens the exposure periods. The exposure periods are approximately six to twelve times shorter than that of the conventional autoradiography.

  19. Alternative splicing of the androgen receptor in polycystic ovary syndrome

    OpenAIRE

    Wang, Fangfang; Pan, Jiexue; Liu, Ye; Meng, Qing; Lv, Pingping; Qu, Fan; Ding, Guo-Lian; Klausen, Christian; Leung, Peter C. K.; Chan, Hsiao Chang; Yao, Weimiao; Zhou, Cai-Yun; Shi, Biwei; ZHANG, JUNYU; Sheng, Jianzhong

    2015-01-01

    Excess androgens and abnormal follicle development, largely due to ovarian granulosa cell (GC) dysfunction, characterize polycystic ovary syndrome (PCOS), a common endocrinopathy of women predisposing to infertility. Thus, it is important to understand GC dysfunction. The androgen receptor (AR) is widely believed to be an essential regulator of GC biology. High expression of AR in GCs is primarily considered to associate with PCOS. However, we show that AR alternative splice variants in GCs d...

  20. Research Resource: Androgen Receptor Activity Is Regulated Through the Mobilization of Cell Surface Receptor Networks.

    Science.gov (United States)

    Hsiao, Jordy J; Ng, Brandon H; Smits, Melinda M; Martinez, Harryl D; Jasavala, Rohini J; Hinkson, Izumi V; Fermin, Damian; Eng, Jimmy K; Nesvizhskii, Alexey I; Wright, Michael E

    2015-08-01

    The aberrant expression of androgen receptor (AR)-dependent transcriptional programs is a defining pathology of the development and progression of prostate cancers. Transcriptional cofactors that bind AR are critical determinants of prostate tumorigenesis. To gain a deeper understanding of the proteins linked to AR-dependent gene transcription, we performed a DNA-affinity chromatography-based proteomic screen designed to identify proteins involved in AR-mediated gene transcription in prostate tumor cells. Functional experiments validated the coregulator roles of known AR-binding proteins in AR-mediated transcription in prostate tumor cells. More importantly, novel coregulatory functions were detected in components of well-established cell surface receptor-dependent signal transduction pathways. Further experimentation demonstrated that components of the TNF, TGF-β, IL receptor, and epidermal growth factor signaling pathways modulated AR-dependent gene transcription and androgen-dependent proliferation in prostate tumor cells. Collectively, our proteomic dataset demonstrates that the cell surface receptor- and AR-dependent pathways are highly integrated, and provides a molecular framework for understanding how disparate signal-transduction pathways can influence AR-dependent transcriptional programs linked to the development and progression of human prostate cancers.

  1. Androgen receptor: structure, role in prostate cancer and drug discovery.

    Science.gov (United States)

    Tan, M H Eileen; Li, Jun; Xu, H Eric; Melcher, Karsten; Yong, Eu-leong

    2015-01-01

    Androgens and androgen receptors (AR) play a pivotal role in expression of the male phenotype. Several diseases, such as androgen insensitivity syndrome (AIS) and prostate cancer, are associated with alterations in AR functions. Indeed, androgen blockade by drugs that prevent the production of androgens and/or block the action of the AR inhibits prostate cancer growth. However, resistance to these drugs often occurs after 2-3 years as the patients develop castration-resistant prostate cancer (CRPC). In CRPC, a functional AR remains a key regulator. Early studies focused on the functional domains of the AR and its crucial role in the pathology. The elucidation of the structures of the AR DNA binding domain (DBD) and ligand binding domain (LBD) provides a new framework for understanding the functions of this receptor and leads to the development of rational drug design for the treatment of prostate cancer. An overview of androgen receptor structure and activity, its actions in prostate cancer, and how structural information and high-throughput screening have been or can be used for drug discovery are provided herein.

  2. Antiandrogens prevent stable DNA-binding of the androgen receptor

    NARCIS (Netherlands)

    P. Farla; R. Hersmus (Remko); J. Trapman (Jan); A.B. Houtsmuller (Adriaan)

    2005-01-01

    textabstractThe androgen receptor (AR) is essential for development of the male gender and in the growth of the majority of prostate cancers. Agonists as well as most antagonists induce translocation of the receptor to the nucleus, whereas only agonists can activate AR function. An

  3. Functional characterisation of a natural androgen receptor missense mutation (N771H) causing human androgen insensitivity syndrome.

    Science.gov (United States)

    Cai, J; Cai, L-Q; Hong, Y; Zhu, Y-S

    2012-05-01

    Androgen insensitivity syndrome (AIS) is an X-linked disorder due to mutations of androgen receptor (AR) gene. Various AR mutations have been identified, and the characterisation of these mutations greatly facilitates our understanding of AR structure-function. In this study, we have analysed an AR missense mutation (N771H) identified in patients with AIS. Functional analysis of the mutant AR was performed by in vitro mutagenesis-cotransfection assays. Compared to the wild-type AR, the dose-response curve of dihydrotestosterone-induced transactivation activity in the mutant AR was greatly shifted to the right and significantly decreased. However, the maximal efficacy of transactivation activity in the mutant AR was similar to that of the wild type. Receptor binding assay indicated that the mutant AR had an approximately 2.5-fold lower binding affinity to dihydrotestosterone compared to the wild type. Western blot analysis showed that the size and the expression level of mutant AR in transfected cells were comparable to the wild type. These data underscore the importance of asparagine at amino acid position 771 of human AR in normal ligand binding and normal receptor function, and a mutation at this position results in androgen insensitivity in affected subjects.

  4. Androgen receptor signaling is required for androgen-sensitive human prostate cancer cell proliferation and survival

    Directory of Open Access Journals (Sweden)

    Day Wanda V

    2005-04-01

    Full Text Available Abstract Background Androgens and androgen receptors (AR regulate normal prostate development and growth. They also are involved in pathological development of prostatic diseases, including benign prostatic hyperplasia (BPH and prostate cancer (PCa. Antiandrogen therapy for PCa, in conjunction with chemical or surgical castration, offers initial positive responses and leads to massive prostate cell death. However, cancer cells later appear as androgen-independent PCa. To investigate the role of AR in prostate cell proliferation and survival, we introduced a vector-based small interfering RNA (siRNA. This siRNA targeted 5'-untranslated region of AR mRNA for extended suppression of AR expression in androgen-sensitive human prostate LNCaP cells. Results The siRNA design successfully suppressed endogenous AR expression, as revealed by western blotting and immunofluorescence staining in LNCaP cells. LNCaP cells did not proliferate in the absence of AR and underwent apoptosis, based on elevated phospho-Histone H2B expression and higher number of apoptotic body as compared to control cells. Conclusion We demonstrated that AR is vital for prostate cell proliferation and survival in this androgen-sensitive prostate cell line. These results further strengthen the hypothesis that AR can be a therapeutic target for treating androgen-sensitive stages of PCa. Unlike antiandorgens, however, siRNA targeting AR provides a direct inactivation of AR function through the suppression of AR protein expression.

  5. Identification of an anabolic selective androgen receptor modulator that actively induces death of androgen-independent prostate cancer cells.

    Science.gov (United States)

    Schmidt, Azriel; Meissner, Robert S; Gentile, Michael A; Chisamore, Michael J; Opas, Evan E; Scafonas, Angela; Cusick, Tara E; Gambone, Carlo; Pennypacker, Brenda; Hodor, Paul; Perkins, James J; Bai, Chang; Ferraro, Damien; Bettoun, David J; Wilkinson, Hilary A; Alves, Stephen E; Flores, Osvaldo; Ray, William J

    2014-09-01

    Prostate cancer (PCa) initially responds to inhibition of androgen receptor (AR) signaling, but inevitably progresses to hormone ablation-resistant disease. Much effort is focused on optimizing this androgen deprivation strategy by improving hormone depletion and AR antagonism. However we found that bicalutamide, a clinically used antiandrogen, actually resembles a selective AR modulator (SARM), as it partially regulates 24% of endogenously 5α-dihydrotestosterone (DHT)-responsive genes in AR(+) MDA-MB-453 breast cancer cells. These data suggested that passive blocking of all AR functions is not required for PCa therapy. Hence, we adopted an active strategy that calls for the development of novel SARMs, which induce a unique gene expression profile that is intolerable to PCa cells. Therefore, we screened 3000 SARMs for the ability to arrest the androgen-independent growth of AR(+) 22Rv1 and LNCaP PCa cells but not AR(-) PC3 or DU145 cells. We identified only one such compound; the 4-aza-steroid, MK-4541, a potent and selective SARM. MK-4541 induces caspase-3 activity and cell death in both androgen-independent, AR(+) PCa cell lines but spares AR(-) cells or AR(+) non-PCa cells. This activity correlates with its promoter context- and cell-type dependent transcriptional effects. In rats, MK-4541 inhibits the trophic effects of DHT on the prostate, but not the levator ani muscle, and triggers an anabolic response in the periosteal compartment of bone. Therefore, MK-4541 has the potential to effectively manage prostatic hypertrophic diseases owing to its antitumor SARM-like mechanism, while simultaneously maintaining the anabolic benefits of natural androgens.

  6. Deoxyribonucleic acid-binding ability of androgen receptors in whole cells: implications for the actions of androgens and antiandrogens

    NARCIS (Netherlands)

    C.W. Kuil (Cor); E. Mulder (Eppo)

    1996-01-01

    textabstractIn whole cells, the effects of several androgens and antiandrogens on the in the induction of DNA binding for the human wild-type androgen receptor (AR) and a mutant receptor ARL (LNCaP mutation; codon 868, Thr to Ala) were examined and related to the transc

  7. Optimizing Ligand Efficiency of Selective Androgen Receptor Modulators (SARMs).

    Science.gov (United States)

    Handlon, Anthony L; Schaller, Lee T; Leesnitzer, Lisa M; Merrihew, Raymond V; Poole, Chuck; Ulrich, John C; Wilson, Joseph W; Cadilla, Rodolfo; Turnbull, Philip

    2016-01-14

    A series of selective androgen receptor modulators (SARMs) containing the 1-(trifluoromethyl)benzyl alcohol core have been optimized for androgen receptor (AR) potency and drug-like properties. We have taken advantage of the lipophilic ligand efficiency (LLE) parameter as a guide to interpret the effect of structural changes on AR activity. Over the course of optimization efforts the LLE increased over 3 log units leading to a SARM 43 with nanomolar potency, good aqueous kinetic solubility (>700 μM), and high oral bioavailability in rats (83%).

  8. Identification and characterisation of an androgen receptor from zebrafish Danio rerio

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Andersen, Ole; Bjerregaard, Poul

    2007-01-01

    Androgens play key roles in vertebrate sex differentiation, gonadal differentiation and sexual behaviour. The action of androgens is primarily mediated through androgen receptors (ARs). The present study describes the isolation, sequencing and initial characterisation of an androgen receptor from...... to determine Kd for the zfARd12. The characterisation of this zfAR provides a new perspective for understanding the mechanisms underlying androgen actions in a model vertebrate species commonly used for studies investigating potential endocrine disrupters.......Androgens play key roles in vertebrate sex differentiation, gonadal differentiation and sexual behaviour. The action of androgens is primarily mediated through androgen receptors (ARs). The present study describes the isolation, sequencing and initial characterisation of an androgen receptor from...

  9. Gene expression profile of androgen modulated genes in the murine fetal developing lung

    Directory of Open Access Journals (Sweden)

    Côté Mélissa

    2010-01-01

    Full Text Available Abstract Background Accumulating evidences suggest that sex affects lung development. Indeed, a higher incidence of respiratory distress syndrome is observed in male compared to female preterm neonates at comparable developmental stage and experimental studies demonstrated an androgen-related delay in male lung maturation. However, the precise mechanisms underlying these deleterious effects of androgens in lung maturation are only partially understood. Methods To build up a better understanding of the effect of androgens on lung development, we analyzed by microarrays the expression of genes showing a sexual difference and those modulated by androgens. Lungs of murine fetuses resulting from a timely mating window of 1 hour were studied at gestational day 17 (GD17 and GD18, corresponding to the period of surge of surfactant production. Using injections of the antiandrogen flutamide to pregnant mice, we hunted for genes in fetal lungs which are transcriptionally modulated by androgens. Results Results revealed that 1844 genes were expressed with a sexual difference at GD17 and 833 at GD18. Many genes were significantly modulated by flutamide: 1597 at GD17 and 1775 at GD18. Datasets were analyzed by using in silico tools for reconstruction of cellular pathways. Between GD17 and GD18, male lungs showed an intensive transcriptional activity of proliferative pathways along with the onset of lung differentiation. Among the genes showing a sex difference or an antiandrogen modulation of their expression, we specifically identified androgen receptor interacting genes, surfactant related genes in particularly those involved in the pathway leading to phospholipid synthesis, and several genes of lung development regulator pathways. Among these latter, some genes related to Shh, FGF, TGF-beta, BMP, and Wnt signaling are modulated by sex and/or antiandrogen treatment. Conclusion Our results show clearly that there is a real delay in lung maturation between

  10. Vocal area-related expression of the androgen receptor in the budgerigar (Melopsittacus undulatus) brain.

    Science.gov (United States)

    Matsunaga, Eiji; Okanoya, Kazuo

    2008-05-01

    The androgen receptor is a steroid hormone receptor widely expressed in the vocal control nuclei in songbirds. Here, we analysed androgen receptor expression in the brains of juvenile and adult budgerigars. With a species-specific probe for budgerigar androgen receptor mRNA, we found that the androgen receptor was expressed in the vocal areas, such as the central nucleus of the lateral nidopallium, the anterior arcopallium, the oval nucleus of the mesopallium, the oval nucleus of the anterior nidopallium and the tracheosyringeal hypoglossal nucleus. With the present data, together with previous reports, it turned out that the androgen receptor expression in telencephalic vocal control areas is similar amongst three groups of vocal learners--songbirds, hummingbirds and parrots, suggesting the possibility that the androgen receptor might play a role in vocal development and that the molecular mechanism regulating the androgen receptor expression in the vocal areas might be important in the evolution of vocal learning.

  11. Design and synthesis of an array of selective androgen receptor modulators.

    Science.gov (United States)

    Trump, Ryan P; Blanc, Jean-Baptiste E; Stewart, Eugene L; Brown, Peter J; Caivano, Matilde; Gray, David W; Hoekstra, William J; Willson, Timothy M; Han, Bajin; Turnbull, Philip

    2007-01-01

    We describe the design, using shape comparison and fast docking computer algorithms, and rapid parallel synthesis of a 1300 member array based on GSK7721, a 4-aminobenzonitrile androgen receptor (AR) antagonist identified by focused screening of the GSK compound collection. The array yielded 352 submicromolar and 17 subnanomolar AR agonists as measured by a cell-based reporter gene functional assay. The rapid synthesis of a large number of active compounds provided valuable information in the optimization of AR modulators, which may be useful in treating androgen deficiency in aging males.

  12. Identification of Androgen Receptor-Specific Enhancer RNAs

    Science.gov (United States)

    2016-06-01

    AND SUBTITLE Identification of Androgen Receptor-Specific Enhancer RNAs 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-15-1-0120 5c. PROGRAM ELEMENT ...interesting eRNAs and their sequences are shown below. AR-eRNA-#1 ( 117 bp

  13. The Biological and Clinical Significance of Androgen Receptor Variants

    Science.gov (United States)

    2014-04-01

    3. Guo Z, Yang X, Sun F et al: A novel androgen receptor splice variant is up-regulated during prostate cancer progression and promotes andro ...prognostic of bio- chemical recurrence in multiple cohorts. Br J Cancer 201 0; 102: 570, 23. Haffner MC, Aryee MJ, Toubaji A et al : Andro - gen

  14. Up-Regulation of Hepatic Alpha-2-HS-Glycoprotein Transcription by Testosterone via Androgen Receptor Activation

    Directory of Open Access Journals (Sweden)

    Jakob Voelkl

    2014-06-01

    Full Text Available Background/Aims: Fetuin-A (alpha-2-HS-glycoprotein, AHSG, a liver borne plasma protein, contributes to the prevention of soft tissue calcification, modulates inflammation, reduces insulin sensitivity and fosters weight gain following high fat diet or ageing. In polycystic ovary syndrome, fetuin-A levels correlate with free androgen levels, an observation pointing to androgen sensitivity of fetuin-A expression. The present study thus explored whether the expression of hepatic fetuin-A is modified by testosterone. Methods: HepG2 cells were treated with testosterone and androgen receptor antagonist flutamide, and were silenced with androgen receptor siRNA. To test the in vivo relevance, male mice were subjected to androgen deprivation therapy (ADT for 7 weeks. AHSG mRNA levels were determined by quantitative RT-PCR and fetuin-A protein abundance by Western blotting. Results: In HepG2 cells, AHSG mRNA expression and fetuin-A protein abundance were both up-regulated following testosterone treatment. The human alpha-2-HS-glycoprotein gene harbors putative androgen receptor response elements in the proximal 5 kb promoter sequence relative to TSS. The effect of testosterone on AHSG mRNA levels was abrogated by silencing of the androgen receptor in HepG2 cells. Moreover, treatment of HepG2 cells with the androgen receptor antagonist flutamide in presence of endogenous ligands in the medium significantly down-regulated AHSG mRNA expression and fetuin-A protein abundance. In addition, ADT of male mice was followed by a significant decrease of hepatic Ahsg mRNA expression and fetuin-A protein levels. Conclusions: Testosterone participates in the regulation of hepatic fetuin-A expression, an effect mediated, at least partially, by androgen receptor activation.

  15. Mental rotation in intellectually gifted boys is affected by the androgen receptor CAG repeat polymorphism.

    Science.gov (United States)

    Durdiaková, Jaroslava; Lakatošová, Silvia; Kubranská, Aneta; Laznibatová, Jolana; Ficek, Andrej; Ostatníková, Daniela; Celec, Peter

    2013-08-01

    Testosterone was shown to organize brain and modulate cognitive functions. It is currently unknown whether mental rotation is also associated with prenatal testosterone exposure and testosterone-related genetic polymorphisms. The aim of our study was to analyze associations between mental rotation performance, the actual testosterone levels, the prenatal testosterone level (expressed as 2D:4D ratio) and the androgen receptor CAG repeat polymorphism in intellectually gifted boys. One hundred forty-seven boys aged 10-18 years with IQ>130 were enrolled. Saliva samples were collected and used for ELISA of actual levels of salivary testosterone. The 2D:4D finger length ratio as an indicator of prenatal testosterone was measured on both hands and averaged. Amthauer mental rotation test was used for the assessment of this spatial ability. The CAG repeat polymorphism in the androgen receptor gene was analyzed using PCR and capillary electrophoresis. Linear regression revealed that 2D:4D finger length ratio and the number of CAG repeats in the androgen receptor gene were associated with mental rotation. Actual levels of testosterone did not correlate significantly with mental rotation. Multivariate analysis of covariance revealed that after adjustment of age as a confounding variable, only the effect of the genetic polymorphism was significant. The results are in line with our previous genetic analysis of intellectually gifted boys showing the importance of CAG repeat polymorphism in the androgen receptor gene. Details of the interactions between androgen signaling, testosterone levels and its metabolism especially during the prenatal development of brain function remain to be elucidated.

  16. Identification of anabolic selective androgen receptor modulators with reduced activities in reproductive tissues and sebaceous glands.

    Science.gov (United States)

    Schmidt, Azriel; Harada, Shun-Ichi; Kimmel, Donald B; Bai, Chang; Chen, Fang; Rutledge, Su Jane; Vogel, Robert L; Scafonas, Angela; Gentile, Michael A; Nantermet, Pascale V; McElwee-Witmer, Sheila; Pennypacker, Brenda; Masarachia, Patricia; Sahoo, Soumya P; Kim, Yuntae; Meissner, Robert S; Hartman, George D; Duggan, Mark E; Rodan, Gideon A; Towler, Dwight A; Ray, William J

    2009-12-25

    Androgen replacement therapy is a promising strategy for the treatment of frailty; however, androgens pose risks for unwanted effects including virilization and hypertrophy of reproductive organs. Selective Androgen Receptor Modulators (SARMs) retain the anabolic properties of androgens in bone and muscle while having reduced effects in other tissues. We describe two structurally similar 4-aza-steroidal androgen receptor (AR) ligands, Cl-4AS-1, a full agonist, and TFM-4AS-1, which is a SARM. TFM-4AS-1 is a potent AR ligand (IC(50), 38 nm) that partially activates an AR-dependent MMTV promoter (55% of maximal response) while antagonizing the N-terminal/C-terminal interaction within AR that is required for full receptor activation. Microarray analyses of MDA-MB-453 cells show that whereas Cl-4AS-1 behaves like 5alpha-dihydrotestosterone (DHT), TFM-4AS-1 acts as a gene-selective agonist, inducing some genes as effectively as DHT and others to a lesser extent or not at all. This gene-selective agonism manifests as tissue-selectivity: in ovariectomized rats, Cl-4AS-1 mimics DHT while TFM-4AS-1 promotes the accrual of bone and muscle mass while having reduced effects on reproductive organs and sebaceous glands. Moreover, TFM-4AS-1 does not promote prostate growth and antagonizes DHT in seminal vesicles. To confirm that the biochemical properties of TFM-4AS-1 confer tissue selectivity, we identified a structurally unrelated compound, FTBU-1, with partial agonist activity coupled with antagonism of the N-terminal/C-terminal interaction and found that it also behaves as a SARM. TFM-4AS-1 and FTBU-1 represent two new classes of SARMs and will allow for comparative studies aimed at understanding the biophysical and physiological basis of tissue-selective effects of nuclear receptor ligands.

  17. Androgen suppresses the proliferation of androgen receptor-positive castration-resistant prostate cancer cells via inhibition of Cdk2, CyclinA, and Skp2.

    Directory of Open Access Journals (Sweden)

    John M Kokontis

    Full Text Available The majority of prostate cancer (PCa patient receiving androgen ablation therapy eventually develop castration-resistant prostate cancer (CRPC. We previously reported that androgen treatment suppresses Skp2 and c-Myc through androgen receptor (AR and induced G1 cell cycle arrest in androgen-independent LNCaP 104-R2 cells, a late stage CRPC cell line model. However, the mechanism of androgenic regulation of Skp2 in CRPC cells was not fully understood. In this study, we investigated the androgenic regulation of Skp2 in two AR-positive CRPC cell line models, the LNCaP 104-R1 and PC-3AR Cells. The former one is an early stage androgen-independent LNCaP cells, while the later one is PC-3 cells re-expressing either wild type AR or mutant LNCaP AR. Proliferation of LNCaP 104-R1 and PC-3AR cells is not dependent on but is suppressed by androgen. We observed in this study that androgen treatment reduced protein expression of Cdk2, Cdk7, Cyclin A, cyclin H, Skp2, c-Myc, and E2F-1; lessened phosphorylation of Thr14, Tyr15, and Thr160 on Cdk2; decreased activity of Cdk2; induced protein level of p27(Kip1; and caused G1 cell cycle arrest in LNCaP 104-R1 cells and PC-3AR cells. Overexpression of Skp2 protein in LNCaP 104-R1 or PC-3AR cells partially blocked accumulation of p27(Kip1 and increased Cdk2 activity under androgen treatment, which partially blocked the androgenic suppressive effects on proliferation and cell cycle. Analyzing on-line gene array data of 214 normal and PCa samples indicated that gene expression of Skp2, Cdk2, and cyclin A positively correlates to each other, while Cdk7 negatively correlates to these genes. These observations suggested that androgen suppresses the proliferation of CRPC cells partially through inhibition of Cyclin A, Cdk2, and Skp2.

  18. Androgen suppresses the proliferation of androgen receptor-positive castration-resistant prostate cancer cells via inhibition of Cdk2, CyclinA, and Skp2.

    Science.gov (United States)

    Kokontis, John M; Lin, Hui-Ping; Jiang, Shih Sheng; Lin, Ching-Yu; Fukuchi, Junichi; Hiipakka, Richard A; Chung, Chi-Jung; Chan, Tzu-Min; Liao, Shutsung; Chang, Chung-Ho; Chuu, Chih-Pin

    2014-01-01

    The majority of prostate cancer (PCa) patient receiving androgen ablation therapy eventually develop castration-resistant prostate cancer (CRPC). We previously reported that androgen treatment suppresses Skp2 and c-Myc through androgen receptor (AR) and induced G1 cell cycle arrest in androgen-independent LNCaP 104-R2 cells, a late stage CRPC cell line model. However, the mechanism of androgenic regulation of Skp2 in CRPC cells was not fully understood. In this study, we investigated the androgenic regulation of Skp2 in two AR-positive CRPC cell line models, the LNCaP 104-R1 and PC-3AR Cells. The former one is an early stage androgen-independent LNCaP cells, while the later one is PC-3 cells re-expressing either wild type AR or mutant LNCaP AR. Proliferation of LNCaP 104-R1 and PC-3AR cells is not dependent on but is suppressed by androgen. We observed in this study that androgen treatment reduced protein expression of Cdk2, Cdk7, Cyclin A, cyclin H, Skp2, c-Myc, and E2F-1; lessened phosphorylation of Thr14, Tyr15, and Thr160 on Cdk2; decreased activity of Cdk2; induced protein level of p27(Kip1); and caused G1 cell cycle arrest in LNCaP 104-R1 cells and PC-3AR cells. Overexpression of Skp2 protein in LNCaP 104-R1 or PC-3AR cells partially blocked accumulation of p27(Kip1) and increased Cdk2 activity under androgen treatment, which partially blocked the androgenic suppressive effects on proliferation and cell cycle. Analyzing on-line gene array data of 214 normal and PCa samples indicated that gene expression of Skp2, Cdk2, and cyclin A positively correlates to each other, while Cdk7 negatively correlates to these genes. These observations suggested that androgen suppresses the proliferation of CRPC cells partially through inhibition of Cyclin A, Cdk2, and Skp2.

  19. 完全型雄激素不敏感综合征雄激素受体基因突变的鉴定与分析%Identification of a novel frameshift mutation of human androgen receptor gene in a patient featuring complete androgen insensitivity syndrome

    Institute of Scientific and Technical Information of China (English)

    谢建红; 瞿京辉; 肖奇志; 周玉球

    2013-01-01

    目的 对l例完全型雄激素不敏感综合征(complete androgen insensitivity syndrome,CAIS)患者的雄激素受体(androgen receptor,AR)基因进行分析,寻找潜在的突变位点,并进一步分析其发病原因.方法 提取患者外周血全基因组DNA,扩增位于X染色体AR基因8个外显子及邻近外显子与内含子剪切位点DNA序列,对扩增产物直接进行DNA序列测定,与GenBank中的基因序列进行比对.结果 该患者AR基因在第6外显子核苷酸序列3507位点缺失一个碱基C而引起移码突变,致使在第808位密码子出现终止密码子(TGA)使得翻译提前终止形成截短的雄激素受体蛋白.该突变可能诱导雄激素受体结合能力发生功能上的变异,导致CAIS的发生.结论 AR基因第6外显子核苷酸序列3507位点缺失碱基C引起的移码突变是一种导致CAIS新的基因突变方式,该研究丰富了AR基因突变谱,为了解CAIS的发病机制提供了新的依据.%Objective To identify potential mutation of human androgen receptor (AR) gene in a patient with complete androgen insensitivity syndrome (CAIS).Methods DNA sequences of 8 exons and exon/intron boundaries of the AR gene were amplified with PCR and directly sequenced.Results DNA sequencing revealed a frameshift mutation due to deletion of nucleotide C at position 3507 in exon 6,which gave rise to a stop codon resulting premature termination for translation.Conclusion A novel frameshift mutation in exon 6 of AR gene probably underlies the disease in our patient.

  20. Crosstalk between androgen and pro-inflammatory signaling remodels androgen receptor and NF-κB cistrome to reprogram the prostate cancer cell transcriptome

    Science.gov (United States)

    Malinen, Marjo; Niskanen, Einari A.; Kaikkonen, Minna U.; Palvimo, Jorma J.

    2017-01-01

    Inflammatory processes and androgen signaling are critical for the growth of prostate cancer (PC), the most common cancer among males in Western countries. To understand the importance of potential interplay between pro-inflammatory and androgen signaling for gene regulation, we have interrogated the crosstalk between androgen receptor (AR) and NF-κB, a key transcriptional mediator of inflammatory responses, by utilizing genome-wide chromatin immunoprecipitation sequencing and global run-on sequencing in PC cells. Co-stimulation of LNCaP cells with androgen and pro-inflammatory cytokine TNFα invoked a transcriptome which was very distinct from that induced by either stimulation alone. The altered transcriptome that included gene programs linked to cell migration and invasiveness was orchestrated by significant remodeling of NF-κB and AR cistrome and enhancer landscape. Although androgen multiplied the NF-κB cistrome and TNFα restrained the AR cistrome, there was no general reciprocal tethering of the AR to the NF-κB on chromatin. Instead, redistribution of FOXA1, PIAS1 and PIAS2 contributed to the exposure of latent NF-κB chromatin-binding sites and masking of AR chromatin-binding sites. Taken together, concomitant androgen and pro-inflammatory signaling significantly remodels especially the NF-κB cistrome, reprogramming the PC cell transcriptome in fashion that may contribute to the progression of PC. PMID:27672034

  1. Synthetic anabolic agents: steroids and nonsteroidal selective androgen receptor modulators.

    Science.gov (United States)

    Thevis, Mario; Schänzer, Wilhelm

    2010-01-01

    The central role of testosterone in the development of male characteristics, as well as its beneficial effects on physical performance and muscle growth, has led to the search for synthetic alternatives with improved pharmacological profiles. Hundreds of steroidal analogs have been prepared with a superior oral bioavailability, which should also possess reduced undesirable effects. However, only a few entered the pharmaceutical market due to severe toxicological incidences that were mainly attributed to the lack of tissue selectivity. Prominent representatives of anabolic-androgenic steroids (AAS) are for instance methyltestosterone, metandienone and stanozolol, which are discussed as model compounds with regard to general pharmacological aspects of synthetic AAS. Recently, nonsteroidal alternatives to AAS have been developed that selectively activate the androgen receptor in either muscle tissue or bones. These so-called selective androgen receptor modulators (SARMs) are currently undergoing late clinical trials (IIb) and will be prohibited by the World Anti-Doping Agency from January 2008. Their entirely synthetic structures are barely related to steroids, but particular functional groups allow for the tissue-selective activation or inhibition of androgen receptors and, thus, the stimulation of muscle growth without the risk of severe undesirable effects commonly observed in steroid replacement therapies. Hence, these compounds possess a high potential for misuse in sports and will be the subject of future doping control assays.

  2. Testosterone regulates keratin 33B expression in rat penis growth through androgen receptor signaling.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Dang, Qiang; Shi, Qi; Gao, Yang; Guo, Peng; Xu, Shan; Wang, Xin-Yang; He, Da-Lin; Gong, Yong-Guang

    2014-01-01

    Androgen therapy is the mainstay of treatment for the hypogonadotropic hypogonadal micropenis because it obviously enhances penis growth in prepubescent microphallic patients. However, the molecular mechanisms of androgen treatment leading to penis growth are still largely unknown. To clarify this well-known phenomenon, we successfully generated a castrated male Sprague Dawley rat model at puberty followed by testosterone administration. Interestingly, compared with the control group, testosterone treatment stimulated a dose-dependent increase of penis weight, length, and width in castrated rats accompanied with a dramatic recovery of the pathological changes of the penis. Mechanistically, testosterone administration substantially increased the expression of androgen receptor (AR) protein. Increased AR protein in the penis could subsequently initiate transcription of its target genes, including keratin 33B (Krt33b). Importantly, we demonstrated that KRT33B is generally expressed in the rat penis and that most KRT33B expression is cytoplasmic. Furthermore, AR could directly modulate its expression by binding to a putative androgen response element sequence of the Krt33b promoter. Overall, this study reveals a novel mechanism facilitating penis growth after testosterone treatment in precastrated prepubescent animals, in which androgen enhances the expression of AR protein as well as its target genes, such as Krt33b.

  3. Design, Synthesis, and Preclinical Characterization of the Selective Androgen Receptor Modulator (SARM) RAD140.

    Science.gov (United States)

    Miller, Chris P; Shomali, Maysoun; Lyttle, C Richard; O'Dea, Louis St L; Herendeen, Hillary; Gallacher, Kyla; Paquin, Dottie; Compton, Dennis R; Sahoo, Bishwabhusan; Kerrigan, Sean A; Burge, Matthew S; Nickels, Michael; Green, Jennifer L; Katzenellenbogen, John A; Tchesnokov, Alexei; Hattersley, Gary

    2011-02-10

    This report describes the discovery of RAD140, a potent, orally bioavailable, nonsteroidal selective androgen receptor modulator (SARM). The characterization of RAD140 in several preclinical models of anabolic androgen action is also described.

  4. Functional analysis of a novel androgen receptor mutation, Q902K, in an individual with partial androgen insensitivity.

    NARCIS (Netherlands)

    A. Umar (Arzu); C.A. Berrevoets (Cor); N.M. Van (Mai); M. van Leeuwen (Marije); M.M.P.J. Verbiest (Michael); W.J. Kleijer (Wim); D. Dooijes (Dennis); J.A. Grootegoed (Anton); S.L.S. Drop (Stenvert); A.O. Brinkmann (Albert)

    2005-01-01

    textabstractAndrogen insensitivity syndrome (AIS) is caused by defects in the androgen receptor (AR) that render the AR partially or completely inactive. As a result, embryonic sex differentiation is impaired. Here, we describe a novel mutation in the AR found in a patient with par

  5. Red Maca (Lepidium meyenii) did not affect cell viability despite increased androgen receptor and prostate-specific antigen gene expression in the human prostate cancer cell line LNCaP.

    Science.gov (United States)

    Díaz, P; Cardenas, H; Orihuela, P A

    2016-10-01

    We examined whether aqueous extract of Lepidium meyenii (red Maca) could inhibit growth, potentiate apoptotic activity of two anticancer drugs Taxol and 2-methoxyestradiol (2ME) or change mRNA expression for the androgen target genes, androgen receptor (Ar) and prostate-specific antigen (Psa) in the human prostate cancer cell line LNCaP. Red Maca aqueous extract at 0, 10, 20, 40 or 80 μg/ml was added to LNCaP cells, and viability was evaluated by the MTS assay at 24 or 48 hr after treatment. Furthermore, LNCaP cells were treated with 80 μg/ml of red Maca plus Taxol or 2ME 5 μM and viability was assessed 48 hr later. Finally, LNCaP cells were treated with red Maca 0, 20, 40 or 80 μg/ml, and 12 hr later, mRNA level for Ar or Psa was assessed by real-time PCR. Treatment with red Maca did not affect viability of LNCaP cells. Apoptotic activity induced by Taxol and 2ME in LNCaP cells was not altered with red Maca treatment. Relative expression of the mRNA for Ar and Psa increased with red Maca 20 and 40 μg/ml, but not at 80 μg/ml. We conclude that red Maca aqueous extract does not have toxic effects, but stimulates androgen signalling in LNCaP cells.

  6. A physiological role for androgen actions in the absence of androgen receptor DNA binding activity.

    Science.gov (United States)

    Pang, Tammy P S; Clarke, Michele V; Ghasem-Zadeh, Ali; Lee, Nicole K L; Davey, Rachel A; MacLean, Helen E

    2012-01-01

    We tested the hypothesis that androgens have physiological actions via non-DNA binding-dependent androgen receptor (AR) signaling pathways in males, using our genetically modified mice that express a mutant AR with deletion of the 2nd zinc finger of the DNA binding domain (AR(ΔZF2)) that cannot bind DNA. In cultured genital skin fibroblasts, the mutant AR(ΔZF2) has normal ligand binding ability, phosphorylates ERK-1/2 in response to 1 min DHT treatment (blocked by the AR antagonist bicalutamide), but has reduced androgen-dependent nuclear localization compared to wildtype (WT). AR(ΔZF2) males have normal baseline ERK-1/2 phosphorylation, with a 1.5-fold increase in Akt phosphorylation in AR(ΔZF2) muscle vs WT. To identify physiological actions of non-DNA binding-dependent AR signaling, AR(ΔZF2) males were treated for 6 weeks with dihydrotestosterone (DHT). Cortical bone growth was suppressed by DHT in AR(ΔZF2) mice (6% decrease in periosteal and 7% decrease in medullary circumference vs untreated AR(ΔZF2) males). In conclusion, these data suggest that non-DNA binding dependent AR actions suppress cortical bone growth, which may provide a mechanism to fine-tune the response to androgens in bone.

  7. Enobosarm (GTx-024) Modulates Adult Skeletal Muscle Mass Independently of the Androgen Receptor in the Satellite Cell Lineage.

    Science.gov (United States)

    Dubois, Vanessa; Simitsidellis, Ioannis; Laurent, Michaël R; Jardi, Ferran; Saunders, Philippa T K; Vanderschueren, Dirk; Claessens, Frank

    2015-12-01

    Androgens increase skeletal muscle mass, but their clinical use is hampered by a lack of tissue selectivity and subsequent side effects. Selective androgen receptor modulators elicit muscle-anabolic effects while only sparingly affecting reproductive tissues. The selective androgen receptor modulator, GTx-024 (enobosarm), is being investigated for cancer cachexia, sarcopenia, and muscle wasting diseases. Here we investigate the role of muscle androgen receptor (AR) in the anabolic effect of GTx-024. In mice lacking AR in the satellite cell lineage (satARKO), the weight of the androgen-sensitive levator ani muscle was lower but was decreased further upon orchidectomy. GTx-024 was as effective as DHT in restoring levator ani weights to sham levels. Expression of the muscle-specific, androgen-responsive genes S-adenosylmethionine decarboxylase and myostatin was decreased by orchidectomy and restored by GTx-024 and DHT in control mice, whereas the expression was low and unaffected by androgen status in satARKO. In contrast, insulin-like growth factor 1Ea expression was not different between satARKO and control muscle, decreased upon castration, and was restored by DHT and GTx-024 in both genotypes. These data indicate that GTx-024 does not selectively modulate AR in the satellite cell lineage and that cells outside this lineage remain androgen responsive in satARKO muscle. Indeed, residual AR-positive cells were present in satARKO muscle, coexpressing the fibroblast-lineage marker vimentin. AR positive, muscle-resident fibroblasts could therefore be involved in the indirect effects of androgens on muscle. In conclusion, both DHT and GTx-024 target AR pathways in the satellite cell lineage, but cells outside this lineage also contribute to the anabolic effects of androgens.

  8. Prostate specific antigen gene expression in androgen insensitive prostate carcinoma subculture cell line.

    Science.gov (United States)

    Tsui, Ke-Hung; Feng, Tsui-Hsia; Chung, Li-Chuan; Chao, Chun-Hsiang; Chang, Phei-Lang; Juang, Horng-Heng

    2008-01-01

    A novel prostate cancer cell line (PC-J) was isolated from an androgen independent non-prostate specific antigen (non-PSA) producing carcinoma cell line. The homologous correlation between PC-J and PC-3 was determined by short tandem repeat analysis. The PSA promoter activity was detected by transient expression assay in the PC-J and LNCaP cells but not in androgen insensitive PC-3 cells. When the PC-J cells were cotransfected with androgen receptor, androgen receptor coactivators and PSA reporter vector cells, the reporter assays indicated that nuclear receptor coactivator 4 (NCOA4) but not androgen receptor activator 24 (ARA24) increased the sensitivity and maximum stimulation of dihydrotestosterone (DHT)-inducing PSA promoter activity. The RT-PCR assays revealed that the expression of several tumor markers, including interleukin-6, prostate stem cell antigen (PSCA), prostate epithelium-specific Ets transcription factor (PDEF) and matriptase, was lower in the PC-J cells than in the PC-3 cells. This cell model elucidated the regulation of PSA expression and enabled comparison of the gene profile at different stages of metastasis in prostatic carcinoma.

  9. The CXCL12/CXCR4 axis promotes ligand-independent activation of the androgen receptor.

    Science.gov (United States)

    Kasina, Sathish; Macoska, Jill A

    2012-04-01

    The molecular mechanisms responsible for the transition of some prostate cancers from androgen ligand-dependent to androgen ligand-independent are incompletely established. Molecules that are ligands for G protein coupled receptors (GPCRs) have been implicated in ligand-independent androgen receptor (AR) activation. The purpose of this study was to examine whether CXCL12, the ligand for the GPCR, CXCR4, might mediate prostate cancer cell proliferation through AR-dependent mechanisms involving functional transactivation of the AR in the absence of androgen. The results of these studies showed that activation of the CXCL12/CXCR4 axis promoted: The nuclear accumulation of both wild-type and mutant AR in several prostate epithelial cell lines; AR-dependent proliferative responses; nuclear accumulation of the AR co-regulator SRC-1 protein; SRC-1:AR protein:protein association; co-localization of AR and SRC-1 on the promoters of AR-regulated genes; AR- and SRC-1 dependent transcription of AR-regulated genes; AR-dependent secretion of the AR-regulated PSA protein; P13K-dependent phosphorylation of AR; MAPK-dependent phosphorylation of SRC-1, and both MAPK- and P13K-dependent secretion of the PSA protein, in the absence of androgen. Taken together, these studies identify CXCL12 as a novel, non-steroidal growth factor that promotes the growth of prostate epithelial cells through AR-dependent mechanisms in the absence of steroid hormones. These findings support the development of novel therapeutics targeting the CXCL12/CXCR4 axis as an ancillary to those targeting the androgen/AR axis to effectively treat castration resistant/recurrent prostate tumors.

  10. Humanizing the Mouse Androgen Receptor to Study Polymorphisms and Mutations in Prostate Cancer

    Science.gov (United States)

    2006-01-01

    generation of these lines, for testis, liver and kidney 6 RNA. Now that the lines have been backcrossed several additional generations to the C57BL/6...tract morphology when compared to wildtype littermates, and no significant differences were seen by microarray analysis of testis and kidney RNA...polymorphism in the androgen receptor gene modulates body fat mass and serum concentrations of leptin and insulin in men. Diabetologia 46:31-9 22

  11. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    OpenAIRE

    Mutter, G L; Boynton, K A

    1995-01-01

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under opt...

  12. Differentially expressed androgen-regulated genes in androgen-sensitive tissues reveal potential biomarkers of early prostate cancer.

    Directory of Open Access Journals (Sweden)

    Dogus Murat Altintas

    Full Text Available BACKGROUND: Several data favor androgen receptor implication in prostate cancer initiation through the induction of several gene activation programs. The aim of the study is to identify potential biomarkers for early diagnosis of prostate cancer (PCa among androgen-regulated genes (ARG and to evaluate comparative expression of these genes in normal prostate and normal prostate-related androgen-sensitive tissues that do not (or rarely give rise to cancer. METHODS: ARG were selected in non-neoplastic adult human prostatic epithelial RWPE-1 cells stably expressing an exogenous human androgen receptor, using RNA-microarrays and validation by qRT-PCR. Expression of 48 preselected genes was quantified in tissue samples (seminal vesicles, prostate transitional zones and prostate cancers, benign prostatic hypertrophy obtained from surgical specimens using TaqMan® low-density arrays. The diagnostic performances of these potential biomarkers were compared to that of genes known to be associated with PCa (i.e. PCA3 and DLX1. RESULTS AND DISCUSSION: By crossing expression studies in 26 matched PCa and normal prostate transitional zone samples, and 35 matched seminal vesicle and PCa samples, 14 genes were identified. Similarly, 9 genes were overexpressed in 15 benign prostatic hypertrophy samples, as compared to PCa samples. Overall, we selected 8 genes of interest to evaluate their diagnostic performances in comparison with that of PCA3 and DLX1. Among them, 3 genes: CRYAB, KCNMA1 and SDPR, were overexpressed in all 3 reference non-cancerous tissues. The areas under ROC curves of these genes reached those of PCA3 (0.91 and DLX1 (0.94. CONCLUSIONS: We identified ARG with reduced expression in PCa and with significant diagnostic values for discriminating between cancerous and non-cancerous prostatic tissues, similar that of PCA3. Given their expression pattern, they could be considered as potentially protective against prostate cancer. Moreover, they could

  13. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome

    OpenAIRE

    G Bhaskararao; Himabindu, Y; Samir Ranjan Nayak; M Sriharibabu

    2014-01-01

    Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen ...

  14. 雄激素受体基因动态突变及线粒体基因分析诊断Kennedy病1例报告%A case report on Kennedy' s disease diagnosed by dynamic mutation of androgen receptor gene and mitochondrial gene analysis

    Institute of Scientific and Technical Information of China (English)

    梁晓瑜; 勾晨雨

    2013-01-01

    目的 通过对一例肌肉活检提示线粒体肌病的患者进行雄激素受体基因(androgen receptor gene,AR)进行动态突变分析和全线粒体(mtDNA)基因扫描明确诊断.方法 使用PCR方法分析患者雄激素受体(androgen receptor gene,AR)基因的CAG重复序列数,使用Touch Down PCR方法分析患者全线粒体基因突变.结果 该患者雄激素受体基因第一个外显子(Xqll-12)上存在46个三核普酸(CAG)重复,确诊Kennedy病.全线粒体(mtDNA)基因分析未显示线粒体疾病的相关致病突变.结论 AR基因CAG动态突变分析和全mtDNA基因扫描是KD与线粒体脑肌病鉴别诊断或KD并发线粒体脑肌病诊断的重要依据.%Objective To diagnose a patient Kennedy' s disease,who was considered as mitochondrial myopathy by dynamic mutation of androgen receptor gene (AR) and mitochondrial gene analysis.Methods Dynamic mutation of AR gene was analyzed by PCR and sequencing,and mtDNA gene was analyzed by touch down PCR and sequencing.Results trinucleotide repeats of CAG were up to 46,and no pathological mutation of mtDNA was found.Conclusion Dynamic mutation analysis of AR gene and mitochondrial gene analysis are indispensable in diagnosing Kennedy' s disease.

  15. Non-Genomic Actions of the Androgen Receptor in Prostate Cancer

    Science.gov (United States)

    Leung, Jacky K.; Sadar, Marianne D.

    2017-01-01

    Androgen receptor (AR) is a validated drug target for prostate cancer based on its role in proliferation, survival, and metastases of prostate cancer cells. Unfortunately, despite recent improvements to androgen deprivation therapy and the advent of better antiandrogens with a superior affinity for the AR ligand-binding domain (LBD), most patients with recurrent disease will eventually develop lethal metastatic castration-resistant prostate cancer (CRPC). Expression of constitutively active AR splice variants that lack the LBD contribute toward therapeutic resistance by bypassing androgen blockade and antiandrogens. In the canonical pathway, binding of androgen to AR LBD triggers the release of AR from molecular chaperones which enable conformational changes and protein–protein interactions to facilitate its nuclear translocation where it regulates the expression of target genes. However, preceding AR function in the nucleus, initial binding of androgen to AR LBD in the cytoplasm may already initiate signal transduction pathways to modulate cellular proliferation and migration. In this article, we review the significance of signal transduction pathways activated by rapid, non-genomic signaling of the AR during the progression to metastatic CRPC and put into perspective the implications for current and novel therapies that target different domains of AR.

  16. Detection of androgen receptor gene mutation in two pedigrees with an-drogen insensitivity syndrome%两个雄激素不敏感综合征家系中 AR基因突变检测

    Institute of Scientific and Technical Information of China (English)

    信艳萍; 吴庆华; 张毅; 史惠蓉

    2015-01-01

    目的:对两个疑似雄激素不敏感综合征( AIS)家系进行基因诊断和其他临床相关检查,旨在发现其致病基因并进行遗传咨询。方法:对两个AIS家系的先证者及相关成员行体格检查、染色体核型分析、内分泌检测及超声检查后,提取外周血全基因组DNA,扩增位于X染色体上AR基因的8个外显子,扩增产物测序后与基因库中正常人的序列进行比对,查找是否存在致病突变。结果:两个AIS家系的先证者均检测到AR基因突变,分别为c.2042T>C(p.681I>T)和c.1822C>T(p.608R>X),家系中女性携带者中检测出了上述位点的杂合突变。家系1先证者行腹腔镜性腺切除术后证实性腺为睾丸。结论:AR基因的p.681 I>T和p.608 R>X是两个AIS家系患者的致病性突变;对AR基因进行基因检测是46,XY性发育异常,特别是AIS有效的诊断方式。%Aim:Clinical and genetic tests were performed in two pedigrees suspected of androgen insensitivity syndrome ( AIS) to get the diagnosis and provide genetic counseling .Methods:Physical examination , karyotyping ,endocrinal tests and ultrasonography were performed in the probands and their relatives .Eight encoding exons of AR gene extracted from peripher-al blood were amplified by PCR .The products were compared with the normal gene sequences and further analyzed by direct DNA sequencing to find possible mutant gene .Results:Different mutations of AR gene were detected in both pedigrees , re-spectively, c.2042T>C(p.681I>T) and c.1822C>T(p.608R>X).Heterozygous double peaks at the same position were found in female carriers.In pedigree 1, the laparoscopic surgery was performed in the proband and the sex gland was con-firmed to be testis.Conclusion:These two types of mutation of AR gene may be the pathologic causes of AIS .Direct sequen-cing of AR gene is a rapid method to diagnose 46,XY disorder of sex development , especially for

  17. Beyond androgen deprivation: ancillary integrative strategies for targeting the androgen receptor addiction of prostate cancer.

    Science.gov (United States)

    McCarty, Mark F; Hejazi, Jalal; Rastmanesh, Reza

    2014-09-01

    The large majority of clinical prostate cancers remain dependent on androgen receptor (AR) activity for proliferation even as they lose their responsiveness to androgen deprivation or antagonism. AR activity can be maintained in these circumstances by increased AR synthesis--often reflecting increased NF-κB activation; upregulation of signaling pathways that promote AR activity in the absence of androgens; and by emergence of AR mutations or splice variants lacking the ligand-binding domain, which render the AR constitutively active. Drugs targeting the N-terminal transactivating domain of the AR, some of which are now in preclinical development, can be expected to inhibit the activity not only of unmutated ARs but also of the mutant forms and splice variants selected for by androgen deprivation. Concurrent measures that suppress AR synthesis or boost AR turnover could be expected to complement the efficacy of such drugs. A number of nutraceuticals that show efficacy in prostate cancer xenograft models--including polyphenols from pomegranate, grape seed, and green tea, the crucifera metabolite diindolylmethane, and the hormone melatonin--have the potential to suppress AR synthesis via downregulation of NF-κB activity; clinical doses of salicylate may have analogous efficacy. The proteasomal turnover of the AR is abetted by diets with a high ratio of long-chain omega-3 to omega-6 fatty acids, which are beneficial in prostate cancer xenograft models; berberine and sulforaphane, by inhibiting AR's interaction with its chaperone Hsp90, likewise promote AR proteasomal degradation and retard growth of human prostate cancer in nude mice. Hinge region acetylation of the AR is required for optimal transactivational activity, and low micromolar concentrations of the catechin epigallocatechin-3-gallate (EGCG) can inhibit such acetylation--possibly explaining the ability of EGCG administration to suppress androgenic activity and cell proliferation in prostate cancer

  18. Nonsteroidal selective androgen receptor modulators enhance female sexual motivation.

    Science.gov (United States)

    Jones, Amanda; Hwang, Dong Jin; Duke, Charles B; He, Yali; Siddam, Anjaiah; Miller, Duane D; Dalton, James T

    2010-08-01

    Women experience a decline in estrogen and androgen levels after natural or surgically induced menopause, effects that are associated with a loss of sexual desire and bone mineral density. Studies in our laboratories have shown the beneficial effects of selective androgen receptor modulators (SARMs) in the treatment of osteoporosis and muscle wasting in animal models. A series of S-3-(phenoxy)-2-hydroxy-2-methyl-N-(4-cyano-3-trifluoromethyl-phenyl)-propionamide analogs was synthesized to evaluate the effects of B-ring substitutions on in vitro and in vivo pharmacologic activity, especially female sexual motivation. The androgen receptor (AR) relative binding affinities ranged from 0.1 to 26.5% (relative to dihydrotestosterone) and demonstrated a range of agonist activity at 100 nM. In vivo pharmacologic activity was first assessed by using male rats. Structural modifications to the B-ring significantly affected the selectivity of the SARMs, demonstrating that single-atom substitutions can dramatically and unexpectedly influence activity in androgenic (i.e., prostate) and anabolic (i.e., muscle) tissues. (S)-N-(4-cyano-3-trifluoromethyl-phenyl)-3-(3-fluoro,4-chlorophenoxy)-2-hydroxy-2-methyl-propanamide (S-23) displayed full agonist activity in androgenic and anabolic tissues; however, the remaining SARMs were more prostate-sparing, selectively maintaining the size of the levator ani muscle in castrated rats. The partner-preference paradigm was used to evaluate the effects of SARMs on female sexual motivation. With the exception of two four-halo substituted analogs, the SARMs increased sexual motivation in ovariectomized rats, with potency and efficacy comparable with testosterone propionate. These results indicate that the AR is important in regulating female libido given the nonaromatizable nature of SARMs and it could be a superior alternative to steroidal testosterone preparations in the treatment of hypoactive sexual desire disorder.

  19. Muscle Dysfunction in Androgen Deprivation: Role of Ryanodine Receptor

    Science.gov (United States)

    2015-09-01

    TITLE AND SUBTITLE Muscle Dysfunction in Androgen Deprivation: Role of Ryanodine Receptor 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-13-1...required for muscle contraction . RyR1 is a homotetrameric macromolecular protein complex that includes four RyR1 monomers (565kDa each), the RyR1... muscle physiology experiments). Under a microscope, the tibialis anterior (TA) muscle is cut with micro dissection scissors at the distal insertion

  20. Targeting Androgen Receptor Aberrations in Castration-Resistant Prostate Cancer.

    Science.gov (United States)

    Sharp, Adam; Welti, Jonathan; Blagg, Julian; de Bono, Johann S

    2016-09-01

    Androgen receptor (AR) splice variants (SV) have been implicated in the development of metastatic castration-resistant prostate cancer and resistance to AR targeting therapies, including abiraterone and enzalutamide. Agents targeting AR-SV are urgently needed to test this hypothesis and further improve the outcome of patients suffering from this lethal disease. Clin Cancer Res; 22(17); 4280-2. ©2016 AACRSee related article by Yang et al., p. 4466.

  1. Castration induces up-regulation of intratumoral androgen biosynthesis and androgen receptor expression in an orthotopic VCaP human prostate cancer xenograft model.

    Science.gov (United States)

    Knuuttila, Matias; Yatkin, Emrah; Kallio, Jenny; Savolainen, Saija; Laajala, Teemu D; Aittokallio, Tero; Oksala, Riikka; Häkkinen, Merja; Keski-Rahkonen, Pekka; Auriola, Seppo; Poutanen, Matti; Mäkelä, Sari

    2014-08-01

    Androgens are key factors involved in the development and progression of prostate cancer (PCa), and PCa growth can be suppressed by androgen deprivation therapy. In a considerable proportion of men receiving androgen deprivation therapy, however, PCa progresses to castration-resistant PCa (CRPC), making the development of efficient therapies challenging. We used an orthotopic VCaP human PCa xenograft model to study cellular and molecular changes in tumors after androgen deprivation therapy (castration). Tumor growth was monitored through weekly serum prostate-specific antigen measurements, and mice with recurrent tumors after castration were randomized to treatment groups. Serum prostate-specific antigen concentrations showed significant correlation with tumor volume. Castration-resistant tumors retained concentrations of intratumoral androgen (androstenedione, testosterone, and 5α-dihydrotestosterone) at levels similar to tumors growing in intact hosts. Accordingly, castration induced up-regulation of enzymes involved in androgen synthesis (CYP17A1, AKR1C3, and HSD17B6), as well as expression of full-length androgen receptor (AR) and AR splice variants (AR-V1 and AR-V7). Furthermore, AR target gene expression was maintained in castration-resistant xenografts. The AR antagonists enzalutamide (MDV3100) and ARN-509 suppressed PSA production of castration-resistant tumors, confirming the androgen dependency of these tumors. Taken together, the findings demonstrate that our VCaP xenograft model exhibits the key characteristics of clinical CRPC and thus provides a valuable tool for identifying druggable targets and for testing therapeutic strategies targeting AR signaling in CRPC.

  2. Preliminary investigations into triazole derived androgen receptor antagonists.

    Science.gov (United States)

    Altimari, Jarrad M; Niranjan, Birunthi; Risbridger, Gail P; Schweiker, Stephanie S; Lohning, Anna E; Henderson, Luke C

    2014-05-01

    A range of 1,4-substituted-1,2,3-N-phenyltriazoles were synthesized and evaluated as non-steroidal androgen receptor (AR) antagonists. The motivation for this study was to replace the N-phenyl amide portion of small molecule antiandrogens with a 1,2,3-triazole and determine effects, if any, on biological activity. The synthetic methodology presented herein is robust, high yielding and extremely rapid. Using this methodology a series of 17 N-aryl triazoles were synthesized from commercially available starting materials in less than 3h. After preliminary biological screening at 20 and 40 μM, the most promising three compounds were found to display IC50 values of 40-50 μM against androgen dependent (LNCaP) cells and serve as a starting point for further structure-activity investigations. All compounds in this work were the focus of an in silico study to dock the compounds into the human androgen receptor ligand binding domain (hARLBD) and compare their predicted binding affinity with known antiandrogens. A comparison of receptor-ligand interactions for the wild type and T877A mutant AR revealed two novel polar interactions. One with Q738 of the wild type site and the second with the mutated A877 residue.

  3. Protein phosphatase 1 suppresses androgen receptor ubiquitylation and degradation.

    Science.gov (United States)

    Liu, Xiaming; Han, Weiwei; Gulla, Sarah; Simon, Nicholas I; Gao, Yanfei; Cai, Changmeng; Yang, Hongmei; Zhang, Xiaoping; Liu, Jihong; Balk, Steven P; Chen, Shaoyong

    2016-01-12

    The phosphoprotein phosphatases are emerging as important androgen receptor (AR) regulators in prostate cancer (PCa). We reported previously that the protein phosphatase 1 catalytic subunit (PP1α) can enhance AR activity by dephosphorylating a site in the AR hinge region (Ser650) and thereby decrease AR nuclear export. In this study we show that PP1α increases the expression of wildtype as well as an S650A mutant AR, indicating that it is acting through one or more additional mechanisms. We next show that PP1α binds primarily to the AR ligand binding domain and decreases its ubiquitylation and degradation. Moreover, we find that the PP1α inhibitor tautomycin increases phosphorylation of AR ubiquitin ligases including SKP2 and MDM2 at sites that enhance their activity, providing a mechanism by which PP1α may suppress AR degradation. Significantly, the tautomycin mediated decrease in AR expression was most pronounced at low androgen levels or in the presence of the AR antagonist enzalutamide. Consistent with this finding, the sensitivity of LNCaP and C4-2 PCa cells to tautomycin, as assessed by PSA synthesis and proliferation, was enhanced at low androgen levels or by treatment with enzalutamide. Together these results indicate that PP1α may contribute to stabilizing AR protein after androgen deprivation therapies, and that targeting PP1α or the AR-PP1α interaction may be effective in castration-resistant prostate cancer (CRPC).

  4. Androgen receptor roles in the development of benign prostate hyperplasia.

    Science.gov (United States)

    Izumi, Kouji; Mizokami, Atsushi; Lin, Wen-Jye; Lai, Kuo-Pao; Chang, Chawnshang

    2013-06-01

    Benign prostate hyperplasia (BPH) is a major cause of lower urinary tract symptoms, with an increased volume of transitional zone and associated with increased stromal cells. It is known that androgen/androgen receptor (AR) signaling plays a key role in development of BPH, and that blockade of this signaling decreases BPH volume and can relieve lower urinary tract symptoms, but the mechanisms of androgen/AR signaling in BPH development remain unclear, and the effectiveness of current drugs for treating BPH is still limited. The detailed mechanisms of androgen/AR signaling need to be clarified, and new therapies are needed for better treatment of BPH patients. This review focuses on roles of AR in epithelial and stromal cells in BPH development. In epithelial cells, AR may contribute to BPH development via epithelial cell-stromal cell interaction with alterations of epithelial-mesenchymal transition, leading to proliferation of stromal cells. Data from several mouse models with selective knockout of AR in stromal smooth-muscle cells and/or fibroblasts indicate that the AR in stromal cells can also promote BPH development. In prostatic inflammation, AR roles in infiltrating macrophages and epithelial and stromal cells have been linked to BPH development, which has led to discovery of new therapeutic targets. For example, targeting AR with the novel AR degradation enhancer, ASC-J9 offers a potential therapeutic approach against BPH development.

  5. Posttranslational modification of the androgen receptor in prostate cancer.

    Science.gov (United States)

    van der Steen, Travis; Tindall, Donald J; Huang, Haojie

    2013-07-16

    The androgen receptor (AR) is important in the development of the prostate by regulating transcription, cellular proliferation, and apoptosis. AR undergoes posttranslational modifications that alter its transcription activity, translocation to the nucleus and stability. The posttranslational modifications that regulate these events are of utmost importance to understand the functional role of AR and its activity. The majority of these modifications occur in the activation function-1 (AF1) region of the AR, which contains the transcriptional activation unit 1 (TAU1) and 5 (TAU5). Identification of the modifications that occur to these regions may increase our understanding of AR activation in prostate cancer and the role of AR in the progression from androgen-dependent to castration-resistant prostate cancer (CRPC). Most of the posttranslational modifications identified to date have been determined using the full-length AR in androgen dependent cells. Further investigations into the role of posttranslational modifications in androgen-independent activation of full-length AR and constitutively active splicing variants are warranted, findings from which may provide new therapeutic options for CRPC.

  6. The androgen receptor in hormone-refractory prostate cancer

    Institute of Scientific and Technical Information of China (English)

    Hai-Lei Mao; Zhi-Qi Zhu; Charlie Degui Chen

    2009-01-01

    Advanced prostate cancer is responsive to hormone therapy that interferes with androgen receptor (AR) signalling.However,the effect is short-lived,as nearly all tumours progress to a hormone-refractory (HR) state,a lethal stage of the disease.Intuitively,the AR should not be involved because hormone therapy that blocks or reduces AR activity is not effective in treating HR turnouts.However,there is still a consensus that AR plays an essential role in HR prostate cancer (HRPC) because AR signalling is still functional in HR tumours.AR signalling can be activated in HR turnouts through several mechanisms.First,activation of intracellular signal transduction pathways can sensitize the AR to castrate levels of androgens.Also,mutations in the AR can change AR ligand specificity,thereby allowing it to be activated by non-steroids or anti-androgens.Finally,overexpression of the wild-type AR sensitizes itself to low concentrations of androgens.Therefore,drugs targeting AR signalling could still be effective in treating HRPC.

  7. Estrogen and androgen regulate actin-remodeling and endocytosis-related genes during rat spermiation.

    Science.gov (United States)

    Kumar, Anita; Dumasia, Kushaan; Gaonkar, Reshma; Sonawane, Shobha; Kadam, Leena; Balasinor, N H

    2015-03-15

    Spermiation, the sperm release process, is imperative to male fertility and reproduction. Morphologically, it is characterized by removal of atypical adherens junctions called ectoplasmic specializations, and formation of transient endocytic devices called tubulobulbar complexes requiring cytoskeleton remodeling and recruitment of proteins needed for endocytosis. Earlier, estrogen administration to adult male rats was seen to cause spermiation failure due to disruption of tubulobulbar complexes. This was accompanied by reduction in intratesticular testosterone levels and increase in intratesticular estrogen along with deregulation of genes involved in cytoskeleton remodeling (Arpc1b, Evl and Capg) and endocytosis (Picalm, Eea1 and Stx5a). In the present study, we aim to understand the role of estrogen and androgen in regulating these genes independently using seminiferous tubule culture system treated with estrogen, androgen or agonists and antagonists of estrogen receptors. We find that transcripts of Arpc1b, Evl and Picalm are responsive to estrogen while those of Picalm, Eea1 and Stx5a are responsive to androgen. We also find that the estrogen regulation of Arpc1b and Evl is mediated through estrogen receptor β and that of Picalm occurs through estrogen receptors α and β. Localization of these proteins at or in the vicinity of tubulobulbar complexes reveals that ARPC1B, EVL, PICALM, EEA1 and STX5A seem to be involved in spermiation. Thus, estrogen and androgen regulate specific genes in seminiferous tubules that could play a role in spermiation.

  8. Expression of novel genes linked to the androgen-induced, proliferative shutoff in prostate cancer cells.

    Science.gov (United States)

    Geck, P; Szelei, J; Jimenez, J; Lin, T M; Sonnenschein, C; Soto, A M

    1997-01-01

    Androgens control cell numbers in the prostate through three separate pathways: (a) inhibition of cell death, (b) induction of cell proliferation (Step-1) and (c) inhibition of cell proliferation (Step-2, proliferative shutoff). The mechanisms underlying these phenomena are incompletely understood. The human prostate carcinoma LNCaP variants express these pathways as follows: LNCaP-FGC express both steps, LNCaP-LNO expresses Step-2, LNCaP-TAC expresses Step-1, and LNCaP-TJA cells express neither step. These cells facilitated the search for mediators of the androgen-induced proliferative shutoff pathway. Androgen exposure for 24 h or longer induced an irreversible proliferative shutoff in LNCaP-FGC cells. The Wang and Brown approach for identifying differentially expressed mRNAs was used to search for mediators of Step-2. Ten unique inserts were identified and from those ten, three genes were further studied. The basal expression of these genes in shutoff-negative variants was not affected by androgen exposure. They were induced by androgens in shutoff-positive LNCaP variants and the androgen receptor-transfected, shutoff-positive, MCF7-AR1 cells. These genes were induced only in the range of androgen concentrations that elicited the shutoff response. Time course analysis showed that their induction precedes the commitment point by 12-18 h. In addition, they were expressed in the normal prostate during proliferative shutoff. These features suggest that the candidate genes have a role in the regulation cascade for proliferative shutoff.

  9. Muscle-specific androgen receptor deletion shows limited actions in myoblasts but not in myofibers in different muscles in vivo.

    Science.gov (United States)

    Rana, Kesha; Chiu, Maria W S; Russell, Patricia K; Skinner, Jarrod P; Lee, Nicole K L; Fam, Barbara C; Zajac, Jeffrey D; MacLean, Helen E

    2016-08-01

    The aim of this study was to investigate the direct muscle cell-mediated actions of androgens by comparing two different mouse lines. The cre-loxP system was used to delete the DNA-binding activity of the androgen receptor (AR) in mature myofibers (MCK mAR(ΔZF2)) in one model and the DNA-binding activity of the AR in both proliferating myoblasts and myofibers (α-actin mAR(ΔZF2)) in another model. We found that hind-limb muscle mass was normal in MCK mAR(ΔZF2) mice and that relative mass of only some hind-limb muscles was reduced in α-actin mAR(ΔZF2) mice. This suggests that myoblasts and myofibers are not the major cellular targets mediating the anabolic actions of androgens on male muscle during growth and development. Levator ani muscle mass was decreased in both mouse lines, demonstrating that there is a myofiber-specific effect in this unique androgen-dependent muscle. We found that the pattern of expression of genes including c-myc, Fzd4 and Igf2 is associated with androgen-dependent changes in muscle mass; therefore, these genes are likely to be mediators of anabolic actions of androgens. Further research is required to identify the major targets of androgen actions in muscle, which are likely to include indirect actions via other tissues.

  10. Stromal Androgen Receptor Roles in the Development of Normal Prostate, Benign Prostate Hyperplasia, and Prostate Cancer

    OpenAIRE

    Wen, Simeng; Chang, Hong-Chiang; Tian, Jing; Shang, Zhiqun; Niu, Yuanjie; Chang, Chawnshang

    2015-01-01

    The prostate is an androgen-sensitive organ that needs proper androgen/androgen receptor (AR) signals for normal development. The progression of prostate diseases, including benign prostate hyperplasia (BPH) and prostate cancer (PCa), also needs proper androgen/AR signals. Tissue recombination studies report that stromal, but not epithelial, AR plays more critical roles via the mesenchymal-epithelial interactions to influence the early process of prostate development. However, in BPH and PCa,...

  11. Global analysis of transcription in castration-resistant prostate cancer cells uncovers active enhancers and direct androgen receptor targets.

    Science.gov (United States)

    Toropainen, Sari; Niskanen, Einari A; Malinen, Marjo; Sutinen, Päivi; Kaikkonen, Minna U; Palvimo, Jorma J

    2016-09-19

    Androgen receptor (AR) is a male sex steroid-activated transcription factor (TF) that plays a critical role in prostate cancers, including castration-resistant prostate cancers (CRPC) that typically express amplified levels of the AR. CRPC-derived VCaP cells display an excessive number of chromatin AR-binding sites (ARBs) most of which localize to distal inter- or intragenic regions. Here, we analyzed direct transcription programs of the AR in VCaP cells using global nuclear run-on sequencing (GRO-seq) and integrated the GRO-seq data with the ARB and VCaP cell-specific TF-binding data. Androgen immediately activated transcription of hundreds of protein-coding genes, including IGF-1 receptor and EGF receptor. Androgen also simultaneously repressed transcription of a large number of genes, including MYC. As functional enhancers have been postulated to produce enhancer-templated non-coding RNAs (eRNAs), we also analyzed the eRNAs, which revealed that only a fraction of the ARBs reside at functional enhancers. Activation of these enhancers was most pronounced at the sites that also bound PIAS1, ERG and HDAC3, whereas binding of HDAC3 and PIAS1 decreased at androgen-repressed enhancers. In summary, our genome-wide data of androgen-regulated enhancers and primary target genes provide new insights how the AR can directly regulate cellular growth and control signaling pathways in CPRC cells.

  12. Discovery of diarylhydantoins as new selective androgen receptor modulators.

    Science.gov (United States)

    Nique, François; Hebbe, Séverine; Peixoto, Christophe; Annoot, Denis; Lefrançois, Jean-Michel; Duval, Eric; Michoux, Laurence; Triballeau, Nicolas; Lemoullec, Jean-Michel; Mollat, Patrick; Thauvin, Maxime; Prangé, Thierry; Minet, Dominique; Clément-Lacroix, Philippe; Robin-Jagerschmidt, Catherine; Fleury, Damien; Guédin, Denis; Deprez, Pierre

    2012-10-11

    A novel selective androgen receptor modulator scaffold has been discovered through structural modifications of hydantoin antiandrogens. Several 4-(4-hydroxyphenyl)-N-arylhydantoins displayed partial agonism with nanomolar in vitro potency in transactivation experiments using androgen receptor (AR) transfected cells. In a standard castrated male rat model, several compounds showed good anabolic activity on levator ani muscle, dissociated from the androgenic activity on ventral prostate, after oral dosing at 30 mg/kg. (+)-4-[3,4-Dimethyl-2,5-dioxo-4-(4-hydroxyphenyl)imidazolidin-1-yl]-2-(trifluoromethyl)benzonitrile ((+)-11b) displayed anabolic potency with a strong dissociation between levator ani muscle and ventral prostate (A(50) = 0.5 mg/kg vs 70 mg/kg). The binding modes of two compounds, including (+)-11b, within the AR ligand-binding domain have been studied by cocrystallization experiments using a coactivator-like peptide. Both compounds bound to the same site, and the overall structures of the AR were very similar.

  13. Androgen receptor CAG polymorphism and the risk of benign prostatic hyperplasia in a Brazilian population

    Directory of Open Access Journals (Sweden)

    Vanderlei Biolchi

    2012-06-01

    Full Text Available Benign prostatic hyperplasia (BPH is a very frequent age-related proliferative abnormality in men. Polymorphic CAG repeat in the androgen receptor (AR can alter transactivation of androgen-responsive genes and potentially influence BPH risk. We investigated the association between CAG repeat length and risk of BPH in a case-control study of a Brazilian population. We evaluated 214 patients; 126 with BPH and 88 healthy controls. DNA was extracted from peripheral leucocytes and the AR gene was analyzed using fragment analysis. Hazard ratio (HR and 95% confidence interval were estimated using logistic regression models. Mean CAG length was not different between patients with BPH and controls. The CAG repeat length was examined as a categorical variable (CAG 21 and CAG 22 and did not differ between the control vs. the BPH group. We found no evidence for an association between AR CAG repeat length in BPH risk in a population-based sample of Brazilians.

  14. Loss of androgen receptor-dependent growth suppression by prostate cancer cells can occur independently from acquiring oncogenic addiction to androgen receptor signaling.

    Directory of Open Access Journals (Sweden)

    Jason M D'Antonio

    Full Text Available The conversion of androgen receptor (AR signaling as a mechanism of growth suppression of normal prostate epithelial cells to that of growth stimulation in prostate cancer cells is often associated with AR mutation, amplification and over-expression. Thus, down-regulation of AR signaling is commonly therapeutic for prostate cancer. The E006AA cell line was established from a hormone naïve, localized prostate cancer. E006AA cells are genetically aneuploid and grow equally well when xenografted into either intact or castrated male NOG but not nude mice. These cells exhibit: 1 X chromosome duplication and AR gene amplification, although paradoxically not coupled with increased AR expression, and 2 somatic, dominant-negative Serine-599-Glycine loss-of-function mutation within the dimerization surface of the DNA binding domain of the AR gene. No effect on the growth of E006AA cells is observed using targeted knockdown of endogenous mutant AR, ectopic expression of wild-type AR, or treatment with androgens or anti-androgens. E006AA cells represent a prototype for a newly identified subtype of prostate cancer cells that exhibit a dominant-negative AR loss-of-function in a hormonally naïve patient. Such loss-of-function eliminates AR-mediated growth suppression normally induced by normal physiological levels of androgens, thus producing a selective growth advantage for these malignant cells in hormonally naïve patients. These data highlight that loss of AR-mediated growth suppression is an independent process, and that, without additional changes, is insufficient for acquiring oncogene addiction to AR signaling. Thus, patients with prostate cancer cells harboring such AR loss-of-function mutations will not benefit from aggressive hormone or anti-AR therapies even though they express AR protein.

  15. Hydrogen sulfide represses androgen receptor transactivation by targeting at the second zinc finger module.

    Science.gov (United States)

    Zhao, Kexin; Li, Shuangshuang; Wu, Lingyun; Lai, Christopher; Yang, Guangdong

    2014-07-25

    Androgen receptor (AR) signaling is indispensable for the development of prostate cancer from the initial androgen-dependent state to a later aggressive androgen-resistant state. This study examined the role of hydrogen sulfide (H(2)S), a novel gasotransmitter, in the regulation of AR signaling as well as its mediation in androgen-independent cell growth in prostate cancer cells. Here we found that H(2)S inhibits cell proliferation of both androgen-dependent (LNCaP) and antiandrogen-resistant prostate cancer cells (LNCaP-B), with more significance on the latter, which was established by long term treatment of parental LNCaP cells with bicalutamide. The expression of cystathionine γ-lyase (CSE), a major H(2)S producing enzyme in prostate tissue, was reduced in both human prostate cancer tissues and LNCaP-B cells. LNCaP-B cells were resistant to bicalutamide-induced cell growth inhibition, and CSE overexpression could rebuild the sensitivity of LNCaP-B cells to bicalutamide. H(2)S significantly repressed the expression of prostate-specific antigen (PSA) and TMPRSS2, two AR-targeted genes. In addition, H(2)S inhibited AR binding with PSA promoter and androgen-responsive element (ARE) luciferase activity. We further found that AR is post-translationally modified by H(2)S through S-sulfhydration. Mutation of cysteine 611 and cysteine 614 in the second zinc finger module of AR-DNA binding domain diminished the effects of H(2)S on AR S-sulfhydration and AR dimerization. These data suggest that reduced CSE/H2S signaling contributes to antiandrogen-resistant status, and sufficient level of H(2)S is able to inhibit AR transactivation and treat castration-resistant prostate cancer.

  16. Synergic prodegradative activity of Bicalutamide and trehalose on the mutant androgen receptor responsible for spinal and bulbar muscular atrophy

    NARCIS (Netherlands)

    Giorgetti, Elise; Rusmini, Paola; Crippa, Valeria; Cristofani, Riccardo; Boncoraglio, Alessandra; Cicardi, Maria E.; Galbiati, Mariarita; Poletti, Angelo

    2015-01-01

    Spinal and bulbar muscular atrophy (SBMA) is an X-linked motoneuron disease due to a CAG triplet-repeat expansion in the androgen receptor (AR) gene, which is translated into an elongated polyglutamine (polyQ) tract in AR protein (ARpolyQ). ARpolyQ toxicity is activated by the AR ligand testosterone

  17. Repressive effects of resveratrol on androgen receptor transcriptional activity.

    Directory of Open Access Journals (Sweden)

    Wen-feng Shi

    Full Text Available BACKGROUND: The chemopreventive effects of resveratrol (RSV on prostate cancer have been well established; the androgen receptor (AR plays pivotal roles in prostatic tumorigenesis. However, the exact underlying molecular mechanisms about the effects of RSV on AR have not been fully elucidated. A model system is needed to determine whether and how RSV represses AR transcriptional activity. METHODOLOGY: The AR cDNA was first cloned into the retroviral vector pOZ-N and then integrated into the genome of AR-negative HeLa cells to generate the AR(+ cells. The constitutively expressed AR was characterized by monitoring hormone-stimulated nuclear translocation, DNA binding, and transcriptional activation, with the AR(- cells serving as controls. AR(+ cells were treated with RSV, and both AR protein levels and AR transcriptional activity were measured simultaneously. Chromatin immunoprecipitation (ChIP assays were used to detect the effects of RSV on the recruitment of AR to its cognate element (ARE. RESULTS: AR in the AR (+ stable cell line functions in a manner similar to that of endogenously expressed AR. Using this model system we clearly demonstrated that RSV represses AR transcriptional activity independently of any effects on AR protein levels. However, neither the hormone-mediated nucleus translocation nor the AR/ARE interaction was affected by RSV treatment. CONCLUSION: We demonstrated unambiguously that RSV regulates AR target gene expression, at least in part, by repressing AR transcriptional activity. Repressive effects of RSV on AR activity result from mechanisms other than the affects of AR nuclear translocation or DNA binding.

  18. Reptides and Proteins Interacting with the Androgen Receptor

    NARCIS (Netherlands)

    D.J. van de Wijngaart (Dennis)

    2009-01-01

    textabstractAndrogens are important sex steroid hormones. The androgens testosterone and dihydrotestosterone (DHT) are essential for normal male sexual differentiation and for the development and maintenance of male reproductive tissues, including the prostate. Androgens mediate their effects by bin

  19. Effect of lycopene on androgen receptor and prostate-specific antigen velocity

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xin; WANG Qi; Barber Neil; CHEN Xiao

    2010-01-01

    Background There is increasing interest in the role of dietary factors in both the development and behaviour of prostate cancer.This study was carried out to evaluate the impact of the dietary factor lycopene on DNA synthesis,activity and expression of the androgen receptor gene element in prostate LnCaP cells and to report our pilot phase Ⅱ study investigating its effect on prostate-specific antigen velocity over one year.Methods LnCaP cells were grown with or without different concentrations of lycopene or tetrahydrofuran (THF solvent)added to the culture medium for 48 hours.DNA synthesis was measured by the incorporation of bromodeoxyuridine (Brdu) into DNA during a 4-hour pulse, followed by immunostaining and visualization of stained cells using fluorescence microscopy.A transient transfection of a plasmid DNA recombinant containing an androgen receptor element-luciferase (ARE-Luc) report gene into LnCaP cells was developed and the impact of different concentrations of lycopene on the androgen receptor element was reflected by quantitative analysis of the luciferase enzyme function.Expression of the androgen gene was also studied by Western blotting.The phase Ⅱ pilot study patients (n=41) previously diagnosed with prostate cancer were enrolled and given lycopene supplement, 10 mg per day, and response was measured by observing changes in the plasma prostate-specific antigen (PSA) levels.Results The addition of 0.5 μmol/L, 5 μmol/L, 10 μmol/L and 15 μmol/L of lycopene was shown to inhibit cell growth by 2.66%, 4.29%, 3.73% and 13.66%, respectively, compared with the THF solvent control samples (P=0.015).As compared with the RPMI1640 medium group, cell proliferation in the presence of 5 μmol/L, 10 μmol/L, and 15 μmol/L lycopene was inhibited by 8.12%, 6.33% and 12.00%, respectively (P=0.024).We showed for the first time that lycopene inhibited the activity of the androgen receptor gene element in a dose-related manner.Inhibition was seen in the

  20. Structure of the homodimeric androgen receptor ligand-binding domain

    Science.gov (United States)

    Nadal, Marta; Prekovic, Stefan; Gallastegui, Nerea; Helsen, Christine; Abella, Montserrat; Zielinska, Karolina; Gay, Marina; Vilaseca, Marta; Taulès, Marta; Houtsmuller, Adriaan B.; van Royen, Martin E.; Claessens, Frank; Fuentes-Prior, Pablo; Estébanez-Perpiñá, Eva

    2017-01-01

    The androgen receptor (AR) plays a crucial role in normal physiology, development and metabolism as well as in the aetiology and treatment of diverse pathologies such as androgen insensitivity syndromes (AIS), male infertility and prostate cancer (PCa). Here we show that dimerization of AR ligand-binding domain (LBD) is induced by receptor agonists but not by antagonists. The 2.15-Å crystal structure of homodimeric, agonist- and coactivator peptide-bound AR-LBD unveils a 1,000-Å2 large dimerization surface, which harbours over 40 previously unexplained AIS- and PCa-associated point mutations. An AIS mutation in the self-association interface (P767A) disrupts dimer formation in vivo, and has a detrimental effect on the transactivating properties of full-length AR, despite retained hormone-binding capacity. The conservation of essential residues suggests that the unveiled dimerization mechanism might be shared by other nuclear receptors. Our work defines AR-LBD homodimerization as an essential step in the proper functioning of this important transcription factor. PMID:28165461

  1. Nrf1 and Nrf2 transcription factors regulate androgen receptor transactivation in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Michelle A Schultz

    Full Text Available Despite androgen deprivation therapy (ADT, persistent androgen receptor (AR signaling enables outgrowth of castration resistant prostate cancer (CRPC. In prostate cancer (PCa cells, ADT may enhance AR activity through induction of oxidative stress. Herein, we investigated the roles of Nrf1 and Nrf2, transcription factors that regulate antioxidant gene expression, on hormone-mediated AR transactivation using a syngeneic in vitro model of androgen dependent (LNCaP and castration resistant (C4-2B PCa cells. Dihydrotestosterone (DHT stimulated transactivation of the androgen response element (ARE was significantly greater in C4-2B cells than in LNCaP cells. DHT-induced AR transactivation was coupled with higher nuclear translocation of p65-Nrf1 in C4-2B cells, as compared to LNCaP cells. Conversely, DHT stimulation suppressed total Nrf2 levels in C4-2B cells but elevated total Nrf2 levels in LNCaP cells. Interestingly, siRNA mediated silencing of Nrf1 attenuated AR transactivation while p65-Nrf1 overexpression enhanced AR transactivation. Subsequent studies showed that Nrf1 physically interacts with AR and enhances AR's DNA-binding activity, suggesting that the p65-Nrf1 isoform is a potential AR coactivator. In contrast, Nrf2 suppressed AR-mediated transactivation by stimulating the nuclear accumulation of the p120-Nrf1 which suppressed AR transactivation. Quantitative RT-PCR studies further validated the inductive effects of p65-Nrf1 isoform on the androgen regulated genes, PSA and TMPRSS2. Therefore, our findings implicate differential roles of Nrf1 and Nrf2 in regulating AR transactivation in PCa cells. Our findings also indicate that the DHT-stimulated increase in p65-Nrf1 and the simultaneous suppression of both Nrf2 and p120-Nrf1 ultimately facilitates AR transactivation in CRPC cells.

  2. Sequencing the transcriptional network of androgen receptor in prostate cancer.

    Science.gov (United States)

    Chng, Kern Rei; Cheung, Edwin

    2013-11-01

    The progression of prostate cancer is largely dependent on the activity of the androgen receptor (AR), which in turn, correlates with the net output of the AR transcriptional regulatory network. A detailed and thorough understanding of the AR transcriptional regulatory network is therefore critical in the strategic manipulation of AR activity for the targeted eradication of prostate cancer cells. In this mini-review, we highlight some of the novel and unexpected mechanistic and functional insights of the AR transcriptional network derived from recent targeted sequencing (ChIP-Seq) studies of AR and its coregulatory factors in prostate cancer cells.

  3. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome.

    Science.gov (United States)

    Bhaskararao, G; Himabindu, Y; Nayak, Samir Rajan; Sriharibabu, M

    2014-07-01

    Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen insensitivity syndrome, and partial androgen insensitivity syndrome. Management of androgen insensitivity syndrome includes multidisciplinary approach and involves gonedectomy to avoid gonadal tumors in later life. Hormone replacement therapy (HRT) and psychological support are required in long-term basis.

  4. The AhR Ligand, TCDD, Regulates Androgen Receptor Activity Differently in Androgen-Sensitive versus Castration-Resistant Human Prostate Cancer Cells.

    Science.gov (United States)

    Ghotbaddini, Maryam; Powell, Joann B

    2015-07-06

    The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR). TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to induce degradation of hormone receptors. The studies reported here, evaluate the effect of TCDD exposure on androgen receptor (AR) expression and activity in androgen-sensitive LNCaP and castration-resistant C4-2 prostate cancer cells. Our results show that TCDD exposure does not induce AhR or AR degradation in C4-2 cells. However, both AhR and AR are degraded in LNCaP cells following TCDD exposure. In addition, TCDD enhances AR phosphorylation and induces expression of AR responsive genes in LNCaP cells. Our data reveals that TCDD effect on AR expression and activity differs in androgen-sensitive and castration-resistant prostate cancer cell models.

  5. The AhR Ligand, TCDD, Regulates Androgen Receptor Activity Differently in Androgen-Sensitive versus Castration-Resistant Human Prostate Cancer Cells

    Directory of Open Access Journals (Sweden)

    Maryam Ghotbaddini

    2015-07-01

    Full Text Available The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR. TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to induce degradation of hormone receptors. The studies reported here, evaluate the effect of TCDD exposure on androgen receptor (AR expression and activity in androgen-sensitive LNCaP and castration-resistant C4-2 prostate cancer cells. Our results show that TCDD exposure does not induce AhR or AR degradation in C4-2 cells. However, both AhR and AR are degraded in LNCaP cells following TCDD exposure. In addition, TCDD enhances AR phosphorylation and induces expression of AR responsive genes in LNCaP cells. Our data reveals that TCDD effect on AR expression and activity differs in androgen-sensitive and castration-resistant prostate cancer cell models.

  6. Cytogenetic and molecular analysis of the Y chromosome: absence of a significant relationship between CAG repeat length in exon 1 of the androgen receptor gene and infertility in Indian men.

    Science.gov (United States)

    Dhillon, Varinderpal S; Husain, Syed A

    2003-10-01

    The genetic basis of male infertility remains unclear in the majority of cases. Recent studies have indicated an association between microdeletions of the azoospermia factor a (AZFa)-AZFc regions of Yq and severe oligospermia or azoospermia. Increased (CAG)n repeat lengths in the androgen receptor (AR) gene have also been reported in infertile men. Therefore, in order to assess the prevalence of these genetic defects to male infertility, 183 men with non-obstructive azoospermia (n = 70), obstructive azoospermia (n = 33), severe oligospermia (n = 80) and 59 fertile men were examined cytogenetically and at molecular level for Yq deletions, microdeletions, and AR-CAG repeat lengths along with hormonal profiles [luteinizing hormone (LH), follicle-stimulating hormone (FSH) and testosterone (T)]. We used high resolution cytogenetics to detect chromosome deletions and multiplex polymerase chain reaction (PCR) involving 27 sequence-tagged site (STS) markers on Yq to determine the rate and extent of Yq microdeletions. PCR amplification with primers flanking exon 1 of AR gene was used to determine the AR-(CAG)n repeat lengths. Hormonal profiles (LH, FSH and T levels) were also analysed in infertile and fertile men. Testicular biopsies showed Sertoli cell only (SCO) morphology, maturation arrests (MA) and hypospermatogenesis. No chromosome aberrations were found in infertile men but there was a significant increase (p CAG repeats in AR gene was observed between infertile and fertile men (22.2 +/- 1.5 and 21.5 +/- 1.4 respectively). No significant increase or decrease in levels of LH, FSH and T was observed in infertile and fertile men. In some infertile men, significantly elevated levels of FSH alone or in combination with LH were found to be indicative of failure of spermatogenesis and/or suggestive of testicular failure. Y-chromosome microdeletions contribute to infertility in some patients but no relationship could be established with the (CAG)n repeat lengths in exon 1 of

  7. Advantages and Limitations of Androgen Receptor-Based Methods for Detecting Anabolic Androgenic Steroid Abuse as Performance Enhancing Drugs.

    Science.gov (United States)

    Bailey, Kathy; Yazdi, Tahmineh; Masharani, Umesh; Tyrrell, Blake; Butch, Anthony; Schaufele, Fred

    2016-01-01

    Testosterone (T) and related androgens are performance enhancing drugs (PEDs) abused by some athletes to gain competitive advantage. To monitor unauthorized androgen abuse, doping control programs use mass spectrometry (MS) to detect androgens, synthetic anabolic-androgenic steroids (AASs) and their metabolites in an athlete's urine. AASs of unknown composition will not be detected by these procedures. Since AASs achieve their anabolic effects by activating the Androgen Receptor (AR), cell-based bioassays that measure the effect of a urine sample on AR activity are under investigation as complementary, pan-androgen detection methods. We evaluated an AR BioAssay as a monitor for androgen activity in urine pre-treated with glucuronidase, which releases T from the inactive T-glucuronide that predominates in urine. AR BioAssay activity levels were expressed as 'T-equivalent' concentrations by comparison to a T dose response curve. The T-equivalent concentrations of androgens in the urine of hypogonadal participants supplemented with T (in whom all androgenic activity should arise from T) were quantitatively identical to the T measurements conducted by MS at the UCLA Olympic Analytical Laboratory (0.96 ± 0.22). All 17 AASs studied were active in the AR BioAssay; other steroids were inactive. 12 metabolites of 10 commonly abused AASs, which are used for MS monitoring of AAS doping because of their prolonged presence in urine, had reduced or no AR BioAssay activity. Thus, the AR BioAssay can accurately and inexpensively monitor T, but its ability to monitor urinary AASs will be limited to a period immediately following doping in which the active AASs remain intact.

  8. Screening of bisphenol A, triclosan and paraben analogues as modulators of the glucocorticoid and androgen receptor activities.

    Science.gov (United States)

    Kolšek, Katra; Gobec, Martina; Mlinarič Raščan, Irena; Sollner Dolenc, Marija

    2015-02-01

    A homeostasis of the glucocorticoid and androgen endocrine system is essential to human health. Their disturbance can lead to various diseases, for example cardiovascular, inflammatory and autoimmune diseases, infertility, cancer. Fifteen widely used industrial chemicals that disrupt endocrine activity were selected for evaluation of potential (anti)glucocorticoid and (anti)androgenic activities. The human breast carcinoma MDA-kb2 cell line was utilized for reporter gene assays, since it expresses both the androgen and the glucocorticoid-responsive reporter. Two new antiandrogens, 4,4'-sulfonylbis(2-methylphenol) (dBPS) and 4,4'-thiodiphenol (THIO), and two new antiglucocorticoids, bisphenol Z and its analog bis[4-(2-hydroxyethoxy)phenyl] sulfone (BHEPS) were identified. Moreover, four new glucocorticoid agonists (methyl paraben, ethyl paraben, propyl paraben and bisphenol F) were found. To elucidate the structure-activity relationship of bisphenols, we performed molecular docking experiments with androgen and glucocorticoid receptor. These docking experiments had shown that bulky structures such as BHEPS and bisphenol Z act as antiglucocorticoid, because they are positioned toward helix H12 in the antagonist conformation and could therefore be responsible for H12 conformational change and the switch between agonistic and antagonistic conformation of receptor. On the other hand smaller structures cannot interact with H12. The results of in vitro screening of fifteen industrial chemicals as modulators of the glucocorticoid and androgen receptor activities demand additional in vivo testing of these chemicals for formulating any relevant hazard identification to human health.

  9. Development and exploitation of a novel mutant androgen receptor modelling strategy to identify new targets for advanced prostate cancer therapy.

    Science.gov (United States)

    O'Neill, Daniel; Jones, Dominic; Wade, Mark; Grey, James; Nakjang, Sirintra; Guo, Wenrui; Cork, David; Davies, Barry R; Wedge, Steve R; Robson, Craig N; Gaughan, Luke

    2015-09-22

    The persistence of androgen receptor (AR) signalling in castrate-resistant prostate cancer (CRPC) highlights the unmet clinical need for the development of more effective AR targeting therapies. A key mechanism of therapy-resistance is by selection of AR mutations that convert anti-androgens to agonists enabling the retention of androgenic signalling in CRPC. To improve our understanding of these receptors in advanced disease we developed a physiologically-relevant model to analyse the global functionality of AR mutants in CRPC. Using the bicalutamide-activated AR(W741L/C) mutation as proof of concept, we demonstrate that this mutant confers an androgenic-like signalling programme and growth promoting phenotype in the presence of bicalutamide. Transcriptomic profiling of AR(W741L) highlighted key genes markedly up-regulated by the mutant receptor, including TIPARP, RASD1 and SGK1. Importantly, SGK1 expression was found to be highly expressed in the KUCaP xenograft model and a CRPC patient biopsy sample both of which express the bicalutamide-activated receptor mutant. Using an SGK1 inhibitor, AR(W741L) transcriptional and growth promoting activity was reduced indicating that exploiting functional distinctions between receptor isoforms in our model may provide new and effective therapies for CRPC patients.

  10. In human granulosa cells from small antral follicles, androgen receptor mRNA and androgen levels in follicular fluid correlate with FSH receptor mRNA

    DEFF Research Database (Denmark)

    Nielsen, M. E.; Rasmussen, I. A.; Kristensen, Stine Gry;

    2011-01-01

    RNA analysis (24 women). Expression of Androgen Receptor (AR) mRNA levels in granulosa cells, and of androstenedione and testosterone in FF, were correlated to the expression of FSH receptor (FSHR), LH receptor (LHR), CYP19 and anti-Müllerian Hormone-receptor2 (AMHR2) mRNA in the granulosa cells and to the FF...... with the expression of AMHR2, but did not correlate with any of the hormones in the FF. These data demonstrate an intimate association between AR expression in immature granulosa cells, and the expression of FSHR in normal small human antral follicles and between the FF levels of androgen and FSHR expression...

  11. Androgen Receptor (AR) Promotes Abdominal Aortic Aneurysm (AAA) Development via Modulating Inflammatory IL1α and TGFβ1 Expression

    OpenAIRE

    Huang, Chiung-Kuei; Luo, Jie; Lai, Kuo-Pao; Wang, Ronghao; Pang, Haiyan; Chang, Eugene; Yan, Chen; Sparks, Janet; Lee, Soo Ok; Cho, Joshua; Chang, Chawnshang

    2015-01-01

    Gender difference is a risk factor for abdominal aortic aneurism formation yet the reason for male predominance remains unclear. Androgen and the androgen receptor influence the male gender difference, indicating that androgen receptor signaling may affect abdominal aortic aneurism development. Using angiotensin II induced abdominal aortic aneurism in apolipoprotein E null mouse models (82.4% abdominal aortic aneurism incidence), we found that mice lacking androgen receptor failed to develop ...

  12. Long CAG Repeat Sequence and Protein Expression of Androgen Receptor Considered as Prognostic Indicators in Male Breast Carcinoma

    OpenAIRE

    Yan-Ni Song; Jing-Shu Geng; Tong Liu; Zhen-Bin Zhong; Yang Liu; Bing-Shu Xia; Hong-Fei Ji; Xiao-Mei Li; Guo-Qiang Zhang; Yan-Lv Ren; Zhi-Gao Li; Da Pang

    2012-01-01

    BACKGROUND: The androgen receptor (AR) expression and the CAG repeat length within the AR gene appear to be involved in the carcinogenesis of male breast carcinoma (MBC). Although phenotypic differences have been observed between MBC and normal control group in AR gene, there is lack of correlation analysis between AR expression and CAG repeat length in MBC. The purpose of the study was to investigate the prognostic value of CAG repeat lengths and AR protein expression. METHODS: 81 tumor tiss...

  13. Selective androgen receptor modulator activity of a steroidal antiandrogen TSAA-291 and its cofactor recruitment profile.

    Science.gov (United States)

    Hikichi, Yukiko; Yamaoka, Masuo; Kusaka, Masami; Hara, Takahito

    2015-10-15

    Selective androgen receptor modulators (SARMs) specifically bind to the androgen receptor and exert agonistic or antagonistic effects on target organs. In this study, we investigated the SARM activity of TSAA-291, previously known as a steroidal antiandrogen, in mice because TSAA-291 was found to possess partial androgen receptor agonist activity in reporter assays. In addition, to clarify the mechanism underlying its tissue selectivity, we performed comprehensive cofactor recruitment analysis of androgen receptor using TSAA-291 and dihydrotestosterone (DHT), an endogenous androgen. The androgen receptor agonistic activity of TSAA-291 was more obvious in reporter assays using skeletal muscle cells than in those using prostate cells. In castrated mice, TSAA-291 increased the weight of the levator ani muscle without increasing the weight of the prostate and seminal vesicle. Comprehensive cofactor recruitment analysis via mammalian two-hybrid methods revealed that among a total of 112 cofactors, 12 cofactors including the protein inhibitor of activated STAT 1 (PIAS1) were differently recruited to androgen receptor in the presence of TSAA-291 and DHT. Prostate displayed higher PIAS1 expression than skeletal muscle. Forced expression of the PIAS1 augmented the transcriptional activity of the androgen receptor, and silencing of PIAS1 by siRNAs suppressed the secretion of prostate-specific antigen, an androgen responsive marker. Our results demonstrate that TSAA-291 has SARM activity and suggest that TSAA-291 may induce different conformational changes of the androgen receptor and recruitment profiles of cofactors such as PIAS1, compared with DHT, to exert tissue-specific activity.

  14. Bisphenol A affects androgen receptor function via multiple mechanisms.

    Science.gov (United States)

    Teng, Christina; Goodwin, Bonnie; Shockley, Keith; Xia, Menghang; Huang, Ruili; Norris, John; Merrick, B Alex; Jetten, Anton M; Austin, Christopher P; Tice, Raymond R

    2013-05-25

    Bisphenol A (BPA), is a well-known endocrine disruptor compound (EDC) that affects the normal development and function of the female and male reproductive system, however the mechanisms of action remain unclear. To investigate the molecular mechanisms of how BPA may affect ten different nuclear receptors, stable cell lines containing individual nuclear receptor ligand binding domain (LBD)-linked to the β-Gal reporter were examined by a quantitative high throughput screening (qHTS) format in the Tox21 Screening Program of the NIH. The results showed that two receptors, estrogen receptor alpha (ERα) and androgen receptor (AR), are affected by BPA in opposite direction. To confirm the observed effects of BPA on ERα and AR, we performed transient transfection experiments with full-length receptors and their corresponding response elements linked to luciferase reporters. We also included in this study two BPA analogs, bisphenol AF (BPAF) and bisphenol S (BPS). As seen in African green monkey kidney CV1 cells, the present study confirmed that BPA and BPAF act as ERα agonists (half maximal effective concentration EC50 of 10-100 nM) and as AR antagonists (half maximal inhibitory concentration IC50 of 1-2 μM). Both BPA and BPAF antagonized AR function via competitive inhibition of the action of synthetic androgen R1881. BPS with lower estrogenic activity (EC50 of 2.2 μM), did not compete with R1881 for AR binding, when tested at 30 μM. Finally, the effects of BPA were also evaluated in a nuclear translocation assays using EGPF-tagged receptors. Similar to 17β-estradiol (E2) which was used as control, BPA was able to enhance ERα nuclear foci formation but at a 100-fold higher concentration. Although BPA was able to bind AR, the nuclear translocation was reduced. Furthermore, BPA was unable to induce functional foci in the nuclei and is consistent with the transient transfection study that BPA is unable to activate AR.

  15. The androgenic anabolic steroid tetrahydrogestrinone produces dioxin-like effects via the aryl hydrocarbon receptor.

    Science.gov (United States)

    Moon, Hyo Youl; Kim, Sun-Hee; Ryu, Sung Ho; Suh, Pann-Ghill

    2012-10-01

    For a long time, athletes have used androgenic anabolic steroids (AASs) in an inappropriate and veiled manner with the aim of improving exercise performance or for cosmetic purposes. Abuse of AASs triggers adverse effects such as hepatocarcinogenesis, heart attacks, and aggressive behavior. However, AAS-induced toxicity is not completely understood at the molecular level. In the present study, we showed, by performing a dioxin response element (DRE)-luciferase reporter gene assay, that tetrahydrogestrinone (THG), a popular and potent androgen receptor agonist, has dioxin-like effects. In addition, we showed that THG increased cytochrome P-450 1A1 (CYP1A1) mRNA and protein levels, and enzyme activity. The gene encoding CYP1A1 is involved in phase 1 xenobiotic metabolism and a target gene of the aryl hydrocarbon receptor (AhR). Using the AhR antagonist CH-223191, we also examined whether the effects of THG on DRE activation depended on AhR. Our results suggest that synthetic anabolic steroids may have dioxin-like side effects that can disturb endocrine systems and may cause other side effects including cancer through AhR.

  16. Promoter-dependent activity on androgen receptor N-terminal domain mutations in androgen insensitivity syndrome.

    Science.gov (United States)

    Tadokoro-Cuccaro, Rieko; Davies, John; Mongan, Nigel P; Bunch, Trevor; Brown, Rosalind S; Audi, Laura; Watt, Kate; McEwan, Iain J; Hughes, Ieuan A

    2014-01-01

    Androgen receptor (AR) mutations are associated with androgen insensitivity syndrome (AIS). Missense mutations identified in the AR-N-terminal domain (AR-NTD) are rare, and clinical phenotypes are typically mild. We investigated 7 missense mutations and 2 insertion/deletions located in the AR-NTD. This study aimed to elucidate the pathogenic role of AR-NTD mutants in AIS and to use this knowledge to further define AR-NTD function. AR-NTD mutations (Q120E, A159T, G216R, N235K, G248V, L272F, and P380R) were introduced into AR-expression plasmids. Stably expressing cell lines were established for del57L and ins58L. Transactivation was measured using luciferase reporter constructs under the control of GRE and Pem promoters. Intrinsic fluorescence spectroscopy and partial proteolysis studies were performed for mutations which showed reduced activities by using a purified AR-AF1 protein. Pem-luciferase reporter activation was reduced for A159T, N235K, and G248V but not the GRE-luciferase reporter. Protein structure analysis detected no significant change in the AR-AF1 region for these mutations. Reduced cellular expression and transactivation activity were observed for ins58L. The mutations Q120E, G216R, L272F, P380R, and del57L showed small or no detectable changes in function. Thus, clinical and experimental analyses have identified novel AR-signalling defects associated with mutations in the structurally disordered AR-NTD domain in patients with AIS.

  17. Novel selective androgen receptor modulators: SAR studies on 6-bisalkylamino-2-quinolinones.

    Science.gov (United States)

    van Oeveren, Arjan; Motamedi, Mehrnoush; Martinborough, Esther; Zhao, Shuo; Shen, Yixing; West, Sarah; Chang, William; Kallel, Adam; Marschke, Keith B; López, Francisco J; Negro-Vilar, Andrés; Zhi, Lin

    2007-03-15

    A series of selective androgen receptor modulators (SARMs) with a wide spectrum of receptor modulating activities was developed based on optimization of the 4-substituted 6-bisalkylamino-2-quinolinones (3). Significance of the trifluoromethyl group on the side chains and its interactions with amino acid residues within the androgen receptor (AR) ligand binding domain are discussed. A representative analog (9) was tested orally in a rodent model of hypogonadism and demonstrated desirable tissue selectivity.

  18. The neuroendocrine-derived peptide parathyroid hormone-related protein promotes prostate cancer cell growth by stabilizing the androgen receptor.

    Science.gov (United States)

    DaSilva, John; Gioeli, Daniel; Weber, Michael J; Parsons, Sarah J

    2009-09-15

    During progression to an androgen-independent state following androgen ablation therapy, prostate cancer cells continue to express the androgen receptor (AR) and androgen-regulated genes, indicating that AR is critical for the proliferation of hormone-refractory prostate cancer cells. Multiple mechanisms have been proposed for the development of AR-dependent hormone-refractory disease, including changes in expression of AR coregulatory proteins, AR mutation, growth factor-mediated activation of AR, and AR protein up-regulation. The most prominent of these progressive changes is the up-regulation of AR that occurs in >90% of prostate cancers. A common feature of the most aggressive hormone-refractory prostate cancers is the accumulation of cells with neuroendocrine characteristics that produce paracrine factors and may provide a novel mechanism for the regulation of AR during advanced stages of the disease. In this study, we show that neuroendocrine-derived parathyroid hormone-related protein (PTHrP)-mediated signaling through the epidermal growth factor receptor (EGFR) and Src pathways contributes to the phenotype of advanced prostate cancer by reducing AR protein turnover. PTHrP-induced accumulation of AR depended on the activity of Src and EGFR and consequent phosphorylation of the AR on Tyr(534). PTHrP-induced tyrosine phosphorylation of AR resulted in reduced AR ubiquitination and interaction with the ubiquitin ligase COOH terminus of Hsp70-interacting protein. These events result in increased accumulation of AR and thus enhanced growth of prostate cancer cells at low levels of androgen.

  19. Inhibition of human prostate cancer xenograft growth by 125I labeled triple-helin forming oligonucleotide directed against androgen receptor

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yong; MA Yi; LU Han-ping; GAO Jin-hui; LIANG Chang-sheng; LIU Chang-zheng; ZOU Jun-tao; WANG Hua-qiao

    2008-01-01

    Background The failure of hormone treatment for advanced prostate cancer might be related to aberrant activation of the androgen receptor.We have shown that 125I labeled triple-helix forming oligonucleotide (TFO) against the androgen receptor gene inhibits androgen receptor expression and cell proliferation of LNCaP prostate cancer cells in vitro.This study aimed at exploring the effects of the 125I-TFO on prostate tumor growth in vivo using a nude mouse xenograft model.Methods TFO was labeled with 125I by the iodogen method.Thirty-two nude mice bearing LNCaP xenograft tumors were randomized into 4 groups and were intratumorally injected with 125I-TFO,unlabeled TFO,Na125I and normal saline.Tumor size was measured weekly.The tumor growth inhibition rate (RI) was calculated by measurement of tumor weight.The expression of the androgen receptor gene was performed by RT-PCR and immunohistochemical study.The prostate specific antigen (PSA) serum levels were measured by enzyme linked immunosorbent assay.The tumor cell apoptosis index (Al) was detected by TUNEL assay.Results Tumor measurements showed that tumor development was significantly inhibited by either 125I-TFO or TFO,with tumor RIs of 50.79% and 32.80% respectively.125I-TFO caused greater inhibition of androgen receptor expression and higher Als in tumor tissue than TFO.Both the tumor weight and the PSA serum levels in 125I-TFO treated mice ((0.93±0.15) g and (17.43±1.85) ng/ml,respectively) were significantly lower than those ((1.27±0.21) g and (28.25±3.41)ng/ml,respectively) in TFO treated mice (all P<0.05).Na125I did not significantly affect tumor growth and androgen receptor expression in tumor tissue.Conclusions The 125I-TFO can effectively inhibit androgen receptor expression and tumor growth of human prostate cancer xenografts in vivo.The inhibitory efficacy of 125I-TFO is more potent than that of TFO,providing a reference for future studies of antigen radiotherapy.

  20. Normal phenotype in conditional androgen receptor (AR) exon 3-floxed neomycin-negative male mice.

    Science.gov (United States)

    Rana, Kesha; Clarke, Michele V; Zajac, Jeffrey D; Davey, Rachel A; MacLean, Helen E

    2014-01-01

    Androgens (testosterone and dihydrotestosterone) acting via the androgen receptor (AR) are required for male sexual differentiation, and also regulate the development of many other tissues including muscle, fat and bone. We previously generated an AR(lox) mouse line with exon 3 of the AR gene targeted by loxP sites. The deletion of exon 3 is in-frame, so only the DNA binding-dependent actions of the AR are deleted, but non-DNA binding-dependent actions are retained. This line also contained an antibiotic resistance selection cassette, neomycin (neo) in intron 3, which was also flanked by loxP sites. Hemizygous AR(lox) male mice demonstrated a phenotype of hyperandrogenization, with increased mass of androgen-dependent tissues. We hypothesized that this hyperandrogenization was likely to be due to the presence of the neo cassette. In this study, we have generated an AR(lox) neo-negative mouse line, using the EIIa-cre deleter mouse line to remove the neo cassette. Hemizygous AR(lox) neo-negative male mice have a normal phenotype, with normal body mass and normal mass of androgen-dependent tissues including the testis, seminal vesicles, kidney, spleen, heart and retroperitoneal fat. This neo-negative exon 3-targeted mouse line is the only floxed AR mouse line available to study the DNA binding-dependent actions of the AR in a tissue-specific manner, and is suitable for investigation in all tissues. This study demonstrates the importance of removing the selection cassette, which can potentially alter the phenotype of floxed mouse lines even in the absence of detectable effects on target gene expression.

  1. Repression of androgen receptor transcription through the E2F1/DNMT1 axis.

    Directory of Open Access Journals (Sweden)

    Conrad David Valdez

    Full Text Available Although androgen receptor (AR function has been extensively studied, regulation of the AR gene itself has been much less characterized. In this study, we observed a dramatic reduction in the expression of androgen receptor mRNA and protein in hyperproliferative prostate epithelium of keratin 5 promoter driven E2F1 transgenic mice. To confirm an inhibitory function for E2F1 on AR transcription, we showed that E2F1 inhibited the transcription of endogenous AR mRNA, subsequent AR protein, and AR promoter activity in both human and mouse epithelial cells. E2F1 also inhibited androgen-stimulated activation of two AR target gene promoters. To elucidate the molecular mechanism of E2F-mediated inhibition of AR, we evaluated the effects of two functional E2F1 mutants on AR promoter activity and found that the transactivation domain appears to mediate E2F1 repression of the AR promoter. Because DNMT1 is a functional intermediate of E2F1 we examined DNMT1 function in AR repression. Repression of endogenous AR in normal human prostate epithelial cells was relieved by DNMT1 shRNA knock down. DNMT1 was shown to be physically associated within the AR minimal promoter located 22 bps from the transcription start site; however, methylation remained unchanged at the promoter regardless of DNMT1 expression. Taken together, our results suggest that DNMT1 operates either as a functional intermediary or in cooperation with E2F1 inhibiting AR gene expression in a methylation independent manner.

  2. Humanized Androgen Receptor Mice: A Genetic Model for Differential Response to Prostate Cancer Therapy

    Science.gov (United States)

    2012-07-01

    address at the International Conference on Hormonal Steroids and Hormones & Cancer, Edinburgh, Scotland , 09/22/2010; Genetic Variation of the Androgen...Ferrell, R.E., Roth , S.M., 2005. Androgen receptor CAG repeat polymorphism is associated with fat-free mass in men. J. Appl. Physiol. 98, 132–137. Wu, C.T

  3. Identification of a Novel Androgen Receptor Mutation in a Family With Multiple Components Compatible With the Testicular Dysgenesis Syndrome

    DEFF Research Database (Denmark)

    Lottrup, Grete; Jørgensen, Anne; Nielsen, John E.;

    2013-01-01

    Context: Androgen signaling via the androgen receptor (AR) is essential for normal testis development and male reproductive functions. We describe a rare family with 3 males affected by a mild disorder of sex determination compatible with testicular dysgenesis syndrome (TDS), including subfertility......, cryptorchidism, hypospadias, and testicular cancer, caused by a novel AR mutation.Objective: The aim of this study was to describe the phenotype of the affected males, characterize functionally the novel AR mutation, and discuss the significance of partial androgen insufficiency in the pathogenesis of TDS...... analysis of the mutation in a gene-reporter assay showed a 50% reduction in AR-induced transcriptional activity. The affected males had elevated LH and T in accordance with decreased AR signaling. The histology and immunohistochemical profile of the testis tissue from the 2 patients with testicular cancer...

  4. Androgen Receptor Coactivator ARID4B Is Required for the Function of Sertoli Cells in Spermatogenesis.

    Science.gov (United States)

    Wu, Ray-Chang; Zeng, Yang; Pan, I-Wen; Wu, Mei-Yi

    2015-09-01

    Defects in spermatogenesis, a process that produces spermatozoa inside seminiferous tubules of the testis, result in male infertility. Spermatogenic progression is highly dependent on a microenvironment provided by Sertoli cells, the only somatic cells and epithelium of seminiferous tubules. However, genes that regulate such an important activity of Sertoli cells are poorly understood. Here, we found that AT-rich interactive domain 4B (ARID4B), is essential for the function of Sertoli cells to regulate spermatogenesis. Specifically, we generated Sertoli cell-specific Arid4b knockout (Arid4bSCKO) mice, and showed that the Arid4bSCKO male mice were completely infertile with impaired testis development and significantly reduced testis size. Importantly, severe structural defects accompanied by loss of germ cells and Sertoli cell-only phenotype were found in many seminiferous tubules of the Arid4bSCKO testes. In addition, maturation of Sertoli cells was significantly delayed in the Arid4bSCKO mice, associated with delayed onset of spermatogenesis. Spermatogenic progression was also defective, showing an arrest at the round spermatid stage in the Arid4bSCKO testes. Interestingly, we showed that ARID4B functions as a "coactivator" of androgen receptor and is required for optimal transcriptional activation of reproductive homeobox 5, an androgen receptor target gene specifically expressed in Sertoli cells and critical for spermatogenesis. Together, our study identified ARID4B to be a key regulator of Sertoli cell function important for male germ cell development.

  5. GON4L Drives Cancer Growth through a YY1-Androgen Receptor-CD24 Axis.

    Science.gov (United States)

    Agarwal, Neeraj; Dancik, Garrett M; Goodspeed, Andrew; Costello, James C; Owens, Charles; Duex, Jason E; Theodorescu, Dan

    2016-09-01

    In principle, the inhibition of candidate gain-of-function genes defined through genomic analyses of large patient cohorts offers an attractive therapeutic strategy. In this study, we focused on changes in expression of CD24, a well-validated clinical biomarker of poor prognosis and a driver of tumor growth and metastasis, as a benchmark to assess functional relevance. Through this approach, we identified GON4L as a regulator of CD24 from screening a pooled shRNA library of 176 candidate gain-of-function genes. GON4L depletion reduced CD24 expression in human bladder cancer cells and blocked cell proliferation in vitro and tumor xenograft growth in vivo Mechanistically, GON4L interacted with transcription factor YY1, promoting its association with the androgen receptor to drive CD24 expression and cell growth. In clinical bladder cancer specimens, expression of GON4L, YY1, and CD24 was elevated compared with normal bladder urothelium. This pathway is biologically relevant in other cancer types as well, where CD24 and the androgen receptor are clinically prognostic, given that silencing of GON4L and YY1 suppressed CD24 expression and growth of human lung, prostate, and breast cancer cells. Overall, our results define GON4L as a novel driver of cancer growth, offering new biomarker and therapeutic opportunities. Cancer Res; 76(17); 5175-85. ©2016 AACR.

  6. Antiandrogens act as selective androgen receptor modulators at the proteome level in prostate cancer cells.

    Science.gov (United States)

    Brooke, Greg N; Gamble, Simon C; Hough, Michael A; Begum, Shajna; Dart, D Alwyn; Odontiadis, Michael; Powell, Sue M; Fioretti, Flavia M; Bryan, Rosie A; Waxman, Jonathan; Wait, Robin; Bevan, Charlotte L

    2015-05-01

    Current therapies for prostate cancer include antiandrogens, inhibitory ligands of the androgen receptor, which repress androgen-stimulated growth. These include the selective androgen receptor modulators cyproterone acetate and hydroxyflutamide and the complete antagonist bicalutamide. Their activity is partly dictated by the presence of androgen receptor mutations, which are commonly detected in patients who relapse while receiving antiandrogens, i.e. in castrate-resistant prostate cancer. To characterize the early proteomic response to these antiandrogens we used the LNCaP prostate cancer cell line, which harbors the androgen receptor mutation most commonly detected in castrate-resistant tumors (T877A), analyzing alterations in the proteome, and comparing these to the effect of these therapeutics upon androgen receptor activity and cell proliferation. The majority are regulated post-transcriptionally, possibly via nongenomic androgen receptor signaling. Differences detected between the exposure groups demonstrate subtle changes in the biological response to each specific ligand, suggesting a spectrum of agonistic and antagonistic effects dependent on the ligand used. Analysis of the crystal structures of the AR in the presence of cyproterone acetate, hydroxyflutamide, and DHT identified important differences in the orientation of key residues located in the AF-2 and BF-3 protein interaction surfaces. This further implies that although there is commonality in the growth responses between androgens and those antiandrogens that stimulate growth in the presence of a mutation, there may also be influential differences in the growth pathways stimulated by the different ligands. This therefore has implications for prostate cancer treatment because tumors may respond differently dependent upon which mutation is present and which ligand is activating growth, also for the design of selective androgen receptor modulators, which aim to elicit differential proteomic

  7. Photoperiod and testosterone regulate androgen receptor immunostaining in the Siberian hamster brain.

    Science.gov (United States)

    Bittman, Eric L; Ehrlich, David A; Ogdahl, Justyne L; Jetton, Amy E

    2003-09-01

    Day length regulates the effects of gonadal steroids on gonadotropin secretion and behavior in seasonal breeders. To determine whether this influence of photoperiod results from changes in androgen receptor expression in Siberian hamster brain regions that regulate neuroendocrine function, androgen receptor immunostaining was examined in castrated animals given either no androgen replacement or one of three doses of testosterone (T) resulting in physiological serum concentrations. Half of the animals were housed under inhibitory photoperiod conditions, and immunostaining was quantified 11 days later. Measurement of serum gonadotropin and prolactin concentrations confirmed that androgen exerted graded effects on pituitary function but that the animals were killed before photoperiodic influences had fully developed. T significantly increased the numbers of androgen receptor-immunoreactive cells in every brain region examined. Photoperiod exerted no significant influence on androgen receptor-immunoreactive cell number in the arcuate nucleus, bed nucleus of the stria terminalis (BNST), medial preoptic nucleus, or in medial amygdala. An interaction between T and photoperiod was observed in the BNST and in the rostral and middle portions of the arcuate nucleus. Although increasing concentrations of T resulted in more intense cellular immunostaining in the BNST and arcuate, this effect was not influenced by day length. These results indicate that relatively short-duration (11 days) exposure to inhibitory photoperiod triggers localized and regionally specific changes in androgen receptor expression.

  8. [Myoanabolic steroids and selective androgen receptor modulators: mechanism of action and perspectives].

    Science.gov (United States)

    Tóth, Miklós

    2009-11-01

    Interest in anabolic steroids has been renewed in the last decade with the discovery of tissue-selective androgen receptor modulators exhibiting high myotropic and small androgenic activity. An explanation put forward by us in 1982 for the mechanism of the preferential myotropic effect of nandrolone (19-nortestosterone) exploits the fundamental difference between the 5alpha-reductase concentrations in skeletal muscle and androgenic target tissue. In androgenic tissue, testosterone is converted to the more potent 5alpha-dihydrotestosterone whereas nandrolone is converted to a less potent derivative. As 5alpha-reduction is negligible in skeletal muscle, this explains why nandrolone shows a greater myotropic to androgenic ratio when compared with testosterone. Anabolic steroids that do not undergo 5alpha-reduction exert myotropic-androgenic dissociation because their effect in androgenic tissues is not amplified by 5alpha-reduction. Tissue selectivity by receptor modulators may be achieved by inducing specific conformational changes of the androgen receptor that affect its interaction with transcriptional coregulators. Anabolic activity is mediated by the stimulation of ribosomal RNA synthesis therefore regulation of this synthesis by anabolic steroids would deserve detailed studies.

  9. INTERACTION OF ORGANOPHOSPHATE PESTICIDES AND RELATED COMPOUNDS WITH THE ANDROGEN RECEPTOR

    Science.gov (United States)

    Identification of several environmental chemicals capable of binding to the androgen receptor (AR) and interfering with its normal function has heightened concern for adverse effects across a broad spectrum of environmental chemicals. We previously demonstrated AR antagonist act...

  10. A Recurrent Germline Mutation in the 5'UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation.

    Science.gov (United States)

    Hornig, Nadine C; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

    2016-01-01

    A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5' untranslated region (5'-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5'UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5'UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general.

  11. A Recurrent Germline Mutation in the 5'UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation.

    Directory of Open Access Journals (Sweden)

    Nadine C Hornig

    Full Text Available A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS generating an upstream open reading frame (uORF in the 5' untranslated region (5'-UTR of the androgen receptor (AR gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5'UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5'UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general.

  12. A Recurrent Germline Mutation in the 5’UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation

    Science.gov (United States)

    Hornig, Nadine C.; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E.; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

    2016-01-01

    A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5’ untranslated region (5’-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5′UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5′UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general. PMID:27110943

  13. Androgen Receptor Gene Polymorphism and Breast Cancer Risk%AR基因外显子1的CAG重复多态性与乳腺癌发生的关系

    Institute of Scientific and Technical Information of China (English)

    孟洁; 付丽

    2012-01-01

    Objective To assess the association between AR ( Androgen Receptor ) gene polymorphism[ CAG ]n in exon 1 and breast cancer. Methods 50 cases of breast cancer and 50 controls were collected. DNA was extracted from peripheral blood leukocytes. The encoding sequence of AR gene exonl was amplified by PCR. After direct sequencing of PCR products,the CAG repeats were calculated. The Wilcoxon rank test was used to compare the distributions of the [ CAG ]n. Breast cancer risk was assessed using multivariate logistic regression. Results The [ CAG ]n was 15 ~26 for cases and was 16 ~26 for controls. The distribution of [ CAG ]n for cases and controls was different P =0.015 ). Women for whom the [ CAG ]n was ≥24 units had approximately 5. 6 risk of breast cancer compared [ CAG ]n ≤20 ( P =0. 04,OR =5. 6 ). Conclusion These data suggest that AR gene exonl[ CAG ]n has influence on breast cancer, and longer AR [ CAG ]n may increase breast cancer risk.%目的 探讨AR(雄激素受体)基因外显子1的CAG重复多态性与乳腺癌发生的关系.方法 研究对象为50例乳腺癌患者和50例健康者,从外周血淋巴细胞中提取基因组DNA,对AR基因外显子1的编码序列进行PCR扩增,扩增产物进行DNA序列测定,计算CAG重复频率.Wilcoxon rank test 比较病例组和对照组的[CAG]n分布,采用多因素log回归分析[CAG]n对乳腺癌发病风险的影响.结果 病例组[CAG]n为15~26,对照组为16~26;两组重复频率分布有差异(P=0.015),[CAG]n≥24时乳腺癌发病风险为[CAG]n≤20的5.6倍(P=0.04,OR=5.6).结论 AR基因外显子1的CAG重复频率对乳腺癌风险发病有影响,长[CAG]n可增大乳腺癌发病风险.

  14. Obstructing Androgen Receptor Activation in Prostate Cancer Cells Through Post-translational Modification by NEDD8

    Science.gov (United States)

    2012-11-01

    Nonidet P - 40 ). Pre-cleared with 25 µl protein-A/G agarose beads, 700 µg lysate was subjected to immunoprecipitation with 20 µl anti-FLAG antibody...cell growth. REPORTABLE OUTCOMES: 1. Chang, K. H., Hsiao, P .-W. and Chen, J. D. Modulation of Androgen Receptor Activity by Reversible NEDD8...Hsiao, P .-W. and Chen, J. D. Modulation of Androgen Receptor Activity by Reversible NEDD8 Modification. (under revision) 1 Modulation of

  15. Selective androgen receptor modulators in drug discovery: medicinal chemistry and therapeutic potential.

    Science.gov (United States)

    Cadilla, Rodolfo; Turnbull, Philip

    2006-01-01

    Modulation of the androgen receptor has the potential to be an effective treatment for hypogonadism, andropause, and associated conditions such as sarcopenia, osteoporosis, benign prostatic hyperplasia, and sexual dysfunction. Side effects associated with classical anabolic steroid treatments have driven the quest for drugs that demonstrate improved therapeutic profiles. Novel, non-steroidal compounds that show tissue selective activity and improved pharmacokinetic properties have been developed. This review provides an overview of current advances in the development of selective androgen receptor modulators (SARMs).

  16. The antiandrogenic effect of finasteride against a mutant androgen receptor.

    Science.gov (United States)

    Wu, Yue; Chhipa, Rishi Raj; Zhang, Haitao; Ip, Clement

    2011-05-15

    Finasteride is known to inhibit Type 2 5α-reductase and thus block the conversion of testosterone to dihydrotestosterone (DHT). The structural similarity of finasteride to DHT raises the possibility that finasteride may also interfere with the function of the androgen receptor (AR). Experiments were carried out to evaluate the antiandrogenic effect of finasteride in LNCaP, C4-2 and VCaP human prostate cancer cells. Finasteride decreased DHT binding to AR, and DHT-stimulated AR activity and cell growth in LNCaP and C4-2 cells, but not in VCaP cells. LNCaP and C4-2 (derived from castration-resistant LNCaP) cells express the T877A mutant AR, while VCaP cells express the wild type AR. When PC-3 cells, which are AR-null, were transfected with either the wild type or the T877A mutant AR, only the mutant AR-expressing cells were sensitive to finasteride inhibition of DHT binding. Peroxiredoxin-1 (Prx1) is a novel endogenous facilitator of AR binding to DHT. In Prx1-rich LNCaP cells, the combination of Prx1 knockdown and finasteride was found to produce a greater inhibitory effect on AR activity and cell growth than either treatment alone. The observation suggests that cells with a low expression of Prx1 are likely to be more responsive to the antiandrogenic effect of finasteride. Additional studies showed that the efficacy of finasteride was comparable to that of bicalutamide (a widely used non-steroidal antiandrogen). The implication of the above findings is discussed in the context of developing strategies to improve the outcome of androgen deprivation therapy.

  17. Development of an endogenous androgen receptor-mediated luciferase expression assay (AR-LUX) for interactive androgenic action

    NARCIS (Netherlands)

    Blankvoort, B.M.G.

    2003-01-01

    The research described in this thesis was aimed at developing an in vitro cell-based reporter gene system applicable to the detection of the illegal use of androgenic growth promoters in cattle, and the presence of potential endocrine disrupters present in surface waters and interfering with androge

  18. Nuclear transportation of exogenous epidermal growth factor receptor and androgen receptor via extracellular vesicles.

    Science.gov (United States)

    Read, Jolene; Ingram, Alistair; Al Saleh, Hassan A; Platko, Khrystyna; Gabriel, Kathleen; Kapoor, Anil; Pinthus, Jehonathan; Majeed, Fadwa; Qureshi, Talha; Al-Nedawi, Khalid

    2017-01-01

    Epidermal growth factor receptor (EGFR) plays a central role in the progression of several human malignancies. Although EGFR is a membrane receptor, it undergoes nuclear translocation, where it has a distinct signalling pathway. Herein, we report a novel mechanism by which cancer cells can directly transport EGFR to the nucleus of other cells via extracellular vesicles (EVs). The transported receptor is active and stimulates the nuclear EGFR pathways. Interestingly, the translocation of EGFR via EVs occurs independently of the nuclear localisation sequence that is required for nuclear translocation of endogenous EGFR. Also, we found that the mutant receptor EGFRvIII could be transported to the nucleus of other cells via EVs. To assess the role of EVs in the regulation of an actual nuclear receptor, we studied the regulation of androgen receptor (AR). We found that full-length AR and mutant variant ARv7 are secreted in EVs derived from prostate cancer cell lines and could be transported to the nucleus of AR-null cells. The EV-derived AR was able to bind the androgen-responsive promoter region of prostate specific antigen, and recruit RNA Pol II, an indication of active transcription. The nuclear-translocated AR via EVs enhanced the proliferation of acceptor cells in the absence of androgen. Finally, we provide evidence that nuclear localisation of AR could occur in vivo via orthotopically-injected EVs in male SCID mice prostate glands. To our knowledge, this is the first study showing the nuclear translocation of nuclear receptors via EVs, which significantly extends the role of EVs as paracrine transcriptional regulators.

  19. Lestaurtinib inhibits histone phosphorylation and androgen-dependent gene expression in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Jens Köhler

    Full Text Available BACKGROUND: Epigenetics is defined as heritable changes in gene expression that are not based on changes in the DNA sequence. Posttranslational modification of histone proteins is a major mechanism of epigenetic regulation. The kinase PRK1 (protein kinase C related kinase 1, also known as PKN1 phosphorylates histone H3 at threonine 11 and is involved in the regulation of androgen receptor signalling. Thus, it has been identified as a novel drug target but little is known about PRK1 inhibitors and consequences of its inhibition. METHODOLOGY/PRINCIPAL FINDING: Using a focused library screening approach, we identified the clinical candidate lestaurtinib (also known as CEP-701 as a new inhibitor of PRK1. Based on a generated 3D model of the PRK1 kinase using the homolog PKC-theta (protein kinase c theta protein as a template, the key interaction of lestaurtinib with PRK1 was analyzed by means of molecular docking studies. Furthermore, the effects on histone H3 threonine phosphorylation and androgen-dependent gene expression was evaluated in prostate cancer cells. CONCLUSIONS/SIGNIFICANCE: Lestaurtinib inhibits PRK1 very potently in vitro and in vivo. Applied to cell culture it inhibits histone H3 threonine phosphorylation and androgen-dependent gene expression, a feature that has not been known yet. Thus our findings have implication both for understanding of the clinical activity of lestaurtinib as well as for future PRK1 inhibitors.

  20. Androgen receptor serine 81 phosphorylation mediates chromatin binding and transcriptional activation.

    Science.gov (United States)

    Chen, Shaoyong; Gulla, Sarah; Cai, Changmeng; Balk, Steven P

    2012-03-01

    Our previous findings indicated that androgen receptor (AR) phosphorylation at serine 81 is stimulated by the mitotic cyclin-dependent kinase 1 (CDK1). In this report, we extended our previous study and confirmed that Ser-81 phosphorylation increases during mitosis, coincident with CDK1 activation. We further showed blocking cell cycle at G(1) or S phase did not disrupt androgen-induced Ser-81 phosphorylation and AR-dependent transcription, consistent with a recent report that AR was phosphorylated at Ser-81 and activated by the transcriptional CDK9. To assess the function of Ser-81 phosphorylation in prostate cancer (PCa) cells expressing endogenous AR, we developed a ligand switch strategy using a ligand-binding domain mutation (W741C) that renders AR responsive to the antagonist bicalutamide. An S81A/W741C double mutant AR stably expressed in PCa cells failed to transactivate the endogenous AR-regulated PSA or TMPRSS2 genes. ChIP showed that the S81A mutation prevented ligand-induced AR recruitment to these genes, and cellular fractionation revealed that the S81A mutation globally abrogated chromatin binding. Conversely, the AR fraction rapidly recruited to chromatin after androgen stimulation was highly enriched for Ser-81 phosphorylation. Finally, inhibition of CDK1 and CDK9 decreased AR Ser-81 phosphorylation, chromatin binding, and transcriptional activity. These findings indicate that Ser-81 phosphorylation by CDK9 stabilizes AR chromatin binding for transcription and suggest that CDK1-mediated Ser-81 phosphorylation during mitosis provides a pool of Ser-81 phosphorylation AR that can be readily recruited to chromatin for gene reactivation and may enhance AR activity in PCa.

  1. Ligand-dependent inhibition of beta-catenin/TCF signaling by androgen receptor.

    Science.gov (United States)

    Chesire, Dennis R; Isaacs, William B

    2002-12-01

    Beta-catenin signaling may contribute to prostate cancer (CaP) progression. Although beta-catenin is known to upregulate T cell factor (TCF) target gene expression in CaP cells, recent evidence demonstrates its capacity to enhance ligand-dependent androgen receptor (AR) function. Thus, we wished to further understand the interaction between these two pathways. We find in both CaP cells (CWR22-Rv1, LAPC-4, DU145) and non-CaP cells (HEK-293, TSU, SW480, HCT-116) that beta-catenin/TCF-related transcription (CRT), as measured by activation of a synthetic promoter and that of cyclin D1, is inhibited by androgen treatment. This inhibition is AR-dependent, as it only occurs in cells expressing AR endogenously or transiently, and is abrogated by AR antagonists. Additional analyses convey that the ligand-dependent nature of CRT suppression depends on transactivation-competent AR in the nucleus, but not on indirect effects stemming from AR target gene expression. Given the recent work identifying an AR/beta-catenin interaction, and from our finding that liganded AR does not prompt gross changes in the constitutive nuclear localization of TCF4 or mutant beta-catenin, we hypothesized that transcription factor (i.e. AR and TCF) competition for beta-catenin recruitment may explain, in part, androgen-induced suppression of CRT. To address this idea, we expressed an AR mutant lacking its DNA-binding domain (DBD). This receptor could not orchestrate ligand-dependent CRT repression, thereby providing support for those recent data implicating the AR DBD/LBD as necessary for beta-catenin interaction. Further supporting this hypothesis, TCF/LEF over-expression counteracts androgen-induced suppression of CRT, and requires beta-catenin binding activity to do so. Interestingly, TCF4 over-expression potently antagonizes AR function; however, this inhibition may occur independently of beta-catenin/TCF4 interaction. These results from TCF4 over-expression analyses, taken together, provide

  2. Selective androgen receptor modulator RAD140 is neuroprotective in cultured neurons and kainate-lesioned male rats.

    Science.gov (United States)

    Jayaraman, Anusha; Christensen, Amy; Moser, V Alexandra; Vest, Rebekah S; Miller, Chris P; Hattersley, Gary; Pike, Christian J

    2014-04-01

    The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed "selective androgen receptor modulators" (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in select androgen-responsive tissues. The efficacy of SARMs in brain is largely unknown. In this study, we investigate the SARM RAD140 in cultured rat neurons and male rat brain for its ability to provide neuroprotection, an important neural action of endogenous androgens that is relevant to neural health and resilience to neurodegenerative diseases. In cultured hippocampal neurons, RAD140 was as effective as testosterone in reducing cell death induced by apoptotic insults. Mechanistically, RAD140 neuroprotection was dependent upon MAPK signaling, as evidenced by elevation of ERK phosphorylation and inhibition of protection by the MAPK kinase inhibitor U0126. Importantly, RAD140 was also neuroprotective in vivo using the rat kainate lesion model. In experiments with gonadectomized, adult male rats, RAD140 was shown to exhibit peripheral tissue-specific androgen action that largely spared prostate, neural efficacy as demonstrated by activation of androgenic gene regulation effects, and neuroprotection of hippocampal neurons against cell death caused by systemic administration of the excitotoxin kainate. These novel findings demonstrate initial preclinical efficacy of a SARM in neuroprotective actions relevant to Alzheimer's disease and related neurodegenerative diseases.

  3. How strong is the association between CAG and GGN repeat length polymorphisms in the androgen receptor gene and prostate cancer risk?

    NARCIS (Netherlands)

    Zeegers, M.P.; Kiemeney, L.A.L.M.; Nieder, A.M.; Ostrer, H.

    2004-01-01

    OBJECTIVE: Although narrative reviews have suggested an association between (CAG)n and (GGN)n polymorphisms in the AR gene and prostate cancer, it has never been quantified systematically. The purpose of this meta-analysis was to provide relative and absolute quantitative summary estimates with suff

  4. Dominant-negative androgen receptor inhibition of intracrine androgen-dependent growth of castration-recurrent prostate cancer.

    Directory of Open Access Journals (Sweden)

    Mark A Titus

    Full Text Available BACKGROUND: Prostate cancer (CaP is the second leading cause of cancer death in American men. Androgen deprivation therapy is initially effective in CaP treatment, but CaP recurs despite castrate levels of circulating androgen. Continued expression of the androgen receptor (AR and its ligands has been linked to castration-recurrent CaP growth. PRINCIPAL FINDING: In this report, the ligand-dependent dominant-negative ARΔ142-337 (ARΔTR was expressed in castration-recurrent CWR-R1 cell and tumor models to elucidate the role of AR signaling. Expression of ARΔTR decreased CWR-R1 tumor growth in the presence and absence of exogenous testosterone (T and improved survival in the presence of exogenous T. There was evidence for negative selection of ARΔTR transgene in T-treated mice. Mass spectrometry revealed castration-recurrent CaP dihydrotestosterone (DHT levels sufficient to activate AR and ARΔTR. In the absence of exogenous testosterone, CWR-R1-ARΔTR and control cells exhibited altered androgen profiles that implicated epithelial CaP cells as a source of intratumoral AR ligands. CONCLUSION: The study provides in vivo evidence that activation of AR signaling by intratumoral AR ligands is required for castration-recurrent CaP growth and that epithelial CaP cells produce sufficient active androgens for CaP recurrence during androgen deprivation therapy. Targeting intracrine T and DHT synthesis should provide a mechanism to inhibit AR and growth of castration-recurrent CaP.

  5. Diversity in the androgen receptor CAG repeat has been shaped by a multistep mutational mechanism.

    Science.gov (United States)

    Santos, Diana; Pimenta, João; Wong, Virginia C N; Amorim, António; Martins, Sandra

    2014-10-01

    The androgen receptor (AR) gene encodes a type of nuclear receptor that functions as a steroid-hormone activated transcription factor. In its coding region, AR includes a CAG repeat, which has been intensely studied due to the inverse correlation between repeat size and AR transcriptional activity. Several studies have reported different (CAG)n sizes associated with the risk of androgen-linked diseases. We aimed at clarifying the mechanisms on the origin of newly CAG sized alleles through a strategy involving the analysis of the associated haplotype diversity. We genotyped 374 control individuals of European and Asian ancestry, and reconstructed the haplotypes associated with the CAG repeat, defined by 10 SNPs and 6 flanking STRs. The most powerful SNPs to tag AR lineages are rs7061037-rs12012620 and rs34191540-rs6625187-rs2768578 in Europeans and Asians, respectively. In the most frequent AR lineage, (CAG)18 alleles seem to have been generated by a multistep mutation mechanism, most probably from longer alleles. We further noticed that the DXS1194-DXS1111 haplotype, in linkage disequilibrium with AR-(CAG)n expanded alleles responsible for spinal bulbar muscular atrophy (SBMA), is rare among our controls; however, the haplotype strategy here described may be used to clarify the origin of expansions in other populations, as in future association studies.

  6. Human CMTM2/CKLFSF2 enhances the ligand-induced transactivation of the androgen receptor

    Institute of Scientific and Technical Information of China (English)

    LIU DaZhen; YIN CaiHua; ZHANG YingMei; TIAN LinJie; LI Ting; LI Dan; MA DaLong; GUO YingLu; WANG Ying

    2009-01-01

    CKLF (chemokine-like factor)-Iike MARVEL (MAL and related proteins for vesicle trafficking and membrane link domain) transmembrane domain containing (CMTM) is a novel gene family. One member of this family, CMTM2, also named chemokine-like factor superfamily 2 (CKLFSF2), is expressed highly in the testis and moderately in the prostate, marrow and peripheral blood cells. However, the function of human CMTM2 remains unknown. Here, we found that CMTM2 was upregulated in 5α-dihydrotestosterone (DHT)-treated LNCaP cells. We investigated the relationship between CMTM2 and the androgen receptor. Our results showed that CMTM2 enhanced DHT-mediated androgen receptor (AR) transactiration and the expression of prostate specific antigen (PSA). We also observed that CMTM2 enhanced the AR protein level, which was reversed by silencing endogenous CMTM2 expression, which suggested that CMTM2 might play an important role in maintaining the AR protein level. We also found that CMTM2 suppressed Akt activation. A previous study showed that Akt could phosphorylate AR at Ser210 and Ser790 and lead to AR ubiquitylation and degradation as well as suppression of AR activity.Taken together, suppressing Akt activation and increasing the AR protein level might be one of the mechanisms for the CMTM2-mediated enhancement of AR transactivation.

  7. Distinct recognition modes of FXXLF and LXXLL motifs by the androgen receptor.

    NARCIS (Netherlands)

    H.J. Dubbink (Erik Jan); R. Hersmus (Remko); C.S. Verma (Chandra); H.A.G.M. van der Korput (Hetty); C.A. Berrevoets (Cor); J. van Tol (Judith); A.C.J. Ziel-van der Made (Angelique); A.O. Brinkmann (Albert); A.C. Pike (Ashley); J. Trapman (Jan)

    2004-01-01

    textabstractAmong nuclear receptors, the androgen receptor (AR) is unique in that its ligand-binding domain (LBD) interacts with the FXXLF motif in the N-terminal domain, resembling coactivator LXXLL motifs. We compared AR- and estrogen receptor alpha-LBD interactions of the wild-t

  8. Androgen Receptor Involvement in Rat Amelogenesis: An Additional Way for Endocrine-Disrupting Chemicals to Affect Enamel Synthesis.

    Science.gov (United States)

    Jedeon, Katia; Loiodice, Sophia; Salhi, Khaled; Le Normand, Manon; Houari, Sophia; Chaloyard, Jessica; Berdal, Ariane; Babajko, Sylvie

    2016-11-01

    Endocrine-disrupting chemicals (EDCs) that interfere with the steroid axis can affect amelogenesis, leading to enamel hypomineralization similar to that of molar incisor hypomineralization, a recently described enamel disease. We investigated the sex steroid receptors that may mediate the effects of EDCs during rat amelogenesis. The expression of androgen receptor (AR), estrogen receptor (ER)-α, and progesterone receptor was dependent on the stage of ameloblast differentiation, whereas ERβ remained undetectable. AR was the only receptor selectively expressed in ameloblasts involved in final enamel mineralization. AR nuclear translocation and induction of androgen-responsive element-containing promoter activity upon T treatment, demonstrated ameloblast responsiveness to androgens. T regulated the expression of genes involved in enamel mineralization such as KLK4, amelotin, SLC26A4, and SLC5A8 but not the expression of genes encoding matrix proteins, which determine enamel thickness. Vinclozolin and to a lesser extent bisphenol A, two antiandrogenic EDCs that cause enamel defects, counteracted the actions of T. In conclusion, we show, for the first time, the following: 1) ameloblasts express AR; 2) the androgen signaling pathway is involved in the enamel mineralization process; and 3) EDCs with antiandrogenic effects inhibit AR activity and preferentially affect amelogenesis in male rats. Their action, through the AR pathway, may specifically and irreversibly affect enamel, potentially leading to the use of dental defects as a biomarker of exposure to environmental pollutants. These results are consistent with the steroid hormones affecting ameloblasts, raising the issue of the hormonal influence on amelogenesis and possible sexual dimorphism in enamel quality.

  9. Androgen Receptor in Teleosts%硬骨鱼类雄激素受体研究进展

    Institute of Scientific and Technical Information of China (English)

    蒲鲁鲁; 张子平; 王艺磊; 陈芸

    2011-01-01

    The biological activity of androgens is mediated by the nuclear androgen receptor (nAR) in vertebrates, nAR is a ligand-regulated transcriptional factor, which belongs to the nuclear receptor superfamily.nAR has been characterized from mammals to teleosts. The nAR subtype is found to exist in two different isoforms in several fish species due to a teleost specific gene duplication event. These subtypes of nAR form two distinct molecular clusters and display different tissue distributions and expression patterns during embryogenesis and gonad development. Recently, increasing evidence has shown the nongenomic or cell surface receptor ( the membrane androgen receptor, mAR )-mediated actions of androgen. Here we review the gene structure;molecular and biological characteristics; tissue distribution; and ligand-binding features of nAR. Furthermore,we also review the characteristics, distribution and relationship of mAR with regards to the reproductive cycle in teleost fish.%在脊椎动物中,雄激素的生理作用主要是通过核雄激素受体(nuclear androgen receptor,nAR)介导的,这种转录因子属于核受体超家族成员.从哺乳动物到硬骨鱼类,均存在nAR.与高等脊椎动物不同的是,由于基因倍增等原因,部分硬骨鱼类nAR存在2种亚型.它们在鱼类胚胎发育和性腺发育过程中表现为不同的组织分布和表达类型.新近研究表明,雄激素也可以引起细胞的非基凶组效应,即不通过经典的核受体做出反应,而是在质膜通过膜雄激素受体(membrane androgen receptor,mAR)来调节.本文就nAR的基凶结构、分子生物学特性、组织分布、激素亲和力等方面的研究进行综述的同时,也对鱼类mAR的激素亲和特性、组织分布及其与生殖周期关系等方面的研究做了介绍.

  10. BTG2 is an LXXLL-dependent co-repressor for androgen receptor transcriptional activity

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Xu-Dong [School of Radiation Medicine and Public Health, Medical College of Soochow University, Suzhou 215123 (China); Meng, Qing-Hui [Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057 (United States); Xu, Jia-Ying; Jiao, Yang [School of Radiation Medicine and Public Health, Medical College of Soochow University, Suzhou 215123 (China); Ge, Chun-Min [Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057 (United States); Jacob, Asha; Wang, Ping [North Shore University Hospital-Long Island Jewish Medical Center and The Feinstein Institute for Medical Research, Manhasset, NY 11030 (United States); Rosen, Eliot M [Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057 (United States); Fan, Saijun, E-mail: sjfan@suda.edu.cn [School of Radiation Medicine and Public Health, Medical College of Soochow University, Suzhou 215123 (China)

    2011-01-28

    Research highlights: {yields} BTG2 associates with AR, androgen causes an increase of the interaction. {yields} BTG2 as a co-repressor inhibits the AR-mediated transcription activity. {yields} BTG2 inhibits the transcription activity and expression of PSA. {yields} An intact {sup 92}LxxLL{sup 96} motif is essential and necessary for these activities of BTG2, while the {sup 20}LxxLL{sup 24} motif is not required. {yields} Ectopic expression of BTG2 reduces proliferation of prostate cancer cells. -- Abstract: The tumor suppressor gene, BTG2 has been down-regulated in prostate cancer and the ectopic expression of this gene has been shown to inhibit prostate cancer cell growth. Sequence analysis revealed that the BTG2 protein contains two leucine-rich motifs ({sup 20}LxxLL{sup 24} and {sup 92}LxxLL{sup 96}), which are usually found in nuclear receptor co-factors. Based on this, we postulated that there will be an association between BTG2 and AR. In this study, we discovered that BTG2 directly bound to the androgen receptor (AR) in the absence of 5{alpha}-dihydrotestosterone (DHT), and in the presence of the androgen, this interaction was increased. BTG2 bearing the mutant {sup 20}LxxLL{sup 24} motif bound to AR equally efficient as the wild-type BTG2, while BTG2 bearing the mutant {sup 92}LxxLL{sup 96} motif failed to interact with AR. Functional studies indicated that ectopic expression of BTG2 caused a significant inhibition of AR-mediated transcriptional activity and a decreased growth of prostate cancer cells. Androgen-induced promoter activation and expression of prostate-specific antigen (PSA) are significantly attenuated by BTG2. The intact {sup 92}LxxLL{sup 96} motif is required for these activities. These findings, for the first time, demonstrate that BTG2 complexes with AR via an LxxLL-dependent mechanism and may play a role in prostate cancer via modulating the AR signaling pathway.

  11. Design, Syntheses and Bioactivities of Androgen Receptor Targeted Taxane Analogs, Simplified Fluorescently Labeled Discodermolide Analogs, and Conformationally Constrained Discodermolide Analogs

    OpenAIRE

    Qi, Jun

    2010-01-01

    Prostate cancer is the most common non-skin cancer for men in America. The androgen receptor exerts transcriptional activity and plays an important role for the proliferation of prostate cancer cells. Androgen receptor ligands bind the androgen receptor and inhibit its transcriptional activity effectively. However, prostate cancer can progress to hormone refractory prostate cancer (HRPC) to avoid this effect. Chemotherapies are currently the primary treatments for HRPC. Unfortunately, none of...

  12. Androgen receptor roles in insulin resistance and obesity in males: the linkage of androgen-deprivation therapy to metabolic syndrome.

    Science.gov (United States)

    Yu, I-Chen; Lin, Hung-Yun; Sparks, Janet D; Yeh, Shuyuan; Chang, Chawnshang

    2014-10-01

    Prostate cancer (PCa) is one of the most frequently diagnosed malignancies in men. Androgen-deprivation therapy (ADT) is the first-line treatment and fundamental management for men with advanced PCa to suppress functions of androgen/androgen receptor (AR) signaling. ADT is effective at improving cancer symptoms and prolonging survival. However, epidemiological and clinical studies support the notion that testosterone deficiency in men leads to the development of metabolic syndrome that increases cardiovascular disease risk. The underlying mechanisms by which androgen/AR signaling regulates metabolic homeostasis in men are complex, and in this review, we discuss molecular mechanisms mediated by AR signaling that link ADT to metabolic syndrome. Results derived from various AR knockout mouse models reveal tissue-specific AR signaling that is involved in regulation of metabolism. These data suggest that steps be taken early to manage metabolic complications associated with PCa patients receiving ADT, which could be accomplished using tissue-selective modulation of AR signaling and by treatment with insulin-sensitizing agents.

  13. Photoperiodic regulation of androgen receptor and steroid receptor coactivator-1 in Siberian hamster brain.

    Science.gov (United States)

    Tetel, Marc J; Ungar, Todd C; Hassan, Brett; Bittman, Eric L

    2004-11-24

    Seasonal changes in the neuroendocrine actions of gonadal steroid hormones are triggered by fluctuations in daylength. The mechanisms responsible for photoperiodic influences upon the feedback and behavioral effects of testosterone in Siberian hamsters are poorly understood. We hypothesized that daylength regulates the expression of androgen receptor (AR) and/or steroid receptor coactivator-1 (SRC-1) in specific forebrain regions. Hamsters were castrated and implanted with either oil-filled capsules or low doses of testosterone; half of the animals remained in 16L/8D and the rest were kept in 10L/14D for the ensuing 70 days. The number of AR-immunoreactive (AR-ir) cells was regulated by testosterone in medial amygdala and caudal arcuate, and by photoperiod in the medial preoptic nucleus and the posterodorsal medial amygdala. A significant interaction between photoperiod and androgen treatment was found in medial preoptic nucleus and posterodorsal medial amygdala. The molecular weight and distribution of SRC-1 were similar to reports in other rodent species, and short days reduced the number of SRC-1-ir cells in posteromedial bed nucleus of the stria terminalis (BNST) and posterodorsal medial amygdala. A significant interaction between androgen treatment and daylength in regulation of SRC-1-ir was found in anterior medial amygdala. The present results indicate that daylength-induced fluctuations in SRC-1 and AR expression may contribute to seasonally changing effects of testosterone.

  14. Estrogen receptor ligands counteract cognitive deficits caused by androgen deprivation in male rats.

    Science.gov (United States)

    Lagunas, Natalia; Calmarza-Font, Isabel; Grassi, Daniela; Garcia-Segura, Luis M

    2011-04-01

    Androgen deprivation causes impairment of cognitive tasks in rodents and humans, and this deficit can be reverted by androgen replacement therapy. Part of the effects of androgens in the male may be mediated by their local metabolism to estradiol or 3-alpha androstanediol within the brain and the consequent activation of estrogen receptors. In this study we have assessed whether the administration of estradiol benzoate, the estrogen receptor β selective agonist diarylpropionitrile or the estrogen receptor α selective agonist propyl pyrazole triol affect performance of androgen-deprived male Wistar rats in the cross-maze test. In addition, we tested the effect of raloxifene and tamoxifen, two selective estrogen receptor modulators used in clinical practice. The behavior of the rats was assessed 2 weeks after orchidectomy or sham surgery. Orchidectomy impaired acquisition in the cross-maze test. Estradiol benzoate and the selective estrogen receptor β agonist significantly improved acquisition in the cross-maze test compared to orchidectomized animals injected with vehicle. Raloxifene and tamoxifen at a dose of 1mg/kg, but not at doses of 0.5 or 2mg/kg, also improved acquisition of orchidectomized animals. Our findings suggest that estrogenic compounds with affinity for estrogen receptor β and selective estrogen receptor modulators, such as raloxifene and tamoxifen, may represent good candidates to promote cognitive performance in androgen-deprived males.

  15. Androgen receptor immunoreactivity in rat occipital cortex after callosotomy

    Directory of Open Access Journals (Sweden)

    G Lepore

    2009-08-01

    Full Text Available Gonadal steroidogenesis can be influenced by direct neural links between the central nervous system and the gonads. It is known that androgen receptor (AR is expressed in many areas of the rat brain involved in neuroendocrine control of reproduction, such as the cerebral cortex. It has been recently shown that the occipital cortex exerts an inhibitory effect on testicular stereoidogenesis by a pituitary-independent neural mechanism. Moreover, the complete transection of the corpus callosum leads to an increase in testosterone (T secretion of hemigonadectomized rats. The present study was undertaken to analyze the possible corticocortical influences regulating male reproductive activities. Adult male Wistar rats were divided into 4 groups: 1 intact animals as control; 2 rats undergoing sham callosotomy; 3 posterior callosotomy; 4 gonadectomy and posterior callosotomy. Western blot analysis showed no remarkable variations in cortical AR expression in any of the groups except in group I where a significant decrease in AR levels was found. Similarly, both immunocytochemical study and cell count estimation showed a lower AR immunoreactivity in occipital cortex of callosotomized rats than in other groups. In addition, there was no difference in serum T and LH concentration between sham-callosotomized and callosotomized rats. In conclusion, our results show that posterior callosotomy led to a reduction in AR in the right occipital cortex suggesting a putative inhibiting effect of the contralateral cortical area.

  16. Ligand-induced conformational alterations of the androgen receptor analyzed by limited trypsinization: Studies on the mechanism of antiandrogen action

    NARCIS (Netherlands)

    C.W. Kuil (Cor); C.A. Berrevoets (Cor); E. Mulder (Eppo)

    1995-01-01

    textabstractLimited proteolysis of in vitro produced human androgen receptor was used to probe the different conformations of the receptor after binding of androgens and several antiandrogens. The results provide evidence for five different conformations of the receptor, as detected by the formation

  17. Androgen receptor driven transcription in molecular apocrine breast cancer is mediated by FoxA1.

    Science.gov (United States)

    Robinson, Jessica L L; Macarthur, Stewart; Ross-Innes, Caryn S; Tilley, Wayne D; Neal, David E; Mills, Ian G; Carroll, Jason S

    2011-06-24

    Breast cancer is a heterogeneous disease and several distinct subtypes exist based on differential gene expression patterns. Molecular apocrine tumours were recently identified as an additional subgroup, characterised as oestrogen receptor negative and androgen receptor positive (ER- AR+), but with an expression profile resembling ER+ luminal breast cancer. One possible explanation for the apparent incongruity is that ER gene expression programmes could be recapitulated by AR. Using a cell line model of ER- AR+ molecular apocrine tumours (termed MDA-MB-453 cells), we map global AR binding events and find a binding profile that is similar to ER binding in breast cancer cells. We find that AR binding is a near-perfect subset of FoxA1 binding regions, a level of concordance never previously seen with a nuclear receptor. AR functionality is dependent on FoxA1, since silencing of FoxA1 inhibits AR binding, expression of the majority of the molecular apocrine gene signature and growth cell growth. These findings show that AR binds and regulates ER cis-regulatory elements in molecular apocrine tumours, resulting in a transcriptional programme reminiscent of ER-mediated transcription in luminal breast cancers.

  18. A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

    DEFF Research Database (Denmark)

    Ottesen, A M; Garn, I D; Aksglaede, L;

    2007-01-01

    -gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes.......Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... chromosome abnormalities (46,XX males; 47,XYY)(n = 4) and normal karyotypes (46,XY) (n = 13). The reference range for the AR-copy number was established as 0.8-1.2 for one copy and 1.7-2.3 for two copies. The qPCR results were within the reference range in 17/18 samples (94%) or 30/31 (97%) samples with one...

  19. Classification and virtual screening of androgen receptor antagonists.

    Science.gov (United States)

    Li, Jiazhong; Gramatica, Paola

    2010-05-24

    Computational tools, such as quantitative structure-activity relationship (QSAR), are highly useful as screening support for prioritization of substances of very high concern (SVHC). From the practical point of view, QSAR models should be effective to pick out more active rather than inactive compounds, expressed as sensitivity in classification works. This research investigates the classification of a big data set of endocrine-disrupting chemicals (EDCs)-androgen receptor (AR) antagonists, mainly aiming to improve the external sensitivity and to screen for potential AR binders. The kNN, lazy IB1, and ADTree methods and the consensus approach were used to build different models, which improve the sensitivity on external chemicals from 57.1% (literature) to 76.4%. Additionally, the models' predictive abilities were further validated on a blind collected data set (sensitivity: 85.7%). Then the proposed classifiers were used: (i) to distinguish a set of AR binders into antagonists and agonists; (ii) to screen a combined estrogen receptor binder database to find out possible chemicals that can bind to both AR and ER; and (iii) to virtually screen our in-house environmental chemical database. The in silico screening results suggest: (i) that some compounds can affect the normal endocrine system through a complex mechanism binding both to ER and AR; (ii) new EDCs, which are nonER binders, but can in silico bind to AR, are recognized; and (iii) about 20% of compounds in a big data set of environmental chemicals are predicted as new AR antagonists. The priority should be given to them to experimentally test the binding activities with AR.

  20. Similarities and Distinctions in Actions of Surface-Directed and Classic Androgen Receptor Antagonists.

    Directory of Open Access Journals (Sweden)

    Ji Ho Suh

    Full Text Available The androgen receptor (AR surface-directed antagonist MJC13 inhibits AR function and proliferation of prostate cancer (PC cells. These effects are related to arrest of an AR/chaperone complex in the cytoplasm. Here, we compared MJC13 and classic AR antagonists such as flutamide and bicalutamide. Microarray analysis and confirmatory qRT-PCR reveals that MJC13 and flutamide inhibit dihydrotestosterone (DHT-dependent genes in LNCaP PC cells. Both compounds are equally effective on a genome wide basis and as effective as second generation AR antagonists (MDV3100, ARN-509 at selected genes. MJC13 inhibits AR binding to the prostate specific antigen (PSA promoter more strongly than flutamide, consistent with different mechanisms of action. Examination of efficacy of MJC13 in conditions that reflect aspects castrate resistant prostate cancer (CRPC reveals that it inhibits flutamide activation of an AR mutant (ART877A that emerges during flutamide withdrawal syndrome, but displays greatly restricted gene-specific activity in 22Rv1 cells that express a constitutively active truncated AR and is inactive against glucocorticoid receptor (GR, which can co-opt androgen-dependent signaling networks in CRPC. Importantly, MJC13 inhibits AR interactions with SRC2 and β-catenin in the nucleus and, unlike flutamide, strongly inhibits amplification of AR activity obtained with transfected SRC2 and β-catenin. MJC13 also inhibits DHT and β-catenin-enhanced cell division in LNCaP cells. Thus, a surface-directed antagonist can block AR activity in some conditions in which a classic antagonist fails and may display utility in particular forms of CRPC.

  1. Similarities and Distinctions in Actions of Surface-Directed and Classic Androgen Receptor Antagonists.

    Science.gov (United States)

    Suh, Ji Ho; Chattopadhyay, Arundhati; Sieglaff, Douglas H; Storer Samaniego, Cheryl; Cox, Marc B; Webb, Paul

    2015-01-01

    The androgen receptor (AR) surface-directed antagonist MJC13 inhibits AR function and proliferation of prostate cancer (PC) cells. These effects are related to arrest of an AR/chaperone complex in the cytoplasm. Here, we compared MJC13 and classic AR antagonists such as flutamide and bicalutamide. Microarray analysis and confirmatory qRT-PCR reveals that MJC13 and flutamide inhibit dihydrotestosterone (DHT)-dependent genes in LNCaP PC cells. Both compounds are equally effective on a genome wide basis and as effective as second generation AR antagonists (MDV3100, ARN-509) at selected genes. MJC13 inhibits AR binding to the prostate specific antigen (PSA) promoter more strongly than flutamide, consistent with different mechanisms of action. Examination of efficacy of MJC13 in conditions that reflect aspects castrate resistant prostate cancer (CRPC) reveals that it inhibits flutamide activation of an AR mutant (ART877A) that emerges during flutamide withdrawal syndrome, but displays greatly restricted gene-specific activity in 22Rv1 cells that express a constitutively active truncated AR and is inactive against glucocorticoid receptor (GR), which can co-opt androgen-dependent signaling networks in CRPC. Importantly, MJC13 inhibits AR interactions with SRC2 and β-catenin in the nucleus and, unlike flutamide, strongly inhibits amplification of AR activity obtained with transfected SRC2 and β-catenin. MJC13 also inhibits DHT and β-catenin-enhanced cell division in LNCaP cells. Thus, a surface-directed antagonist can block AR activity in some conditions in which a classic antagonist fails and may display utility in particular forms of CRPC.

  2. Content of Androgen Receptor in Cultured Genital Skin Fibroblast From Different Ages of Chinese Normal Men

    Institute of Scientific and Technical Information of China (English)

    卢建; 何立敏; 张金山; 杨震; 周云

    1995-01-01

    A ratpid, simple, reliable method is described for assaying androgen receptor (AR) in dispersed, whole, cultured human genital skin fibroblasts (GSF) with a synthetic androgen, 3H-methyltrienolone (3H-R1881). Receptors for androgen in GSF exhiblt high affinity (Kd=3.0±0.1 nmol/L), low binding capacity and androgen specificity. The content of AR in cultured GSF from 40 normal men varying in age from 1.5—60 years u:as also investigated by this assay. Scatchard analysis and slngle plot revealed the presence of 4.500-8500 binding sites per cell, mean number of AR in GSF of these men is 6288±1082 binding sites/cell. No significant difference was observed in the content of AR in different age groups. This result showed that the content of AR in these ceils did not change with age.

  3. "Topological significance" analysis of gene expression and proteomic profiles from prostate cancer cells reveals key mechanisms of androgen response.

    Directory of Open Access Journals (Sweden)

    Adaikkalam Vellaichamy

    Full Text Available BACKGROUND: The problem of prostate cancer progression to androgen independence has been extensively studied. Several studies systematically analyzed gene expression profiles in the context of biological networks and pathways, uncovering novel aspects of prostate cancer. Despite significant research efforts, the mechanisms underlying tumor progression are poorly understood. We applied a novel approach to reconstruct system-wide molecular events following stimulation of LNCaP prostate cancer cells with synthetic androgen and to identify potential mechanisms of androgen-independent progression of prostate cancer. METHODOLOGY/PRINCIPAL FINDINGS: We have performed concurrent measurements of gene expression and protein levels following the treatment using microarrays and iTRAQ proteomics. Sets of up-regulated genes and proteins were analyzed using our novel concept of "topological significance". This method combines high-throughput molecular data with the global network of protein interactions to identify nodes which occupy significant network positions with respect to differentially expressed genes or proteins. Our analysis identified the network of growth factor regulation of cell cycle as the main response module for androgen treatment in LNCap cells. We show that the majority of signaling nodes in this network occupy significant positions with respect to the observed gene expression and proteomic profiles elicited by androgen stimulus. Our results further indicate that growth factor signaling probably represents a "second phase" response, not directly dependent on the initial androgen stimulus. CONCLUSIONS/SIGNIFICANCE: We conclude that in prostate cancer cells the proliferative signals are likely to be transmitted from multiple growth factor receptors by a multitude of signaling pathways converging on several key regulators of cell proliferation such as c-Myc, Cyclin D and CREB1. Moreover, these pathways are not isolated but constitute an

  4. Mutation of androgen receptor N-terminal phosphorylation site Tyr-267 leads to inhibition of nuclear translocation and DNA binding.

    Science.gov (United States)

    Karaca, Mehmet; Liu, Yuanbo; Zhang, Zhentao; De Silva, Dinuka; Parker, Joel S; Earp, H Shelton; Whang, Young E

    2015-01-01

    Reactivation of androgen receptor (AR) may drive recurrent prostate cancer in castrate patients. Ack1 tyrosine kinase is overexpressed in prostate cancer and promotes castrate resistant xenograft tumor growth and enhances androgen target gene expression and AR recruitment to enhancers. Ack1 phosphorylates AR at Tyr-267 and possibly Tyr-363, both in the N-terminal transactivation domain. In this study, the role of these phosphorylation sites was investigated by characterizing the phosphorylation site mutants in the context of full length and truncated AR lacking the ligand-binding domain. Y267F and Y363F mutants showed decreased transactivation of reporters. Expression of wild type full length and truncated AR in LNCaP cells increased cell proliferation in androgen-depleted conditions and increased colony formation. However, the Y267F mutant of full length and truncated AR was defective in stimulating cell proliferation. The Y363F mutant was less severely affected than the Y267F mutant. The full length AR Y267F mutant was defective in nuclear translocation induced by androgen or Ack1 kinase. The truncated AR was constitutively localized to the nucleus. Chromatin immunoprecipitation analysis showed that it was recruited to the target enhancers without androgen. The truncated Y267F AR mutant did not exhibit constitutive nuclear localization and androgen enhancer binding activity. These results support the concept that phosphorylation of Tyr-267, and to a lesser extent Tyr-363, is required for AR nuclear translocation and recruitment and DNA binding and provide a rationale for development of novel approaches to inhibit AR activity.

  5. Mutation of androgen receptor N-terminal phosphorylation site Tyr-267 leads to inhibition of nuclear translocation and DNA binding.

    Directory of Open Access Journals (Sweden)

    Mehmet Karaca

    Full Text Available Reactivation of androgen receptor (AR may drive recurrent prostate cancer in castrate patients. Ack1 tyrosine kinase is overexpressed in prostate cancer and promotes castrate resistant xenograft tumor growth and enhances androgen target gene expression and AR recruitment to enhancers. Ack1 phosphorylates AR at Tyr-267 and possibly Tyr-363, both in the N-terminal transactivation domain. In this study, the role of these phosphorylation sites was investigated by characterizing the phosphorylation site mutants in the context of full length and truncated AR lacking the ligand-binding domain. Y267F and Y363F mutants showed decreased transactivation of reporters. Expression of wild type full length and truncated AR in LNCaP cells increased cell proliferation in androgen-depleted conditions and increased colony formation. However, the Y267F mutant of full length and truncated AR was defective in stimulating cell proliferation. The Y363F mutant was less severely affected than the Y267F mutant. The full length AR Y267F mutant was defective in nuclear translocation induced by androgen or Ack1 kinase. The truncated AR was constitutively localized to the nucleus. Chromatin immunoprecipitation analysis showed that it was recruited to the target enhancers without androgen. The truncated Y267F AR mutant did not exhibit constitutive nuclear localization and androgen enhancer binding activity. These results support the concept that phosphorylation of Tyr-267, and to a lesser extent Tyr-363, is required for AR nuclear translocation and recruitment and DNA binding and provide a rationale for development of novel approaches to inhibit AR activity.

  6. The androgen receptor has no direct antiresorptive actions in mouse osteoclasts.

    Science.gov (United States)

    Sinnesael, Mieke; Jardi, Ferran; Deboel, Ludo; Laurent, Michaël R; Dubois, Vanessa; Zajac, Jeffrey D; Davey, Rachel A; Carmeliet, Geert; Claessens, Frank; Vanderschueren, Dirk

    2015-08-15

    Androgen deficiency or androgen receptor knockout (ARKO) causes high-turnover osteopenia, but the target cells for this effect remain unclear. To examine whether AR in osteoclasts directly suppresses bone resorption, we crossed AR-floxed with cathepsin K-Cre mice. Osteoclast-specific ARKO (ocl-ARKO) mice showed no changes neither in osteoclast surface nor in bone microarchitecture nor in the response to orchidectomy and androgen replacement, indicating that the AR in osteoclasts is not critical for bone maintenance. In line with the lack of a bone phenotype, the levels of AR were very low in osteoclast-enriched cultures derived from bone marrow (BM) and undetectable in osteoclasts generated from spleen precursors. Since tibiae of ubiquitous ARKO mice displayed increased osteoclast counts, the role of AR was further explored using cell cultures from these animals. Osteoclast generation and activity in vitro were similar between ARKO and wildtype control (WT) mice. In co-culture experiments, BM stromal cells (BMSCs) were essential for the suppressive action of AR on osteoclastogenesis and osteoclast activity. Stimulation with 1,25(OH)2 vitamin D3 increased Rankl and decreased Tnfsf11 (osteoprotegerin, Opg) gene expression in BMSCs more than in osteoblasts. This increase in the Rankl/Opg ratio following 1,25(OH)2D3 stimulation was lower, not higher, in ARKO mice. Runx2 expression in BMSCs was however higher in ARKO vs. WT, suggesting that ARKO mice may more readily commit osteoprogenitor cells to osteoblastogenesis. In conclusion, the AR does not seem to suppress bone resorption through direct actions in osteoclasts. BMSCs may however represent an alternative AR target in the BM milieu.

  7. Molecular chaperones enhance the degradation of expanded polyglutamine repeat androgen receptor in a cellular model of spinal and bulbar muscular atrophy

    NARCIS (Netherlands)

    Bailey, CK; Andriola, IFM; Kampinga, HH; Merry, DE

    2002-01-01

    Spinal and bulbar muscular atrophy (SBMA) is one of a growing number of neurodegenerative diseases caused by a polyglutamine-encoding CAG trinucleotide repeat expansion, and is caused by an expansion within exon 1 of the androgen receptor (AR) gene. The family of polyglutamine diseases is characteri

  8. Inhibition of the Androgen Receptor by Antiandrogens in Spinobulbar Muscle Atrophy.

    Science.gov (United States)

    Baniahmad, Aria

    2016-03-01

    Spinal-bulbar muscle atrophy (SBMA) or also named Kennedy's Disease is caused by a polyglutamine expansion (PolyQ) of the coding region of the androgen receptor (AR). The AR is a ligand-controlled transcription factor and member of the nuclear hormone receptor superfamily. The central characteristics of the SBMA pathogenicity are muscle weakness, the loss of motoneurons and the occurrence of AR-containing protein aggregates that are observed in spinal cord motoneurons and skeletal muscles induced by the AR-PolyQ expansion in the presence of androgens. The PolyQ triggers a misfolding in the AR-PolyQ and leads to protein aggregation in spinal cord motoneurons and muscle cells. The AR-PolyQ toxicity is activated by the AR ligand testosterone and dihydrotestosterone that activate the receptor and triggers nuclear toxicity by inducing AR nuclear translocation. In line with this, androgen treatment of SBMA patients worsened the SBMA symptoms. SBMA has been modeled in AR-overexpressing and AR-PolyQ-knock-in animals, but precisely how the PolyQ expansion leads to neurodegeneration is unclear. The androgen-induced toxicity and androgen-dependent nuclear accumulation of AR-PolyQ protein seems to be central to the pathogenesis. Therefore, the inhibition of the androgen-activated AR-PolyQ might be a therapeutic option. Here the use of AR antagonists for treatment option of SBMA will be reviewed and discussed.

  9. A protein in rat prostatic chromatin interacting with androgen regulated gene

    Institute of Scientific and Technical Information of China (English)

    XUYOUHAI; RONGCHANG; 等

    1992-01-01

    2M NaCl-insoluble fraction of rat ventral Prostate chromatin(residual proteins)contain proteins able to interact specifically with androgen-receptor complex and is ,therefore,a part of the aceptor complex.Among residual proteins a 98 KDa protein has been found which binds significantly to a genomic fiagment containing an androgen-regulated gene coding for a 22 KDa protein The biological significance of this binding in androgen action need to be further studied.A mini-plasmid clone containing 22 KDa protein coding sequence was cloned into charon 4A genomic library from which a 5.7 Kb genomic fragment was isolated,identified by hybridization with a 5' and a 3' cDNA probes,and shown to contain the 3' flanking sequence.Restriction enzyme treatment of this fragment yielded a 4.7 Kb restriction fragmwent representing the 5' upstream region and a 1.0 Kb containing part of the coding sequence.Deletion studies indicated that the 97 KDa protein bound only to a subclone of about 300 bp segment .Furthermore,gel shifting experiment supported its DNA-protein binding.

  10. Estrogen and androgen receptor activities of hydraulic fracturing chemicals and surface and ground water in a drilling-dense region

    Science.gov (United States)

    Kassotis, Christopher D.; Tillitt, Donald E.; Davis, J. Wade; Hormann, Anette M.; Nagel, Susan C.

    2014-01-01

    The rapid rise in natural gas extraction using hydraulic fracturing increases the potential for contamination of surface and ground water from chemicals used throughout the process. Hundreds of products containing more than 750 chemicals and components are potentially used throughout the extraction process, including more than 100 known or suspected endocrine-disrupting chemicals. We hypothesized thataselected subset of chemicalsusedin natural gas drilling operationsandalso surface and ground water samples collected in a drilling-dense region of Garfield County, Colorado, would exhibit estrogen and androgen receptor activities. Water samples were collected, solid-phase extracted, and measured for estrogen and androgen receptor activities using reporter gene assays in human cell lines. Of the 39 unique water samples, 89%, 41%, 12%, and 46% exhibited estrogenic, antiestrogenic, androgenic, and antiandrogenic activities, respectively. Testing of a subset of natural gas drilling chemicals revealed novel antiestrogenic, novel antiandrogenic, and limited estrogenic activities. The Colorado River, the drainage basin for this region, exhibited moderate levels of estrogenic, antiestrogenic, and antiandrogenic activities, suggesting that higher localized activity at sites with known natural gas–related spills surrounding the river might be contributing to the multiple receptor activities observed in this water source. The majority of water samples collected from sites in a drilling-dense region of Colorado exhibited more estrogenic, antiestrogenic, or antiandrogenic activities than reference sites with limited nearby drilling operations. Our data suggest that natural gas drilling operationsmayresult in elevated endocrine-disrupting chemical activity in surface and ground water.

  11. 苯丙酸诺龙对烫伤模型大鼠雄激素受体介导靶基因转录调控的影响%Effect of nandrolone phenylpropionate on androgen receptor-mediated transcriptional regulation of target genes in rat scald models

    Institute of Scientific and Technical Information of China (English)

    李凯; 岑瑛

    2015-01-01

    BACKGROUND:Moderate to severe burn and trauma, treatment of which has been paid equal attention to wound surface, is always a difficulty of clinical systemic treatment and has a poor prognosis. Anabolic hormones have acquired secure and good results in the treatment of burns in both animals and clinical patients. Although use of anabolic hormones is restricted by the doping management, but its androgen receptor and nuclear receptor coregulators are the newly emerging areas of interests in the field of gene regulation mechanism in recent years. OBJECTIVE:To investigate the effect of nandrolone phenylpropionate on androgen receptor-mediated transcriptional regulation of target gene in rat scald models. METHODS: Thirty-six rats were randomly divided into nandrolone phenylpropionate, model and control groups. In the nandrolone phenylpropionate and model groups, rats were subjected to a 20% total body surface area second-degree scald injury by hot water. Two days after model preparation, rats in these two groups were intramuscularly injected with nandrolone phenylpropionate and saline, once every other day, for a total of 21 days. RESULTS AND CONCLUSION:The gene expression levels of steroid receptor coactivator-1 and insulin-like growth factor 1 in the rat livers and gonads (testes, ovaries) were significantly different between the nandrolone phenylpropionate and model groups (P 0.05)。说明在不同组织不同生理病理条件下苯丙酸诺龙对类固醇受体辅助活化因子1、c-myc、胰岛素样生长因子1基因表达的作用是不同的。

  12. Selective androgen receptor modulators (SARMs negatively regulate triple-negative breast cancer growth and epithelial:mesenchymal stem cell signaling.

    Directory of Open Access Journals (Sweden)

    Ramesh Narayanan

    Full Text Available The androgen receptor (AR is the most highly expressed steroid receptor in breast cancer with 75-95% of estrogen receptor (ER-positive and 40-70% of ER-negative breast cancers expressing AR. Though historically breast cancers were treated with steroidal androgens, their use fell from favor because of their virilizing side effects and the emergence of tamoxifen. Nonsteroidal, tissue selective androgen receptor modulators (SARMs may provide a novel targeted approach to exploit the therapeutic benefits of androgen therapy in breast cancer.Since MDA-MB-453 triple-negative breast cancer cells express mutated AR, PTEN, and p53, MDA-MB-231 triple-negative breast cancer cells stably expressing wildtype AR (MDA-MB-231-AR were used to evaluate the in vitro and in vivo anti-proliferative effects of SARMs. Microarray analysis and epithelial:mesenchymal stem cell (MSC co-culture signaling studies were performed to understand the mechanisms of action.Dihydrotestosterone and SARMs, but not bicalutamide, inhibited the proliferation of MDA-MB-231-AR. The SARMs reduced the MDA-MB-231-AR tumor growth and tumor weight by greater than 90%, compared to vehicle-treated tumors. SARM treatment inhibited the intratumoral expression of genes and pathways that promote breast cancer development through its actions on the AR. SARM treatment also inhibited the metastasis-promoting paracrine factors, IL6 and MMP13, and subsequent migration and invasion of epithelial:MSC co-cultures.1. AR stimulation inhibits paracrine factors that are important for MSC interactions and breast cancer invasion and metastasis. 2. SARMs may provide promise as novel targeted therapies to treat AR-positive triple-negative breast cancer.

  13. Androgen receptor isoforms in human and rat prostate

    Institute of Scientific and Technical Information of China (English)

    Shu-JieXIA; Gang-YaoHAO; Xiao-DaTANG

    2000-01-01

    Aim: To investigate the androgen receptor (AR) isoforms and its variability of expression in human and rat prostatic tissues. Methods: Human benign prostatic hyperplasia (BPH) and prostatic cancer tissues were obtained from patients undergoing prostatectomy, and rat ventral prostate was incised 3 days after castration. Forty-one AR-positive BPH specimens, 3 prostatic cancer specimens, and 6 rat prostates were used. After processing at 4℃, the tissues were examined by means of high resolution isoelectric focusing (IEF) technique to determine their AR isoforms. Results:From the prostatic specimens, 3 types of AR isoforms were detected with pI values at 6.5, 6.0, and 5.3. In human BPH tissues, 15/41 (36.6%) specimens showed all the three types of isoforms, while 19/41 (46.3%) showed 2 isoforms at various combinations and 7/41(17.1%), 1 isoform. For the 3 prostatic cancer specimens, one showed 3 isoforms, one, 2 isoforms, and the other failed to show any isoform. All rat prostatic tissues showed 2 isoforms at different combinations. Binding of 3H-dihydrotestosterone (DHT) to the isoforms was inhibited by the addition of 100-fold excess of DHT or testosterone, but not progesterone, oestradiol or diethylstilboestrol. Conclusion: AR isoforms are different in different patients. Although their genesis is not clear, the therapeutic implication of the present observation appears to be interesting, that may help clarifying the individual differences in the response to hormonal therapy.(Asian J Androl 2000 Dec;2:307-310)

  14. Assembly of methylated KDM1A and CHD1 drives androgen receptor-dependent transcription and translocation.

    Science.gov (United States)

    Metzger, Eric; Willmann, Dominica; McMillan, Joel; Forne, Ignasi; Metzger, Philipp; Gerhardt, Stefan; Petroll, Kerstin; von Maessenhausen, Anne; Urban, Sylvia; Schott, Anne-Kathrin; Espejo, Alexsandra; Eberlin, Adrien; Wohlwend, Daniel; Schüle, Katrin M; Schleicher, Michael; Perner, Sven; Bedford, Mark T; Jung, Manfred; Dengjel, Jörn; Flaig, Ralf; Imhof, Axel; Einsle, Oliver; Schüle, Roland

    2016-02-01

    Prostate cancer evolution is driven by a combination of epigenetic and genetic alterations such as coordinated chromosomal rearrangements, termed chromoplexy. TMPRSS2-ERG gene fusions found in human prostate tumors are a hallmark of chromoplexy. TMPRSS2-ERG fusions have been linked to androgen signaling and depend on androgen receptor (AR)-coupled gene transcription. Here, we show that dimethylation of KDM1A at K114 (to form K114me2) by the histone methyltransferase EHMT2 is a key event controlling androgen-dependent gene transcription and TMPRSS2-ERG fusion. We identified CHD1 as a KDM1A K114me2 reader and characterized the KDM1A K114me2-CHD1 recognition mode by solving the cocrystal structure. Genome-wide analyses revealed chromatin colocalization of KDM1A K114me2, CHD1 and AR in prostate tumor cells. Together, our data link the assembly of methylated KDM1A and CHD1 with AR-dependent transcription and genomic translocations, thereby providing mechanistic insight into the formation of TMPRSS2-ERG gene fusions during prostate-tumor evolution.

  15. Differential modulation of androgen receptor transcriptional activity by the nuclear receptor co-repressor (N-CoR).

    NARCIS (Netherlands)

    C.A. Berrevoets (Cor); A. Umar (Arzu); A.O. Brinkmann (Albert); J. Trapman (Jan)

    2004-01-01

    textabstractAntiandrogens are widely used agents in the treatment of prostate cancer, as inhibitors of AR (androgen receptor) action. Although the precise mechanism of antiandrogen action is not yet elucidated, recent studies indicate the involvement of nuclear receptor co-represso

  16. Expression and function of androgen receptor coactivator p44/Mep50/WDR77 in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Martin Ligr

    Full Text Available Hormones, including estrogen and progesterone, and their receptors play an important role in the development and progression of ovarian carcinoma. Androgen, its receptor and coactivators have also been implicated in these processes. p44/Mep50/WDR77 was identified as a subunit of the methylosome complex and lately characterized as a steroid receptor coactivator that enhances androgen receptor as well as estrogen receptor-mediated transcriptional activity in a ligand-dependent manner. We previously described distinct expression and function of p44 in prostate, testis, and breast cancers. In this report, we examined the expression and function of p44 in ovarian cancer. In contrast to findings in prostate and testicular cancer and similar to breast cancer, p44 shows strong cytoplasmic localization in morphologically normal ovarian surface and fallopian tube epithelia, while nuclear p44 is observed in invasive ovarian carcinoma. We observed that p44 can serve as a coactivator of both androgen receptor (AR and estrogen receptor (ER in ovarian cells. Further, overexpression of nuclear-localized p44 stimulates proliferation and invasion in ovarian cancer cells in the presence of estrogen or androgen. These findings strongly suggest that p44 plays a role in mediating the effects of hormones during ovarian tumorigenesis.

  17. Aberrant E2F activation by polyglutamine expansion of androgen receptor in SBMA neurotoxicity.

    Science.gov (United States)

    Suzuki, Eriko; Zhao, Yue; Ito, Saya; Sawatsubashi, Shun; Murata, Takuya; Furutani, Takashi; Shirode, Yuko; Yamagata, Kaoru; Tanabe, Masahiko; Kimura, Shuhei; Ueda, Takashi; Fujiyama, Sally; Lim, Jinseon; Matsukawa, Hiroyuki; Kouzmenko, Alexander P; Aigaki, Toshiro; Tabata, Tetsuya; Takeyama, Ken-ichi; Kato, Shigeaki

    2009-03-10

    Spinal and bulbar muscular atrophy (SBMA) is a neurodegenerative disorder caused by a polyglutamine repeat (polyQ) expansion within the human androgen receptor (AR). Unlike other neurodegenerative diseases caused by abnormal polyQ expansion, the onset of SBMA depends on androgen binding to mutant human polyQ-AR proteins. This is also observed in Drosophila eyes ectopically expressing the polyQ-AR mutants. We have genetically screened mediators of androgen-induced neurodegeneration caused by polyQ-AR mutants in Drosophila eyes. We identified Rbf (Retinoblastoma-family protein), the Drosophila homologue of human Rb (Retinoblastoma protein), as a neuroprotective factor. Androgen-dependent association of Rbf or Rb with AR was remarkably potentiated by aberrant polyQ expansion. Such potentiated Rb association appeared to attenuate recruitment of histone deacetyltransferase 1 (HDAC1), a corepressor of E2F function. Either overexpression of Rbf or E2F deficiency in fly eyes reduced the neurotoxicity of the polyQ-AR mutants. Induction of E2F function by polyQ-AR-bound androgen was suppressed by Rb in human neuroblastoma cells. We conclude that abnormal expansion of polyQ may potentiate innate androgen-dependent association of AR with Rb. This appears to lead to androgen-dependent onset of SBMA through aberrant E2F transactivation caused by suppressed histone deacetylation.

  18. Studies on Androgen Receptor mRNA expression in Pancreas, Hypothalamus and Ovary of Androgen Sterilized Rats

    Institute of Scientific and Technical Information of China (English)

    Li WANG; Jing-wen HOU; Li-min LU; Jin YU; Sui-qi GUI

    2004-01-01

    Objective To investigate the androgen receptor (AR) mRNA expression in pancreas,hypothalamus and ovary of androgen sterilized rats (ASR)Methods ASR model was established by subcutaneous injection of testosterone propionate to SD female rats at the age of 9 days. Around the age of 106 days (proestrus),all rats were killed, serum △ 4-andronestedione (△ 4-A), total testosterone (TT), free testosterone (FT), insulin (Ins) and C-peptide (C-P)were measured by radioimmunoassay (RIA). Total RNA in pancreas, hypothalamus and ovary were extracted and the amount of AR mRNA was quantitatedly analyzed by RT-PCR with single base mutant template as inner standard. Results Serum concentrations of△ 4-A, TT, FT, Ins and C-P in ASR model rats were significantly higher than those in control group (P<0. 05, P<0. 01). The expression of AR mRNA in pancreas, hypothalamus and ovary increased significantly (P<0. 05,P<0. 01) of model rats as compared with control group. Conclusion The elevated serum androgen levels in ASR model could enhance the expression of AR mRNA levels in pancreas, hypothalamus and ovary, which further induce hyperinsulinemia and anovulation.

  19. The impact of point mutations in the human androgen receptor: classification of mutations on the basis of transcriptional activity.

    Directory of Open Access Journals (Sweden)

    Colin W Hay

    Full Text Available Androgen receptor mediated signaling drives prostate cancer cell growth and survival. Mutations within the receptor occur infrequently in prostate cancer prior to hormonal therapy but become prevalent in incurable androgen independent and metastatic tumors. Despite the determining role played by the androgen receptor in all stages of prostate cancer progression, there is a conspicuous dearth of comparable data on the consequences of mutations. In order to remedy this omission, we have combined an expansive study of forty five mutations which are predominantly associated with high Gleason scores and metastatic tumors, and span the entire length of the receptor, with a literature review of the mutations under investigation. We report the discovery of a novel prevalent class of androgen receptor mutation that possesses loss of function at low levels of androgen yet transforms to a gain of function at physiological levels. Importantly, mutations introducing constitutive gain of function are uncommon, with the majority of mutations leading to either loss of function or no significant change from wild-type activity. Therefore, the widely accepted supposition that androgen receptor mutations in prostate cancer result in gain of function is appealing, but mistaken. In addition, the transcriptional outcome of some mutations is dependent upon the androgen receptor responsive element. We discuss the consequences of these findings and the role of androgen receptor mutations for prostate cancer progression and current treatment options.

  20. Coregulator control of androgen receptor action by a novel nuclear receptor-binding motif.

    Science.gov (United States)

    Jehle, Katja; Cato, Laura; Neeb, Antje; Muhle-Goll, Claudia; Jung, Nicole; Smith, Emmanuel W; Buzon, Victor; Carbó, Laia R; Estébanez-Perpiñá, Eva; Schmitz, Katja; Fruk, Ljiljana; Luy, Burkhard; Chen, Yu; Cox, Marc B; Bräse, Stefan; Brown, Myles; Cato, Andrew C B

    2014-03-28

    The androgen receptor (AR) is a ligand-activated transcription factor that is essential for prostate cancer development. It is activated by androgens through its ligand-binding domain (LBD), which consists predominantly of 11 α-helices. Upon ligand binding, the last helix is reorganized to an agonist conformation termed activator function-2 (AF-2) for coactivator binding. Several coactivators bind to the AF-2 pocket through conserved LXXLL or FXXLF sequences to enhance the activity of the receptor. Recently, a small compound-binding surface adjacent to AF-2 has been identified as an allosteric modulator of the AF-2 activity and is termed binding function-3 (BF-3). However, the role of BF-3 in vivo is currently unknown, and little is understood about what proteins can bind to it. Here we demonstrate that a duplicated GARRPR motif at the N terminus of the cochaperone Bag-1L functions through the BF-3 pocket. These findings are supported by the fact that a selective BF-3 inhibitor or mutations within the BF-3 pocket abolish the interaction between the GARRPR motif(s) and the BF-3. Conversely, amino acid exchanges in the two GARRPR motifs of Bag-1L can impair the interaction between Bag-1L and AR without altering the ability of Bag-1L to bind to chromatin. Furthermore, the mutant Bag-1L increases androgen-dependent activation of a subset of AR targets in a genome-wide transcriptome analysis, demonstrating a repressive function of the GARRPR/BF-3 interaction. We have therefore identified GARRPR as a novel BF-3 regulatory sequence important for fine-tuning the activity of the AR.

  1. Screening of 397 chemicals and development of a quantitative structure-activity relationship model for androgen receptor antagonism

    DEFF Research Database (Denmark)

    Vinggaard, Annemarie; Niemelä, Jay Russell; Wedebye, Eva Bay;

    2008-01-01

    We have screened 397 chemicals for human androgen receptor (AR) antagonism by a sensitive reporter gene assay to generate data for the development of a quantitative structure-activity relationship (QSAR) model. A total of 523 chemicals comprising data on 292 chemicals from our laboratory and data...... by the synthetic androgen R1881. The MultiCASE expert system was used to construct a QSAR model for AR antagonizing potential. A "5 Times, 2-Fold 50% Cross Validation" of the model showed a sensitivity of 64%, a specificity of 84%, and a concordance of 76%. Data for 102 chemicals were generated for an external...... validation of the model resulting in a sensitivity of 57%, a specificity of 98%, and a concordance of 92% of the model. The model was run on a set of 176103 chemicals, and 47% were within the domain of the model. Approximately 8% of chemicals was predicted active for AR antagonism. We conclude...

  2. S578N mutation of the androgen receptor in an adolescent with complete androgen insensitivity syndrome

    Institute of Scientific and Technical Information of China (English)

    XIAO Yuan; WANG De-fen; LI Xiao-ying; YANG Jun; WANG Wei

    2010-01-01

    @@ Androgen insensitivity syndrome (AIS) was first described by the American gynecologist Morris in 1953 and was initially described in 82 patients.1 The syndrome was designated "testicular feminization syndrome" , because the testes produce hormones with estrogen-like actions.1 Clinical AIS manifestations include the appearance of normal female external genitalia without internal female genital organs. Other clinical manifestations include undescended testes, normal female breast development, and scant axillary and pubic hair. AIS is the most common condition that cancause male undermasculinisation.

  3. Synthesis, structure-activity relationships, and characterization of novel nonsteroidal and selective androgen receptor modulators.

    Science.gov (United States)

    Schlienger, Nathalie; Lund, Birgitte W; Pawlas, Jan; Badalassi, Fabrizio; Bertozzi, Fabio; Lewinsky, Rasmus; Fejzic, Alma; Thygesen, Mikkel B; Tabatabaei, Ali; Bradley, Stefania Risso; Gardell, Luis R; Piu, Fabrice; Olsson, Roger

    2009-11-26

    Herein we describe the discovery of ACP-105 (1), a novel and potent nonsteroidal selective androgen receptor modulator (SARM) with partial agonist activity relative to the natural androgen testosterone. Compound 1 was developed from a series of compounds found in a HTS screen using the receptor selection and amplification technology (R-SAT). In vivo, 1 improved anabolic parameters in a 2-week chronic study in castrated male rats. In addition to compound 1, a number of potent antiandrogens were discovered from the same series of compounds whereof one compound, 13, had antagonist activity at the AR T877A mutant involved in prostate cancer.

  4. Androgen receptor (CAG)n polymorphisms and breast cancer risk in a Han Chinese population.

    Science.gov (United States)

    Dang, J; Peng, L; Zhong, H J; Huo, Z H

    2015-08-28

    The androgen receptor (AR) is involved in the differentiation and growth of breast cancer. Genetic markers in the AR gene have a plausible role in modulating the risk of breast cancer. In this study, we studied the association of breast cancer and the trinucleotide repeat polymorphism (CAG)n in exon 1 of the AR gene in 202 patients with breast cancer and 183 healthy controls from our hospital (Yinchuan, China). Repeat lengths were determined by fluorescent DNA fragment analysis using the ABI GeneScan software and DNA sequencing. We detected 17 short tandem repeat alleles in exon 1 in the Han population of Ningxia Province, China. The CAG repeat number ranged from 14 to 31 and the frequency ranged from 0.339 to 24.460%. Generally, (CAG)n repeat lengths 22 were classified as long (L). No association was found between breast cancer and the S/L (CAG) variants. However, the frequency of the (CAG)25 repeats in the breast cancer group was significantly higher than that in the control group (P = 0.033, odds ratio = 1.790, 95% confidence interval = 1.044-3.069). These findings indicate a role for AR gene (CAG)n variations in breast cancer and might be informative for future genetic or biological studies on breast cancer, although these findings need replication in other populations.

  5. Cross-species sensitivity to a novel androgen receptor agonist of potential environmental concern, spironolactone.

    Science.gov (United States)

    LaLone, Carlie A; Villeneuve, Daniel L; Cavallin, Jenna E; Kahl, Michael D; Durhan, Elizabeth J; Makynen, Elizabeth A; Jensen, Kathleen M; Stevens, Kyle E; Severson, Megan N; Blanksma, Chad A; Flynn, Kevin M; Hartig, Philip C; Woodard, Jonne S; Berninger, Jason P; Norberg-King, Teresa J; Johnson, Rodney D; Ankley, Gerald T

    2013-11-01

    Spironolactone is a pharmaceutical that in humans is used to treat conditions like hirsutism, various dermatologic afflictions, and female-pattern hair loss through antagonism of the androgen receptor. Although not routinely monitored in the environment, spironolactone has been detected downstream of a pharmaceutical manufacturer, indicating a potential for exposure of aquatic species. Furthermore, spironolactone has been reported to cause masculinization of female western mosquitofish, a response indicative of androgen receptor activation. Predictive methods to identify homologous proteins to the human and western mosquitofish androgen receptor suggest that vertebrates would be more susceptible to adverse effects mediated by chemicals like spironolactone that target the androgen receptor compared with invertebrate species that lack a relevant homolog. In addition, an adverse outcome pathway previously developed for activation of the androgen receptor suggests that androgen mimics can lead to reproductive toxicity in fish. To assess this, 21-d reproduction studies were conducted with 2 fish species, fathead minnow and Japanese medaka, and the invertebrate Daphnia magna. Spironolactone significantly reduced the fecundity of medaka and fathead minnows at 50 μg/L, whereas daphnia reproduction was not affected by concentrations as large as 500 μg/L. Phenotypic masculinization of females of both fish species was observed at 5 μg/L as evidenced by formation of tubercles in fathead minnows and papillary processes in Japanese medaka. Effects in fish occurred at concentrations below those reported in the environment. These results demonstrate how a priori knowledge of an adverse outcome pathway and the conservation of a key molecular target across vertebrates can be utilized to identify potential chemicals of concern in terms of monitoring and highlight potentially sensitive species and endpoints for testing.

  6. Effect of androgen suppression compared with androgen receptor blockade on arterial stiffness in men with prostate cancer.

    Science.gov (United States)

    Dockery, Frances; Bulpitt, Christopher J; Agarwal, Sanjiv; Vernon, Clare; Rajkumar, Chakravarthi

    2009-01-01

    Endogenous testosterone and estradiol are thought to be cardio-protective in men. We wanted to determine the effects of 2 different anti-androgen therapies on arterial stiffness as one suppresses (goserelin--a gonadotrophin-releasing hormone analog) while the other increases (bicalutamide--an androgen receptor blocker) both testosterone and estradiol. We conducted a randomized trial on 43 men (mean age, 71.2 +/- 6.2 years) with localized prostate cancer. They received either goserelin or bicalutamide for 24 weeks. Carotid-femoral (C-F) and carotid-radial (C-R) pulse wave velocities (PWVs) were measured. Twenty age- and disease-matched men with prostate cancer on no active treatment were studied in a similar manner. After 12 weeks of goserelin, radial artery PWV increased significantly from baseline and a nonsignificant increase was observed in femoral PWV (change from baseline radial: +1.4 m/s, P = .002, femoral: +0.9 m/s, P = .127) Both PWV measures increased significantly with bicalutamide (change from baseline radial: +0.8, femoral: +0.9 m/s, P change from baseline radial: +1.7, femoral: +1.3 m/s, P change from baseline radial: +0.4, femoral: +0.4 m/s, P not significant [NS]); however, comparison of changes between the 2 drugs were not significantly different at either 12 or 24 weeks (P >or= .967 at 12 weeks and P >or= .07 at 24 weeks). The untreated men studied in parallel showed no changes at 12 or 24 weeks in either PWV measure. Anti-androgen treatment in men might increase large artery stiffness, an adverse cardiovascular risk factor; however, the effect was not maintained with testosterone receptor blockade, in the longer term, but tended to be sustained with suppression therapy. This could relate to the different sex hormone effects of the 2 therapies.

  7. Phosphorylation of the androgen receptor by PIM1 in hormone refractory prostate cancer.

    Science.gov (United States)

    Ha, S; Iqbal, N J; Mita, P; Ruoff, R; Gerald, W L; Lepor, H; Taneja, S S; Lee, P; Melamed, J; Garabedian, M J; Logan, S K

    2013-08-22

    Integration of cellular signaling pathways with androgen receptor (AR) signaling can be achieved through phosphorylation of AR by cellular kinases. However, the kinases responsible for phosphorylating the AR at numerous sites and the functional consequences of AR phosphorylation are only partially understood. Bioinformatic analysis revealed AR serine 213 (S213) as a putative substrate for PIM1, a kinase overexpressed in prostate cancer. Therefore, phosphorylation of AR serine 213 by PIM1 was examined using a phosphorylation site-specific antibody. Wild-type PIM1, but not catalytically inactive PIM1, specifically phosphorylated AR but not an AR serine-to-alanine mutant (S213A). In vitro kinase assays confirmed that PIM1 can phosphorylate AR S213 in a ligand-independent manner and cell type-specific phosphorylation was observed in prostate cancer cell lines. Upon PIM1 overexpression, AR phosphorylation was observed in the absence of hormone and was further increased in the presence of hormone in LNCaP, LNCaP-abl and VCaP cells. Moreover, phosphorylation of AR was reduced in the presence of PIM kinase inhibitors. An examination of AR-mediated transcription showed that reporter gene activity was reduced in the presence of PIM1 and wild-type AR, but not S213A mutant AR. Androgen-mediated transcription of endogenous PSA, Nkx3.1 and IGFBP5 was also decreased in the presence of PIM1, whereas IL6, cyclin A1 and caveolin 2 were increased. Immunohistochemical analysis of prostate cancer tissue microarrays showed significant P-AR S213 expression that was associated with hormone refractory prostate cancers, likely identifying cells with catalytically active PIM1. In addition, prostate cancers expressing a high level of P-AR S213 were twice as likely to be from biochemically recurrent cancers. Thus, AR phosphorylation by PIM1 at S213 impacts gene transcription and is highly prevalent in aggressive prostate cancer.

  8. Androgen Receptor in Macrophages of Male Rat is Greater Than in Female

    Directory of Open Access Journals (Sweden)

    Kazem Ahmadi

    2005-01-01

    Full Text Available he presence and possible sex differences of androgen receptor in peritoneal macrophages was investigated using immunomagnetic beads. Macrophages were incubated with different concentrations of [3H]-5αDHT in the presence or absence of a 100 fold excess of unlabelled 5α-DHT. Labelled cells were separated from unbound steroid by immunomagnetic beads coated with anti-rat macrophage antibody. The binding identified in the rat macrophages was highly selective towards androgenic compounds. The dissociation constant (kd value for the receptor was calculated to be 3.3X10-9M and 5X10-9M for macrophages of male and female rat respectively. The number of receptors in each cell was 792±3 and 120±1 for male and female respectively. Indicating a sex differences in androgen receptor (p<0.001. Taken together it can be concluded that part of sex differences in immune responses and also auto-immune disease could be related to sex differences in androgen receptor in macrophages.

  9. EPI-001, A Compound Active against Castration-Resistant Prostate Cancer, Targets Transactivation Unit 5 of the Androgen Receptor.

    Science.gov (United States)

    De Mol, Eva; Fenwick, R Bryn; Phang, Christopher T W; Buzón, Victor; Szulc, Elzbieta; de la Fuente, Alex; Escobedo, Albert; García, Jesús; Bertoncini, Carlos W; Estébanez-Perpiñá, Eva; McEwan, Iain J; Riera, Antoni; Salvatella, Xavier

    2016-09-16

    Castration-resistant prostate cancer is the lethal condition suffered by prostate cancer patients that become refractory to androgen deprivation therapy. EPI-001 is a recently identified compound active against this condition that modulates the activity of the androgen receptor, a nuclear receptor that is essential for disease progression. The mechanism by which this compound exerts its inhibitory activity is however not yet fully understood. Here we show, by using high resolution solution nuclear magnetic resonance spectroscopy, that EPI-001 selectively interacts with a partially folded region of the transactivation domain of the androgen receptor, known as transactivation unit 5, that is key for the ability of prostate cells to proliferate in the absence of androgens, a distinctive feature of castration-resistant prostate cancer. Our results can contribute to the development of more potent and less toxic novel androgen receptor antagonists for treating this disease.

  10. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  11. Androgen receptor non-nuclear regulation of prostate cancer cell invasion mediated by Src and matriptase.

    Science.gov (United States)

    Zarif, Jelani C; Lamb, Laura E; Schulz, Veronique V; Nollet, Eric A; Miranti, Cindy K

    2015-03-30

    Castration-resistant prostate cancers still depend on nuclear androgen receptor (AR) function despite their lack of dependence on exogenous androgen. Second generation anti-androgen therapies are more efficient at blocking nuclear AR; however resistant tumors still develop. Recent studies indicate Src is highly active in these resistant tumors. By manipulating AR activity in several different prostate cancer cell lines through RNAi, drug treatment, and the use of a nuclear-deficient AR mutant, we demonstrate that androgen acting on cytoplasmic AR rapidly stimulates Src tyrosine kinase via a non-genomic mechanism. Cytoplasmic AR, acting through Src enhances laminin integrin-dependent invasion. Active Matriptase, which cleaves laminin, is elevated within minutes after androgen stimulation, and is subsequently shed into the medium. Matriptase activation and shedding induced by cytoplasmic AR is dependent on Src. Concomitantly, CDCP1/gp140, a Matriptase and Src substrate that controls integrin-based migration, is activated. However, only inhibition of Matriptase, but not CDCP1, suppresses the AR/Src-dependent increase in invasion. Matriptase, present in conditioned medium from AR-stimulated cells, is sufficient to enhance invasion in the absence of androgen. Thus, invasion is stimulated by a rapid but sustained increase in Src activity, mediated non-genomically by cytoplasmic AR, leading to rapid activation and shedding of the laminin protease Matriptase.

  12. Development and Characterization of Uterine Glandular Epithelium Specific Androgen Receptor Knockout Mouse Model.

    Science.gov (United States)

    Choi, Jaesung Peter; Zheng, Yu; Skulte, Katherine A; Handelsman, David J; Simanainen, Ulla

    2015-11-01

    While estrogen action is the major driver of uterine development, androgens acting via the androgen receptor (AR) may also promote uterine growth as suggested by uterine phenotypes in global AR knockout (ARKO) female mice. Because AR is expressed in uterine endometrial glands, we generated (Cre/loxP) uterine gland epithelium-specific ARKO (ugeARKO) to determine the role of endometrial gland-specific androgen actions. However, AR in uterine gland epithelium may not be required for normal uterine development and function because ugeARKO females had normal uterine development and fertility. To determine if exogenous androgens acting via AR can fully support uterine growth in the absence of estrogens, the ARKO and ugeARKO females were ovariectomized and treated with supraphysiological doses of testosterone or dihydrotestosterone (nonaromatizable androgen). Both dihydrotestosterone and testosterone supported full uterine regrowth in wild-type females while ARKO females had no regrowth (comparable to ovariectomized only). These findings suggest that androgens acting via AR can promote full uterine regrowth in the absence of estrogens. The ugeARKO had 50% regrowth when compared to intact uterine glands, and histomorphologically, both the endometrial and myometrial areas were significantly (P glandular epithelial AR located in the endometrium may indirectly modify myometrial development. Additionally, to confirm Cre function in endometrial glands, we generated uge-specific PTEN knockout mouse model. The ugePTEN knockout females developed severe endometrial hyperplasia and therefore present a novel model for future research.

  13. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Harold D Love

    Full Text Available Benign prostatic hyperplasia (BPH and prostate carcinoma (CaP are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1 highly expressed in prostate, 2 had significant expression changes in response to androgens, and, 3 encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  14. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Science.gov (United States)

    Love, Harold D; Booton, S Erin; Boone, Braden E; Breyer, Joan P; Koyama, Tatsuki; Revelo, Monica P; Shappell, Scott B; Smith, Jeffrey R; Hayward, Simon W

    2009-12-21

    Benign prostatic hyperplasia (BPH) and prostate carcinoma (CaP) are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ) human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1) highly expressed in prostate, 2) had significant expression changes in response to androgens, and, 3) encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  15. Beyond aggression: Androgen-receptor blockade modulates social interaction in wild meerkats.

    Science.gov (United States)

    delBarco-Trillo, Javier; Greene, Lydia K; Goncalves, Ines Braga; Fenkes, Miriam; Wisse, Jillian H; Drewe, Julian A; Manser, Marta B; Clutton-Brock, Tim; Drea, Christine M

    2016-02-01

    In male vertebrates, androgens are inextricably linked to reproduction, social dominance, and aggression, often at the cost of paternal investment or prosociality. Testosterone is invoked to explain rank-related reproductive differences, but its role within a status class, particularly among subordinates, is underappreciated. Recent evidence, especially for monogamous and cooperatively breeding species, suggests broader androgenic mediation of adult social interaction. We explored the actions of androgens in subordinate, male members of a cooperatively breeding species, the meerkat (Suricata suricatta). Although male meerkats show no rank-related testosterone differences, subordinate helpers rarely reproduce. We blocked androgen receptors, in the field, by treating subordinate males with the antiandrogen, flutamide. We monitored androgen concentrations (via baseline serum and time-sequential fecal sampling) and recorded behavior within their groups (via focal observation). Relative to controls, flutamide-treated animals initiated less and received more high-intensity aggression (biting, threatening, feeding competition), engaged in more prosocial behavior (social sniffing, grooming, huddling), and less frequently initiated play or assumed a 'dominant' role during play, revealing significant androgenic effects across a broad range of social behavior. By contrast, guarding or vigilance and measures of olfactory and vocal communication in subordinate males appeared unaffected by flutamide treatment. Thus, androgens in male meerkat helpers are aligned with the traditional trade-off between promoting reproductive and aggressive behavior at a cost to affiliation. Our findings, based on rare endocrine manipulation in wild mammals, show a more pervasive role for androgens in adult social behavior than is often recognized, with possible relevance for understanding tradeoffs in cooperative systems.

  16. Silencing neuronal mutant androgen receptor in a mouse model of spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Sahashi, Kentaro; Katsuno, Masahisa; Hung, Gene; Adachi, Hiroaki; Kondo, Naohide; Nakatsuji, Hideaki; Tohnai, Genki; Iida, Madoka; Bennett, C Frank; Sobue, Gen

    2015-11-01

    Spinal and bulbar muscular atrophy (SBMA), an adult-onset neurodegenerative disease that affects males, results from a CAG triplet repeat/polyglutamine expansions in the androgen receptor (AR) gene. Patients develop progressive muscular weakness and atrophy, and no effective therapy is currently available. The tissue-specific pathogenesis, especially relative pathological contributions between degenerative motor neurons and muscles, remains inconclusive. Though peripheral pathology in skeletal muscle caused by toxic AR protein has been recently reported to play a pivotal role in the pathogenesis of SBMA using mouse models, the role of motor neuron degeneration in SBMA has not been rigorously investigated. Here, we exploited synthetic antisense oligonucleotides to inhibit the RNA levels of mutant AR in the central nervous system (CNS) and explore its therapeutic effects in our SBMA mouse model that harbors a mutant AR gene with 97 CAG expansions and characteristic SBMA-like neurogenic phenotypes. A single intracerebroventricular administration of the antisense oligonucleotides in the presymptomatic phase efficiently suppressed the mutant gene expression in the CNS, and delayed the onset and progression of motor dysfunction, improved body weight gain and survival with the amelioration of neuronal histopathology in motor units such as spinal motor neurons, neuromuscular junctions and skeletal muscle. These findings highlight the importance of the neurotoxicity of mutant AR protein in motor neurons as a therapeutic target.

  17. ERG Cooperates with Androgen Receptor in Regulating Trefoil Factor 3 in Prostate Cancer Disease Progression

    Directory of Open Access Journals (Sweden)

    David S. Rickman

    2010-12-01

    Full Text Available To elucidate the role of ETS gene fusions in castration-resistant prostate cancer (CRPC, we characterized the transcriptome of 54 CRPC tumor samples from men with locally advanced or metastatic disease. Trefoil factor 3 (TFF3 emerged as the most highly differentially regulated gene with respect to ERG rearrangement status and resistance to hormone ablation therapy. Conventional chromatin immunoprecipitation (ChIP-polymerase chain reaction and ChIP followed by DNA sequencing (ChIP-seq revealed direct binding of ERG to ETS binding sites in the TFF3 promoter in ERG-rearranged prostate cancer cell lines. These results were confirmed in ERG-rearranged hormone-naive prostate cancer (HNPC and CRPC tissue samples. Functional studies demonstrated that ERG has an inhibitory effect on TFF3 expression in hormone-naive cancer but not in the castration-resistant state. In addition, we provide evidence suggesting an effect of androgen receptor signaling on ERG-regulated TFF3 expression. Furthermore, TFF3 overexpression enhances ERG-mediated cell invasion in CRPC prostate cancer cells. Taken together, our findings reveal a novel mechanism for enhanced tumor cell aggressiveness resulting from ERG rearrangement in the castration-resistant setting through TFF3 gene expression.

  18. ERG cooperates with androgen receptor in regulating trefoil factor 3 in prostate cancer disease progression.

    Science.gov (United States)

    Rickman, David S; Chen, Ying-Bei; Banerjee, Samprit; Pan, Yihang; Yu, Jindan; Vuong, Terry; Perner, Sven; Lafargue, Christopher J; Mertz, Kirsten D; Setlur, Sunita R; Sircar, Kanishka; Chinnaiyan, Arul M; Bismar, Tarek A; Rubin, Mark A; Demichelis, Francesca

    2010-12-01

    To elucidate the role of ETS gene fusions in castration-resistant prostate cancer (CRPC), we characterized the transcriptome of 54 CRPC tumor samples from men with locally advanced or metastatic disease. Trefoil factor 3 (TFF3) emerged as the most highly differentially regulated gene with respect to ERG rearrangement status and resistance to hormone ablation therapy. Conventional chromatin immunoprecipitation (ChIP)-polymerase chain reaction and ChIP followed by DNA sequencing (ChIP-seq) revealed direct binding of ERG to ETS binding sites in the TFF3 promoter in ERG-rearranged prostate cancer cell lines. These results were confirmed in ERG-rearranged hormone-naive prostate cancer (HNPC) and CRPC tissue samples. Functional studies demonstrated that ERG has an inhibitory effect on TFF3 expression in hormone-naive cancer but not in the castration-resistant state. In addition, we provide evidence suggesting an effect of androgen receptor signaling on ERG-regulated TFF3 expression. Furthermore, TFF3 overexpression enhances ERG-mediated cell invasion in CRPC prostate cancer cells. Taken together, our findings reveal a novel mechanism for enhanced tumor cell aggressiveness resulting from ERG rearrangement in the castration-resistant setting through TFF3 gene expression.

  19. CAG microsatellite polymorphisms of androgen receptor gene and the stage and grade of prostate cancer%雄激素受体基因微卫星CAG多态性与前列腺癌的分期分级

    Institute of Scientific and Technical Information of China (English)

    李长岭; 吕宁; 董金堂; 关维民; 万仪增

    2001-01-01

    Objective To explore the relationship between the CAG mirosatellite in androgen receptor(AR)gene and the stage and grade of prostate cancer(PC).Methods The number of CAG repeats in exon 1 of the AR gene was measured in 37 PC tissues by PCR-SSCP analysis, and its association with stages and grades of PC determined.Results The average number of CAG repeats of AR gene differed significantly between PC in stage B (25.04±1.88) and in stage C~D (24.14±2.64)(P=0.002). The frequency of short CAG(<22) was 13.0%(3/23) in stage B and 28.6%(4/14) in stage C~D, while that of long CAG(≥22) was 87.0%(20/23) and 71.4%(10/14) (P=0.029 ), respectively. The average number of CAG repeats increased with the decrease in tumor cell differentiation. The frequency of short CAG repeats dropped with the increase in tumor cell differentiation while the opposite was true for that of long CAG repeats.Conclusion The number of CAG repeats in AR gene may be one of the factors determining the biologic characteratics PC. Short CAG repeats may signify aggressiveness of PC.%目的研究雄激素受体(AR)基因三核苷酸CAG微卫星多态性与前列腺癌(PC)分期和分级的关系,探讨其与肿瘤生物学特性的相关性。方法运用聚合酶链反应-单链构象多态性分析法(PCR-SSCP),对37例PC标本的AR基因CAG微卫星数量进行测定,并进行不同病变期别、分化级别间的比较及统计学分析。结果 AR基因CAG微卫星数量在病变B期与C~D期分别为25.04±1.88和22.14±2.64(P=0.002);其短的AR基因CAG(数量<22)的分布为:B期13.0%(3/23),C~D期28.6%(4/14);其长的AR基因CAG(数量≥22)的分布为:B期87.0%(20/23),C~D期71.4%(10/14),差异有显著性(P=0.029)。AR基因CAG微卫星数量随PC病变分化程度的增高而增加,低分化为23.64±2.56,中分化为24.29±3.45,高分化为25.6±1.67,在高分化与低分化间差异有显著性(P=0.047)。短

  20. Antagonizing effects of membrane-acting androgens on the eicosanoid receptor OXER1 in prostate cancer.

    Science.gov (United States)

    Kalyvianaki, Konstantina; Gebhart, Veronika; Peroulis, Nikolaos; Panagiotopoulou, Christina; Kiagiadaki, Fotini; Pediaditakis, Iosif; Aivaliotis, Michalis; Moustou, Eleni; Tzardi, Maria; Notas, George; Castanas, Elias; Kampa, Marilena

    2017-03-14

    Accumulating evidence during the last decades revealed that androgen can exert membrane initiated actions that involve signaling via specific kinases and the modulation of significant cellular processes, important for prostate cancer cell growth and metastasis. Results of the present work clearly show that androgens can specifically act at the membrane level via the GPCR oxoeicosanoid receptor 1 (OXER1) in prostate cancer cells. In fact, OXER1 expression parallels that of membrane androgen binding in prostate cancer cell lines and tumor specimens, while in silico docking simulation of OXER1 showed that testosterone could bind to OXER1 within the same grove as 5-OxoETE, the natural ligand of OXER1. Interestingly, testosterone antagonizes the effects of 5-oxoETE on specific signaling pathways and rapid effects such as actin cytoskeleton reorganization that ultimately can modulate cell migration and metastasis. These findings verify that membrane-acting androgens exert specific effects through an antagonistic interaction with OXER1. Additionally, this interaction between androgen and OXER1, which is an arachidonic acid metabolite receptor expressed in prostate cancer, provides a novel link between steroid and lipid actions and renders OXER1 as new player in the disease. These findings should be taken into account in the design of novel therapeutic approaches in prostate cancer.

  1. Antagonizing effects of membrane-acting androgens on the eicosanoid receptor OXER1 in prostate cancer

    Science.gov (United States)

    Kalyvianaki, Konstantina; Gebhart, Veronika; Peroulis, Nikolaos; Panagiotopoulou, Christina; Kiagiadaki, Fotini; Pediaditakis, Iosif; Aivaliotis, Michalis; Moustou, Eleni; Tzardi, Maria; Notas, George; Castanas, Elias; Kampa, Marilena

    2017-01-01

    Accumulating evidence during the last decades revealed that androgen can exert membrane initiated actions that involve signaling via specific kinases and the modulation of significant cellular processes, important for prostate cancer cell growth and metastasis. Results of the present work clearly show that androgens can specifically act at the membrane level via the GPCR oxoeicosanoid receptor 1 (OXER1) in prostate cancer cells. In fact, OXER1 expression parallels that of membrane androgen binding in prostate cancer cell lines and tumor specimens, while in silico docking simulation of OXER1 showed that testosterone could bind to OXER1 within the same grove as 5-OxoETE, the natural ligand of OXER1. Interestingly, testosterone antagonizes the effects of 5-oxoETE on specific signaling pathways and rapid effects such as actin cytoskeleton reorganization that ultimately can modulate cell migration and metastasis. These findings verify that membrane-acting androgens exert specific effects through an antagonistic interaction with OXER1. Additionally, this interaction between androgen and OXER1, which is an arachidonic acid metabolite receptor expressed in prostate cancer, provides a novel link between steroid and lipid actions and renders OXER1 as new player in the disease. These findings should be taken into account in the design of novel therapeutic approaches in prostate cancer. PMID:28290516

  2. Stilbenes inhibit androgen receptor expression in 22Rv1 castrate-resistant prostate cancer cells

    Science.gov (United States)

    Androgen receptor (AR) signaling plays an important role in the development and progression of prostate cancer (PCa). Importantly, AR continues to be expressed in advanced stages of castrate-resistant PCa (CRPC), where it can have ligand- independent activity. Identification of naturally occurring s...

  3. Design, synthesis, and biological evaluation of 4-phenylpyrrole derivatives as novel androgen receptor antagonists.

    Science.gov (United States)

    Yamamoto, Satoshi; Matsunaga, Nobuyuki; Hitaka, Takenori; Yamada, Masami; Hara, Takahito; Miyazaki, Junichi; Santou, Takashi; Kusaka, Masami; Yamaoka, Masuo; Kanzaki, Naoyuki; Furuya, Shuichi; Tasaka, Akihiro; Hamamura, Kazumasa; Ito, Mitsuhiro

    2012-01-01

    A series of 4-phenylpyrrole derivatives D were designed, synthesized, and evaluated for their potential as novel orally available androgen receptor antagonists therapeutically effective against castration-resistant prostate cancers. 4-Phenylpyrrole compound 1 exhibited androgen receptor (AR) antagonistic activity against T877A and W741C mutant-type ARs as well as wild-type AR. An arylmethyl group incorporated into compound 1 contributed to enhancement of antagonistic activity. Compound 4n, 1-{[6-chloro-5-(hydroxymethyl)pyridin-3-yl]methyl}-4-(4-cyanophenyl)-2,5-dimethyl-1H-pyrrole-3-carbonitrile exhibited inhibitory effects on tumor cell growth against the bicalutamide-resistant LNCaP-cxD2 cell line as well as the androgen receptor-dependent JDCaP cell line in a mouse xenograft model. These results demonstrate that this series of pyrrole compounds are novel androgen receptor antagonists with efficacy against prostate cancer cells, including castration-resistant prostate cancers such as bicalutamide-resistant prostate cancer.

  4. Genotype and phenotype in Klinefelter syndrome - impact of androgen receptor polymorphism and skewed X inactivation

    DEFF Research Database (Denmark)

    Bojesen, A; Hertz, J M; Gravholt, C H

    2011-01-01

    The phenotypic variation of Klinefelter syndrome (KS) is wide and may by caused by various genetic and epigenetic effects. Skewed inactivation of the supra-numerical X chromosome and polymorphism in the androgen receptor (AR) have been suggested as plausible causes. We wanted to describe X...

  5. AOP description: Androgen receptor agonism leading to reproductive dysfunction (in fish)

    Science.gov (United States)

    This adverse outcome pathway details the linkage between binding and activation of androgen receptor as a nuclear transcription factor in females and the adverse effect of reduced cumulative fecundity in repeat-spawning fish species. Cumulative fecundity is the most apical endpoi...

  6. Mechanism of Transcriptional Regulation by Androgen Receptor and its Coactivators in the Context of Chromatin

    Science.gov (United States)

    2002-07-01

    caso - reaction and the mixture was incubated for 20 min at roomteprtr.In co petition says, unlabeled ARE or TRE 󈧎 dex and flutamide. We are...activation and nuclear targeting sig- nals of the human androgen receptor. J Biol Chem 266: LNCaP cells were culture in Roswell Park Memorial Institute 510

  7. Synthesis of potent, substituted carbazoles as selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Miller, Chris P; Bhaket, Pushpal; Muthukaman, Nagarajan; Lyttle, C Richard; Shomali, Maysoun; Gallacher, Kyla; Slocum, Connie; Hattersley, Gary

    2010-12-15

    The synthesis and in vitro binding affinity for a novel series of potent androgen receptor modulators is described. One of the more potent compounds (17, RAD35010) was further characterized in vivo where it restored levator ani weight in castrated male rats to near sham level while having no significant effect on prostate weight.

  8. Selective Androgen Receptor Modulator RAD140 Is Neuroprotective in Cultured Neurons and Kainate-Lesioned Male Rats

    OpenAIRE

    2014-01-01

    The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed “selective androgen receptor modulators” (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in sel...

  9. Testosterone and Androgen Receptor Sensitivity in Relation to Hyperactivity Symptoms in Boys with Autism Spectrum Disorders

    Science.gov (United States)

    2016-01-01

    Introduction Autism spectrum disorders (ASD) and hyperactivity symptoms exhibit an incidence that is male-biased. Thus androgen activity can be considered a plausible biological risk factor for these disorders. However, there is insufficient information about the association between increased androgen activity and hyperactivity symptoms in children with ASD. Methods In the present study, the relationship between parameters of androgenicity (plasmatic testosterone levels and androgen receptor sensitivity) and hyperactivity in 60 boys (age 3–15) with ASD is investigated. Given well documented differences in parent and trained examiners ratings of symptom severity, we employed a standardized parent`s questionnaire (Nisonger Child Behavior Rating Form) as well as a direct examiner`s rating (Autism diagnostic observation schedule) for assessment of hyperactivity symptoms. Results Although it was found there was no significant association between actual plasmatic testosterone levels and hyperactivity symptoms, the number of CAG triplets was significantly negatively correlated with hyperactivity symptoms (R2 = 0.118, p = 0.007) in the sample, indicating increased androgen receptor sensitivity in association with hyperactivity symptoms. Direct trained examiner´s assessment appeared to be a relevant method for evaluating of behavioral problems in the investigation of biological underpinnings of these problems in our study. Conclusions A potential ASD subtype characterized by increased rates of hyperactivity symptoms might have distinct etiopathogenesis and require a specific behavioral and pharmacological approach. We propose an increase of androgen receptor sensitivity as a biomarker for a specific ASD subtype accompanied with hyperactivity symptoms. Findings are discussed in terms of their implications for practice and future research. PMID:26910733

  10. CLONING, EXPRESSION AND CHARACTERIZATION OF THE ANDROGEN RECEPTOR AND ISOLATION OF ESTROGEN RECEPTOR ALPHA FROM THE FATHEAD MINNOW (PIMEPHALES PROMELAS)

    Science.gov (United States)

    In vitro screening assays designed to identify hormone mimics or antagonists, including those recommended for use in the EPA's Tier 1 screening battery, typically use mammalian estrogen (ER) and androgen receptors (AR) such as rat or human. Although we know that the amino acid s...

  11. Androgen receptors and experimental bone loss - an in vivo and in vitro study.

    Science.gov (United States)

    Steffens, Joao Paulo; Coimbra, Leila Santana; Rossa, Carlos; Kantarci, Alpdogan; Van Dyke, Thomas E; Spolidorio, Luis Carlos

    2015-12-01

    Testosterone is a sex hormone that exhibits many functions beyond reproduction; one such function is the regulation of bone metabolism. The role played by androgen receptors during testosterone-mediated biological processes associated with bone metabolism is largely unknown. This study aims to use a periodontal disease model in vivo in order to assess the involvement of androgen receptors on microbial-induced inflammation and alveolar bone resorption in experimental bone loss. The impact of hormone deprivation was tested through both orchiectomy and chemical blockage of androgen receptor using flutamide (FLU). Additionally, the direct effect of exogenous testosterone, and the role of the androgen receptor, on osteoclastogenesis were investigated. Thirty male adult rats (n=10/group) were subjected to: 1-orchiectomy (OCX); 2-OCX sham surgery; or 3-OCX sham surgery plus FLU, four weeks before the induction of experimental bone loss. Ten OCX sham-operated rats were not subjected to experimental bone loss and served as healthy controls. The rats were euthanized two weeks later, so as to assess bone resorption and the production of inflammatory cytokines in the gingival tissue and serum. In order to study the in vitro impact of testosterone, osteoclasts were differentiated from RAW264.7 cells and testosterone was added at increasing concentrations. Both OCX and FLU increased bone resorption, but OCX alone was observed to increase osteoclast count. IL-1β production was increased only in the gingival tissue of OCX animals, whereas FLU-treated animals presented a decreased expression of IL-6. Testosterone reduced the osteoclast formation in a dose-dependent manner, and significantly impacted the production of TNF-α; FLU partially reversed these actions. When taken together, our results indicate that testosterone modulates experimental bone loss, and that this action is mediated, at least in part, via the androgen receptor.

  12. Selectivity in progesterone and androgen receptor binding of progestagens used in oral contraceptives

    Energy Technology Data Exchange (ETDEWEB)

    Kloosterboer, H.J.; Vonk-Noordegraaf, C.A.; Turpijn, E.W.

    1988-09-01

    The relative binding affinities (RBAs) of four progestational compounds (norethisterone, levonorgestrel, 3-keto-desogestrel and gestodene) for the human progesterone and androgen receptors were measured in MCF-7 cytosol and intact MCF-7 cells. For the binding to the progesterone receptor, both Org 2058 and Org 3236 (or 3-keto-desogestrel) were used as labelled ligands. The following ranking (low to high) for the RBA of the nuclear (intact cells) progesterone receptor irrespective of the ligand used is found: norethisterone much less than levonorgestrel less than 3-keto-destogestrel less than gestodene. The difference between the various progestagens is significant with the exception of that between 3-keto-desogestrel and gestodene, when Org 2058 is used as ligand. For the cytosolic progesterone receptor, the same order is found with the exception that similar RBAs are found for gestodene and 3-keto-desogestrel. The four progestagens clearly differ with respect to binding to the androgen receptor using dihydrotestosterone as labelled ligand in intact cells; the ranking (low to high) is: norethisterone less than 3 keto-desogestrel less than levonorgestrel and gestodene. The difference between 3-keto-desogestrel and levonorgestrel or gestodene is significant. The selectivity indices (ratio of the mean RBA for the progesterone receptor to that of androgen receptor) in intact cells are significantly higher for 3-keto-desogestrel and gestodene than for levonorgestrel and norethisterone. From these results we conclude that the introduction of the 18-methyl in norethisterone (levonorgestel) increases both the binding to the progesterone and androgen receptors.

  13. The relationship between anogenital distance and the androgen receptor CAG repeat length

    OpenAIRE

    Eisenberg, Michael L.; Hsieh, Tung-Chin; Pastuszak, Alexander W; McIntyre, Matthew G.; Walters, Rustin C; Lamb, Dolores J.; Lipshultz, Larry I

    2013-01-01

    Anogenital distance (AGD) is used to define degree of virilization of genital development, with shorter length being associated with feminization and male infertility. The first exon of the androgen receptor (AR) consists of a polymorphic sequence of cytosine–adenine–guanine (CAG) repeats, with longer CAG repeat lengths being associated with decreased receptor function. We sought to determine if there is an association between AGD and AR CAG repeat length. A cross-sectional, prospective cohor...

  14. [A potential of selective androgen receptor modulator(SARM)for the therapy of osteoporosis].

    Science.gov (United States)

    Yanase, Toshihiko

    2016-07-01

    In recent years, the drugs, which show anabolic, effect on bone and muscle without stimulating prostate has been developed. They show tissue-specific selective androgen actions and called selective androgen receptor modulators(SARMs). The development of drug targeting bone and muscle in male is very promising as a treatment tool for osteoporosis and sarcopenia in the near future. The clinical study is under going especially in the field of cachexia associated with cancer, but unfortunately there is no drug in the current market at present. The current situation of the development of SARMs will be reviewed.

  15. Integrated expression profiling and ChIP-seq analyses of the growth inhibition response program of the androgen receptor.

    Directory of Open Access Journals (Sweden)

    Biaoyang Lin

    Full Text Available BACKGROUND: The androgen receptor (AR plays important roles in the development of male phenotype and in different human diseases including prostate cancers. The AR can act either as a promoter or a tumor suppressor depending on cell types. The AR proliferative response program has been well studied, but its prohibitive response program has not yet been thoroughly studied. METHODOLOGY/PRINCIPAL FINDINGS: Previous studies found that PC3 cells expressing the wild-type AR inhibit growth and suppress invasion. We applied expression profiling to identify the response program of PC3 cells expressing the AR (PC3-AR under different growth conditions (i.e. with or without androgens and at different concentration of androgens and then applied the newly developed ChIP-seq technology to identify the AR binding regions in the PC3 cancer genome. A surprising finding was that the comparison of MOCK-transfected PC3 cells with AR-transfected cells identified 3,452 differentially expressed genes (two fold cutoff even without the addition of androgens (i.e. in ethanol control, suggesting that a ligand independent activation or extremely low-level androgen activation of the AR. ChIP-Seq analysis revealed 6,629 AR binding regions in the cancer genome of PC3 cells with an FDR (false discovery rate cut off of 0.05. About 22.4% (638 of 2,849 can be mapped to within 2 kb of the transcription start site (TSS. Three novel AR binding motifs were identified in the AR binding regions of PC3-AR cells, and two of them share a core consensus sequence CGAGCTCTTC, which together mapped to 27.3% of AR binding regions (1,808/6,629. In contrast, only about 2.9% (190/6,629 of AR binding sites contains the canonical AR matrix M00481, M00447 and M00962 (from the Transfac database, which is derived mostly from AR proliferative responsive genes in androgen dependent cells. In addition, we identified four top ranking co-occupancy transcription factors in the AR binding regions, which

  16. Exposure to paper mill effluent at a site in North Central Florida elicits molecular-level changes in gene expression indicative of progesterone and androgen exposure.

    Science.gov (United States)

    Brockmeier, Erica K; Jayasinghe, B Sumith; Pine, William E; Wilkinson, Krystan A; Denslow, Nancy D

    2014-01-01

    Endocrine disrupting compounds (EDCs) are chemicals that negatively impact endocrine system function, with effluent from paper mills one example of this class of chemicals. In Florida, female Eastern mosquitofish (Gambusia holbrooki) have been observed with male secondary sexual characteristics at three paper mill-impacted sites, indicative of EDC exposure, and are still found at one site on the Fenholloway River. The potential impacts that paper mill effluent exposure has on the G. holbrooki endocrine system and the stream ecosystem are unknown. The objective of this study was to use gene expression analysis to determine if exposure to an androgen receptor agonist was occurring and to couple this analysis with in vitro assays to evaluate the presence of androgen and progesterone receptor active chemicals in the Fenholloway River. Focused gene expression analyses of masculinized G. holbrooki from downstream of the Fenholloway River paper mill were indicative of androgen exposure, while genes related to reproduction indicated potential progesterone exposure. Hepatic microarray analysis revealed an increase in the expression of metabolic genes in Fenholloway River fish, with similarities in genes and biological processes compared to G. holbrooki exposed to androgens. Water samples collected downstream of the paper mill and at a reference site indicated that progesterone and androgen receptor active chemicals were present at both sites, which corroborates previous chemical analyses. Results indicate that G. holbrooki downstream of the Fenholloway River paper mill are impacted by a mixture of both androgens and progesterones. This research provides data on the mechanisms of how paper mill effluents in Florida are acting as endocrine disruptors.

  17. Androgenic/estrogenic balance in the male rat cerebral circulation: metabolic enzymes and sex steroid receptors.

    Science.gov (United States)

    Gonzales, Rayna J; Ansar, Saema; Duckles, Sue P; Krause, Diana N

    2007-11-01

    Tissues from males can be regulated by a balance of androgenic and estrogenic effects because of local metabolism of testosterone and expression of relevant steroid hormone receptors. As a critical first step to understanding sex hormone influences in the cerebral circulation of males, we investigated the presence of enzymes that metabolize testosterone to active products and their respective receptors. We found that cerebral blood vessels from male rats express 5alpha-reductase type 2 and aromatase, enzymes responsible for conversion of testosterone into dihydrotestosterone (DHT) and 17beta-estradiol, respectively. Protein levels of these enzymes, however, were not modulated by long-term in vivo hormone treatment. We also showed the presence of receptors for both androgens (AR) and estrogens (ER) from male cerebral vessels. Western blot analysis showed bands corresponding to the full-length AR (110 kDa) and ERalpha (66 kDa). Long-term in vivo treatment of orchiectomized rats with testosterone or DHT, but not estrogen, increased AR levels in cerebral vessels. In contrast, ERalpha protein levels were increased after in vivo treatment with estrogen but not testosterone. Fluorescent immunostaining revealed ERalpha, AR, and 5alpha-reductase type 2 in both the endothelial and smooth muscle layers of cerebral arteries, whereas aromatase staining was solely localized to the endothelium. Thus, cerebral vessels from males are target tissues for both androgens and estrogen. Furthermore, local metabolism of testosterone might balance opposing androgenic and estrogenic influences on cerebrovascular as well as brain function in males.

  18. RNase L Suppresses Androgen Receptor Signaling, Cell Migration and Matrix Metalloproteinase Activity in Prostate Cancer Cells.

    Science.gov (United States)

    Dayal, Shubham; Zhou, Jun; Manivannan, Praveen; Siddiqui, Mohammad Adnan; Ahmad, Omaima Farid; Clark, Matthew; Awadia, Sahezeel; Garcia-Mata, Rafael; Shemshedini, Lirim; Malathi, Krishnamurthy

    2017-03-01

    The interferon antiviral pathways and prostate cancer genetics converge on a regulated endoribonuclease, RNase L. Positional cloning and linkage studies mapped Hereditary Prostate Cancer 1 (HPC1) to RNASEL. To date, there is no correlation of viral infections with prostate cancer, suggesting that RNase L may play additional roles in tumor suppression. Here, we demonstrate a role of RNase L as a suppressor of androgen receptor (AR) signaling, cell migration and matrix metalloproteinase activity. Using RNase L mutants, we show that its nucleolytic activity is dispensable for both AR signaling and migration. The most prevalent HPC1-associated mutations in RNase L, R462Q and E265X, enhance AR signaling and cell migration. RNase L negatively regulates cell migration and attachment on various extracellular matrices. We demonstrate that RNase L knockdown cells promote increased cell surface expression of integrin β1 which activates Focal Adhesion Kinase-Sarcoma (FAK-Src) pathway and Ras-related C3 botulinum toxin substrate 1-guanosine triphosphatase (Rac1-GTPase) activity to increase cell migration. Activity of matrix metalloproteinase (MMP)-2 and -9 is significantly increased in cells where RNase L levels are ablated. We show that mutations in RNase L found in HPC patients may promote prostate cancer by increasing expression of AR-responsive genes and cell motility and identify novel roles of RNase L as a prostate cancer susceptibility gene.

  19. Involvement of androgen receptor in sex determination in an amphibian species.

    Directory of Open Access Journals (Sweden)

    Jun Fujii

    Full Text Available In mice and humans, the androgen receptor (AR gene, located on the X chromosome, is not known to be involved in sex determination. In the Japanese frog Rana rugosa the AR is located on the sex chromosomes (X, Y, Z and W. Phylogenetic analysis shows that the AR on the X chromosome (X-AR of the Korean R. rugosa is basal and segregates into two clusters: one containing W-AR of Japanese R. rugosa, the other containing Y-AR. AR expression is twice as high in ZZ (male compared to ZW (female embryos in which the W-AR is barely expressed. Higher AR-expression may be associated with male sex determination in this species. To examine whether the Z-AR is involved in sex determination in R. rugosa, we produced transgenic (Tg frogs carrying an exogenous Z-AR. Analysis of ZW Tg frogs revealed development of masculinized gonads or 'ovotestes'. Expression of CYP17 and Dmrt1, genes known to be activated during normal male gonadal development, were up-regulated in the ZW ovotestis. Testosterone, supplied to the rearing water, completed the female-to-male sex-reversal in the AR-Tg ZW frogs. Here we report that Z-AR is involved in male sex-determination in an amphibian species.

  20. Involvement of androgen receptor in sex determination in an amphibian species.

    Science.gov (United States)

    Fujii, Jun; Kodama, Maho; Oike, Akira; Matsuo, Yasuki; Min, Mi-Sook; Hasebe, Takashi; Ishizuya-Oka, Atsuko; Kawakami, Koichi; Nakamura, Masahisa

    2014-01-01

    In mice and humans, the androgen receptor (AR) gene, located on the X chromosome, is not known to be involved in sex determination. In the Japanese frog Rana rugosa the AR is located on the sex chromosomes (X, Y, Z and W). Phylogenetic analysis shows that the AR on the X chromosome (X-AR) of the Korean R. rugosa is basal and segregates into two clusters: one containing W-AR of Japanese R. rugosa, the other containing Y-AR. AR expression is twice as high in ZZ (male) compared to ZW (female) embryos in which the W-AR is barely expressed. Higher AR-expression may be associated with male sex determination in this species. To examine whether the Z-AR is involved in sex determination in R. rugosa, we produced transgenic (Tg) frogs carrying an exogenous Z-AR. Analysis of ZW Tg frogs revealed development of masculinized gonads or 'ovotestes'. Expression of CYP17 and Dmrt1, genes known to be activated during normal male gonadal development, were up-regulated in the ZW ovotestis. Testosterone, supplied to the rearing water, completed the female-to-male sex-reversal in the AR-Tg ZW frogs. Here we report that Z-AR is involved in male sex-determination in an amphibian species.

  1. Androgen receptor CAG polymorphism and sporadic and early-onset prostate cancer among Mexican men.

    Science.gov (United States)

    Gómez, Rocío; Torres-Sánchez, Luisa; Camacho-Mejorado, Rafael; Burguete-García, Ana I; Vázquez-Salas, Ruth Argelia; Martínez-Nava, Gabriela A; Santana, Carla; Noris, Gino

    2016-09-01

    A short CAG repeat length in the gene encoding for the androgen receptor (AR) has been associated with prostate cancer (PC) risk and aggressiveness. In Latino men, information on this association is scarce. Hence, the aim of this study was to evaluate this association in Mexican males. Using fragment analysis by capillary electrophoresis, we determined the number of CAG repeats-(CAG)n-in AR gene from 158 incident PC cases and 326 age-matched healthy controls (±5 years), residing in Mexico City, Mexico. According to Gleason scale and age at diagnosis, cases were classified as high (⩾7) and low grade (CAG repeat length than controls (18.6±2.2 vs 19.5±2.5; P=0.02). Lower number of CAG repeats (CAG)⩽19 were associated with a greater risk for early-onset PC (odds ratio: 2.31; 95% confidence interval: 1.14-4.69). CAG repeat length could increase the risk for sporadic and early-onset PC. The best cutoff point for identifying at-risk subjects was (CAG)19. However, further studies are necessary to replicate our findings in subjects with a family history of PC and also to evaluate the association between CAG repeats length and disease progression.

  2. Androgen receptor status predicts response to chemotherapy, not risk of breast cancer in Indian women

    Directory of Open Access Journals (Sweden)

    Chakraborty Anurupa

    2010-08-01

    Full Text Available Abstract Background Considerably little is known about the biological role and clinical significance of androgen receptor expression in breast cancer. The objectives of this study were to characterize AR-CAG repeat genotypes in a cohort of women with breast cancer and to determine the influence of AR on response to neoadjuvant chemotherapy and clinical outcome. Materials and methods Genotyping of the AR CAG repeat region was done on 70 patients and 80 healthy aged- matched female controls. To assess response to NACT, tissue samples from 30 LABC cases were evaluated quantitatively by real time for AR mRNA expression. The clinical response was correlated with both the pre and post chemotherapy AR expression. The CAG alleles did not show differences between cases and controls when the mean of short, long and average length of both CAG alleles was considered. However, analysis when done defining short allele as CAGn Conclusions Although, expansion of the CAGn in the AR gene doesn't show any major effect on breast cancer risk, patients with positive AR expression, pre neoadjuvant chemotherapy, were found to be good responders and a decrease in mRNA level of AR gene related to the chemotherapy-induced apoptosis could serve as an important independent predictor of response to NACT.

  3. Targeting of Androgen Receptor Expression by Andro-miRs as Novel Adjunctive Therapeutics in Prostate Cancer.

    Science.gov (United States)

    Ebron, Jey Sabith; Weyman, Crystal M; Shukla, Girish C

    2013-04-01

    Prostate cancer begins as an androgen-responsive disease. However, subsequent accumulation of multiple sequential genetic and epigenetic alterations transforms the disease into an aggressive, castration-resistant prostate cancer (CRPC). The monoallelic Androgen Receptor (AR) is associated with the onset, growth and development of Prostate cancer. The AR is a ligand-dependent transcription factor, and the targeting of androgen- and AR-signaling axis remains the primary therapeutic option for Prostate cancer (PCa) treatment. A durable and functional disruption of AR signaling pathways combining both traditional and novel therapeutics is likely to provide better treatment options for CRPC. Recent work has indicated that expression of AR is modulated at the posttranscriptional level by regulatory miRNAs. Due to a relatively long 3' untranslated region (UTR) of AR mRNA, the posttranscription expression is likely to be regulated by hundreds of miRNAs in normal as well as in disease state. The main objective of the article is to offer a thought-provoking concept of "andro-miRs" and their potential application in AR gene expression targeting. This new paradigm for targeting constitutively active AR and its tumor specific splicing isoforms using andro-miRs may pave the way for a novel adjunctive therapy and improved treatment of CRPC.

  4. A novel selective androgen receptor modulator, NEP28, is efficacious in muscle and brain without serious side effects on prostate.

    Science.gov (United States)

    Akita, Kazumasa; Harada, Koichiro; Ichihara, Junji; Takata, Naoko; Takahashi, Yasuhiko; Saito, Koichi

    2013-11-15

    Age-related androgen depletion is known to be a risk factor for various diseases, such as osteoporosis and sarcopenia. Furthermore, recent studies have demonstrated that age-related androgen depletion results in accumulation of β-amyloid protein and thereby acts as a risk factor for the development of Alzheimer's disease. Supplemental androgen therapy has been shown to be efficacious in treating osteoporosis and sarcopenia. In addition, studies in animals have demonstrated that androgens can play a protective role against Alzheimer's disease. However, androgen therapy is not used routinely for these indications, because of side effects. Selective androgen receptor modulators (SARMs) are a new class of compounds. SARMs maintain the beneficial effects of androgens on bone and muscle while reducing unwanted side effects. NEP28 is a new SARM exhibiting high selectivity for androgen receptor. To investigate the pharmacological effects of NEP28, we compared the effects on muscle, prostate, and brain with mice that were androgen depleted by orchidectomy and then treated with either placebo, NEP28, dihydrotestosterone, or methyltestosterone. We demonstrated that NEP28 showed tissue-selective effect equivalent to or higher than existing SARMs. In addition, the administration of NEP28 increased the activity of neprilysin, a known Aβ-degrading enzyme. These results indicate that SARM is efficacious for the treatment of not only osteoporosis and sarcopenia, but also Alzheimer's disease.

  5. Effects of blocking androgen receptor expression with specific hammerhead ribozyme on in vitro growth of prostate cancer cell line

    Institute of Scientific and Technical Information of China (English)

    童强松; 赵军; 陈朝晖; 曾甫清; 鲁功成

    2003-01-01

    Objective To study the possibility of gene therapy for prostate cancer by blocking androgen receptor (AR) gene expression using a specific hammerhead ribozyme (RZ).Methods The hammerhead ribozyme expression vector pcDNA-hAR-RZ, specific to AR mRNA, was constructed and transfected into the prostate cancer cell line LNCaP by using lipofectamine. Androgen receptor expression was measured by RT-PCR and immunohistochemical methods. Cellular proliferation activities were assayed using the tetrazolium bromide colorimetry method; cell cycle changes were observed by flow cytometry; and cell apoptosis was detected by the TdT-mediated dUTP-biotin nick end labeling method. Results One to seven days after transfection with the ribozyme expression vector, AR mRNA expression at molecular and protein levels in LNCaP cells decreased by 32.6%-40.7% (P<0.05) and 21.0%-87.64% (P<0.05) respectively, and cell proliferation was inhibited by 18.28%-35.34% (P<0.05). Meanwhile, the cell cycle was arrested at the G2/M stage, and apoptotic morphological changes occurred with an apoptosis rate of 25.17% (P<0.01).Conclusion Ribozyme specific against AR mRNA is capable of inhibiting the expression AR and inducing the apoptosis in prostate cancer cells.

  6. Preserved fertility in a patient with gynecomastia associated with the p.Pro695Ser mutation in the androgen receptor.

    Science.gov (United States)

    Petroli, Reginaldo J; Hiort, Olaf; Struve, Dagmar; Maciel-Guerra, Andréa T; Guerra-Júnior, Gil; Palandi de Mello, Maricilda; Werner, Ralf

    2014-01-01

    The androgen insensitivity syndrome (AIS) is described as a dysfunction of the androgen receptor (AR) in 46,XY individuals, which can be associated with mutations in the AR gene or can be due to unknown mechanisms. Different mutations in AIS generally cause variable phenotypes that range from a complete hormone resistance to a mild form usually associated with male infertility. The purpose of this study was to search for mutations in the AR gene in a fertile man with gynecomastia and to evaluate the influence of the mutation on the AR transactivation ability. Sequencing of the AR gene revealed the p.Pro695Ser mutation. It is located within the AR ligand-binding domain. Bioinformatics analysis indicated a deleterious role, which was verified after testing transactivation activity and N-/C-terminal (N/C) interaction by in vitro expression of a reporter gene and 2-hybrid assays. p.Pro695Ser showed low levels of both transactivation activity and N/C interaction at low dihydrotestosterone (DHT) conditions. As the ligand concentration increased, both transactivation activity and N/C interaction also increased and reached normal levels. Therefore, this study provides functional insights for the p.Pro695Ser mutation described here for the first time in a patient with mild AIS. The expression profile of p.Pro695Ser not only correlates to the patient's phenotype, but also suggests that a high-dose DHT therapy may overcome the functional deficit of the mutant AR.

  7. Androgen receptor coregulator ARA267-α interacts with death receptor-6 revealed by the yeast two-hybrid

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    ARA267-αis a newly identified androgen receptor coactivator.In order to further elucidate its precise role in cells,using the ARA267- α fragment containing four PHD and one SET conserved domains as bait we revealed an ARA267-α-PHD-SET-interacting protein,death receptor-6(DR6),in the yeast two-hybrid screening.DR6 is the member of TNF receptor family and has a death domain in its intracellular cytoplasmic portion(DR6cp)to mediate the cell apoptosis.The interaction between ARA267-α-PHD-SET and DR6cp was confirmed in vitro and in vivo.Our finding implied that androgen signaling pathway might cross talk with apoptosis signaling pathway through the interaction between ARA267-α and DR6.

  8. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome

    Directory of Open Access Journals (Sweden)

    G Bhaskararao

    2014-01-01

    Full Text Available Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen insensitivity syndrome, and partial androgen insensitivity syndrome. Management of androgen insensitivity syndrome includes multidisciplinary approach and involves gonedectomy to avoid gonadal tumors in later life. Hormone replacement therapy (HRT and psychological support are required in long-term basis.

  9. Critical role of androgen receptor in the postnatal period in male sexual behavior in rats.

    Science.gov (United States)

    Yamada, Shunji; Ohoya, Miku; Takanami, Keiko; Matsuda, Ken Ichi; Kawata, Mitsuhiro

    2015-11-16

    Gonadal hormones have a developmental role in organization of the nervous system that regulates sexually dimorphic behavior. It is well known that androgen secreted from testes in the perinatal period is converted to estrogen by aromatase in rodent brain, and that estrogen and its receptor play a pivotal role in masculinization of brain structure and function. Treatment with flutamide, an androgen receptor (AR) antagonist, during the perinatal period inhibits development of malespecific brain structure and function, suggesting that androgen signaling via AR also influences brain masculinization. In this study, we investigated which stage during the postnatal period is critical for androgen signaling in brain masculinization. The postnatal period was designated as postnatal days (PD) 0-22, and divided into stages I (PD 0-7), II (PD 8-14), and III (PD 15-22). Newborn male rats were given flutamide subcutaneously in each stage. After adulthood, the effects of postnatal flutamide treatment on brain masculinization were evaluated byanalysis of male sexual behavior. Continuous inhibition of AR throughout stages I and II caused a robust reduction of the intromission ratio and ejaculation frequency compared with other groups. AR inhibition in stage I, II, or III did not cause any change. AR inhibition had no effect onmount behavior. These results show that stage-specific AR activation in the first two postnatal weeks may contribute to brain masculinization mediating male sexual behavior in adulthood.

  10. Effect of small molecules modulating androgen receptor (SARMs in human prostate cancer models.

    Directory of Open Access Journals (Sweden)

    Anna Tesei

    Full Text Available The management of hormone-refractory prostate cancer represents a major challenge in the therapy of this tumor, and identification of novel androgen receptor antagonists is needed to render treatment more effective. We analyzed the activity of two novel androgen receptor antagonists, (S-11 and (R-9, in in vitro and in vivo experimental models of hormone-sensitive or castration-resistant prostate cancer (CRPC. In vitro experiments were performed on LNCaP, LNCaP-AR, LNCaP-Rbic and VCaP human prostate cancer cells. Cytotoxic activity was assessed by SRB and BrdU uptake, AR transactivation by luciferase reporter assay and PSA levels by Real Time RT-PCR and ELISA assays. Cell cycle progression-related markers were evaluated by western blot. In vivo experiments were performed on SCID mice xenografted with cells with different sensitivity to hormonal treatment. In hormone-sensitive LNCaP and LNCaP-AR cells, the latter expressing high androgen receptor levels, (R-9 and (S-11 exhibited a higher cytotoxic effect compared to that of the reference compound ((R-bicalutamide, also in the presence of the synthetic androgen R1881. Furthermore, the cytotoxic effect produced by (R-9 was higher than that of (S-11 in the two hormone-resistant LNCaP-AR and VCaP cells. A significant reduction in PSA levels was observed after exposure to both molecules. Moreover, (S-11 and (R-9 inhibited DNA synthesis by blocking the androgen-induced increase in cyclin D1 protein levels. In vivo studies on the toxicological profile of (R-9 did not reveal the presence of adverse events. Furthermore, (R-9 inhibited tumor growth in various in vivo models, especially LNCaP-Rbic xenografts, representative of recurrent disease. Our in vitro results highlight the antitumor activity of the two novel molecules (R-9 and (S-11, making them a potentially attractive option for the treatment of CRPC.

  11. Pharmacological characterization of an imidazolopyrazole as novel selective androgen receptor modulator.

    Science.gov (United States)

    Zhang, Xuqing; Allan, George F; Tannenbaum, Pamela; Sbriscia, Tifanie; Linton, Olivia; Lai, Muh-Tsann; Haynes-Johnson, Donna; Bhattacharjee, Sheela; Lundeen, Scott G; Sui, Zhihua

    2013-03-01

    Selective androgen receptor modulators (SARMs) are androgens with tissue-selective activity. SARMs that have anabolic activity on muscle while having minimal stimulatory activity on prostate are classified as SARM agonists. They can be used to prevent the loss of lean body mass that is associated with cancer, immunodeficiency, renal disease and aging. They may also have anabolic activity on bone; thus, unlike estrogens, they may reverse the loss of bone strength associated with aging or hypogonadism. Our in-house effort on SARM program discovers a nonsteroidal androgen receptor ligand with a unique imidazolopyrazole moiety in its structure. In vitro, this compound is a weak androgen receptor binder and a weak androgen agonist. Despite this, in orchidectomized mature rats it is an effective SARM agonist, with an ED(50) on levator ani muscle of 3.3mg/kg and an ED(50) on ventral prostate of >30mg/kg. It has its maximal effect on muscle at the dose of 10mg/kg. In addition, this compound has mixed agonistic and antagonistic activities on prostate, reducing the weight of that tissue in intact rats by 22% at 10mg/kg. The compound does not have significant effect on gonadotropin levels or testosterone levels in both orchidectomized and intact male rats. It does not have notable progestin, estrogen or glucocorticoid agonistic or antagonistic activity in rats. In a female sexual behavior model, it improves the sexual desire of ovariectomized female rats for sexually mature intact males over nonsexually ovariectomized females. Overall, the imidazolopyrazole is a potent prostate-sparing candidate for development as a SARM agonist with an appropriate pharmacological profile for clinical benefit in muscle-wasting conditions and female sexual function disorders.

  12. Looking beyond Androgen Receptor Signaling in the Treatment of Advanced Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Benjamin Sunkel

    2014-01-01

    Full Text Available This review will provide a description of recent efforts in our laboratory contributing to a general goal of identifying critical determinants of prostate cancer growth in both androgen-dependent and -independent contexts. Important outcomes to date have indicated that the sustained activation of AR transcriptional activity in castration-resistant prostate cancer (CRPC cells results in a gene expression profile separate from the androgen-responsive profile of androgen-dependent prostate cancer (ADPC cells. Contributing to this reprogramming is enhanced FoxA1 recruitment of AR to G2/M phase target gene loci and the enhanced chromatin looping of CRPC-specific gene regulatory elements facilitated by PI3K/Akt-phosphorylated MED1. We have also observed a role for FoxA1 beyond AR signaling in driving G1/S phase cell cycle progression that relies on interactions with novel collaborators MYBL2 and CREB1. Finally, we describe an in-depth mechanism of GATA2-mediated androgen-responsive gene expression in both ADPC and CRPC cells. Altogether these efforts provide evidence to support the development of novel prostate cancer therapeutics that address downstream targets of AR activity as well as AR-independent drivers of disease-relevant transcription programs.

  13. Catalytic inhibitors of DNA topoisomerase II suppress the androgen receptor signaling and prostate cancer progression.

    Science.gov (United States)

    Li, Haolong; Xie, Ning; Gleave, Martin E; Dong, Xuesen

    2015-08-21

    Although the new generation of androgen receptor (AR) antagonists like enzalutamide (ENZ) prolong survival of metastatic castration-resistant prostate cancer (CRPC), AR-driven tumors eventually recur indicating that additional therapies are required to fully block AR function. Since DNA topoisomerase II (Topo II) was demonstrated to be essential for AR to initiate gene transcription, this study tested whether catalytic inhibitors of Topo II can block AR signaling and suppress ENZ-resistant CRPC growth. Using multiple prostate cancer cell lines, we showed that catalytic Topo II inhibitors, ICRF187 and ICRF193 inhibited transcription activities of the wild-type AR, mutant ARs (F876L and W741C) and the AR-V7 splice variant. ICRF187 and ICRF193 decreased AR recruitment to target promoters and reduced AR nuclear localization. Both ICRF187 and ICRF193 also inhibited cell proliferation and delayed cell cycling at the G2/M phase. ICRF187 inhibited tumor growth of castration-resistant LNCaP and 22RV1 xenografts as well as ENZ-resistant MR49F xenografts. We conclude that catalytic Topo II inhibitors can block AR signaling and inhibit tumor growth of CRPC xenografts, identifying a potential co-targeting approach using these inhibitors in combination with AR pathway inhibitors in CRPC.

  14. Pax6 represses androgen receptor-mediated transactivation by inhibiting recruitment of the coactivator SPBP.

    Directory of Open Access Journals (Sweden)

    Julianne Elvenes

    Full Text Available The androgen receptor (AR has a central role in development and maintenance of the male reproductive system and in the etiology of prostate cancer. The transcription factor Pax6 has recently been reported to act as a repressor of AR and to be hypermethylated in prostate cancer cells. SPBP is a transcriptional regulator that previously has been shown to enhance the activity of Pax6. In this study we have identified SPBP to act as a transcriptional coactivator of AR. We also show that Pax6 inhibits SPBP-mediated enhancement of AR activity on the AR target gene probasin promoter, a repression that was partly reversed by increased expression of SPBP. Enhanced expression of Pax6 reduced the amount of SPBP associated with the probasin promoter when assayed by ChIP in HeLa cells. We mapped the interaction between both AR and SPBP, and AR and Pax6 to the DNA-binding domains of the involved proteins. Further binding studies revealed that Pax6 and SPBP compete for binding to AR. These results suggest that Pax6 represses AR activity by displacing and/or inhibiting recruitment of coactivators to AR target promoters. Understanding the mechanism for inhibition of AR coactivators can give rise to molecular targeted drugs for treatment of prostate cancer.

  15. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    Science.gov (United States)

    Mutter, G L; Boynton, K A

    1995-04-25

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under optimal conditions amplification efficiency of two HUMARA alleles is near-equivalent, generating PCR products in a ratio proportional to that of the genomic template. In contrast, reduction of template quantity, damage of template by ultraviolet irradiation or addition of monovalent salts (sodium chloride, sodium acetate or ammonium acetate) produces highly variable imbalances of allelic PCR products, with a strong tendency to preferentially amplify lower molecular weight alleles. Variability and biasing was diminished by substitution of 7-deaza-2'-dGTP for dGTP during amplification, an intervention which reduces stability of intramolecular and intermolecular GC base pairing. We conclude that DNA which is scanty, damaged or salt contaminated may display amplification bias of GC-rich PCR targets, potentially confounding accurate interpretation or reproducibility of assays which require co-amplification of alleles.

  16. Structure of the ligand-binding domain (LBD) of human androgen receptor in complex with a selective modulator LGD2226

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng; Liu, Xiao-qin; Li, He; Liang, Kai-ni [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, 15 Datun Road, Chaoyang District, Beijing 100101 (China); Miner, Jeffrey N.; Hong, Mei; Kallel, E. Adam; Oeveren, Arjan van; Zhi, Lin [Discovery Research, Ligand Pharmaceuticals Inc., 10275 Science Center Drive, San Diego, California 92121 (United States); Jiang, Tao, E-mail: x-ray@sun5.ibp.ac.cn [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, 15 Datun Road, Chaoyang District, Beijing 100101 (China)

    2006-11-01

    Crystal structure of the ligand-binding domain of androgen receptor in complex with LGD2226. The androgen receptor (AR) is a ligand-inducible steroid hormone receptor that mediates androgen action, determining male sexual phenotypes and promoting spermatogenesis. As the androgens play a dominant role in male sexual development and function, steroidal androgen agonists have been used clinically for some years. However, there is a risk of potential side effects and most steroidal androgens cannot be dosed orally, which limits the use of these substances. 1,2-Dihydro-6-N,N-bis(2,2,2-trifluoroethyl) amino-4-trifluoromethyl-2-quinolinone (LGD2226) is a synthetic nonsteroidal ligand and a novel selective AR modulator. The crystal structure of the complex of LGD2226 with the androgen receptor ligand-binding domain (AR LBD) at 2.1 Å was solved and compared with the structure of the AR LBD–R1881 complex. It is hoped that this will aid in further explaining the selectivity of LGD2226 observed in in vitro and in vivo assays and in developing more selective and effective therapeutic agents.

  17. Strategies for Amplification of Trinucleotide Repeats: Optimization of Fragile X and Androgen Receptor PCR.

    Science.gov (United States)

    Papp; Snyder; Sedra; Guida; Prior

    1996-06-01

    Background: Trinucleotide repeat regions are heritable unstable elements that change in copy number from generation to generation. Amplification of these triplet repeats is an important diagnostic tool for molecular medicine. However, these repeats are often difficult to amplify and may require the use of different cosolvents or amplification strategies. Methods and Results: We used the fragile X and androgen receptor triplet repeat regions to demonstrate a series of conditions that may be used to optimize the amplification of repeat sequences. Conclusions: For androgen receptor, we show that predigestion of the template DNA was sufficient to generate consistent amplification. In the case of fragile X we found that predigestion, when combined with use of betaine as a destabilizing additive, was superior to other methods and yielded consistent amplification of normal and premutation alleles in both isotopic and nonisotopic reactions.

  18. Structural Stereochemistry of Androstene Hormones Determines Interactions with Human Androgen, Estrogen, and Glucocorticoid Receptors

    Directory of Open Access Journals (Sweden)

    Thomas L. Shaak

    2013-01-01

    Full Text Available DHEA, 17α-AED, 17β-AED, and 17β-AET exhibit strong biological activity that has been attributed to androgenic, estrogenic, or antiglucocorticoid activity in vivo and in vitro. This study compared DHEA, 17α-AED, 17β-AED, and 17β-AET for their ability to activate the human AR, ER, and GR and determine the relative androgenicity, estrogenicity, and glucocorticoid activity. The results show that, at the receptor level, these androstene hormones are weak AR and even weaker ER activators. Direct androstene hormone activation of the human AR, ERα, and ERβ may not be essential for their biological function. Similarly, these hormones indirectly activated the human GR, only in the presence of high dexamethasone concentrations. These results underscore the major difference between androstene hormone interactions with these nuclear receptors and their biological effects.

  19. Synthesis and biological evaluation of novel selective androgen receptor modulators (SARMs). Part I.

    Science.gov (United States)

    Aikawa, Katsuji; Miyawaki, Toshio; Hitaka, Takenori; Imai, Yumi N; Hara, Takahito; Miyazaki, Junichi; Yamaoka, Masuo; Kusaka, Masami; Kanzaki, Naoyuki; Tasaka, Akihiro; Shiraishi, Mitsuru; Yamamoto, Satoshi

    2015-05-15

    To develop effective drugs for hypogonadism, sarcopenia, and cachexia, we designed, synthesized, and evaluated selective androgen receptor modulators (SARMs) that exhibit not only anabolic effects on organs such as muscles and the central nervous system (CNS) but also neutral or antagonistic effects on the prostate. Based on the information obtained from a docking model with androgen receptor (AR), we modified a hit compound A identified through high-throughput screening. Among the prepared compounds, 1-(4-cyano-1-naphthyl)-2,3-disubstituted pyrrolidine derivatives 17h, 17m, and 17j had highly potent AR agonistic activities in vitro and good tissue selectivity in vivo. These derivatives increased the weight of the levator ani muscle without influencing the prostate and seminal vesicle. In addition, these compounds induced sexual behavior in castrated rats, indicating that the compounds could also act as agonists on the CNS.

  20. GLI1, a crucial mediator of sonic hedgehog signaling in prostate cancer, functions as a negative modulator for androgen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Guangchun; Goto, Yutaka; Sakamoto, Ryuichi; Tanaka, Kimitaka; Matsubara, Eri [Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Nakamura, Masafumi [Department of Cancer Therapy and Research, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Zheng, Hong [School of Pharmacy, Second Military Medical University, Shanghai 200433 (China); Lu, Jian [Department of Pathophysiology, Second Military Medical University, Shanghai 200433 (China); Takayanagi, Ryoichi [Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Nomura, Masatoshi, E-mail: nomura@med.kyushu-u.ac.jp [Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan)

    2011-01-21

    Research highlights: {yields} GLI1, which play a central role in sonic hedgehog signaling in prostate cancer, can act as a co-repressor to substantially block androgen receptor-mediated transactivation. {yields} GLI1 directly interacts with AR. {yields} SHH-GLI pathway might be one of determinants governing the transition of prostate cancer from an androgen-dependent to an androgen-independent state. -- Abstract: Sonic hedgehog (SHH) signaling, acting in a combinatorial manner with androgen signaling, is essential for prostate patterning and development. Recently, elevated activation of SHH signaling has been shown to play important roles in proliferation, progression and metastasis of prostate cancer. In this report, we demonstrate for the first time, that GLI1, which has been shown to play a central role in SHH signaling in prostate cancer, can act as a co-repressor to substantially block androgen receptor (AR)-mediated transactivation, at least in part, by directly interacting with AR. Our observations suggest that the SHH-GLI pathway might be one of determinants governing the transition of prostate cancer from an androgen-dependent to an androgen-independent state by compensating, or even superseding androgen signaling.

  1. A novel nuclear role for the Vav3 nucleotide exchange factor in androgen receptor coactivation in prostate cancer.

    Science.gov (United States)

    Rao, S; Lyons, L S; Fahrenholtz, C D; Wu, F; Farooq, A; Balkan, W; Burnstein, K L

    2012-02-01

    Increased androgen receptor (AR) transcriptional activity mediated by coactivator proteins may drive castration-resistant prostate cancer (CRPC) growth. Vav3, a Rho GTPase guanine nucleotide exchange factor (GEF), is overexpressed in human prostate cancers, particularly in models of CRPC progression. Vav3 coactivates AR in a Vav3 pleckstrin homology (PH) domain-dependent but GEF-independent manner. Ectopic expression of Vav3 in androgen-dependent human prostate cancer cells conferred robust castration-resistant xenograft tumor growth. Vav3 but not a Vav3 PH mutant greatly stimulated interaction between the AR amino and carboxyl termini (N-C interaction), which is required for maximal receptor transcriptional activity. Vav3 was distributed between the cytoplasm and nucleus with nuclear localization-dependent on the Vav3 PH domain. Membrane targeting of Vav3 abolished Vav3 potentiation of AR activity, whereas nuclear targeting of a Vav3 PH mutant rescued AR coactivation, suggesting that nuclear localization is an important function of the Vav3 PH domain. A nuclear role for Vav3 was further demonstrated by sequential chromatin immunoprecipitation assays, which revealed that Vav3 and AR were recruited to the same transcriptional complexes of an AR target gene enhancer. These data demonstrate the importance of Vav3 in CRPC and define a novel nuclear function of Vav3 in regulating AR activity.

  2. Genetic ablation of androgen receptor signaling in fetal Leydig cell lineage affects Leydig cell functions in adult testis.

    Science.gov (United States)

    Kaftanovskaya, Elena M; Lopez, Carolina; Ferguson, Lydia; Myhr, Courtney; Agoulnik, Alexander I

    2015-06-01

    It is commonly accepted that androgen-producing fetal Leydig cells (FLC) are substituted by adult Leydig cells (ALC) during perinatal testis development. The mechanisms influencing this process are unclear. We used mice with a retinoid acid receptor 2 promoter-Cre recombinase transgene (Rarb-cre) expressed in embryonic FLC precursors, but not in postnatal testis, and a dual fluorescent Cre recombinase reporter to label FLC and ALC in vivo. All FLC in newborn testis had the recombinant, whereas the majority of LC in adult testis had the nonrecombinant reporter. Primary LC cultures from adult testis had either recombinant (20%) or nonrecombinant (80%) cells, demonstrating that the FLC survive in adult testis and their ontogeny is distinct from ALC. Conditional inactivation of androgen receptor (AR) allele using the Rarb-cre transgene resulted in a 50% increase of AR-negative LC in adult testis. The mutant males became infertile with age, with all LC in older testis showing signs of incomplete differentiation, such as a large number of big lipid droplets, an increase of finger-like protrusions, and a misexpression of steroidogenic or FLC- and ALC-specific genes. We propose that the antiandrogenic exposure during early development may similarly result in an increase of FLC in adult testis, leading to abnormal LC differentiation.

  3. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies.

    Science.gov (United States)

    Mao, Qixing; Qiu, Mantang; Dong, Gaochao; Xia, Wenjie; Zhang, Shuai; Xu, Youtao; Wang, Jie; Rong, Yin; Xu, Lin; Jiang, Feng

    2015-01-01

    The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg's test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855-1.245). However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089-1.992). Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014-1.707). These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results.

  4. Androgen receptor expression in the rat prostate is down-regulated by dietary phytoestrogens

    OpenAIRE

    Handa Robert J; Adlercreutz Herman; Lund Trent D; Munson Daniel J; Lephart Edwin D

    2004-01-01

    Abstract Background It is well established that the growth of the prostate gland is a hormone-dependent phenomenon involving both androgenic and estrogenic control. Proliferation of prostate cells is, at least in part, under control of estrogen receptor beta (ER-beta). Phytoestrogens bind ER-beta with high affinity and therefore may have antiproliferative effects in the prostate. Methods The prostates of male Long-Evans rats fed a diet high in phytoestrogens (Phyto-600) or very low levels of ...

  5. Regulation of human androgen receptor by corepressors and signal transduction in prostate cancer

    OpenAIRE

    2006-01-01

    The thesis primarily addresses the role of transcriptional corepressor and signal transduction cascades in regulating androgen receptor (AR) activity. AR is a ligand-activated transcription factor and is important for the development of male phenotype. Malfunctioning of AR function has been implicated in the progression of the prostate cancer (CaP). Clinical management of the CaP most often involves the administration of anti-hormones (Cas, CPA) that bind to AR and turn it transcr...

  6. Discovery of non-LBD inhibitor for androgen receptor by structure-guide design.

    Science.gov (United States)

    Ryu, Byung Jun; Kim, Nakjeong; Kim, Jun Tae; Koo, Tae-Sung; Yoo, Sung-Eun; Jeong, Seo Hee; Kim, Seong Hwan; Kang, Nam Sook

    2013-07-01

    In this study, we synthesized the BF-3 binding small molecules, a series of pyridazinone-based compounds, as a novel class of non-LBP antiandrogens for treating prostate cancer by inhibiting androgen receptor. The new class compound was discovered to inhibitor the viability of AR-dependent human prostate LNCap cells and AR activity combining with the computational method. It showed a good physicochemical and PK property.

  7. Targeting Ligand Dependent and Ligand Independent Androgen Receptor Signaling in Prostate Cancer

    Science.gov (United States)

    2014-10-01

    References 1. Cunha GR, Lung B, Reese B. Glandular epithelial induction by embryonic mesenchyme in adult bladder epithelium of BALB/c mice. Invest Urol...Buffalo, New York 14203 Androgen receptor (AR) action throughout prostate development and in maintenance of the pros- tatic epithelium is partly... epithelium causes prostatic hyperplasia and alteration of differentiated phenotype [published online May 19, 2014]. Lab Invest. 2014. doi:10.1038/labinvest

  8. Evaluation of Androgen Receptor Function in Prostate Cancer Prognosis and Therapeutic Stratification

    Science.gov (United States)

    2014-10-01

    Bethesda, MD 20817 REPORT DATE: October 2014 TYPE OF REPORT: Annual PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick...October 2014 2. REPORT TYPE : Annual 3. DATES COVERED (From - To) 30 SEP 2013 - 29 SEP 2014 4. TITLE AND SUBTITLE: Evaluation of Androgen Receptor...examined human prostate cancer tissues (surgery or diagnostic biopsy specimens) at early stages of the disease and matched with longitudinal follow up data

  9. Targeting Ligand-Dependent and Ligand-Independent Androgen Receptor Signaling in Prostate Cancer

    Science.gov (United States)

    2015-10-01

    Award Number: W81XWH-12-1-0288 TITLE: Targeting Ligand-Dependent and Ligand-Independent Androgen Receptor Signaling in Prostate Cancer...average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed...and completing and reviewing this collection of information. Send comments regarding this burden estimate or any other aspect of this collection of

  10. N-Aryl-oxazolidin-2-imine Muscle Selective Androgen Receptor Modulators Enhance Potency through Pharmacophore Reorientation

    Energy Technology Data Exchange (ETDEWEB)

    Nirschl, Alexandra A.; Zou, Yan; Krystek, Jr., Stanley R.; Sutton, James C.; Simpkins, Ligaya M.; Lupisella, John A.; Kuhns, Joyce E.; Seethala, Ramakrishna; Golla, Rajasree; Sleph, Paul G.; Beehler, Blake C.; Grover, Gary J.; Egan, Donald; Fura, Aberra; Vyas, Viral P.; Li, Yi-Xin; Sack, John S.; Kish, Kevin F.; An, Yongmi; Bryson, James A.; Gougoutas, Jack Z.; DiMarco, John; Zahler, Robert; Ostrowski, Jacek; Hamann, Lawrence G.; (BMS)

    2010-11-09

    A novel selective androgen receptor modulator (SARM) scaffold was discovered as a byproduct obtained during synthesis of our earlier series of imidazolidin-2-ones. The resulting oxazolidin-2-imines are among the most potent SARMs known, with many analogues exhibiting sub-nM in vitro potency in binding and functional assays. Despite the potential for hydrolytic instability at gut pH, compounds of the present class showed good oral bioavailability and were highly active in a standard rodent pharmacological model.

  11. Histone H4 Lys 20 methyltransferase SET8 promotes androgen receptor-mediated transcription activation in prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Lushuai [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Li, Yanyan; Du, Fengxia [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); Han, Xiao [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Li, Xiaohua [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); Niu, Yuanjie [Chawnshang Chang Sex Hormone Research Center, Tianjin Institute of Urology, Tianjin Medical University, Tianjin 300070 (China); Ren, Shancheng, E-mail: renshancheng@gmail.com [Department of Urology, Shanghai Changhai Hospital, Second Military Medical University, Shanghai 200433 (China); Sun, Yingli, E-mail: sunyl@big.ac.cn [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-07-18

    Highlights: • Dihydrotestosterone stimulates H4K20me1 enrichment at the PSA promoter. • SET8 promotes AR-mediated transcription activation. • SET8 interacts with AR and promotes cell proliferation. - Abstract: Histone methylation status in different lysine residues has an important role in transcription regulation. The effect of H4K20 monomethylation (H4K20me1) on androgen receptor (AR)-mediated gene transcription remains unclear. Here we show that AR agonist stimulates the enrichment of H4K20me1 and SET8 at the promoter of AR target gene PSA in an AR dependent manner. Furthermore, SET8 is crucial for the transcription activation of PSA. Co-immunoprecipitation analyses demonstrate that SET8 interacts with AR. Therefore, we conclude that SET8 is involved in AR-mediated transcription activation, possibly through its interaction with AR and H4K20me1 modification.

  12. Abnormal Mitochondrial Function and Impaired Granulosa Cell Differentiation in Androgen Receptor Knockout Mice

    Directory of Open Access Journals (Sweden)

    Ruey-Sheng Wang

    2015-04-01

    Full Text Available In the ovary, the paracrine interactions between the oocyte and surrounded granulosa cells are critical for optimal oocyte quality and embryonic development. Mice lacking the androgen receptor (AR−/− were noted to have reduced fertility with abnormal ovarian function that might involve the promotion of preantral follicle growth and prevention of follicular atresia. However, the detailed mechanism of how AR in granulosa cells exerts its effects on oocyte quality is poorly understood. Comparing in vitro maturation rate of oocytes, we found oocytes collected from AR−/− mice have a significantly poor maturating rate with 60% reached metaphase II and 30% remained in germinal vesicle breakdown stage, whereas 95% of wild-type AR (AR+/+ oocytes had reached metaphase II. Interestingly, we found these AR−/− female mice also had an increased frequency of morphological alterations in the mitochondria of granulosa cells with reduced ATP generation (0.18 ± 0.02 vs. 0.29 ± 0.02 µM/mg protein; p < 0.05 and aberrant mitochondrial biogenesis. Mechanism dissection found loss of AR led to a significant decrease in the expression of peroxisome proliferator-activated receptor γ (PPARγ co-activator 1-β (PGC1-β and its sequential downstream genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM, in controlling mitochondrial biogenesis. These results indicate that AR may contribute to maintain oocyte quality and fertility via controlling the signals of PGC1-β-mediated mitochondrial biogenesis in granulosa cells.

  13. A precisely substituted benzopyran targets androgen refractory prostate cancer cells through selective modulation of estrogen receptors.

    Science.gov (United States)

    Kumar, Rajeev; Verma, Vikas; Sharma, Vikas; Jain, Ashish; Singh, Vishal; Sarswat, Amit; Maikhuri, Jagdamba P; Sharma, Vishnu L; Gupta, Gopal

    2015-03-15

    Dietary consumption of phytoestrogens like genistein has been linked with lower incidence of prostate cancer. The estradiol-like benzopyran core of genistein confers estrogen receptor-β (ER-β) selectivity that imparts weak anti-proliferative activity against prostate cancer cells. DL-2-[4-(2-piperidinoethoxy)phenyl]-3-phenyl-2H-1-benzopyran (BP), a SERM designed with benzopyran core, targeted androgen independent prostate cancer (PC-3) cells 14-times more potently than genistein, ~25% more efficiently than tamoxifen and 6.5-times more actively than ICI-182780, without forfeiting significant specificity in comparison to genistein. BP increased apoptosis (annexin-V and TUNEL labeling), arrested cell cycle, and significantly increased caspase-3 activity along with mRNA expressions of estrogen receptor (ER)-β and FasL (qPCR) in PC-3 cells. In classical ERE-luc reporter assay BP behaved as a potent ER-α antagonist and ER-β agonist. Accordingly, it decreased expression of ER-α target PS2 (P<0.01) and increased expression of ER-β target TNF-α (P<0.05) genes in PC-3. ER-β deficient PC-3 (siRNA-transfected) was resistant to apoptotic and anti-proliferative actions of SERMs, including stimulation of FasL expression by BP. BP significantly inhibited phosphorylation of Akt and ERK-1/2, JNK and p38 in PC-3 (immunoblotting), and thus adopted a multi-pathway mechanism to exert a more potent anti-proliferative activity against prostate cancer cells than natural and synthetic SERMs. Its precise ER-subtype specific activity presents a unique lead structure for further optimization.

  14. The discovery of novel human androgen receptor antagonist chemotypes using a combined pharmacophore screening procedure.

    Science.gov (United States)

    Voet, Arnout; Helsen, Christine; Zhang, Kam Y J; Claessens, Frank

    2013-04-01

    Unraveling the mechanisms involved in castration- and therapy-resistant prostate cancer has led to a renewed interest in androgen receptor (AR)-targeted therapeutics. Anti-androgens that block the activity of the AR therefore remain a valid therapeutic option. However, they must be more effective than, or display a distinct mechanism of action or binding mode from those of bicalutamide and hydroxyflutamide, which are currently in clinical use. For that reason, the second-generation anti-androgen MDV3100 was developed. MDV3100, however, shares its 4-cyano-3-(trifluoromethyl)phenyl group with bicalutamide and hydroxyflutamide required for binding to the AR. In this work, we used a combined strategy to find new antagonist structures distinct from the 4-cyano-3-(trifluoromethyl)phenyl group to avoid cross-resistance for these compounds and to find structures without agonist activity on mutant ARs (AR W741C and AR T877A). We found two novel chemotypes with AR-antagonistic activity (IC(50): 3-6 μM) by virtual screening and confirmed their biological activity in an androgen-responsive reporter assay. The design of our computational approach was validated by the observation of strongly decreased or absence of agonistic activity on the two mutant ARs. Further structural derivatization to optimize the potency of these compounds can render these chemotypes into very promising, alternative AR antagonists for prostate cancer therapy.

  15. Differential effects of genistein on prostate cancer cells depend on mutational status of the androgen receptor.

    Directory of Open Access Journals (Sweden)

    Abeer M Mahmoud

    Full Text Available Blocking the androgen receptor (AR activity is the main goal of therapies for advanced prostate cancer (PCa. However, relapse with a more aggressive, hormone refractory PCa arises, which harbors restored AR activity. One mechanism of such reactivation occurs through acquisition of AR mutations that enable its activation by various steroidal and non-steroidal structures. Thus, natural and chemical compounds that contribute to inappropriate (androgen-independent activation of the AR become an area of intensive research. Here, we demonstrate that genistein, a soy phytoestrogen binds to both the wild and the Thr877Ala (T877A mutant types of AR competitively with androgen, nevertheless, it exerts a pleiotropic effect on PCa cell proliferation and AR activity depending on the mutational status of the AR. Genistein inhibited, in a dose-dependent way, cell proliferation and AR nuclear localization and expression in LAPC-4 cells that have wild AR. However, in LNCaP cells that express the T877A mutant AR, genistein induced a biphasic effect where physiological doses (0.5-5 µmol/L stimulated cell growth and increased AR expression and transcriptional activity, and higher doses induced inhibitory effects. Similar biphasic results were achieved in PC-3 cells transfected with AR mutants; T877A, W741C and H874Y. These findings suggest that genistein, at physiological concentrations, potentially act as an agonist and activate the mutant AR that can be present in advanced PCa after androgen ablation therapy.

  16. Differential effects of genistein on prostate cancer cells depend on mutational status of the androgen receptor.

    Science.gov (United States)

    Mahmoud, Abeer M; Zhu, Tian; Parray, Aijaz; Siddique, Hifzur R; Yang, Wancai; Saleem, Mohammad; Bosland, Maarten C

    2013-01-01

    Blocking the androgen receptor (AR) activity is the main goal of therapies for advanced prostate cancer (PCa). However, relapse with a more aggressive, hormone refractory PCa arises, which harbors restored AR activity. One mechanism of such reactivation occurs through acquisition of AR mutations that enable its activation by various steroidal and non-steroidal structures. Thus, natural and chemical compounds that contribute to inappropriate (androgen-independent) activation of the AR become an area of intensive research. Here, we demonstrate that genistein, a soy phytoestrogen binds to both the wild and the Thr877Ala (T877A) mutant types of AR competitively with androgen, nevertheless, it exerts a pleiotropic effect on PCa cell proliferation and AR activity depending on the mutational status of the AR. Genistein inhibited, in a dose-dependent way, cell proliferation and AR nuclear localization and expression in LAPC-4 cells that have wild AR. However, in LNCaP cells that express the T877A mutant AR, genistein induced a biphasic effect where physiological doses (0.5-5 µmol/L) stimulated cell growth and increased AR expression and transcriptional activity, and higher doses induced inhibitory effects. Similar biphasic results were achieved in PC-3 cells transfected with AR mutants; T877A, W741C and H874Y. These findings suggest that genistein, at physiological concentrations, potentially act as an agonist and activate the mutant AR that can be present in advanced PCa after androgen ablation therapy.

  17. Androgen receptors and hormone sensitivity of a human prostatic cancer cell line (PC-3) are modulated by natural beta-interferon

    NARCIS (Netherlands)

    G. Sica (G.); G. Dell'Acqua (G.); F. Iacopino (F.); A. Fattorossi (A.); P. Marchetti (P.); Th.H. van der Kwast (Theo); M. Pavone-Macaluso (M.)

    1991-01-01

    textabstractAndrogen recptors are expressed at a low level in the cell line PC-3, which does not respond to either androgens or antiandrogens. If these cells are exposed to natural beta-interferon (β-IFN) a reduction in cell growth and an increase in androgen receptors, evaluated by both biochemical

  18. Targeting Prostate Cancer with Bifunctional Modulators of the Androgen Receptor

    Science.gov (United States)

    2013-10-01

    element of immunosuppressive regimens for organ transplantation (1). Despite these 24 Bifunctional Ligand Control of Nuclear Receptors 3 well...Gerez J, Paez-Pereda M, Rein T, Iniguez-Lluhi JA, Holsboer F, Arzt E 2013 RSUME enhances glucocorticoid receptor SUMOylation and transcriptional... transplant recipients. Transpl Immunol 27:12-18 42. Marinec PS, Lancia JK, Gestwicki JE 2008 Bifunctional molecules evade cytochrome P(450) metabolism

  19. Characterization of niphatenones that inhibit androgen receptor N-terminal domain.

    Directory of Open Access Journals (Sweden)

    Carmen A Banuelos

    Full Text Available Androgen ablation therapy causes a temporary reduction in tumor burden in patients with advanced prostate cancer. Unfortunately the malignancy will return to form lethal castration-recurrent prostate cancer (CRPC. The androgen receptor (AR remains transcriptionally active in CRPC in spite of castrate levels of androgens in the blood. AR transcriptional activity resides in its N-terminal domain (NTD. Possible mechanisms of continued AR transcriptional activity may include, at least in part, expression of constitutively active splice variants of AR that lack the C-terminal ligand-binding domain (LBD. Current therapies that target the AR LBD, would not be effective against these AR variants. Currently no drugs are clinically available that target the AR NTD which should be effective against these AR variants as well as full-length AR. Niphatenones were originally isolated and identified in active extracts from Niphates digitalis marine sponge. Here we begin to characterize the mechanism of niphatenones in blocking AR transcriptional activity. Both enantiomers had similar IC50 values of 6 µM for inhibiting the full-length AR in a functional transcriptional assay. However, (S-niphatenone had significantly better activity against the AR NTD compared to (R-niphatenone. Consistent with niphatenones binding to and inhibiting transactivation of AR NTD, niphatenones inhibited AR splice variant. Niphatenone did not affect the transcriptional activity of the related progesterone receptor, but slightly decreased glucocorticoid receptor (GR activity and covalently bound to GR activation function-1 (AF-1 region. Niphatenone blocked N/C interactions of AR without altering either AR protein levels or its intracellular localization in response to androgen. Alkylation with glutathione suggests that niphatenones are not a feasible scaffold for further drug development.

  20. Androgen receptor is the key transcriptional mediator of the tumor suppressor SPOP in prostate cancer.

    Science.gov (United States)

    Geng, Chuandong; Rajapakshe, Kimal; Shah, Shrijal S; Shou, John; Eedunuri, Vijay Kumar; Foley, Christopher; Fiskus, Warren; Rajendran, Mahitha; Chew, Sue Anne; Zimmermann, Martin; Bond, Richard; He, Bin; Coarfa, Cristian; Mitsiades, Nicholas

    2014-10-01

    Somatic missense mutations in the substrate-binding pocket of the E3 ubiquitin ligase adaptor SPOP are present in up to 15% of human prostate adenocarcinomas, but are rare in other malignancies, suggesting a prostate-specific mechanism of action. SPOP promotes ubiquitination and degradation of several protein substrates, including the androgen receptor (AR) coactivator SRC-3. However, the relative contributions that SPOP substrates may make to the pathophysiology of SPOP-mutant (mt) prostate adenocarcinomas are unknown. Using an unbiased bioinformatics approach, we determined that the gene expression profile of prostate adenocarcinoma cells engineered to express mt-SPOP overlaps greatly with the gene signature of both SRC-3 and AR transcriptional output, with a stronger similarity to AR than SRC-3. This finding suggests that in addition to its SRC-3-mediated effects, SPOP also exerts SRC-3-independent effects that are AR-mediated. Indeed, we found that wild-type (wt) but not prostate adenocarcinoma-associated mutants of SPOP promoted AR ubiquitination and degradation, acting directly through a SPOP-binding motif in the hinge region of AR. In support of these results, tumor xenografts composed of prostate adenocarcinoma cells expressing mt-SPOP exhibited higher AR protein levels and grew faster than tumors composed of prostate adenocarcinoma cells expressing wt-SPOP. Furthermore, genetic ablation of SPOP was sufficient to increase AR protein levels in mouse prostate. Examination of public human prostate adenocarcinoma datasets confirmed a strong link between transcriptomic profiles of mt-SPOP and AR. Overall, our studies highlight the AR axis as the key transcriptional output of SPOP in prostate adenocarcinoma and provide an explanation for the prostate-specific tumor suppressor role of wt-SPOP.

  1. Down-regulation of Zac1 gene expression in rat white adipose tissue by androgens.

    Science.gov (United States)

    Mirowska, Agnieszka; Sledzinski, Tomasz; Smolenski, Ryszard T; Swierczynski, Julian

    2014-03-01

    ZAC1 is a zinc-finger protein transcription factor, a transcriptional cofactor for nuclear receptors, and a co-activator of nuclear receptors, which interacts with multiple signaling pathways affecting apoptosis, cell cycle arrest, and metabolism. Some data suggest that ZAC1 regulates the expression of genes associated with function of adipose tissue. Since there is no information about the levels of Zac1 gene expression in white adipose tissue (WAT), and the expression of several genes associated with metabolic function of WAT is significantly lower in male than female animals, we have examined: (a) the relative ZAC1 mRNA levels in some organs/tissues, including three main depots of WAT, in 3-month-old male rats; (b) the relative ZAC1 mRNA levels in WAT of male and female rats; (c) the effect of orchidectomy and orchidectomy with concomitant testosterone treatment on ZAC1 mRNA and protein levels; (d) the effect of ovariectomy and ovariectomy with concomitant 17β-estradiol treatment on ZAC1 mRNA levels; (e) the effect of dihydrotestosterone on ZAC1 mRNA levels in isolated adipocytes. Our results indicate that: (a) ZAC1 mRNA levels are relatively high in WAT in comparison with other organs/tissues; (b) ZAC1 mRNA levels in subcutaneous WAT are approximately 2-fold lower than in epididymal and retroperitoneal adipose tissue; (c) ZAC1 mRNA levels in WAT of adult female rats are approximately 2-fold higher than in male rats; (d) testosterone is inversely related to ZAC1 mRNA and protein levels in WAT of male rats; and (e) dihydrotestosterone decreases the ZAC1 mRNA levels in adipocytes in dose dependent manner. In conclusion, Zac1 gene is highly expressed in white adipose tissue of adult rats. Androgens could play an important role in down-regulation of the ZAC1 mRNA and protein levels in rats.

  2. Moving Beyond the Androgen Receptor (AR): Targeting AR-Interacting Proteins to Treat Prostate Cancer.

    Science.gov (United States)

    Foley, Christopher; Mitsiades, Nicholas

    2016-04-01

    Medical or surgical castration serves as the backbone of systemic therapy for advanced and metastatic prostate cancer, taking advantage of the importance of androgen signaling in this disease. Unfortunately, resistance to castration emerges almost universally. Despite the development and approval of new and more potent androgen synthesis inhibitors and androgen receptor (AR) antagonists, prostate cancers continue to develop resistance to these therapeutics, while often maintaining their dependence on the AR signaling axis. This highlights the need for innovative therapeutic approaches that aim to continue disrupting AR downstream signaling but are orthogonal to directly targeting the AR itself. In this review, we discuss the preclinical research that has been done, as well as clinical trials for prostate cancer, on inhibiting several important families of AR-interacting proteins, including chaperones (such as heat shock protein 90 (HSP90) and FKBP52), pioneer factors (including forkhead box protein A1 (FOXA1) and GATA-2), and AR transcriptional coregulators such as the p160 steroid receptor coactivators (SRCs) SRC-1, SRC-2, SRC-3, as well as lysine deacetylases (KDACs) and lysine acetyltransferases (KATs). Researching the effect of-and developing new therapeutic agents that target-the AR signaling axis is critical to advancing our understanding of prostate cancer biology, to continue to improve treatments for prostate cancer and for overcoming castration resistance.

  3. Novel series of potent, nonsteroidal, selective androgen receptor modulators based on 7H-[1,4]oxazino[3,2-g]quinolin-7-ones.

    Science.gov (United States)

    Higuchi, Robert I; Arienti, Kristen L; López, Francisco J; Mani, Neelakhanda S; Mais, Dale E; Caferro, Thomas R; Long, Yun Oliver; Jones, Todd K; Edwards, James P; Zhi, Lin; Schrader, William T; Negro-Vilar, Andrés; Marschke, Keith B

    2007-05-17

    Recent interest in orally available androgens has fueled the search for new androgens for use in hormone replacement therapy and as anabolic agents. In pursuit of this, we have discovered a series of novel androgen receptor modulators derived from 7H-[1,4]oxazino[3,2-g]quinolin-7-ones. These compounds were synthesized and evaluated in competitive binding assays and an androgen receptor transcriptional activation assay. A number of compounds from the series demonstrated single-digit nanomolar agonist activity in vitro. In addition, lead compound (R)-16e was orally active in established rodent models that measure androgenic and anabolic properties of these agents. In this assay, (R)-16e demonstrated full efficacy in muscle and only partially stimulated the prostate at 100 mg/kg. These data suggest that these compounds may be utilized as selective androgen receptor modulators or SARMs. This series represents a novel class of compounds for use in androgen replacement therapy.

  4. Identification of an AR mutation-negative class of androgen insensitivity by determining endogenous AR activity

    NARCIS (Netherlands)

    Hornig, N.C.; Ukat, M.; H.U. Schweikert (H.); O. Hiort (Olaf); Werner, R.; S.L.S. Drop (Stenvert); M.L. Cools (Martine); I.A. Hughes (Ieuan A.); L. Audí (Laura); S.F. Ahmed (S. Faisal); Demiri, J.; Rodens, P.; Worch, L.; Wehner, G.; Kulle, A.E.; Dunstheimer, D.; Müller-Roßberg, E.; T. Reinehr (Thomas); Hadidi, A.T.; Eckstein, A.K.; Van Der Horst, C.; Seif, C.; R. Siebert (Reiner); O. Ammerpohl (Ole); P-M. Holterhus (Paul-Martin)

    2016-01-01

    textabstractContext: Only approximately 85%of patients with a clinical diagnosis complete androgen insensitivity syndrome and less than 30%with partial androgen insensitivity syndrome can be explained by inactivating mutations in the androgen receptor (AR) gene. Objective: The objective of the study

  5. BAY 1024767 blocks androgen receptor mutants found in castration-resistant prostate cancer patients.

    Science.gov (United States)

    Sugawara, Tatsuo; Lejeune, Pascale; Köhr, Silke; Neuhaus, Roland; Faus, Hortensia; Gelato, Kathy A; Busemann, Matthias; Cleve, Arwed; Lücking, Ulrich; von Nussbaum, Franz; Brands, Michael; Mumberg, Dominik; Jung, Klaus; Stephan, Carsten; Haendler, Bernard

    2016-02-01

    Androgen receptor (AR) mutations arise in patients developing resistance to hormone deprivation therapies. Here we describe BAY 1024767, a thiohydantoin derivative with strong antagonistic activity against nine AR variants with mutations located in the AR ligand-binding domain (LBD), and against wild-type AR. Antagonism was maintained, though reduced, at increased androgen levels. Anti-tumor efficacy was evidenced in vivo in the KuCaP-1 prostate cancer model which bears the W741C bicalutamide resistance mutation and in the syngeneic prostate cancer rat model Dunning R3327-G. The prevalence of six selected AR mutations was determined in plasma DNA originating from 100 resistant patients and found to be at least 12%. Altogether the results show BAY 1024767 to be a strong antagonist for several AR mutants linked to therapy resistance, which opens the door for next-generation compounds that can benefit patients based on their mutation profile.

  6. The transcriptional programme of the androgen receptor (AR) in prostate cancer.

    Science.gov (United States)

    Lamb, Alastair D; Massie, Charlie E; Neal, David E

    2014-03-01

    The androgen receptor (AR) is essential for normal prostate and prostate cancer cell growth. AR transcriptional activity is almost always maintained even in hormone relapsed prostate cancer (HRPC) in the absence of normal levels of circulating testosterone. Current molecular techniques, such as chromatin-immunoprecipitation sequencing (ChIP-seq), have permitted identification of direct AR-binding sites in cell lines and human tissue with a distinct coordinate network evident in HRPC. The effectiveness of novel agents, such as abiraterone acetate (suppresses adrenal androgens) or enzalutamide (MDV3100, potent AR antagonist), in treating advanced prostate cancer underlines the on-going critical role of the AR throughout all stages of the disease. Persistent AR activity in advanced disease regulates cell cycle activity, steroid biosynthesis and anabolic metabolism in conjunction with regulatory co-factors, such as the E2F family, c-Myc and signal transducer and activator of transcription (STAT) transcription factors. Further treatment approaches must target these other factors.

  7. Selective androgen receptor modulators for the treatment of late onset male hypogonadism.

    Science.gov (United States)

    Coss, Christopher C; Jones, Amanda; Hancock, Michael L; Steiner, Mitchell S; Dalton, James T

    2014-01-01

    Several testosterone preparations are used in the treatment of hypogonadism in the ageing male. These therapies differ in their convenience, flexibility, regional availability and expense but share their pharmacokinetic basis of approval and dearth of long-term safety data. The brevity and relatively reduced cost of pharmacokinetic based registration trials provides little commercial incentive to develop improved novel therapies for the treatment of late onset male hypogonadism. Selective androgen receptor modulators (SARMs) have been shown to provide anabolic benefit in the absence of androgenic effects on prostate, hair and skin. Current clinical development for SARMs is focused on acute muscle wasting conditions with defi ned clinical endpoints of physical function and lean body mass. Similar regulatory clarity concerning clinical deficits in men with hypogonadism is required before the beneficial pharmacology and desirable pharmacokinetics of SARMs can be employed in the treatment of late onset male hypogonadism.

  8. Selective androgen receptor modulators for the treatment of late onset male hypogonadism

    Directory of Open Access Journals (Sweden)

    Christopher C Coss

    2014-04-01

    Full Text Available Several testosterone preparations are used in the treatment of hypogonadism in the ageing male. These therapies differ in their convenience, flexibility, regional availability and expense but share their pharmacokinetic basis of approval and dearth of long-term safety data. The brevity and relatively reduced cost of pharmacokinetic based registration trials provides little commercial incentive to develop improved novel therapies for the treatment of late onset male hypogonadism. Selective androgen receptor modulators (SARMs have been shown to provide anabolic benefit in the absence of androgenic effects on prostate, hair and skin. Current clinical development for SARMs is focused on acute muscle wasting conditions with defi ned clinical endpoints of physical function and lean body mass. Similar regulatory clarity concerning clinical deficits in men with hypogonadism is required before the beneficial pharmacology and desirable pharmacokinetics of SARMs can be employed in the treatment of late onset male hypogonadism.

  9. Nonalcoholic steatohepatitis-related hepatocellular carcinoma: is there a role for the androgen receptor pathway?

    Directory of Open Access Journals (Sweden)

    Ali MA

    2017-03-01

    Full Text Available Mahmoud A Ali,1 Sahin Lacin,1 Reham Abdel-Wahab,1,2 Mark Uemura,1 Manal Hassan,1 Asif Rashid,3 Dan G Duda,4 Ahmed O Kaseb1 1Department of Gastrointestinal Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA; 2Department of Clinical Oncology, Assiut University, Assiut, Egypt; 3Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX, 4Department of Radiation Oncology, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA Abstract: The epidemic of insulin resistance, obesity, and metabolic syndrome has led to the emergence of nonalcoholic steatohepatitis (NASH as the most common cause of liver disease in the US. Patients with NASH are at an increased risk for hepatic disease-related morbidity and death, and chronic inflammation in NASH patients can lead to hepatocellular carcinoma (HCC. The prevalence of HCC is higher in males than in females, and genetic studies have identified androgen and androgen receptors (ARs as partially responsible for the gender disparity in the development of liver disease and HCC. Although many factors are known to play important roles in the progression of inflammation in NASH patients, the role of androgen and AR in the progression of NASH to HCC has been understudied. This review summarizes the evidence for a potential role of androgen and the AR pathway in the development of NASH-related HCC and in the treatment of HCC. It has been proposed that AR plays a role in the progression of HCC: inhibitory roles in early stages of hepatocarcinogenesis and tumor-promoting roles in advanced stages. AR can be activated by several pathways, even in the absence of androgen. While AR has been explored as a potential therapeutic target in HCC, several clinical trials have failed to demonstrate a clinical benefit of antiandrogen drugs in HCC. This review discusses the potential reason for these observations and discuss the potential future trials

  10. Prostate Cell Specific Regulation of Androgen Receptor Phosphorylation In Vivo

    Science.gov (United States)

    2006-11-01

    analysis indicates that the screen is preferentially isolating proteins with a known role in gene transcription and we are currently assessing the phosphorylation- dependence of the putative AR interacting proteins .

  11. Discovery of ODM-201, a new-generation androgen receptor inhibitor targeting resistance mechanisms to androgen signaling-directed prostate cancer therapies.

    Science.gov (United States)

    Moilanen, Anu-Maarit; Riikonen, Reetta; Oksala, Riikka; Ravanti, Laura; Aho, Eija; Wohlfahrt, Gerd; Nykänen, Pirjo S; Törmäkangas, Olli P; Palvimo, Jorma J; Kallio, Pekka J

    2015-07-03

    Activation of androgen receptor (AR) is crucial for prostate cancer growth. Remarkably, also castration-resistant prostate cancer (CRPC) is dependent on functional AR, and several mechanisms have been proposed to explain the addiction. Known causes of CRPC include gene amplification and overexpression as well as point mutations of AR. We report here the pharmacological profile of ODM-201, a novel AR inhibitor that showed significant antitumor activity and a favorable safety profile in phase 1/2 studies in men with CRPC. ODM-201 is a full and high-affinity AR antagonist that, similar to second-generation antiandrogens enzalutamide and ARN-509, inhibits testosterone-induced nuclear translocation of AR. Importantly, ODM-201 also blocks the activity of the tested mutant ARs arising in response to antiandrogen therapies, including the F876L mutation that confers resistance to enzalutamide and ARN-509. In addition, ODM-201 reduces the growth of AR-overexpressing VCaP prostate cancer cells both in vitro and in a castration-resistant VCaP xenograft model. In contrast to other antiandrogens, ODM-201 shows negligible brain penetrance and does not increase serum testosterone levels in mice. In conclusion, ODM-201 is a potent AR inhibitor that overcomes resistance to AR-targeted therapies by antagonizing both overexpressed and mutated ARs. ODM-201 is currently in a phase 3 trial in CRPC.

  12. A precisely substituted benzopyran targets androgen refractory prostate cancer cells through selective modulation of estrogen receptors

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Rajeev; Verma, Vikas; Sharma, Vikas; Jain, Ashish; Singh, Vishal [Division of Endocrinology, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Sarswat, Amit [Division of Medicinal & Process Chemistry, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Maikhuri, Jagdamba P. [Division of Endocrinology, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Sharma, Vishnu L. [Division of Medicinal & Process Chemistry, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Gupta, Gopal, E-mail: g_gupta@cdri.res.in [Division of Endocrinology, CSIR—Central Drug Research Institute, Lucknow 226 031 (India)

    2015-03-15

    Dietary consumption of phytoestrogens like genistein has been linked with lower incidence of prostate cancer. The estradiol-like benzopyran core of genistein confers estrogen receptor-β (ER-β) selectivity that imparts weak anti-proliferative activity against prostate cancer cells. DL-2-[4-(2-piperidinoethoxy)phenyl]-3-phenyl-2H-1-benzopyran (BP), a SERM designed with benzopyran core, targeted androgen independent prostate cancer (PC-3) cells 14-times more potently than genistein, ~ 25% more efficiently than tamoxifen and 6.5-times more actively than ICI-182780, without forfeiting significant specificity in comparison to genistein. BP increased apoptosis (annexin-V and TUNEL labeling), arrested cell cycle, and significantly increased caspase-3 activity along with mRNA expressions of estrogen receptor (ER)-β and FasL (qPCR) in PC-3 cells. In classical ERE-luc reporter assay BP behaved as a potent ER-α antagonist and ER-β agonist. Accordingly, it decreased expression of ER-α target PS2 (P < 0.01) and increased expression of ER-β target TNF-α (P < 0.05) genes in PC-3. ER-β deficient PC-3 (siRNA-transfected) was resistant to apoptotic and anti-proliferative actions of SERMs, including stimulation of FasL expression by BP. BP significantly inhibited phosphorylation of Akt and ERK-1/2, JNK and p38 in PC-3 (immunoblotting), and thus adopted a multi-pathway mechanism to exert a more potent anti-proliferative activity against prostate cancer cells than natural and synthetic SERMs. Its precise ER-subtype specific activity presents a unique lead structure for further optimization. - Highlights: • BP with benzopyran core of genistein was identified for ER-β selective action. • BP was 14-times more potent than genistien in targeting prostate cancer cells. • It behaved as a potent ER-β agonist and ER-α antagonist in gene reporter assays. • BP's anti-proliferative action was inhibited significantly in ER-β deficient cells. • BP — a unique lead

  13. Clearance of the mutant androgen receptor in motoneuronal models of spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Rusmini, Paola; Crippa, Valeria; Giorgetti, Elisa; Boncoraglio, Alessandra; Cristofani, Riccardo; Carra, Serena; Poletti, Angelo

    2013-11-01

    Spinal and bulbar muscular atrophy (SBMA) is an X-linked motoneuron disease caused by an abnormal expansion of a tandem CAG repeat in exon 1 of the androgen receptor (AR) gene that results in an abnormally long polyglutamine tract (polyQ) in the AR protein. As a result, the mutant AR (ARpolyQ) misfolds, forming cytoplasmic and nuclear aggregates in the affected neurons. Neurotoxicity only appears to be associated with the formation of nuclear aggregates. Thus, improved ARpolyQ cytoplasmic clearance, which indirectly decreases ARpolyQ nuclear accumulation, has beneficial effects on affected motoneurons. In addition, increased ARpolyQ clearance contributes to maintenance of motoneuron proteostasis and viability, preventing the blockage of the proteasome and autophagy pathways that might play a role in the neuropathy in SBMA. The expression of heat shock protein B8 (HspB8), a member of the small heat shock protein family, is highly induced in surviving motoneurons of patients affected by motoneuron diseases, where it seems to participate in the stress response aimed at cell protection. We report here that HspB8 facilitates the autophagic removal of misfolded aggregating species of ARpolyQ. In addition, though HspB8 does not influence p62 and LC3 (two key autophagic molecules) expression, it does prevent p62 bodies formation, and restores the normal autophagic flux in these cells. Interestingly, trehalose, a well-known autophagy stimulator, induces HspB8 expression, suggesting that HspB8 might act as one of the molecular mediators of the proautophagic activity of trehalose. Collectively, these data support the hypothesis that treatments aimed at restoring a normal autophagic flux that result in the more efficient clearance of mutant ARpolyQ might produce beneficial effects in SBMA patients.

  14. IκB Kinases Modulate the Activity of the Androgen Receptor in Prostate Carcinoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Garima Jain

    2012-03-01

    Full Text Available Enhanced nuclear localization of nuclear factor κB (NF-κB in prostate cancer (PCa samples and constitutive NF-κB signaling in a class of PCa cell lines with low androgen receptor (AR expression (PC3 and DU-145 imply an important role of the IκB kinase (IKK/NF-κB system in PCa. However, most PCa and PCa cell lines depend on the activity of the AR, and the role of NF-κB in these AR-expressing PCa remains unclear. Here, we demonstrate that inhibition of NF-κB signaling by the IKK inhibitor BMS345541 reduced proliferation and increased apoptosis in AR-expressing PCa cell lines. Furthermore, AR activity and target gene expression were distinctively reduced, whereas AR protein levels remained unaltered on BMS345541 treatment. Similar effects were observed particularly after small interfering RNA (siRNA-mediated knockdown of IKK1, but not by siRNA-mediated suppression of IKK2. Moreover, IKK1 overexpression augmented 5α-dihydrotestosterone-induced nuclear AR translocation, whereas nuclear AR was reduced by IKK1 knockdown or BMS345541. However, because IKK1 also enhances the activity of a chronically nuclear AR mutant, modulation of the subcellular distribution seems not to be the only mechanism by which IKK1 enhances AR activity. Finally, reduced in vivo AR phosphorylation after BMS345541 treatment and in vitro AR phosphorylation by IKK1 or IKK2 imply that AR constitutes a novel IKK target. Taken together, our data identify IKK1 as a potentially target structure for future therapeutic intervention in PCa.

  15. Microarray analysis of androgen-regulated gene expression in testis: the use of the androgen-binding protein (ABP-transgenic mouse as a model

    Directory of Open Access Journals (Sweden)

    Grossman Gail

    2005-12-01

    Full Text Available Abstract Background Spermatogenesis is an androgen-dependent process, yet the molecular mechanisms of androgens' actions in testis are poorly understood. Transgenic mice overexpressing rat androgen-binding protein (ABP in their testes have reduced levels of intratesticular androgens and, as a result, show a progressive impairment of spermatogenesis. We used this model to characterize changes in global gene expression in testis in response to reduced bioavailability of androgens. Methods Total RNA was extracted from testes of 30-day old transgenic and wild-type control mice, converted to cRNA, labeled with biotin, and hybridized to oligonucleotide microarrays. Microarray results were confirmed by real-time reverse transcription polymerase chain reaction. Results Three-hundred-eighty-one genes (3.05% of all transcripts represented on the chips were up-regulated and 198 genes (1.59% were down-regulated by at least a factor of 2 in the androgen-deficient animals compared to controls. Genes encoding membrane proteins, intracellular signaling molecules, enzymes, proteins participating in the immune response, and those involved in cytoskeleton organization were significantly overrepresented in the up-regulated group. Among the down-regulated transcripts, those coding for extracellular proteins were overrepresented most dramatically, followed by those related to proteolysis, cell adhesion, immune response, and growth factor, cytokine, and ion channel activities. Transcripts with the greatest potential impact on cellular activities included several transcription factors, intracellular signal transducers, secreted signaling molecules and enzymes, and various cell surface molecules. Major nodes in the up-regulated network were IL-6, AGT, MYC, and A2M, those in the down-regulated network were IL-2, -4, and -10, MAPK8, SOCS1, and CREB1. Conclusion Microarray analysis followed by gene ontology profiling and connectivity analysis identified several functional

  16. Androgens and skeletal muscle: cellular and molecular action mechanisms underlying the anabolic actions.

    Science.gov (United States)

    Dubois, Vanessa; Laurent, Michaël; Boonen, Steven; Vanderschueren, Dirk; Claessens, Frank

    2012-05-01

    Androgens increase both the size and strength of skeletal muscle via diverse mechanisms. The aim of this review is to discuss the different cellular targets of androgens in skeletal muscle as well as the respective androgen actions in these cells leading to changes in proliferation, myogenic differentiation, and protein metabolism. Androgens bind and activate a specific nuclear receptor which will directly affect the transcription of target genes. These genes encode muscle-specific transcription factors, enzymes, structural proteins, as well as microRNAs. In addition, anabolic action of androgens is partly established through crosstalk with other signaling molecules such as Akt, myostatin, IGF-I, and Notch. Finally, androgens may also exert non-genomic effects in muscle by increasing Ca(2+) uptake and modulating kinase activities. In conclusion, the anabolic effect of androgens on skeletal muscle is not only explained by activation of the myocyte androgen receptor but is also the combined result of many genomic and non-genomic actions.

  17. The binding of 3H-labelled androgen-receptor complexes to hypothalamic chromatin of neonatal mice: effect of sex and androgenization.

    Science.gov (United States)

    Ventanas, J; Garcia, C; López-Bote, C; López, A; Burgos, J

    1990-03-01

    The binding of 3H-labelled androgen-receptor complexes, prepared by (NH4)2SO4 precipitation from the 105,000 g supernatant of hypothalamic cytosol, to hypothalamic chromatin of neonatal mice covalently coupled to cellulose was measured in vitro. Saturation binding was also determined after extraction of histones and the masking of acidic proteins with high molarities of guanidine hydrochloride. This investigation showed the presence of high-affinity, low-capacity acceptor sites for [3H]-testosterone-receptor complexes in male hypothalamic chromatin (Kd value = 0.39 x 10(-10) M and binding sites of 41 fmol per mg of DNA). Acceptor activity seems to be associated with the acidic protein fraction of chromatin. No specific acceptor sites of similar nature were found in chromatin taken from the hypothalami of female mice. On the basis of these results, it is suggested that the androgen-unresponsiveness of female mice is related to the absence of acceptors for the androgen-receptor in female mice hypothalami.

  18. Androgen receptors and serum testosterone levels identify different subsets of postmenopausal breast cancers

    Directory of Open Access Journals (Sweden)

    Secreto Giorgio

    2012-12-01

    Full Text Available Abstract Background Androgen receptors (AR are frequently expressed in breast cancers, but their implication in cancer growth is still controversial. In the present study, we further investigated the role of the androgen/AR pathway in breast cancer development. Methods AR expression was evaluated by immunochemistry in a cohort of 528 postmenopausal breast cancer patients previously examined for the association of serum testosterone levels with patient and tumor characteristics. AR expression was classified according to the percentage of stained cells: AR-absent (0% and AR-poorly (1%-30%, AR-moderately (>30%-60%, and AR-highly (>60% positive. Results Statistical analysis was performed in 451 patients who experienced natural menopause. AR-high expression was significantly related with low histologic grade and estrogen receptor (ER- and progesterone receptor (PR-positive status (P trendP=0.022, although a trend across the AR expression categories was not present. When women defined by ER status were analyzed separately, regression analysis in the ER-positive group showed a significant association of high testosterone levels with AR-highly-positive expression (OR 1.86; 95% CI, 1.10-3.16, but the association was essentially due to patients greater than or equal to 65 years (OR 2.42; 95% CI, 1.22-4.82. In ER-positive group, elevated testosterone levels appeared also associated with AR-absent expression, although the small number of patients in this category limited the appearance of significant effects (OR 1.92; 95% CI, 0.73–5.02: the association was present in both age groups ( Conclusions The findings in the present study confirm that testosterone levels are a marker of hormone-dependent breast cancer and suggest that the contemporary evaluation of ER status, AR expression, and circulating testosterone levels may identify different subsets of cancers whose growth may be influenced by androgens.

  19. Androgen regulates development of the sexually dimorphic gastrin-releasing peptide neuron system in the lumbar spinal cord: evidence from a mouse line lacking androgen receptor in the nervous system.

    Science.gov (United States)

    Sakamoto, Hirotaka; Saito, Kazuhiro; Marie-Luce, Clarisse; Raskin, Kalina; Oti, Takumi; Satoh, Keita; Tamura, Kei; Sakamoto, Tatsuya; Mhaouty-Kodja, Sakina

    2014-01-13

    Androgens including testosterone, organize the nervous system as well as masculine external and internal genitalia during the perinatal period. Androgen organization involves promotion of masculine body features, usually by acting through androgen receptors (ARs). We have recently demonstrated that the gastrin-releasing peptide (GRP) system in the lumbar spinal cord also mediates spinal centers promoting penile reflexes during male sexual behavior in rats. Testosterone may induce sexual differentiation of this spinal GRP system during development and maintain its activation in adulthood. In the present study, we examined the role of ARs in the nervous system regulating the development of the sexually dimorphic GRP system. For this purpose, we used a conditional mouse line selectively lacking the AR gene in the nervous system. AR floxed males carrying (mutants) or not (controls) the nestin-Cre transgene were castrated in adulthood and supplemented with physiological amounts of testosterone. Loss of AR expression in the nervous system resulted in a significant decrease in the number of GRP neurons compared to control littermates. Consequently, the intensity of GRP axonal projections onto the lower lumbar and upper sacral spinal cord was greater in control males than in mutant males. These results suggest that ARs expressed in the nervous system play a significant role in the development of the GRP system in the male lumbar spinal cord. The AR-deletion mutation may attenuate sexual behavior and activity of mutant males via spinal GRP system-mediated neural mechanisms.

  20. Neural Androgen Receptor Deletion Impairs the Temporal Processing of Objects and Hippocampal CA1-Dependent Mechanisms.

    Directory of Open Access Journals (Sweden)

    Marie Picot

    Full Text Available We studied the role of testosterone, mediated by the androgen receptor (AR, in modulating temporal order memory for visual objects. For this purpose, we used male mice lacking AR specifically in the nervous system. Control and mutant males were gonadectomized at adulthood and supplemented with equivalent amounts of testosterone in order to normalize their hormonal levels. We found that neural AR deletion selectively impaired the processing of temporal information for visual objects, without affecting classical object recognition or anxiety-like behavior and circulating corticosterone levels, which remained similar to those in control males. Thus, mutant males were unable to discriminate between the most recently seen object and previously seen objects, whereas their control littermates showed more interest in exploring previously seen objects. Because the hippocampal CA1 area has been associated with temporal memory for visual objects, we investigated whether neural AR deletion altered the functionality of this region. Electrophysiological analysis showed that neural AR deletion affected basal glutamate synaptic transmission and decreased the magnitude of N-methyl-D-aspartate receptor (NMDAR activation and high-frequency stimulation-induced long-term potentiation. The impairment of NMDAR function was not due to changes in protein levels of receptor. These results provide the first evidence for the modulation of temporal processing of information for visual objects by androgens, via AR activation, possibly through regulation of NMDAR signaling in the CA1 area in male mice.

  1. Neural Androgen Receptor Deletion Impairs the Temporal Processing of Objects and Hippocampal CA1-Dependent Mechanisms.

    Science.gov (United States)

    Picot, Marie; Billard, Jean-Marie; Dombret, Carlos; Albac, Christelle; Karameh, Nida; Daumas, Stéphanie; Hardin-Pouzet, Hélène; Mhaouty-Kodja, Sakina

    2016-01-01

    We studied the role of testosterone, mediated by the androgen receptor (AR), in modulating temporal order memory for visual objects. For this purpose, we used male mice lacking AR specifically in the nervous system. Control and mutant males were gonadectomized at adulthood and supplemented with equivalent amounts of testosterone in order to normalize their hormonal levels. We found that neural AR deletion selectively impaired the processing of temporal information for visual objects, without affecting classical object recognition or anxiety-like behavior and circulating corticosterone levels, which remained similar to those in control males. Thus, mutant males were unable to discriminate between the most recently seen object and previously seen objects, whereas their control littermates showed more interest in exploring previously seen objects. Because the hippocampal CA1 area has been associated with temporal memory for visual objects, we investigated whether neural AR deletion altered the functionality of this region. Electrophysiological analysis showed that neural AR deletion affected basal glutamate synaptic transmission and decreased the magnitude of N-methyl-D-aspartate receptor (NMDAR) activation and high-frequency stimulation-induced long-term potentiation. The impairment of NMDAR function was not due to changes in protein levels of receptor. These results provide the first evidence for the modulation of temporal processing of information for visual objects by androgens, via AR activation, possibly through regulation of NMDAR signaling in the CA1 area in male mice.

  2. Prostate cancer characteristics associated with response to pre-receptor targeting of the androgen axis.

    Directory of Open Access Journals (Sweden)

    Elahe A Mostaghel

    Full Text Available Factors influencing differential responses of prostate tumors to androgen receptor (AR axis-directed therapeutics are poorly understood, and predictors of treatment efficacy are needed. We hypothesized that the efficacy of inhibiting DHT ligand synthesis would associate with intra-tumoral androgen ratios indicative of relative dependence on DHT-mediated growth.We characterized two androgen-sensitive prostate cancer xenograft models after androgen suppression by castration in combination with the SRD5A inhibitor, dutasteride, as well as a panel of castration resistant metastases obtained via rapid autopsy.In LuCaP35 tumors (intra-tumoral T:DHT ratio 2:1 dutasteride suppressed DHT to 0.02 ng/gm and prolonged survival vs. castration alone (337 vs.152 days, HR 2.8, p = 0.0015. In LuCaP96 tumors (T:DHT 10:1, survival was not improved despite similar DHT reduction (0.02 ng/gm. LuCaP35 demonstrated higher expression of steroid biosynthetic enzymes maintaining DHT levels (5-fold higher SRD5A1, 41 fold higher, 99-fold higher RL-HSD, p<0.0001 for both, reconstitution of intra-tumoral DHT (to ∼30% of untreated tumors, and ∼2 fold increased expression of full length AR. In contrast, LuCaP96 demonstrated higher levels of steroid catabolizing enzymes (6.9-fold higher AKR1C2, 3000-fold higher UGT2B15, p = 0.002 and p<0.0001 respectively, persistent suppression of intra-tumoral DHT, and 6-8 fold induction of full length AR and the ligand independent V7 AR splice variant. Human metastases demonstrated bio-active androgen levels and AR full length and AR splice-variant expression consistent with the range observed in xenografts.Intrinsic differences in basal steroidogenesis, as well as variable expression of full length and splice-variant AR, associate with response and resistance to pre-receptor AR ligand suppression. Expression of steroidogenic enzymes and AR isoforms may serve as potential biomarkers of sensitivity to potent AR-axis inhibition and

  3. Nonmyocytic androgen receptor regulates the sexually dimorphic development of the embryonic bulbocavernosus muscle.

    Science.gov (United States)

    Ipulan, Lerrie Ann; Suzuki, Kentaro; Sakamoto, Yuki; Murashima, Aki; Imai, Yuuki; Omori, Akiko; Nakagata, Naomi; Nishinakamura, Ryuichi; Valasek, Petr; Yamada, Gen

    2014-07-01

    The bulbocavernosus (BC) is a sexually dimorphic muscle observed only in males. Androgen receptor knockout mouse studies show the loss of BC formation. This suggests that androgen signaling plays a vital role in its development. Androgen has been known to induce muscle hypertrophy through satellite cell activation and myonuclei accretion during muscle regeneration and growth. Whether the same mechanism is present during embryonic development is not yet elucidated. To identify the mechanism of sexual dimorphism during BC development, the timing of morphological differences was first established. It was revealed that the BC was morphologically different between male and female mice at embryonic day (E) 16.5. Differences in the myogenic process were detected at E15.5. The male BC possesses a higher number of proliferating undifferentiated myoblasts. To identify the role of androgen signaling in this process, muscle-specific androgen receptor (AR) mutation was introduced, which resulted in no observable phenotypes. Hence, the expression of AR in the BC was examined and found that the AR did not colocalize with any muscle markers such as Myogenic differentiation 1, Myogenin, and paired box transcription factor 7. It was revealed that the mesenchyme surrounding the BC expressed AR and the BC started to express AR at E15.5. AR mutation on the nonmyocytic cells using spalt-like transcription factor 1 (Sall1) Cre driver mouse was performed, which resulted in defective BC formation. It was revealed that the number of proliferating undifferentiated myoblasts was reduced in the Sall1 Cre:AR(L-/Y) mutant embryos, and the adult mutants were devoid of BC. The transition of myoblasts from proliferation to differentiation is mediated by cyclin-dependent kinase inhibitors. An increased expression of p21 was observed in the BC myoblast of the Sall1 Cre:AR(L-/Y) mutant and wild-type female. Altogether this study suggests that the nonmyocytic AR may paracrinely regulate the

  4. Bioluminescence Microscopy as a Method to Measure Single Cell Androgen Receptor Activity Heterogeneous Responses to Antiandrogens

    Science.gov (United States)

    Jain, Pallavi; Neveu, Bertrand; Velot, Lauriane; Wu, Lily; Fradet, Yves; Pouliot, Frédéric

    2016-01-01

    Cancer cell heterogeneity is well-documented. Therefore, techniques to monitor single cell heterogeneous responses to treatment are needed. We developed a highly translational and quantitative bioluminescence microscopy method to measure single cell androgen receptor (AR) activity modulation by antiandrogens from fluid biopsies. We showed that this assay can detect heterogeneous cellular response to drug treatment and that the sum of single cell AR activity can mirror the response in the whole cell population. This method may thus be used to monitor heterogeneous dynamic treatment responses in cancer cells. PMID:27678181

  5. Selective ablation of the androgen receptor in mouse sertoli cells affects sertoli cell maturation, barrier formation and cytoskeletal development.

    Directory of Open Access Journals (Sweden)

    Ariane Willems

    Full Text Available The observation that mice with a selective ablation of the androgen receptor (AR in Sertoli cells (SC (SCARKO mice display a complete block in meiosis supports the contention that SC play a pivotal role in the control of germ cell development by androgens. To delineate the physiological and molecular mechanism responsible for this control, we compared tubular development in pubertal SCARKO mice and littermate controls. Particular attention was paid to differences in SC maturation, SC barrier formation and cytoskeletal organization and to the molecular mediators potentially involved. Functional analysis of SC barrier development by hypertonic perfusion and lanthanum permeation techniques and immunohistochemical analysis of junction formation showed that SCARKO mice still attempt to produce a barrier separating basal and adluminal compartment but that barrier formation is delayed and defective. Defective barrier formation was accompanied by disturbances in SC nuclear maturation (immature shape, absence of prominent, tripartite nucleoli and SC polarization (aberrant positioning of SC nuclei and cytoskeletal elements such as vimentin. Quantitative RT-PCR was used to study the transcript levels of genes potentially related to the described phenomena between day 8 and 35. Differences in the expression of SC genes known to play a role in junction formation could be shown from day 8 for Cldn11, from day 15 for Cldn3 and Espn, from day 20 for Cdh2 and Jam3 and from day 35 for ZO-1. Marked differences were also noted in the transcript levels of several genes that are also related to cell adhesion and cytoskeletal dynamics but that have not yet been studied in SC (Actn3, Ank3, Anxa9, Scin, Emb, Mpzl2. It is concluded that absence of a functional AR in SC impedes the remodeling of testicular tubules expected at the onset of spermatogenesis and interferes with the creation of the specific environment needed for germ cell development.

  6. Antiproliferative Effect of Androgen Receptor Inhibition in Mesenchymal Stem-Like Triple-Negative Breast Cancer

    Directory of Open Access Journals (Sweden)

    Aiyu Zhu

    2016-03-01

    Full Text Available Background/Aims: Androgen receptor (AR, a steroid hormone receptor, has recently emerged as prognostic and treatment-predictive marker in breast cancer. Previous studies have shown that AR is widely expressed in up to one-third of triple-negative breast cancer (TNBC. However, the role of AR in TNBC is still not fully understood, especially in mesenchymal stem-like (MSL TNBC cells. Methods: MSL TNBC MDA-MB-231 and Hs578T breast cancer cells were exposed to various concentration of agonist 5-α-dihydrotestosterone (DHT or nonsteroidal antagonist bicalutamide or untreated. The effects of AR on cell viability and apoptosis were determined by MTT assay, cell counting, flow cytometry analysis and protein expression of p53, p73, p21 and Cyclin D1 were analyzed by western blotting. The bindings of AR to p73 and p21 promoter were detected by ChIP assay. MDA-MB-231 cells were transplanted into nude mice and the tumor growth curves were determined and expression of AR, p73 and p21 were detected by Immunohistochemistry (IHC staining after treatment of DHT or bicalutamide. Results: We demonstrate that AR agonist DHT induces MSL TNBC breast cancer cells proliferation and inhibits apoptosis in vitro. Similarly, activated AR significantly increases viability of MDA-MB-231 xenografts in vivo. On the contrary, AR antagonist, bicalutamide, causes apoptosis and exerts inhibitory effects on the growth of breast cancer. Moreover, DHT-dependent activation of AR involves regulation in the cell cycle related genes, including p73, p21 and Cyclin D1. Further investigations indicate the modulation of AR on p73 and p21 mediated by direct binding of AR to their promoters, and DHT could make these binding more effectively. Conclusions: Our study demonstrates the tumorigenesis role of AR and the inhibitory effect of bicalutamide in AR-positive MSL TNBC both in vitro and in vivo, suggesting that AR inhibition could be a potential therapeutic approach for AR-positive TNBC

  7. [Changes in the expression of receptors of steroid hormones in the development of partial androgen deficiency of aging men (PADAM)].

    Science.gov (United States)

    Pecherskiĭ, A V; Semiglazov, V F; Komiakov, B K; Guliev, B G; Gorelov, A I; Novikov, A I; Pecherskiĭ, V I; Simonov, N N; Guliaev, A V; Samusenko, I A; Vonskiĭ, M S; Muttenberg, A G; Loran, O B

    2005-01-01

    This work is devoted to the vital topic of the influence of partial androgen deficiency of aging men (PADAM) on the development of cells with androgen receptors. The results obtained in this study suggest a conclusion that the production of testosterone by some tumors and tissues of the peritumorous zone, which is accompanied by increased proliferative activity and disturbance of the regulation of the cell cycle, is caused by PADAM. The given changes are directed at compensating for testicular deficiency (in particular at overcoming the androgen-dependent stage of development of androgen-sensitive cells). These changes are a partial manifestation of metabolic syndrome (X-syndrome). The atypical cells, which unavoidably develop during metabolic syndrome, are dealt with by means of the immune system, whose capabilities become less and less adequate in the given circumstances.

  8. Dissection of androgen receptor-promoter interactions: steroid receptors partition their interaction energetics in parallel with their phylogenetic divergence.

    Science.gov (United States)

    De Angelis, Rolando W; Yang, Qin; Miura, Michael T; Bain, David L

    2013-11-15

    Steroid receptors comprise a homologous family of ligand-activated transcription factors. The members include androgen receptor (AR), estrogen receptor (ER), glucocorticoid receptor (GR), mineralocorticoid receptor (MR), and progesterone receptor (PR). Phylogenetic studies demonstrate that AR, GR, MR, and PR are most closely related, falling into subgroup 3C. ER is more distantly related, falling into subgroup 3A. To determine the quantitative basis by which receptors generate their unique transcriptional responses, we are systematically dissecting the promoter-binding energetics of all receptors under a single "standard state" condition. Here, we examine the self-assembly and promoter-binding energetics of full-length AR and a mutant associated with prostate cancer, T877A. We first demonstrate that both proteins exist only as monomers, showing no evidence of dimerization. Although this result contradicts the traditional understanding that steroid receptors dimerize in the absence of DNA, it is fully consistent with our previous work demonstrating that GR and two PR isoforms either do not dimerize or dimerize only weakly. Moreover, both AR proteins exhibit substantial cooperativity between binding sites, again as seen for GR and PR. In sharp contrast, the more distantly related ER-α dimerizes so strongly that energetics can only be measured indirectly, yet cooperativity is negligible. Thus, homologous receptors partition their promoter-binding energetics quite differently. Moreover, since receptors most closely related by phylogeny partition their energetics similarly, such partitioning appears to be evolutionarily conserved. We speculate that such differences in energetics, coupled with different promoter architectures, serve as the basis for generating receptor-specific promoter occupancy and thus function.

  9. Melatonin Receptor Genes in Vertebrates

    Directory of Open Access Journals (Sweden)

    Hua Dong Yin

    2013-05-01

    Full Text Available Melatonin receptors are members of the G protein-coupled receptor (GPCR family. Three genes for melatonin receptors have been cloned. The MT1 (or Mel1a or MTNR1A and MT2 (or Mel1b or MTNR1B receptor subtypes are present in humans and other mammals, while an additional melatonin receptor subtype, Mel1c (or MTNR1C, has been identified in fish, amphibians and birds. Another melatonin related orphan receptor, GPR50, which does not bind melatonin, is found exclusively in mammals. The hormone melatonin is secreted primarily by the pineal gland, with highest levels occurring during the dark period of a circadian cycle. This hormone acts systemically in numerous organs. In the brain, it is involved in the regulation of various neural and endocrine processes, and it readjusts the circadian pacemaker, the suprachiasmatic nucleus. This article reviews recent studies of gene organization, expression, evolution and mutations of melatonin receptor genes of vertebrates. Gene polymorphisms reveal that numerous mutations are associated with diseases and disorders. The phylogenetic analysis of receptor genes indicates that GPR50 is an outgroup to all other melatonin receptor sequences. GPR50 may have separated from a melatonin receptor ancestor before the split between MTNR1C and the MTNR1A/B ancestor.

  10. Relationships between androgens, serotonin gene expression and innervation in male macaques.

    Science.gov (United States)

    Bethea, C L; Coleman, K; Phu, K; Reddy, A P; Phu, A

    2014-08-22

    Androgen administration to castrated individuals was purported to decrease activity in the serotonin system. However, we found that androgen administration to castrated male macaques increased fenfluramine-induced serotonin release as reflected by increased prolactin secretion. In this study, we sought to define the effects of androgens and aromatase inhibition on serotonin-related gene expression in the dorsal raphe, as well as serotonergic innervation of the LC. Male Japanese macaques (Macaca fuscata) were castrated for 5-7 months and then treated for 3 months with (1) placebo, (2) testosterone (T), (3) dihydrotestosterone (DHT; non-aromatizable androgen) and ATD (steroidal aromatase inhibitor), or (4) Flutamide (FLUT; androgen antagonist) and ATD (n=5/group). This study reports the expression of serotonin-related genes: tryptophan hydroxylase 2 (TPH2), serotonin reuptake transporter (SERT) and the serotonin 1A autoreceptor (5HT1A) using digoxigenin-ISH and image analysis. To examine the production of serotonin and the serotonergic innervation of a target area underlying arousal and vigilance, we measured the serotonin axon density entering the LC with ICC and image analysis. TPH2 and SERT expression were significantly elevated in T- and DHT + ATD-treated groups over placebo- and FLUT + ATD-treated groups in the dorsal raphe (p expression between the groups. There was a significant decrease in the pixel area of serotonin axons and in the number of varicosities in the LC across the treatment groups with T > placebo > DHT + ATD = FLUT + ATD treatments. Comparatively, T- and DHT + ATD-treated groups had elevated TPH2 and SERT gene expression, but the DHT + ATD group had markedly suppressed serotonin axon density relative to the T-treated group. Further comparison with previously published data indicated that TPH2 and SERT expression reflected yawning and basal prolactin secretion. The serotonin axon density in the LC agreed with the area under the fenfluramine

  11. Mechanism of the tissue-specific action of the selective androgen receptor modulator S-101479.

    Science.gov (United States)

    Furuya, Kazuyuki; Yamamoto, Noriko; Ohyabu, Yuki; Morikyu, Teruyuki; Ishige, Hirohide; Albers, Michael; Endo, Yasuhisa

    2013-01-01

    Selective androgen receptor modulators (SARMs) comprise a new class of molecules that induce anabolic effects with fewer side effects than those of other anabolic agents. We previously reported that the novel SARM S-101479 had a tissue-selective bone anabolic effect with diminished side effects in female animals. However, the mechanism of its tissue selectivity is not well known. In this report, we show that S-101479 increased alkaline phosphatase activity and androgen receptor (AR) transcriptional activity in osteoblastic cell lines in the same manner as the natural androgen ligand dihydrotestosterone (DHT); conversely, stimulation of AR dimerization was very low compared with that of DHT (34.4%). S-101479 increased bone mineral content in ovariectomized rats without promoting endometrial proliferation. Yeast two-hybrid interaction assays revealed that DHT promoted recruitment of numerous cofactors to AR such as TIF2, SRC1, β-catenin, NCoA3, gelsolin and PROX1 in a dose-dependent manner. SARMs induced recruitment of fewer cofactors than DHT; in particular, S-101479 failed to induce recruitment of canonical p160 coactivators such as SRC1, TIF2 and notably NCoA3 but only stimulated binding of AR to gelsolin and PROX1. The results suggest that a full capability of the AR to dimerize and to effectively and unselectively recruit all canonical cofactors is not a prerequisite for transcriptional activity in osteoblastic cells and resulting anabolic effects in bone tissues. Instead, few relevant cofactors might be sufficient to promote AR activity in these tissues.

  12. Single amino acid substitutions at 2 of 14 positions in an ultra-conserved region of the androgen receptor yield an androgen-binding domain that is reversibly thermolabile

    Energy Technology Data Exchange (ETDEWEB)

    Vasiliou, M.; Lumbroso, R.; Alvarado, C. [McGill Univ., Quebec (Canada)] [and others

    1994-09-01

    The stereochemistry of the androgen receptor (AR) that is responsible for androgen-specific binding and for its contribution to the transregulatory attributes of an androgen-receptor complex are unknown. Our objective is to define structure-function relations of the human AR by correlating germline missense mutations at its X-linked locus with its resultant misbehavior. Subjects with Arg773Cys have complete androgen insensitivity. We and several other laboratories have reported that their genital skin fibroblasts (GSF) have negligible androgen-binding activity at 37{degrees}. We have found that Phe763Leu also causes CAI, but with approximately 10 fmol/mg protein androgen-binding activity at 37{degrees} (R-deficient). Within COS-1 cells transfected with each mutant AR cDNA, Phe763Leu and Arg773Cys androgen-binding activities are reversibly thermolabile, by a factor of 2, at 37{degrees} versus 22{degrees}, only in the presence of androgen; in the absence of androgen they are thermostable at 37{degrees}. We have discovered that (for a reason yet unknown) the GSF from a third family with Arg773Cys (and no other coding sequence mutation) have 20-40 mol/mg protein of androgen-binding activity at 37{degrees} when measured with 3-6 nFM androgen. This activity reversibly doubles at 22{degrees}. The reversible thermolability of an AR with Arg773Cys (and probably with Phe763Leu) is demonstrable within GSF. Ligand-dependence of this thermolability implies that ligand induces these mutant AR to undergo a deviant conformational change in, or near, a 14-aa region that shares 90% identity/similarity with its closest receptor relatives.

  13. A novel selective androgen receptor modulator (SARM) MK-4541 exerts anti-androgenic activity in the prostate cancer xenograft R-3327G and anabolic activity on skeletal muscle mass & function in castrated mice.

    Science.gov (United States)

    Chisamore, Michael J; Gentile, Michael A; Dillon, Gregory Michael; Baran, Matthew; Gambone, Carlo; Riley, Sean; Schmidt, Azriel; Flores, Osvaldo; Wilkinson, Hilary; Alves, Stephen E

    2016-10-01

    The androgen receptor (AR) is a member of the nuclear hormone receptor super family of transcription factors. Androgens play an essential role in the development, growth, and maintenance of male sex organs, as well as the musculoskeletal and central nervous systems. Yet with advancing age, androgens can drive the onset of prostate cancer, the second leading cause of cancer death in males within the United States. Androgen deprivation therapy (ADT) by pharmacologic and/or surgical castration induces apoptosis of prostate cells and subsequent shrinkage of the prostate and prostate tumors. However, ADT is associated with significant musculoskeletal and behavioral adverse effects. The unique pharmacological activity of selective androgen receptor modulator (SARM) MK-4541 recently has been reported as an AR antagonist with 5α-reductase inhibitor function. The molecule inhibits proliferation and induces apoptosis in AR positive, androgen dependent prostate cancer cells. Importantly, MK-4541 inhibited androgen-dependent prostate growth in male rats yet maintained lean body mass and bone formation following ovariectomy in female rats. In the present study, we evaluated the effects of SARM MK-4541 in the androgen-dependent Dunning R3327-G prostate carcinoma xenograft mouse model as well as on skeletal muscle mass and function, and AR-regulated behavior in mice. MK-4541 significantly inhibited the growth of R3327-G prostate tumors, exhibited anti-androgen effects on the seminal vesicles, reduced plasma testosterone concentrations in intact males, and inhibited Ki67 expression. MK-4541 treated xenografts appeared similar to xenografts in castrated mice. Importantly, we demonstrate that MK-4541 exhibited anabolic activity in androgen deficient conditions, increasing lean body mass and muscle function in adult castrated mice. Moreover, MK-4541 treatment restored general activity levels in castrated mice. Thus, MK-4541 exhibits an optimum profile as an adjuvant therapy to ADT

  14. CLONING AND IN VITRO EXPRESSION AND CHARACTERIZATION OF THE ANDROGEN RECEPTOR AND ISOLATION OF ESTROGEN RECEPTOR α FROM THE FATHEAD MINNOW (PIMEPHALES PROMELAS)

    Science.gov (United States)

    In vitro screening assays designed to identify hormone mimics or antagonists typically use mammalian (rat, human) estrogen (ER) and androgen receptors (AR). Although we know that the amino acid sequences of steroid receptors in nonmammalian vertebrates are not identical to the ma...

  15. CDNA CLONING OF FATHEAD MINNOW (PIMEPHALES PROMELAS) ESTROGEN AND ANDROGEN RECEPTORS FOR USE IN STEROID RECEPTOR EXTRAPOLATION STUDIES FOR ENDOCRINE DISRUPTING CHEMICALS

    Science.gov (United States)

    cDNA Cloning of Fathead minnow (Pimephales promelas) Estrogen and Androgen Receptors for Use in Steroid Receptor Extrapolation Studies for Endocrine Disrupting Chemicals. Wilson, V.S.1,, Korte, J.2, Hartig P. 1, Ankley, G.T.2, Gray, L.E., Jr 1, , and Welch, J.E.1. 1U.S...

  16. Preclinical pharmacology of FL442, a novel nonsteroidal androgen receptor modulator.

    Science.gov (United States)

    Poutiainen, Pekka K; Huhtala, Tuulia; Jääskeläinen, Tiina; Petsalo, Aleksanteri; Küblbeck, Jenni; Kaikkonen, Sanna; Palvimo, Jorma J; Raunio, Hannu; Närvänen, Ale; Peräkylä, Mikael; Juvonen, Risto O; Honkakoski, Paavo; Laatikainen, Reino; Pulkkinen, Juha T

    2014-04-25

    The preclinical profiles of two most potent compounds of our recently published cycloalkane[d]isoxazole pharmacophore-based androgen receptor (AR) modulators, FL442 (4-(3a,4,5,6,7,7a-hexahydro-benzo[d]isoxazol-3-yl)-2-(trifluoromethyl)benzonitrile) and its nitro analog FL425 (3-(4-nitro-3-(trifluoromethyl)phenyl)-3a,4,5,6,7,7a-hexahydrobenzo[d]isoxazole), were explored to evaluate their druggability for the treatment of AR dependent prostate cancer. The studies revealed that both compounds are selective to AR over other closely related steroid hormone receptors and that FL442 exhibits equal inhibition efficiency towards the androgen-responsive LNCaP prostate cancer cell line as the most widely used antiandrogen bicalutamide and the more recently discovered enzalutamide. Notably, FL442 maintains antiandrogenic activity with enzalutamide-activated AR mutant F876L. In contrast to bicalutamide, FL442 does not stimulate the VCaP prostate cancer cells which express elevated levels of the AR. Distribution analyses showed that [(14)CN]FL442 accumulates strongly in the mouse prostate. In spite of its low plasma concentration obtained by intraperitoneal administration, FL442 significantly inhibited LNCaP xenograft tumor growth. These findings provide a preclinical proof for FL442 as a promising AR targeted candidate for a further optimization.

  17. Neonatal RU-486 (mifepristone) exposure increases androgen receptor immunoreactivity and sexual behavior in male rats.

    Science.gov (United States)

    Forbes-Lorman, Robin; Auger, Anthony P; Auger, Catherine J

    2014-01-16

    Progesterone and progestin receptors (PRs) are known to play a role in the development of brain physiology and behavior in many different species. The distribution and regulation of PRs within the developing brain suggest that they likely contribute to the organization of the brain and behavior in a sex-specific manner. We examined the role of PR signaling during development on the organization of adult sexual behavior and androgen receptor (AR) expression in the brain. We administered the PR antagonist, RU-486, subcutaneously to male and female rats on postnatal days 1-7 (0=day of birth) and examined adult sexual behavior and AR-immunoreactivity (AR-ir) in the adult brain. A typical sex difference in lordosis quotient (LQ) was observed and neonatal RU-486 treatment did not alter this behavior. In contrast, neonatal RU-486 treatment increased adult male sexual behavior and AR-ir in several brain areas in males. These data indicate that a transient disruption in PR signaling during development can have lasting consequences on the male brain and may increase male sexual behavior in part by increasing AR expression, and therefore androgen sensitivity, in adulthood.

  18. The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA.

    Science.gov (United States)

    Grossmann, M E; Tindall, D J

    1995-05-01

    The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCC-CCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'-untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.

  19. Lead evaluation of tetrahydroquinolines as nonsteroidal selective androgen receptor modulators for the treatment of osteoporosis.

    Science.gov (United States)

    Nagata, Naoya; Furuya, Kazuyuki; Oguro, Nao; Nishiyama, Daisuke; Kawai, Kentaro; Yamamoto, Noriko; Ohyabu, Yuki; Satsukawa, Masahiro; Miyakawa, Motonori

    2014-01-01

    Tetrahydroquinoline (THQ) was deemed to be a suitable scaffold for our nonsteroidal selective androgen receptor modulator (SARM) concept. We adapted the strategy of switching the antagonist function of cyano-group-containing THQ (CN-THQ) to the agonist function and optimized CN-THQ as an orally available drug candidate with suitable pharmacological and ADME profiles. Based on binding mode analyses and synthetic accessibility, we designed and synthesized a compound that possesses a para-substituted aromatic ring attached through an amide linker. The long-tail THQ derivative 6-acetamido-N-(2-(8-cyano-3a,4,5,9b-tetrahydro-3H-cyclopenta[c]quinolin-4-yl)-2-methylpropyl)nicotinamide (1 d), which bears a para-acetamide-substituted aromatic group, showed an appropriate in vitro biological profile, as expected. We considered that the large conformational change at Trp741 of the androgen receptor (AR) and the hydrogen bond between 1 d and helix 12 of the AR could maintain the structure of the AR in its agonist form; indeed, 1 d displays strong AR agonistic activity. Furthermore, 1 d showed an appropriate in vivo profile for use as an orally available SARM, displaying clear tissue selectivity, with a separation between its desirable osteoanabolic effect on femoral bone mineral density and its undesirable virilizing effects on the uterus and clitoral gland in a female osteoporosis model.

  20. Novel mutations of androgen receptor: a possible mechanism of bicalutamide withdrawal syndrome.

    Science.gov (United States)

    Hara, Takahito; Miyazaki, Jun-ichi; Araki, Hideo; Yamaoka, Masuo; Kanzaki, Naoyuki; Kusaka, Masami; Miyamoto, Masaomi

    2003-01-01

    Most prostate cancers (PCs) become resistant to combined androgen blockade therapy with surgical or medical castration and antiandrogens after several years. Some of these refractory PCs regress after discontinuation of antiandrogen administration [antiandrogen withdrawal syndrome (AWS)]. Although the molecular mechanisms of the AWS are not fully understood because of the lack of suitable experimental models, one hypothesis of the mechanism is mutation of androgen receptor (AR). However, bicalutamide, which has become the most prevalent pure antiandrogen, does not work as an agonist for any mutant AR detected thus far in PC. To elucidate the mechanisms of the AWS, we established and characterized novel LNCaP cell sublines, LNCaP-cxDs, which were generated in vitro by culturing androgen-dependent LNCaP-FGC human PC cells in androgen-depleted medium with bicalutamide to mimic the combined androgen blockade therapy. LNCaP-FGC cells did not grow at first, but they started to grow after 6-13 weeks of culture. Bicalutamide stimulated LNCaP-cxD cell growth and increased prostate-specific antigen secretion from LNCaP-cxD cells both in vitro and in vivo. Sequencing of AR transcripts revealed that the AR in LNCaP-cxD cells harbors a novel mutation in codon 741, TGG (tryptophan) to TGT (cysteine; W741C), or in codon 741, TGG to TTG (leucine; W741L), in the ligand-binding domain. Transactivation assays showed that bicalutamide worked as an agonist for both W741C and W741L mutant ARs. Importantly, another antiandrogen, hydroxyflutamide, worked as an antagonist for these mutant ARs. In summary, we demonstrate for the first time that within only 6-13 weeks of in vitro exposure to bicalutamide, LNCaP-FGC cells, whose growth had initially been suppressed, came to use bicalutamide as an AR agonist via W741 AR mutation to survive. Our data strongly support the hypothesis that AR mutation is one possible mechanism of the AWS and suggest that flutamide might be effective as a second

  1. Androgen receptor functional analyses by high throughput imaging: determination of ligand, cell cycle, and mutation-specific effects.

    Directory of Open Access Journals (Sweden)

    Adam T Szafran

    Full Text Available BACKGROUND: Understanding how androgen receptor (AR function is modulated by exposure to steroids, growth factors or small molecules can have important mechanistic implications for AR-related disease therapies (e.g., prostate cancer, androgen insensitivity syndrome, AIS, and in the analysis of environmental endocrine disruptors. METHODOLOGY/PRINCIPAL FINDINGS: We report the development of a high throughput (HT image-based assay that quantifies AR subcellular and subnuclear distribution, and transcriptional reporter gene activity on a cell-by-cell basis. Furthermore, simultaneous analysis of DNA content allowed determination of cell cycle position and permitted the analysis of cell cycle dependent changes in AR function in unsynchronized cell populations. Assay quality for EC50 coefficients of variation were 5-24%, with Z' values reaching 0.91. This was achieved by the selective analysis of cells expressing physiological levels of AR, important because minor over-expression resulted in elevated nuclear speckling and decreased transcriptional reporter gene activity. A small screen of AR-binding ligands, including known agonists, antagonists, and endocrine disruptors, demonstrated that nuclear translocation and nuclear "speckling" were linked with transcriptional output, and specific ligands were noted to differentially affect measurements for wild type versus mutant AR, suggesting differing mechanisms of action. HT imaging of patient-derived AIS mutations demonstrated a proof-of-principle personalized medicine approach to rapidly identify ligands capable of restoring multiple AR functions. CONCLUSIONS/SIGNIFICANCE: HT imaging-based multiplex screening will provide a rapid, systems-level analysis of compounds/RNAi that may differentially affect wild type AR or clinically relevant AR mutations.

  2. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies

    Directory of Open Access Journals (Sweden)

    Mao Q

    2015-08-01

    Full Text Available Qixing Mao,1–3,* Mantang Qiu,1–3,* Gaochao Dong,3 Wenjie Xia,1–3 Shuai Zhang,1,3 Youtao Xu,1,3 Jie Wang,3 Yin Rong,1,3 Lin Xu,1,3 Feng Jiang1,3 1Department of Thoracic Surgery, Nanjing Medical University Affiliated Cancer Institute of Jiangsu Province, 2Fourth Clinical College of Nanjing Medical University, 3Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg’s test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855–1.245. However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089–1.992. Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014–1.707. These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results. Keywords: androgen, CAG repeat polymorphism, women

  3. A novel variant of androgen receptor is associated with idiopathic azoospermia.

    Science.gov (United States)

    Mou, Lisha; Gui, Yaoting

    2016-10-01

    A variety of genetic variants can lead to abnormal human spermatogenesis. The androgen receptor (AR) is an important steroid hormone receptor that is critical for male sexual differentiation and the maintenance of normal spermatogenesis. In the present study, each exon of AR in 776 patients diagnosed with idiopathic azoospermia (IA) and 709 proven fertile men were sequenced using use panel re‑sequencing methods to examine whether AR is involved in the pathogenesis of IA. Two synonymous variants and seven missense variants were detected. Of the missense variants, a luciferase assay demonstrated that the R630W variant reduced the transcriptional regulatory function of AR. This novel variant (p. R630W) of AR is the first to be identified in association with IA, thereby highlighting the importance of AR during spermatogenesis.

  4. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  5. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    Energy Technology Data Exchange (ETDEWEB)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de; Brinkmann, A.O.; Degenhart, H.J.; Trapman, J. (Erasmus Univ., Rotterdam (Netherlands))

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-point sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.

  6. The structural basis of androgen receptor activation: Intramolecular and intermolecular amino–carboxy interactions

    Science.gov (United States)

    Schaufele, Fred; Carbonell, Xavier; Guerbadot, Martin; Borngraeber, Sabine; Chapman, Mark S.; Ma, Aye Aye K.; Miner, Jeffrey N.; Diamond, Marc I.

    2005-01-01

    Nuclear receptors (NRs) are ligand-regulated transcription factors important in human physiology and disease. In certain NRs, including the androgen receptor (AR), ligand binding to the carboxy-terminal domain (LBD) regulates transcriptional activation functions in the LBD and amino-terminal domain (NTD). The basis for NTD–LBD communication is unknown but may involve NTD–LBD interactions either within a single receptor or between different members of an AR dimer. Here, measurement of FRET between fluorophores attached to the NTD and LBD of the AR established that agonist binding initiated an intramolecular NTD–LBD interaction in the nucleus and cytoplasm. This intramolecular folding was followed by AR self-association, which occurred preferentially in the nucleus. Rapid, ligand-induced intramolecular folding and delayed association also were observed for estrogen receptor-α but not for peroxisome proliferator activated receptor-γ2. An antagonist ligand, hydroxyflutamide, blocked the NTD–LBD association within AR. NTD–LBD association also closely correlated with the transcriptional activation by heterologous ligands of AR mutants isolated from hormone-refractory prostate tumors. Intramolecular folding, but not AR–AR affinity, was disrupted by mutation of an α-helical (23FQNLF27) motif in the AR NTD previously described to interact with the AR LBD in vitro. This work establishes an intramolecular NTD–LBD conformational change as an initial component of ligand-regulated NR function. PMID:15994236

  7. Assessment of Correlation between Androgen Receptor CAG Repeat Length and Infertility in Infertile Men Living in Khuzestan, Iran

    Directory of Open Access Journals (Sweden)

    Saeid Reza Khatami

    2015-02-01

    Full Text Available Background: The androgen receptor (AR gene contains a polymorphic trinucleotide repeat that encodes a polyglutamine tract in its N-terminal transactivation domain (NTAD. We aimed to find a correlation between the length of this polymorphic tract and azoospermia or oligozoospermia in infertile men living in Khuzestan, Iran. Materials and Methods: In this case-control study during two years till 2010, we searched for microdeletions in the Y chromosome in 84 infertile male patients with normal karyotype who lived in Khuzestan Province, Southwest of Iran. All cases (n=12 of azoospermia or oligozoospermia resulting from Y chromosome microdeletions were excluded from our study. The number of CAG repeats in exon 1 of the AR gene was determined in 72 patients with azoospermia or oligozoospermia and in 72 fertile controls, using the polymerase chain reaction (PCR and polyacrylamide gel electrophoresis. Results: Microdeletions were detected in 14.3% (n=12 patients suffering severe oligozoospermia. The mean CAG repeat length was 18.99 ± 0.35 (range, 11-26 and 19.96 ± 0.54 (range, 12-25 in infertile males and controls, respectively. Also in the infertile group, the most common allele was 19 (26.38%, while in controls, it was 25 (22.22%. Conclusion: Y chromosome microdeletions could be one of the main reasons of male infertility living in Khuzestan Province, while there was no correlation between CAG length in AR gene with azoospermia or oligozoospermia in infertile men living in Khuzestan, Iran.

  8. 2,2-bis(4-chlorophenyl)-1,1-dichloroethylene stimulates androgen independence in prostate cancer cells through combinatorial activation of mutant androgen receptor and mitogen-activated protein kinase pathways.

    Science.gov (United States)

    Shah, Supriya; Hess-Wilson, Janet K; Webb, Siobhan; Daly, Hannah; Godoy-Tundidor, Sonia; Kim, Jae; Boldison, Joanne; Daaka, Yehia; Knudsen, Karen E

    2008-09-01

    Therapy resistance represents a major clinical challenge in disseminated prostate cancer for which only palliative treatment is available. One phenotype of therapy-resistant tumors is the expression of somatic, gain-of-function mutations of the androgen receptor (AR). Such mutant receptors can use noncanonical endogenous ligands (e.g., estrogen) as agonists, thereby promoting recurrent tumor formation. Additionally, selected AR mutants are sensitized to the estrogenic endocrine-disrupting compound (EDC) bisphenol A, present in the environment. Herein, screening of additional EDCs revealed that multiple tumor-derived AR mutants (including T877A, H874Y, L701H, and V715M) are sensitized to activation by the pesticide 2,2-bis(4-chlorophenyl)-1,1-dichloroethylene (DDE), thus indicating that this agent may impinge on AR signaling in cancer cells. Further investigation showed that DDE induced mutant AR recruitment to the prostate-specific antigen regulatory region, concomitant with an enhancement of target gene expression, and androgen-independent proliferation. By contrast, neither AR activation nor altered cellular proliferation was observed in cells expressing wild-type AR. Activation of signal transduction pathways was also observed based on rapid phosphorylation of mitogen-activated protein kinase (MAPK) and vasodilator-stimulated phosphoprotein, although only MAPK activation was associated with DDE-induced cellular proliferation. Functional analyses showed that both mutant AR and MAPK pathways contribute to the proliferative action of DDE, as evidenced through selective abrogation of each pathway. Together, these data show that exposure to environmentally relevant doses of EDCs can promote androgen-independent cellular proliferation in tumor cells expressing mutant AR and that DDE uses both mutant AR and MAPK pathways to exert its mitogenic activity.

  9. Immunohistochemical localization of androgen receptor in rat caput epididymis during postnatal development

    Directory of Open Access Journals (Sweden)

    Sema Timurkaan

    2011-09-01

    Full Text Available Objectives: The aim of this study was to investigate the developmental pattern of androgen receptor (AR in caput epididymis.Materials and methods: In this study three randomly selected rats were sacrificed at ages 21, 56, 90 and 120 days old. All male rats were anesthetized with ethyl ether before killing. Then, the caput epididymides were removed and fixed in Bouin’s fixative at +4°C for 36 hour. Afterwards the tissue samples were embedded in paraffin for routine histological methods. Later the tissues were sectioned at 5μm and mounted on poly-L-lysin-coated slides. To solve the antigen masking problem, we performed microwave stimulated antigen retrieval technique before the immunohistochemical staining. Avidin-Biotin-Peroxidase Complex (ABC method was applied for immunohistochemical staining.Results: In all age groups of rats studied, positive immunohistochemical staining for the AR appeared in nuclei of epididymal cells. The staining intensity of AR positive cells did not change depending on age. In caput epididymis, immunostainable AR was found in tubular epithelial cells (principal cells, basal cells and apical cells and peritubular smooth muscle cells. The AR staining in the epithelial cells appeared to be stronger than in the peritubular smooth muscle cells. In the epithelial cells; staining intensity was stronger in principal cells than in basal cells and apical cells.Conclusion: Staining intensity of AR positive epididymal cells irrespective of age indicated the necessity of androgens for postnatal differentiation and maintaining the structure of the epididymis. Stronger staining intensity in principal cells suggested that principal cells are more sensitive to androgen stimulation. J Clin Exp Invest 2011; 2 (3: 260-266.

  10. Conazole fungicides inhibit Leydig cell testosterone secretion and androgen receptor activation in vitro

    Directory of Open Access Journals (Sweden)

    Maarke J.E. Roelofs

    2014-01-01

    Full Text Available Conazole fungicides are widely used in agriculture despite their suspected endocrine disrupting properties. In this study, the potential (anti-androgenic effects of ten conazoles were assessed and mutually compared with existing data. Effects of cyproconazole (CYPRO, fluconazole (FLUC, flusilazole (FLUS, hexaconazole (HEXA, myconazole (MYC, penconazole (PEN, prochloraz (PRO, tebuconazole (TEBU, triadimefon (TRIA, and triticonazole (TRIT were examined using murine Leydig (MA-10 cells and human T47D-ARE cells stably transfected with an androgen responsive element and a firefly luciferase reporter gene. Six conazoles caused a decrease in basal testosterone (T secretion by MA-10 cells varying from 61% up to 12% compared to vehicle-treated control. T secretion was concentration-dependently inhibited after exposure of MA-10 cells to several concentrations of FLUS (IC50 = 12.4 μM or TEBU (IC50 = 2.4 μM in combination with LH. The expression of steroidogenic and cholesterol biosynthesis genes was not changed by conazole exposure. Also, there were no changes in reactive oxygen species (ROS formation that could explain the altered T secretion after exposure to conazoles. Nine conazoles decreased T-induced AR activation (IC50s ranging from 10.7 to 71.5 μM and effect potencies (REPs were calculated relative to the known AR antagonist flutamide (FLUT. FLUC had no effect on AR activation by T. FLUS was the most potent (REP = 3.61 and MYC the least potent (REP = 0.03 AR antagonist. All other conazoles had a comparable REP from 0.12 to 0.38. Our results show distinct in vitro anti-androgenic effects of several conazole fungicides arising from two mechanisms: inhibition of T secretion and AR antagonism, suggesting potential testicular toxic effects. These effects warrant further mechanistic investigation and clearly show the need for accurate exposure data in order to perform proper (human risk assessment of this class of compounds.

  11. A Glu-urea-Lys Ligand-conjugated Lipid Nanoparticle/siRNA System Inhibits Androgen Receptor Expression In Vivo

    Science.gov (United States)

    Lee, Justin B; Zhang, Kaixin; Tam, Yuen Yi C; Quick, Joslyn; Tam, Ying K; Lin, Paulo JC; Chen, Sam; Liu, Yan; Nair, Jayaprakash K; Zlatev, Ivan; Rajeev, Kallanthottathil G; Manoharan, Muthiah; Rennie, Paul S; Cullis, Pieter R

    2016-01-01

    The androgen receptor plays a critical role in the progression of prostate cancer. Here, we describe targeting the prostate-specific membrane antigen using a lipid nanoparticle formulation containing small interfering RNA designed to silence expression of the messenger RNA encoding the androgen receptor. Specifically, a Glu-urea-Lys PSMA-targeting ligand was incorporated into the lipid nanoparticle system formulated with a long alkyl chain polyethylene glycol-lipid to enhance accumulation at tumor sites and facilitate intracellular uptake into tumor cells following systemic administration. Through these features, and by using a structurally refined cationic lipid and an optimized small interfering RNA payload, a lipid nanoparticle system with improved potency and significant therapeutic potential against prostate cancer and potentially other solid tumors was developed. Decreases in serum prostate-specific antigen, tumor cellular proliferation, and androgen receptor levels were observed in a mouse xenograft model following intravenous injection. These results support the potential clinical utility of a prostate-specific membrane antigen–targeted lipid nanoparticle system to silence the androgen receptor in advanced prostate cancer.

  12. BINDING OF STEROIDS AND ENVIRONMENTAL CHEMICALS TO THE RAINBOW TROUT ANDROGEN RECEPTOR ALPHA EXPRESSED IN COS CELLS

    Science.gov (United States)

    Binding of Steroids and Environmental Chemicals to the Rainbow Trout Androgen Receptor Alpha Expressed in COS Cells. Mary C. Cardon, L. Earl Gray. Jr., Phillip C. Hartig and Vickie S. Wilson U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology...

  13. LINE-1 ORF-1p functions as a novel androgen receptor co-activator and promotes the growth of human prostatic carcinoma cells.

    Science.gov (United States)

    Lu, Yinying; Feng, Fan; Yang, Yutao; Gao, Xudong; Cui, Jiajun; Zhang, Chuanfu; Zhang, Fan; Xu, Zhongxian; Qv, Jianhui; Wang, Chunping; Zeng, Zhen; Zhu, Yunfeng; Yang, Yongping

    2013-02-01

    Widespread interest in the mechanism of transcriptional regulation by the androgen receptor (AR) has been stimulated by the finding that AR signaling is critically important in the progression of human prostate cancers. Co-factors, the co-repressors, or the co-activators are responsible for the regulation of AR activation. The pro-oncogene human Long Interspersed Nucleotide acid Element-1 (LINE-1) encodes LINE-1 ORF-1p and plays important roles in the development and progression of several human carcinomas. In this study, the results showed that LINE-1 ORF-1p increased the AR transcriptional activity and in turn enhanced the expression of prostate specific antigen (PSA) in the presence of R1881. A physical protein-protein interaction between the AR signaling and the LINE-1 ORF-1p was identified by the immunoprecipitation assays and GST pull-down assays. Furthermore, LINE-1 ORF-1p would function as a novel AR positive co-regulator through modulating its cytoplasm/nucleus translocation and the recruitment to the androgen response element in the PSA gene promoter. Our date also showed that the LINE-1 ORF-1p promoted the proliferation and anchor-independent growth of LNCaP (ligand dependent) and PC-3 (ligand independent) human prostatic carcinoma cells. By investigating a novel role of the LINE-1 ORF-1p in the androgen/androgen receptor signaling pathway regulation, our study identifies that LINE-1 ORF-1p may be a novel AR co-regulator and molecular target for human prostate carcinoma therapy.

  14. Corepressor effect on androgen receptor activity varies with the length of the CAG encoded polyglutamine repeat and is dependent on receptor/corepressor ratio in prostate cancer cells.

    Science.gov (United States)

    Buchanan, Grant; Need, Eleanor F; Barrett, Jeffrey M; Bianco-Miotto, Tina; Thompson, Vanessa C; Butler, Lisa M; Marshall, Villis R; Tilley, Wayne D; Coetzee, Gerhard A

    2011-08-01

    The response of prostate cells to androgens reflects a combination of androgen receptor (AR) transactivation and transrepression, but how these two processes differ mechanistically and influence prostate cancer risk and disease outcome remain elusive. Given recent interest in targeting AR transrepressive processes, a better understanding of AR/corepressor interaction and responses is warranted. Here, we used transactivation and interaction assays with wild-type and mutant ARs, and deletion AR fragments, to dissect the relationship between AR and the corepressor, silencing mediator for retinoic acid and thyroid hormone receptors (SMRT). We additionally tested how these processes are influenced by AR agonist and antagonist ligands, as well as by variation in the polyglutamine tract in the AR amino terminal domain (NTD), which is encoded by a polymorphic CAG repeat in the gene. SMRT was recruited to the AR ligand binding domain by agonist ligand, and as determined by the effect of strategic mutations in activation function 2 (AF-2), requires a precise conformation of that domain. A distinct region of SMRT also mediated interaction with the AR-NTD via the transactivation unit 5 (TAU5; residues 315-538) region. The degree to which SMRT was able to repress AR increased from 17% to 56% as the AR polyglutamine repeat length was increased from 9 to 42 residues, but critically this effect could be abolished by increasing the SMRT:AR molar ratio. These data suggest that the extent to which the CAG encoded polyglutamine repeat influences AR activity represents a balance between corepressor and coactivator occupancy of the same ligand-dependent and independent AR interaction surfaces. Changes in the homeostatic relationship of AR to these molecules, including SMRT, may explain the variable penetrance of the CAG repeat and the loss of AR signaling flexibility in prostate cancer progression.

  15. Androgen receptor isoforms in human prostatic cancer tissue and LNCaP cell line

    Institute of Scientific and Technical Information of China (English)

    Shu-Jie XIA; Xiao-Da TANG; Qing-Zheng MA

    2001-01-01

    Aim: To investigate the androgen receptor (AR) isoform expressions in human prostatic cancer tissue and LNCaP cell line. Methods: With high resolution isoelectric focusing (IEF) method we demonstrated the different expressions of AR isoforms in human prostatic cancer tissues and LNCaP cell line. Results: Data were obtained from three prostatic cancer specimens and the LNCaP cell line. Three types of AR isoforms were detected with pI values at 6.5,6.0, and 5.3. For the 3 prostatic cancer specimens, 1 sample showed all the three types of AR isoforms, the second specimen expressed at 6.5 and 6.0, and the third failed to show any type of isoforms. The LNCaP cell line expressed all the three AR isoforms. Binding of 3H-dihydrotestosterone (3H-DHT) to these three isoforms was inhibited by the addition ofl00-fold excess of DHT or testosterone, while not by progesterone, oestradiol and diethylstilboestrol. Conclusion: The expression of AR isofonns is different in different prostate cancer tissues, which may be related to the difference in the effect of anti-androgen therapy in different patients.

  16. Chiral dimethylamine flutamide derivatives-modeling, synthesis, androgen receptor affinities and carbon-11 labeling

    Energy Technology Data Exchange (ETDEWEB)

    Jacobson, Orit [Department of Medical Biophysics and Nuclear Medicine, Hebrew University of Jerusalem, Hadassah Hospital, Jerusalem 91120 (Israel); Laky, Desideriu [Department of Medical Biophysics and Nuclear Medicine, Hebrew University of Jerusalem, Hadassah Hospital, Jerusalem 91120 (Israel); Carlson, Kathryn E. [Department of Chemistry, University of Illinois, Urbana, IL 61801 (United States); Elgavish, Sharona [Bioinformatics Unit, Hebrew University of Jerusalem, Jerusalem 91120 (Israel); Gozin, Michael [School of Chemistry, Raymond and Beverly Sackler Faculty of Exact Sciences, Tel Aviv University, Tel Aviv 69978 (Israel); Even-Sapir, Einat [Department of Nuclear Medicine, Tel Aviv Sourasky Medical Center, Sackler School of Medicine, Tel Aviv University, Tel Aviv 64239 (Israel); Leibovitc, Ilan [Department of Urology, Meir Medical Center, Sackler School of Medicine, Tel Aviv University, Kfar Sava 44281 (Israel); Gutman, Mordechai [Department of Surgery A, Sapir Medical Center, Sackler School of Medicine, Tel Aviv University, Kfar Sava 44281 (Israel); Chisin, Roland [Department of Medical Biophysics and Nuclear Medicine, Hebrew University of Jerusalem, Hadassah Hospital, Jerusalem 91120 (Israel); Katzenellenbogen, John A. [Department of Chemistry, University of Illinois, Urbana, IL 61801 (United States); Mishani, Eyal [Department of Medical Biophysics and Nuclear Medicine, Hebrew University of Jerusalem, Hadassah Hospital, Jerusalem 91120 (Israel)]. E-mail: mishani@md.huji.ac.il

    2006-08-15

    Most prostate cancers are androgen dependent upon initial diagnosis. On the other hand, some very aggressive forms of prostate cancer were shown to have lost the expression of the androgen receptor (AR). Although the AR is routinely targeted in endocrine treatment, the clinical outcome remains suboptimal. Therefore, it is crucial to demonstrate the presence and activity of the AR in each case of prostate cancer, before and after treatment. While noninvasive positron emission tomography (PET) has the potential to determine AR expression of tumor cells in vivo, fully optimized PET imaging agents are not yet available. Based on molecular modeling, three novel derivatives of hydroxyflutamide (Compounds 1-3) were designed and synthesized. They contain an electron-rich group (dimethylamine) located on the methyl moiety, which may confer a better stability to the molecule in vivo. Compounds 1-3 have AR binding that is similar or higher than that of the currently used commercial drugs. An automated carbon-11 radiolabeling route was developed, and the compounds were successfully labeled with a 10-15% decay-corrected radiochemical yield, 99% radiochemical purity and a specific activity of 4Ci/{mu}mol end of bombardment (n=15). These labeled biomarkers may facilitate the future quantitative molecular imaging of AR-positive prostate cancer using PET and may also allow for image-guided treatment of prostate cancer.

  17. ATM Inhibition Potentiates Death of Androgen Receptor-inactivated Prostate Cancer Cells with Telomere Dysfunction.

    Science.gov (United States)

    Reddy, Vidyavathi; Wu, Min; Ciavattone, Nicholas; McKenty, Nathan; Menon, Mani; Barrack, Evelyn R; Reddy, G Prem-Veer; Kim, Sahn-Ho

    2015-10-16

    Androgen receptor (AR) plays a role in maintaining telomere stability in prostate cancer cells, as AR inactivation induces telomere dysfunction within 3 h. Since telomere dysfunction in other systems is known to activate ATM (ataxia telangiectasia mutated)-mediated DNA damage response (DDR) signaling pathways, we investigated the role of ATM-mediated DDR signaling in AR-inactivated prostate cancer cells. Indeed, the induction of telomere dysfunction in cells treated with AR-antagonists (Casodex or MDV3100) or AR-siRNA was associated with a dramatic increase in phosphorylation (activation) of ATM and its downstream effector Chk2 and the presenceof phosphorylated ATM at telomeres, indicating activation of DDR signaling at telomeres. Moreover, Casodex washout led to the reversal of telomere dysfunction, indicating repair of damaged telomeres. ATM inhibitor blocked ATM phosphorylation, induced PARP cleavage, abrogated cell cycle checkpoint activation and attenuated the formation of γH2AX foci at telomeres in AR-inactivated cells, suggesting that ATM inhibitor induces apoptosis in AR-inactivated cells by blocking the repair of damaged DNA at telomeres. Finally, colony formation assay revealed a dramatic decrease in the survival of cells co-treated with Casodex and ATM inhibitor as compared with those treated with either Casodex or ATM inhibitor alone. These observations indicate that inhibitors of DDR signaling pathways may offer a unique opportunity to enhance the potency of AR-targeted therapies for the treatment of androgen-sensitive as well as castration-resistant prostate cancer.

  18. Distribution of androgen and progesterone receptors in the spiny mouse (Acomys cahirinus) ovary during postnatal life.

    Science.gov (United States)

    Hułas-Stasiak, Monika; Gawron, Antoni

    2010-03-01

    This study describes the localization of androgen (AR) and progesterone (PR) receptors in the developing ovary in the spiny mouse. The immunohistochemical analysis showed for the first time the expression of AR and PR proteins in the ovary as early as in one day-old females. Both AR and PR were present in germinal epithelium cells, stromal cells as well as in the granulosa and theca layer of ovarian follicles. On days 7, 14, 21, 30, 60 and 90, the distribution of AR and PR depended on the stage of follicular development rather than on the animal's age. A novel observation was that PR protein was detected not only in granulosa cells of preovulatory follicles, but also in the growing and early antral follicles. It was demonstrated that there is a different pattern of AR and PR immunoexpression throughout folliculogenesis. In contrast to AR, whose expression decreased during follicular development, the PR immunostaining increased during this time. It is concluded that androgens and progesterone may play an important role in the early stage of follicular development in the spiny mouse.

  19. A Cell Model for Conditional Profiling of Androgen-Receptor-Interacting Proteins

    Directory of Open Access Journals (Sweden)

    K. A. Mooslehner

    2012-01-01

    Full Text Available Partial androgen insensitivity syndrome (PAIS is associated with impaired male genital development and can be transmitted through mutations in the androgen receptor (AR. The aim of this study is to develop a cell model suitable for studying the impact AR mutations might have on AR interacting proteins. For this purpose, male genital development relevant mouse cell lines were genetically modified to express a tagged version of wild-type AR, allowing copurification of multiprotein complexes under native conditions followed by mass spectrometry. We report 57 known wild-type AR-interacting proteins identified in cells grown under proliferating and 65 under nonproliferating conditions. Of those, 47 were common to both samples suggesting different AR protein complex components in proliferating and proliferation-inhibited cells from the mouse proximal caput epididymus. These preliminary results now allow future studies to focus on replacing wild-type AR with mutant AR to uncover differences in protein interactions caused by AR mutations involved in PAIS.

  20. Increased androgen receptor expression in serous carcinoma of the ovary is associated with an improved survival

    Directory of Open Access Journals (Sweden)

    Nodin Björn

    2010-06-01

    Full Text Available Abstract Background Altered androgen hormone homeostasis and androgen receptor (AR activity have been implicated in ovarian carcinogenesis but the relationship between AR expression in ovarian cancer and clinical outcome remains unclear. Methods In this study, the prognostic impact of AR expression was investigated using immunohistochemistry in tissue microarrays from 154 incident cases of epithelial ovarian cancer (EOC in the prospective, population-based cohorts Malmö Diet and Cancer Study and Malmö Preventive Project. A subset of corresponding fallopian tubes (n = 36 with no histopathological evidence of disease was also analysed. Results While abundantly expressed in the majority of fallopian tubes with more than 75% positive nuclei in 16/36 (44% cases, AR was absent in 108/154 (70% of EOC cases. AR expression was not related to prognosis in the entire cohort, but in the serous subtype (n = 90, AR positivity (> 10% positive nuclei was associated with a prolonged disease specific survival in univariate (HR= 0.49; 95% CI 0.25-0.96; p= 0.038 and multivariate (HR= 0.46; 95% CI 0.22-0.97; p= 0.042 analysis, adjusted for age, grade and clinical stage. Conclusions AR expression is considerably reduced in EOC as compared to fallopian tubes, and in EOC of the serous subtype, high AR expression is a favourable prognostic factor. These results indicate that assessment of AR expression might be of value for treatment stratification of EOC patients with serous ovarian carcinoma.

  1. An electrospun scaffold loaded with anti-androgen receptor compound for accelerating wound healing

    Directory of Open Access Journals (Sweden)

    Cassandra Chong

    2013-09-01

    Full Text Available Current dermal regenerative scaffolds provide wound coverage, and structural support and guidance for tissue repair, but usually lack enough bio-signals needed for speeding up skin cell growth, migration, wound closure, and skin regeneration. In this study, an androgen receptor (AR inhibitor called ASC-J9 is used to demonstrate the concept and feasibility of fabricating drug-loaded scaffolds via electrospinning. Inhibition of androgen is known to promote skin wound healing. The novel ASC-J9 - loaded porous scaffold was fabricated for skin wound repair using electrospun fibers of collagen and polycaprolactone (PCL blend. Our preliminary results indicated that ASC-J9 - loaded scaffolds facilitated more efficient attachment and ingrowth of dermal fibroblasts, compared to the control collagen-PCL scaffold. A significant increase of cell proliferation was observed with the drug-loaded scaffold over a 28-day period. The drug-loaded scaffold also accelerated keratinocyte migration and wound closure in a contraction-inhibited mouse wound model over 21 days. The data indicated a sustained release of ASC-J9 from the scaffold and its potential to accelerate wound healing by promoting cell proliferation and migration over an extended period of time. More importantly, our results proved the concept and feasibility of fabricating drug-releasing or bioactive dermal scaffolds for more effective wound healing.

  2. 睾丸发育不全综合症与雄激素受体基因多态性及相关围产因素的研究%Study on the relationship among testicular dysgenesis syndrome, androgen receptor gene polymorphism and associated perinatal factors

    Institute of Scientific and Technical Information of China (English)

    孙革; 王恒友; 吴鼎文; 唐达星

    2012-01-01

    Objective To explore the relationships among the occurrence ofteaticular dysgenesis syndrome with hypospadias and cryptorchidism,the polymorphic androgen-receptor CAG repeat and associated perinatal factors.Methods Blood samples were collected from 60 hypospadias,32 cryptorchidism (unilatcral 29 and bilateral 3,6 of them combined with hypospadias) and 70 normal boys as control between May 2009 and Dec 2010.CAG repeat lengths of androgen receptor were measured.The perinatal data collected included birth weight and gestational age; mother's age,history of tocolysis in early trimester (the use of progesterone),assisted reproduction,mother's occupation,habitation and history of gestational hypertension.All data were statistically analyzed.Results The CAG repeat length of hypospadias and cryptorchidism were significantly longer than the control (P =0.008 and 0.028 respectively).Low birth weight of infants (P =0.003),mother's age (P =0.007) and the use of progesterone (P =0.000) were found to be risk factors for hypospadias.Mother's age (P =0.003)and agriculturalactivities (P =0.017) were risk factors for cryptorchidism.Conclusions The occurrence oftesticular dysgenesis syndrome is associated with multiple factors.The AR gene CAG repeat length,low birth weight,young mother,especially exposure to estrogen,anti-androgen substances,such as progesterone and pesticide all contribute to an increased risk of the occurrence of testicular dysgenesis syndrome.%目的 探讨睾丸发育不全综合症(testicular dysgenesis syndrome,TDS)的幼年期发病(尿道下裂、隐睾)与雄激素受体(Androgen receptor,AR)基因CAG重复长度多态性改变及相关围产因素的关系.方法 收集2009年5月至2010年12月共60例尿道下裂、隐睾32例(单侧29例,双侧3例,其中尿道下裂合并单侧隐睾6例)及正常对照组70例,采血提取基因组DNA,检测AR基因CAG重复序列次数;收集围产资料,包括小儿出生时体重及胎龄、母亲分娩时年龄

  3. Age- and Sex-Dependent Changes in Androgen Receptor Expression in the Developing Mouse Cortex and Hippocampus

    OpenAIRE

    2015-01-01

    During the perinatal period, male mice are exposed to higher levels of testosterone (T) than females, which promotes sexual dimorphism in their brain structures and behaviors. In addition to acting via estrogen receptors after being locally converted into estradiol by aromatase, T also acts directly through androgen receptor (AR) in the brain. Therefore, we hypothesized that AR expression in the developing mouse cortex and hippocampus was sexually dimorphic. To test our hypothesis, we measure...

  4. A role for the androgen receptor in the treatment of male breast cancer.

    Science.gov (United States)

    Zhu, Jason; Davis, Carter T; Silberman, Sandra; Spector, Neil; Zhang, Tian

    2016-02-01

    Male breast cancer (BC) is relatively rare, making up less than 1% of all breast cancer cases in the United States. Treatment guidelines for male BC are derived from studies on the treatment of female BC, and are based molecular and clinical characteristics, such as hormone receptor positivity. For female estrogen receptor positive (ER+) breast cancers, the standard of care includes three classes of endocrine therapies: selective estrogen receptor modulators, aromatase inhibitors, and pure anti-estrogens. In contrast to female ER+ breast cancers, there is less known about the optimal treatment for male ER+ BC. Furthermore, in contrast to ER, less is known about the role of the androgen receptor (AR) in male and female BC. We report here the treatment of a 28-year-old man with metastatic AR+, ER+ breast cancer otherwise refractory to chemotherapy, who has had a durable clinical response to hormonal suppression with the combination of aromatase inhibition (Letrozole) in conjunction with a GnRH agonist (Leuprolide).

  5. Semenogelin I promotes prostate cancer cell growth via functioning as an androgen receptor coactivator and protecting against zinc cytotoxicity.

    Science.gov (United States)

    Ishiguro, Hitoshi; Izumi, Koji; Kashiwagi, Eiji; Zheng, Yichun; Li, Yi; Kawahara, Takashi; Miyamoto, Hiroshi

    2015-01-01

    A seminal plasma protein, semenogelin I (SgI), contributes to sperm clotting, upon binding to Zn(2+), and can be proteolyzed by prostate-specific antigen (PSA), resulting in release of the trapped spermatozoa after ejaculation. In contrast, the role of SgI in the development and progression of any types of malignancies remains largely unknown. We previously demonstrated that SgI was overexpressed in prostate cancer tissues and its expression was enhanced by zinc treatment in LNCaP cells. In the current study, using cell lines stably expressing SgI, we investigated its biological functions, in conjunction with zinc, androgen, and androgen receptor (AR), in prostate cancer. Zinc, without SgI, inhibited cell growth of both AR-positive and AR-negative lines. Co-expression of SgI prevented zinc inhibiting dihydrotestosterone-mediated proliferation of AR-positive cells, whereas SgI and/or dihydrotestosterone showed marginal effects in AR-negative cells. Similar effects of SgI overexpression in LNCaP on dihydrotestosterone-induced cell invasion, such as its significant enhancement with zinc, were seen. Overexpression of SgI in LNCaP and CWR22Rv1 cells also augmented dihydrotestosterone-mediated PSA expression (mRNA, protein) in the presence of zinc. However, culture in the conditioned medium containing secreted forms of SgI failed to significantly increase cell viability with or without zinc. In luciferase reporter gene assays, SgI showed even slight inhibitory effects (8% and 15% decreases in PC3 and CWR22Rv1, respectively) at 0 μM zinc and significant stimulatory effects (2.1- and 3.2-fold) at 100 μM zinc on dihydrotestosterone-enhanced AR transactivation. Co-immunoprecipitation then demonstrated dihydrotestosterone-induced physical interactions between AR and SgI. These results suggest that intracellular SgI, together with zinc, functions as an AR coactivator and thereby promotes androgen-mediated prostate cancer progression.

  6. Activation of P-TEFb by Androgen Receptor-Regulated Enhancer RNAs in Castration-Resistant Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2016-04-01

    Full Text Available The androgen receptor (AR is required for castration-resistant prostate cancer (CRPC progression, but the function and disease relevance of AR-bound enhancers remain unclear. Here, we identify a group of AR-regulated enhancer RNAs (e.g., PSA eRNA that are upregulated in CRPC cells, patient-derived xenografts (PDXs, and patient tissues. PSA eRNA binds to CYCLIN T1, activates P-TEFb, and promotes cis and trans target gene transcription by increasing serine-2 phosphorylation of RNA polymerase II (Pol II-Ser2p. We define an HIV-1 TAR RNA-like (TAR-L motif in PSA eRNA that is required for CYCLIN T1 binding. Using TALEN-mediated gene editing we further demonstrate that this motif is essential for increased Pol II-Ser2p occupancy levels and CRPC cell growth. We have uncovered a P-TEFb activation mechanism and reveal altered eRNA expression that is related to abnormal AR function and may potentially be a therapeutic target in CRPC.

  7. Baldness and the androgen receptor: the AR polyglycine repeat polymorphism does not confer susceptibility to androgenetic alopecia.

    Science.gov (United States)

    Ellis, Justine A; Scurrah, Katrina J; Cobb, Joanna E; Zaloumis, Sophie G; Duncan, Anna E; Harrap, Stephen B

    2007-05-01

    Androgenetic alopecia, or male pattern baldness, is a complex condition with a strong heritable component. In 2001, we published the first significant evidence of a genetic association between baldness and a synonymous coding SNP (rs6152) in the androgen receptor gene, AR. Recently, this finding was replicated in three independent studies, confirming an important role for AR in the baldness phenotype. In one such replication study, it was claimed that the causative variant underlying the association was likely to be the polyglycine (GGN) repeat polymorphism, one of two apparently functional triplet repeat polymorphisms located in the exon 1 transactivating domain of the gene. Here, we extend our original association finding and present comprehensive evidence from approximately 1,200 fathers and sons drawn from 703 families of the Victorian Family Heart Study, a general population Caucasian cohort, that neither exon 1 triplet repeat polymorphism is causative in this condition. Seventy-eight percent of fathers (531/683) and 30% of sons (157/520) were affected to some degree with AGA. We utilised statistical methods appropriate for the categorical nature of the phenotype and familial structure of the cohort, and determined that whilst SNP rs6152 was strongly associated with baldness (P baldness, but also for the many other complex conditions that have thus far been linked to AR.

  8. Peroxisome proliferator-activated receptor gamma (PPARγ) in brown trout: Interference of estrogenic and androgenic inputs in primary hepatocytes.

    Science.gov (United States)

    Lopes, Célia; Madureira, Tânia Vieira; Ferreira, Nádia; Pinheiro, Ivone; Castro, L Filipe C; Rocha, Eduardo

    2016-09-01

    Peroxisome proliferator-activated receptor gamma (PPARγ) is a pivotal regulator of lipid and glucose metabolism in vertebrates. Here, we isolated and characterized for the first time the PPARγ gene from brown trout (Salmo trutta f. fario). Hormones have been reported to interfere with the regulatory function of PPARγ in various organisms, albeit with little focus on fish. Thus, primary hepatocytes isolated from juveniles of brown trout were exposed to 1, 10 and 50μM of ethinylestradiol (EE2) or testosterone (T). A significant (3 fold) decrease was obtained in response to 50μM of EE2 and to 10 and 50μM of T (13 and 14 folds), while a 3 fold increase was observed at 1μM of EE2. Therefore, trout PPARγ seems a target for natural/synthetic compounds with estrogenic or androgenic properties and so, we advocate considering PPARγ as another alert sensor gene when assessing the effects of sex-steroid endocrine disruptors.

  9. Systematic structure-function analysis of androgen receptor Leu 701 mutants explains the properties of the prostate cancer mutant L701H

    NARCIS (Netherlands)

    D.J. van de Wijngaart (Dennis); M. Molier; S.J. Lusher (Scott); R. Hersmus (Remko); G.W. Jenster (Guido); J. Trapman (Hans); H.J. Dubbink (Erik Jan)

    2010-01-01

    textabstractOne mechanism of prostate tumors for escape from androgen ablation therapies is mutation of the androgen receptor (AR). Weinvestigated the unique properties of theARL701H mutant, which is strongly stimulated by cortisol, by a systematic structure-function analysis. Most amino acid substi

  10. Unusual specificity of the androgen receptor in the human prostate tumor cell line LNCaP: High affinity for progestagenic and estrogenic steroids

    NARCIS (Netherlands)

    J. Veldscholte (Jos); M.M. Voorhorst-Ogink (M.); J. Bolt-de Vries (Joan); H.C.J. van Rooij (Henri); J. Trapman (Jan); E. Mulder (Eppo)

    1990-01-01

    textabstractAbstract LNCaP tumor cells, derived from a metastatic lesion of a human prostatic carcinoma, are androgen-sensitive in cell culture. Although increase in growth rate is observed with low doses of progestagens or estradiol, these cells contain exclusively androgen receptors. In the presen

  11. NF-κB and androgen receptor variant expression correlate with human BPH progression

    DEFF Research Database (Denmark)

    Austin, David C; Strand, Douglas W; Love, Harold L;

    2016-01-01

    BACKGROUND: Benign prostatic hyperplasia (BPH) is a common, chronic progressive disease. Inflammation is associated with prostatic enlargement and resistance to 5α-reductase inhibitor (5ARI) therapy. Activation of the nuclear factor-kappa B (NF-κB) pathway is linked to both inflammation and ligand......-independent prostate cancer progression. METHODS: NF-κB activation and androgen receptor variant (AR-V) expression were quantified in transition zone tissue samples from patients with a wide range of AUASS from incidental BPH in patients treated for low grade, localized peripheral zone prostate cancer to advanced......-V expression as well as cellular growth and differentiation were assessed. RESULTS: Canonical NF-κB signaling was found to be upregulated in late versus early stage BPH, and to be strongly associated with non-insulin dependent diabetes mellitus. Elevated expression of AR-variant 7 (AR-V7), but not other AR...

  12. GENERATION OF MONOCLONAL ANTIBODY AGAINST HUMAN ANDROGEN RECEPTOR WITH SYNTHETIC PEPTIDE

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective: Preparation of anti-human androgen receptor(hAR) monoclonal antibody (McAb). Methods: Four cells lines of hybridoma secreting specific monoclonal antibodies against AR were first established by fusion SP2/0 cell with spleen cell from BALB/c mice immunized with the coupling complex of hAR-KLH. Results: Paraffin-embedded sections of 45 prostate cancers were detected. There was an overall concordance of 91% using Immunohistochemistry between AR polyclonal antibody from Zymed and hAR-N McAb selfmade. Conclusion: The results show that the McAb obtained in this study would be a useful tool to detect the AR status in prostate cancer.

  13. Long CAG repeat sequence and protein expression of androgen receptor considered as prognostic indicators in male breast carcinoma.

    Directory of Open Access Journals (Sweden)

    Yan-Ni Song

    Full Text Available BACKGROUND: The androgen receptor (AR expression and the CAG repeat length within the AR gene appear to be involved in the carcinogenesis of male breast carcinoma (MBC. Although phenotypic differences have been observed between MBC and normal control group in AR gene, there is lack of correlation analysis between AR expression and CAG repeat length in MBC. The purpose of the study was to investigate the prognostic value of CAG repeat lengths and AR protein expression. METHODS: 81 tumor tissues were used for immunostaining for AR expression and CAG repeat length determination and 80 normal controls were analyzed with CAG repeat length in AR gene. The CAG repeat length and AR expression were analyzed in relation to clinicopathological factors and prognostic indicators. RESULTS: AR gene in many MBCs has long CAG repeat sequence compared with that in control group (P = 0.001 and controls are more likely to exhibit short CAG repeat sequence than MBCs. There was statistically significant difference in long CAG repeat sequence between AR status for MBC patients (P = 0.004. The presence of long CAG repeat sequence and AR-positive expression were associated with shorter survival of MBC patients (CAG repeat: P = 0.050 for 5y-OS; P = 0.035 for 5y-DFS AR status: P = 0.048 for 5y-OS; P = 0.029 for 5y-DFS, respectively. CONCLUSION: The CAG repeat length within the AR gene might be one useful molecular biomarker to identify males at increased risk of breast cancer development. The presence of long CAG repeat sequence and AR protein expression were in relation to survival of MBC patients. The CAG repeat length and AR expression were two independent prognostic indicators in MBC patients.

  14. Design and synthesis of tricyclic tetrahydroquinolines as a new series of nonsteroidal selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Nagata, Naoya; Miyakawa, Motonori; Amano, Seiji; Furuya, Kazuyuki; Yamamoto, Noriko; Inoguchi, Kiyoshi

    2011-03-15

    Some tricyclic tetrahydroquinolines (THQs) were found to have the potential of a new series of nonsteroidal selective androgen receptor modulators (SARMs). Compound 5b was first designed and synthesized under our hypothesis based on a four-point pharmacophoric requirement of the 3-carbonyl, 18-methyl, 17-hydroxyl, and 13-quaternary carbon groups of dihydrotestosterone (DHT). It was revealed that this compound exhibits not only a strong androgen receptor (AR) agonistic activity (EC(50)=9.2 nM) but also the highest selectivity in binding affinity to AR among the steroid hormone receptors. Furthermore, this compound showed a weak virilizing effect with retention of the desired anabolic effect as compared with DHT in vivo.

  15. Stilbene induced inhibition of androgen receptor dimerization: implications for AR and ARΔLBD-signalling in human prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Wolfgang Streicher

    Full Text Available BACKGROUND: Advanced castration resistant prostate cancer (CRPC is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. METHODOLOGY: In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV and (E-4-(2, 6-Difluorostyryl-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. RESULTS: The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. CONCLUSION: RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors.

  16. Adenylyl cyclase activating polypeptide reduces phosphorylation and toxicity of the polyglutamine-expanded androgen receptor in spinobulbar muscular atrophy.

    Science.gov (Uni