WorldWideScience

Sample records for androgen modulated genes

  1. Complex modulation of androgen responsive gene expression by methoxyacetic acid

    Directory of Open Access Journals (Sweden)

    Stanley Kerri A

    2011-03-01

    Full Text Available Abstract Background Optimal androgen signaling is critical for testicular development and spermatogenesis. Methoxyacetic acid (MAA, the primary active metabolite of the industrial chemical ethylene glycol monomethyl ether, disrupts spermatogenesis and causes testicular atrophy. Transcriptional trans-activation studies have indicated that MAA can enhance androgen receptor activity, however, whether MAA actually impacts the expression of androgen-responsive genes in vivo, and which genes might be affected is not known. Methods A mouse TM3 Leydig cell line that stably expresses androgen receptor (TM3-AR was prepared and analyzed by transcriptional profiling to identify target gene interactions between MAA and testosterone on a global scale. Results MAA is shown to have widespread effects on androgen-responsive genes, affecting processes ranging from apoptosis to ion transport, cell adhesion, phosphorylation and transcription, with MAA able to enhance, as well as antagonize, androgenic responses. Moreover, testosterone is shown to exert both positive and negative effects on MAA gene responses. Motif analysis indicated that binding sites for FOX, HOX, LEF/TCF, STAT5 and MEF2 family transcription factors are among the most highly enriched in genes regulated by testosterone and MAA. Notably, 65 FOXO targets were repressed by testosterone or showed repression enhanced by MAA with testosterone; these include 16 genes associated with developmental processes, six of which are Hox genes. Conclusions These findings highlight the complex interactions between testosterone and MAA, and provide insight into the effects of MAA exposure on androgen-dependent processes in a Leydig cell model.

  2. Gene expression profile of androgen modulated genes in the murine fetal developing lung

    Directory of Open Access Journals (Sweden)

    Côté Mélissa

    2010-01-01

    Full Text Available Abstract Background Accumulating evidences suggest that sex affects lung development. Indeed, a higher incidence of respiratory distress syndrome is observed in male compared to female preterm neonates at comparable developmental stage and experimental studies demonstrated an androgen-related delay in male lung maturation. However, the precise mechanisms underlying these deleterious effects of androgens in lung maturation are only partially understood. Methods To build up a better understanding of the effect of androgens on lung development, we analyzed by microarrays the expression of genes showing a sexual difference and those modulated by androgens. Lungs of murine fetuses resulting from a timely mating window of 1 hour were studied at gestational day 17 (GD17 and GD18, corresponding to the period of surge of surfactant production. Using injections of the antiandrogen flutamide to pregnant mice, we hunted for genes in fetal lungs which are transcriptionally modulated by androgens. Results Results revealed that 1844 genes were expressed with a sexual difference at GD17 and 833 at GD18. Many genes were significantly modulated by flutamide: 1597 at GD17 and 1775 at GD18. Datasets were analyzed by using in silico tools for reconstruction of cellular pathways. Between GD17 and GD18, male lungs showed an intensive transcriptional activity of proliferative pathways along with the onset of lung differentiation. Among the genes showing a sex difference or an antiandrogen modulation of their expression, we specifically identified androgen receptor interacting genes, surfactant related genes in particularly those involved in the pathway leading to phospholipid synthesis, and several genes of lung development regulator pathways. Among these latter, some genes related to Shh, FGF, TGF-beta, BMP, and Wnt signaling are modulated by sex and/or antiandrogen treatment. Conclusion Our results show clearly that there is a real delay in lung maturation between

  3. SUMOylation modulates the transcriptional activity of androgen receptor in a target gene and pathway selective manner.

    Science.gov (United States)

    Sutinen, Päivi; Malinen, Marjo; Heikkinen, Sami; Palvimo, Jorma J

    2014-07-01

    Androgen receptor (AR) plays an important regulatory role in prostate cancer. AR's transcriptional activity is regulated by androgenic ligands, but also by post-translational modifications, such as SUMOylation. To study the role of AR SUMOylation in genuine chromatin environment, we compared androgen-regulated gene expression and AR chromatin occupancy in PC-3 prostate cancer cell lines stably expressing wild-type (wt) or doubly SUMOylation site-mutated AR (AR-K386R,K520R). Our genome-wide gene expression analyses reveal that the SUMOylation modulates the AR function in a target gene and pathway selective manner. The transcripts that are differentially regulated by androgen and SUMOylation are linked to cellular movement, cell death, cellular proliferation, cellular development and cell cycle. Fittingly, SUMOylation mutant AR cells proliferate faster and are more sensitive to apoptosis. Moreover, ChIP-seq analyses show that the SUMOylation can modulate the chromatin occupancy of AR on many loci in a fashion that parallels their differential androgen-regulated expression. De novo motif analyses reveal that FOXA1, C/EBP and AP-1 motifs are differentially enriched at the wtAR- and the AR-K386R,K520R-preferred genomic binding positions. Taken together, our data indicate that SUMOylation does not simply repress the AR activity, but it regulates AR's interaction with the chromatin and the receptor's target gene selection.

  4. Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.

    Science.gov (United States)

    Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao

    2009-11-01

    Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.

  5. Neural androgen receptors modulate gene expression and social recognition but not social investigation

    Directory of Open Access Journals (Sweden)

    Sara A Karlsson

    2016-03-01

    Full Text Available The role of sex and androgen receptors (ARs for social preference and social memory is rather unknown. In this study of mice we compared males, females and males lacking ARs specifically in the nervous system, ARNesDel, with respect to social preference, assessed with the three-chambered apparatus test, and social recognition, assessed with the social discrimination procedure. In the social discrimination test we also evaluated the tentative importance of the sex of the stimulus animal. Novel object recognition and olfaction were investigated to complement the results from the social tests. Gene expression analysis was performed to reveal molecules involved in the effects of sex and androgens on social behaviors. All three test groups showed social preference in the three-chambered apparatus test. In both social tests an AR-independent sexual dimorphism was seen in the persistence of social investigation of female conspecifics, whereas the social interest towards male stimuli mice was similar in all groups. Male and female controls recognized conspecifics independent of their sex, whereas ARNesDel males recognized female but not male stimuli mice. Moreover, the non-social behaviors were not affected by AR deficiency. The gene expression analyses of hypothalamus and amygdala indicated that Oxtr, Cd38, Esr1, Cyp19a1, Ucn3, Crh and Gtf2i were differentially expressed between the three groups. In conclusion, our results suggest that ARs are required for recognition of male but not female conspecifics, while being dispensable for social investigation towards both sexes. In addition, the AR seems to regulate genes related to oxytocin, estrogen and William’s syndrome.

  6. Expanding the therapeutic use of androgens via selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Gao, Wenqing; Dalton, James T

    2007-03-01

    Selective androgen receptor modulators (SARMs) are a novel class of androgen receptor (AR) ligands that might change the future of androgen therapy dramatically. With improved pharmacokinetic characteristics and tissue-selective pharmacological activities, SARMs are expected to greatly extend the clinical applications of androgens to osteoporosis, muscle wasting, male contraception and diseases of the prostate. Mechanistic studies with currently available SARMs will help to define the contributions of differential tissue distribution, tissue-specific expression of 5alpha-reductase, ligand-specific regulation of gene expression and AR interactions with tissue-specific coactivators to their observed tissue selectivity, and lead to even greater expansion of selective anabolic therapies.

  7. Development of selective androgen receptor modulators and their therapeutic applications.

    Science.gov (United States)

    Chen, Fang; Rodan, Gideon A; Schmidt, Azi

    2002-01-01

    Androgens control a broad range of physiological functions. The androgen receptor (AR), a steroid receptor that mediates the diverse biological actions of androgens, is a ligand inducible transcription factor. Abnormalities in the androgen signaling system result in many disturbances ranging from changes in gender determination and sexual development to psychiatric and emotional disorders. Androgen replacement therapy can improve many clinical conditions including hypogonadism and osteoporosis, but is limited by the lack of efficacious and safe therapeutic agents with easy delivery options. Recent progress in the area of gene regulation by steroid receptors and by selective receptor modulators provides an opportunity to examine if selective androgen receptor modulators (SARMs) could address some of the problems associated with current androgen therapy. Since the composition of the transcriptional initiation complex recruited by liganded AR determines the specificity of gene regulation, synthetic ligands aimed at initiating transcription of tissue and promoter specific genes offers hope for developing better androgen therapy. Establishment of assays that predict synthetic ligand activity is critical for SARM development. Advancement in high throughput compound screening and gene fingerprinting technologies, such as microarrays and proteomics, will facilitate and accelerate identification of effective SARMs.

  8. Enhanced evaluation of selective androgen receptor modulators in vivo.

    Science.gov (United States)

    Otto-Duessel, M; He, M; Adamson, T W; Jones, J O

    2013-01-01

    Selective androgen receptor modulators (SARMs) are a class of drugs that control the activity of the androgen receptor (AR), which mediates the response to androgens, in a tissue-selective fashion. They are specifically designed to reduce the possible complications that result from the systemic inhibition or activation of AR in patients with diseases that involve androgen signalling. However, there are no ideal in vivo models for evaluating candidate SARMs. Therefore, we created a panel of androgen-responsive genes in clinically relevant AR expressing tissues including prostate, skin, bone, fat, muscle, brain and kidney. We used select genes from this panel to compare transcriptional changes in response to the full agonist dihydrotestosterone (DHT) and the SARM bolandiol at 16 h and 6 weeks. We identified several genes in each tissue whose expression at each of these time points correlates with the known tissue-specific effects of these compounds. For example, in the prostate we found four genes whose expression was much lower in animals treated with bolandiol compared with animals treated with DHT for 6 weeks, which correlated well with differences in prostate weight. We demonstrate that adding molecular measurements (androgen-regulated gene expression) to the traditional physiological measurements (tissue weights, etc.) makes the evaluation of potential SARMs more accurate, thorough and perhaps more rapid by allowing measurement of selectivity after only 16 h of drug treatment.

  9. Discovery and therapeutic promise of selective androgen receptor modulators.

    Science.gov (United States)

    Chen, Jiyun; Kim, Juhyun; Dalton, James T

    2005-06-01

    Androgens are essential for male development and the maintenance of male secondary characteristics, such as bone mass, muscle mass, body composition, and spermatogenesis. The main disadvantages of steroidal androgens are their undesirable physicochemical and pharmacokinetic properties. The recent discovery of nonsteroidal selective androgen receptor modulators (SARMs) provides a promising alternative for testosterone replacement therapies with advantages including oral bioavailability, flexibility of structural modification, androgen receptor specificity, tissue selectivity, and the lack of steroid-related side effects.

  10. The Presence of Clitoromegaly in the Nonclassical Form of 21-Hydroxylase Deficiency Could Be Partially Modulated by the CAG Polymorphic Tract of the Androgen Receptor Gene

    Science.gov (United States)

    Garcia Gomes, Larissa; Bugano Diniz Gomes, Diogo; Marcondes, José Antônio Miguel; Madureira, Guiomar; de Mendonca, Berenice Bilharinho; Bachega, Tânia A. Sartori Sanchez

    2016-01-01

    Background In the nonclassical form (NC), good correlation has been observed between genotypes and 17OH-progesterone (17-OHP) levels. However, this correlation was not identified with regard to the severity of hyperandrogenic manifestations, which could depend on interindividual variability in peripheral androgen sensitivity. Androgen action is modulated by the polymorphic CAG tract (nCAG) of the androgen receptor (AR) gene and by polymorphisms in 5α-reductase type 2 (SRD5A2) enzyme, both of which are involved in the severity of hyperandrogenic disorders. Objectives To analyze whether nCAG-AR and SRD5A2 polymorphisms influence the severity of the nonclassical phenotype. Patients NC patients (n = 114) diagnosed by stimulated-17OHP ≥10 ng/mL were divided into groups according to the beginning of hyperandrogenic manifestations (pediatric and adolescent/adult) and CYP21A2 genotypes (C/C: homozygosis for mild mutations; A/C: compound heterozygosis for severe/mild mutations). Methods CYP21A2 mutations were screened by allelic-specific PCR, MLPA and/or sequencing. HpaII-digested and HpaII-undigested DNA samples underwent GeneScan analysis to study nCAG, and the SRD5A2 polymorphisms were screened by RLFP. Results Mean nCAG did not differ among pediatric, adolescent/adult and asymptomatic subjects. In the C/C genotype, we observed a significantly lower frequency of longer CAG alleles in pediatric patients than in adolescent/adults (p = 0.01). In patients carrying the A/C genotype, the frequencies of shorter and longer CAG alleles did not differ between pediatric patients and adolescent/adults (p>0.05). Patients with clitoromegaly had significantly lower weighted CAG biallelic mean than those without it: 19.1±2.7 and 21.6±2.5, respectively (p = 0.007), independent of the CYP21A2 genotype's severity. The SRD5A2 polymorphisms were not associated with the variability of hyperandrogenic NC phenotypes. Conclusions In this series, we observed a modulatory effect of the CAG

  11. Androgen receptor modulators: a marriage of chemistry and biology.

    Science.gov (United States)

    McEwan, Iain J

    2013-06-01

    Androgenic steroids are important for male development in utero and secondary sexual characteristics at puberty. In addition, androgens play a role in non-reproductive tissues, such as bone and muscle in both sexes. The actions of the androgens testosterone and dihydrotestosterone are mediated by a single receptor protein, the androgen receptor. Over the last 60-70 years there has been considerable research interest in the development of inhibitors of androgen receptor for the management of diseases such as prostate cancer. However, more recently, there is also a growing appreciation of the need for selective androgen modulators that would demonstrate tissue-selective agonist or antagonist activity. The chemistry and biology of selective agonists, antagonists and selective androgen receptor modulators will be discussed in this review.

  12. In vivo modulation of androgen receptor by androgens

    Institute of Scientific and Technical Information of China (English)

    V·L·Kumar; V·Kumar

    2002-01-01

    Aim:To study the effect of androgen and antiandrogen on the level of androgen receptor(AR)mRNA.Methods:The totalRNA was extracted from the prostate and analyzed by slot blot analysis,The blots were hybrid-ized with ARcDNA probe and 1Aprobe(internal control)and autoradionraphy was performed.The intensity of signal was measured with a densitometer and the ratio of AR RNAand1ARNAwas calculated.Results:Androgenic deprivation produced by castration decreased the weight of the prostate and increased the levels of ARmRNA.Treatment of the castrated rats with testostrone increased the weight of prostate and decreased the levels of ARmRNA.Treatment of normal rats with flutamide decreased the weight of the gland and increased the levels of AR mRNA.Conclusion:Androgens produce proliferative effect on the prostate and negatively regulate the AR transcription.

  13. Computational Investigation on the Allosteric Modulation of Androgen Receptor

    Institute of Scientific and Technical Information of China (English)

    OU Min-Rui; LI Jun-Qian

    2012-01-01

    Androgens have similar structures with different biological activities. To identify molecular determinants responsible for the activity difference, we have docked six steroidal androgens to the binding site or the surface of androgen receptor by using molecular docking with computational investigation. The energy was calculated respectively based on the QM (quantum mechanics) and MM (molecular mechanics) methods. The result shows that the allosteric modulation of androgen receptor plays an important role in the binding process between androgens and receptor. The open state receptor is less stable than the close state one, but the latter is more favorable for binding with androgens. It is worthy of note that when the androgen receptors binding or without binding with androgen are in close state, they are difficult to return to their open state. This phenomenon is an exception of the well known two-state model theory in which the two states are reversible. Whether the internal of close state androgen receptor has a combination of androgen or not, the androgen receptor surface can be combined with another androgen, and their surface binding energies could be very close. The result is consistent with the experimental observations, but this phenomenon of continuous combination from open state is also an exception of the two-state model theory.

  14. Selective androgen receptor modulators: in pursuit of tissue-selective androgens.

    Science.gov (United States)

    Omwancha, Josephat; Brown, Terry R

    2006-10-01

    The androgen receptor mediates the androgenic and anabolic activity of the endogenous steroids testosterone and 5alpha-dihydrotestosterone. Current knowledge of the androgen receptor protein structure, and the molecular mechanisms surrounding the binding properties and activities of agonists and antagonists has led to the design and development of novel nonsteroidal ligands with selected tissue-specific androgen receptor agonist and antagonist activities. The activity of these compounds, termed selective androgen receptor modulators (SARMs), is directed toward the maintenance or enhancement of anabolic effects on bone and muscle with minimal androgenic effects on prostate growth. SARMs are of potential therapeutic value in the treatment of male hypogonadism, osteoporosis, frailty and muscle wasting, burn injury and would healing, anemia, mood and depression, benign prostatic hyperplasia and prostate cancer.

  15. Selective androgen receptor modulators as improved androgen therapy for advanced breast cancer.

    Science.gov (United States)

    Coss, Christopher C; Jones, Amanda; Dalton, James T

    2014-11-01

    Androgens were at one time a therapeutic mainstay in the treatment of advanced breast cancer. Despite comparable efficacy, SERMs and aromatase inhibitors eventually became the therapies of choice due to in part to preferred side-effect profiles. Molecular characterization of breast tumors has revealed an abundance of androgen receptor expression but the choice of an appropriate androgen receptor ligand (agonist or antagonist) has been confounded by multiple conflicting reports concerning the role of the receptor in the disease. Modern clinical efforts have almost exclusively utilized antagonists. However, the recent clinical development of selective androgen receptor modulators with greatly improved side-effect profiles has renewed interest in androgen agonist therapy for advanced breast cancer.

  16. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  17. Selective androgen receptor modulators for frailty and osteoporosis.

    Science.gov (United States)

    Kilbourne, Edward J; Moore, William J; Freedman, Leonard P; Nagpal, Sunil

    2007-10-01

    Androgens play an important role not only in male sexual differentiation, puberty, sexual behavior and spermatogenesis, but also in the maintenance of bone architecture and muscle mass and strength. For decades, steroidal androgens have been used by hypogonadal and aging men as hormone replacement therapy, and abused by prominent athletes as anabolic agents for enhancing physical performance. The use of steroidal androgens is associated with hepatotoxicity, potential for prostate stimulation, virilizing actions and other side effects resulting from their cross-reactivity to related steroid receptors. Therefore, to utilize the therapeutic potential of the androgen receptor for the treatment of indications such as osteoporosis and frailty, several pharmaceutical and biotechnology companies are developing non-steroidal tissue-selective androgen receptor modulators (SARMs) that retain the beneficial properties of natural androgens and exhibit better therapeutic indices. This article reviews the mechanism of androgen action, novel non-steroidal ligands under development and future directions of SARM research for the discovery of novel modulators for frailty and osteoporosis.

  18. [Bone and Men's Health. Bone selective androgen receptor modulators].

    Science.gov (United States)

    Furuya, Kazuyuki

    2010-02-01

    Androgen, one of the sex steroid hormones shows various biological activities on the corresponding various tissues. Many efforts to produce novel drug materials maintaining a desired biological activity with an adequate tissue selectivity, which is so-called selective androgen receptor modulators (SARMs) , are being performed. As one of such efforts, studies on SARMs against bone tissues which possess a significant potential to stimulate a bone formation with reducing undesirable androgenic virilizing activities are in progress all over the world. This review focuses on the research and development activities of such SARMs and discuses their usefulness for the treatment of osteoporosis.

  19. Androgen receptor gene polymorphism in zebra species

    Directory of Open Access Journals (Sweden)

    Hideyuki Ito

    2015-09-01

    Full Text Available Androgen receptor genes (AR have been found to have associations with reproductive development, behavioral traits, and disorders in humans. However, the influence of similar genetic effects on the behavior of other animals is scarce. We examined the loci AR glutamine repeat (ARQ in 44 Grevy's zebras, 23 plains zebras, and three mountain zebras, and compared them with those of domesticated horses. We observed polymorphism among zebra species and between zebra and horse. As androgens such as testosterone influence aggressiveness, AR polymorphism among equid species may be associated with differences in levels of aggression and tameness. Our findings indicate that it would be useful to conduct further studies focusing on the potential association between AR and personality traits, and to understand domestication of equid species.

  20. Identification of androgen-responsive genes that are alternatively regulated in androgen-dependent and androgen-independent rat prostate tumors.

    NARCIS (Netherlands)

    Pfundt, R.; Smit, F.P.; Jansen, Corine; Aalders, T.W.; Straatman, H.M.P.M.; Vliet, W. van der; Isaacs, J.; Geurts van Kessel, A.H.M.; Schalken, J.A.

    2005-01-01

    The vast majority of androgen-dependent prostate tumors progress toward incurable, androgen-independent tumors. The identification of androgen-responsive genes, which are still actively transcribed in the tumors of patients who have undergone androgen ablation, may shed light on the molecular mechan

  1. Identification of an anabolic selective androgen receptor modulator that actively induces death of androgen-independent prostate cancer cells.

    Science.gov (United States)

    Schmidt, Azriel; Meissner, Robert S; Gentile, Michael A; Chisamore, Michael J; Opas, Evan E; Scafonas, Angela; Cusick, Tara E; Gambone, Carlo; Pennypacker, Brenda; Hodor, Paul; Perkins, James J; Bai, Chang; Ferraro, Damien; Bettoun, David J; Wilkinson, Hilary A; Alves, Stephen E; Flores, Osvaldo; Ray, William J

    2014-09-01

    Prostate cancer (PCa) initially responds to inhibition of androgen receptor (AR) signaling, but inevitably progresses to hormone ablation-resistant disease. Much effort is focused on optimizing this androgen deprivation strategy by improving hormone depletion and AR antagonism. However we found that bicalutamide, a clinically used antiandrogen, actually resembles a selective AR modulator (SARM), as it partially regulates 24% of endogenously 5α-dihydrotestosterone (DHT)-responsive genes in AR(+) MDA-MB-453 breast cancer cells. These data suggested that passive blocking of all AR functions is not required for PCa therapy. Hence, we adopted an active strategy that calls for the development of novel SARMs, which induce a unique gene expression profile that is intolerable to PCa cells. Therefore, we screened 3000 SARMs for the ability to arrest the androgen-independent growth of AR(+) 22Rv1 and LNCaP PCa cells but not AR(-) PC3 or DU145 cells. We identified only one such compound; the 4-aza-steroid, MK-4541, a potent and selective SARM. MK-4541 induces caspase-3 activity and cell death in both androgen-independent, AR(+) PCa cell lines but spares AR(-) cells or AR(+) non-PCa cells. This activity correlates with its promoter context- and cell-type dependent transcriptional effects. In rats, MK-4541 inhibits the trophic effects of DHT on the prostate, but not the levator ani muscle, and triggers an anabolic response in the periosteal compartment of bone. Therefore, MK-4541 has the potential to effectively manage prostatic hypertrophic diseases owing to its antitumor SARM-like mechanism, while simultaneously maintaining the anabolic benefits of natural androgens.

  2. Design and synthesis of an array of selective androgen receptor modulators.

    Science.gov (United States)

    Trump, Ryan P; Blanc, Jean-Baptiste E; Stewart, Eugene L; Brown, Peter J; Caivano, Matilde; Gray, David W; Hoekstra, William J; Willson, Timothy M; Han, Bajin; Turnbull, Philip

    2007-01-01

    We describe the design, using shape comparison and fast docking computer algorithms, and rapid parallel synthesis of a 1300 member array based on GSK7721, a 4-aminobenzonitrile androgen receptor (AR) antagonist identified by focused screening of the GSK compound collection. The array yielded 352 submicromolar and 17 subnanomolar AR agonists as measured by a cell-based reporter gene functional assay. The rapid synthesis of a large number of active compounds provided valuable information in the optimization of AR modulators, which may be useful in treating androgen deficiency in aging males.

  3. Optimizing Ligand Efficiency of Selective Androgen Receptor Modulators (SARMs).

    Science.gov (United States)

    Handlon, Anthony L; Schaller, Lee T; Leesnitzer, Lisa M; Merrihew, Raymond V; Poole, Chuck; Ulrich, John C; Wilson, Joseph W; Cadilla, Rodolfo; Turnbull, Philip

    2016-01-14

    A series of selective androgen receptor modulators (SARMs) containing the 1-(trifluoromethyl)benzyl alcohol core have been optimized for androgen receptor (AR) potency and drug-like properties. We have taken advantage of the lipophilic ligand efficiency (LLE) parameter as a guide to interpret the effect of structural changes on AR activity. Over the course of optimization efforts the LLE increased over 3 log units leading to a SARM 43 with nanomolar potency, good aqueous kinetic solubility (>700 μM), and high oral bioavailability in rats (83%).

  4. Design, Synthesis, and Preclinical Characterization of the Selective Androgen Receptor Modulator (SARM) RAD140.

    Science.gov (United States)

    Miller, Chris P; Shomali, Maysoun; Lyttle, C Richard; O'Dea, Louis St L; Herendeen, Hillary; Gallacher, Kyla; Paquin, Dottie; Compton, Dennis R; Sahoo, Bishwabhusan; Kerrigan, Sean A; Burge, Matthew S; Nickels, Michael; Green, Jennifer L; Katzenellenbogen, John A; Tchesnokov, Alexei; Hattersley, Gary

    2011-02-10

    This report describes the discovery of RAD140, a potent, orally bioavailable, nonsteroidal selective androgen receptor modulator (SARM). The characterization of RAD140 in several preclinical models of anabolic androgen action is also described.

  5. Enobosarm (GTx-024) Modulates Adult Skeletal Muscle Mass Independently of the Androgen Receptor in the Satellite Cell Lineage.

    Science.gov (United States)

    Dubois, Vanessa; Simitsidellis, Ioannis; Laurent, Michaël R; Jardi, Ferran; Saunders, Philippa T K; Vanderschueren, Dirk; Claessens, Frank

    2015-12-01

    Androgens increase skeletal muscle mass, but their clinical use is hampered by a lack of tissue selectivity and subsequent side effects. Selective androgen receptor modulators elicit muscle-anabolic effects while only sparingly affecting reproductive tissues. The selective androgen receptor modulator, GTx-024 (enobosarm), is being investigated for cancer cachexia, sarcopenia, and muscle wasting diseases. Here we investigate the role of muscle androgen receptor (AR) in the anabolic effect of GTx-024. In mice lacking AR in the satellite cell lineage (satARKO), the weight of the androgen-sensitive levator ani muscle was lower but was decreased further upon orchidectomy. GTx-024 was as effective as DHT in restoring levator ani weights to sham levels. Expression of the muscle-specific, androgen-responsive genes S-adenosylmethionine decarboxylase and myostatin was decreased by orchidectomy and restored by GTx-024 and DHT in control mice, whereas the expression was low and unaffected by androgen status in satARKO. In contrast, insulin-like growth factor 1Ea expression was not different between satARKO and control muscle, decreased upon castration, and was restored by DHT and GTx-024 in both genotypes. These data indicate that GTx-024 does not selectively modulate AR in the satellite cell lineage and that cells outside this lineage remain androgen responsive in satARKO muscle. Indeed, residual AR-positive cells were present in satARKO muscle, coexpressing the fibroblast-lineage marker vimentin. AR positive, muscle-resident fibroblasts could therefore be involved in the indirect effects of androgens on muscle. In conclusion, both DHT and GTx-024 target AR pathways in the satellite cell lineage, but cells outside this lineage also contribute to the anabolic effects of androgens.

  6. Synthetic anabolic agents: steroids and nonsteroidal selective androgen receptor modulators.

    Science.gov (United States)

    Thevis, Mario; Schänzer, Wilhelm

    2010-01-01

    The central role of testosterone in the development of male characteristics, as well as its beneficial effects on physical performance and muscle growth, has led to the search for synthetic alternatives with improved pharmacological profiles. Hundreds of steroidal analogs have been prepared with a superior oral bioavailability, which should also possess reduced undesirable effects. However, only a few entered the pharmaceutical market due to severe toxicological incidences that were mainly attributed to the lack of tissue selectivity. Prominent representatives of anabolic-androgenic steroids (AAS) are for instance methyltestosterone, metandienone and stanozolol, which are discussed as model compounds with regard to general pharmacological aspects of synthetic AAS. Recently, nonsteroidal alternatives to AAS have been developed that selectively activate the androgen receptor in either muscle tissue or bones. These so-called selective androgen receptor modulators (SARMs) are currently undergoing late clinical trials (IIb) and will be prohibited by the World Anti-Doping Agency from January 2008. Their entirely synthetic structures are barely related to steroids, but particular functional groups allow for the tissue-selective activation or inhibition of androgen receptors and, thus, the stimulation of muscle growth without the risk of severe undesirable effects commonly observed in steroid replacement therapies. Hence, these compounds possess a high potential for misuse in sports and will be the subject of future doping control assays.

  7. Androgen deprivation modulates the inflammatory response induced by irradiation

    Directory of Open Access Journals (Sweden)

    Lin Paul-Yang

    2009-03-01

    Full Text Available Abstract Background The aim of this study was to determine whether radiation (RT-induced inflammatory responses and organ damage might be modulated by androgen deprivation therapies. Methods The mRNA and tissue sections obtained from the lungs, intestines and livers of irradiated mice with or without androgen deprivation were analyzed by real-time PCR and histological analysis. Activation of NF-kappa B was examined by measuring nuclear protein levels in the intestine and lung 24 h after irradiation. We also examined the levels of cyclooxygenase-2 (COX-2, TGF-β1 and p-AKT to elucidate the related pathway responsible to irradiation (RT -induced fibrosis. Results We found androgen deprivation by castration significantly augmented RT-induced inflammation, associated with the increase NF-κB activation and COX-2 expression. However, administration of flutamide had no obvious effect on the radiation-induced inflammation response in the lung and intestine. These different responses were probably due to the increase of RT-induced NF-κB activation and COX-2 expression by castration or lupron treatment. In addition, our data suggest that TGF-β1 and the induced epithelial-mesenchymal transition (EMT via the PI3K/Akt signaling pathway may contribute to RT-induced fibrosis. Conclusion When irradiation was given to patients with total androgen deprivation, the augmenting effects on the RT-induced inflammation and fibrosis should take into consideration for complications associated with radiotherapy.

  8. Androgen receptor gene mutation, rearrangement, polymorphism.

    Science.gov (United States)

    Eisermann, Kurtis; Wang, Dan; Jing, Yifeng; Pascal, Laura E; Wang, Zhou

    2013-09-01

    Genetic aberrations of the androgen receptor (AR) caused by mutations, rearrangements, and polymorphisms result in a mutant receptor that has varied functions compared to wild type AR. To date, over 1,000 mutations have been reported in the AR with most of these being associated with androgen insensitivity syndrome (AIS). While mutations of AR associated with prostate cancer occur less often in early stage localized disease, mutations in castration-resistant prostate cancer (CRPC) patients treated with anti-androgens occur more frequently with 10-30% of these patients having some form of mutation in the AR. Resistance to anti-androgen therapy usually results from gain-of-function mutations in the LBD such as is seen with bicalutamide and more recently with enzalutamide (MDV3100). Thus, it is crucial to investigate these new AR mutations arising from drug resistance to anti-androgens and other small molecule pharmacological agents.

  9. Nonsteroidal selective androgen receptor modulators enhance female sexual motivation.

    Science.gov (United States)

    Jones, Amanda; Hwang, Dong Jin; Duke, Charles B; He, Yali; Siddam, Anjaiah; Miller, Duane D; Dalton, James T

    2010-08-01

    Women experience a decline in estrogen and androgen levels after natural or surgically induced menopause, effects that are associated with a loss of sexual desire and bone mineral density. Studies in our laboratories have shown the beneficial effects of selective androgen receptor modulators (SARMs) in the treatment of osteoporosis and muscle wasting in animal models. A series of S-3-(phenoxy)-2-hydroxy-2-methyl-N-(4-cyano-3-trifluoromethyl-phenyl)-propionamide analogs was synthesized to evaluate the effects of B-ring substitutions on in vitro and in vivo pharmacologic activity, especially female sexual motivation. The androgen receptor (AR) relative binding affinities ranged from 0.1 to 26.5% (relative to dihydrotestosterone) and demonstrated a range of agonist activity at 100 nM. In vivo pharmacologic activity was first assessed by using male rats. Structural modifications to the B-ring significantly affected the selectivity of the SARMs, demonstrating that single-atom substitutions can dramatically and unexpectedly influence activity in androgenic (i.e., prostate) and anabolic (i.e., muscle) tissues. (S)-N-(4-cyano-3-trifluoromethyl-phenyl)-3-(3-fluoro,4-chlorophenoxy)-2-hydroxy-2-methyl-propanamide (S-23) displayed full agonist activity in androgenic and anabolic tissues; however, the remaining SARMs were more prostate-sparing, selectively maintaining the size of the levator ani muscle in castrated rats. The partner-preference paradigm was used to evaluate the effects of SARMs on female sexual motivation. With the exception of two four-halo substituted analogs, the SARMs increased sexual motivation in ovariectomized rats, with potency and efficacy comparable with testosterone propionate. These results indicate that the AR is important in regulating female libido given the nonaromatizable nature of SARMs and it could be a superior alternative to steroidal testosterone preparations in the treatment of hypoactive sexual desire disorder.

  10. Androgens regulate gene expression in avian skeletal muscles.

    Directory of Open Access Journals (Sweden)

    Matthew J Fuxjager

    Full Text Available Circulating androgens in adult reproductively active male vertebrates influence a diversity of organ systems and thus are considered costly. Recently, we obtained evidence that androgen receptors (AR are expressed in several skeletal muscles of three passeriform birds, the golden-collared manakin (Manacus vitellinus, zebra finch (Taenopygia guttata, and ochre-bellied flycatcher (Mionectes oleagieus. Because skeletal muscles that control wing movement make up the bulk of a bird's body mass, evidence for widespread effects of androgen action on these muscles would greatly expand the functional impact of androgens beyond their well-characterized effects on relatively discrete targets throughout the avian body. To investigate this issue, we use quantitative PCR (qPCR to determine if androgens alter gene mRNA expression patterns in wing musculature of wild golden-collared manakins and captive zebra finches. In manakins, the androgen testosterone (T up-regulated expression of parvalbumin (PV and insulin-like growth factor I (IGF-I, two genes whose products enhance cellular Ca(2+ cycling and hypertrophy of skeletal muscle fibers. In T-treated zebra finches, the anti-androgen flutamide blunted PV and IGF-I expression. These results suggest that certain transcriptional effects of androgen action via AR are conserved in passerine skeletal muscle tissue. When we examined wing muscles of manakins, zebra finches and ochre-bellied flycatchers, we found that expression of PV and IGF-I varied across species and in a manner consistent with a function for AR-dependent gene regulation. Together, these findings imply that androgens have the potential to act on avian muscle in a way that may enhance the physicality required for successful reproduction.

  11. Expression of androgen receptor target genes in skeletal muscle

    OpenAIRE

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR)-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (ARΔZF2 ) versus w...

  12. Hydrogen sulfide represses androgen receptor transactivation by targeting at the second zinc finger module.

    Science.gov (United States)

    Zhao, Kexin; Li, Shuangshuang; Wu, Lingyun; Lai, Christopher; Yang, Guangdong

    2014-07-25

    Androgen receptor (AR) signaling is indispensable for the development of prostate cancer from the initial androgen-dependent state to a later aggressive androgen-resistant state. This study examined the role of hydrogen sulfide (H(2)S), a novel gasotransmitter, in the regulation of AR signaling as well as its mediation in androgen-independent cell growth in prostate cancer cells. Here we found that H(2)S inhibits cell proliferation of both androgen-dependent (LNCaP) and antiandrogen-resistant prostate cancer cells (LNCaP-B), with more significance on the latter, which was established by long term treatment of parental LNCaP cells with bicalutamide. The expression of cystathionine γ-lyase (CSE), a major H(2)S producing enzyme in prostate tissue, was reduced in both human prostate cancer tissues and LNCaP-B cells. LNCaP-B cells were resistant to bicalutamide-induced cell growth inhibition, and CSE overexpression could rebuild the sensitivity of LNCaP-B cells to bicalutamide. H(2)S significantly repressed the expression of prostate-specific antigen (PSA) and TMPRSS2, two AR-targeted genes. In addition, H(2)S inhibited AR binding with PSA promoter and androgen-responsive element (ARE) luciferase activity. We further found that AR is post-translationally modified by H(2)S through S-sulfhydration. Mutation of cysteine 611 and cysteine 614 in the second zinc finger module of AR-DNA binding domain diminished the effects of H(2)S on AR S-sulfhydration and AR dimerization. These data suggest that reduced CSE/H2S signaling contributes to antiandrogen-resistant status, and sufficient level of H(2)S is able to inhibit AR transactivation and treat castration-resistant prostate cancer.

  13. Identification of anabolic selective androgen receptor modulators with reduced activities in reproductive tissues and sebaceous glands.

    Science.gov (United States)

    Schmidt, Azriel; Harada, Shun-Ichi; Kimmel, Donald B; Bai, Chang; Chen, Fang; Rutledge, Su Jane; Vogel, Robert L; Scafonas, Angela; Gentile, Michael A; Nantermet, Pascale V; McElwee-Witmer, Sheila; Pennypacker, Brenda; Masarachia, Patricia; Sahoo, Soumya P; Kim, Yuntae; Meissner, Robert S; Hartman, George D; Duggan, Mark E; Rodan, Gideon A; Towler, Dwight A; Ray, William J

    2009-12-25

    Androgen replacement therapy is a promising strategy for the treatment of frailty; however, androgens pose risks for unwanted effects including virilization and hypertrophy of reproductive organs. Selective Androgen Receptor Modulators (SARMs) retain the anabolic properties of androgens in bone and muscle while having reduced effects in other tissues. We describe two structurally similar 4-aza-steroidal androgen receptor (AR) ligands, Cl-4AS-1, a full agonist, and TFM-4AS-1, which is a SARM. TFM-4AS-1 is a potent AR ligand (IC(50), 38 nm) that partially activates an AR-dependent MMTV promoter (55% of maximal response) while antagonizing the N-terminal/C-terminal interaction within AR that is required for full receptor activation. Microarray analyses of MDA-MB-453 cells show that whereas Cl-4AS-1 behaves like 5alpha-dihydrotestosterone (DHT), TFM-4AS-1 acts as a gene-selective agonist, inducing some genes as effectively as DHT and others to a lesser extent or not at all. This gene-selective agonism manifests as tissue-selectivity: in ovariectomized rats, Cl-4AS-1 mimics DHT while TFM-4AS-1 promotes the accrual of bone and muscle mass while having reduced effects on reproductive organs and sebaceous glands. Moreover, TFM-4AS-1 does not promote prostate growth and antagonizes DHT in seminal vesicles. To confirm that the biochemical properties of TFM-4AS-1 confer tissue selectivity, we identified a structurally unrelated compound, FTBU-1, with partial agonist activity coupled with antagonism of the N-terminal/C-terminal interaction and found that it also behaves as a SARM. TFM-4AS-1 and FTBU-1 represent two new classes of SARMs and will allow for comparative studies aimed at understanding the biophysical and physiological basis of tissue-selective effects of nuclear receptor ligands.

  14. Discovery of diarylhydantoins as new selective androgen receptor modulators.

    Science.gov (United States)

    Nique, François; Hebbe, Séverine; Peixoto, Christophe; Annoot, Denis; Lefrançois, Jean-Michel; Duval, Eric; Michoux, Laurence; Triballeau, Nicolas; Lemoullec, Jean-Michel; Mollat, Patrick; Thauvin, Maxime; Prangé, Thierry; Minet, Dominique; Clément-Lacroix, Philippe; Robin-Jagerschmidt, Catherine; Fleury, Damien; Guédin, Denis; Deprez, Pierre

    2012-10-11

    A novel selective androgen receptor modulator scaffold has been discovered through structural modifications of hydantoin antiandrogens. Several 4-(4-hydroxyphenyl)-N-arylhydantoins displayed partial agonism with nanomolar in vitro potency in transactivation experiments using androgen receptor (AR) transfected cells. In a standard castrated male rat model, several compounds showed good anabolic activity on levator ani muscle, dissociated from the androgenic activity on ventral prostate, after oral dosing at 30 mg/kg. (+)-4-[3,4-Dimethyl-2,5-dioxo-4-(4-hydroxyphenyl)imidazolidin-1-yl]-2-(trifluoromethyl)benzonitrile ((+)-11b) displayed anabolic potency with a strong dissociation between levator ani muscle and ventral prostate (A(50) = 0.5 mg/kg vs 70 mg/kg). The binding modes of two compounds, including (+)-11b, within the AR ligand-binding domain have been studied by cocrystallization experiments using a coactivator-like peptide. Both compounds bound to the same site, and the overall structures of the AR were very similar.

  15. Androgen insensitivity syndrome: do trinucleotide repeats in androgen receptor gene have any role?

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Nalini J. Gupta; Baidyanath Chakravarty; Lalji Singh; Kumarasamy Thangaraj

    2008-01-01

    Aim: To investigate the role of CAG and GGN repeats as genetic background affecting androgen insensitivity syn- drome (AIS) phenotype. Methods: We analyzed lengths of androgen receptor (AR)-CAG and GGN repeats in 69 AIS cases, along with 136 unrelated normal male individuals. The lengths of repeats were analyzed using polymerase chain reaction (PCR) amplification followed by allelic genotyping to determine allele length. Results: Our study revealed significantly shorter mean lengths of CAG repeats in patients (mean 18.25 repeats, range 14-26 repeats) in comparison to the controls (mean 22.57 repeats, range 12-39 repeats) (two-tailed P < 0.0001). GGN repeats, however, did not differ significantly between patients (mean 21.48 repeats) and controls (mean 21.21 repeats) (two- tailed P = 0.474). Among patients' groups, the mean number of CAG repeats in partial androgen insensitivity cases (mean 15.83 repeats) was significantly less than in complete androgen insensitivity cases (mean 19.46 repeats) (two- tailed P < 0.0001). Conclusion: The findings suggest that shorter lengths of repeats in the AR gene might act as low penetrance genetic background in varying manifestation of androgen insensitivity. (Asian J Androl 2008 Jul; 10: 616-624)

  16. Recent developments in antiandrogens and selective androgen receptor modulators.

    Science.gov (United States)

    Haendler, Bernard; Cleve, Arwed

    2012-04-16

    The androgens testosterone and dihydrotestosterone play an essential role in the development and maintenance of primary and secondary male characteristics. Androgens bind to a specific androgen receptor (AR), a ligand-dependent transcription factor which controls the expression of a large number of downstream target genes. The AR is an essential player in early and late prostate cancer, and may also be involved in some forms of breast cancer. It also represents a drug target for the treatment of hypogonadism. Recent studies furthermore indicate that targeting the AR in pathologies such as frailty syndrome, cachexia or polycystic ovary syndrome may have clinical benefit. Numerous AR ligands with very different pharmacological properties have been identified in the last 40 years and helped to treat several of these diseases. However, progress still needs to be made in order to find compounds with an improved profile with regard to efficacy, differentiation and side-effects. This will only be achieved through a better understanding of the mechanisms involved in normal and aberrant AR signaling.

  17. A competitive inhibitor that reduces recruitment of androgen receptor to androgen-responsive genes.

    Science.gov (United States)

    Cherian, Milu T; Wilson, Elizabeth M; Shapiro, David J

    2012-07-01

    The androgen receptor (AR) has a critical role in the growth and progression of androgen-dependent and castration-resistant prostate cancers. To identify novel inhibitors of AR transactivation that block growth of prostate cancer cells, a luciferase-based high-throughput screen of ~160,000 small molecules was performed in cells stably expressing AR and a prostate-specific antigen (PSA)-luciferase reporter. CPIC (1-(3-(2-chlorophenoxy) propyl)-1H-indole-3-carbonitrile) was identified as a small molecule that blocks AR transactivation to a greater extent than other steroid receptors. CPIC inhibited AR-mediated proliferation of androgen-sensitive prostate cancer cell lines, with minimal toxicity in AR-negative cell lines. CPIC treatment also reduced the anchorage-independent growth of LAPC-4 prostate cancer cells. CPIC functioned as a pure antagonist by inhibiting the expression of AR-regulated genes in LAPC-4 cells that express wild-type AR and exhibited weak agonist activity in LNCaP cells that express the mutant AR-T877A. CPIC treatment did not reduce AR levels or alter its nuclear localization. We used chromatin immunoprecipitation to identify the site of action of CPIC. CPIC inhibited recruitment of androgen-bound AR to the PSA promoter and enhancer sites to a greater extent than bicalutamide. CPIC is a new therapeutic inhibitor that targets AR-mediated gene activation with potential to arrest the growth of prostate cancer.

  18. Androgen regulation of the TMPRSS2 gene and the effect of a SNP in an androgen response element.

    Science.gov (United States)

    Clinckemalie, Liesbeth; Spans, Lien; Dubois, Vanessa; Laurent, Michaël; Helsen, Christine; Joniau, Steven; Claessens, Frank

    2013-12-01

    More than 50% of prostate cancers have undergone a genomic reorganization that juxtaposes the androgen-regulated promoter of TMPRSS2 and the protein coding parts of several ETS oncogenes. These gene fusions lead to prostate-specific and androgen-induced ETS expression and are associated with aggressive lesions, poor prognosis, and early-onset prostate cancer. In this study, we showed that an enhancer at 13 kb upstream of the TMPRSS2 transcription start site is crucial for the androgen regulation of the TMPRSS2 gene when tested in bacterial artificial chromosomal vectors. Within this enhancer, we identified the exact androgen receptor binding sequence. This newly identified androgen response element is situated next to two binding sites for the pioneer factor GATA2, which were identified by DNase I footprinting. Both the androgen response element and the GATA-2 binding sites are involved in the enhancer activity. Importantly, a single nucleotide polymorphism (rs8134378) within this androgen response element reduces binding and transactivation by the androgen receptor. The presence of this SNP might have implications on the expression and/or formation levels of TMPRSS2 fusions, because both have been shown to be influenced by androgens.

  19. Development of an androgen reporter gene assay (AR-LUX) utilizing a human cell line with an endogenously regulated androgen receptor.

    Science.gov (United States)

    Blankvoort, B M; de Groene, E M; van Meeteren-Kreikamp, A P; Witkamp, R F; Rodenburg, R J; Aarts, J M

    2001-11-01

    The aim of the work described in this report is to develop and characterize a cell-based androgen reporter assay. For this purpose, the androgen receptor (AR) expressing human breast cancer cell line T47D was stably transfected with a luciferase gene under transcriptional control of the PB-ARE-2 androgen response element. The application of this cell line in an endogenous Androgen Receptor-mediated LUciferase eXpression assay (AR-LUX) was validated. An EC50 value of 86 pM was determined for the standard androgen R1881 with a detection limit of 46 pM. Other androgens like dihydrotestosterone, 17beta-trenbolone, and bolasterone also induced luciferase expression, while anti-androgens suppressed these responses. As expected, AR-mediated responses were also elicited by high concentrations of the steroids progesterone, 17beta-estradiol, d-aldosterone, and dexamethasone, with observed EC50 values 10 to 350,000 times higher than that for R1881. A unique feature of the AR-LUX assay is that effects on modulation of active endogenous AR-levels are reliably reflected in the luciferase induction response, as exemplified by vitamin D, all-trans-retinoic acid, epigallocatechin gallate, and forskolin. This feature is especially useful when assessing complex mixtures, e.g., environmental samples or natural compound libraries. From these data it is concluded that the AR-LUX assay is a reliable in vitro test system for the detection and quantification of AR-mediated biological effects. The 96-well plate format makes the assay particularly suitable for high-throughput screening.

  20. Expression of androgen receptor target genes in skeletal muscle

    Directory of Open Access Journals (Sweden)

    Kesha Rana

    2014-10-01

    Full Text Available We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (ARΔZF2 versus wildtype mice, demonstrating that myogenin is repressed by the androgen/AR pathway. The ubiquitin ligase Fbxo32 was repressed by 12 h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, and c-Myc expression was decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR∆ZF2 muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7 , p57 Kip2, Igf2 and calcineurin Aa, was increased in AR∆ZF2 muscle, and the expression of all but p57 Kip2 was also decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase-mediated atrophy pathways to preserve muscle mass in adult muscle.

  1. Expression of androgen receptor target genes in skeletal muscle

    Institute of Scientific and Technical Information of China (English)

    Kesha Rana; Nicole KL Lee; Jeffrey D Zajac; Helen E MacLean

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor(AR)‑regulated genes ininvitroandinvivomodels. The expression of the myogenic regulatory factormyogenin was signiifcantly decreased in skeletal muscle from testosterone‑treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity(ARΔZF2) versus wildtype mice, demonstrating thatmyogenin is repressed by the androgen/AR pathway. The ubiquitin ligaseFbxo32 was repressed by 12h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, andc‑Myc expression was decreased in testosterone‑treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR∆ZF2 muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7, p57Kip2, Igf2 andcalcineurin Aa, was increased in AR∆ZF2 muscle, and the expression of all butp57Kip2was also decreased in testosterone‑treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase‑mediated atrophy pathways to preserve muscle mass in adult muscle.

  2. Expression of androgen receptor target genes in skeletal muscle.

    Science.gov (United States)

    Rana, Kesha; Lee, Nicole K L; Zajac, Jeffrey D; MacLean, Helen E

    2014-01-01

    We aimed to determine the mechanisms of the anabolic actions of androgens in skeletal muscle by investigating potential androgen receptor (AR)-regulated genes in in vitro and in vivo models. The expression of the myogenic regulatory factor myogenin was significantly decreased in skeletal muscle from testosterone-treated orchidectomized male mice compared to control orchidectomized males, and was increased in muscle from male AR knockout mice that lacked DNA binding activity (AR(ΔZF2)) versus wildtype mice, demonstrating that myogenin is repressed by the androgen/AR pathway. The ubiquitin ligase Fbxo32 was repressed by 12 h dihydrotestosterone treatment in human skeletal muscle cell myoblasts, and c-Myc expression was decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle, and increased in AR(∆ZF2) muscle. The expression of a group of genes that regulate the transition from myoblast proliferation to differentiation, Tceal7 , p57(Kip2), Igf2 and calcineurin Aa, was increased in AR(∆ZF2) muscle, and the expression of all but p57(Kip2) was also decreased in testosterone-treated orchidectomized male muscle compared to control orchidectomized male muscle. We conclude that in males, androgens act via the AR in part to promote peak muscle mass by maintaining myoblasts in the proliferative state and delaying the transition to differentiation during muscle growth and development, and by suppressing ubiquitin ligase-mediated atrophy pathways to preserve muscle mass in adult muscle.

  3. A PRACTICAL APPROACH TO THE DETECTION OF ANDROGEN RECEPTOR GENE-MUTATIONS AND PEDIGREE ANALYSIS IN FAMILIES WITH X-LINKED ANDROGEN INSENSITIVITY

    NARCIS (Netherlands)

    RISSTALPERS, C; HOOGENBOEZEM, T; SLEDDENS, HFBM; VERLEUNMOOIJMAN, MCT; DEGENHART, HJ; DROP, SLS; HALLEY, DJJ; Oosterwijk, Jan; HODGINS, MB; TRAPMAN, J; BRINKMANN, AO

    1994-01-01

    Androgen insensitivity syndrome (AIS) is an X-linked disorder in which defects in the androgen receptor gene have prevented the normal development of both internal and external male structures in 46,XY individuals. This survey reports the analysis of 11 AIS subjects. The androgen receptor gene of th

  4. Selective androgen receptor modulators in drug discovery: medicinal chemistry and therapeutic potential.

    Science.gov (United States)

    Cadilla, Rodolfo; Turnbull, Philip

    2006-01-01

    Modulation of the androgen receptor has the potential to be an effective treatment for hypogonadism, andropause, and associated conditions such as sarcopenia, osteoporosis, benign prostatic hyperplasia, and sexual dysfunction. Side effects associated with classical anabolic steroid treatments have driven the quest for drugs that demonstrate improved therapeutic profiles. Novel, non-steroidal compounds that show tissue selective activity and improved pharmacokinetic properties have been developed. This review provides an overview of current advances in the development of selective androgen receptor modulators (SARMs).

  5. Novel selective androgen receptor modulators: SAR studies on 6-bisalkylamino-2-quinolinones.

    Science.gov (United States)

    van Oeveren, Arjan; Motamedi, Mehrnoush; Martinborough, Esther; Zhao, Shuo; Shen, Yixing; West, Sarah; Chang, William; Kallel, Adam; Marschke, Keith B; López, Francisco J; Negro-Vilar, Andrés; Zhi, Lin

    2007-03-15

    A series of selective androgen receptor modulators (SARMs) with a wide spectrum of receptor modulating activities was developed based on optimization of the 4-substituted 6-bisalkylamino-2-quinolinones (3). Significance of the trifluoromethyl group on the side chains and its interactions with amino acid residues within the androgen receptor (AR) ligand binding domain are discussed. A representative analog (9) was tested orally in a rodent model of hypogonadism and demonstrated desirable tissue selectivity.

  6. Screening of bisphenol A, triclosan and paraben analogues as modulators of the glucocorticoid and androgen receptor activities.

    Science.gov (United States)

    Kolšek, Katra; Gobec, Martina; Mlinarič Raščan, Irena; Sollner Dolenc, Marija

    2015-02-01

    A homeostasis of the glucocorticoid and androgen endocrine system is essential to human health. Their disturbance can lead to various diseases, for example cardiovascular, inflammatory and autoimmune diseases, infertility, cancer. Fifteen widely used industrial chemicals that disrupt endocrine activity were selected for evaluation of potential (anti)glucocorticoid and (anti)androgenic activities. The human breast carcinoma MDA-kb2 cell line was utilized for reporter gene assays, since it expresses both the androgen and the glucocorticoid-responsive reporter. Two new antiandrogens, 4,4'-sulfonylbis(2-methylphenol) (dBPS) and 4,4'-thiodiphenol (THIO), and two new antiglucocorticoids, bisphenol Z and its analog bis[4-(2-hydroxyethoxy)phenyl] sulfone (BHEPS) were identified. Moreover, four new glucocorticoid agonists (methyl paraben, ethyl paraben, propyl paraben and bisphenol F) were found. To elucidate the structure-activity relationship of bisphenols, we performed molecular docking experiments with androgen and glucocorticoid receptor. These docking experiments had shown that bulky structures such as BHEPS and bisphenol Z act as antiglucocorticoid, because they are positioned toward helix H12 in the antagonist conformation and could therefore be responsible for H12 conformational change and the switch between agonistic and antagonistic conformation of receptor. On the other hand smaller structures cannot interact with H12. The results of in vitro screening of fifteen industrial chemicals as modulators of the glucocorticoid and androgen receptor activities demand additional in vivo testing of these chemicals for formulating any relevant hazard identification to human health.

  7. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  8. Selective androgen receptor modulator RAD140 is neuroprotective in cultured neurons and kainate-lesioned male rats.

    Science.gov (United States)

    Jayaraman, Anusha; Christensen, Amy; Moser, V Alexandra; Vest, Rebekah S; Miller, Chris P; Hattersley, Gary; Pike, Christian J

    2014-04-01

    The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed "selective androgen receptor modulators" (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in select androgen-responsive tissues. The efficacy of SARMs in brain is largely unknown. In this study, we investigate the SARM RAD140 in cultured rat neurons and male rat brain for its ability to provide neuroprotection, an important neural action of endogenous androgens that is relevant to neural health and resilience to neurodegenerative diseases. In cultured hippocampal neurons, RAD140 was as effective as testosterone in reducing cell death induced by apoptotic insults. Mechanistically, RAD140 neuroprotection was dependent upon MAPK signaling, as evidenced by elevation of ERK phosphorylation and inhibition of protection by the MAPK kinase inhibitor U0126. Importantly, RAD140 was also neuroprotective in vivo using the rat kainate lesion model. In experiments with gonadectomized, adult male rats, RAD140 was shown to exhibit peripheral tissue-specific androgen action that largely spared prostate, neural efficacy as demonstrated by activation of androgenic gene regulation effects, and neuroprotection of hippocampal neurons against cell death caused by systemic administration of the excitotoxin kainate. These novel findings demonstrate initial preclinical efficacy of a SARM in neuroprotective actions relevant to Alzheimer's disease and related neurodegenerative diseases.

  9. [Myoanabolic steroids and selective androgen receptor modulators: mechanism of action and perspectives].

    Science.gov (United States)

    Tóth, Miklós

    2009-11-01

    Interest in anabolic steroids has been renewed in the last decade with the discovery of tissue-selective androgen receptor modulators exhibiting high myotropic and small androgenic activity. An explanation put forward by us in 1982 for the mechanism of the preferential myotropic effect of nandrolone (19-nortestosterone) exploits the fundamental difference between the 5alpha-reductase concentrations in skeletal muscle and androgenic target tissue. In androgenic tissue, testosterone is converted to the more potent 5alpha-dihydrotestosterone whereas nandrolone is converted to a less potent derivative. As 5alpha-reduction is negligible in skeletal muscle, this explains why nandrolone shows a greater myotropic to androgenic ratio when compared with testosterone. Anabolic steroids that do not undergo 5alpha-reduction exert myotropic-androgenic dissociation because their effect in androgenic tissues is not amplified by 5alpha-reduction. Tissue selectivity by receptor modulators may be achieved by inducing specific conformational changes of the androgen receptor that affect its interaction with transcriptional coregulators. Anabolic activity is mediated by the stimulation of ribosomal RNA synthesis therefore regulation of this synthesis by anabolic steroids would deserve detailed studies.

  10. L712V mutation in the androgen receptor gene causes complete androgen insensitivity syndrome due to severe loss of androgen function.

    Science.gov (United States)

    Rajender, Singh; Gupta, Nalini J; Chakrabarty, Baidyanath; Singh, Lalji; Thangaraj, Kumarasamy

    2013-12-11

    Inability to respond to the circulating androgens is named as androgen insensitivity syndrome (AIS). Mutations in the androgen receptor (AR) gene are the most common cause of AIS. A cause and effect relationship between some of these mutations and the AIS phenotype has been proven by in vitro studies. Several other mutations have been identified, but need to be functionally validated for pathogenicity. Screening of the AR mutations upon presumptive diagnosis of AIS is recommended. We analyzed a case of complete androgen insensitivity syndrome (CAIS) for mutations in the AR gene. Sequencing of the entire coding region revealed C>G mutation (CTT-GTT) at codon 712 (position according to the NCBI database) in exon 4 of the gene, resulting in replacement of leucine with valine in the ligand-binding domain of the AR protein. No incidence of this mutation was observed in 230 normal male individuals analyzed for comparison. In vitro androgen binding and transactivation assays using mutant clone showed approximately 71% loss of ligand binding and about 76% loss of transactivation function. We conclude that CAIS in this individual was due to L712V substitution in the androgen receptor protein.

  11. Identification of novel androgen receptor target genes in prostate cancer

    Directory of Open Access Journals (Sweden)

    Gerald William L

    2007-06-01

    Full Text Available Abstract Background The androgen receptor (AR plays critical roles in both androgen-dependent and castrate-resistant prostate cancer (PCa. However, little is known about AR target genes that mediate the receptor's roles in disease progression. Results Using Chromatin Immunoprecipitation (ChIP Display, we discovered 19 novel loci occupied by the AR in castrate resistant C4-2B PCa cells. Only four of the 19 AR-occupied regions were within 10-kb 5'-flanking regulatory sequences. Three were located up to 4-kb 3' of the nearest gene, eight were intragenic and four were in gene deserts. Whereas the AR occupied the same loci in C4-2B (castrate resistant and LNCaP (androgen-dependent PCa cells, differences between the two cell lines were observed in the response of nearby genes to androgens. Among the genes strongly stimulated by DHT in C4-2B cells – D-dopachrome tautomerase (DDT, Protein kinase C delta (PRKCD, Glutathione S- transferase theta 2 (GSTT2, Transient receptor potential cation channel subfamily V member 3 (TRPV3, and Pyrroline-5-carboxylate reductase 1 (PYCR1 – most were less strongly or hardly stimulated in LNCaP cells. Another AR target gene, ornithine aminotransferase (OAT, was AR-stimulated in a ligand-independent manner, since it was repressed by AR siRNA knockdown, but not stimulated by DHT. We also present evidence for in vivo AR-mediated regulation of several genes identified by ChIP Display. For example, PRKCD and PYCR1, which may contribute to PCa cell growth and survival, are expressed in PCa biopsies from primary tumors before and after ablation and in metastatic lesions in a manner consistent with AR-mediated stimulation. Conclusion AR genomic occupancy is similar between LNCaP and C4-2B cells and is not biased towards 5' gene flanking sequences. The AR transcriptionally regulates less than half the genes nearby AR-occupied regions, usually but not always, in a ligand-dependent manner. Most are stimulated and a few are

  12. Identification and characterization of the minimal androgen-regulated kidney-specific kidney androgen-regulated protein gene promoter

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The kidney androgen-regulated protein (Kap) gene is tissue specific and regulated by androgen in mouse kidney proximal tubule cells (PTCs). In the present study, we aimed to identify the minimal PTC-specific androgen-regulated Kap promoter and analyze its androgen response elements (AREs).Adeletion series of the Kap1542 promoter/luciferase constructs were assayed in opossum kidney (OK) PTCs in the presence or absence of 15 nM dihydrotestosterone (DHT). Kap 1542 and Kap637 had low activity and no androgen induction; Kap224 had a basal activity that was 4- to 5-fold higher than that of Kap 1542, but was only sfightly induced by DHT. Kap 147 had a basal activity that was 2- to 3-fold higher than that of Kap 1542 and was induced by DHT 4- to 6-fold. Kap77 abol-ished basal promoter activity but was still induced by DHT. Results showed that, in vitro, Kap147 was a minimal androgen-regulated promoter. Transient transfection in different cells demonstrated that Kap147 specifically initi-ated reporter gene expression in PTCs. Sequence analysis revealed two potential AREs located at positions -124 and -39 of Kap147. Mutational assays showed that only the ARE at -124 was involved in androgen response in OK cells. Electrophoretic mobility shift assay also verified -124 ARE bound specifically to androgen receptor. In conclusion, we defined the minimal Kap 147 promoter that may be a good model for the study of kidney PTC-specific expression and molecular mechanisms that lead to an androgen-specific responsiveness in vivo.

  13. "Topological significance" analysis of gene expression and proteomic profiles from prostate cancer cells reveals key mechanisms of androgen response.

    Directory of Open Access Journals (Sweden)

    Adaikkalam Vellaichamy

    Full Text Available BACKGROUND: The problem of prostate cancer progression to androgen independence has been extensively studied. Several studies systematically analyzed gene expression profiles in the context of biological networks and pathways, uncovering novel aspects of prostate cancer. Despite significant research efforts, the mechanisms underlying tumor progression are poorly understood. We applied a novel approach to reconstruct system-wide molecular events following stimulation of LNCaP prostate cancer cells with synthetic androgen and to identify potential mechanisms of androgen-independent progression of prostate cancer. METHODOLOGY/PRINCIPAL FINDINGS: We have performed concurrent measurements of gene expression and protein levels following the treatment using microarrays and iTRAQ proteomics. Sets of up-regulated genes and proteins were analyzed using our novel concept of "topological significance". This method combines high-throughput molecular data with the global network of protein interactions to identify nodes which occupy significant network positions with respect to differentially expressed genes or proteins. Our analysis identified the network of growth factor regulation of cell cycle as the main response module for androgen treatment in LNCap cells. We show that the majority of signaling nodes in this network occupy significant positions with respect to the observed gene expression and proteomic profiles elicited by androgen stimulus. Our results further indicate that growth factor signaling probably represents a "second phase" response, not directly dependent on the initial androgen stimulus. CONCLUSIONS/SIGNIFICANCE: We conclude that in prostate cancer cells the proliferative signals are likely to be transmitted from multiple growth factor receptors by a multitude of signaling pathways converging on several key regulators of cell proliferation such as c-Myc, Cyclin D and CREB1. Moreover, these pathways are not isolated but constitute an

  14. Changes in gene expression following androgen receptor blockade is not equivalent to androgen ablation by castration in the rat ventral prostate

    Indian Academy of Sciences (India)

    Anil M Limaye; Irfan Asangani; Thyagarajan Kalyani; Paturu Kondaiah

    2008-06-01

    Involution of the rat ventral prostate and concomitant modulation of gene expression post-castration is a well-documented phenomenon. While the rat castration model has been extensively used to study androgen regulation of gene expression in the ventral prostate, it is not clear whether all the gene expression changes post-castration are due to androgen depletion alone. To obtain insights into this, we performed differential display reverse transcriptase polymerase chain reaction (DD-RT-PCR) which resulted in the identification of castration and/or flutamide-regulated genes in the rat ventral prostate. These include clusterin, methionine adenosyl transferase II, and prostate-specific transcripts such as PBPC1BS, S100RVP and A7. While clusterin, PBPC1BS and methionine adenosyl transferase II are regulated by both castration and flutamide, S100 RVP and A7 are regulated by castration alone. Interestingly, we show that flutamide, unlike castration, does not induce apoptosis in the rat ventral prostate epithelium, which could be an underlying cause for the differential effects of castration and flutamide treatment. We propose that castration leads to enrichment and depletion of stromal and epithelial cell types, respectively, resulting in erroneous conclusions on some of the cell type-specific transcripts as being androgen regulated.

  15. Selective androgen receptor modulator activity of a steroidal antiandrogen TSAA-291 and its cofactor recruitment profile.

    Science.gov (United States)

    Hikichi, Yukiko; Yamaoka, Masuo; Kusaka, Masami; Hara, Takahito

    2015-10-15

    Selective androgen receptor modulators (SARMs) specifically bind to the androgen receptor and exert agonistic or antagonistic effects on target organs. In this study, we investigated the SARM activity of TSAA-291, previously known as a steroidal antiandrogen, in mice because TSAA-291 was found to possess partial androgen receptor agonist activity in reporter assays. In addition, to clarify the mechanism underlying its tissue selectivity, we performed comprehensive cofactor recruitment analysis of androgen receptor using TSAA-291 and dihydrotestosterone (DHT), an endogenous androgen. The androgen receptor agonistic activity of TSAA-291 was more obvious in reporter assays using skeletal muscle cells than in those using prostate cells. In castrated mice, TSAA-291 increased the weight of the levator ani muscle without increasing the weight of the prostate and seminal vesicle. Comprehensive cofactor recruitment analysis via mammalian two-hybrid methods revealed that among a total of 112 cofactors, 12 cofactors including the protein inhibitor of activated STAT 1 (PIAS1) were differently recruited to androgen receptor in the presence of TSAA-291 and DHT. Prostate displayed higher PIAS1 expression than skeletal muscle. Forced expression of the PIAS1 augmented the transcriptional activity of the androgen receptor, and silencing of PIAS1 by siRNAs suppressed the secretion of prostate-specific antigen, an androgen responsive marker. Our results demonstrate that TSAA-291 has SARM activity and suggest that TSAA-291 may induce different conformational changes of the androgen receptor and recruitment profiles of cofactors such as PIAS1, compared with DHT, to exert tissue-specific activity.

  16. Antiandrogens act as selective androgen receptor modulators at the proteome level in prostate cancer cells.

    Science.gov (United States)

    Brooke, Greg N; Gamble, Simon C; Hough, Michael A; Begum, Shajna; Dart, D Alwyn; Odontiadis, Michael; Powell, Sue M; Fioretti, Flavia M; Bryan, Rosie A; Waxman, Jonathan; Wait, Robin; Bevan, Charlotte L

    2015-05-01

    Current therapies for prostate cancer include antiandrogens, inhibitory ligands of the androgen receptor, which repress androgen-stimulated growth. These include the selective androgen receptor modulators cyproterone acetate and hydroxyflutamide and the complete antagonist bicalutamide. Their activity is partly dictated by the presence of androgen receptor mutations, which are commonly detected in patients who relapse while receiving antiandrogens, i.e. in castrate-resistant prostate cancer. To characterize the early proteomic response to these antiandrogens we used the LNCaP prostate cancer cell line, which harbors the androgen receptor mutation most commonly detected in castrate-resistant tumors (T877A), analyzing alterations in the proteome, and comparing these to the effect of these therapeutics upon androgen receptor activity and cell proliferation. The majority are regulated post-transcriptionally, possibly via nongenomic androgen receptor signaling. Differences detected between the exposure groups demonstrate subtle changes in the biological response to each specific ligand, suggesting a spectrum of agonistic and antagonistic effects dependent on the ligand used. Analysis of the crystal structures of the AR in the presence of cyproterone acetate, hydroxyflutamide, and DHT identified important differences in the orientation of key residues located in the AF-2 and BF-3 protein interaction surfaces. This further implies that although there is commonality in the growth responses between androgens and those antiandrogens that stimulate growth in the presence of a mutation, there may also be influential differences in the growth pathways stimulated by the different ligands. This therefore has implications for prostate cancer treatment because tumors may respond differently dependent upon which mutation is present and which ligand is activating growth, also for the design of selective androgen receptor modulators, which aim to elicit differential proteomic

  17. Identification of testosterone-/androgen receptor-regulated genes in mouse Sertoli cells

    Institute of Scientific and Technical Information of China (English)

    Qiao-Xia Zhang; Xiao-Yan Zhang; Zhen-Ming Zhang; Wei Lu; Ling Liu; Gang Li; Zhi-Ming Cai; Yao-Ting Gui; Chawnshang Chang

    2012-01-01

    Androgen and androgen receptor (AR) play important roles in male spermatogenesis and fertility,yet detailed androgenlAR signals in Sertoli cells remain unclear.To identify AR target genes in Sertoli cells,we analyzed the gene expression profiles of testis between mice lacking AR in Sertoli cells (S-AR-/y) and their littermate wild-type (WT) mice.Digital gene expression analysis identified 2276 genes downregulated and 2865 genes upregulated in the S-AR-/y mice testis compared to WT ones.To further nail down the difference within Sertoli cells,we first constructed Sertoli cell line TM4 with stably transfected AR (named as TM4/AR) and found androgens failed to transactivate AR in Sertoli TM4 and TM4/AR cells.Interestingly,additional transient transfection of AR-cDNA resulted in significant androgen responsiveness with TM4/AR cells showing 10 times more androgen sensitivity than TM4 cells.In the condition where maximal androgen response was demonstrated,we then analyzed gene expression and found the expression levels of 2313 genes were changed more than twofold by transient transfection of AR-cDNA in the presence of testosterone.Among these genes,603 androgen-/ AR-regulated genes,including 164 upregulated and 439 downregulated,were found in both S-AR-/y mice testis and TM4/AR cells.Using informatics analysis,the gene ontology was applied to analyze these androgen-/AR-regulated genes to predict the potential roles of androgen/AR in the process of spermatogenesis.Together,using gene analysis in both S-AR-/y mice testis and TM4/AR cells may help us to better understand the androgen/AR signals in Sertoli cells and their influences in spermatogenesis.

  18. Androgen resistance.

    Science.gov (United States)

    Hughes, Ieuan A; Deeb, Asma

    2006-12-01

    Androgen resistance causes the androgen insensitivity syndrome in its variant forms and is a paradigm of clinical syndromes associated with hormone resistance. In its complete form, the syndrome causes XY sex reversal and a female phenotype. Partial resistance to androgens is a common cause of ambiguous genitalia of the newborn, but a similar phenotype may result from several other conditions, including defects in testis determination and androgen biosynthesis. The biological actions of androgens are mediated by a single intracellular androgen receptor encoded by a gene on the long arm of the X chromosome. Mutations in this gene result in varying degrees of androgen receptor dysfunction and phenotypes that often show poor concordance with the genotype. Functional characterization and three-dimensional modelling of novel mutant receptors has been informative in understanding the mechanism of androgen action. Management issues in syndromes of androgen insensitivity include decisions on sex assignment, timing of gonadectomy in relation to tumour risk, and genetic and psychological counselling.

  19. Single strand conformation polymorphism analysis of androgen receptor gene mutations in patients with androgen insensitivity syndromes: Application for diagnosis, genetic counseling, and therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hiort, O. (Medizinische Universitaet zu Luebeck (Germany) Tufts-New England Medical Center, Boston, MA (United States)); Huang, Q. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States)); Sinnecker, G.H.G.; Kruse, K. (Medizinische Universitaet zu Luebeck (Germany)); Sadeghi-Nejad, A.; Wolfe, H.J. (Tufts-New England Medical Center, Boston, MA (United States)); Yandell, D.W. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States))(Harvard Medical School, Boston, MA (United States) Harvard School of Public Health, Boston, MA (United States))

    1993-07-01

    Recent studies indicate that mutations in the androgen receptor gene are associated with androgen insensitivity syndromes, a heterogeneous group of related disorders involving defective sexual differentiation in karyotypic males. In this report, the authors address the possibility of rapid mutational analysis of the androgen receptor gene for initial diagnosis, genetic counseling, and molecular subclassification of affected patients and their families. DNA from peripheral blood leukocytes of six patients from five families with various degrees of androgen insensitivity was studied. Exons 2 to 8 of the androgen receptor gene were analyzed using a combination of single strand conformation polymorphism analysis and direct DNA sequencing. Female family members were also studied to identify heterozygote carriers. Point mutations in the AR gene were identified in all six patients, and all mutations caused amino acid substitutions. One patient with incomplete androgen insensitivity was a mosaic for the mutation. Four of the five mothers, as well as a young sister of one patient, were carriers of the mutation present in the affected child. The data show that new mutations may occur in the androgen receptor gene leading to sporadic androgen insensitivity syndrome. Molecular genetic characterization of the variant allele can serve as a primary tool for diagnosis and subsequent therapy, and can provide a basis for distinguishing heterozygous carriers in familial androgen resistance. The identification of carriers is of substantial clinical importance for genetic counseling. 29 refs., 2 figs., 1 tab.

  20. Synthesis of potent, substituted carbazoles as selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Miller, Chris P; Bhaket, Pushpal; Muthukaman, Nagarajan; Lyttle, C Richard; Shomali, Maysoun; Gallacher, Kyla; Slocum, Connie; Hattersley, Gary

    2010-12-15

    The synthesis and in vitro binding affinity for a novel series of potent androgen receptor modulators is described. One of the more potent compounds (17, RAD35010) was further characterized in vivo where it restored levator ani weight in castrated male rats to near sham level while having no significant effect on prostate weight.

  1. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    OpenAIRE

    Lobaccaro, J.M.; Lumbroso, S.; Poujol, Nicolas; Georget, V.; Brinkmann, Albert; Malpuech, Georges; Sultan, C.

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for a predictive frameshift in the open reading frame and introduction of a premature stop codon at position 783 instead of 919. The deletion was reproduced in androgen receptor wildtype cDNA and tran...

  2. Synthesis, structure-activity relationships, and characterization of novel nonsteroidal and selective androgen receptor modulators.

    Science.gov (United States)

    Schlienger, Nathalie; Lund, Birgitte W; Pawlas, Jan; Badalassi, Fabrizio; Bertozzi, Fabio; Lewinsky, Rasmus; Fejzic, Alma; Thygesen, Mikkel B; Tabatabaei, Ali; Bradley, Stefania Risso; Gardell, Luis R; Piu, Fabrice; Olsson, Roger

    2009-11-26

    Herein we describe the discovery of ACP-105 (1), a novel and potent nonsteroidal selective androgen receptor modulator (SARM) with partial agonist activity relative to the natural androgen testosterone. Compound 1 was developed from a series of compounds found in a HTS screen using the receptor selection and amplification technology (R-SAT). In vivo, 1 improved anabolic parameters in a 2-week chronic study in castrated male rats. In addition to compound 1, a number of potent antiandrogens were discovered from the same series of compounds whereof one compound, 13, had antagonist activity at the AR T877A mutant involved in prostate cancer.

  3. [A potential of selective androgen receptor modulator(SARM)for the therapy of osteoporosis].

    Science.gov (United States)

    Yanase, Toshihiko

    2016-07-01

    In recent years, the drugs, which show anabolic, effect on bone and muscle without stimulating prostate has been developed. They show tissue-specific selective androgen actions and called selective androgen receptor modulators(SARMs). The development of drug targeting bone and muscle in male is very promising as a treatment tool for osteoporosis and sarcopenia in the near future. The clinical study is under going especially in the field of cachexia associated with cancer, but unfortunately there is no drug in the current market at present. The current situation of the development of SARMs will be reviewed.

  4. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Harold D Love

    Full Text Available Benign prostatic hyperplasia (BPH and prostate carcinoma (CaP are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1 highly expressed in prostate, 2 had significant expression changes in response to androgens, and, 3 encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  5. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Science.gov (United States)

    Love, Harold D; Booton, S Erin; Boone, Braden E; Breyer, Joan P; Koyama, Tatsuki; Revelo, Monica P; Shappell, Scott B; Smith, Jeffrey R; Hayward, Simon W

    2009-12-21

    Benign prostatic hyperplasia (BPH) and prostate carcinoma (CaP) are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ) human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1) highly expressed in prostate, 2) had significant expression changes in response to androgens, and, 3) encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  6. Androgen receptor gene mutations in hormone-refractory prostate cancer.

    Science.gov (United States)

    Wallén, M J; Linja, M; Kaartinen, K; Schleutker, J; Visakorpi, T

    1999-12-01

    Prostate cancer is considered to be one of the most hormone-dependent human malignancies. As a key mediator of hormonal response, the androgen receptor (AR) is believed to have an important role in the progression of prostate cancer. Mutations in the coding region of the AR gene have been found in both untreated and hormone-refractory prostate cancer, but the frequency of such mutations at different stages of the disease is poorly documented and even contradictory results have been published. In the present study, the frequency of AR gene mutations was determined in 30 locally recurrent and two metastatic hormone-refractory prostate tumours using the polymerase chain reaction (PCR), non-radioactive single strand conformation polymorphism (SSCP), and sequencing. The length of the polymorphic CAG repeat, which is inversely correlated with the ability of the AR to activate transcription, was also analysed as well as the GGC repeat. Twelve samples were known to contain an AR gene amplification. Altogether, one point mutation (Gly(674)-->Ala) and one microsatellite mutation (CAG(20)-->CAG(18)) were found, both in cancers containing the AR gene amplification. The mean lengths of the polymorphic CAG and GGC repeats were similar to those observed in the normal population. These results favour the view that mutations in the AR gene are rare in hormone-refractory prostate cancer and do not play an important role, at least, in local relapse. Instead, the amplification and consequent overexpression of the wild-type AR gene seem to be the most common alteration involving the AR in hormone-refractory prostate cancer.

  7. Development of an androgen reporter gene assay (AR-LUX) utilizing a human cell line with an endogenously regulated androgen receptor

    NARCIS (Netherlands)

    Blankvoort, B.M.G.; Groene, E.M. de; Meeteren-Kreikamp, A.P. van; Witkamp, R.F.; Rodenburg, R.J.T.; Aarts, J.M.M.J.G.

    2001-01-01

    The aim of the work described in this report is to develop and characterize a cell-based androgen reporter assay. For this purpose, the androgen receptor (AR) expressing human breast cancer cell line T47D was stably transfected with a luciferase gene under transcriptional control of the PB-ARE-2 and

  8. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    NARCIS (Netherlands)

    J.M. Lobaccaro; S. Lumbroso; N. Poujol (Nicolas); V. Georget; A.O. Brinkmann (Albert); G. Malpuech (Georges); C. Sultan

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for

  9. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    Center, Kansas City, KS 66160, USA Introduction Prostate cancer is the most common cancer diagnosed after skin cancers and the... cancer cell growth: androgen regulation of CDK2, CDK4 , and CKI p16 genes. Cancer Res. 1997; 57:4511-4516. 109. Gregory CW, Hamil KG, Kim D, Hall SH...the most diagnosed non- skin cancer and the second leading cause of cancer -related death [2]. Currently, prostate-specific antigen (PSA) is the most

  10. Selective androgen receptor modulators (SARMs negatively regulate triple-negative breast cancer growth and epithelial:mesenchymal stem cell signaling.

    Directory of Open Access Journals (Sweden)

    Ramesh Narayanan

    Full Text Available The androgen receptor (AR is the most highly expressed steroid receptor in breast cancer with 75-95% of estrogen receptor (ER-positive and 40-70% of ER-negative breast cancers expressing AR. Though historically breast cancers were treated with steroidal androgens, their use fell from favor because of their virilizing side effects and the emergence of tamoxifen. Nonsteroidal, tissue selective androgen receptor modulators (SARMs may provide a novel targeted approach to exploit the therapeutic benefits of androgen therapy in breast cancer.Since MDA-MB-453 triple-negative breast cancer cells express mutated AR, PTEN, and p53, MDA-MB-231 triple-negative breast cancer cells stably expressing wildtype AR (MDA-MB-231-AR were used to evaluate the in vitro and in vivo anti-proliferative effects of SARMs. Microarray analysis and epithelial:mesenchymal stem cell (MSC co-culture signaling studies were performed to understand the mechanisms of action.Dihydrotestosterone and SARMs, but not bicalutamide, inhibited the proliferation of MDA-MB-231-AR. The SARMs reduced the MDA-MB-231-AR tumor growth and tumor weight by greater than 90%, compared to vehicle-treated tumors. SARM treatment inhibited the intratumoral expression of genes and pathways that promote breast cancer development through its actions on the AR. SARM treatment also inhibited the metastasis-promoting paracrine factors, IL6 and MMP13, and subsequent migration and invasion of epithelial:MSC co-cultures.1. AR stimulation inhibits paracrine factors that are important for MSC interactions and breast cancer invasion and metastasis. 2. SARMs may provide promise as novel targeted therapies to treat AR-positive triple-negative breast cancer.

  11. Differentially expressed androgen-regulated genes in androgen-sensitive tissues reveal potential biomarkers of early prostate cancer.

    Directory of Open Access Journals (Sweden)

    Dogus Murat Altintas

    Full Text Available BACKGROUND: Several data favor androgen receptor implication in prostate cancer initiation through the induction of several gene activation programs. The aim of the study is to identify potential biomarkers for early diagnosis of prostate cancer (PCa among androgen-regulated genes (ARG and to evaluate comparative expression of these genes in normal prostate and normal prostate-related androgen-sensitive tissues that do not (or rarely give rise to cancer. METHODS: ARG were selected in non-neoplastic adult human prostatic epithelial RWPE-1 cells stably expressing an exogenous human androgen receptor, using RNA-microarrays and validation by qRT-PCR. Expression of 48 preselected genes was quantified in tissue samples (seminal vesicles, prostate transitional zones and prostate cancers, benign prostatic hypertrophy obtained from surgical specimens using TaqMan® low-density arrays. The diagnostic performances of these potential biomarkers were compared to that of genes known to be associated with PCa (i.e. PCA3 and DLX1. RESULTS AND DISCUSSION: By crossing expression studies in 26 matched PCa and normal prostate transitional zone samples, and 35 matched seminal vesicle and PCa samples, 14 genes were identified. Similarly, 9 genes were overexpressed in 15 benign prostatic hypertrophy samples, as compared to PCa samples. Overall, we selected 8 genes of interest to evaluate their diagnostic performances in comparison with that of PCA3 and DLX1. Among them, 3 genes: CRYAB, KCNMA1 and SDPR, were overexpressed in all 3 reference non-cancerous tissues. The areas under ROC curves of these genes reached those of PCA3 (0.91 and DLX1 (0.94. CONCLUSIONS: We identified ARG with reduced expression in PCa and with significant diagnostic values for discriminating between cancerous and non-cancerous prostatic tissues, similar that of PCA3. Given their expression pattern, they could be considered as potentially protective against prostate cancer. Moreover, they could

  12. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  13. A novel selective androgen receptor modulator, NEP28, is efficacious in muscle and brain without serious side effects on prostate.

    Science.gov (United States)

    Akita, Kazumasa; Harada, Koichiro; Ichihara, Junji; Takata, Naoko; Takahashi, Yasuhiko; Saito, Koichi

    2013-11-15

    Age-related androgen depletion is known to be a risk factor for various diseases, such as osteoporosis and sarcopenia. Furthermore, recent studies have demonstrated that age-related androgen depletion results in accumulation of β-amyloid protein and thereby acts as a risk factor for the development of Alzheimer's disease. Supplemental androgen therapy has been shown to be efficacious in treating osteoporosis and sarcopenia. In addition, studies in animals have demonstrated that androgens can play a protective role against Alzheimer's disease. However, androgen therapy is not used routinely for these indications, because of side effects. Selective androgen receptor modulators (SARMs) are a new class of compounds. SARMs maintain the beneficial effects of androgens on bone and muscle while reducing unwanted side effects. NEP28 is a new SARM exhibiting high selectivity for androgen receptor. To investigate the pharmacological effects of NEP28, we compared the effects on muscle, prostate, and brain with mice that were androgen depleted by orchidectomy and then treated with either placebo, NEP28, dihydrotestosterone, or methyltestosterone. We demonstrated that NEP28 showed tissue-selective effect equivalent to or higher than existing SARMs. In addition, the administration of NEP28 increased the activity of neprilysin, a known Aβ-degrading enzyme. These results indicate that SARM is efficacious for the treatment of not only osteoporosis and sarcopenia, but also Alzheimer's disease.

  14. N-Aryl-oxazolidin-2-imine Muscle Selective Androgen Receptor Modulators Enhance Potency through Pharmacophore Reorientation

    Energy Technology Data Exchange (ETDEWEB)

    Nirschl, Alexandra A.; Zou, Yan; Krystek, Jr., Stanley R.; Sutton, James C.; Simpkins, Ligaya M.; Lupisella, John A.; Kuhns, Joyce E.; Seethala, Ramakrishna; Golla, Rajasree; Sleph, Paul G.; Beehler, Blake C.; Grover, Gary J.; Egan, Donald; Fura, Aberra; Vyas, Viral P.; Li, Yi-Xin; Sack, John S.; Kish, Kevin F.; An, Yongmi; Bryson, James A.; Gougoutas, Jack Z.; DiMarco, John; Zahler, Robert; Ostrowski, Jacek; Hamann, Lawrence G.; (BMS)

    2010-11-09

    A novel selective androgen receptor modulator (SARM) scaffold was discovered as a byproduct obtained during synthesis of our earlier series of imidazolidin-2-ones. The resulting oxazolidin-2-imines are among the most potent SARMs known, with many analogues exhibiting sub-nM in vitro potency in binding and functional assays. Despite the potential for hydrolytic instability at gut pH, compounds of the present class showed good oral bioavailability and were highly active in a standard rodent pharmacological model.

  15. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer

    OpenAIRE

    Madjunkova, S.; Eftimov, A.; Georgiev, V.; Petrovski, D; Dimovski, AJ; Plaseska-Karanfilska, D

    2012-01-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5′ end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. Th...

  16. Gene expression profiling of the androgen receptor antagonists flutamide and vinclozolin in zebrafish (Danio rerio) gonads

    Energy Technology Data Exchange (ETDEWEB)

    Martinovic-Weigelt, Dalma, E-mail: dalma@stthomas.edu [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); University of St. Thomas, 2115 Summit Ave, Saint Paul, MN 55105 (United States); Wang Ronglin [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Villeneuve, Daniel L. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); Bencic, David C.; Lazorchak, Jim [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Ankley, Gerald T. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States)

    2011-01-25

    The studies presented in this manuscript focus on characterization of transcriptomic responses to anti-androgens in zebrafish (Danio rerio). Research on the effects of anti-androgens in fish has been characterized by a heavy reliance on apical endpoints, and molecular mechanisms of action (MOA) of anti-androgens remain poorly elucidated. In the present study, we examined effects of a short term exposure (24-96 h) to the androgen receptor antagonists flutamide (FLU) and vinclozolin (VZ) on gene expression in gonads of sexually mature zebrafish, using commercially available zebrafish oligonucleotide microarrays (4 x 44 K platform). We found that VZ and FLU potentially impact reproductive processes via multiple pathways related to steroidogenesis, spermatogenesis, and fertilization. Observed changes in gene expression often were shared by VZ and FLU, as demonstrated by overlap in differentially-expressed genes and enrichment of several common key pathways including: (1) integrin and actin signaling, (2) nuclear receptor 5A1 signaling, (3) fibroblast growth factor receptor signaling, (4) polyamine synthesis, and (5) androgen synthesis. This information should prove useful to elucidating specific mechanisms of reproductive effects of anti-androgens in fish, as well as developing biomarkers for this important class of endocrine-active chemicals.

  17. Androgen receptor regulation of the seladin-1/DHCR24 gene: altered expression in prostate cancer.

    Science.gov (United States)

    Bonaccorsi, Lorella; Luciani, Paola; Nesi, Gabriella; Mannucci, Edoardo; Deledda, Cristiana; Dichiara, Francesca; Paglierani, Milena; Rosati, Fabiana; Masieri, Lorenzo; Serni, Sergio; Carini, Marco; Proietti-Pannunzi, Laura; Monti, Salvatore; Forti, Gianni; Danza, Giovanna; Serio, Mario; Peri, Alessandro

    2008-10-01

    Prostate cancer (CaP) represents a major leading cause of morbidity and mortality in the Western world. Elevated cholesterol levels, resulting from altered cholesterol metabolism, have been found in CaP cells. Seladin-1 (SELective Alzheimer Disease INdicator-1)/DHCR24 is a recently described gene involved in cholesterol biosynthesis. Here, we demonstrated the androgen regulation of seladin-1/DHCR24 expression, due to the presence of androgen responsive element sequences in its promoter region. In metastatic androgen receptor-negative CaP cells seladin-1/DHCR24 expression and cholesterol amount were reduced compared to androgen receptor-positive cells. In tumor samples from 61 patients who underwent radical prostatectomy the expression of seladin-1/DHCR24 was significantly higher with respect to normal tissues. In addition, in cancer tissues mRNA levels were positively related to T stage. In tumor specimens from 23 patients who received androgen ablation treatment for 3 months before surgery seladin-1/DHCR24 expression was significantly lower with respect to patients treated by surgery only. In conclusion, our study demonstrated for the first time the androgen regulation of the seladin-1/DHCR24 gene and the presence of a higher level of expression in CaP tissues, compared to the normal prostate. These findings, together with the results previously obtained in metastatic disease, suggest an involvement of this gene in CaP.

  18. Pharmacological characterization of an imidazolopyrazole as novel selective androgen receptor modulator.

    Science.gov (United States)

    Zhang, Xuqing; Allan, George F; Tannenbaum, Pamela; Sbriscia, Tifanie; Linton, Olivia; Lai, Muh-Tsann; Haynes-Johnson, Donna; Bhattacharjee, Sheela; Lundeen, Scott G; Sui, Zhihua

    2013-03-01

    Selective androgen receptor modulators (SARMs) are androgens with tissue-selective activity. SARMs that have anabolic activity on muscle while having minimal stimulatory activity on prostate are classified as SARM agonists. They can be used to prevent the loss of lean body mass that is associated with cancer, immunodeficiency, renal disease and aging. They may also have anabolic activity on bone; thus, unlike estrogens, they may reverse the loss of bone strength associated with aging or hypogonadism. Our in-house effort on SARM program discovers a nonsteroidal androgen receptor ligand with a unique imidazolopyrazole moiety in its structure. In vitro, this compound is a weak androgen receptor binder and a weak androgen agonist. Despite this, in orchidectomized mature rats it is an effective SARM agonist, with an ED(50) on levator ani muscle of 3.3mg/kg and an ED(50) on ventral prostate of >30mg/kg. It has its maximal effect on muscle at the dose of 10mg/kg. In addition, this compound has mixed agonistic and antagonistic activities on prostate, reducing the weight of that tissue in intact rats by 22% at 10mg/kg. The compound does not have significant effect on gonadotropin levels or testosterone levels in both orchidectomized and intact male rats. It does not have notable progestin, estrogen or glucocorticoid agonistic or antagonistic activity in rats. In a female sexual behavior model, it improves the sexual desire of ovariectomized female rats for sexually mature intact males over nonsexually ovariectomized females. Overall, the imidazolopyrazole is a potent prostate-sparing candidate for development as a SARM agonist with an appropriate pharmacological profile for clinical benefit in muscle-wasting conditions and female sexual function disorders.

  19. Synthesis and biological evaluation of novel selective androgen receptor modulators (SARMs). Part I.

    Science.gov (United States)

    Aikawa, Katsuji; Miyawaki, Toshio; Hitaka, Takenori; Imai, Yumi N; Hara, Takahito; Miyazaki, Junichi; Yamaoka, Masuo; Kusaka, Masami; Kanzaki, Naoyuki; Tasaka, Akihiro; Shiraishi, Mitsuru; Yamamoto, Satoshi

    2015-05-15

    To develop effective drugs for hypogonadism, sarcopenia, and cachexia, we designed, synthesized, and evaluated selective androgen receptor modulators (SARMs) that exhibit not only anabolic effects on organs such as muscles and the central nervous system (CNS) but also neutral or antagonistic effects on the prostate. Based on the information obtained from a docking model with androgen receptor (AR), we modified a hit compound A identified through high-throughput screening. Among the prepared compounds, 1-(4-cyano-1-naphthyl)-2,3-disubstituted pyrrolidine derivatives 17h, 17m, and 17j had highly potent AR agonistic activities in vitro and good tissue selectivity in vivo. These derivatives increased the weight of the levator ani muscle without influencing the prostate and seminal vesicle. In addition, these compounds induced sexual behavior in castrated rats, indicating that the compounds could also act as agonists on the CNS.

  20. Selective androgen receptor modulators for the treatment of late onset male hypogonadism.

    Science.gov (United States)

    Coss, Christopher C; Jones, Amanda; Hancock, Michael L; Steiner, Mitchell S; Dalton, James T

    2014-01-01

    Several testosterone preparations are used in the treatment of hypogonadism in the ageing male. These therapies differ in their convenience, flexibility, regional availability and expense but share their pharmacokinetic basis of approval and dearth of long-term safety data. The brevity and relatively reduced cost of pharmacokinetic based registration trials provides little commercial incentive to develop improved novel therapies for the treatment of late onset male hypogonadism. Selective androgen receptor modulators (SARMs) have been shown to provide anabolic benefit in the absence of androgenic effects on prostate, hair and skin. Current clinical development for SARMs is focused on acute muscle wasting conditions with defi ned clinical endpoints of physical function and lean body mass. Similar regulatory clarity concerning clinical deficits in men with hypogonadism is required before the beneficial pharmacology and desirable pharmacokinetics of SARMs can be employed in the treatment of late onset male hypogonadism.

  1. Selective androgen receptor modulators for the treatment of late onset male hypogonadism

    Directory of Open Access Journals (Sweden)

    Christopher C Coss

    2014-04-01

    Full Text Available Several testosterone preparations are used in the treatment of hypogonadism in the ageing male. These therapies differ in their convenience, flexibility, regional availability and expense but share their pharmacokinetic basis of approval and dearth of long-term safety data. The brevity and relatively reduced cost of pharmacokinetic based registration trials provides little commercial incentive to develop improved novel therapies for the treatment of late onset male hypogonadism. Selective androgen receptor modulators (SARMs have been shown to provide anabolic benefit in the absence of androgenic effects on prostate, hair and skin. Current clinical development for SARMs is focused on acute muscle wasting conditions with defi ned clinical endpoints of physical function and lean body mass. Similar regulatory clarity concerning clinical deficits in men with hypogonadism is required before the beneficial pharmacology and desirable pharmacokinetics of SARMs can be employed in the treatment of late onset male hypogonadism.

  2. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  3. IκB Kinases Modulate the Activity of the Androgen Receptor in Prostate Carcinoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Garima Jain

    2012-03-01

    Full Text Available Enhanced nuclear localization of nuclear factor κB (NF-κB in prostate cancer (PCa samples and constitutive NF-κB signaling in a class of PCa cell lines with low androgen receptor (AR expression (PC3 and DU-145 imply an important role of the IκB kinase (IKK/NF-κB system in PCa. However, most PCa and PCa cell lines depend on the activity of the AR, and the role of NF-κB in these AR-expressing PCa remains unclear. Here, we demonstrate that inhibition of NF-κB signaling by the IKK inhibitor BMS345541 reduced proliferation and increased apoptosis in AR-expressing PCa cell lines. Furthermore, AR activity and target gene expression were distinctively reduced, whereas AR protein levels remained unaltered on BMS345541 treatment. Similar effects were observed particularly after small interfering RNA (siRNA-mediated knockdown of IKK1, but not by siRNA-mediated suppression of IKK2. Moreover, IKK1 overexpression augmented 5α-dihydrotestosterone-induced nuclear AR translocation, whereas nuclear AR was reduced by IKK1 knockdown or BMS345541. However, because IKK1 also enhances the activity of a chronically nuclear AR mutant, modulation of the subcellular distribution seems not to be the only mechanism by which IKK1 enhances AR activity. Finally, reduced in vivo AR phosphorylation after BMS345541 treatment and in vitro AR phosphorylation by IKK1 or IKK2 imply that AR constitutes a novel IKK target. Taken together, our data identify IKK1 as a potentially target structure for future therapeutic intervention in PCa.

  4. Expression of novel genes linked to the androgen-induced, proliferative shutoff in prostate cancer cells.

    Science.gov (United States)

    Geck, P; Szelei, J; Jimenez, J; Lin, T M; Sonnenschein, C; Soto, A M

    1997-01-01

    Androgens control cell numbers in the prostate through three separate pathways: (a) inhibition of cell death, (b) induction of cell proliferation (Step-1) and (c) inhibition of cell proliferation (Step-2, proliferative shutoff). The mechanisms underlying these phenomena are incompletely understood. The human prostate carcinoma LNCaP variants express these pathways as follows: LNCaP-FGC express both steps, LNCaP-LNO expresses Step-2, LNCaP-TAC expresses Step-1, and LNCaP-TJA cells express neither step. These cells facilitated the search for mediators of the androgen-induced proliferative shutoff pathway. Androgen exposure for 24 h or longer induced an irreversible proliferative shutoff in LNCaP-FGC cells. The Wang and Brown approach for identifying differentially expressed mRNAs was used to search for mediators of Step-2. Ten unique inserts were identified and from those ten, three genes were further studied. The basal expression of these genes in shutoff-negative variants was not affected by androgen exposure. They were induced by androgens in shutoff-positive LNCaP variants and the androgen receptor-transfected, shutoff-positive, MCF7-AR1 cells. These genes were induced only in the range of androgen concentrations that elicited the shutoff response. Time course analysis showed that their induction precedes the commitment point by 12-18 h. In addition, they were expressed in the normal prostate during proliferative shutoff. These features suggest that the candidate genes have a role in the regulation cascade for proliferative shutoff.

  5. Structure of the ligand-binding domain (LBD) of human androgen receptor in complex with a selective modulator LGD2226

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng; Liu, Xiao-qin; Li, He; Liang, Kai-ni [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, 15 Datun Road, Chaoyang District, Beijing 100101 (China); Miner, Jeffrey N.; Hong, Mei; Kallel, E. Adam; Oeveren, Arjan van; Zhi, Lin [Discovery Research, Ligand Pharmaceuticals Inc., 10275 Science Center Drive, San Diego, California 92121 (United States); Jiang, Tao, E-mail: x-ray@sun5.ibp.ac.cn [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, 15 Datun Road, Chaoyang District, Beijing 100101 (China)

    2006-11-01

    Crystal structure of the ligand-binding domain of androgen receptor in complex with LGD2226. The androgen receptor (AR) is a ligand-inducible steroid hormone receptor that mediates androgen action, determining male sexual phenotypes and promoting spermatogenesis. As the androgens play a dominant role in male sexual development and function, steroidal androgen agonists have been used clinically for some years. However, there is a risk of potential side effects and most steroidal androgens cannot be dosed orally, which limits the use of these substances. 1,2-Dihydro-6-N,N-bis(2,2,2-trifluoroethyl) amino-4-trifluoromethyl-2-quinolinone (LGD2226) is a synthetic nonsteroidal ligand and a novel selective AR modulator. The crystal structure of the complex of LGD2226 with the androgen receptor ligand-binding domain (AR LBD) at 2.1 Å was solved and compared with the structure of the AR LBD–R1881 complex. It is hoped that this will aid in further explaining the selectivity of LGD2226 observed in in vitro and in vivo assays and in developing more selective and effective therapeutic agents.

  6. Novel series of potent, nonsteroidal, selective androgen receptor modulators based on 7H-[1,4]oxazino[3,2-g]quinolin-7-ones.

    Science.gov (United States)

    Higuchi, Robert I; Arienti, Kristen L; López, Francisco J; Mani, Neelakhanda S; Mais, Dale E; Caferro, Thomas R; Long, Yun Oliver; Jones, Todd K; Edwards, James P; Zhi, Lin; Schrader, William T; Negro-Vilar, Andrés; Marschke, Keith B

    2007-05-17

    Recent interest in orally available androgens has fueled the search for new androgens for use in hormone replacement therapy and as anabolic agents. In pursuit of this, we have discovered a series of novel androgen receptor modulators derived from 7H-[1,4]oxazino[3,2-g]quinolin-7-ones. These compounds were synthesized and evaluated in competitive binding assays and an androgen receptor transcriptional activation assay. A number of compounds from the series demonstrated single-digit nanomolar agonist activity in vitro. In addition, lead compound (R)-16e was orally active in established rodent models that measure androgenic and anabolic properties of these agents. In this assay, (R)-16e demonstrated full efficacy in muscle and only partially stimulated the prostate at 100 mg/kg. These data suggest that these compounds may be utilized as selective androgen receptor modulators or SARMs. This series represents a novel class of compounds for use in androgen replacement therapy.

  7. Microarray analysis of androgen-regulated gene expression in testis: the use of the androgen-binding protein (ABP-transgenic mouse as a model

    Directory of Open Access Journals (Sweden)

    Grossman Gail

    2005-12-01

    Full Text Available Abstract Background Spermatogenesis is an androgen-dependent process, yet the molecular mechanisms of androgens' actions in testis are poorly understood. Transgenic mice overexpressing rat androgen-binding protein (ABP in their testes have reduced levels of intratesticular androgens and, as a result, show a progressive impairment of spermatogenesis. We used this model to characterize changes in global gene expression in testis in response to reduced bioavailability of androgens. Methods Total RNA was extracted from testes of 30-day old transgenic and wild-type control mice, converted to cRNA, labeled with biotin, and hybridized to oligonucleotide microarrays. Microarray results were confirmed by real-time reverse transcription polymerase chain reaction. Results Three-hundred-eighty-one genes (3.05% of all transcripts represented on the chips were up-regulated and 198 genes (1.59% were down-regulated by at least a factor of 2 in the androgen-deficient animals compared to controls. Genes encoding membrane proteins, intracellular signaling molecules, enzymes, proteins participating in the immune response, and those involved in cytoskeleton organization were significantly overrepresented in the up-regulated group. Among the down-regulated transcripts, those coding for extracellular proteins were overrepresented most dramatically, followed by those related to proteolysis, cell adhesion, immune response, and growth factor, cytokine, and ion channel activities. Transcripts with the greatest potential impact on cellular activities included several transcription factors, intracellular signal transducers, secreted signaling molecules and enzymes, and various cell surface molecules. Major nodes in the up-regulated network were IL-6, AGT, MYC, and A2M, those in the down-regulated network were IL-2, -4, and -10, MAPK8, SOCS1, and CREB1. Conclusion Microarray analysis followed by gene ontology profiling and connectivity analysis identified several functional

  8. Transcriptional network of androgen receptor in prostate cancer progression.

    Science.gov (United States)

    Takayama, Ken-ichi; Inoue, Satoshi

    2013-08-01

    The androgen receptor belongs to the nuclear receptor superfamily and functions as a ligand-dependent transcription factor. It binds to the androgen responsive element and recruits coregulatory factors to modulate gene transcription. In addition, the androgen receptor interacts with other transcription factors, such as forkhead box A1, and other oncogenic signaling pathway molecules that bind deoxyribonucleic acid and regulate transcription. Androgen receptor signaling plays an important role in the development of prostate cancer. Prostate cancer cells proliferate in an androgen-dependent manner, and androgen receptor blockade is effective in prostate cancer therapy. However, patients often progress to castration-resistant prostate cancer with elevated androgen receptor expression and hypersensitivity to androgen. Recently, comprehensive analysis tools, such as complementary DNA microarray, chromatin immunoprecipitation-on-chip and chromatin immunoprecipitation-sequence, have described the androgen-mediated diverse transcriptional program and gene networks in prostate cancer. Furthermore, functional and clinical studies have shown that some of the androgen receptor-regulated genes could be prognostic markers and potential therapeutic targets for the treatment of prostate cancer, particularly castration-resistant prostate cancer. Thus, identifying androgen receptor downstream signaling events and investigating the regulation of androgen receptor activity is critical for understanding the mechanism of carcinogenesis and progression to castration-resistant prostate cancer.

  9. CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

    Directory of Open Access Journals (Sweden)

    O. B. Loran

    2014-07-01

    Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

  10. CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

    Directory of Open Access Journals (Sweden)

    O. B. Loran

    2009-01-01

    Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

  11. CAG repeat polymorphism in the androgen receptor (AR) gene of SBMA patients and a control group.

    Science.gov (United States)

    Sułek, Anna; Hoffman-Zacharska, Dorota; Krysa, Wioletta; Szirkowiec, Walentyna; Fidziańska, Elzbieta; Zaremba, Jacek

    2005-01-01

    Spinobulbar muscular atrophy (SBMA) is an X-linked form of motor neuron disease characterized by progressive atrophy of the muscles, dysphagia, dysarthria and mild androgen insensitivity. SBMA is caused by CAG repeat expansion in the androgen receptor gene. CAG repeat polymorphism was analysed in a Polish control group (n = 150) and patients suspected of SBMA (n = 60). Normal and abnormal ranges of CAG repeats were established in the control group and in 21 patients whose clinical diagnosis of SBMA was molecularly confirmed. The ranges are similar to those reported for other populations.

  12. Androgen Receptor-Target Genes in African American Prostate Cancer Disparities

    Directory of Open Access Journals (Sweden)

    Bi-Dar Wang

    2013-01-01

    Full Text Available The incidence and mortality rates of prostate cancer (PCa are higher in African American (AA compared to Caucasian American (CA men. To elucidate the molecular mechanisms underlying PCa disparities, we employed an integrative approach combining gene expression profiling and pathway and promoter analyses to investigate differential transcriptomes and deregulated signaling pathways in AA versus CA cancers. A comparison of AA and CA PCa specimens identified 1,188 differentially expressed genes. Interestingly, these transcriptional differences were overrepresented in signaling pathways that converged on the androgen receptor (AR, suggesting that the AR may be a unifying oncogenic theme in AA PCa. Gene promoter analysis revealed that 382 out of 1,188 genes contained cis-acting AR-binding sequences. Chromatin immunoprecipitation confirmed STAT1, RHOA, ITGB5, MAPKAPK2, CSNK2A,1 and PIK3CB genes as novel AR targets in PCa disparities. Moreover, functional screens revealed that androgen-stimulated AR binding and upregulation of RHOA, ITGB5, and PIK3CB genes were associated with increased invasive activity of AA PCa cells, as siRNA-mediated knockdown of each gene caused a loss of androgen-stimulated invasion. In summation, our findings demonstrate that transcriptional changes have preferentially occurred in multiple signaling pathways converging (“transcriptional convergence” on AR signaling, thereby contributing to AR-target gene activation and PCa aggressiveness in AAs.

  13. Prostate specific antigen gene expression in androgen insensitive prostate carcinoma subculture cell line.

    Science.gov (United States)

    Tsui, Ke-Hung; Feng, Tsui-Hsia; Chung, Li-Chuan; Chao, Chun-Hsiang; Chang, Phei-Lang; Juang, Horng-Heng

    2008-01-01

    A novel prostate cancer cell line (PC-J) was isolated from an androgen independent non-prostate specific antigen (non-PSA) producing carcinoma cell line. The homologous correlation between PC-J and PC-3 was determined by short tandem repeat analysis. The PSA promoter activity was detected by transient expression assay in the PC-J and LNCaP cells but not in androgen insensitive PC-3 cells. When the PC-J cells were cotransfected with androgen receptor, androgen receptor coactivators and PSA reporter vector cells, the reporter assays indicated that nuclear receptor coactivator 4 (NCOA4) but not androgen receptor activator 24 (ARA24) increased the sensitivity and maximum stimulation of dihydrotestosterone (DHT)-inducing PSA promoter activity. The RT-PCR assays revealed that the expression of several tumor markers, including interleukin-6, prostate stem cell antigen (PSCA), prostate epithelium-specific Ets transcription factor (PDEF) and matriptase, was lower in the PC-J cells than in the PC-3 cells. This cell model elucidated the regulation of PSA expression and enabled comparison of the gene profile at different stages of metastasis in prostatic carcinoma.

  14. Relationships between androgens, serotonin gene expression and innervation in male macaques.

    Science.gov (United States)

    Bethea, C L; Coleman, K; Phu, K; Reddy, A P; Phu, A

    2014-08-22

    Androgen administration to castrated individuals was purported to decrease activity in the serotonin system. However, we found that androgen administration to castrated male macaques increased fenfluramine-induced serotonin release as reflected by increased prolactin secretion. In this study, we sought to define the effects of androgens and aromatase inhibition on serotonin-related gene expression in the dorsal raphe, as well as serotonergic innervation of the LC. Male Japanese macaques (Macaca fuscata) were castrated for 5-7 months and then treated for 3 months with (1) placebo, (2) testosterone (T), (3) dihydrotestosterone (DHT; non-aromatizable androgen) and ATD (steroidal aromatase inhibitor), or (4) Flutamide (FLUT; androgen antagonist) and ATD (n=5/group). This study reports the expression of serotonin-related genes: tryptophan hydroxylase 2 (TPH2), serotonin reuptake transporter (SERT) and the serotonin 1A autoreceptor (5HT1A) using digoxigenin-ISH and image analysis. To examine the production of serotonin and the serotonergic innervation of a target area underlying arousal and vigilance, we measured the serotonin axon density entering the LC with ICC and image analysis. TPH2 and SERT expression were significantly elevated in T- and DHT + ATD-treated groups over placebo- and FLUT + ATD-treated groups in the dorsal raphe (p expression between the groups. There was a significant decrease in the pixel area of serotonin axons and in the number of varicosities in the LC across the treatment groups with T > placebo > DHT + ATD = FLUT + ATD treatments. Comparatively, T- and DHT + ATD-treated groups had elevated TPH2 and SERT gene expression, but the DHT + ATD group had markedly suppressed serotonin axon density relative to the T-treated group. Further comparison with previously published data indicated that TPH2 and SERT expression reflected yawning and basal prolactin secretion. The serotonin axon density in the LC agreed with the area under the fenfluramine

  15. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol

    Energy Technology Data Exchange (ETDEWEB)

    Elo, J.P.; Kvist, L.; Leinonen, K.; Isomaa, V. [Univ. of Oulu (Finland)] [and others

    1995-12-01

    Androgens are necessary for the development of prostatic cancer. The mechanisms by which the originally androgen-dependent prostatic cancer cells are relieved of the requirement to use androgen for their growth are largely unknown. The human prostatic cancer cell line LNCaP has been shown to contain a point mutation in the human androgen receptor gene (hAR), suggesting that changes in the hAR may contribute to the abnormal hormone response of prostatic cells. To search for point mutations in the hAR, we used single strand conformation polymorphism analysis and a polymerase chain reaction direct sequencing method to screen 23 prostatic cancer specimens from untreated patients, 6 prostatic cancer specimens from treated patients, and 11 benign prostatic hyperplasia specimens. One mutation was identified in DNA isolated from prostatic cancer tissue, and the mutation was also detected in the leukocyte DNA of the patient and his offspring. The mutation changed codon 726 in exon E from arginine to leucine and was a germ line mutation. The mutation we found in exon E of the hAR gene does not alter the ligand binding specificity of the AR, but the mutated receptor was activated by estradiol to a significantly greater extent than the wild-type receptor. The AR gene mutation described in this study might be one explanation for the altered biological activity of prostatic cancer. 36 refs., 4 figs.

  16. Estrogen and androgen regulate actin-remodeling and endocytosis-related genes during rat spermiation.

    Science.gov (United States)

    Kumar, Anita; Dumasia, Kushaan; Gaonkar, Reshma; Sonawane, Shobha; Kadam, Leena; Balasinor, N H

    2015-03-15

    Spermiation, the sperm release process, is imperative to male fertility and reproduction. Morphologically, it is characterized by removal of atypical adherens junctions called ectoplasmic specializations, and formation of transient endocytic devices called tubulobulbar complexes requiring cytoskeleton remodeling and recruitment of proteins needed for endocytosis. Earlier, estrogen administration to adult male rats was seen to cause spermiation failure due to disruption of tubulobulbar complexes. This was accompanied by reduction in intratesticular testosterone levels and increase in intratesticular estrogen along with deregulation of genes involved in cytoskeleton remodeling (Arpc1b, Evl and Capg) and endocytosis (Picalm, Eea1 and Stx5a). In the present study, we aim to understand the role of estrogen and androgen in regulating these genes independently using seminiferous tubule culture system treated with estrogen, androgen or agonists and antagonists of estrogen receptors. We find that transcripts of Arpc1b, Evl and Picalm are responsive to estrogen while those of Picalm, Eea1 and Stx5a are responsive to androgen. We also find that the estrogen regulation of Arpc1b and Evl is mediated through estrogen receptor β and that of Picalm occurs through estrogen receptors α and β. Localization of these proteins at or in the vicinity of tubulobulbar complexes reveals that ARPC1B, EVL, PICALM, EEA1 and STX5A seem to be involved in spermiation. Thus, estrogen and androgen regulate specific genes in seminiferous tubules that could play a role in spermiation.

  17. A large deletion/insertion-induced frameshift mutation of the androgen receptor gene in a family with a familial complete androgen insensitivity syndrome.

    Science.gov (United States)

    Cong, Peikuan; Ye, Yinghui; Wang, Yue; Lu, Lingping; Yong, Jing; Yu, Ping; Joseph, Kimani Kagunda; Jin, Fan; Qi, Ming

    2012-06-01

    Androgen insensitivity syndrome (AIS) is an X-linked recessive genetic disorder with a normal 46, XY karyotype caused by abnormality of the androgen receptor (AR) gene. One Chinese family consisting of the proband and 5 other members with complete androgen insensitivity syndrome (CAIS) was investigated. Mutation analysis by DNA sequencing on all 8 exons and flanking intron regions of the AR gene revealed a unique large deletion/insertion mutation in the family. A 287 bp deletion and 77 bp insertion (c.933_1219delins77) mutation at codon 312 resulted in a frameshift which caused a premature stop (p.Phe312Aspfs*7) of polypeptide formation. The proband's mother and grandmother were heterozygous for the mutant allele. The proband's father, uncle and grandfather have the normal allele. From the pedigree constructed from mutational analysis of the family, it is revealed that the probably pathogenic mutation comes from the maternal side.

  18. Mechanism of the tissue-specific action of the selective androgen receptor modulator S-101479.

    Science.gov (United States)

    Furuya, Kazuyuki; Yamamoto, Noriko; Ohyabu, Yuki; Morikyu, Teruyuki; Ishige, Hirohide; Albers, Michael; Endo, Yasuhisa

    2013-01-01

    Selective androgen receptor modulators (SARMs) comprise a new class of molecules that induce anabolic effects with fewer side effects than those of other anabolic agents. We previously reported that the novel SARM S-101479 had a tissue-selective bone anabolic effect with diminished side effects in female animals. However, the mechanism of its tissue selectivity is not well known. In this report, we show that S-101479 increased alkaline phosphatase activity and androgen receptor (AR) transcriptional activity in osteoblastic cell lines in the same manner as the natural androgen ligand dihydrotestosterone (DHT); conversely, stimulation of AR dimerization was very low compared with that of DHT (34.4%). S-101479 increased bone mineral content in ovariectomized rats without promoting endometrial proliferation. Yeast two-hybrid interaction assays revealed that DHT promoted recruitment of numerous cofactors to AR such as TIF2, SRC1, β-catenin, NCoA3, gelsolin and PROX1 in a dose-dependent manner. SARMs induced recruitment of fewer cofactors than DHT; in particular, S-101479 failed to induce recruitment of canonical p160 coactivators such as SRC1, TIF2 and notably NCoA3 but only stimulated binding of AR to gelsolin and PROX1. The results suggest that a full capability of the AR to dimerize and to effectively and unselectively recruit all canonical cofactors is not a prerequisite for transcriptional activity in osteoblastic cells and resulting anabolic effects in bone tissues. Instead, few relevant cofactors might be sufficient to promote AR activity in these tissues.

  19. Preclinical pharmacology of FL442, a novel nonsteroidal androgen receptor modulator.

    Science.gov (United States)

    Poutiainen, Pekka K; Huhtala, Tuulia; Jääskeläinen, Tiina; Petsalo, Aleksanteri; Küblbeck, Jenni; Kaikkonen, Sanna; Palvimo, Jorma J; Raunio, Hannu; Närvänen, Ale; Peräkylä, Mikael; Juvonen, Risto O; Honkakoski, Paavo; Laatikainen, Reino; Pulkkinen, Juha T

    2014-04-25

    The preclinical profiles of two most potent compounds of our recently published cycloalkane[d]isoxazole pharmacophore-based androgen receptor (AR) modulators, FL442 (4-(3a,4,5,6,7,7a-hexahydro-benzo[d]isoxazol-3-yl)-2-(trifluoromethyl)benzonitrile) and its nitro analog FL425 (3-(4-nitro-3-(trifluoromethyl)phenyl)-3a,4,5,6,7,7a-hexahydrobenzo[d]isoxazole), were explored to evaluate their druggability for the treatment of AR dependent prostate cancer. The studies revealed that both compounds are selective to AR over other closely related steroid hormone receptors and that FL442 exhibits equal inhibition efficiency towards the androgen-responsive LNCaP prostate cancer cell line as the most widely used antiandrogen bicalutamide and the more recently discovered enzalutamide. Notably, FL442 maintains antiandrogenic activity with enzalutamide-activated AR mutant F876L. In contrast to bicalutamide, FL442 does not stimulate the VCaP prostate cancer cells which express elevated levels of the AR. Distribution analyses showed that [(14)CN]FL442 accumulates strongly in the mouse prostate. In spite of its low plasma concentration obtained by intraperitoneal administration, FL442 significantly inhibited LNCaP xenograft tumor growth. These findings provide a preclinical proof for FL442 as a promising AR targeted candidate for a further optimization.

  20. Lead evaluation of tetrahydroquinolines as nonsteroidal selective androgen receptor modulators for the treatment of osteoporosis.

    Science.gov (United States)

    Nagata, Naoya; Furuya, Kazuyuki; Oguro, Nao; Nishiyama, Daisuke; Kawai, Kentaro; Yamamoto, Noriko; Ohyabu, Yuki; Satsukawa, Masahiro; Miyakawa, Motonori

    2014-01-01

    Tetrahydroquinoline (THQ) was deemed to be a suitable scaffold for our nonsteroidal selective androgen receptor modulator (SARM) concept. We adapted the strategy of switching the antagonist function of cyano-group-containing THQ (CN-THQ) to the agonist function and optimized CN-THQ as an orally available drug candidate with suitable pharmacological and ADME profiles. Based on binding mode analyses and synthetic accessibility, we designed and synthesized a compound that possesses a para-substituted aromatic ring attached through an amide linker. The long-tail THQ derivative 6-acetamido-N-(2-(8-cyano-3a,4,5,9b-tetrahydro-3H-cyclopenta[c]quinolin-4-yl)-2-methylpropyl)nicotinamide (1 d), which bears a para-acetamide-substituted aromatic group, showed an appropriate in vitro biological profile, as expected. We considered that the large conformational change at Trp741 of the androgen receptor (AR) and the hydrogen bond between 1 d and helix 12 of the AR could maintain the structure of the AR in its agonist form; indeed, 1 d displays strong AR agonistic activity. Furthermore, 1 d showed an appropriate in vivo profile for use as an orally available SARM, displaying clear tissue selectivity, with a separation between its desirable osteoanabolic effect on femoral bone mineral density and its undesirable virilizing effects on the uterus and clitoral gland in a female osteoporosis model.

  1. A novel selective androgen receptor modulator (SARM) MK-4541 exerts anti-androgenic activity in the prostate cancer xenograft R-3327G and anabolic activity on skeletal muscle mass & function in castrated mice.

    Science.gov (United States)

    Chisamore, Michael J; Gentile, Michael A; Dillon, Gregory Michael; Baran, Matthew; Gambone, Carlo; Riley, Sean; Schmidt, Azriel; Flores, Osvaldo; Wilkinson, Hilary; Alves, Stephen E

    2016-10-01

    The androgen receptor (AR) is a member of the nuclear hormone receptor super family of transcription factors. Androgens play an essential role in the development, growth, and maintenance of male sex organs, as well as the musculoskeletal and central nervous systems. Yet with advancing age, androgens can drive the onset of prostate cancer, the second leading cause of cancer death in males within the United States. Androgen deprivation therapy (ADT) by pharmacologic and/or surgical castration induces apoptosis of prostate cells and subsequent shrinkage of the prostate and prostate tumors. However, ADT is associated with significant musculoskeletal and behavioral adverse effects. The unique pharmacological activity of selective androgen receptor modulator (SARM) MK-4541 recently has been reported as an AR antagonist with 5α-reductase inhibitor function. The molecule inhibits proliferation and induces apoptosis in AR positive, androgen dependent prostate cancer cells. Importantly, MK-4541 inhibited androgen-dependent prostate growth in male rats yet maintained lean body mass and bone formation following ovariectomy in female rats. In the present study, we evaluated the effects of SARM MK-4541 in the androgen-dependent Dunning R3327-G prostate carcinoma xenograft mouse model as well as on skeletal muscle mass and function, and AR-regulated behavior in mice. MK-4541 significantly inhibited the growth of R3327-G prostate tumors, exhibited anti-androgen effects on the seminal vesicles, reduced plasma testosterone concentrations in intact males, and inhibited Ki67 expression. MK-4541 treated xenografts appeared similar to xenografts in castrated mice. Importantly, we demonstrate that MK-4541 exhibited anabolic activity in androgen deficient conditions, increasing lean body mass and muscle function in adult castrated mice. Moreover, MK-4541 treatment restored general activity levels in castrated mice. Thus, MK-4541 exhibits an optimum profile as an adjuvant therapy to ADT

  2. Androgens and skeletal muscle: cellular and molecular action mechanisms underlying the anabolic actions.

    Science.gov (United States)

    Dubois, Vanessa; Laurent, Michaël; Boonen, Steven; Vanderschueren, Dirk; Claessens, Frank

    2012-05-01

    Androgens increase both the size and strength of skeletal muscle via diverse mechanisms. The aim of this review is to discuss the different cellular targets of androgens in skeletal muscle as well as the respective androgen actions in these cells leading to changes in proliferation, myogenic differentiation, and protein metabolism. Androgens bind and activate a specific nuclear receptor which will directly affect the transcription of target genes. These genes encode muscle-specific transcription factors, enzymes, structural proteins, as well as microRNAs. In addition, anabolic action of androgens is partly established through crosstalk with other signaling molecules such as Akt, myostatin, IGF-I, and Notch. Finally, androgens may also exert non-genomic effects in muscle by increasing Ca(2+) uptake and modulating kinase activities. In conclusion, the anabolic effect of androgens on skeletal muscle is not only explained by activation of the myocyte androgen receptor but is also the combined result of many genomic and non-genomic actions.

  3. Lestaurtinib inhibits histone phosphorylation and androgen-dependent gene expression in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Jens Köhler

    Full Text Available BACKGROUND: Epigenetics is defined as heritable changes in gene expression that are not based on changes in the DNA sequence. Posttranslational modification of histone proteins is a major mechanism of epigenetic regulation. The kinase PRK1 (protein kinase C related kinase 1, also known as PKN1 phosphorylates histone H3 at threonine 11 and is involved in the regulation of androgen receptor signalling. Thus, it has been identified as a novel drug target but little is known about PRK1 inhibitors and consequences of its inhibition. METHODOLOGY/PRINCIPAL FINDING: Using a focused library screening approach, we identified the clinical candidate lestaurtinib (also known as CEP-701 as a new inhibitor of PRK1. Based on a generated 3D model of the PRK1 kinase using the homolog PKC-theta (protein kinase c theta protein as a template, the key interaction of lestaurtinib with PRK1 was analyzed by means of molecular docking studies. Furthermore, the effects on histone H3 threonine phosphorylation and androgen-dependent gene expression was evaluated in prostate cancer cells. CONCLUSIONS/SIGNIFICANCE: Lestaurtinib inhibits PRK1 very potently in vitro and in vivo. Applied to cell culture it inhibits histone H3 threonine phosphorylation and androgen-dependent gene expression, a feature that has not been known yet. Thus our findings have implication both for understanding of the clinical activity of lestaurtinib as well as for future PRK1 inhibitors.

  4. ANDROGEN REGULATION OF PROSTATIC STEROID BINDING PROTEIN GENE TRANSCRIPTION

    Institute of Scientific and Technical Information of China (English)

    ZHANGYong-Lian; ZHOUZong-Xun; ZHANGYou-Duan; PARKERMalcolmG

    1989-01-01

    Prostatic steroid binding protein (PSBP) is a major protein secreted in the rat ventral prostate (V.P.) and also one of the components in seminal fluid, The potential importance of this protein in male fertility emerged from its ability of binding cholesterol which might modulate the proportion of phospholipids and cholesterol in sperm making it suitable

  5. Genetic factors modulate the impact of pubertal androgen excess on insulin sensitivity and fertility.

    Directory of Open Access Journals (Sweden)

    Abigail R Dowling

    Full Text Available Polycystic ovary syndrome (PCOS is the most common endocrine disorder of reproductive age women. The syndrome is caused by a combination of environmental influences and genetic predisposition. Despite extensive efforts, the heritable factors contributing to PCOS development are not fully understood. The objective of this study was to test the hypothesis that genetic background contributes to the development of a PCOS-like reproductive and metabolic phenotype in mice exposed to excess DHEA during the pubertal transition. We tested whether the PCOS phenotype would be more pronounced on the diabetes-prone C57BL/6 background than the previously used strain, BALB/cByJ. In addition, we examined strain-dependent upregulation of the expression of ovarian and extra-ovarian candidate genes implicated in human PCOS, genes containing known strain variants, and genes involved with steroidogenesis or insulin sensitivity. These studies show that there are significant strain-related differences in metabolic response to excess androgen exposure during puberty. Additionally, our results suggest the C57BL/6J strain provides a more robust and uniform experimental platform for PCOS research than the BALB/cByJ strain.

  6. Complete androgen insensitivity syndrome caused by a novel splice donor site mutation and activation of a cryptic splice donor site in the androgen receptor gene.

    Science.gov (United States)

    Infante, Joana B; Alvelos, Maria I; Bastos, Margarida; Carrilho, Francisco; Lemos, Manuel C

    2016-01-01

    The androgen insensitivity syndrome is an X-linked recessive genetic disorder characterized by resistance to the actions of androgens in an individual with a male karyotype. We evaluated a 34-year-old female with primary amenorrhea and a 46,XY karyotype, with normal secondary sex characteristics, absence of uterus and ovaries, intra-abdominal testis, and elevated testosterone levels. Sequence analysis of the androgen receptor (AR) gene revealed a novel splice donor site mutation in intron 4 (c.2173+2T>C). RT-PCR analysis showed that this mutation resulted in the activation of a cryptic splice donor site located in the second half of exon 4 and in the synthesis of a shorter mRNA transcript and an in-frame deletion of 41 amino acids. This novel mutation associated with a rare mechanism of abnormal splicing further expands the spectrum of mutations associated with the androgen insensitivity syndrome and may contribute to the understanding of the molecular mechanisms involved in splicing defects.

  7. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer.

    Science.gov (United States)

    Madjunkova, S; Eftimov, A; Georgiev, V; Petrovski, D; Dimovski, Aj; Plaseska-Karanfilska, D

    2012-06-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5' end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. This retrospective case-control study evaluates the possible effect of short CAG repeats on the AR gene in prostate cancer risk in Macedonian males. A total of 392 male subjects, 134 PC patients, 106 patients with benign prostatic hyperplasia (BPH) and 152 males from the general Macedonian population were enrolled in this study. The CAG repeat length was determined by fluorescent polymerase chain reaction (PCR) amplification of exon1 of the AR gene followed by capillary electrophoresis (CE) on a genetic analyzer. The mean repeat length in PC patients was 21.5 ± 2.65, in controls 22.28 ± 2.86 (p = 0.009) and in BPH patients 22.1 ± 2.52 (p = 0.038). Short CAG repeats (CAG repeat (CAG repeat length. These results suggest that reduced CAG repeat length may be associated with increased prostate cancer risk in Macedonian men.

  8. Larger trinucleotide repeat size in the androgen receptor gene of infertile men with extremely severe oligozoospermia.

    Science.gov (United States)

    Patrizio, P; Leonard, D G; Chen, K L; Hernandez-Ayup, S; Trounson, A O

    2001-01-01

    Androgens are significant regulators of human spermatogenesis. Their action is mediated through the androgen receptor (AR), which binds to the androgen responsive element on DNA and regulates gene transcription. Men become infertile with spinobulbar muscular atrophy (Kennedy disease) caused by a trinucleotide repeat expansion, > or = 40 CAG repeats, in the AR gene located on the X chromosome. In this prospective study, we investigated whether the variable size, larger repeats, of this trinucleotide could alter AR function and result in impaired spermatogenesis. A total of 69 infertile men were studied. Clinical and laboratory analysis showed idiopathic, nonobstructive azoospermia in 16 men, extremely severe oligozoospermia in 27 men (PCR) amplification across the AR repeat region. Accurate size determination of the PCR product using an ABI 373 DNA sequencer allowed precise calculation of CAG repeat sizes. The AR gene was not analyzed for other types of mutations. The difference in CAG repeat size between infertile men and proven fertile controls was statistically significant, P = .03. Patients with extremely severe oligozoospermia had significantly longer CAG repeat tracts (mean, 25.4 +/- 4.0; P = .0005; range 20-39) than controls (mean, 22 +/- 2.8; range 12-30) or patients with severe oligozoospermia (mean, 22.2 +/- 2.3; range 18-26). None of the 26 infertile men with sperm counts CAG repeats compared with 6 out of 45 controls (13%; P = .06). This study suggests that some men with severe impairment of spermatogenesis have longer trinucleotide repeats in the AR gene. Although direct evidence is missing, lower affinity between androgen and the AR protein or decreased AR protein availability with longer repeats could be responsible for a diminished androgen effect on spermatogenesis. Two of the patients in the extremely severe oligozoospermia group had 35 and 39 CAG repeats, respectively (normal range is 11 to 33). Although not yet considered a mutation, longer

  9. Mutations of androgen receptor gene in Brazilian patients with male pseudohermaphroditism

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    1998-06-01

    Full Text Available We describe the identification of point mutations in the androgen receptor gene in five Brazilian patients with female assignment and behavior. The eight exons of the gene were amplified by the polymerase chain reaction (PCR and analyzed for single-strand conformation polymorphism (SSCP to detect the mutations. Direct sequencing of the mutant PCR products demonstrated single transitions in three of these cases: G®A in case 1, within exon C, changing codon 615 from Arg to His; G®A in case 2, within exon E, changing codon 752 from Arg to Gln, and C®T in case 3, within exon B, but without amino acid change.

  10. Validation and application of reporter gene assays for the determination of estrogenic and androgenic endocrine disruptor activity in sport supplements.

    Science.gov (United States)

    Plotan, Monika; Elliott, Christopher T; Oplatowska, Michalina; Connolly, Lisa

    2012-07-01

    Previously developed estrogen and androgen mammalian reporter gene assays (RGAs) were assessed for their potential use as a quantitative screening method in the detection of estrogenic and androgenic endocrine disruptors (EDs) in sport supplements. The validation of both RGAs coupled with dispersive solid phase extraction (dSPE) was performed in accordance with European Commission Decision EC/2002/6579 for biological screening methods. Decision limits (CCα) and detection capabilities (CCβ) were established for both the estrogen and androgen RGAs. All samples were compliant with CCα and CCβ in both bioassays. Recovery rates were 96 % for 17β-estradiol and 115 % for dihydrotestosterone as obtained in their corresponding RGA. Both estrogens and androgens were stable in samples for more than 3 weeks, when stored at -20 °C. Specificity, good repeatability (coefficients of variation (CV), 12-25 %), reproducibility and robustness of both bioassays were also observed. Four different ED modes of action were determined for estrogens and androgens in 53 sport supplements, using the validated RGAs. This study revealed that 89 % of the investigated sport supplements contained estrogenic EDs and 51 % contained androgenic compounds. In conclusion, both bioassays are suitable for sport supplement screening of estrogenic and androgenic EDs.

  11. Testosterone increases renal anti-aging klotho gene expression via the androgen receptor-mediated pathway.

    Science.gov (United States)

    Hsu, Shih-Che; Huang, Shih-Ming; Lin, Shih-Hua; Ka, Shuk-Man; Chen, Ann; Shih, Meng-Fu; Hsu, Yu-Juei

    2014-12-01

    Gender is known to be associated with longevity and oestrogen administration induced longevity-associated gene expression is one of the potential mechanisms underlying the benefits of oestrogen on lifespan, whereas the role of testosterone in the regulation of longevity-associated gene expressions remains largely unclear. The klotho gene, predominantly expressed in the kidney, has recently been discovered to be an aging suppressor gene. In the present study, we investigated the regulatory effects of testosterone on renal klotho gene expression in vivo and in vitro. In testosterone-administered mouse kidney and NRK-52E cells, increased klotho expression was accompanied by the up-regulation of the nuclear androgen receptor (AR). Overexpression of AR enhanced the expression of klotho mRNA and protein. Conversely, testosterone-induced klotho expression was attenuated in the presence of flutamide, an AR antagonist. A reporter assay and a chromatin immunoprecipitation (ChIP) assay demonstrated that AR directly binds to the klotho promoter via androgen response elements (AREs) which reconfirmed its importance for AR binding via the element mutation. In summary, our study demonstrates that testosterone up-regulates anti-aging klotho together with AR expression in the kidney in vivo and in vitro by recruiting AR on to the AREs of the klotho promoter.

  12. Genetic and Functional Analysis of Androgen Receptor Gene Mutations

    NARCIS (Netherlands)

    H.T. Brüggenwirth (Hennie)

    1998-01-01

    textabstractNuclear hormone receptors (NHRs) are intermediary factors through which extracellular signals regulate expression of genes that are involved in homeostasis, development, and differentiation (Beato et al. '995, Mangelsdorf and Evans 1995). These receptors are characterized by a modular st

  13. The fungus Cunninghamella elegans can produce human and equine metabolites of selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Rydevik, Axel; Thevis, Mario; Krug, Oliver; Bondesson, Ulf; Hedeland, Mikael

    2013-05-01

    1. Selective androgen receptor modulators (SARMs) are a group of substances that have potential to be used as doping agents in sports. Being a relatively new group not available on the open market means that no reference materials are commercially available for the main metabolites. In the presented study, the in vitro metabolism of SARMs by the fungus Cunninghamella elegans has been investigated with the purpose of finding out if it can produce relevant human and equine metabolites. 2. Three different SARMs, S1, S4 and S24, were incubated for 5 days with C. elegans. The samples were analysed both with and without sample pretreatment using ultra performance liquid chromatography coupled to high resolution mass spectrometry. 3. All the important phase I and some phase II metabolites from human and horse were formed by the fungus. They were formed through reactions such as hydroxylation, deacetylation, O-dephenylation, nitro-reduction, acetylation and sulfonation. 4. The study showed that the fungus produced relevant metabolites of the SARMs and thus can be used to mimic mammalian metabolism. Furthermore, it has the potential to be used for future production of reference material.

  14. A protein in rat prostatic chromatin interacting with androgen regulated gene

    Institute of Scientific and Technical Information of China (English)

    XUYOUHAI; RONGCHANG; 等

    1992-01-01

    2M NaCl-insoluble fraction of rat ventral Prostate chromatin(residual proteins)contain proteins able to interact specifically with androgen-receptor complex and is ,therefore,a part of the aceptor complex.Among residual proteins a 98 KDa protein has been found which binds significantly to a genomic fiagment containing an androgen-regulated gene coding for a 22 KDa protein The biological significance of this binding in androgen action need to be further studied.A mini-plasmid clone containing 22 KDa protein coding sequence was cloned into charon 4A genomic library from which a 5.7 Kb genomic fragment was isolated,identified by hybridization with a 5' and a 3' cDNA probes,and shown to contain the 3' flanking sequence.Restriction enzyme treatment of this fragment yielded a 4.7 Kb restriction fragmwent representing the 5' upstream region and a 1.0 Kb containing part of the coding sequence.Deletion studies indicated that the 97 KDa protein bound only to a subclone of about 300 bp segment .Furthermore,gel shifting experiment supported its DNA-protein binding.

  15. Androgen receptor- and PIAS1-regulated gene programs in molecular apocrine breast cancer cells.

    Science.gov (United States)

    Malinen, Marjo; Toropainen, Sari; Jääskeläinen, Tiina; Sahu, Biswajyoti; Jänne, Olli A; Palvimo, Jorma J

    2015-10-15

    We have analyzed androgen receptor (AR) chromatin binding sites (ARBs) and androgen-regulated transcriptome in estrogen receptor negative molecular apocrine breast cancer cells. These analyses revealed that 42% of ARBs and 39% androgen-regulated transcripts in MDA-MB453 cells have counterparts in VCaP prostate cancer cells. Pathway analyses showed a similar enrichment of molecular and cellular functions among AR targets in both breast and prostate cancer cells, with cellular growth and proliferation being among the most enriched functions. Silencing of the coregulator SUMO ligase PIAS1 in MDA-MB453 cells influenced AR function in a target-selective fashion. An anti-apoptotic effect of the silencing suggests involvement of the PIAS1 in the regulation of cell death and survival pathways. In sum, apocrine breast cancer and prostate cancer cells share a core AR cistrome and target gene signature linked to cancer cell growth, and PIAS1 plays a similar coregulatory role for AR in both cancer cell types.

  16. Identification of a mutant allele of the androgen receptor gene in a family with androgen insensitivity syndrome: detection of carriers and prenatal diagnosis.

    Science.gov (United States)

    Fogu, G; Bertini, V; Dessole, S; Bandiera, P; Campus, P M; Capobianco, G; Sanna, R; Soro, G; Montella, A

    2004-05-01

    We report the results of a molecular study of a large family segregating the complete form of the Androgen Insensitivity Syndrome (CAIS) in several family members from three generations. We identified the mutant allele by polymerase chain reaction (PCR) amplification of the short tandem repeat (CAG)n, highly polymorphic in the population, present in the first exon of the androgen receptor (AR) gene. In this family four different alleles were detected and one of these showed a perfect segregation with the disease. This study enabled us to identify the heterozygous females in this family. We think that this simple, indirect test, is also suitable for prenatal diagnosis of Morris' syndrome when the mother is heterozygous for the size of the short tandem repeat and one affected subject in the family may be studied.

  17. Ockham's razor and selective androgen receptor modulators (SARMs): are we overlooking the role of 5alpha-reductase?

    Science.gov (United States)

    Gao, Wenqing; Dalton, James T

    2007-02-01

    Selective Androgen Receptor Modulators (SARMs) are a novel class of AR ligands that possess tissue-selective pharmacological activities. SARMs of various chemical structures have been discovered and characterized, and lead compounds with much improved specificity for AR, in vivo pharmacokinetic profiles, and higher degree of tissue selectivity have entered clinical development, and are expected to dramatically expand the clinical applications of androgens. With the rapid progress in SARM discovery and increasing demand for mechanism-based drug design, more and more research efforts have been devoted to the mechanisms of action of the observed tissue selectivity of SARMs. There is increasing enthusiasm in adapting the molecular mechanisms of action from SERM research to the SARM field; however, is the SARM story really so complicated? The tissue-specific expression of 5alpha-reductase might provide a simple explanation for this puzzle.

  18. Design and synthesis of tricyclic tetrahydroquinolines as a new series of nonsteroidal selective androgen receptor modulators (SARMs).

    Science.gov (United States)

    Nagata, Naoya; Miyakawa, Motonori; Amano, Seiji; Furuya, Kazuyuki; Yamamoto, Noriko; Inoguchi, Kiyoshi

    2011-03-15

    Some tricyclic tetrahydroquinolines (THQs) were found to have the potential of a new series of nonsteroidal selective androgen receptor modulators (SARMs). Compound 5b was first designed and synthesized under our hypothesis based on a four-point pharmacophoric requirement of the 3-carbonyl, 18-methyl, 17-hydroxyl, and 13-quaternary carbon groups of dihydrotestosterone (DHT). It was revealed that this compound exhibits not only a strong androgen receptor (AR) agonistic activity (EC(50)=9.2 nM) but also the highest selectivity in binding affinity to AR among the steroid hormone receptors. Furthermore, this compound showed a weak virilizing effect with retention of the desired anabolic effect as compared with DHT in vivo.

  19. Reduced CAG repeats length in androgen receptor gene is associated with violent criminal behavior.

    Science.gov (United States)

    Rajender, Singh; Pandu, Guguluth; Sharma, J D; Gandhi, K P C; Singh, Lalji; Thangaraj, Kumarasamy

    2008-09-01

    Androgens mediate their functions through androgen receptors (AR). The two triplet repeats in the AR gene (CAG and GGN) are highly polymorphic among various populations and have been extensively studied in diverse clinical conditions and antisocial personality disorders. Several studies have reported either higher levels of testosterone among rapists or the correlation of shorter CAG repeats with criminal activities. However, to date, no study has analyzed AR gene in rapists worldwide, and no study has been conducted on criminals from Indian subcontinent. Therefore, we have analyzed the AR-CAG repeat length in 645 men, of which 241 were convicted for rape, 107 for murder, 26 for both murder and rape, and 271 were control males. The aim was to explore if there was any correlation between CAG repeat length and criminal behavior. The study revealed significantly shorter CAG repeats in the rapists (mean 18.44 repeats) and murderers (mean 17.59 repeats) compared to the control men (mean 21.19 repeats). The criminals who committed murder after rape had a far shorter mean repeat length (mean 17.31 repeats) in comparison to the controls or those convicted of rape or murder alone. In short, our study suggests that the reduced CAG repeats in the AR gene are associated with criminal behavior. This, along with other studies, would help in understanding the biological factors associated with the antisocial or criminal activities.

  20. Beyond aggression: Androgen-receptor blockade modulates social interaction in wild meerkats.

    Science.gov (United States)

    delBarco-Trillo, Javier; Greene, Lydia K; Goncalves, Ines Braga; Fenkes, Miriam; Wisse, Jillian H; Drewe, Julian A; Manser, Marta B; Clutton-Brock, Tim; Drea, Christine M

    2016-02-01

    In male vertebrates, androgens are inextricably linked to reproduction, social dominance, and aggression, often at the cost of paternal investment or prosociality. Testosterone is invoked to explain rank-related reproductive differences, but its role within a status class, particularly among subordinates, is underappreciated. Recent evidence, especially for monogamous and cooperatively breeding species, suggests broader androgenic mediation of adult social interaction. We explored the actions of androgens in subordinate, male members of a cooperatively breeding species, the meerkat (Suricata suricatta). Although male meerkats show no rank-related testosterone differences, subordinate helpers rarely reproduce. We blocked androgen receptors, in the field, by treating subordinate males with the antiandrogen, flutamide. We monitored androgen concentrations (via baseline serum and time-sequential fecal sampling) and recorded behavior within their groups (via focal observation). Relative to controls, flutamide-treated animals initiated less and received more high-intensity aggression (biting, threatening, feeding competition), engaged in more prosocial behavior (social sniffing, grooming, huddling), and less frequently initiated play or assumed a 'dominant' role during play, revealing significant androgenic effects across a broad range of social behavior. By contrast, guarding or vigilance and measures of olfactory and vocal communication in subordinate males appeared unaffected by flutamide treatment. Thus, androgens in male meerkat helpers are aligned with the traditional trade-off between promoting reproductive and aggressive behavior at a cost to affiliation. Our findings, based on rare endocrine manipulation in wild mammals, show a more pervasive role for androgens in adult social behavior than is often recognized, with possible relevance for understanding tradeoffs in cooperative systems.

  1. Androgen receptor-dependent transactivation of growth arrest-specific gene 6 mediates inhibitory effects of testosterone on vascular calcification.

    Science.gov (United States)

    Son, Bo-Kyung; Akishita, Masahiro; Iijima, Katsuya; Ogawa, Sumito; Maemura, Koji; Yu, Jing; Takeyama, Kenichi; Kato, Shigeaki; Eto, Masato; Ouchi, Yasuyoshi

    2010-03-05

    Recent epidemiological studies have found that androgen deficiency is associated with a higher incidence of cardiovascular disease in men. However, little is known about the mechanism underlying the cardioprotective effects of androgens. Here we show the inhibitory effects of testosterone on vascular calcification and a critical role of androgen receptor (AR)-dependent transactivation of growth arrest-specific gene 6 (Gas6), a key regulator of inorganic phosphate (P(i))-induced calcification of vascular smooth muscle cells (VSMC). Testosterone and nonaromatizable androgen dihydrotestosterone inhibited P(i)-induced calcification of human aortic VSMC in a concentration-dependent manner. Androgen inhibited P(i)-induced VSMC apoptosis, an essential process for VSMC calcification. The effects on VSMC calcification were mediated by restoration of P(i)-induced down-regulation of Gas6 expression and a subsequent reduction of Akt phosphorylation. These effects of androgen were blocked by an AR antagonist, flutamide, but not by an estrogen receptor antagonist, ICI 182,780. We then explored the mechanistic role of the AR in Gas6 expression and found an abundant expression of AR predominantly in the nucleus of VSMC and two consensus ARE sequences in the Gas6 promoter region. Dihydrotestosterone stimulated Gas6 promoter activity, and this effect was abrogated by flutamide and by AR siRNA. Site-specific mutation revealed that the proximal ARE was essential for androgen-dependent transactivation of Gas6. Furthermore, chromatin immunoprecipitation assays demonstrated ligand-dependent binding of the AR to the proximal ARE of Gas6. These results indicate that AR signaling directly regulates Gas6 transcription, which leads to inhibition of vascular calcification, and provides a mechanistic insight into the cardioprotective action of androgens.

  2. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    2004-12-01

    Full Text Available The human androgen receptor (AR gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  3. Peripheral androgen receptor gene suppression rescues disease in mouse models of spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Lieberman, Andrew P; Yu, Zhigang; Murray, Sue; Peralta, Raechel; Low, Audrey; Guo, Shuling; Yu, Xing Xian; Cortes, Constanza J; Bennett, C Frank; Monia, Brett P; La Spada, Albert R; Hung, Gene

    2014-05-01

    Spinal and bulbar muscular atrophy (SBMA) is caused by the polyglutamine androgen receptor (polyQ-AR), a protein expressed by both lower motor neurons and skeletal muscle. Although viewed as a motor neuronopathy, data from patients and mouse models suggest that muscle contributes to disease pathogenesis. Here, we tested this hypothesis using AR113Q knockin and human bacterial artificial chromosome/clone (BAC) transgenic mice that express the full-length polyQ-AR and display androgen-dependent weakness, muscle atrophy, and early death. We developed antisense oligonucleotides that suppressed AR gene expression in the periphery but not the CNS after subcutaneous administration. Suppression of polyQ-AR in the periphery rescued deficits in muscle weight, fiber size, and grip strength, reversed changes in muscle gene expression, and extended the lifespan of mutant males. We conclude that polyQ-AR expression in the periphery is an important contributor to pathology in SBMA mice and that peripheral administration of therapeutics should be explored for SBMA patients.

  4. Peripheral Androgen Receptor Gene Suppression Rescues Disease in Mouse Models of Spinal and Bulbar Muscular Atrophy

    Directory of Open Access Journals (Sweden)

    Andrew P. Lieberman

    2014-05-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA is caused by the polyglutamine androgen receptor (polyQ-AR, a protein expressed by both lower motor neurons and skeletal muscle. Although viewed as a motor neuronopathy, data from patients and mouse models suggest that muscle contributes to disease pathogenesis. Here, we tested this hypothesis using AR113Q knockin and human bacterial artificial chromosome/clone (BAC transgenic mice that express the full-length polyQ-AR and display androgen-dependent weakness, muscle atrophy, and early death. We developed antisense oligonucleotides that suppressed AR gene expression in the periphery but not the CNS after subcutaneous administration. Suppression of polyQ-AR in the periphery rescued deficits in muscle weight, fiber size, and grip strength, reversed changes in muscle gene expression, and extended the lifespan of mutant males. We conclude that polyQ-AR expression in the periphery is an important contributor to pathology in SBMA mice and that peripheral administration of therapeutics should be explored for SBMA patients.

  5. Androgen receptor gene polymorphisms lean mass and performance in young men.

    Science.gov (United States)

    Guadalupe-Grau, Amelia; Rodríguez-González, F Germán; Dorado, Cecilia; Olmedillas, Hugo; Fuentes, Teresa; Pérez-Gómez, Jorge; Delgado-Guerra, Safira; Vicente-Rodríguez, Germán; Ara, Ignacio; Guerra, Borja; Arteaga-Ortiz, Rafael; Calbet, José A L; Díaz-Chico, B Nicolás

    2011-02-01

    The exon-1 of the androgen receptor (AR) gene contains two repeat length polymorphisms which modify either the amount of AR protein inside the cell (GGN(n), polyglycine) or its transcriptional activity (CAG(n), polyglutamine). Shorter CAG and/or GGN repeats provide stronger androgen signalling and vice versa. To test the hypothesis that CAG and GGN repeat AR polymorphisms affect muscle mass and various variables of muscular strength phenotype traits, the length of CAG and GGN repeats was determined by PCR and fragment analysis and confirmed by DNA sequencing of selected samples in 282 men (28.6 ± 7.6 years). Individuals were grouped as CAG short (CAG(S)) if harbouring repeat lengths of ≤ 21 and CAG long (CAG(L)) if CAG >21. GGN was considered short (GGN(S)) or long (GGN(L)) if GGN ≤ 23 or >23, respectively. No significant differences in lean body mass or fitness were observed between the CAG(S) and CAG(L) groups, or between GGN(S) and GGN(L) groups, but a trend for a correlation was found for the GGN repeat and lean mass of the extremities (r=-0.11, p=0.06). In summary, the lengths of CAG and GGN repeat of the AR gene do not appear to influence lean mass or fitness in young men.

  6. Androgen receptor gene polymorphisms and risk of prostate cancer: a meta-analysis

    Science.gov (United States)

    Weng, Hong; Li, Sheng; Huang, Jing-Yu; He, Zi-Qi; Meng, Xiang-Yu; Cao, Yue; Fang, Cheng; Zeng, Xian-Tao

    2017-01-01

    Although the association between CAG and GGN repeats in the androgen receptor gene and prostate cancer risk has been widely studied, it remains controversial from previous meta-analyses and narrative reviews. Therefore, we performed this meta-analysis to provide more precise estimates with sufficient power. A total of 51 publications with 61 studies for CAG repeats and 14 publications with 16 studies for GGN repeats were identified in the meta-analysis. The results showed that short CAG repeats (repeats) carriers presented an elevated risk of prostate cancer than long CAG repeats (≥22) carriers (OR = 1.31, 95% CI 1.16 to 1.47). Prostate cancer cases presented an average fewer CAG repeats (MD = −0.85, 95% CI −1.28 to −0.42) than controls. Short GGN repeats (≤16) carriers presented an increased risk of prostate cancer than long GGN repeats (>16) carriers (OR = 1.38, 95% CI 1.05 to 1.82). In subgroup analyses, the abovementioned significant association was predominantly observed in Caucasian populations. The meta-analysis showed that short CAG and GGN repeats in androgen receptor gene were associated with increased risk of prostate cancer, especially in Caucasians. PMID:28091563

  7. Three novel and two known androgen receptor gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients

    Indian Academy of Sciences (India)

    BALACHANDRAN SARANYA; GUNASEKARAN BHAVANI; BRINDHA ARUMUGAM; MEENA JAYASHANKAR; SATHIYAVEDU THYAGARAJAN SANTHIYA

    2016-12-01

    Molecular characterization of 23 cytogenetically confirmed XY females was attempted by screening coding regions of SRY and androgen receptor (AR) genes. Five of the index cases showed sequence variations in various exons of the AR gene: a deletion (n.1911delG) and substitutions n.1761G>A and n.1317C>T in exon 1; n.3510C>T transition in exon 6 and deletion mutation (n.3672delT) in exon 7. Four mutations identified here lead to the formation of truncated receptor protein, involving a substantial loss of AR functional domains which explains the phenotype in the subjects. The n.1761G>A substitution has been previously reported in cases with mild androgen insensitivity. Although the ligand-binding domain was considered as the mutational hot spot in AR gene, we report here 3/5 variations in the N-terminal domain emphasizing the significance of considering the N-terminal domain of AR as well for mutation screening. Our present observation also strengthens the role of AR gene and its direct association with AIS.

  8. Molecular cell biology of androgen receptor signalling.

    Science.gov (United States)

    Bennett, Nigel C; Gardiner, Robert A; Hooper, John D; Johnson, David W; Gobe, Glenda C

    2010-06-01

    The classical action of androgen receptor (AR) is to regulate gene transcriptional processes via AR nuclear translocation, response element binding and recruitment of, or crosstalk with, transcription factors. AR also utilises non-classical, non-genomic mechanisms of signal transduction. These precede gene transcription or protein synthesis, and involve steroid-induced modulation of cytoplasmic or cell membrane-bound regulatory proteins. Despite many decades of investigation, the role of AR in gene regulation of cells and tissues remains only partially characterised. AR exerts most of its effects in sex hormone-dependent tissues of the body, but the receptor is also expressed in many tissues not previously thought to be androgen sensitive. Thus it is likely that a complex, more over-arching, role for AR exists. Each AR domain co-ordinates a multitude of individual and vital roles via a diverse array of interacting partner molecules that are necessary for cellular and tissue development and maintenance. Aberrant AR activity, promoted by mutations or binding partner misregulation, can present as many clinical manifestations including androgen insensitivity syndrome and prostate cancer. In the case of malignant prostate cancer, treatment generally revolves around androgen deprivation therapies designed to interfere with AR action and the androgen signalling axis. Androgen therapies for prostate cancer often fail, highlighting a real need for increased research into AR function.

  9. A precisely substituted benzopyran targets androgen refractory prostate cancer cells through selective modulation of estrogen receptors.

    Science.gov (United States)

    Kumar, Rajeev; Verma, Vikas; Sharma, Vikas; Jain, Ashish; Singh, Vishal; Sarswat, Amit; Maikhuri, Jagdamba P; Sharma, Vishnu L; Gupta, Gopal

    2015-03-15

    Dietary consumption of phytoestrogens like genistein has been linked with lower incidence of prostate cancer. The estradiol-like benzopyran core of genistein confers estrogen receptor-β (ER-β) selectivity that imparts weak anti-proliferative activity against prostate cancer cells. DL-2-[4-(2-piperidinoethoxy)phenyl]-3-phenyl-2H-1-benzopyran (BP), a SERM designed with benzopyran core, targeted androgen independent prostate cancer (PC-3) cells 14-times more potently than genistein, ~25% more efficiently than tamoxifen and 6.5-times more actively than ICI-182780, without forfeiting significant specificity in comparison to genistein. BP increased apoptosis (annexin-V and TUNEL labeling), arrested cell cycle, and significantly increased caspase-3 activity along with mRNA expressions of estrogen receptor (ER)-β and FasL (qPCR) in PC-3 cells. In classical ERE-luc reporter assay BP behaved as a potent ER-α antagonist and ER-β agonist. Accordingly, it decreased expression of ER-α target PS2 (P<0.01) and increased expression of ER-β target TNF-α (P<0.05) genes in PC-3. ER-β deficient PC-3 (siRNA-transfected) was resistant to apoptotic and anti-proliferative actions of SERMs, including stimulation of FasL expression by BP. BP significantly inhibited phosphorylation of Akt and ERK-1/2, JNK and p38 in PC-3 (immunoblotting), and thus adopted a multi-pathway mechanism to exert a more potent anti-proliferative activity against prostate cancer cells than natural and synthetic SERMs. Its precise ER-subtype specific activity presents a unique lead structure for further optimization.

  10. Tetrahydroquinolines as a novel series of nonsteroidal selective androgen receptor modulators: structural requirements for better physicochemical and biological properties.

    Science.gov (United States)

    Nagata, Naoya; Miyakawa, Motonori; Amano, Seiji; Furuya, Kazuyuki; Yamamoto, Noriko; Nejishima, Hiroaki; Inoguchi, Kiyoshi

    2011-11-01

    A rationally designed tetrahydroquinoline (1) for nonsteroidal selective androgen receptor modulators was modified for the exploration of promising compounds by Grieco three-component condensation using various dienophiles. Based on the in vitro effects and physicochemical properties of the synthesized compounds, compound 4c was selected for further study. Compound 4c increased the femoral bone mineral density as much as DHT, but it reduced the uterus effect compared with DHT in ovariectomized rats. Thus, compound 4c has desirable osteoanabolic effects with weak undesirable effects on the uterus in a female osteoporosis model.

  11. A precisely substituted benzopyran targets androgen refractory prostate cancer cells through selective modulation of estrogen receptors

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Rajeev; Verma, Vikas; Sharma, Vikas; Jain, Ashish; Singh, Vishal [Division of Endocrinology, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Sarswat, Amit [Division of Medicinal & Process Chemistry, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Maikhuri, Jagdamba P. [Division of Endocrinology, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Sharma, Vishnu L. [Division of Medicinal & Process Chemistry, CSIR—Central Drug Research Institute, Lucknow 226 031 (India); Gupta, Gopal, E-mail: g_gupta@cdri.res.in [Division of Endocrinology, CSIR—Central Drug Research Institute, Lucknow 226 031 (India)

    2015-03-15

    Dietary consumption of phytoestrogens like genistein has been linked with lower incidence of prostate cancer. The estradiol-like benzopyran core of genistein confers estrogen receptor-β (ER-β) selectivity that imparts weak anti-proliferative activity against prostate cancer cells. DL-2-[4-(2-piperidinoethoxy)phenyl]-3-phenyl-2H-1-benzopyran (BP), a SERM designed with benzopyran core, targeted androgen independent prostate cancer (PC-3) cells 14-times more potently than genistein, ~ 25% more efficiently than tamoxifen and 6.5-times more actively than ICI-182780, without forfeiting significant specificity in comparison to genistein. BP increased apoptosis (annexin-V and TUNEL labeling), arrested cell cycle, and significantly increased caspase-3 activity along with mRNA expressions of estrogen receptor (ER)-β and FasL (qPCR) in PC-3 cells. In classical ERE-luc reporter assay BP behaved as a potent ER-α antagonist and ER-β agonist. Accordingly, it decreased expression of ER-α target PS2 (P < 0.01) and increased expression of ER-β target TNF-α (P < 0.05) genes in PC-3. ER-β deficient PC-3 (siRNA-transfected) was resistant to apoptotic and anti-proliferative actions of SERMs, including stimulation of FasL expression by BP. BP significantly inhibited phosphorylation of Akt and ERK-1/2, JNK and p38 in PC-3 (immunoblotting), and thus adopted a multi-pathway mechanism to exert a more potent anti-proliferative activity against prostate cancer cells than natural and synthetic SERMs. Its precise ER-subtype specific activity presents a unique lead structure for further optimization. - Highlights: • BP with benzopyran core of genistein was identified for ER-β selective action. • BP was 14-times more potent than genistien in targeting prostate cancer cells. • It behaved as a potent ER-β agonist and ER-α antagonist in gene reporter assays. • BP's anti-proliferative action was inhibited significantly in ER-β deficient cells. • BP — a unique lead

  12. Natural proteasome inhibitor celastrol suppresses androgen-independent prostate cancer progression by modulating apoptotic proteins and NF-kappaB.

    Directory of Open Access Journals (Sweden)

    Yao Dai

    Full Text Available Celastrol is a natural proteasome inhibitor that exhibits promising anti-tumor effects in human malignancies, especially the androgen-independent prostate cancer (AIPC with constitutive NF-κB activation. Celastrol induces apoptosis by means of proteasome inhibition and suppresses prostate tumor growth. However, the detailed mechanism of action remains elusive. In the current study, we aim to test the hypothesis that celastrol suppresses AIPC progression via inhibiting the constitutive NF-κB activity as well as modulating the Bcl-2 family proteins.We examined the efficacy of celastrol both in vitro and in vivo, and evaluated the role of NF-κB in celastrol-mediated AIPC regression. We found that celastrol inhibited cell proliferation in all three AIPC cell lines (PC-3, DU145 and CL1, with IC₅₀ in the range of 1-2 µM. Celastrol also suppressed cell migration and invasion. Celastrol significantly induced apoptosis as evidenced by increased sub-G1 population, caspase activation and PARP cleavage. Moreover, celastrol promoted cleavage of the anti-apoptotic protein Mcl-1 and activated the pro-apoptotic protein Noxa. In addition, celastrol rapidly blocked cytosolic IκBα degradation and nuclear translocation of RelA. Likewise, celastrol inhibited the expression of multiple NF-κB target genes that are involved in proliferation, invasion and anti-apoptosis. Celastrol suppressed AIPC tumor progression by inhibiting proliferation, increasing apoptosis and decreasing angiogenesis, in PC-3 xenograft model in nude mouse. Furthermore, increased cellular IκBα and inhibited expression of various NF-κB target genes were observed in tumor tissues.Our data suggest that, via targeting the proteasome, celastrol suppresses proliferation, invasion and angiogenesis by inducing the apoptotic machinery and attenuating constitutive NF-κB activity in AIPC both in vitro and in vivo. Celastrol as an active ingredient of traditional herbal medicine could thus be

  13. Molecular analysis of the androgen receptor gene in Kennedy's disease. Report of two families and review of the literature.

    Science.gov (United States)

    Lumbroso, S; Lobaccaro, J M; Vial, C; Sassolas, G; Ollagnon, B; Belon, C; Pouget, J; Sultan, C

    1997-01-01

    We have performed a molecular analysis of the androgen receptor gene in two families with suspected Kennedy's disease (spinal and bulbar muscular atrophy, SBMA) with the aim of making a firm diagnosis of the disease. The 2 patients studied were sporadic cases. Both presented clinical signs compatible with the diagnosis of SBMA: limb and facial muscular weakness of adult onset progressing toward muscular atrophy. Clinical signs of partial androgen insensitivity syndrome usually observed in SBMA were present only in patient 2. Enzymatic amplification of the CAG repeat region of exon 1 of the androgen receptor gene was performed on genomic DNA. PCR products were submitted to agarose or acrylamide electrophoresis for size evaluation. Precise determination of the CAG number was performed by direct sequencing of purified amplification products. Androgen receptor gene analysis was also performed in 2 sisters of patient 1 and in the mother, sisters and daughter of patient 2. Androgen receptor-binding activity was also determined on cultured genital skin fibroblasts of patient 1. Analysis of PCR products showed in both patients a single band that was much larger in size than the control. The expansion of the CAG repeat number was confirmed by direct sequencing: the exact number of CAG was 47 in patient 1 and 42 in patient 2 (n = 12-32). The 2 studied sisters of patient 1 did not present the abnormal fragment, demonstrating they are not carriers for the disease. Conversely, the mother, sisters and daughter of patient 2 presented both normal and mutated alleles. The migration of the labelled PCR products on a sequencing gel revealed a meiotic instability of expanded CAG repeat in family 2. Moreover, patient 1 had a decreased androgen-binding capacity on cultured genital skin fibroblasts. In both families, analysis of the androgen receptor gene permitted us to diagnose SBMA in the patients and to establish the carrier status in siblings. These results correspond to the

  14. HDAC6 regulates androgen receptor hypersensitivity and nuclear localization via modulating Hsp90 acetylation in castration-resistant prostate cancer.

    Science.gov (United States)

    Ai, Junkui; Wang, Yujuan; Dar, Javid A; Liu, June; Liu, Lingqi; Nelson, Joel B; Wang, Zhou

    2009-12-01

    The development of castration-resistant prostate cancer (PCa) requires that under castration conditions, the androgen receptor (AR) remains active and thus nuclear. Heat shock protein 90 (Hsp90) plays a key role in androgen-induced and -independent nuclear localization and activation of AR. Histone deacetylase 6 (HDAC6) is implicated, but has not been proven, in regulating AR activity via modulating Hsp90 acetylation. Here, we report that knockdown of HDAC6 in C4-2 cells using short hairpin RNA impaired ligand-independent nuclear localization of endogenous AR and inhibited PSA expression and cell growth in the absence or presence of dihydrotestosterone (DHT). The dose-response curve of DHT-stimulated C4-2 colony formation was shifted by shHDAC6 such that approximately 10-fold higher concentration of DHT is required, indicating a requirement for HDAC6 in AR hypersensitivity. HDAC6 knockdown also inhibited C4-2 xenograft tumor establishment in castrated, but not in testes-intact, nude mice. Studies using HDAC6-deficient mouse embryonic fibroblasts cells showed that inhibition of AR nuclear localization by HDAC6 knockdown can be largely alleviated by expressing a deacetylation mimic Hsp90 mutant. Taken together, our studies suggest that HDAC6 regulates AR hypersensitivity and nuclear localization, mainly via modulating HSP90 acetylation. Targeting HDAC6 alone or in combination with other therapeutic approaches is a promising new strategy for prevention and/or treatment of castration-resistant PCa.

  15. Effect of small molecules modulating androgen receptor (SARMs in human prostate cancer models.

    Directory of Open Access Journals (Sweden)

    Anna Tesei

    Full Text Available The management of hormone-refractory prostate cancer represents a major challenge in the therapy of this tumor, and identification of novel androgen receptor antagonists is needed to render treatment more effective. We analyzed the activity of two novel androgen receptor antagonists, (S-11 and (R-9, in in vitro and in vivo experimental models of hormone-sensitive or castration-resistant prostate cancer (CRPC. In vitro experiments were performed on LNCaP, LNCaP-AR, LNCaP-Rbic and VCaP human prostate cancer cells. Cytotoxic activity was assessed by SRB and BrdU uptake, AR transactivation by luciferase reporter assay and PSA levels by Real Time RT-PCR and ELISA assays. Cell cycle progression-related markers were evaluated by western blot. In vivo experiments were performed on SCID mice xenografted with cells with different sensitivity to hormonal treatment. In hormone-sensitive LNCaP and LNCaP-AR cells, the latter expressing high androgen receptor levels, (R-9 and (S-11 exhibited a higher cytotoxic effect compared to that of the reference compound ((R-bicalutamide, also in the presence of the synthetic androgen R1881. Furthermore, the cytotoxic effect produced by (R-9 was higher than that of (S-11 in the two hormone-resistant LNCaP-AR and VCaP cells. A significant reduction in PSA levels was observed after exposure to both molecules. Moreover, (S-11 and (R-9 inhibited DNA synthesis by blocking the androgen-induced increase in cyclin D1 protein levels. In vivo studies on the toxicological profile of (R-9 did not reveal the presence of adverse events. Furthermore, (R-9 inhibited tumor growth in various in vivo models, especially LNCaP-Rbic xenografts, representative of recurrent disease. Our in vitro results highlight the antitumor activity of the two novel molecules (R-9 and (S-11, making them a potentially attractive option for the treatment of CRPC.

  16. Preliminary study on androgen dependence of calcitonin gene-related peptide in rat penis

    Institute of Scientific and Technical Information of China (English)

    Zhou-Jun Shen; Shan-Wen Chen; Ying-Li Lu; Liao-Yuan Li; Xie-Lai Zhou; Ming-Guang Zhang; Zhao-Dian Chen

    2005-01-01

    Aim: To study the androgen dependence of the neurotransmitter, calcitonin gene-related peptide (CGRP) in rat penis.Methods: Forty-four Sprague-Dawley rats were randomly divided into Group A (intact controls), Group B (castrated)group were anaesthetized. Blood samples were taken for the measurement of serum testosterone and dihydrotestosterone (DHT) by means of radioimmunoassay. Penile samples were harvested for the investigation of calcitonin gene related peptide (CGRP)-immunoreactive nerve fibers with immunohistochemistry. The computer-assisted imaging analysis system was applied to calculate the area proportion of the CGRP-positive nerve fibers (CGRP-PNF) in each group.Results: 1) Both 4 and 10 weeks later, testosterone and DHT levels in Group B decreased significantly compared with those in Group A, (P<0.05, P<0.01, respectively); DHT level in Group C was also significantly decreased in comparison with that in Group A for both 4- and 10- week animals (P < 0.05); 2) There was no significant differences in area proportion of CGRP-PNF among Groups A, B and C 4 weeks after treatments (P > 0.05); However, 10weeks later, the proportion of CGRP-PNF in Groups B and C was significantly less than that in Group A (P < 0.01);3) The proportion of CGRP-PNF of 4-week animals in Groups B and C was significantly higher than that of 10-week animals (P<0.05). Conclusion: The expression of neurotransmitter, CGRP may depend on androgens, including testosterone and DHT in rat penis.

  17. Polymorphic CAG Repeat and Protein Expression of Androgen Receptor Gene in Colorectal Cancer.

    Science.gov (United States)

    Huang, Rui; Wang, Guiyu; Song, Yanni; Wang, Feng; Zhu, Bing; Tang, Qingchao; Liu, Zheng; Chen, Yinggang; Zhang, Qian; Muhammad, Shan; Wang, Xishan

    2015-04-01

    Although somatic alterations in CAG repeats in the androgen receptor (AR) gene have been suggested to predispose to colorectal cancer, less is known about AR in colorectal cancer carcinogenesis. Because of lack of relevant analysis on CAG repeat length and AR expression in colorectal cancer, we aimed to investigate the prognostic value of polymorphic CAG and protein expression of the AR gene in patients with colorectal cancer. A case-control study was carried out on 550 patients with colorectal cancer and 540 healthy controls to investigate whether polymorphic CAG within the AR gene is linked to increased risk for colorectal cancer. Polymorphic CAG and AR expression were analyzed to clarify their relationship with clinicopathologic and prognostic factors in patients with colorectal cancer. The study showed that the AR gene in patients with colorectal cancer had a longer CAG repeat sequence than those in the control group, as well as increased risk for colorectal cancer among females (P = 0.013), males (P = 0.002), and total colorectal cancer population (P CAG repeat sequence among males (P CAG repeat sequence and negative AR expression were associated with a short 5-year overall survival (OS) rate in colorectal cancer. Long CAG repeat sequences and the absence of AR expression were closely related to the development of colorectal cancer. Both long CAG and decreased AR expression were correlated with the poor 5-year OS in patients with colorectal cancer.

  18. Androgen modulation of social decision making mechanisms in the brain: an integrative and embodied perspective

    Directory of Open Access Journals (Sweden)

    Rui F Oliveira

    2014-07-01

    Full Text Available Apart from their role in reproduction androgens also respond to social challenges and this response has been seen as a way to regulate the expression of behaviour according to the perceived social environment (Challenge hypothesis, Wingfield et al. 1990. This hypothesis implies that social decision-making mechanisms localized in the central nervous system (CNS are open to the influence of peripheral hormones that ultimately are under the control of the CNS through the hypothalamic-pituitary-gonadal axis. Therefore, two puzzling questions emerge at two different levels of biological analysis: (1 Why does the brain, which perceives the social environment and regulates androgen production in the gonad, need feedback information from the gonad to adjust its social decision-making processes? (2 How does the brain regulate gonadal androgen responses to social challenges and how do these feedback into the brain? In this paper, we will address these two questions using the integrative approach proposed by Niko Tinbergen, who proposed that a full understanding of behaviour requires its analysis at both proximate (physiology, ontogeny and ultimate (ecology, evolution levels.

  19. Rescue of Metabolic Alterations in AR113Q Skeletal Muscle by Peripheral Androgen Receptor Gene Silencing

    Directory of Open Access Journals (Sweden)

    Elisa Giorgetti

    2016-09-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA, a progressive degenerative disorder, is caused by a CAG/glutamine expansion in the androgen receptor (polyQ AR. Recent studies demonstrate that skeletal muscle is an important site of toxicity that contributes to the SBMA phenotype. Here, we sought to identify critical pathways altered in muscle that underlie disease manifestations in AR113Q mice. This led to the unanticipated identification of gene expression changes affecting regulators of carbohydrate metabolism, similar to those triggered by denervation. AR113Q muscle exhibits diminished glycolysis, altered mitochondria, and an impaired response to exercise. Strikingly, the expression of genes regulating muscle energy metabolism is rescued following peripheral polyQ AR gene silencing by antisense oligonucleotides (ASO, a therapeutic strategy that alleviates disease. Our data establish the occurrence of a metabolic imbalance in SBMA muscle triggered by peripheral expression of the polyQ AR and indicate that alterations in energy utilization contribute to non-neuronal disease manifestations.

  20. A unique mosaic Turner syndrome patient with androgen receptor gene derived marker chromosome.

    Science.gov (United States)

    Kalkan, Rasime; Özdağ, Nermin; Bundak, Rüveyde; Çirakoğlu, Ayşe; Serakinci, Nedime

    2016-01-01

    Patients with Turner syndrome are generally characterized by having short stature with no secondary sexual characteristics. Some abnormalities, such as webbed neck, renal malformations (>50%) and cardiac defects (10%) are less common. The intelligence of these patients is considered normal. Non-mosaic monosomy X is observed in approximately 45% of postnatal patients with Turner syndrome and the rest of the patients have structural abnormalities or mosaicism involving 46,X,i(Xq), 45,X/46,XX, 45,X and other variants. The phenotype of 45,X/46,X,+mar individuals varies by the genetic continent and degree of the mosaicism. The gene content of the marker chromosome is the most important when correlating the phenotype with the genotype. Here we present an 11-year-old female who was referred for evaluation of her short stature and learning disabilities. Conventional cytogenetic investigation showed a mosaic 45,X/46,X,+mar karyotype. Fluorescence in situ hybridization showed that the marker chromosome originated from the X chromosome within the androgen receptor (AR) and X-inactive specific transcript (XIST) genes. Therefore, it is possible that aberrant activation of the marker chromosome, compromising the AR and XIST genes, may modify the Turner syndrome phenotype.

  1. 选择性雄激素受体调节子的开发及其治疗应用%Development of Selective Androgen Receptor Modulators and Their Therapeutic Applications

    Institute of Scientific and Technical Information of China (English)

    Fang; Chen(

    2002-01-01

    Androgens control a broad range of physiological functions. The androgen receptor (AR), a steroid receptor that mediates the diverse biological actions of androgens, is a ligand inducible transcription factor. Abnormalities in the androgen signaling system result in many disturbances ranging from changes in gender determination and sexual development to psychiatric and emotional disorders. Androgen replacement therapy can improve many clinical conditions including hypogonadism and osteoporosis, but is limited by the lack of efficacious and safe therapeutic agents with easy delivery options. Recent progress in the area of gene regulation by steroid receptors and by selective receptor modulators provides an opportunity to examine if selective androgen receptor modulators (SARMs) could address some of the problems associated with current androgen therapy. Since the composition of the transcriptional initiation complex recruited by liganded AR determines the specificity of gene regulation, synthetic ligands aimed at initiating transcription of tissue and promoter specific genes offers hope for developing better androgen therapy. Establishment of assays that predict synthetic ligand activity is critical for SARM development. Advancement in high throughput compound screening and gene fingerprinting technologies, such as microarrays and proteomics, will facilitate and accelerate identification of effective SARMs.%雄激素控制着广泛的生理学功能.雄激素受体作为调节雄激素多种生物学作用的甾体类受体,是一种配基诱导的转录因子.雄激素信号系统的异常导致了从性别确定和性征发育到精神和情感失常的许多紊乱.雄激素替代治疗能改善许多临床症状,包括性腺机能低下与骨质疏松,但由于疗效不高和缺少方便给药的安全制剂而受到限制.最近甾体类受体和选择性受体调节子的基因调控技术,为选择性雄激素受体调节子能否解答现行雄激素治疗

  2. Androgen Receptor (AR) Promotes Abdominal Aortic Aneurysm (AAA) Development via Modulating Inflammatory IL1α and TGFβ1 Expression

    OpenAIRE

    Huang, Chiung-Kuei; Luo, Jie; Lai, Kuo-Pao; Wang, Ronghao; Pang, Haiyan; Chang, Eugene; Yan, Chen; Sparks, Janet; Lee, Soo Ok; Cho, Joshua; Chang, Chawnshang

    2015-01-01

    Gender difference is a risk factor for abdominal aortic aneurism formation yet the reason for male predominance remains unclear. Androgen and the androgen receptor influence the male gender difference, indicating that androgen receptor signaling may affect abdominal aortic aneurism development. Using angiotensin II induced abdominal aortic aneurism in apolipoprotein E null mouse models (82.4% abdominal aortic aneurism incidence), we found that mice lacking androgen receptor failed to develop ...

  3. A preliminary case study of androgen receptor gene polymorphism association with impulsivity in women with alcoholism

    Directory of Open Access Journals (Sweden)

    Mettman DJ

    2014-03-01

    Full Text Available Daniel J Mettman, Merlin G Butler, Albert B Poje, Elizabeth C Penick, Ann M Manzardo Departments of Psychiatry and Behavioral Sciences and Pediatrics, MS 4015, Kansas University Medical Center, Kansas City, KS, USA Objective: The androgen receptor (AR gene, located on the X chromosome, contains a common polymorphism involving cytosine-adenine-guanine (CAG repeats, which impacts disease and could contribute to the unequal sex ratio in alcoholism. CAG repeats in the AR gene are known to correlate with impulsivity in males. We report the first preliminary study examining the association between the number of CAG repeats and measures of impulsivity in females with chronic alcoholism. Methods: A total of 35 women and 85 men with chronic alcoholism were previously recruited for a nutritional clinical trial, and 26 well-characterized females (19 African–American and seven Caucasian with alcoholism agreed to participate for genetic testing. Genomic deoxyribonucleic acid (DNA was isolated from peripheral blood and CAG repeats determined by analyzing polymerase chain reaction (PCR-amplified products, using the polymorphic AR gene assay. CAG repeat length was correlated with raw scores from the Barratt Impulsivity Scale, version 11 and the Alcoholism Severity Scale. Results: CAG repeat lengths were significantly longer in Caucasian alcoholic women compared with African–Americans, and the average number of CAG repeats were significantly, positively correlated (P<0.05 with impulsivity scores. Women with average CAG repeat length (CAGave ≥18, representing the upper quartile of the repeat range, showed significantly greater mean raw impulsivity scores. CAG repeat length appeared to have less effect in African–American compared with Caucasian women, possibly due to a shorter average repeat length. Conclusion: We found an association between the number of CAG repeats and impulsivity in females with chronic alcoholism, specifically in women with CAGave

  4. Down-regulation of Zac1 gene expression in rat white adipose tissue by androgens.

    Science.gov (United States)

    Mirowska, Agnieszka; Sledzinski, Tomasz; Smolenski, Ryszard T; Swierczynski, Julian

    2014-03-01

    ZAC1 is a zinc-finger protein transcription factor, a transcriptional cofactor for nuclear receptors, and a co-activator of nuclear receptors, which interacts with multiple signaling pathways affecting apoptosis, cell cycle arrest, and metabolism. Some data suggest that ZAC1 regulates the expression of genes associated with function of adipose tissue. Since there is no information about the levels of Zac1 gene expression in white adipose tissue (WAT), and the expression of several genes associated with metabolic function of WAT is significantly lower in male than female animals, we have examined: (a) the relative ZAC1 mRNA levels in some organs/tissues, including three main depots of WAT, in 3-month-old male rats; (b) the relative ZAC1 mRNA levels in WAT of male and female rats; (c) the effect of orchidectomy and orchidectomy with concomitant testosterone treatment on ZAC1 mRNA and protein levels; (d) the effect of ovariectomy and ovariectomy with concomitant 17β-estradiol treatment on ZAC1 mRNA levels; (e) the effect of dihydrotestosterone on ZAC1 mRNA levels in isolated adipocytes. Our results indicate that: (a) ZAC1 mRNA levels are relatively high in WAT in comparison with other organs/tissues; (b) ZAC1 mRNA levels in subcutaneous WAT are approximately 2-fold lower than in epididymal and retroperitoneal adipose tissue; (c) ZAC1 mRNA levels in WAT of adult female rats are approximately 2-fold higher than in male rats; (d) testosterone is inversely related to ZAC1 mRNA and protein levels in WAT of male rats; and (e) dihydrotestosterone decreases the ZAC1 mRNA levels in adipocytes in dose dependent manner. In conclusion, Zac1 gene is highly expressed in white adipose tissue of adult rats. Androgens could play an important role in down-regulation of the ZAC1 mRNA and protein levels in rats.

  5. A selective androgen receptor modulator enhances male-directed sexual preference, proceptive behavior, and lordosis behavior in sexually experienced, but not sexually naive, female rats.

    Science.gov (United States)

    Kudwa, A E; López, F J; McGivern, R F; Handa, R J

    2010-06-01

    Androgens influence many aspects of reproductive behavior, including sexual preference of females for males. In oophorectomized women with sexual desire disorder, testosterone patches improve libido, but their use is limited because of adverse side effects. Selective androgen receptor modulators offer an improved safety profile for both sexes: enhancing libido and muscle and bone growth in a manner similar to steroidal androgens but with fewer adverse effects, such as hirsutism, acne, and prostate growth. The current study investigated the action of a novel selective androgen receptor modulator (LGD-3303 [9-chloro-2-ethyl-1-methyl-3-(2,2,2-trifluoroethyl)-3H-pyrrolo-[3,2-f]quinolin-7(6H)-one]) on male-directed sexual preference, proceptivity, and lordosis behavior of female rats. LGD-3303 is a nonsteroidal, nonaromatizable, highly selective ligand for the androgen receptor and effectively crosses the blood-brain barrier. Gonadectomized female rats were treated with LGD-3303 (3-30 mg/kg) or vehicle by daily oral gavage. Results showed that LGD-3303 treatment enhanced sexual preference of females for males but only if females had previous sexual experience. This occurred after 1 or 7 d of treatment. In contrast, preference for males was inhibited by LGD-3303 treatments of sexually naive females. The LGD-3303 increase in male preference was blocked by pretreatment with the androgen receptor antagonist flutamide. LGD-3303 treatment increased lordosis and proceptivity behaviors in ovariectomized females primed with suboptimal doses of estradiol benzoate plus progesterone. These data support the concept that LGD-3303 can stimulate aspects of female sexual behavior and may serve as a potential therapeutic for women with sexual desire disorders.

  6. Intra- and interspecific aggression do not modulate androgen levels in dusky gregories, yet male aggression is reduced by an androgen blocker.

    Science.gov (United States)

    Vullioud, Philippe; Bshary, Redouan; Ros, Albert Frank Huascar

    2013-08-01

    Discussions about social behavior are generally limited to fitness effects of interactions occurring between conspecifics. However, many fitness relevant interactions take place between individuals belonging to different species. Our detailed knowledge about the role of hormones in intraspecific interactions provides a starting point to investigate how far interspecific interactions are governed by the same physiological mechanisms. Here, we carried out standardized resident-intruder (sRI) tests in the laboratory to investigate the relationship between androgens and both intra- and interspecific aggression in a year-round territorial coral reef fish, the dusky gregory, Stegastes nigricans. This damselfish species fiercely defend cultivated algal crops, used as a food source, against a broad array of species, mainly food competitors, and thus represent an ideal model system for comparisons of intra-and interspecific territorial aggression. In a first experiment, resident S. nigricans showed elevated territorial aggression against intra- and interspecific intruders, yet neither elicited a significant increase in androgen levels. However, in a second experiment where we treated residents with flutamide, an androgen receptor blocker, males but not females showed decreased aggression, both towards intra- and interspecific intruders. Thus androgens appear to affect aggression in a broader territorial context where species identity of the intruder appears to play no role. This supports the idea that the same hormonal mechanism may be relevant in intra- and interspecific interactions. We further propose that in such a case, where physiological mechanisms of behavioral responses are found to be context dependent, interspecific territorial aggression should be considered a social behavior.

  7. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome

    OpenAIRE

    G Bhaskararao; Himabindu, Y; Samir Ranjan Nayak; M Sriharibabu

    2014-01-01

    Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen ...

  8. CAG repeat length in androgen receptor gene and male infertility in Egyptian patients.

    Science.gov (United States)

    Mosaad, Y M; Shahin, D; Elkholy, A A-M; Mosbah, A; Badawy, W

    2012-02-01

    The CAG repeat and its association with infertility has been debatable. Therefore, this study was planned to assess the distribution of CAG repeat expansion in Egyptian patients and to investigate its association with male infertility. Forty-five infertile men were eligible for the study in addition to 20 aged-matched fertile males as control. Semen analysis, scrotal sonography, assay of serum testosterone, follicle-stimulating hormone (FSH) and luteinising hormone (LH), and determination of the CAG repeat number within exon 1 of the androgen receptor (AR) gene were carried out. Statistically significant difference was found between infertile and control groups regarding sperm count, sperm motility, serum FSH level and CAG repeats (P CAG repeats (P = 1.0) was found between oligozoospermic and asthenospermic groups; negative correlation was found between CAG repeat length and sperm count, and a positive correlation was found between CAG repeat length and serum FSH (P CAG repeat may be associated with lower AR function with derangement of sperm production, and this may contribute to male infertility in Egyptian men.

  9. Rosemary (Rosmarinus officinalis) extract modulates CHOP/GADD153 to promote androgen receptor degradation and decreases xenograft tumor growth.

    Science.gov (United States)

    Petiwala, Sakina M; Berhe, Saba; Li, Gongbo; Puthenveetil, Angela G; Rahman, Ozair; Nonn, Larisa; Johnson, Jeremy J

    2014-01-01

    The Mediterranean diet has long been attributed to preventing or delaying the onset of cardiovascular disease, diabetes and various solid organ cancers. In this particular study, a rosemary extract standardized to carnosic acid was evaluated for its potential in disrupting the endoplasmic reticulum machinery to decrease the viability of prostate cancer cells and promote degradation of the androgen receptor. Two human prostate cancer cell lines, 22Rv1 and LNCaP, and prostate epithelial cells procured from two different patients undergoing radical prostatectomy were treated with standardized rosemary extract and evaluated by flow cytometry, MTT, BrdU, Western blot and fluorescent microscopy. A significant modulation of endoplasmic reticulum stress proteins was observed in cancer cells while normal prostate epithelial cells did not undergo endoplasmic reticulum stress. This biphasic response suggests that standardized rosemary extract may preferentially target cancer cells as opposed to "normal" cells. Furthermore, we observed standardized rosemary extract to decrease androgen receptor expression that appears to be regulated by the expression of CHOP/GADD153. Using a xenograft tumor model we observed standardized rosemary extract when given orally to significantly suppress tumor growth by 46% compared to mice not receiving standardized rosemary extract. In the last several years regulatory governing bodies (e.g. European Union) have approved standardized rosemary extracts as food preservatives. These results are especially significant as it is becoming more likely that individuals will be receiving standardized rosemary extracts that are a part of a natural preservative system in various food preparations. Taken a step further, it is possible that the potential benefits that are often associated with a "Mediterranean Diet" in the future may begin to extend beyond the Mediterranean diet as more of the population is consuming standardized rosemary extracts.

  10. Rosemary (Rosmarinus officinalis extract modulates CHOP/GADD153 to promote androgen receptor degradation and decreases xenograft tumor growth.

    Directory of Open Access Journals (Sweden)

    Sakina M Petiwala

    Full Text Available The Mediterranean diet has long been attributed to preventing or delaying the onset of cardiovascular disease, diabetes and various solid organ cancers. In this particular study, a rosemary extract standardized to carnosic acid was evaluated for its potential in disrupting the endoplasmic reticulum machinery to decrease the viability of prostate cancer cells and promote degradation of the androgen receptor. Two human prostate cancer cell lines, 22Rv1 and LNCaP, and prostate epithelial cells procured from two different patients undergoing radical prostatectomy were treated with standardized rosemary extract and evaluated by flow cytometry, MTT, BrdU, Western blot and fluorescent microscopy. A significant modulation of endoplasmic reticulum stress proteins was observed in cancer cells while normal prostate epithelial cells did not undergo endoplasmic reticulum stress. This biphasic response suggests that standardized rosemary extract may preferentially target cancer cells as opposed to "normal" cells. Furthermore, we observed standardized rosemary extract to decrease androgen receptor expression that appears to be regulated by the expression of CHOP/GADD153. Using a xenograft tumor model we observed standardized rosemary extract when given orally to significantly suppress tumor growth by 46% compared to mice not receiving standardized rosemary extract. In the last several years regulatory governing bodies (e.g. European Union have approved standardized rosemary extracts as food preservatives. These results are especially significant as it is becoming more likely that individuals will be receiving standardized rosemary extracts that are a part of a natural preservative system in various food preparations. Taken a step further, it is possible that the potential benefits that are often associated with a "Mediterranean Diet" in the future may begin to extend beyond the Mediterranean diet as more of the population is consuming standardized rosemary

  11. Modulation of gene expression made easy

    DEFF Research Database (Denmark)

    Solem, Christian; Jensen, Peter Ruhdal

    2002-01-01

    A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...... beta-glucuronidase, resulting in an operon structure in which both genes are transcribed from a common promoter. We show that there is a linear correlation between the expressions of the two genes, which facilitates screening for mutants with suitable enzyme activities. In a second example, we show......, overexpression was achieved by introducing an additional gene copy into a phage attachment site on the chromosome. This resulted in a series of strains with phosphofructokinase activities from 1.4 to 11 times the wild-type activity level. In this example, the pfk gene was cloned upstream of a gusA gene encoding...

  12. 3-alkoxy-pyrrolo[1,2-b]pyrazolines as selective androgen receptor modulators with ideal physicochemical properties for transdermal administration.

    Science.gov (United States)

    Ullrich, Thomas; Sasmal, Sanjita; Boorgu, Venkatesham; Pasagadi, Srinivasu; Cheera, Srisailam; Rajagopalan, Sujatha; Bhumireddy, Archana; Shashikumar, Dhanya; Chelur, Shekar; Belliappa, Charamanna; Pandit, Chetan; Krishnamurthy, Narasimharao; Mukherjee, Subhendu; Ramanathan, Anuradha; Ghadiyaram, Chakshusmathi; Ramachandra, Murali; Santos, Paulo G; Lagu, Bharat; Bock, Mark G; Perrone, Mark H; Weiler, Sven; Keller, Hansjoerg

    2014-09-11

    We describe the synthesis and characterization of 3-alkoxy-pyrrolo[1,2-b]pyrazolines as novel selective androgen receptor (AR) modulators that possess excellent physicochemical properties for transdermal administration. Compound 26 bound to human AR with an IC50 of 0.7 nM with great selectivity over other nuclear hormone receptors and potently activated AR in a C2C12 muscle cell reporter gene assay with an EC50 of 0.5 nM. It showed high aqueous solubility of 1.3 g/L at pH 7.4, and an in silico model as well as a customized parallel artificial membrane permeability assay indicated good skin permeation. Indeed, when measuring skin permeation through excised human skin, an excellent flux of 2 μg/(cm(2)·h) was determined without any permeation enhancers. In a 2 week Hershberger model using castrated rats, the compound showed dose-dependent effects fully restoring skeletal muscle weight at 0.3 mg/kg/day after subcutaneous administration with high selectivity over prostate stimulation.

  13. Selective Androgen Receptor Modulator RAD140 Is Neuroprotective in Cultured Neurons and Kainate-Lesioned Male Rats

    OpenAIRE

    2014-01-01

    The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed “selective androgen receptor modulators” (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in sel...

  14. Genotype versus phenotype in families with androgen insensitivity syndrome

    NARCIS (Netherlands)

    Boehmer, ALM; Bruggenwirth, H; Van Assendelft, C; Otten, BJ; Verleun-Mooijman, MCT; Niermeijer, MF; Brunner, HG; Rouwe, CW; Waelkens, JJ; Oostdijk, W; Kleijer, WJ; Van der Kwast, TH; De Vroede, MA; Drop, SLS

    2001-01-01

    Androgen insensitivity syndrome encompasses a wide range of phenotypes, which are caused by numerous different mutations in the AR gene. Detailed information on the genotype/ phenotype relationship in androgen insensitivity syndrome is important for sex assignment, treatment of androgen insensitivit

  15. The CAG repeat polymorphism of androgen receptor gene and prostate cancer: a meta-analysis.

    Science.gov (United States)

    Gu, Mingliang; Dong, Xiaoqun; Zhang, Xuezhi; Niu, Wenquan

    2012-03-01

    The association between the polymorphic CAG repeat in androgen receptor gene (AR) and prostate cancer susceptibility has been studied extensively. However, the results are contradictory. The purpose of our meta-analysis was to investigate whether CAG repeat related to prostate cancer risk and had genetic heterogeneity across different geographic regions and study designs. Random-effects model was performed irrespective of between-study heterogeneity. Data and study quality were assessed in duplicate. Publication bias was assessed by the fail-safe number and Egger's test. There were 16 (patients/controls: 2972/3792), 19 (3835/4908) and 12 (3372/2631) study groups for comparisons of ≥ 20, 22 and 23 repeats of CAG sequence, respectively. Compared with CAG repeat repeats had 21% (95% CI: 0.61-1.02; P = 0.076), 5% (95% CI: 0.81-1.11; P = 0.508) and 5% (95% CI: 0.76-1.20; P = 0.681) decreased risk of prostate cancer. After classifying studies by geographic areas, carriers of ≥ 20 repeats had 11% decreased risk in populations from USA, 53% from Europe, and 20% from Asia (P > 0.05), whereas comparison of ≥ 23 repeats with others generated a significant prediction in European populations (OR = 1.17; P = 0.039). Stratification by study designs revealed no material changes in risk estimation. Meta-regression analysis found no significant sources of between-study heterogeneity for age, study design and geographic region for all comparisons. There was no identified publication bias. Taken together, our results demonstrated that AR CAG repeat polymorphism with ≥ 20 repeats might confer a protective effect among the prostate cancer patients with 45 years older but not all the prostate cancer patients.

  16. 1-(2-Hydroxy-2-methyl-3-phenoxypropanoyl)indoline-4-carbonitrile derivatives as potent and tissue selective androgen receptor modulators.

    Science.gov (United States)

    Piatnitski Chekler, Eugene L; Unwalla, Rayomond; Khan, Taukeer A; Tangirala, Raghuram S; Johnson, Mark; St Andre, Michael; Anderson, James T; Kenney, Thomas; Chiparri, Sue; McNally, Chris; Kilbourne, Edward; Thompson, Catherine; Nagpal, Sunil; Weber, Gregory; Schelling, Scott; Owens, Jane; Morris, Carl A; Powell, Dennis; Verhoest, Patrick R; Gilbert, Adam M

    2014-03-27

    We present a novel series of selective androgen receptor modulators (SARMs) which shows excellent biological activity and physical properties. 1-(2-Hydroxy-2-methyl-3-phenoxypropanoyl)-indoline-4-carbonitriles showed potent binding to the androgen receptor (AR) and activated AR-mediated transcription in vitro. Representative compounds demonstrated diminished activity in promoting the intramolecular interaction between the AR carboxyl (C) and amino (N) termini. This N/C-termini interaction is a biomarker assay for the undesired androgenic responses in vivo. In orchidectomized rats, daily administration of a lead compound from this series showed anabolic activity by increasing levator ani muscle weight. Importantly, minimal androgenic effects (increased tissue weights) were observed in the prostate and seminal vesicles, along with minimal repression of circulating luteinizing hormone (LH) levels and no change in the lipid and triglyceride levels. This lead compound completed a two week rat toxicology study, and was well tolerated at doses up to 100 mg/kg/day, the highest dose tested, for 14 consecutive days.

  17. GLI1, a crucial mediator of sonic hedgehog signaling in prostate cancer, functions as a negative modulator for androgen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Guangchun; Goto, Yutaka; Sakamoto, Ryuichi; Tanaka, Kimitaka; Matsubara, Eri [Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Nakamura, Masafumi [Department of Cancer Therapy and Research, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Zheng, Hong [School of Pharmacy, Second Military Medical University, Shanghai 200433 (China); Lu, Jian [Department of Pathophysiology, Second Military Medical University, Shanghai 200433 (China); Takayanagi, Ryoichi [Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Nomura, Masatoshi, E-mail: nomura@med.kyushu-u.ac.jp [Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan)

    2011-01-21

    Research highlights: {yields} GLI1, which play a central role in sonic hedgehog signaling in prostate cancer, can act as a co-repressor to substantially block androgen receptor-mediated transactivation. {yields} GLI1 directly interacts with AR. {yields} SHH-GLI pathway might be one of determinants governing the transition of prostate cancer from an androgen-dependent to an androgen-independent state. -- Abstract: Sonic hedgehog (SHH) signaling, acting in a combinatorial manner with androgen signaling, is essential for prostate patterning and development. Recently, elevated activation of SHH signaling has been shown to play important roles in proliferation, progression and metastasis of prostate cancer. In this report, we demonstrate for the first time, that GLI1, which has been shown to play a central role in SHH signaling in prostate cancer, can act as a co-repressor to substantially block androgen receptor (AR)-mediated transactivation, at least in part, by directly interacting with AR. Our observations suggest that the SHH-GLI pathway might be one of determinants governing the transition of prostate cancer from an androgen-dependent to an androgen-independent state by compensating, or even superseding androgen signaling.

  18. Gene expression changes in rat prostate after activation or blocking of the androgen and estrogen receptor

    DEFF Research Database (Denmark)

    Nellemann, Christine Lydia; Dalgaard, Majken; Holst, Bjørn;

    2005-01-01

    Several endpoints of different molecular complexity were studied in the Hershberger assay in order to evaluate the specificity and suitability of this test as a broad screening model. Androgen and estrogen receptors were activated or blocked, and expression of typical estrogen- or androgen...... and the anti-estrogen, ICI 182780, only affected ODC expression. Therefore, estrogenic or anti-estrogenic compounds would not be expected to seriously affect the outcome of a Hershberger test. However, EB given alone to castrated rats resulted in various effects. EB increased seminal vesicle weight, an effect...... reversed by ICI 182780, and affected TRPM-2, PBP C3, ODC, IGF-1, AR, and ERa mRNA levels. AR expression in the prostate seemed to be under regulation of both estrogens and androgens, as ICI 182780 inhibited the testosterone-induced AR expression, and flutamide inhibited the EB-induced AR expression...

  19. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome.

    Science.gov (United States)

    Bhaskararao, G; Himabindu, Y; Nayak, Samir Rajan; Sriharibabu, M

    2014-07-01

    Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen insensitivity syndrome, and partial androgen insensitivity syndrome. Management of androgen insensitivity syndrome includes multidisciplinary approach and involves gonedectomy to avoid gonadal tumors in later life. Hormone replacement therapy (HRT) and psychological support are required in long-term basis.

  20. Polymorphic CAG and GGC repeat lengths in the androgen receptor gene and prostate cancer risk: analysis of a Brazilian population.

    Science.gov (United States)

    Silva Neto, Brasil; Koff, Walter J; Biolchi, Vanderlei; Brenner, Cleber; Biolo, Karlo D; Spritzer, Poli Mara; Brum, Ilma S

    2008-02-01

    Variations in transcriptional activity of the androgen receptor (AR) are related to polymorphic CAG and GGC repeats in exon 1 of the AR gene. We investigated the association between CAG and GGC repeat length and the risk of prostate cancer in a case-control study from a Brazilian population. We evaluated 49 patients and 51 healthy controls. DNA was extracted from peripheral leukocytes and the AR gene was analyzed by fragment analysis (GeneMapper software, Applied Biosystems, Foster City, California, USA). CAG and GGC mean lengths were not different between cases and controls. The risk for prostate cancer was higher for CAG repeats repeat lengths (CAG + GGC) repeats ( 17) were not associated with risk for prostate cancer (OR = 1.13 [95% CI 0.47-2.75]). In conclusion, fewer number of CAG repeats and total repeats (CAG + GGC) in the AR gene may be associated with increased risk for prostate cancer.

  1. SIRT1 modulates aggregation and toxicity through deacetylation of the androgen receptor in cell models of SBMA.

    Science.gov (United States)

    Montie, Heather L; Pestell, Richard G; Merry, Diane E

    2011-11-30

    Posttranslational protein modifications can play a major role in disease pathogenesis; phosphorylation, sumoylation, and acetylation modulate the toxicity of a variety of proteotoxic proteins. The androgen receptor (AR) is substantially modified, in response to hormone binding, by phosphorylation, sumoylation, and acetylation; these modifications might thus contribute to DHT-dependent polyglutamine (polyQ)-expanded AR proteotoxicity in spinal and bulbar muscular atrophy (SBMA). SIRT1, a nuclear protein and deacetylase of the AR, is neuroprotective in many neurodegenerative disease models. Our studies reveal that SIRT1 also offers protection against polyQ-expanded AR by deacetylating the AR at lysines 630/632/633. This finding suggested that nuclear AR acetylation plays a role in the aberrant metabolism and toxicity of polyQ-expanded AR. Subsequent studies revealed that the polyQ-expanded AR is hyperacetylated and that pharmacologic reduction of acetylation reduces mutant AR aggregation. Moreover, genetic mutation to inhibit polyQ-expanded AR acetylation of lysines 630/632/633 substantially decreased its aggregation and completely abrogated its toxicity in cell lines and motor neurons. Our studies also reveal one means by which the AR acetylation state likely modifies polyQ-expanded AR metabolism and toxicity, through its effect on DHT-dependent AR stabilization. Overall, our findings reveal a neuroprotective function of SIRT1 that operates through its deacetylation of polyQ-expanded AR and highlight the potential of both SIRT1 and AR acetylation as powerful therapeutic targets in SBMA.

  2. Pharmacokinetic drug interactions of the selective androgen receptor modulator GTx-024(Enobosarm) with itraconazole, rifampin, probenecid, celecoxib and rosuvastatin.

    Science.gov (United States)

    Coss, Christopher C; Jones, Amanda; Dalton, James T

    2016-08-01

    GTx-024 (also known as enobosarm) is a first in class selective androgen receptor modulator being developed for diverse indications in oncology. Preclinical studies of GTx-024 supported the evaluation of several potential drug-drug interactions in a clinical setting. A series of open-label Phase I GTx-024 drug-drug interaction studies were designed to interrogate potential interactions with CYP3A4 inhibitor (itraconazole), a CYP3A4 inducer (rifampin), a pan-UGT inhibitor (probenecid), a CYP2C9 substrate (celecoxib) and a BCRP substrate (rosuvastatin). The plasma pharmacokinetics of GTx-024, its major metabolite (GTx-024 glucuronide), and each substrate were characterized in detail. Itraconazole administration had no effect on GTx-024 pharmacokinetics. Likewise, GTx-024 administration did not significantly change the pharmacokinetics of celecoxib or rosuvastatin. Rifampin administration had the largest impact on GTx-024 pharmacokinetics of any co-administered agent and reduced the maximal plasma concentration (Cmax) by 23 % and the area under the curve (AUC∞) by 43 %. Probenecid had a complex interaction with GTx-024 whereby both GTx-024 plasma levels and GTx-024 glucuronide plasma levels (AUC∞) were increased by co-administration of the UGT inhibitor (50 and 112 %, respectively). Overall, GTx-024 was well tolerated and poses very little risk of generating clinically relevant drug-drug interactions.

  3. Subtle structural changes in tetrahydroquinolines, a new class of nonsteroidal selective androgen receptor modulators, induce different functions.

    Science.gov (United States)

    Nagata, Naoya; Kawai, Kentaro; Nakanishi, Isao

    2012-08-27

    Tetrahydroquinolines (THQs), a new class of nonsteroidal selective androgen receptor (AR) modulators, have two indispensable functional groups, that is, a hydroxyl group for AR binding and a nitro group for agonistic activity. Interestingly, switching the nitro to a cyano group, the compound acts as an antagonist. To understand this phenomenon, molecular dynamics simulations were applied for dihydrotestosterone (DHT) and representative THQs complexes with AR. Upon ligand binding, the hydroxyl group formed a tight hydrogen-bond (H-bond) with Asn705 on Helix 3 (H3). The immobilization of Asn705 on H3 is helpful in the formation of tight H-bonds with Asp890 on loop 11-12, and this immobilization consequently leads to a stabilization of H12. The difference in the DHT carbonyl isosteres affected the presence or absence of the H-bonds between the hydroxyl group of THQ and Thr877 and the distortion of H12, which is caused by the methyl group of THQ. Thus, the binding, agonist, and antagonist functions were controlled by subtle structural changes in THQ.

  4. Analysis of selective androgen receptor modulators by gas chromatography-microchip atmospheric pressure photoionization-mass spectrometry.

    Science.gov (United States)

    Luosujärvi, Laura; Haapala, Markus; Thevis, Mario; Saarela, Ville; Franssila, Sami; Ketola, Raimo A; Kostiainen, Risto; Kotiaho, Tapio

    2010-02-01

    A gas chromatography-microchip atmospheric pressure photoionization-mass spectrometric (GC-microAPPI-MS) method was developed and used for the analysis of three 2-quinolinone-derived selective androgen receptor modulators (SARMs). SARMs were analyzed from spiked urine samples, which were hydrolyzed and derivatized with N-methyl-N-(trimethylsilyl)trifluoroacetamide before analysis. Trimethylsilyl derivatives of SARMs formed both radical cations (M(+*)) and protonated molecules ([M + H](+)) in photoionization. Better signal-to-noise ratios (S/N) were obtained in MS/MS analysis using the M(+*) ions as precursor ions than using the [M + H](+) ions, and therefore the M(+*) ions were selected for the precursor ions in selected reaction monitoring (SRM) analysis. Limits of detection (LODs) with the method ranged from 0.01 to 1 ng/mL, which correspond to instrumental LODs of 0.2-20 pg. Limits of quantitation ranged from 0.03 to 3 ng/mL. The mass spectrometric response to the analytes was linear (R > or = 0.995) from the LOQ concentration level up to 100 ng/mL concentration, and intra-day repeatabilities were 5%-9%. In addition to the GC-microAPPI-MS study, the proof-of-principle of gas chromatography-microchip atmospheric pressure chemical ionization-Orbitrap MS (GC-microAPCI-Orbitrap MS) was demonstrated.

  5. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis

    OpenAIRE

    Pan, Bihui; Li, Rui; CHEN, YAO; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Hongjuan DING; Xia,Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-01-01

    Abstract The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports. We searched for reports published before August 2015 using PubMed, CNKI, VIP, an...

  6. The mouse salivary androgen-binding protein (ABP) gene cluster on chromosomes 7: characterization and evolutionary relationships.

    Science.gov (United States)

    Laukaitis, Christina M; Dlouhy, Stephen R; Karn, Robert C

    2003-10-01

    Mouse salivary androgen-binding protein (ABP) is a pair of dimers, composed of an alpha subunit disulfide bridged to either a beta or a gamma subunit. It has been proposed that each subunit is encoded by a distinct gene: Abpa, Abpb, and Abpg for the alpha, beta, and gamma subunits, respectively. We report here the structures and sequences of the genes that encode these three subunits. Each gene has three exons separated by two introns. Mouse salivary ABP is a member of the secretoglobin family, and we compare the structure of the three ABP subunit genes to those of 18 other mammalian secretoglobins. We map the three genes as a gene cluster located 10 cM from the centromere of Chromosome (Chr) 7 and show that Abpa is the closest of the three to the gene for glucose phosphate isomerase (GPI) and that Abpg is the closest to the centromere, with Abpb mapping between them. Abpa is oriented in the opposite direction to Abpb and Abpg, with its 5' end directed toward their 5' ends. We compare the location of these genes with other secretoglobin genes in the mouse genome and with the known locations of secretoglobin genes in the human genome and present evidence that strong positive selection has driven the divergence of the coding regions of Abpb and Abpg since the putative duplication event that created them.

  7. Exposure to paper mill effluent at a site in North Central Florida elicits molecular-level changes in gene expression indicative of progesterone and androgen exposure.

    Science.gov (United States)

    Brockmeier, Erica K; Jayasinghe, B Sumith; Pine, William E; Wilkinson, Krystan A; Denslow, Nancy D

    2014-01-01

    Endocrine disrupting compounds (EDCs) are chemicals that negatively impact endocrine system function, with effluent from paper mills one example of this class of chemicals. In Florida, female Eastern mosquitofish (Gambusia holbrooki) have been observed with male secondary sexual characteristics at three paper mill-impacted sites, indicative of EDC exposure, and are still found at one site on the Fenholloway River. The potential impacts that paper mill effluent exposure has on the G. holbrooki endocrine system and the stream ecosystem are unknown. The objective of this study was to use gene expression analysis to determine if exposure to an androgen receptor agonist was occurring and to couple this analysis with in vitro assays to evaluate the presence of androgen and progesterone receptor active chemicals in the Fenholloway River. Focused gene expression analyses of masculinized G. holbrooki from downstream of the Fenholloway River paper mill were indicative of androgen exposure, while genes related to reproduction indicated potential progesterone exposure. Hepatic microarray analysis revealed an increase in the expression of metabolic genes in Fenholloway River fish, with similarities in genes and biological processes compared to G. holbrooki exposed to androgens. Water samples collected downstream of the paper mill and at a reference site indicated that progesterone and androgen receptor active chemicals were present at both sites, which corroborates previous chemical analyses. Results indicate that G. holbrooki downstream of the Fenholloway River paper mill are impacted by a mixture of both androgens and progesterones. This research provides data on the mechanisms of how paper mill effluents in Florida are acting as endocrine disruptors.

  8. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  9. Elevated expression of steroidogenesis pathway genes; CYP17, GATA6 and StAR in prenatally androgenized rats.

    Science.gov (United States)

    Jahromi, Marziyeh Salehi; Tehrani, Fahimeh Ramezani; Noroozzadeh, Mahsa; Zarkesh, Maryam; Ghasemi, Asghar; Zadeh-Vakili, Azita

    2016-11-15

    It is believed that excess androgen exposure of the fetus, via altered gene expression, causes hyperandrogenism a key feature of polycystic ovary syndrome (PCOS). The aim of this study was to evaluate expression of Cytochrome P450-17 (CYP17), GATA-binding protein (GAGT6) and Steroidogenic acute regulatory protein (StAR), genes of adult female rats prenatally exposed to androgen excess, closely reflect endocrine and ovarian disturbances of PCOS in women, by comparing them during different phases of estrus cycle with those of non-treated rats. Both the adult prenatally testosterone exposed and control rats (n=23, each) were divided into four groups based on their observed vaginal smear (proestrus, estrus, metestrus and diestrus) and the relative expression of CYP17, GATA6 and StAR genes was measured in ovarian theca cells using Cyber-green Real-Time PCR. Serum sex steroid hormones and gonadotropins levels were measured using the ELISA method; a comparison of these two groups showed that there was an overall increase in the studied genes (CYP17; 2.39 fold change, 95% CI: 1.23-3.55; P<0.05, GATA6; 2.08 fold change, 95% CI: 1.62-2.55; P<0.0001, and StAR; 1.4 fold change, 95% CI: 1.02-1.78; P<0.05), despite variations in different phases with maximum elevation for all genes in diestrus. The changes observed may impair the normal development of ovaries that mediate the programming of adult PCOS.

  10. Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance

    DEFF Research Database (Denmark)

    Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun;

    2014-01-01

    Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity...... in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls....... Glucose transport in myotubes was comparable in patients with PCOS vs. controls and was unchanged by testosterone treatment (p=0.21 PCOS vs. controls). These results suggest that testosterone treatment of myotubes increases the aromatase and androgen receptor gene expression without affecting insulin...

  11. Androgen receptor expression in human ovarian and uterine tissue of long term androgen-treated transsexual women

    NARCIS (Netherlands)

    D. Chadha; T.D. Pache; F.J. Huikeshoven (Frans); A.O. Brinkmann (Albert); Th.H. van der Kwast (Theo)

    1994-01-01

    textabstractAndrogen receptor (AR) modulation in human uteri and ovaries of long term androgen-treated transsexual female patients was investigated. Androgen receptor expression was evaluated immunohistochemically in the ovaries of 11 and the endometria and myometria of six androgen-treated transsex

  12. Androgen receptor gene CAG and GGN repeat polymorphisms in Chilean men with primary severe spermatogenic failure.

    Science.gov (United States)

    Castro-Nallar, Eduardo; Bacallao, Ketty; Parada-Bustamante, Alexis; Lardone, María C; López, Patricia V; Madariaga, Marcia; Valdevenito, Raúl; Piottante, Antonio; Ebensperger, Mauricio; Castro, Andrea

    2010-01-01

    There is ample documentation supporting the fact that androgens are required for normal spermatogenesis. A minority of infertile men have abnormal testosterone blood levels or mild androgen receptor mutations. We investigated the androgen receptor CAG and GGN repeat lengths in Chilean men with spermatogenic impairment. We studied 117 secretory azoospermic/oligozoospermic men (93 idiopathic and 24 excryptorchidic), without Y-chromosome microdeletions, and 121 controls with normal spermatogenesis (42 obstructive and 79 normozoospermic men). Peripheral blood was drawn to obtain genomic DNA for polymerase chain reaction and automated sequencing of CAG and GGN repeats. Testicular characterization included hormonal studies, physical evaluation, and seminal and biopsy analysis. The CAG and GGN polymorphism distributions were similar among idiopathic men, excryptorchidic men, and controls and among the different types of spermatogenic impairment. However, the proportion of the CAG 21 allele was significantly increased in idiopathic cases compared to controls (P = .012 by Bonferroni test, odds ratio = 2.99, 95% confidence interval, 1.27-7.0) and the CAG 32 allele only was observed in excryptorchidic patients (P CAG 21 allele (P = .024, χ(2) test). On the other hand, in idiopathic cases and controls the most common GGN allele was 23, followed by 24, but an inverse relation was found among excryptorchidic cases. The joint distribution of CAG and GGN in control, idiopathic, and excryptorchidic groups did not show an association between the 2 allele repeat polymorphisms (P > 0.05, χ(2) test). Our results suggest that the CAG 21 allele seems to increase the risk of idiopathic Sertoli cell-only syndrome. Moreover, the GGN 24 allele could be contributing to deranged androgen receptor function, associated with cryptorchidism and spermatogenic failure.

  13. CAG repeat polymorphism in androgen receptor gene is not directly associated with polycystic ovary syndrome but influences serum testosterone levels.

    Science.gov (United States)

    Skrgatic, L; Baldani, D Pavicic; Cerne, J Z; Ferk, P; Gersak, K

    2012-02-01

    Hyperandrogenemia has been the most consistent feature of polycystic ovary syndrome (PCOS). Androgens exert their effects through androgen receptors (ARs). The expansion of the codon CAG trinucleotide repeat polymorphism in exon 1 of the AR gene represents a type of genetic alteration associated with changes in the AR gene function. The purpose of this study was to establish a possible association of the AR gene CAG repeat length polymorphism with PCOS, and its influence on clinical and biochemical androgen traits. Two hundred and fourteen Croatian women with PCOS and 209 healthy control women of reproductive age were enrolled. Phenotypic hyperandrogenism, BMI and waist to hip ratio were recorded. Hormonal profiles, fasting insulin and glucose levels were measured on cycle days 3-5. Genotyping of the CAG repeat polymorphism in the AR gene was performed. We found no significant difference in the mean CAG repeat number between the PCOS patients and controls (22.1±3.4 vs. 21.9±3.2, P=0.286). There was a positive correlation between the CAG repeat length and total testosterone (TT) in the PCOS group (R=0.225, P=0.015). A multiple linear regression model using mean CAG repeat length, BMI, age and HOMA-IR as predictors explained 8.5% (adjusted R²) of the variability in serum TT levels. In this model the CAG repeat polymorphism was found to be a significant predictor of serum TT levels in PCOS patients (P=0.015). The logistic regression analysis revealed that the CAG repeat length is not a significant predictor of hirsutism and acne status (P=0.921 and P=0.437, respectively). The model was adjusted for serum TT, free testosterone, androstendione and DHEAS levels as independent variables, which were also not found to be significant predictors of hirsutism (P=0.687, P=0.194, P=0.675 and P=0.938, respectively) or acne status (P=0.594, P=0.095, P=0.290 and P=0.151, respectively). In conclusion, the AR CAG repeat polymorphism is not a major determinant of PCOS in the

  14. CD8+ T cells promote proliferation of benign prostatic hyperplasia epithelial cells under low androgen level via modulation of CCL5/STAT5/CCND1 signaling pathway

    Science.gov (United States)

    Yang, Yang; Hu, Shuai; Liu, Jie; Cui, Yun; Fan, Yu; Lv, Tianjing; Liu, Libo; Li, Jun; He, Qun; Han, Wenke; Yu, Wei; Sun, Yin; Jin, Jie

    2017-01-01

    Previous studies by our group have shown that low intra-prostatic dihydrotestosterone (DHT) induced BPH epithelial cells (BECs) to recruit CD8+ T cells. However, the influence of the recruited CD8+ T cells on BECs under a low androgen level is still unknown. Here, we found CD8+ T cells have the capacity to promote proliferation of BECs in low androgen condition. Mechanism dissection revealed that interaction between CD8+ T cells and BECs through secretion of CCL5 might promote the phosphorylation of STAT5 and a higher expression of CCND1 in BECs. Suppressed CCL5/STAT5 signals via CCL5 neutralizing antibody or STAT5 inhibitor Pimozide led to reverse CD8+ T cell-enhanced BECs proliferation. IHC analysis from Finasteride treated patients showed PCNA expression in BECs was highly correlated to the level of CD8+ T cell infiltration and the expression of CCL5. Consequently, our data indicated infiltrating CD8+ T cells could promote the proliferation of BECs in low androgen condition via modulation of CCL5/STAT5/CCND1 signaling. The increased secretion of CCL5 from the CD8+ T cells/BECs interaction might help BECs survive in a low DHT environment. Targeting these signals may provide a new potential therapeutic approach to better treat BPH patients who failed the therapy of 5α-reductase inhibitors. PMID:28216616

  15. Androgen-androgen receptor system improves chronic inflammatory conditions by suppressing monocyte chemoattractant protein-1 gene expression in adipocytes via transcriptional regulation.

    Science.gov (United States)

    Morooka, Nobukatsu; Ueguri, Kei; Yee, Karen Kar Lye; Yanase, Toshihiko; Sato, Takashi

    2016-09-02

    Age-related decreases in sex hormones are closely related to chronic inflammation in obesity and metabolic diseases. Particularly, the molecular basis of androgen activity in regulating inflammation and controlling metabolism remains largely unknown. Obese adipocytes secrete monocyte chemoattractant protein-1 (MCP-1), a key chemokine that promotes the infiltration of monocytes/macrophages into adipose tissue, thereby leading to metabolic disorders. Here, we studied the role of androgen-androgen receptor (AR) action in regulating MCP-1 expression in adipose tissue. We observed the induction of Mcp-1 expression in 3T3-L1 adipocytes co-cultured with RAW264.7 macrophages. Additionally, Mcp-1 expression was upregulated by culturing in conditioned medium derived from inflammatory macrophages (M1-Mφ) containing tumor necrosis factor-alpha (TNF-α). We found that sex hormones downregulated TNF-α-induced Mcp-1 and interleukin (Il)-6 expression in 3T3-L1 adipocytes. Furthermore, luciferase-reporter analysis indicated that MCP-1 promoter activity was predominantly suppressed by dihydrotestosterone (DHT)-AR interactions through functional canonical nuclear factor-kappa B (NF-κB) sites, whereas non-canonical NF-κB site containing important flanking sequences exhibited minor contributions to DHT-AR transcriptional repression. These findings suggested that androgen-AR suppressed obesity-induced chronic inflammation in adipose tissue.

  16. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis.

    Science.gov (United States)

    Pan, Bihui; Li, Rui; Chen, Yao; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-03-01

    The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports.We searched for reports published before August 2015 using PubMed, CNKI, VIP, and WanFang. Data on sample size, mean, and standard deviation (SD) of AR-CAG repeat length were extracted independently by 3 investigators.Forty-four reports were selected based on criteria. The overall infertile patients and azoospermic patients were found to have longer AR-CAG repeat length (standard mean difference (SMD) = 0.19, 95% confidence interval (CI): 0.10-0.28, P CAG repeat length was longer in infertile men in Asian, Caucasian, and mixed races (SMD = 0.25, 95% CI: 0.08-0.43, P CAG repeat length was associated with male infertility. The subgroup study on races shows that increased AR-CAG repeat length was associated with male infertility in Asian, Caucasian, and mixed races. Increased AR-CAG repeat length was also associated with azoospermia.This meta-analysis supports that increased androgen receptor CAG length is capable of causing male infertility susceptibility.

  17. 雄激素受体基因的表型异种突变%Phenotypic heterogeneity of mutations in androgen receptor gene

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Lalji Singh; Kumarasamy Thangaraj

    2007-01-01

    Androgen receptor (AR) gene has been extensively studied in diverse clinical conditions. In addition to the point mutations, trinucleotide repeat (CAG and GGN) length polymorphisms have been an additional subject of interest and controversy among geneticists. The polymorphic variations in triplet repeats have been associated with a number of disorders, but at the same time contradictory findings have also been reported. Further, studies on the same disorder in different populations have generated different results. Therefore, combined analysis or review of the published studies has been of much value to extract information on the significance of variations in the gene in various clinical conditions. AR genetics has been reviewed extensively but until now review articles have focused on individual clinical categories such as androgen insensitivity, male infertility, prostate cancer, and so on. We have made the first effort to review most the aspects of AR genetics. The impact of androgens in various disorders and polymorphic variations in the AR gene is the main focus of this review. Additionally, the correlations observed in various studies have been discussed in the light of in vitro evidences available for the effect of AR gene variations on the action of androgens.

  18. Analysis of the CAG repeat number in exon 1 of the androgen receptor gene in Slovene men with idiopathic azoospermia and oligoasthenoteratozoospermia

    Institute of Scientific and Technical Information of China (English)

    Borut Peterlin; Branko Zorn; Natasa Teran; Tanja Kunej

    2007-01-01

    @@ Dear Sir, I am Borut Peterlin, from Division of Medical Genetics,Department of Obstetrics and Gynaecology, University Medical Center, Ljubljana, Slovenia. We write to you to discuss if the number of CAG repeats in the androgen receptor (AR) gene is associated with male infertility in a group of 190 Slovene infertile men compared to 137 men with proven fertility.

  19. Mutations in the ligand-binding domain of the androgen receptor gene cluster in two regions of the gene.

    Science.gov (United States)

    McPhaul, M J; Marcelli, M; Zoppi, S; Wilson, C M; Griffin, J E; Wilson, J D

    1992-11-01

    We have analyzed the nucleotide sequence of the androgen receptor from 22 unrelated subjects with substitution mutations of the hormone-binding domain. Eleven had the phenotype of complete testicular feminization, four had incomplete testicular feminization, and seven had Reifenstein syndrome. The underlying functional defect in cultured skin fibroblasts included individuals with absent, qualitative, or quantitative defects in ligand binding. 19 of the 21 substitution mutations (90%) cluster in two regions that account for approximately 35% of the hormone-binding domain, namely, between amino acids 726 and 772 and between amino acids 826 and 864. The fact that one of these regions is homologous to a region of the human thyroid hormone receptor (hTR-beta) which is a known cluster site for mutations that cause thyroid hormone resistance implies that this localization of mutations is not a coincidence. These regions of the androgen receptor may be of particular importance for the formation and function of the hormone-receptor complex.

  20. Mutations in the ligand-binding domain of the androgen receptor gene cluster in two regions of the gene.

    OpenAIRE

    McPhaul, M J; Marcelli, M; Zoppi, S; Wilson, C. M.; Griffin, J E; Wilson, J. D.

    1992-01-01

    We have analyzed the nucleotide sequence of the androgen receptor from 22 unrelated subjects with substitution mutations of the hormone-binding domain. Eleven had the phenotype of complete testicular feminization, four had incomplete testicular feminization, and seven had Reifenstein syndrome. The underlying functional defect in cultured skin fibroblasts included individuals with absent, qualitative, or quantitative defects in ligand binding. 19 of the 21 substitution mutations (90%) cluster ...

  1. Differential modulation of androgen receptor transcriptional activity by the nuclear receptor co-repressor (N-CoR).

    NARCIS (Netherlands)

    C.A. Berrevoets (Cor); A. Umar (Arzu); A.O. Brinkmann (Albert); J. Trapman (Jan)

    2004-01-01

    textabstractAntiandrogens are widely used agents in the treatment of prostate cancer, as inhibitors of AR (androgen receptor) action. Although the precise mechanism of antiandrogen action is not yet elucidated, recent studies indicate the involvement of nuclear receptor co-represso

  2. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S. (Univ. of North Carolina, Chapel Hill (USA)); Brown, T.R.; Migeon, C.J. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (USA))

    1989-12-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development.

  3. Tandem CAG repeats of the androgen receptor gene and prostate cancer risk in black and white men.

    Science.gov (United States)

    Panz, V R; Joffe, B I; Spitz, I; Lindenberg, T; Farkas, A; Haffejee, M

    2001-07-01

    The most common malignancy in men worldwide is cancer of the prostate. Androgens play a direct role in normal and malignant growth of prostate cells via the androgen receptor (AR). This study analyzed the polymorphic CAG repeat sequence in exon 1 of the AR gene to determine if the number of repeats might be an indicator of prostate cancer risk or aggressive disease. DNA was extracted from blood samples of 20 black and 20 white men with well-documented prostate cancer and 40 healthy controls (20 blacks and 20 whites). PCR amplification was followed by gel electrophoresis and DNA sequencing. This region normally contains between 9 and 29 repeats. Patients and controls both had minor variations in the number of repeats, which ranged from 13 to 27 with 21 being the most frequent allele. Black controls and patients both had a mean of 20 +/- 3 repeats; in whites the mean was significantly lower in patients than controls (21 +/- 2 versus 23 +/- 2; p = 0.004). Combined black and white patients also had a lower number than the combined group of controls (20 +/- 3 versus 22 +/- 3; p = 0.02). Similarly, black and white patients with aggressive disease had a lower number than patients whose disease was more slowly progressive (19 +/- 2 versus 22 +/- 3; p = 0.02). We conclude that the small differences in the number of CAG repeats in both black and white patients do not appear to be a strong indicator of risk or aggressive disease but that this size polymorphism may be one of many genetic and environmental risk factors involved in prostate cancer.

  4. Rosemary (Rosmarinus officinalis) Extract Modulates CHOP/GADD153 to Promote Androgen Receptor Degradation and Decreases Xenograft Tumor Growth

    OpenAIRE

    Petiwala, Sakina M.; Saba Berhe; Gongbo Li; Puthenveetil, Angela G.; Ozair Rahman; Larisa Nonn; Johnson, Jeremy J.

    2014-01-01

    The Mediterranean diet has long been attributed to preventing or delaying the onset of cardiovascular disease, diabetes and various solid organ cancers. In this particular study, a rosemary extract standardized to carnosic acid was evaluated for its potential in disrupting the endoplasmic reticulum machinery to decrease the viability of prostate cancer cells and promote degradation of the androgen receptor. Two human prostate cancer cell lines, 22Rv1 and LNCaP, and prostate epithelial cells p...

  5. Fenofibrate down-regulates the expressions of androgen receptor (AR) and AR target genes and induces oxidative stress in the prostate cancer cell line LNCaP

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Hu; Zhu, Chen; Qin, Chao [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Tao, Tao [Department of Neurosurgery, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Li, Jie; Cheng, Gong; Li, Pu; Cao, Qiang; Meng, Xiaoxin; Ju, Xiaobing; Shao, Pengfei; Hua, Lixin [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Gu, Min, E-mail: medzhao1980@163.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Yin, Changjun, E-mail: drcjyin@gmail.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China)

    2013-03-08

    Highlights: ► Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells. ► Fenofibrate reduces the expressions of androgen receptor in LNCaP cells. ► Fenofibrate induces oxidative stress in the prostate cancer cell line LNCaP. -- Abstract: Fenofibrate, a peroxisome proliferator-androgen receptor-alpha agonist, is widely used in treating different forms of hyperlipidemia and hypercholesterolemia. Recent reports have indicated that fenofibrate exerts anti-proliferative and pro-apoptotic properties. This study aims to investigate the effects of fenofibrate on the prostate cancer (PCa) cell line LNCaP. The effects of fenofibrate on LNCaP cells were evaluated by flow cytometry, reverse transcription-polymerase chain reaction, enzyme-linked immunosorbent assays, Western blot analysis, and dual-luciferase reporter assay. Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells, reduces the expressions of androgen receptor (AR) and AR target genes (prostate-specific antigen and TMPRSS2), and inhibits Akt phosphorylation. Fenofibrate can induce the accumulation of intracellular reactive oxygen species and malondialdehyde, and decrease the activities of total anti-oxidant and superoxide dismutase in LNCaP cells. Fenofibrate exerts an anti-proliferative property by inhibiting the expression of AR and induces apoptosis by causing oxidative stress. Therefore, our data suggest fenofibrate may have beneficial effects in fenofibrate users by preventing prostate cancer growth through inhibition of androgen activation and expression.

  6. Indole-3-carbinol and 3’, 3’-diindolylmethane modulate androgen effect up-regulation on C-C chemokine ligand 2 and monocyte attraction to prostate cancer cells

    Science.gov (United States)

    Inflammation has a role in prostate tumorigenesis. Recruitment of inflammatory monocytes to the tumor site is mediated by C-C chemokine ligand 2 (CCL2) through binding to its receptor CCR2. We hypothesized that androgen could modulate CCL2 expression in hormone-responsive prostate cancer cells, and ...

  7. Androgen receptor promotes abdominal aortic aneurysm development via modulating inflammatory interleukin-1α and transforming growth factor-β1 expression.

    Science.gov (United States)

    Huang, Chiung-Kuei; Luo, Jie; Lai, Kuo-Pao; Wang, Ronghao; Pang, Haiyan; Chang, Eugene; Yan, Chen; Sparks, Janet; Lee, Soo Ok; Cho, Joshua; Chang, Chawnshang

    2015-10-01

    Sex difference is a risk factor for abdominal aortic aneurysm (AAA) formation yet the reason for male predominance remains unclear. Androgen and the androgen receptor (AR) influence the male sex difference, indicating that AR signaling may affect AAA development. Using angiotensin II–induced AAA in apolipoprotein E null mouse models (82.4% AAA incidence), we found that mice lacking AR failed to develop AAA and aorta had dramatically reduced macrophages infiltration and intact elastic fibers. These findings suggested that AR expression in endothelial cells, macrophages, or smooth muscle cells might play a role in AAA development. Selective knockout of AR in each of these cell types further demonstrated that mice lacking AR in macrophages (20% AAA incidence) or smooth muscle cells (12.5% AAA incidence) but not in endothelial cells (71.4% AAA incidence) had suppressed AAA development. Mechanism dissection showed that AR functioned through modulation of interleukin-1α (IL-1α) and transforming growth factor-β1 signals and by targeting AR with the AR degradation enhancer ASC-J9 led to significant suppression of AAA development. These results demonstrate the underlying mechanism by which AR influences AAA development is through IL-1α and transforming growth factor-β1, and provides a potential new therapy to suppress/prevent AAA by targeting AR with ASC-J9.

  8. A common deletion in the uridine diphosphate glucuronyltransferase (UGT) 2B17 gene is a strong determinant of androgen excretion in healthy pubertal boys

    DEFF Research Database (Denmark)

    Juul, A; Sørensen, K; Aksglaede, L;

    2008-01-01

    BACKGROUND: Testosterone (T) is excreted in urine as water-soluble glucuronidated and sulfated conjugates. The ability to glucuronidate T and other steroids depends on a number of different glucuronidases (UGT) of which UGT2B17 is essential. The aim of the study was to evaluate the influence of UGT......2B17 genotypes on urinary excretion of androgen metabolites in pubertal boys. STUDY DESIGN: A clinical study of 116 healthy boys aged 8-19 yr. UGT2B17 genotyping was performed using quantitative PCR. Serum FSH, LH, T, estradiol (E2), and SHBG were analyzed by immunoassays, and urinary levels...... of androgen metabolites were quantitated by gas chromatography/mass spectrometry in all subjects. RESULTS: Ten of 116 subjects (9%) presented with a homozygote deletion of the UGT2B17 gene (del/del), whereas 52 and 54 boys were hetero- and homozygous carriers of the UGT2B17 gene (del/ins and ins...

  9. Androgen receptor gene CAG repeat polymorphism and ovarian cancer risk: A meta-analysis.

    Science.gov (United States)

    Deng, Yang; Wang, Jue; Wang, Ling; Du, Yan

    2017-02-28

    Ovarian cancer is one of the common gynecological malignancies worldwide. It is usually diagnosed at a later stage, thus missing the best opportunity for treatment. Despite the advancement of ovarian cancer treatment, the prognosis is still poor. Androgen receptor (AR) may play a role in ovarian carcinogenesis. Previous studies regarding the association between AR CAG repeat length and ovarian cancer risk reported inconsistent results. Therefore, we conducted a meta-analysis to evaluate the association between AR CAG repeat length and ovarian cancer risk following the MOOSE guidelines. PubMed, Web of Science, EBSCO and other databases were searched up to September 15(th) 2016. Case control studies with clear definition of CAG repeat length and detailed genotype information were included. Two authors independently reviewed and extracted data. Pooled analysis and subgroup analysis stratified by ethnicity were performed for different genetic models. Begg's funnel plot and Egger's test were performed for publication bias estimation. Overall, there was no association between the AR CAG repeat polymorphism and ovarian cancer risk. However, short CAG repeat polymorphism was associated with increased ovarian cancer risk in African Americans and Chinese under the dominant model, whereas a reverse association was observed in Caucasians and Italians under the other three models. Our study results should be interpreted with caution. Further well-designed epidemiological and functional studies are needed to elucidate the role of AR in ovarian carcinogenesis.

  10. MR Guided Pulsed High Intensity Focused Ultrasound Enhancement of Gene Therapy Combined with Androgen Deprivation and Radiotherapy for Prostate Cancer Treatment

    Science.gov (United States)

    2012-09-01

    the observed enhancement are not well understood. It is thought mainly due to the nonthermal effects of ultrasound —mechanical streaming and cavitation ...AD ________________ Award Number: W81XWH-08-1-0469 TITLE: MR Guided Pulsed High Intensity Focused Ultrasound Enhancement of (Enter title of award...Intensity Focused Ultrasound Enhancement of 5b. GRANT NUMBER Gene Therapy Combined with Androgen Deprivation and Radiotherapy W81XWH-08-1-0469 for Prostate

  11. Androgen deprivation of the PC-310 [correction of prohormone convertase-310] human prostate cancer model system induces neuroendocrine differentiation

    NARCIS (Netherlands)

    J. Jongsma (Johan); M.H. Oomen; M.A. Noordzij (Marinus); W.M. van Weerden (Wytske); G.J. Martens; Th.H. van der Kwast (Theo); F.H. Schröder (Fritz); G.J. van Steenbrugge (Gert Jan)

    2000-01-01

    textabstractNeuroendocrine (NE) cells are androgen-independent cells and secrete growth-modulating neuropeptides via a regulated secretory pathway (RSP). We studied NE differentiation after androgen withdrawal in the androgen-dependent prostate cancer xenograft PC-310.

  12. Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance.

    Science.gov (United States)

    Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun; Jakobsen, Marianne Antonius; Brusgaard, Klaus; Tan, Qihua; Gaster, Michael

    2014-09-05

    Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity is conserved in cultured myotubes (in vitro) from patients with PCOS, but the effect of testosterone on this insulin sensitivity is unknown. We investigated the effect of 7days testosterone treatment (100nmol/l) on glucose transport and gene expression levels of hormone receptors and enzymes involved in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls. Glucose transport in myotubes was comparable in patients with PCOS vs. controls and was unchanged by testosterone treatment (p=0.21 PCOS vs. controls). These results suggest that testosterone treatment of myotubes increases the aromatase and androgen receptor gene expression without affecting insulin sensitivity and if testosterone is implicated in muscular insulin resistance in PCOS, this is by and indirect mechanism.

  13. Variation in CAG and GGN repeat lengths and CAG/GGN haplotype in androgen receptor gene polymorphism and prostate carcinoma in Nigerians.

    Science.gov (United States)

    Akinloye, O; Gromoll, J; Simoni, M

    2011-01-01

    Prostate cancer has become the most common cancer in Nigerian men. The growth of the prostate gland depends on circulating androgens and intracellular steroid signalling pathways. The effects of androgens are mediated through the androgen receptor (AR), a nuclear transcription factor encoded by the AR gene. The common polymorphisms, CAG and GGN repeats, in exon 1 of this gene have been implicated as possible risk factors. Thus far, existing supporting data are scanty and none are from sub-Saharan African populations. Therefore, this study investigates the possible association between AR polymorphism repeat length (CAG and GGN) and prostate cancer in Nigerians. A total of 261 subjects (70 with prostate cancer, 68 with benign prostate hyperplasia [BPH], 123 age-matched apparently normal subjects as controls) were studied. CAG and GGN repeats length were determined by fragment length analysis using GeneScan. The CAG repeat length in prostate cancer and in BPH compared to the controls was significantly different (P CAG repeats showing a significant odds ratio (OR) in both cases. However, this was not observed in GGN repeat length, which showed no significant difference between cases and controls (P > 0.05). CAG and GGN haplotype variation showed no significant difference between cases and controls (P > 0.05), except that the haplotypes CAG > or =21 and GGN CAG repeat length is a risk factor for prostate cancer, and also suggests an association with BPH.

  14. Androgen receptors and hormone sensitivity of a human prostatic cancer cell line (PC-3) are modulated by natural beta-interferon

    NARCIS (Netherlands)

    G. Sica (G.); G. Dell'Acqua (G.); F. Iacopino (F.); A. Fattorossi (A.); P. Marchetti (P.); Th.H. van der Kwast (Theo); M. Pavone-Macaluso (M.)

    1991-01-01

    textabstractAndrogen recptors are expressed at a low level in the cell line PC-3, which does not respond to either androgens or antiandrogens. If these cells are exposed to natural beta-interferon (β-IFN) a reduction in cell growth and an increase in androgen receptors, evaluated by both biochemical

  15. Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines.

    Science.gov (United States)

    Wilson, Stephen; Qi, Jianfei; Filipp, Fabian V

    2016-09-14

    Sequence motifs are short, recurring patterns in DNA that can mediate sequence-specific binding for proteins such as transcription factors or DNA modifying enzymes. The androgen response element (ARE) is a palindromic, dihexameric motif present in promoters or enhancers of genes targeted by the androgen receptor (AR). Using chromatin immunoprecipitation sequencing (ChIP-Seq) we refined AR-binding and AREs at a genome-scale in androgen-insensitive and androgen-responsive prostate cancer cell lines. Model-based searches identified more than 120,000 ChIP-Seq motifs allowing for expansion and refinement of the ARE. We classified AREs according to their degeneracy and their transcriptional involvement. Additionally, we quantified ARE utilization in response to somatic copy number amplifications, AR splice-variants, and steroid treatment. Although imperfect AREs make up 99.9% of the motifs, the degree of degeneracy correlates negatively with validated transcriptional outcome. Weaker AREs, particularly ARE half sites, benefit from neighboring motifs or cooperating transcription factors in regulating gene expression. Taken together, ARE full sites generate a reliable transcriptional outcome in AR positive cells, despite their low genome-wide abundance. In contrast, the transcriptional influence of ARE half sites can be modulated by cooperating factors.

  16. Cystatin C is downregulated in prostate cancer and modulates invasion of prostate cancer cells via MAPK/Erk and androgen receptor pathways.

    Directory of Open Access Journals (Sweden)

    Barbara Wegiel

    Full Text Available Cystatin C is believed to prevent tumor progression by inhibiting the activities of a family of lysosomal cysteine proteases. However, little is known about the precise mechanism of cystatin C function in prostate cancer. In the present study, we examined the expression of cystatin C and its association with matrix metalloproteinases 2 (MMP2 and androgen receptor (AR in a tissue microarray comparing benign and malignant specimens from 448 patients who underwent radical prostatectomy for localized prostate cancer. Cystatin C expression was significantly lower in cancer specimens than in benign tissues (p<0.001 and there was a statistically significant inverse correlation between expression of cystatin C and MMP2 (r(s (2 = -0.056, p = 0.05. There was a clear trend that patients with decreased level of cystatin C had lower overall survival. Targeted inhibition of cystatin C using specific siRNA resulted in an increased invasiveness of PC3 cells, whereas induction of cystatin C overexpression greatly reduced invasion rate of PC3 in vitro. The effect of cystatin C on modulating the PC3 cell invasion was provoked by Erk2 inhibitor that specifically inhibited MAPK/Erk2 activity. This suggests that cystatin C may mediate tumor cell invasion by modulating the activity of MAPK/Erk cascades. Consistent with our immunohistochemical findings that patients with low expression of cystatin C and high expression of androgen receptor (AR tend to have worse overall survival than patients with high expression of cystatin C and high AR expression, induced overexpression of AR in PC3 cells expressing cystatin C siRNA greatly enhanced the invasiveness of PC3 cells. This suggests that there may be a crosstalk between cystatin C and AR-mediated pathways. Our study uncovers a novel role for cystatin C and its associated cellular pathways in prostate cancer invasion and metastasis.

  17. Characterization of in vitro generated metabolites of the selective androgen receptor modulators S-22 and S-23 and in vivo comparison to post-administration canine urine specimens.

    Science.gov (United States)

    Thevis, Mario; Gerace, Enrico; Thomas, Andreas; Beuck, Simon; Geyer, Hans; Schlörer, Nils; Kearbey, Jeffrey D; Dalton, James T; Schänzer, Wilhelm

    2010-01-01

    Selective androgen receptor modulators (SARMs) have great therapeutic potential in various diseases including cancer cachexia, sarcopenia, and osteoporosis, and the number of drug candidates has been growing over the last decade. The SARM drug candidates S-22 and S-23 belong to one of the most advanced groups of androgen receptor modulators and are based on an arylpropionamide-derived core structure. Due to their anabolic effects, SARMs have been prohibited in elite sports and have been a subject of sports drug testing programmes since January 2008. Consequently, the structure of analytically useful urinary metabolites should be elucidated to provide targets for sensitive and retrospective analysis. In the present study, the phase-I and -II metabolism of S-22 and S-23 was simulated using hepatic human enzymes, and resulting metabolites were characterized by means of state-of-the-art mass spectrometric approaches employing high resolution/high accuracy Orbitrap mass spectrometry. Subsequently, the newly defined target compounds including the glucuronic acid conjugates of S-22 and S-23, their corresponding monohydroxylated and bishydroxylated analogs, as well as their B-ring depleted counterparts were implemented into an existing routine doping control procedure, which was examined for its specificity for the added substances. In order to obtain proof-of-concept data for authentic urine specimens, canine urine samples collected up to 72 h after oral administration of S-22 to dogs were analyzed using the established approach outlining the capability of the presented assay to detect the glucuronide of S-22 as well as the B-ring-depleted metabolite (M3) in all samples following therapeutic (31.4 µg/kg) dosing. Finally, M3 was chemically synthesized, characterized by nuclear magnetic resonance spectroscopy and high resolution/high accuracy mass spectrometry, and chosen as primary target for future doping control analyses.

  18. Androgen receptor and its splice variant, AR-V7, differentially regulate FOXA1 sensitive genes in LNCaP prostate cancer cells.

    Science.gov (United States)

    Krause, William C; Shafi, Ayesha A; Nakka, Manjula; Weigel, Nancy L

    2014-09-01

    Prostate cancer (PCa) is an androgen-dependent disease, and tumors that are resistant to androgen ablation therapy often remain androgen receptor (AR) dependent. Among the contributors to castration-resistant PCa are AR splice variants that lack the ligand-binding domain (LBD). Instead, they have small amounts of unique sequence derived from cryptic exons or from out of frame translation. The AR-V7 (or AR3) variant is constitutively active and is expressed under conditions consistent with CRPC. AR-V7 is reported to regulate a transcriptional program that is similar but not identical to that of AR. However, it is unknown whether these differences are due to the unique sequence in AR-V7, or simply to loss of the LBD. To examine transcriptional regulation by AR-V7, we have used lentiviruses encoding AR-V7 (amino acids 1-627 of AR with the 16 amino acids unique to the variant) to prepare a derivative of the androgen-dependent LNCaP cells with inducible expression of AR-V7. An additional cell line was generated with regulated expression of AR-NTD (amino acids 1-660 of AR); this mutant lacks the LBD but does not have the AR-V7 specific sequence. We find that AR and AR-V7 have distinct activities on target genes that are co-regulated by FOXA1. Transcripts regulated by AR-V7 were similarly regulated by AR-NTD, indicating that loss of the LBD is sufficient for the observed differences. Differential regulation of target genes correlates with preferential recruitment of AR or AR-V7 to specific cis-regulatory DNA sequences providing an explanation for some of the observed differences in target gene regulation.

  19. Negative association between androgen receptor gene CAG repeat polymorphism and polycystic ovary syndrome? A systematic review and meta-analysis.

    Science.gov (United States)

    Wang, Rui; Goodarzi, Mark O; Xiong, Ting; Wang, Di; Azziz, Ricardo; Zhang, Hanwang

    2012-10-01

    A number of studies focusing on the association between the exon 1 CAG repeat polymorphism of the androgen receptor (AR) gene and polycystic ovary syndrome (PCOS) have revealed conflicting results. The current systematic review and meta-analysis was conducted to quantify the strength of the association and to explore potential sources of heterogeneity that may have influenced the results. Studies matched to search terms from PubMed, EMBASE and HuGE Navigator published through to 31 January 2012 were retrieved. Data extraction from the included studies was carried out by two authors independently. Weighted mean differences (WMDs) of biallelic mean and odds ratios (ORs) of alleles and genotypes were pooled for meta-analysis. Sixteen articles reporting on 17 studies were included. In continuous data analysis, the summary WMD was -0.06 (95% confidence interval -0.29 to 0.16). In dichotomous data analysis, we divided the alleles into short and long alleles and calculated the summary ORs. No statistically significant results were identified by different comparison models or different cut-off point definitions. No publication bias was observed in continuous and dichotomous data analysis. In summary, the current systematic review and meta-analysis found that the AR CAG microsatellite repeat polymorphism is unlikely to be a major determining factor in the development of PCOS.

  20. Androgen receptor gene CAG repeat polymorphism and risk of isolated hypospadias: results from a meta-analysis.

    Science.gov (United States)

    Huang, G; Shan, W; Zeng, L; Huang, L

    2015-03-06

    Studies investigating the association between the CAG repeat polymorphism and the risk of isolated hypospadias have reported conflicting results. The aim of this study was to quantitatively summarize the evidence for such a relationship. Two investigators independently searched the Medline, Embase, CNKI, and Wanfang databases. Weighted mean difference and 95% confidence intervals for the CAG repeat polymorphism and isolated hypospadias were calculated using a random-effects model. Subgroup analyses were performed by race, study design, sample for DNA extraction, and hypospadias classifications. This meta-analysis included 6 case-control studies, including 444 isolated hypospadias cases and 727 controls. The results showed that patients with isolated hypospadias had longer CAG repeats in their androgen receptor gene sequence (weighted mean difference = 1.36, 95% confidence interval = 0.60-2.13; P = 0.0005). Similarly, stratified analyses also detected significant associations in all subgroups, excluding the group with severe hypospadias (weighted mean difference = 0.35, 95% confidence interval = -0.42-1.12; P = 0.38). This meta-analysis indicated that longer CAG repeats were associated with the risk of isolated hypospadias, and that longer CAG polymorphisms may be related to the etiology of isolated hypospadias. Future studies based on Asian and African-American patients should be performed to re-evaluate this association.

  1. Impact of CAG repeat length in the androgen receptor gene on male infertility - a meta-analysis.

    Science.gov (United States)

    Xiao, Feifan; Lan, Aihua; Lin, Zhidi; Song, Jianfei; Zhang, Yuening; Li, Jiatong; Gu, Kailong; Lv, Baihao; Zhao, Dong; Zeng, Siping; Zhang, Ruoheng; Zhao, Wei; Pan, Zhengyan; Deng, Xiaozhen; Yang, Xiaoli

    2016-07-01

    CAG repeats are polymorphic nucleotide repeats present in the androgen receptor gene. Many studies have estimated the association between CAG repeat length and male infertility, but the conclusions are controversial. Previous meta-analyses have come to different conclusions; however, new studies have been published. An updated meta-analysis was conducted. PubMed, CBM, CNKI and Web of Science databases were systematically searched for studies published from 1 January 2000 to 1 October 2015. Case-control studies on the association between CAG repeat length and male infertility using appropriate methodology were included. Forty studies were selected, including 3858 cases and 3161 controls. Results showed statistically significantly longer CAG repeat length among cases compared with controls (SMD = 0.14; 95% CI, 0.02-0.26). Shorter repeat length was associated with a lower risk of male infertility compared with a longer repeat length in the overall analysis (OR = 0.79, 95% CI: 0.66-0.95). Moreover, CAG repeat length was associated with male infertility in Caucasian populations, but not Asian or Egyptian populations. Subgroup analysis revealed no significant difference in German populations, but CAG repeat length was associated with male infertility in China and the USA. There were no significant differences between cases and controls in azoospermia and severe oligozoospermia.

  2. Influence of the glutation S-transferases T1 and M1 gene polymorphisms on androgenic status and semen quality after surgical treatment of varicocele

    Directory of Open Access Journals (Sweden)

    P. V. Glybochko

    2013-01-01

    Full Text Available Aim: to examine androgenic status in men after surgical treatment of varicocele; to investigate genotype GSTT1 and GSTM1 in patients with pathozoospermia. Thirty men after surgical treatment of varicocele were recruited to this study. All subjects were evaluated by history, physical examination, semen analysis, serum FSH, LH, E2, PL, inhibin B and total testosterone determination. GSTT1, CSTM1 gene polymorphisms were determined by polymerase chain reaction. Total testosterone and inhibin B levels were significantly lower in patients with pathozoospermia. Patients with the GSTM1(- genotype had lower sperm concentrations than those with the GSTM1(+ genotype.Our results suggest that the GSTM1(- genotype is risk factor for androgen deficiency and pathozoospermia.

  3. Modulating gene function with peptide nucleic acids (PNA)

    DEFF Research Database (Denmark)

    Nielsen, Peter E.; Crooke, Stanley T.

    2008-01-01

    A review on peptide nucleic acid (PNA) oligomers as modulators of gene expression ranging from gene silencing at the mRNAor the dsDNA (antigene) level, and redirection of mRNA splicing to gene activation through transcription bubble mimicking. PNA chem., anti-infective agents, cellular delivery, ...

  4. ANDROGEN INSENSITIVITY SYNDROME

    OpenAIRE

    Kanan; Sonali

    2014-01-01

    The condition is inherited as X - linked recessive gene 1 . The underlying pathology is the inability of end organs to respond to androgens. These cases are phenotypically and psychologically female with adequate breast development , normal external genitalia , a vagina with variable depth , absent /sparse pubic hair and axillary hair. The exact incidence in India is not known but the reported incidence is 1 in 2 , 000 to 1 in 62 ,400 worldwi...

  5. Identifying disease feature genes based on cellular localized gene functional modules and regulation networks

    Institute of Scientific and Technical Information of China (English)

    ZHANG Min; ZHU Jing; GUO Zheng; LI Xia; YANG Da; WANG Lei; RAO Shaoqi

    2006-01-01

    Identifying disease-relevant genes and functional modules, based on gene expression profiles and gene functional knowledge, is of high importance for studying disease mechanisms and subtyping disease phenotypes. Using gene categories of biological process and cellular component in Gene Ontology, we propose an approach to selecting functional modules enriched with differentially expressed genes, and identifying the feature functional modules of high disease discriminating abilities. Using the differentially expressed genes in each feature module as the feature genes, we reveal the relevance of the modules to the studied diseases. Using three datasets for prostate cancer, gastric cancer, and leukemia, we have demonstrated that the proposed modular approach is of high power in identifying functionally integrated feature gene subsets that are highly relevant to the disease mechanisms. Our analysis has also shown that the critical disease-relevant genes might be better recognized from the gene regulation network, which is constructed using the characterized functional modules, giving important clues to the concerted mechanisms of the modules responding to complex disease states. In addition, the proposed approach to selecting the disease-relevant genes by jointly considering the gene functional knowledge suggests a new way for precisely classifying disease samples with clear biological interpretations, which is critical for the clinical diagnosis and the elucidation of the pathogenic basis of complex diseases.

  6. Characterization of equine urinary metabolites of selective androgen receptor modulators (SARMs) S1, S4 and S22 for doping control purposes.

    Science.gov (United States)

    Hansson, Annelie; Knych, Heather; Stanley, Scott; Thevis, Mario; Bondesson, Ulf; Hedeland, Mikael

    2015-08-01

    Selective androgen receptor modulators, SARMs, constitute a class of compounds with anabolic properties but with few androgenic side-effects. This makes them possible substances of abuse and the World Anti-Doping Agency (WADA) has banned the entire class of substances. There have been several cases of illicit use of aryl propionamide SARMs in human sports and in 2013, 13 cases were reported. These substances have been found to be extensively metabolized in humans, making detection of metabolites necessary for doping control. SARMs are also of great interest to equine doping control, but the in vivo metabolite pattern and thus possible analytical targets have not been previously studied in this species. In this study, the urinary metabolites of the SARMs S1, S4, and S22 in horses were studied after intravenous injection, using ultra high performance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UHPLC-QToF-MS). Eight different metabolites were found for SARM S1, nine for SARM S4, and seven for SARM S22. The equine urinary metabolite profiles differed significantly from those of humans. The parent compounds were only detected for SARMs S4 and S22 and only at the first sampling time point at 3 h post administration, making them unsuitable as target compounds. For all three SARMs tested, the metabolite yielding the highest response had undergone amide hydrolysis, hydroxylation and sulfonation. The resulting phase II metabolites (4-nitro-3-trifluoro-methyl-phenylamine sulfate for SARMs S1 and S4 and 4-cyano-3-trifluoro-methyl-phenylamine sulfate for SARM S22) are proposed as analytical targets for use in equine doping control.

  7. Proteome-wide muscle protein fractional synthesis rates predict muscle mass gain in response to a selective androgen receptor modulator in rats.

    Science.gov (United States)

    Shankaran, Mahalakshmi; Shearer, Todd W; Stimpson, Stephen A; Turner, Scott M; King, Chelsea; Wong, Po-Yin Anne; Shen, Ying; Turnbull, Philip S; Kramer, Fritz; Clifton, Lisa; Russell, Alan; Hellerstein, Marc K; Evans, William J

    2016-03-15

    Biomarkers of muscle protein synthesis rate could provide early data demonstrating anabolic efficacy for treating muscle-wasting conditions. Androgenic therapies have been shown to increase muscle mass primarily by increasing the rate of muscle protein synthesis. We hypothesized that the synthesis rate of large numbers of individual muscle proteins could serve as early response biomarkers and potentially treatment-specific signaling for predicting the effect of anabolic treatments on muscle mass. Utilizing selective androgen receptor modulator (SARM) treatment in the ovariectomized (OVX) rat, we applied an unbiased, dynamic proteomics approach to measure the fractional synthesis rates (FSR) of 167-201 individual skeletal muscle proteins in triceps, EDL, and soleus. OVX rats treated with a SARM molecule (GSK212A at 0.1, 0.3, or 1 mg/kg) for 10 or 28 days showed significant, dose-related increases in body weight, lean body mass, and individual triceps but not EDL or soleus weights. Thirty-four out of the 94 proteins measured from the triceps of all rats exhibited a significant, dose-related increase in FSR after 10 days of SARM treatment. For several cytoplasmic proteins, including carbonic anhydrase 3, creatine kinase M-type (CK-M), pyruvate kinase, and aldolase-A, a change in 10-day FSR was strongly correlated (r(2) = 0.90-0.99) to the 28-day change in lean body mass and triceps weight gains, suggesting a noninvasive measurement of SARM effects. In summary, FSR of multiple muscle proteins measured by dynamics of moderate- to high-abundance proteins provides early biomarkers of the anabolic response of skeletal muscle to SARM.

  8. Validation of a GC/MS method for the detection of two quinolinone-derived selective androgen receptor modulators in doping control analysis.

    Science.gov (United States)

    Gerace, E; Salomone, A; Fasano, F; Costa, R; Boschi, D; Di Stilo, A; Vincenti, M

    2011-04-01

    Selective androgen receptor modulators (SARMs) represent an emerging class of drugs likely to be abused in sport. For clinical applications, these substances provide a promising alternative to testosterone-replacement therapies and their advantages include oral bioavailability, androgen receptor specificity, tissue selectivity, and the absence of steroid-related side effects. Although not yet commercially available, since January 2008 SARMs have been included on the prohibited list issued yearly by the World Anti-Doping Agency (WADA), so control laboratories need to update their procedures to detect either the parent drugs or their metabolites. Within this context, two quinolinone SARM models were synthesized and automatically characterized to update the existing routine screening procedures. The conditions for the new target analytes are compatible with the existing laboratory protocols used for both in-competition and out-of-competition controls and can be included in them. Validation parameters according to ISO 17025 and WADA guidelines were successfully determined. For analytical determinations, spiked urine samples were hydrolyzed and extracted at pH 9.6 with 10 mL of tert-butyl methyl ether. Then, the analytes were subsequently converted into trimethylsilyl derivatives and detected by gas chromatography-mass spectrometry. The absence of interferents, together with excellent repeatability of both retention times and the relative abundances of diagnostic ions, allowed proper identification of all SARM analytes. The analytes' quantification was linear up to 500 ng/mL and precision criteria were satisfied (coefficient of variation less than 25% at 10 ng/mL). The limits of detection were 1 ng/mL for both SARMs, whereas recovery values were between 95.5 and 99.3%. The validated method can be efficiently used for urine screening of the 2-quinolinone-derived SARMs tested.

  9. Identification of selected in vitro generated phase-I metabolites of the steroidal selective androgen receptor modulator MK-0773 for doping control purposes.

    Science.gov (United States)

    Lagojda, Andreas; Kuehne, Dirk; Krug, Oliver; Thomas, Andreas; Wigger, Tina; Karst, Uwe; Schänzer, Wilhelm; Thevis, Mario

    2016-01-01

    Research into developing anabolic agents for various therapeutic purposes has been pursued for decades. As the clinical utility of anabolic-androgenic steroids has been found to be limited because of their lack of tissue selectivity and associated off-target effects, alternative drug entities have been designed and are commonly referred to as selective androgen receptor modulators (SARMs). While most of these SARMs are of nonsteroidal structure, the drug candidate MK-0773 comprises a 4-aza-steroidal nucleus. Besides the intended therapeutic use, SARMs have been found to be illicitly distributed and misused as doping agents in sport, necessitating frequently updated doping control analytical assays. As steroidal compounds reportedly undergo considerable metabolic transformations, the phase-I metabolism of MK-0773 was simulated using human liver microsomal (HLM) preparations and electrochemical conversion. Subsequently, major metabolic products were identified and characterized employing liquid chromatography-high-resolution/high- accuracy tandem mass spectrometry with electrospray (ESI) and atmospheric pressure chemical ionization (APCI) as well as nuclear magnetic resonance (NMR) spectroscopy. MK-0773 produced numerous phase-I metabolites under the chosen in vitro incubation reactions, mostly resulting from mono- and bisoxygenation of the steroid. HLM yielded at least 10 monooxygenated species, while electrochemistry-based experiments resulted predominantly in three monohydroxylated metabolites. Elemental composition data and product ion mass spectra were generated for these analytes, ESI/APCI measurements corroborated the formation of at least two N-oxygenated metabolites, and NMR data obtained from electrochemistry-derived products supported structures suggested for three monohydroxylated compounds. Hereby, the hydroxylation of the A-ring located N- bound methyl group was found to be of particular intensity. In the absence of controlled elimination studies, the

  10. The novel non-steroidal selective androgen receptor modulator S-101479 has additive effects with bisphosphonate, selective estrogen receptor modulator, and parathyroid hormone on the bones of osteoporotic female rats.

    Science.gov (United States)

    Furuya, Kazuyuki; Yamamoto, Noriko; Ohyabu, Yuki; Makino, Akito; Morikyu, Teruyuki; Ishige, Hirohide; Kuzutani, Kazuya; Endo, Yasuhisa

    2012-01-01

    We have studied non-steroidal selective androgen receptor modulators (SARMs) to develop anti-osteoporosis drugs for males and females. Many SARMs have been studied for their anabolic effects on bone or muscle with reduced virilizing effects in male animals. However, the tissue selectivities of these agents in female animals have not been fully evaluated. We evaluated the novel SARM S-101479 from tetrahydroquinoline libraries in ovariectomized (OVX) rats. S-101479 preferentially bound to the androgen receptor with nanomolar affinity among nuclear receptors. It increased the bone mineral density (BMD) of femurs and diminished the effects on the uterus and clitoral gland in OVX rats. We then compared the effect of S-101479 on bone with those of commercial anti-osteoporosis drugs such as alendronate, raloxifene, and teriparatide. Furthermore, we evaluated the effects of combination treatments with these agents in OVX rats. After 16-week treatment, all agents significantly increased BMD, but the magnitude of bone mineral content (BMC) and/or bone size (projected bone area) were different. Alendronate, raloxifene, and teriparatide maintained BMC and bone size in this experimental dose. Only S-101479 increased BMC with bone size on single treatments. In combination treatment, S-101479 significantly increased BMC and bone size compared with single treatments of other agents. S-101479, like natural androgen, may have showed periosteal bone formation of the cortical area and indicated additive effects with commercial anti-osteoporosis drugs. These results indicate that S-101479 may be a useful anti-osteoporosis drug, particularly for patients with established severe osteoporosis.

  11. Laparoscopic gonedectomy in a case of complete androgen insensitivity syndrome

    Directory of Open Access Journals (Sweden)

    G Bhaskararao

    2014-01-01

    Full Text Available Complete Androgen insensitivity syndrome is a disorder of hormone resistance characterized by a female phenotype in an individual with an XY karyotype. The pathogenesis of CAIS involves a defective androgen receptor gene located on X-chromosome at Xq11-12and end organ insensitivity to androgens, although androgen concentrations are appropriate for the age of the patient. There are three major types of androgen insensitivity syndrome: Complete androgen insensitivity syndrome, minimal androgen insensitivity syndrome, and partial androgen insensitivity syndrome. Management of androgen insensitivity syndrome includes multidisciplinary approach and involves gonedectomy to avoid gonadal tumors in later life. Hormone replacement therapy (HRT and psychological support are required in long-term basis.

  12. Expression of two vitellogenin genes (vg1 and vg3) in fathead minnow (Pimephales promelas) liver in response to exposure to steroidal estrogens and androgens.

    Energy Technology Data Exchange (ETDEWEB)

    Miracle, Ann L.; Ankley, Gerald; Lattier, David

    2006-03-01

    In this study, we describe the sequence for the fathead minnow (Pimephales promelas) vitellogenin 3 gene (vg3), and compare the response of vg1 and vg3 following exposure to steroidal estrogens and androgens. The fathead minnow vg3 sequence is only the second nucleotide sequence described in teleosts, following the original description of this isoform in zebrafish (Danio rerio). Following a brief exposure (24 hours) to 2, 5, and 10 ng/L 17 alpha-ethynylestradiol (EE2), both vg1and vg3 are upregulated in male liver. However, levels of vg3 induction are 4 orders of magnitude lower than induction of vg1. Suppression of vg in female liver following androgenic exposure with 50 or 500 ng/L 17 beta-trenbolone occurs at similar significance levels for both vg1 and vg3 isoforms. The results of this study confirm the use of vg1 as an indicator of estrogenic exposure in male fish, and present the potential for vg1 and /or vg3 for use as indicators of androgenic exposure.

  13. Reverse-engineering transcriptional modules from gene expression data

    OpenAIRE

    Michoel, Tom; De Smet, Riet; Joshi, Anagha; Marchal, Kathleen; de Peer, Yves Van

    2009-01-01

    "Module networks" are a framework to learn gene regulatory networks from expression data using a probabilistic model in which coregulated genes share the same parameters and conditional distributions. We present a method to infer ensembles of such networks and an averaging procedure to extract the statistically most significant modules and their regulators. We show that the inferred probabilistic models extend beyond the data set used to learn the models.

  14. Androgen receptor gene methylation and exon one CAG repeat length in ovarian cancer: differences from breast cancer.

    Science.gov (United States)

    Kassim, Samar; Zoheiry, Nivan M; Hamed, Wael M; Going, James J; Craft, John A

    2004-07-01

    More than one neoplastic founder clone can exist in benign epithelial tumours. Although theories of clonal selection make pluriclonality appear unlikely in carcinomas, published data do not exclude this possibility. This study looked for evidence of multiclonal X inactivation in ovarian carcinoma using AR methylation as a marker. Fifteen unifocal ovarian carcinomas and 14 multifocal carcinomas all in Scottish patients were studied. One representative formalin-fixed paraffin-embedded tumour block was chosen for each of the former and two for the latter. From each of these 43 tumour blocks three samples each of approximately 10(4) carcinoma cells were obtained by microdissection (129 in all). DNA released by proteinase K digestion was subjected to PCR amplification of the androgen receptor gene AR exon I CAG repeat polymorphism with and without prior digestion with methylation-sensitive restriction enzymes HpaII and HhaI. Complex amplification patterns were consistent with mosaic X inactivation in some ovarian carcinomas but acquired anomalies of AR methylation cannot be excluded. Parallel analysis of other X-linked polymorphic loci would strengthen the inference of clonality status from DNA methylation data in tumour X studies. Strikingly, the number of CAG repeats in the 29 ovarian tumour patients (median 16, range 11 - 20) was substantially fewer than in 34 previously studied breast cancer patients from the same scottish population (median 21, range 14 - 26; P CAG repeat were over-represented in the ovarian cancer patients but not in the breast cancer series. These findings reinforce recent suggestions that AR may have a role in ovarian carcinogenesis.

  15. Inhibition of Androgen-Independent Prostate Cancer by Estrogenic Compounds Is Associated with Increased Expression of Immune-Related Genes

    Directory of Open Access Journals (Sweden)

    Ilsa M. Coleman

    2006-10-01

    Full Text Available The clinical utility of estrogens for treating prostate cancer (CaP was established in the 1940s by Huggins. The classic model of the anti-CaP activity of estrogens postulates an indirect mechanism involving the suppression of androgen production. However, clinical, preclinical studies have shown that estrogens exert growth-inhibitory effects on CaP under low-androgen conditions, suggesting additional modes whereby estrogens affect CaP cells and/or the microenvironment. Here we have investigated the activity of 17β estradiol (E2 against androgen-independent CaP, identified molecular alterations in tumors exposed to E2. E2 treatment inhibited the growth of all four androgen-independent CaP xenografts studied (LuCaP 35V, LuCaP 23.1AI, LuCaP 49, LuCaP 58 in castrated male mice. The molecular basis of growth suppression was studied by cDNA microarray analysis, which indicated that multiple pathways are altered by E2 treatment. Of particular interest are changes in transcripts encoding proteins that mediate immune responses, regulate androgen receptor signaling. In conclusion, our data show that estrogens have powerful inhibitory effects on CaP in vivo in androgendepleted environments, suggest novel mechanisms of estrogen-mediated antitumor activity. These results indicate that incorporating estrogens into CaP treatment protocols could enhance therapeutic efficacy even in cases of advanced disease.

  16. High Throughput Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    Science.gov (United States)

    2005-02-01

    molecule Soc. 2002, 124, 544. agonists. Bioorg. Med. Chem. 2001, 9, 557. 33. Berg , T.; Cohen, S. B.; Desharnais, J.; Sonderegger, C.; 18. Chen, Y.; Bilban...Kaldor, M. G. Siegel, Cure. Opin. C/tern. Biol. 1997, 1, [80] T. Berg , S. B. Cohen, J. Desharnais, C. Sonderegger, D. J. 101-106. Maslyar, J. Goldberg...251, 1211 [322] l. A. Wilson, L K. Joliffe, Curr. Opin. Struct. Biol. 1999,9,696- 1217. 702 [289] E. M. Blackwood, B. Luscher , R. N. Eisenman, Genes

  17. MicroRNAs are mediators of androgen action in prostate and muscle.

    Directory of Open Access Journals (Sweden)

    Ramesh Narayanan

    Full Text Available Androgen receptor (AR function is critical for the development of male reproductive organs, muscle, bone and other tissues. Functionally impaired AR results in androgen insensitivity syndrome (AIS. The interaction between AR and microRNA (miR signaling pathways was examined to understand the role of miRs in AR function. Reduction of androgen levels in Sprague-Dawley rats by castration inhibited the expression of a large set of miRs in prostate and muscle, which was reversed by treatment of castrated rats with 3 mg/day dihydrotestosterone (DHT or selective androgen receptor modulators. Knockout of the miR processing enzyme, DICER, in LNCaP prostate cancer cells or tissue specifically in mice inhibited AR function leading to AIS. Since the only function of miRs is to bind to 3' UTR and inhibit translation of target genes, androgens might induce miRs to inhibit repressors of AR function. In concordance, knock-down of DICER in LNCaP cells and in tissues in mice induced the expression of corepressors, NCoR and SMRT. These studies demonstrate a feedback loop between miRs, corepressors and AR and the imperative role of miRs in AR function in non-cancerous androgen-responsive tissues.

  18. Brachyury as a potential modulator of androgen receptor activity and a key player in therapy resistance in prostate cancer

    Science.gov (United States)

    Pinto, Filipe; Pértega-Gomes, Nelma; Vizcaíno, José R.; Andrade, Raquel P.; Cárcano, Flavio M.; Reis, Rui Manuel

    2016-01-01

    Prostate cancer (PCa) is the most commonly diagnosed neoplasm and the second leading cause of cancer-related deaths in men. Acquisition of resistance to conventional therapy is a major problem for PCa patient management. Several mechanisms have been described to promote therapy resistance in PCa, such as androgen receptor (AR) activation, epithelial-to-mesenchymal transition (EMT), acquisition of stem cell properties and neuroendocrine transdifferentiation (NEtD). Recently, we identified Brachyury as a new biomarker of PCa aggressiveness and poor prognosis. In the present study we aimed to assess the role of Brachyury in PCa therapy resistance. We showed that Brachyury overexpression in prostate cancer cells lines increased resistance to docetaxel and cabazitaxel drugs, whereas Brachyury abrogation induced decrease in therapy resistance. Through ChiP-qPCR assays we further demonstrated that Brachyury is a direct regulator of AR expression as well as of the biomarker AMACR and the mesenchymal markers Snail and Fibronectin. Furthermore, in vitro Brachyury was also able to increase EMT and stem properties. By in silico analysis, clinically human Brachyury-positive PCa samples were associated with biomarkers of PCa aggressiveness and therapy resistance, including PTEN loss, and expression of NEtD markers, ERG and Bcl-2. Taken together, our results indicate that Brachyury contributes to tumor chemotherapy resistance, constituting an attractive target for advanced PCa patients. PMID:27049720

  19. Effects of androgen-binding protein (ABP) on spermatid Tnp1 gene expression in vitro.

    Science.gov (United States)

    Della-Maria, Julie; Gerard, Anne; Franck, Patricia; Gerard, Hubert

    2002-12-30

    In vitro studies were designed to determine whether Sertoli cell-delivered ABP could act on spermatogenetic events, whether such an action could occur via a paracrine or a juxtacrine pathway and whether sex steroids could be involved in this action. ABP delivery to germ cells was achieved using an in vitro model based on recombinant rat ABP-producing mouse Sertoli cells cocultivated with rat spermatids. Using semi-quantitative RT-PCR, the expression of the Tnp 1 gene encoding the Transition Protein 1, involved in the histone to protamine replacement during spermatid nuclear transformation, was analyzed. Our results provide clear evidence that Sertoli cell-derived ABP acts on spermatids by modifying the TP1 mRNA level. This outcome, strictly requiring juxtacrine conditions, is obtained in the absence of sex steroid hormones. To our knowledge this is the first evidence of an effect of ABP itself on male germ cells.

  20. A codon-usage variant in the (GGN){sub n} trinucleotide polymorphism of the androgen receptor gene as an aid in the prenatal diagnosis of ambiguous genitalia due to partial androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Lumbroso, R.; Vasiliou, M.; Beitel, L.K. [McGill Univ., Montreal, Quebec (Canada)] [and others

    1994-09-01

    Exon 1 at the X-linked androgen receptor (AR) locus encodes an N-terminal modulatory domain that contains two large homopolyamino acid tracts: (CAG;glutamine;Gln){sub 11-33} and (GGN;Glycine;Cly){sub 15-27}. Certain AR mutations cause partial androgen insensitivity (PAI) with frank genital ambiguity that may engender appreciable parental anxiety and patient morbidity. If the AR mutation in a PAI family is unknown, the AR`s intragenic trinucleotide repeat polymorphisms may be used for prenatal diagnosis. However, intergenerational instability of repeat-size may be worrisome, particularly when the information alleles differ by only a few repeats. Here, we report the discovery of a codon-usage (silent substitution) variant in the GGN repeat, and describe its use as a source of complementary information for prenatal diagnosis. The standard sense sequence of the (GGN){sub n} tract is (GGT){sub 3} GGG(GGT){sub 2} (GGC){sub 9-21}. On 4 of 27 X chromosomes we noted that the internal GGT sequence was expanded to 3 or 4 repeats. We used an internal (GGT){sub 4} repeat in a total (GGN){sub 24} tract together with a (CAG){sub 20} tract to distinguish an X chromosome with a mutant AR allele from another X chromosome, bearing a normal allele, that had an internal (GGT){sub 2} repeat in a total (GGN){sub 23} tract together with a (CAG){sub 21} tract. Subsequently, we found the base change leading to a pathogenic amino acid substitution (M779I) in codon 6 of the mutant AR gene in an affected maternal aunt and the fetus at risk. This confirmed the prenatal diagnosis based on the intragenic trinucleotide repeat polymorphisms, and it strengthened the prediction of external genital ambiguity using our previous experience with M779I in another family.

  1. Niche-modulated and niche-modulating genes in bone marrow cells

    Science.gov (United States)

    Cohen, Y; Garach-Jehoshua, O; Bar-Chaim, A; Kornberg, A

    2012-01-01

    Bone marrow (BM) cells depend on their niche for growth and survival. However, the genes modulated by niche stimuli have not been discriminated yet. For this purpose, we investigated BM aspirations from patients with various hematological malignancies. Each aspirate was fractionated, and the various samples were fixed at different time points and analyzed by microarray. Identification of niche-modulated genes relied on sustained change in expression following loss of niche regulation. Compared with the reference (‘authentic') samples, which were fixed immediately following aspiration, the BM samples fixed after longer stay out-of-niche acquired numerous changes in gene-expression profile (GEP). The overall genes modulated included a common subset of functionally diverse genes displaying prompt and sustained ‘switch' in expression irrespective of the tumor type. Interestingly, the ‘switch' in GEP was reversible and turned ‘off-and-on' again in culture conditions, resuming cell–cell–matrix contact versus respread into suspension, respectively. Moreover, the resuming of contact prolonged the survival of tumor cells out-of-niche, and the regression of the ‘contactless switch' was followed by induction of a new set of genes, this time mainly encoding extracellular proteins including angiogenic factors and extracellular matrix proteins. Our data set, being unique in authentic expression design, uncovered niche-modulated and niche-modulating genes capable of controlling homing, expansion and angiogenesis. PMID:23241658

  2. Transcriptome analysis of androgenic gland for discovery of novel genes from the oriental river prawn, Macrobrachium nipponense, using Illumina Hiseq 2000.

    Directory of Open Access Journals (Sweden)

    Shubo Jin

    Full Text Available BACKGROUND: The oriental river prawn, Macrobrachium nipponense, is an important aquaculture species in China, even in whole of Asia. The androgenic gland produces hormones that play crucial roles in sexual differentiation to maleness. This study is the first de novo M. nipponense transcriptome analysis using cDNA prepared from mRNA isolated from the androgenic gland. Illumina/Solexa was used for sequencing. METHODOLOGY AND PRINCIPAL FINDING: The total volume of RNA sample was more than 5 ug. We generated 70,853,361 high quality reads after eliminating adapter sequences and filtering out low-quality reads. A total of 78,408 isosequences were obtained by clustering and assembly of the clean reads, producing 57,619 non-redundant transcripts with an average length of 1244.19 bp. In total 70,702 isosequences were matched to the Nr database, additional analyses were performed by GO (33,203, KEGG (17,868, and COG analyses (13,817, identifying the potential genes and their functions. A total of 47 sex-determination related gene families were identified from the M. nipponense androgenic gland transcriptome based on the functional annotation of non-redundant transcripts and comparisons with the published literature. Furthermore, a total of 40 candidate novel genes were found, that may contribute to sex-determination based on their extremely high expression levels in the androgenic compared to other sex glands,. Further, 437 SSRs and 65,535 high-confidence SNPs were identified in this EST dataset from which 14 EST-SSR markers have been isolated. CONCLUSION: Our study provides new sequence information for M. nipponense, which will be the basis for further genetic studies on decapods crustaceans. More importantly, this study dramatically improves understanding of sex-determination mechanisms, and advances sex-determination research in all crustacean species. The huge number of potential SSR and SNP markers isolated from the transcriptome may shed the lights

  3. Integrative transcriptomics-based identification of cryptic drivers of taxol-resistance genes in ovarian carcinoma cells: Analysis of the androgen receptor.

    Science.gov (United States)

    Sun, Nian-Kang; Huang, Shang-Lang; Lu, Hsing-Pang; Chang, Ting-Chang; Chao, Chuck C-K

    2015-09-29

    A systematic analysis of the genes involved in taxol resistance (txr) has never been performed. In the present study, we created txr ovarian carcinoma cell lines to identify the genes involved in chemoresistance. Transcriptome analysis revealed 1,194 overexpressed genes in txr cells. Among the upregulated genes, more than 12 cryptic transcription factors were identified using MetaCore analysis (including AR, C/EBPβ, ERα, HNF4α, c-Jun/AP-1, c-Myc, and SP-1). Notably, individual silencing of these transcription factors (except HNF4`)sensitized txr cells to taxol. The androgen receptor (AR) and its target genes were selected for further analysis. Silencing AR using RNA interference produced a 3-fold sensitization to taxol in txr cells, a response similar to that produced by silencing abcb1. AR silencing also downregulated the expression of prominent txr gene candidates (including abcb1, abcb6, abcg2, bmp5, fat3, fgfr2, h1f0, srcrb4d, and tmprss15). In contrast, AR activation using the agonist DHT upregulated expression of the target genes. Individually silencing seven out of nine (78%) AR-regulated txr genes sensitized txr cells to taxol. Inhibition of AKT and JNK cellular kinases using chemical inhibitors caused a dramatic suppression of AR expression. These results indicate that the AR represents a critical driver of gene expression involved in txr.

  4. Mass spectrometric characterization of urinary metabolites of the selective androgen receptor modulator S-22 to identify potential targets for routine doping controls.

    Science.gov (United States)

    Thevis, Mario; Thomas, Andreas; Möller, Ines; Geyer, Hans; Dalton, James T; Schänzer, Wilhelm

    2011-08-15

    Drugs that promote anabolic processes with limited undesirable effects are of considerable therapeutic interest; some notable examples include those for the treatment of cancer cachexia and muscle-wasting diseases. Anabolic properties are not only therapeutically beneficial to critically ill and debilitated patients, but are also desirable to athletes seeking artificial enhancements in endurance, strength and accelerated recovery. The use of anabolic agents in the clinical setting is being reconsidered with the emergence of a new class of drugs referred to as SARMs (selective androgen receptor modulators). SARMs have the potential to complement or even replace anabolic androgenic steroidal use with the benefit of a reduction of the undesirable side effects associated with steroid administration alone. Arylpropionamide-based SARMs such as andarine (S-4) and S-22 have shown promising therapeutic properties and have attracted the interest of elite and amateur athletes despite the absence of clinical approval, and evidence for trafficking and misuse in sport has been obtained by doping control authorities. In this communication, the elucidation of urinary metabolites of the SARM drug candidate S-22 is compared with earlier in vitro metabolism studies. Following oral administration of illicit S-22, urine samples were collected after 62 and 135 h and analyzed for the active drug and its major metabolic products. Liquid chromatography interfaced with high-resolution/high-accuracy (tandem) mass spectrometry was used to identify and/or confirm the predicted target analytes for sports drug testing purposes. S-22 was detected in both specimens accompanied by its glucuronic acid conjugate. This was the B-ring hydroxylated derivative of S-22 plus the corresponding glucuronide (with the phase-II metabolites being the more abundant analytes). In addition, the samples collected 62 h post-administration also contained the phase-I metabolite hydroxylated at the methyl residue (C-20

  5. Testosterone regulates keratin 33B expression in rat penis growth through androgen receptor signaling.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Dang, Qiang; Shi, Qi; Gao, Yang; Guo, Peng; Xu, Shan; Wang, Xin-Yang; He, Da-Lin; Gong, Yong-Guang

    2014-01-01

    Androgen therapy is the mainstay of treatment for the hypogonadotropic hypogonadal micropenis because it obviously enhances penis growth in prepubescent microphallic patients. However, the molecular mechanisms of androgen treatment leading to penis growth are still largely unknown. To clarify this well-known phenomenon, we successfully generated a castrated male Sprague Dawley rat model at puberty followed by testosterone administration. Interestingly, compared with the control group, testosterone treatment stimulated a dose-dependent increase of penis weight, length, and width in castrated rats accompanied with a dramatic recovery of the pathological changes of the penis. Mechanistically, testosterone administration substantially increased the expression of androgen receptor (AR) protein. Increased AR protein in the penis could subsequently initiate transcription of its target genes, including keratin 33B (Krt33b). Importantly, we demonstrated that KRT33B is generally expressed in the rat penis and that most KRT33B expression is cytoplasmic. Furthermore, AR could directly modulate its expression by binding to a putative androgen response element sequence of the Krt33b promoter. Overall, this study reveals a novel mechanism facilitating penis growth after testosterone treatment in precastrated prepubescent animals, in which androgen enhances the expression of AR protein as well as its target genes, such as Krt33b.

  6. Up-Regulation of Hepatic Alpha-2-HS-Glycoprotein Transcription by Testosterone via Androgen Receptor Activation

    Directory of Open Access Journals (Sweden)

    Jakob Voelkl

    2014-06-01

    Full Text Available Background/Aims: Fetuin-A (alpha-2-HS-glycoprotein, AHSG, a liver borne plasma protein, contributes to the prevention of soft tissue calcification, modulates inflammation, reduces insulin sensitivity and fosters weight gain following high fat diet or ageing. In polycystic ovary syndrome, fetuin-A levels correlate with free androgen levels, an observation pointing to androgen sensitivity of fetuin-A expression. The present study thus explored whether the expression of hepatic fetuin-A is modified by testosterone. Methods: HepG2 cells were treated with testosterone and androgen receptor antagonist flutamide, and were silenced with androgen receptor siRNA. To test the in vivo relevance, male mice were subjected to androgen deprivation therapy (ADT for 7 weeks. AHSG mRNA levels were determined by quantitative RT-PCR and fetuin-A protein abundance by Western blotting. Results: In HepG2 cells, AHSG mRNA expression and fetuin-A protein abundance were both up-regulated following testosterone treatment. The human alpha-2-HS-glycoprotein gene harbors putative androgen receptor response elements in the proximal 5 kb promoter sequence relative to TSS. The effect of testosterone on AHSG mRNA levels was abrogated by silencing of the androgen receptor in HepG2 cells. Moreover, treatment of HepG2 cells with the androgen receptor antagonist flutamide in presence of endogenous ligands in the medium significantly down-regulated AHSG mRNA expression and fetuin-A protein abundance. In addition, ADT of male mice was followed by a significant decrease of hepatic Ahsg mRNA expression and fetuin-A protein levels. Conclusions: Testosterone participates in the regulation of hepatic fetuin-A expression, an effect mediated, at least partially, by androgen receptor activation.

  7. Module network inference from a cancer gene expression data set identifies microRNA regulated modules.

    Directory of Open Access Journals (Sweden)

    Eric Bonnet

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are small RNAs that recognize and regulate mRNA target genes. Multiple lines of evidence indicate that they are key regulators of numerous critical functions in development and disease, including cancer. However, defining the place and function of miRNAs in complex regulatory networks is not straightforward. Systems approaches, like the inference of a module network from expression data, can help to achieve this goal. METHODOLOGY/PRINCIPAL FINDINGS: During the last decade, much progress has been made in the development of robust and powerful module network inference algorithms. In this study, we analyze and assess experimentally a module network inferred from both miRNA and mRNA expression data, using our recently developed module network inference algorithm based on probabilistic optimization techniques. We show that several miRNAs are predicted as statistically significant regulators for various modules of tightly co-expressed genes. A detailed analysis of three of those modules demonstrates that the specific assignment of miRNAs is functionally coherent and supported by literature. We further designed a set of experiments to test the assignment of miR-200a as the top regulator of a small module of nine genes. The results strongly suggest that miR-200a is regulating the module genes via the transcription factor ZEB1. Interestingly, this module is most likely involved in epithelial homeostasis and its dysregulation might contribute to the malignant process in cancer cells. CONCLUSIONS/SIGNIFICANCE: Our results show that a robust module network analysis of expression data can provide novel insights of miRNA function in important cellular processes. Such a computational approach, starting from expression data alone, can be helpful in the process of identifying the function of miRNAs by suggesting modules of co-expressed genes in which they play a regulatory role. As shown in this study, those modules can then be

  8. A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

    DEFF Research Database (Denmark)

    Ottesen, A M; Garn, I D; Aksglaede, L;

    2007-01-01

    Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....

  9. Analysis of the CAG repeat region of the androgen receptor gene in a kindred with X-linked spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Belsham, D D; Yee, W C; Greenberg, C R; Wrogemann, K

    1992-10-01

    Herein we describe a family with X-linked spinal and bulbar muscular atrophy (SBMA or Kennedy's disease), an adult onset neuromuscular disease characterized by slow progression, predominant proximal and bulbar muscle weakness. One frequent association is the appearance of gynecomastia. This disorder was previously shown to be linked to the locus DXYS1 on the proximal long arm of the X chromosome. Recently, a report implicated a mutation at the N-terminus of the androgen receptor gene involving amplification of CAG repeats as the cause of X-linked SBMA. We studied this region of the androgen receptor in a kindred clinically suspected but not confirmed of having X-linked SBMA by the polymerase chain reaction (PCR) followed by Southern analysis and DNA sequencing. The mutated allele was found to have an increased number of 51 CAG repeats confirming the clinical diagnosis of SBMA. Normal individuals revealed 23 repeat numbers within the normal range, while another unrelated X-linked SBMA patient had an enlarged CAG repeat region. The carrier or disease status could be established or confirmed in 12 individuals of this family on the basis of detecting normal and disease alleles reflected by the number of CAG repeats.

  10. Relation of androgen receptor gene polymorphism to bone mineral density and fracture risk in early postmenopausal women during a 5-year randomized hormone replacement therapy trial.

    Science.gov (United States)

    Salmén, Timo; Heikkinen, Anna-Mari; Mahonen, Anitta; Kröger, Heikki; Komulainen, Marja; Pallonen, Heli; Saarikoski, Seppo; Honkanen, Risto; Mäenpää, Pekka H

    2003-02-01

    In women, the influence of androgens on bone health is not clear. It has been suggested that the androgen receptor (AR) genotype is associated with bone mineral density and serum androgen levels in pre- and perimenopausal women, but the association between AR genotype, bone mineral density, and fracture risk has not been studied in postmenopausal women. Therefore, we studied whether AR polymorphism affects bone mineral density, bone mineral density change, or fracture risk in a 5-year randomized hormone replacement therapy (HRT) trial on 331 early postmenopausal women (mean baseline age, 52.7 +/- 2.3 years). The participants consisted of two treatment groups: the HRT group (n = 151) received a sequential combination of 2 mg estradiol valerate and 1 mg cyproterone acetate with or without vitamin D3, 100-300 IU + 93 mg calcium as lactate/day, and the non-HRT group (n = 180) received 93 mg calcium alone or in combination with vitamin D3, 100-300 IU/day for 5 years. Bone mineral density was measured from lumbar spine and proximal femur (DXA) before and after the 5-year trial. All new symptomatic, radiographically defined fractures were recorded during the follow-up. The length of CAG repeat in exon 1 of AR gene was evaluated after polymerase chain reaction (PCR) amplification. The subjects were divided into three repeat groups according to AR alleles. None of the baseline characteristics were associated with AR gene polymorphism and HRT treatment. The polymorphism did not influence the calculated annual changes of lumbar or femoral neck bone mineral density during the 5-year follow-up in the HRT (p = 0.926 and 0.146, respectively) or non-HRT (p = 0.818 and 0.917, respectively) groups. In all, 28 women sustained 33 fractures during the follow-up. Thus, the numbers of fractures were limited. The AR repeat length variation was not significantly associated with fracture risk in the HRT or non-HRT groups (p = 0.632 and 0.459, respectively; Cox proportional hazards model

  11. Effect of testosterone on insulin-like growth factor-I, androgen receptor, and myostatin gene expression in splenius and semitendinosus muscles in sheep.

    Science.gov (United States)

    Mateescu, R G; Thonney, M L

    2005-04-01

    Testosterone is known to act differentially on skeletal muscle from different regions. Two genes likely to mediate the testosterone effect are IGF-I, an important growth regulator acting in an autocrine and paracrine way, and androgen receptor (AR), as receptor density could account for differential muscle growth. Another muscle-specific gene that may play a role in differential muscle growth is myostatin, a member of the transforming growth factor-beta superfamily, shown to be a negative regulator of skeletal muscle mass. The objective of this study was to quantify and compare the expression of these three genes in two different skeletal muscles in sheep. East Friesian x Dorset-sired ram lambs from Dorset ewes were used in a 2 x 4 factorial experiment. Eighteen sets of twins were assigned to four age groups corresponding to 77, 105, 133, and 161 d of age, and one individual from each set was castrated at birth. Total RNA was extracted from samples of splenius (SP) and semitendinosus muscles collected at the time of slaughter. Insulin-like growth factor-I mRNA was measured using competitive reverse-transcription PCR. Androgen receptor and myostatin mRNA were measured by ribonuclease protection assay with standard curves. Weight of SP was greater than semitendinosus in rams compared with wethers at 105, 133, and 161 d (P = 0.05, P = 0.04, and P = 0.02, respectively). The difference in IGF-I mRNA levels between the two muscles was greater in rams than in wethers at 133 (P = 0.001) and 161 d (P = 0.014), and the difference in AR mRNA levels was greater in rams than in wethers at 105, 133, and 161 d (P = 0.002, P muscles in rams and wethers at any age. These results suggest that locally produced IGF-I and the regulation of AR expression are important for sexually dimorphic muscle growth patterns.

  12. Cohesin modulates transcription of estrogen-responsive genes.

    Science.gov (United States)

    Antony, Jisha; Dasgupta, Tanushree; Rhodes, Jenny M; McEwan, Miranda V; Print, Cristin G; O'Sullivan, Justin M; Horsfield, Julia A

    2015-03-01

    The cohesin complex has essential roles in cell division, DNA damage repair and gene transcription. The transcriptional function of cohesin is thought to derive from its ability to connect distant regulatory elements with gene promoters. Genome-wide binding of cohesin in breast cancer cells frequently coincides with estrogen receptor alpha (ER), leading to the hypothesis that cohesin facilitates estrogen-dependent gene transcription. We found that cohesin modulates the expression of only a subset of genes in the ER transcription program, either activating or repressing transcription depending on the gene target. Estrogen-responsive genes most significantly influenced by cohesin were enriched in pathways associated with breast cancer progression such as PI3K and ErbB1. In MCF7 breast cancer cells, cohesin depletion enhanced transcription of TFF1 and TFF2, and was associated with increased ER binding and increased interaction between TFF1 and its distal enhancer situated within TMPRSS3. In contrast, cohesin depletion reduced c-MYC mRNA and was accompanied by reduced interaction between a distal enhancer of c-MYC and its promoters. Our data indicates that cohesin is not a universal facilitator of ER-induced transcription and can even restrict enhancer-promoter communication. We propose that cohesin modulates transcription of estrogen-dependent genes to achieve appropriate directionality and amplitude of expression.

  13. Humanizing the Mouse Androgen Receptor to Study Polymorphisms and Mutations in Prostate Cancer

    Science.gov (United States)

    2006-01-01

    generation of these lines, for testis, liver and kidney 6 RNA. Now that the lines have been backcrossed several additional generations to the C57BL/6...tract morphology when compared to wildtype littermates, and no significant differences were seen by microarray analysis of testis and kidney RNA...polymorphism in the androgen receptor gene modulates body fat mass and serum concentrations of leptin and insulin in men. Diabetologia 46:31-9 22

  14. PSA and androgen-related gene (AR, CYP17, and CYP19) polymorphisms and the risk of adenocarcinoma at prostate biopsy

    DEFF Research Database (Denmark)

    dos Santos, Rodrigo Mattos; de Jesus, Carlos Márcio Nóbrega; Trindade Filho, José Carlos Souza;

    2008-01-01

    The aim of the present study was to examine the impact of polymorphisms in prostate-specific antigen (PSA) and androgen-related genes (AR, CYP17, and CYP19) on prostate cancer (PCa) risk in selected high-risk patients who underwent prostate biopsy. Blood samples and prostate tissues were obtained...... for DNA analysis. Single-nucleotide polymorphisms in the 50-untranslated regions (UTRs) of the PSA (substitution A>G at position-158) and CYP17 (substitution T>C at 50-UTR) genes were detected by polymerase chain reaction (PCR)-restriction fragment length polymorphism assays. The CAG and TTTA repeats...... in the AR and CYP19 genes, respectively, were genotyped by PCR-based GeneScan analysis. Patients with the GG genotype of the PSA gene had a higher risk of PCa than those with the AG or AA genotype (OR=3.79, p=0.00138). The AA genotype was associated with lower PSA levels (6.44 +/- 1.64 ng=mL) compared...

  15. Non-Genomic Actions of the Androgen Receptor in Prostate Cancer

    Science.gov (United States)

    Leung, Jacky K.; Sadar, Marianne D.

    2017-01-01

    Androgen receptor (AR) is a validated drug target for prostate cancer based on its role in proliferation, survival, and metastases of prostate cancer cells. Unfortunately, despite recent improvements to androgen deprivation therapy and the advent of better antiandrogens with a superior affinity for the AR ligand-binding domain (LBD), most patients with recurrent disease will eventually develop lethal metastatic castration-resistant prostate cancer (CRPC). Expression of constitutively active AR splice variants that lack the LBD contribute toward therapeutic resistance by bypassing androgen blockade and antiandrogens. In the canonical pathway, binding of androgen to AR LBD triggers the release of AR from molecular chaperones which enable conformational changes and protein–protein interactions to facilitate its nuclear translocation where it regulates the expression of target genes. However, preceding AR function in the nucleus, initial binding of androgen to AR LBD in the cytoplasm may already initiate signal transduction pathways to modulate cellular proliferation and migration. In this article, we review the significance of signal transduction pathways activated by rapid, non-genomic signaling of the AR during the progression to metastatic CRPC and put into perspective the implications for current and novel therapies that target different domains of AR.

  16. Observation of Androgen Receptor Gene and Sex Hormone Binding Protein Gene in PCOS Patients%PCOS患者雄激素受体基因和性激素结合蛋白基因情况观察

    Institute of Scientific and Technical Information of China (English)

    马娟; 周俊; 田贵聪; 石华

    2016-01-01

    目的:研究观察多囊卵巢综合征(polycystic ovary syndrome,PCOS)患者的雄激素受体基因和性激素结合蛋白基因的情况。方法:选取2014年11月-2015年7月本院接诊的62例PCOS患者为观察组,同一时期由于生殖系统发生异常导致不孕的62例患者为对照组。提取所有患者血液标本的DNA进行基因扩增、琼脂糖凝胶、毛细管电泳等检测,观察研究PCOS患者的雄激素受体和性激素结合蛋白基因的情况。结果:观察组SHBG-TAAAA基因型多态性与胰岛素抵抗的研究中,发现9/9基因型的分布在胰岛素抵抗和非胰岛素抵抗两组中存在统计学差异(P<0.05);观察组中,短重复组在高雄激素血症组的分布为52.94%,在雄激素正常组分布为42.86%;而长重复组在高雄激素血症组的分布为61.76%,在雄激素正常组的分布为39.29%,两组数据比较差异有统计学意义(P<0.05)。结论:雄激素受体基因和性激素结合蛋白基因与PCOS相关,可对PCOS的检查指标、PCOS防治、及早诊断起重要作用。%Objective:To investigate the status of androgen receptor gene and sex hormone binding protein gene in patients with polycystic ovary syndrome(PCOS).Method:A total of 62 PCOS patients were selected as the observation group from November 2014 to July 2015 in our hospital,the control group were choosed from the same period due to the occurrence of reproductive system abnormalities lead to infertility in 62 patients.DNA gene amplification,agarose gel electrophoresis and capillary electrophoresis were performed to detect the expression of androgen receptor and sex hormone binding protein gene in PCOS patients.Result:SHBG-TAAAA gene type of polymorphic and insulin resistance of the observation group in the study,found that 9/9 genotype distribution in insulin resistance and insulin resistance had a significant difference in two groups(P<0.05).In the observation group

  17. Antioxidants Abrogate Alpha-Tocopherylquinone-Mediated Down-Regulation of the Androgen Receptor in Androgen-Responsive Prostate Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Alexandra M Fajardo

    Full Text Available Tocopherylquinone (TQ, the oxidation product of alpha-tocopherol (AT, is a bioactive molecule with distinct properties from AT. In this study, AT and TQ are investigated for their comparative effects on growth and androgenic activity in prostate cancer cells. TQ potently inhibited the growth of androgen-responsive prostate cancer cell lines (e.g., LAPC4 and LNCaP cells, whereas the growth of androgen-independent prostate cancer cells (e.g., DU145 cells was not affected by TQ. Due to the growth inhibitory effects induced by TQ on androgen-responsive cells, the anti-androgenic properties of TQ were examined. TQ inhibited the androgen-induced activation of an androgen-responsive reporter and inhibited the release of prostate specific antigen from LNCaP cells. TQ pretreatment was also found to inhibit AR activation as measured using the Multifunctional Androgen Receptor Screening assay. Furthermore, TQ decreased androgen-responsive gene expression, including TM4SF1, KLK2, and PSA over 5-fold, whereas AT did not affect the expression of androgen-responsive genes. Of importance, the antiandrogenic effects of TQ on prostate cancer cells were found to result from androgen receptor protein down-regulation produced by TQ that was not observed with AT treatment. Moreover, none of the androgenic endpoints assessed were affected by AT. The down-regulation of androgen receptor protein by TQ was abrogated by co-treatment with antioxidants. Overall, the biological actions of TQ were found to be distinct from AT, where TQ was found to be a potent inhibitor of cell growth and androgenic activity in androgen-responsive prostate cancer cells.

  18. Inactivation by UDP-glucuronosyltransferase enzymes: the end of androgen signaling.

    Science.gov (United States)

    Chouinard, Sarah; Yueh, Mei-Fei; Tukey, Robert H; Giton, Frank; Fiet, Jean; Pelletier, Georges; Barbier, Olivier; Bélanger, Alain

    2008-04-01

    Conjugation by UDP-Glucuronosyltransferase (UGT) is the major pathway of androgen metabolism and elimination in the human. High concentrations of glucuronide conjugates of androsterone (ADT) and androstane-3alpha,17beta-diol (3alpha-diol) are present in circulation and several studies over the last 30 years have concluded that the serum levels of these metabolites might reflect the androgen metabolism in several tissues, including the liver and androgen target tissues. Three UGT2B enzymes are responsible for the conjugation of DHT and its metabolites ADT and 3alpha-diol: UGT2B7, B15 and B17. UGT2B7 is expressed in the liver and skin whereas UGT2B15 and B17 were found in the liver, prostate and skin. Very specific antibodies against each UGT2B enzyme have been obtained and used for immunohistochemical studies in the human prostate. It was shown that UGT2B17 is expressed in basal cells whereas UGT2B15 is only localized in luminal cells, where it inactivates DHT. By using LNCaP cells, we have also demonstrated that the expression and activity of UGT2B15 and B17 are modulated by several endogenous prostate factors including androgen. Finally, to study the physiological role of UGT2B enzymes, transgenic mice bearing the human UGT2B15 gene were recently obtained. A decrease in reproductive tissue weight from transgenic animals compared to those from control animals was observed. In conclusion, the conjugation by UGT2B7, B15 and B17, which represents a non-reversible step in androgen metabolism, is an important means by which androgens are regulated locally. It is also postulated that UGT enzymes protect the tissue from deleteriously high concentrations of active androgen.

  19. Cytogenetic and molecular analysis of infertile Chinese men: karyotypic abnormalities, Y-chromosome microdeletions, and CAG and GGN repeat polymorphisms in the androgen receptor gene.

    Science.gov (United States)

    Han, T T; Ran, J; Ding, X P; Li, L J; Zhang, L Y; Zhang, Y P; Nie, S S; Chen, L

    2013-07-08

    Chromosome abnormalities, Y-chromosome microdeletions, and androgen receptor gene CAG and GGN repeat polymorphisms in infertile Chinese men featuring severe oligospermia and azoospermia were analyzed. Ninety-six fertile men and 189 non-obstructive infertile men, including 125 patients with azoospermia and 64 with severe oligozoospermia, were studied. Seventeen infertile men (9.0%) carried a chromosome abnormality. Twenty (10.6%) carried a Y-chromosome microdeletion. In the remainder of the patients and controls, GGN and CAG repeats were sequenced. Short GGN repeats (n repeats strongly correlated with sperm counts. No significant difference in CAG repeats was found between patients and controls, nor were CAG repeats correlated with sperm counts. However, for CAG repeats ranging between 24 and 25, there was a >2.5-fold risk (OR = 2.539, 95%CI = 1.206-5.344, P repeats in Chinese male infertility.

  20. Aberrant splicing of androgenic receptor mRNA results in synthesis of a nonfunctional receptor protein in a patient with androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Ris-Stalpers, C.; Kuiper, G.G.J.M.; Faber, P.W.; van Rooij, H.C.J.; Degenhart, H.J.; Trapman, J.; Brinkmann, A.O. (Erasmus Univ., Rotterdam (Netherlands)); Schweikert, H.U. (Univ. of Bonn (Germany)); Zegers, N.D. (Medical Biological Laboratory-Organization for Applied Scientific Research, Rijswijk (Netherlands)); Hodgins, M.B. (Glasgow Univ. (United Kingdom))

    1990-10-01

    Androgen insensitivity is a disorder in which the correct androgen response in an androgen target cell is impaired. The clinical symtpoms of this X chromosome-linked syndrome are presumed to be caused by mutations in the androgen receptor gene. The authors report a G {r arrow} T mutation in the splice donor site of intron 4 of the androgen receptor gene of a 46, XY subject lacking detectable androgen binding to the receptor and with the complete form of androgen insensitivity. This point mutation completely abolishes normal RNA splicing at the exon 4/intron 4 boundary and results in the activation of a cryptic splice donor site in exon 4, which leads to the deletion of 123 nucleotides from the mRNA. Translation of the mutant mRNA results in an androgen receptor protein {approx}5 kDa smaller than the wild type. This mutated androgen receptor protein was unable to bind androgens and unable to activate transcription of an androgen-regulated reporter gene construct. This mutation in the human androgen receptor gene demonstrates the importance of an intact steroid-binding domain for proper androgen receptor functioning in vivo.

  1. Long-term outcomes from dose-escalated image-guided intensity-modulated radiotherapy with androgen deprivation: encouraging results for intermediate- and high-risk prostate cancer

    Directory of Open Access Journals (Sweden)

    Wilcox SW

    2014-08-01

    Full Text Available Shea W Wilcox,1,4 Noel J Aherne,2,4 Linus C Benjamin,1 Bosco Wu,1 Thomaz de Campos Silva,3 Craig S McLachlan,4 Michael J McKay,3,5 Andrew J Last,1 Thomas P Shakespeare1–4 1North Coast Cancer Institute, Port Macquarie, NSW, Australia; 2North Coast Cancer Institute, Coffs Harbour, NSW, Australia; 3North Coast Cancer Institute, Lismore, NSW, Australia; 4The University of New South Wales, Rural Clinical School, Sydney, NSW, Australia; 5The University of Sydney, Sydney, NSW, Australia Purpose: Dose-escalated (DE radiotherapy in the setting of localized prostate cancer has been shown to improve biochemical disease-free survival (bDFS in several studies. In the same group of patients, androgen deprivation therapy (ADT has been shown to confer a survival benefit when combined with radiotherapy doses of up to 70 Gy; however, there is currently little long-term data on patients who have received high-dose intensity-modulated radiotherapy (IMRT with ADT. We report the long-term outcomes in a large cohort of patients treated with the combination of DE image-guided IMRT (IG-IMRT and ADT. Methods and materials: Patients with localized prostate cancer were identified from a centralized database across an integrated cancer center. All patients received DE IG-IMRT, combined with ADT, and had a minimum follow up of 12 months post-radiotherapy. All relapse and toxicity data were collected prospectively. Actuarial bDFS, metastasis-free survival, prostate cancer-specific survival, and multivariate analyses were calculated using the SPSS v20.0 statistical package. Results: Seven hundred and eighty-two eligible patients were identified with a median follow up of 46 months. Overall, 4.3% of patients relapsed, 2.0% developed distant metastases, and 0.6% died from metastatic prostate cancer. At 5-years, bDFS was 88%, metastasis-free survival was 95%, and prostate cancer-specific survival was 98%. Five-year grade 2 genitourinary and gastrointestinal toxicity was 2

  2. Cyclin-dependent kinase 5 modulates STAT3 and androgen receptor activation through phosphorylation of Ser⁷²⁷ on STAT3 in prostate cancer cells.

    Science.gov (United States)

    Hsu, Fu-Ning; Chen, Mei-Chih; Lin, Kuan-Chia; Peng, Yu-Ting; Li, Pei-Chi; Lin, Eugene; Chiang, Ming-Ching; Hsieh, Jer-Tsong; Lin, Ho

    2013-10-15

    Cyclin-dependent kinase 5 (Cdk5) is known to regulate prostate cancer metastasis. Our previous results indicated that Cdk5 activates androgen receptor (AR) and supports prostate cancer growth. We also found that STAT3 is a target of Cdk5 in promoting thyroid cancer cell growth, whereas STAT3 may play a role as a regulator to AR activation under cytokine control. In this study, we investigated the regulation of Cdk5 and its activator p35 on STAT3/AR signaling in prostate cancer cells. Our results show that Cdk5 biochemically interacts with STAT3 and that this interaction depends on Cdk5 activation in prostate cancer cells. The phosphorylation of STAT3 at Ser⁷²⁷ (p-Ser⁷²⁷-STAT3) is regulated by Cdk5 in cells and xenograft tumors. The mutant of STAT3 S727A reduces its interaction with Cdk5. We further show that the nuclear distribution of p-Ser⁷²⁷-STAT3 and the expression of STAT3-regulated genes (junB, c-fos, c-myc, and survivin) are regulated by Cdk5 activation. STAT3 mutant does not further decrease cell proliferation upon Cdk5 inhibition, which implies that the role of STAT3 regulated by Cdk5 correlates to cell proliferation control. Interestingly, Cdk5 may regulate the interaction between STAT3 and AR through phosphorylation of Ser⁷²⁷-STAT3 and therefore upregulate AR protein stability and transactivation. Correspondingly, clinical evidence shows that the level of p-Ser⁷²⁷-STAT3 is significantly correlated with Gleason score and the levels of upstream regulators (Cdk5 and p35) as well as downstream protein (AR). In conclusion, this study demonstrates that Cdk5 regulates STAT3 activation through Ser⁷²⁷ phosphorylation and further promotes AR activation by protein-protein interaction in prostate cancer cells.

  3. Ovarian overproduction of androgens

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001165.htm Ovarian overproduction of androgens To use the sharing features on this page, please enable JavaScript. Ovarian overproduction of androgens is a condition in which the ...

  4. Androgen receptor mutations

    NARCIS (Netherlands)

    A.O. Brinkmann (Albert); G.W. Jenster (Guido); C. Ris-Stalpers (Carolyn); J.A.G.M. van der Korput (J. A G M); H.T. Brüggenwirth (Hennie); A.L.M. Boehmer (Annemie); J. Trapman (Jan)

    1995-01-01

    textabstractMale sexual differentiation and development proceed under direct control of androgens. Androgen action is mediated by the intracellular androgen receptor, which belongs to the superfamily of ligand-dependent transcription factors. At least three pathological situations are associated wit

  5. Transcriptional Modulation of Heat-Shock Protein Gene Expression

    OpenAIRE

    Anastasis Stephanou; Latchman, David S.

    2011-01-01

    Heat-shock proteins (Hsps) are molecular chaperones that are ubiquitously expressed but are also induced in cells exposed to stressful stimuli. Hsps have been implicated in the induction and propagation of several diseases. This paper focuses on regulatory factors that control the transcription of the genes encoding Hsps. We also highlight how distinct transcription factors are able to interact and modulate Hsps in different pathological states. Thus, a better understanding of the complex sig...

  6. Transcriptional modulation of heat-shock protein gene expression.

    OpenAIRE

    A. Stephanou; Latchman, D S

    2011-01-01

    Heat-shock proteins (Hsps) are molecular chaperones that are ubiquitously expressed but are also induced in cells exposed to stressful stimuli. Hsps have been implicated in the induction and propagation of several diseases. This paper focuses on regulatory factors that control the transcription of the genes encoding Hsps. We also highlight how distinct transcription factors are able to interact and modulate Hsps in different pathological states. Thus, a better understanding of the complex sig...

  7. Extracting expression modules from perturbational gene expression compendia

    Directory of Open Access Journals (Sweden)

    Van Dijck Patrick

    2008-04-01

    Full Text Available Abstract Background Compendia of gene expression profiles under chemical and genetic perturbations constitute an invaluable resource from a systems biology perspective. However, the perturbational nature of such data imposes specific challenges on the computational methods used to analyze them. In particular, traditional clustering algorithms have difficulties in handling one of the prominent features of perturbational compendia, namely partial coexpression relationships between genes. Biclustering methods on the other hand are specifically designed to capture such partial coexpression patterns, but they show a variety of other drawbacks. For instance, some biclustering methods are less suited to identify overlapping biclusters, while others generate highly redundant biclusters. Also, none of the existing biclustering tools takes advantage of the staple of perturbational expression data analysis: the identification of differentially expressed genes. Results We introduce a novel method, called ENIGMA, that addresses some of these issues. ENIGMA leverages differential expression analysis results to extract expression modules from perturbational gene expression data. The core parameters of the ENIGMA clustering procedure are automatically optimized to reduce the redundancy between modules. In contrast to the biclusters produced by most other methods, ENIGMA modules may show internal substructure, i.e. subsets of genes with distinct but significantly related expression patterns. The grouping of these (often functionally related patterns in one module greatly aids in the biological interpretation of the data. We show that ENIGMA outperforms other methods on artificial datasets, using a quality criterion that, unlike other criteria, can be used for algorithms that generate overlapping clusters and that can be modified to take redundancy between clusters into account. Finally, we apply ENIGMA to the Rosetta compendium of expression profiles for

  8. Androgens and bone.

    Science.gov (United States)

    Vanderschueren, Dirk; Vandenput, Liesbeth; Boonen, Steven; Lindberg, Marie K; Bouillon, Roger; Ohlsson, Claes

    2004-06-01

    Loss of estrogens or androgens increases the rate of bone remodeling by removing restraining effects on osteoblastogenesis and osteoclastogenesis, and also causes a focal imbalance between resorption and formation by prolonging the lifespan of osteoclasts and shortening the lifespan of osteoblasts. Conversely, androgens, as well as estrogens, maintain cancellous bone mass and integrity, regardless of age or sex. Although androgens, via the androgen receptor (AR), and estrogens, via the estrogen receptors (ERs), can exert these effects, their relative contribution remains uncertain. Recent studies suggest that androgen action on cancellous bone depends on (local) aromatization of androgens into estrogens. However, at least in rodents, androgen action on cancellous bone can be directly mediated via AR activation, even in the absence of ERs. Androgens also increase cortical bone size via stimulation of both longitudinal and radial growth. First, androgens, like estrogens, have a biphasic effect on endochondral bone formation: at the start of puberty, sex steroids stimulate endochondral bone formation, whereas they induce epiphyseal closure at the end of puberty. Androgen action on the growth plate is, however, clearly mediated via aromatization in estrogens and interaction with ERalpha. Androgens increase radial growth, whereas estrogens decrease periosteal bone formation. This effect of androgens may be important because bone strength in males seems to be determined by relatively higher periosteal bone formation and, therefore, greater bone dimensions, relative to muscle mass at older age. Experiments in mice again suggest that both the AR and ERalpha pathways are involved in androgen action on radial bone growth. ERbeta may mediate growth-limiting effects of estrogens in the female but does not seem to be involved in the regulation of bone size in males. In conclusion, androgens may protect men against osteoporosis via maintenance of cancellous bone mass and

  9. Phase II Study of Long-Term Androgen Suppression With Bevacizumab and Intensity-Modulated Radiation Therapy (IMRT) in High-Risk Prostate Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Vuky, Jacqueline, E-mail: vukyja@ohsu.edu [Section of Community Hematology/Oncology, Knight Cancer Institute, Oregon Health Sciences University, Portland, OR (United States); Pham, Huong T. [Section of Hematology/Oncology and Radiation Oncology, Virginia Mason Medical Center, Seattle, WA (United States); Warren, Sarah; Douglass, Erika [Benaroya Research Institute, Virginia Mason Medical Center, Seattle, WA (United States); Badiozamani, Kasra [Section of Hematology/Oncology and Radiation Oncology, Virginia Mason Medical Center, Seattle, WA (United States); Madsen, Berit; Hsi, Alex [Peninsula Cancer Center, Poulsbo, WA (United States); Song Guobin [Section of Hematology/Oncology and Radiation Oncology, Virginia Mason Medical Center, Seattle, WA (United States)

    2012-03-15

    Purpose: We report a Phase II trial assessing the acute and late toxicities of intensity-modulated radiation therapy (IMRT), long-term androgen suppression (LTAS), and bevacizumab in patients with high-risk localized prostate cancer. Methods and Materials: We treated 18 patients with LTAS with bicalutamide and goserelin in combination with bevacizumab and IMRT. Bevacizumab (10 mg/kg every 2 weeks) was administered for the first 16 weeks, and 15 mg/kg was then given every 3 weeks for 12 additional weeks, with an IMRT dose of 77.9 Gy to the prostate, 64.6 Gy to the seminal vesicles, and 57 Gy to the pelvic lymph nodes. Patients were eligible if they had clinical stage T2b to T4, a Gleason sum score of 8 to 10, or a prostate- specific antigen level of 20ng/mL or greater. The primary endpoint of the study was evaluation of acute and late toxicities. Results: The median age was 69 years, with a median pretreatment prostate-specific antigen level of 12.5 ng/mL and Gleason score of 8. The pretreatment clinical stage was T1c in 4 patients, T2 in 11, and T3 in 3. All patients completed IMRT with median follow-up of 34 months (range, 28-40 months) The most common Grade 2 or higher toxicities were hypertension (61% of patients with Grade 2 and 11% with Grade 3), proteinuria (28% with Grade 2 and 6% with Grade 3), and leucopenia (28% with Grade 2). No Grade 4 or higher acute toxicities were reported. Late toxicities included proctitis (6% of patients with Grade 2 and 11% with Grade 3), rectal bleeding (6% with Grade 2 and 11% with Grade 3), hematuria (6% with Grade 2), proteinuria (17% with Grade 2), hyponatremia (6% with Grade 3), cystitis (6% with Grade 3), and urinary retention (6% with Grade 2 and 11% with Grade 3). Grade 4 prostatitis occurred in 1 patient (6%). Conclusions: Bevacizumab does not appear to exacerbate the acute effects of IMRT. Late toxicities may have been worsened with this regimen. Further investigations of bevacizumab with LTAS and IMRT should be

  10. Transcription dynamics of inducible genes modulated by negative regulations.

    Science.gov (United States)

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  11. Detection of androgen receptor gene mutation in two pedigrees with an-drogen insensitivity syndrome%两个雄激素不敏感综合征家系中 AR基因突变检测

    Institute of Scientific and Technical Information of China (English)

    信艳萍; 吴庆华; 张毅; 史惠蓉

    2015-01-01

    目的:对两个疑似雄激素不敏感综合征( AIS)家系进行基因诊断和其他临床相关检查,旨在发现其致病基因并进行遗传咨询。方法:对两个AIS家系的先证者及相关成员行体格检查、染色体核型分析、内分泌检测及超声检查后,提取外周血全基因组DNA,扩增位于X染色体上AR基因的8个外显子,扩增产物测序后与基因库中正常人的序列进行比对,查找是否存在致病突变。结果:两个AIS家系的先证者均检测到AR基因突变,分别为c.2042T>C(p.681I>T)和c.1822C>T(p.608R>X),家系中女性携带者中检测出了上述位点的杂合突变。家系1先证者行腹腔镜性腺切除术后证实性腺为睾丸。结论:AR基因的p.681 I>T和p.608 R>X是两个AIS家系患者的致病性突变;对AR基因进行基因检测是46,XY性发育异常,特别是AIS有效的诊断方式。%Aim:Clinical and genetic tests were performed in two pedigrees suspected of androgen insensitivity syndrome ( AIS) to get the diagnosis and provide genetic counseling .Methods:Physical examination , karyotyping ,endocrinal tests and ultrasonography were performed in the probands and their relatives .Eight encoding exons of AR gene extracted from peripher-al blood were amplified by PCR .The products were compared with the normal gene sequences and further analyzed by direct DNA sequencing to find possible mutant gene .Results:Different mutations of AR gene were detected in both pedigrees , re-spectively, c.2042T>C(p.681I>T) and c.1822C>T(p.608R>X).Heterozygous double peaks at the same position were found in female carriers.In pedigree 1, the laparoscopic surgery was performed in the proband and the sex gland was con-firmed to be testis.Conclusion:These two types of mutation of AR gene may be the pathologic causes of AIS .Direct sequen-cing of AR gene is a rapid method to diagnose 46,XY disorder of sex development , especially for

  12. Differential regulation of LncRNA-SARCC suppresses VHL-mutant RCC cell proliferation yet promotes VHL-normal RCC cell proliferation via modulating androgen receptor/HIF-2α/C-MYC axis under hypoxia.

    Science.gov (United States)

    Zhai, W; Sun, Y; Jiang, M; Wang, M; Gasiewicz, T A; Zheng, J; Chang, C

    2016-09-15

    It is well established that hypoxia contributes to tumor progression in a hypoxia inducible factor-2α (HIF-2α)-dependent manner in renal cell carcinoma (RCC), yet the role of long noncoding RNAs (LncRNAs) involved in hypoxia-mediated RCC progression remains unclear. Here we demonstrate that LncRNA-SARCC (Suppressing Androgen Receptor in Renal Cell Carcinoma) is differentially regulated by hypoxia in a von Hippel-Lindau (VHL)-dependent manner both in RCC cell culture and clinical specimens. LncRNA-SARCC can suppress hypoxic cell cycle progression in the VHL-mutant RCC cells while derepress it in the VHL-restored RCC cells. Mechanism dissection reveals that LncRNA-SARCC can post-transcriptionally regulate androgen receptor (AR) by physically binding and destablizing AR protein to suppress AR/HIF-2α/C-MYC signals. In return, HIF-2α can transcriptionally regulate the LncRNA-SARCC expression via binding to hypoxia-responsive elements on the promoter of LncRNA-SARCC. The negative feedback modulation between LncRNA-SARCC/AR complex and HIF-2α signaling may then lead to differentially modulated RCC progression in a VHL-dependent manner. Together, these results may provide us a new therapeutic approach via targeting this newly identified signal from LncRNA-SARCC to AR-mediated HIF-2α/C-MYC signals against RCC progression.

  13. Androgen Receptor-Mediated Escape Mechanisms from Androgen Ablation Therapy

    Science.gov (United States)

    2005-10-01

    of CAG repeats in the Machado-Joseph disease , spinocerebellar ataxia type 1 and androgen receptor genes. Hum. Mol. Genet. 4, 1585-1590. Rundlett, S . E... diseases such as Huntington disease and spinal and bulbar muscular atro- phy, which is commonly called Kennedy’s disease . This finding has been attributed...STATEMENT: Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author( s ) and

  14. Correlation study between the polymorphism of repetitive sequence in gene CAG of androgen receptor and the occurrence and progression of prostate cancer

    Institute of Scientific and Technical Information of China (English)

    Xiao-Lei Zhai; Xiao-Wei Qu; Liang Guo; Qian-He Ha

    2014-01-01

    Objective: To explore the relation between the polymorphism of repetitive sequence in gene CAG of androgen receptor (AR) and the susceptibility and clinical stages as well as pathological grading of prostate cancer among Han population. Method: Sixty-eight cases with prostate cancer hospitalized in Urinary Surgery Department from Feb. 2010 to Feb. 2012 and 60 healthy cases were chosen as research subjects. Methods of PCR and direct sequencing were adopted to detect DNA sequence of AR gene and the length of repetitive sequence in CAG. Results: The lengths of repetitive sequence in CAG of patients with prostate cancer and healthy people were (22.3±4.6) and (23.0±4.9), respectively showing no statistical significance. Comparing length (repetitive sequence of CAG)>22, those with that ﹤ 22 suffer a remarkably higher risk of prostate cancer (P﹤0.05). The number of repetitive sequence in CAG of patients at clinical stage C-D was less than that of patients at stage B, and the number of repetitive sequence in CAG of patients with poorly differentiated prostate cancer was also less than that of patients with moderately and highly differentiated prostate cancer. But there was no statistical significance int the difference (P>0.05); the proportion of patients with length ﹤22 at clinical stage C-D was much larger than that of patients at clinical stage B (P﹤0.05), and as the aggravation of pathological grading, the proportion of patients with the length ﹤22 was also remarkably increased and there was significant difference between patients with highly differentiated prostate cancer and those with poorly differentiated prostate cancer (P﹤0.05). Conclusions: There is correlation between the occurrence and development of prostate cancer in Han population and the polymorphism of repetitive sequence in gene CAG of androgen receptor. The less the number of repetitive sequence in CAG is, the higher the risk of prostate cancer will be and the more severe the clinical

  15. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    Science.gov (United States)

    Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M

    2014-01-01

    The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  16. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    Directory of Open Access Journals (Sweden)

    Robert C Karn

    Full Text Available The Androgen-binding protein (Abp region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1 no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2 substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3 that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  17. Androgens exert sexually dimorphic effects on angiogenesis: novel insight into the relationship between androgens and cardiovascular disease

    Institute of Scientific and Technical Information of China (English)

    Katya B Rubinow; John K Amory; Stephanie T Page

    2011-01-01

    @@ The effects of androgen exposure on cardiovascular disease (CVD) risk in men remain poorly understood.Given the earlier incidence of CVD among men relative to women, androgens historically have been assumed to potentiate CVD in men.However,mounting clinical data challenge this assumption and increasingly implicate low levels of circulating testosterone as a risk factor for CVD and mortality.1,2 In their recenfly published report 'A sex-specific role for androgens in angiogenesis',3 Sieveking and colleagues make striking observations regarding the impact of androgens on angiogenesis and recovery from ischemic injury, important components of vascular repair which might provide a mechanism whereby androgens could exert protective cardiovascular effects.Moreover, these findings were sex-specific in both in vitro and in vivo model systems, suggesting a sexually dimorphic effect of androgens in modulating CVD.

  18. Sequence Evolution and Expression of the Androgen Receptor and Other Pathway-Related Genes in a Unisexual Fish, the Amazon Molly, Poecilia formosa, and Its Bisexual Ancestors.

    Directory of Open Access Journals (Sweden)

    Fangjun Zhu

    Full Text Available The all-female Amazon molly (Poecilia formosa originated from a single hybridization of two bisexual ancestors, Atlantic molly (Poecilia mexicana and sailfin molly (Poecilia latipinna. As a gynogenetic species, the Amazon molly needs to copulate with a heterospecific male, but the genetic information of the sperm-donor does not contribute to the next generation, as the sperm only acts as the trigger for the diploid eggs' embryogenesis. Here, we study the sequence evolution and gene expression of the duplicated genes coding for androgen receptors (ars and other pathway-related genes, i.e., the estrogen receptors (ers and cytochrome P450, family19, subfamily A, aromatase genes (cyp19as, in the Amazon molly, in comparison to its bisexual ancestors. Mollies possess-as most other teleost fish-two copies of the ar, er, and cyp19a genes, i.e., arα/arβ, erα/erβ1, and cyp19a1 (also referred as cyp19a1a/cyp19a2 (also referred to as cyp19a1b, respectively. Non-synonymous single nucleotide polymorphisms (SNPs among the ancestral bisexual species were generally predicted not to alter protein function. Some derived substitutions in the P. mexicana and one in P. formosa are predicted to impact protein function. We also describe the gene expression pattern of the ars and pathway-related genes in various tissues (i.e., brain, gill, and ovary and provide SNP markers for allele specific expression research. As a general tendency, the levels of gene expression were lowest in gill and highest in ovarian tissues, while expression levels in the brain were intermediate in most cases. Expression levels in P. formosa were conserved where expression did not differ between the two bisexual ancestors. In those cases where gene expression levels significantly differed between the bisexual species, P. formosa expression was always comparable to the higher expression level among the two ancestors. Interestingly, erβ1 was expressed neither in brain nor in gill in the

  19. Sequence Evolution and Expression of the Androgen Receptor and Other Pathway-Related Genes in a Unisexual Fish, the Amazon Molly, Poecilia formosa, and Its Bisexual Ancestors

    Science.gov (United States)

    Zhu, Fangjun; Schlupp, Ingo; Tiedemann, Ralph

    2016-01-01

    The all-female Amazon molly (Poecilia formosa) originated from a single hybridization of two bisexual ancestors, Atlantic molly (Poecilia mexicana) and sailfin molly (Poecilia latipinna). As a gynogenetic species, the Amazon molly needs to copulate with a heterospecific male, but the genetic information of the sperm-donor does not contribute to the next generation, as the sperm only acts as the trigger for the diploid eggs’ embryogenesis. Here, we study the sequence evolution and gene expression of the duplicated genes coding for androgen receptors (ars) and other pathway-related genes, i.e., the estrogen receptors (ers) and cytochrome P450, family19, subfamily A, aromatase genes (cyp19as), in the Amazon molly, in comparison to its bisexual ancestors. Mollies possess–as most other teleost fish—two copies of the ar, er, and cyp19a genes, i.e., arα/arβ, erα/erβ1, and cyp19a1 (also referred as cyp19a1a)/cyp19a2 (also referred to as cyp19a1b), respectively. Non-synonymous single nucleotide polymorphisms (SNPs) among the ancestral bisexual species were generally predicted not to alter protein function. Some derived substitutions in the P. mexicana and one in P. formosa are predicted to impact protein function. We also describe the gene expression pattern of the ars and pathway-related genes in various tissues (i.e., brain, gill, and ovary) and provide SNP markers for allele specific expression research. As a general tendency, the levels of gene expression were lowest in gill and highest in ovarian tissues, while expression levels in the brain were intermediate in most cases. Expression levels in P. formosa were conserved where expression did not differ between the two bisexual ancestors. In those cases where gene expression levels significantly differed between the bisexual species, P. formosa expression was always comparable to the higher expression level among the two ancestors. Interestingly, erβ1 was expressed neither in brain nor in gill in the analyzed

  20. Androgens and the skeleton.

    Science.gov (United States)

    Lindberg, M K; Vandenput, L; Movèrare Skrtic, S; Vanderschueren, D; Boonen, S; Bouillon, R; Ohlsson, C

    2005-03-01

    Loss of estrogens or androgens causes bone loss by increasing the rate of bone remodeling, and also causes an imbalance between resorption and formation by prolonging the lifespan of osteoclasts and shortening the lifespan of osteoblasts. Conversely, treatment with androgens, as well as estrogens, maintains cancellous bone mass and integrity, regardless of age or sex. Both androgens, via the androgen receptor (AR), and estrogens, via the estrogen receptors (ERs) can exert these effects, but the relative contribution of these 2 pathways remains uncertain. Androgens, like estrogens, stimulate endochondral bone formation at the start of puberty, whereas they induce epiphyseal closure at the end of puberty, thus, they have a biphasic effect. Androgen action on the growth plate is, however, clearly mediated via aromatization into estrogens and interaction with ER alpha. Androgens increase, while estrogens decrease radial growth. This differential effect of the sex steroids may be important because bone strength in males seems to be determined by higher periosteal bone formation and, therefore, greater bone dimensions. Experiments in mice suggest that both the AR and ER alpha pathways are involved in androgen action on radial bone growth. ER beta may mediate growth-limiting effects of estrogens in the female but does not seem to be involved in the regulation of bone size in males. In conclusion, androgens may protect men against osteoporosis via maintenance of cancellous bone mass and expansion of cortical bone. This androgen action on bone is mediated by the AR and ER alpha.

  1. Precisely modulated pathogenicity island interference with late phage gene transcription.

    Science.gov (United States)

    Ram, Geeta; Chen, John; Ross, Hope F; Novick, Richard P

    2014-10-07

    Having gone to great evolutionary lengths to develop resistance to bacteriophages, bacteria have come up with resistance mechanisms directed at every aspect of the bacteriophage life cycle. Most genes involved in phage resistance are carried by plasmids and other mobile genetic elements, including bacteriophages and their relatives. A very special case of phage resistance is exhibited by the highly mobile phage satellites, staphylococcal pathogenicity islands (SaPIs), which carry and disseminate superantigen and other virulence genes. Unlike the usual phage-resistance mechanisms, the SaPI-encoded interference mechanisms are carefully crafted to ensure that a phage-infected, SaPI-containing cell will lyse, releasing the requisite crop of SaPI particles as well as a greatly diminished crop of phage particles. Previously described SaPI interference genes target phage functions that are not required for SaPI particle production and release. Here we describe a SaPI-mediated interference system that affects expression of late phage gene transcription and consequently is required for SaPI and phage. Although when cloned separately, a single SaPI gene totally blocks phage production, its activity in situ is modulated accurately by a second gene, achieving the required level of interference. The advantage for the host bacteria is that the SaPIs curb excessive phage growth while enhancing their gene transfer activity. This activity is in contrast to that of the clustered regularly interspaced short palindromic repeats (CRISPRs), which totally block phage growth at the cost of phage-mediated gene transfer. In staphylococci the SaPI strategy seems to have prevailed during evolution: The great majority of Staphylococcus aureus strains carry one or more SaPIs, whereas CRISPRs are extremely rare.

  2. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  3. Androgens and women's health.

    Science.gov (United States)

    Redmond, G P

    1998-01-01

    Androgenic disorders are those conditions in women characterized by excessive androgen action. They are the most common endocrinopathy of women, affecting from 10% to 20%. Signs are: persistent acne, hirsutism and androgenic alopecia, which is the female equivalent of male pattern baldness. A subgroup, those traditionally labeled as having polycystic ovary syndrome (PCOS), additionally have anovulation, as well as menstrual abnormalities and, often, obesity. Although women with androgenic disorders usually present themselves for help with the skin or menstrual changes, there are other important implications regarding their health. Women with PCOS have varying degrees of insulin resistance, and an increased incidence of Type II diabetes mellitus, as well as unfavorable lipid patterns. The presence of these risk factors is suggested by upper segment obesity, darkening of the skin, and the other skin changes that make up acanthosis nigricans. Diagnosis involves measurement of circulating androgens (of which free testosterone is most important), together with prolactin and FSH when menstrual dysfunction is present. Many women with androgenic skin changes have normal serum androgen levels, suggesting increased end organ sensitivity to androgens. Others have hyperandrogenism (of ovarian or adrenal origin). Treatment is usually successful in controlling acne, reducing hirsutism and stabilizing, or partially reversing, androgenic alopecia. Pharmacological approaches involve suppressing androgen levels, for example, the use of an appropriate oral contraceptive, or antagonizing androgen action with several medications that have this activity. Unfortunately, most women with androgenic disorders are frustrated in their efforts to obtain medical help. Understanding androgenic disorders will enable the physician to significantly help the majority of women with these conditions.

  4. Light Controlled Modulation of Gene Expression by Chemical Optoepigenetic Probes

    Science.gov (United States)

    Reis, Surya A.; Ghosh, Balaram; Hendricks, J. Adam; Szantai-Kis, D. Miklos; Törk, Lisa; Ross, Kenneth N.; Lamb, Justin; Read-Button, Willis; Zheng, Baixue; Wang, Hongtao; Salthouse, Christopher; Haggarty, Stephen J.; Mazitschek, Ralph

    2016-01-01

    Epigenetic gene regulation is a dynamic process orchestrated by chromatin-modifying enzymes. Many of these master regulators exert their function through covalent modification of DNA and histone proteins. Aberrant epigenetic processes have been implicated in the pathophysiology of multiple human diseases. Small-molecule inhibitors have been essential to advancing our understanding of the underlying molecular mechanisms of epigenetic processes. However, the resolution offered by small molecules is often insufficient to manipulate epigenetic processes with high spatio-temporal control. Here, we present a novel and generalizable approach, referred to as ‘Chemo-Optical Modulation of Epigenetically-regulated Transcription’ (COMET), enabling high-resolution, optical control of epigenetic mechanisms based on photochromic inhibitors of human histone deacetylases using visible light. COMET probes may translate into novel therapeutic strategies for diseases where conditional and selective epigenome modulation is required. PMID:26974814

  5. Gene Regulation, Modulation, and Their Applications in Gene Expression Data Analysis

    Directory of Open Access Journals (Sweden)

    Mario Flores

    2013-01-01

    Full Text Available Common microarray and next-generation sequencing data analysis concentrate on tumor subtype classification, marker detection, and transcriptional regulation discovery during biological processes by exploring the correlated gene expression patterns and their shared functions. Genetic regulatory network (GRN based approaches have been employed in many large studies in order to scrutinize for dysregulation and potential treatment controls. In addition to gene regulation and network construction, the concept of the network modulator that has significant systemic impact has been proposed, and detection algorithms have been developed in past years. Here we provide a unified mathematic description of these methods, followed with a brief survey of these modulator identification algorithms. As an early attempt to extend the concept to new RNA regulation mechanism, competitive endogenous RNA (ceRNA, into a modulator framework, we provide two applications to illustrate the network construction, modulation effect, and the preliminary finding from these networks. Those methods we surveyed and developed are used to dissect the regulated network under different modulators. Not limit to these, the concept of “modulation” can adapt to various biological mechanisms to discover the novel gene regulation mechanisms.

  6. The CAG repeat polymorphism in the androgen receptor gene (AR) and its relationship to head and neck cancer.

    Science.gov (United States)

    dos Santos, M L; Sibov, T T; Nishimoto, I N; Kowalski, L P; Miracca, E C; Nagai, M A

    2004-02-01

    Sex hormones may play an important role in the tumorigenic process of the head and neck. The aim of our work was to investigate whether the androgen receptor (AR) CAG repeat polymorphism is associated with an increased relative risk for head and neck cancer. Genomic DNA from 103 male patients with head and neck carcinomas and 100 male controls were analyzed for the AR CAG polymorphism by PCR amplification and direct sequencing or denaturing polyacrilamide gel electrophoresis. Logistic regression analysis showed a significant association between CAG repeat length and risk of head and neck cancer in individuals with more than 20 CAG repeats [OR=2.54 (95% CI, 1.3-4.8)]. For the group of individuals with oral and laryngeal cancer the estimated relative risk was increased to 2.79 (95% CI, 1.2-6.3) and 3.06 (95% CI, 1.0-9.6), respectively, in men with CAG repeat length >20. These results suggest, for the first time, that shorter AR CAG repeat alleles have a protective effect for head and neck cancer development.

  7. Transcriptional Modulation of Heat-Shock Protein Gene Expression

    Directory of Open Access Journals (Sweden)

    Anastasis Stephanou

    2011-01-01

    Full Text Available Heat-shock proteins (Hsps are molecular chaperones that are ubiquitously expressed but are also induced in cells exposed to stressful stimuli. Hsps have been implicated in the induction and propagation of several diseases. This paper focuses on regulatory factors that control the transcription of the genes encoding Hsps. We also highlight how distinct transcription factors are able to interact and modulate Hsps in different pathological states. Thus, a better understanding of the complex signaling pathways regulating Hsp expression may lead to novel therapeutic targets.

  8. Transcriptional modulation of heat-shock protein gene expression.

    Science.gov (United States)

    Stephanou, Anastasis; Latchman, David S

    2011-01-01

    Heat-shock proteins (Hsps) are molecular chaperones that are ubiquitously expressed but are also induced in cells exposed to stressful stimuli. Hsps have been implicated in the induction and propagation of several diseases. This paper focuses on regulatory factors that control the transcription of the genes encoding Hsps. We also highlight how distinct transcription factors are able to interact and modulate Hsps in different pathological states. Thus, a better understanding of the complex signaling pathways regulating Hsp expression may lead to novel therapeutic targets.

  9. Mental rotation in intellectually gifted boys is affected by the androgen receptor CAG repeat polymorphism.

    Science.gov (United States)

    Durdiaková, Jaroslava; Lakatošová, Silvia; Kubranská, Aneta; Laznibatová, Jolana; Ficek, Andrej; Ostatníková, Daniela; Celec, Peter

    2013-08-01

    Testosterone was shown to organize brain and modulate cognitive functions. It is currently unknown whether mental rotation is also associated with prenatal testosterone exposure and testosterone-related genetic polymorphisms. The aim of our study was to analyze associations between mental rotation performance, the actual testosterone levels, the prenatal testosterone level (expressed as 2D:4D ratio) and the androgen receptor CAG repeat polymorphism in intellectually gifted boys. One hundred forty-seven boys aged 10-18 years with IQ>130 were enrolled. Saliva samples were collected and used for ELISA of actual levels of salivary testosterone. The 2D:4D finger length ratio as an indicator of prenatal testosterone was measured on both hands and averaged. Amthauer mental rotation test was used for the assessment of this spatial ability. The CAG repeat polymorphism in the androgen receptor gene was analyzed using PCR and capillary electrophoresis. Linear regression revealed that 2D:4D finger length ratio and the number of CAG repeats in the androgen receptor gene were associated with mental rotation. Actual levels of testosterone did not correlate significantly with mental rotation. Multivariate analysis of covariance revealed that after adjustment of age as a confounding variable, only the effect of the genetic polymorphism was significant. The results are in line with our previous genetic analysis of intellectually gifted boys showing the importance of CAG repeat polymorphism in the androgen receptor gene. Details of the interactions between androgen signaling, testosterone levels and its metabolism especially during the prenatal development of brain function remain to be elucidated.

  10. Motif-guided sparse decomposition of gene expression data for regulatory module identification

    Directory of Open Access Journals (Sweden)

    Hoffman Eric P

    2011-03-01

    Full Text Available Abstract Background Genes work coordinately as gene modules or gene networks. Various computational approaches have been proposed to find gene modules based on gene expression data; for example, gene clustering is a popular method for grouping genes with similar gene expression patterns. However, traditional gene clustering often yields unsatisfactory results for regulatory module identification because the resulting gene clusters are co-expressed but not necessarily co-regulated. Results We propose a novel approach, motif-guided sparse decomposition (mSD, to identify gene regulatory modules by integrating gene expression data and DNA sequence motif information. The mSD approach is implemented as a two-step algorithm comprising estimates of (1 transcription factor activity and (2 the strength of the predicted gene regulation event(s. Specifically, a motif-guided clustering method is first developed to estimate the transcription factor activity of a gene module; sparse component analysis is then applied to estimate the regulation strength, and so predict the target genes of the transcription factors. The mSD approach was first tested for its improved performance in finding regulatory modules using simulated and real yeast data, revealing functionally distinct gene modules enriched with biologically validated transcription factors. We then demonstrated the efficacy of the mSD approach on breast cancer cell line data and uncovered several important gene regulatory modules related to endocrine therapy of breast cancer. Conclusion We have developed a new integrated strategy, namely motif-guided sparse decomposition (mSD of gene expression data, for regulatory module identification. The mSD method features a novel motif-guided clustering method for transcription factor activity estimation by finding a balance between co-regulation and co-expression. The mSD method further utilizes a sparse decomposition method for regulation strength estimation. The

  11. A Network Partition Algorithm for Mining Gene Functional Modules of Colon Cancer from DNA Microarray Data

    Institute of Scientific and Technical Information of China (English)

    Xiao-Gang Ruan; Jin-Lian Wang; Jian-Geng Li

    2006-01-01

    Computational analysis is essential for transforming the masses of microarray data into a mechanistic understanding of cancer. Here we present a method for finding gene functional modules of cancer from microarray data and have applied it to colon cancer. First, a colon cancer gene network and a normal colon tissue gene network were constructed using correlations between the genes. Then the modules that tended to have a homogeneous functional composition were identified by splitting up the network. Analysis of both networks revealed that they are scale-free.Comparison of the gene functional modules for colon cancer and normal tissues showed that the modules' functions changed with their structures.

  12. Identification of an AR mutation-negative class of androgen insensitivity by determining endogenous AR activity

    NARCIS (Netherlands)

    Hornig, N.C.; Ukat, M.; H.U. Schweikert (H.); O. Hiort (Olaf); Werner, R.; S.L.S. Drop (Stenvert); M.L. Cools (Martine); I.A. Hughes (Ieuan A.); L. Audí (Laura); S.F. Ahmed (S. Faisal); Demiri, J.; Rodens, P.; Worch, L.; Wehner, G.; Kulle, A.E.; Dunstheimer, D.; Müller-Roßberg, E.; T. Reinehr (Thomas); Hadidi, A.T.; Eckstein, A.K.; Van Der Horst, C.; Seif, C.; R. Siebert (Reiner); O. Ammerpohl (Ole); P-M. Holterhus (Paul-Martin)

    2016-01-01

    textabstractContext: Only approximately 85%of patients with a clinical diagnosis complete androgen insensitivity syndrome and less than 30%with partial androgen insensitivity syndrome can be explained by inactivating mutations in the androgen receptor (AR) gene. Objective: The objective of the study

  13. Contribution of allelic variability in prostate specific antigen (PSA & androgen receptor (AR genes to serum PSA levels in men with prostate cancer

    Directory of Open Access Journals (Sweden)

    Sushant V Chavan

    2014-01-01

    Full Text Available Background & objectives: Wide variability in serum prostate specific antigen (PSA levels exists in malignant conditions of the prostate. PSA is expressed in normal range in 20 to 25 per cent of prostate cancer cases even in presence of high grade Gleason score. This study was aimed to assess the influence of genetic variants exhibited by PSA and androgen receptor (AR genes towards the variable expression of PSA in prostate cancer. Methods: Pre-treatment serum PSA levels from 101 prostate cancer cases were retrieved from medical record. PSA genotype analysis in promoter region and AR gene microsatellite Cytosine/Adenine/Guanine (CAG repeat analysis in exon 1 region was performed using DNA sequencing and fragment analysis techniques. Results: A total of seven single nucleotide polymorphisms (SNPs in the PSA promoter region were noted. Only two SNPs viz., 158G/A (P<0.001 in the proximal promoter region and -3845G/A (P<0.001 in enhancer region showed significant association with serum PSA levels. The carriers of homozygous GG genotype (P<0.001 at both of these polymorphic sites showed higher expression of PSA whereas homozygous AA genotype (P<0.001 carriers demonstrated lower PSA levels. The combination effect of PSA genotypes along with stratified AR CAG repeats lengths (long, intermediate and short was also studied. The homozygous GG genotype along with AR long CAG repeats and homozygous AA genotype along with AR short CAG repeats at position -3845 and -158 showed strong interaction and thus influenced serum PSA levels. Interpretation & conclusions: The genetic variants exhibited by PSA gene at positions -3845G/A and -158G/A may be accountable towards wide variability of serum PSA levels in prostate cancer. Also the preferential binding of G and A alleles at these polymorphic sites along with AR long and short CAG repeats may contribute towards PSA expression.

  14. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Allen, R.C.; Zoghbi, H.Y.; Moseley, A.B.; Rosenblatt, H.M.; Belmont, J.W. (Baylor College of Medicine, Houston (United States))

    1992-12-01

    The human androgen-receptor gene (HUMARA; GenBank) contains a highly polymorphic trinucleotide repeat in the first exon. The authors have found that the methylation of HpaII and HhaI sites less than 100 pb away from this polymorphic short tandem repeat (STR) correlates with X inactivation. The close proximity of the restriction-enzyme sites to the STR allows the development of a PCR assay that distinguishes between the maternal and paternal alleles and identifies their methylation status. The accuracy of this assay was tested on (a) DNA from hamster/human hybrid cell lines containing either an active or inactive human X chromosome; (b) DNA from normal males and females; and (c) DNA from females showing nonrandom patterns of X inactivation. Data obtained using this assay correlated substantially with those obtained using the PGK, HPRT, and M27[beta] probes, which detect X inactivation patterns by Southern blot analysis. In order to demonstrate one application of this assay, the authors examined X inactivation patterns in the B lymphocytes of potential and obligate carriers of X-linked agammaglobulinemia. 42 refs., 5 figs., 1 tab.

  15. [Tissue variability of androgen receptor gene in bulbospinal muscular atrophy--comparison of the number of CAG repeats between muscles and peripheral blood leukocytes].

    Science.gov (United States)

    Nakajima, H; Kimura, F; Shinoda, K; Ohsawa, N; Nakagawa, T; Shimizu, A

    1993-10-01

    We investigated an expansion of CAG repeats in exon 1 of androgen receptor gene in skeletal muscle tissue obtained from the patients with various neuro-muscular disorders (5 BSMA, 33 patients with amyotrophic lateral sclerosis, 3 patients with spinal progressive muscular atrophy and 2 patients with hereditary motor sensory neuropathy), by polymerase chain reaction (PCR) amplification according to LaSpadas' description. These muscle tissues had been stored at -70 degrees C freezer during 7 years. We also studied the tissue variation of CAG repeats size between muscles and peripheral blood leukocytes in 4 patients with BSMA. And we confirmed the increased number of CAG repeats in all 5 BSMA except for other patients with neurogenic muscular atrophy. In the 4 BSMA patients, we subcloned the PCR products from muscles tissues and peripheral blood leukocytes, and we determined the number of CAG repeats by sequencing. The repeats of them were 43-51, and all BSMA patients showed the same number of CAG repeats in muscles tissues and peripheral blood leukocytes. The CAG repeats fragment of BSMA may be stable region in frozen storage state for 7 years, and we didn't recognized the somatic variation at least between muscles tissues and peripheral blood leukocytes.

  16. Clock gene modulates roles of OXTR and AVPR1b genes in prosociality.

    Directory of Open Access Journals (Sweden)

    Haipeng Ci

    Full Text Available BACKGROUND: The arginine vasopressin receptor (AVPR and oxytocin receptor (OXTR genes have been demonstrated to contribute to prosocial behavior. Recent research has focused on the manner by which these simple receptor genes influence prosociality, particularly with regard to the AVP system, which is modulated by the clock gene. The clock gene is responsible for regulating the human biological clock, affecting sleep, emotion and behavior. The current study examined in detail whether the influences of the OXTR and AVPR1b genes on prosociality are dependent on the clock gene. METHODOLOGY/PRINCIPAL FINDINGS: This study assessed interactions between the clock gene (rs1801260, rs6832769 and the OXTR (rs1042778, rs237887 and AVPR1b (rs28373064 genes in association with individual differences in prosociality in healthy male Chinese subjects (n = 436. The Prosocial Tendencies Measure (PTM-R was used to assess prosociality. Participants carrying both the GG/GA variant of AVPR1b rs28373064 and the AA variant of clock rs6832769 showed the highest scores on the Emotional PTM. Carriers of both the T allele of OXTR rs1042778 and the C allele of clock rs1801260 showed the lowest total PTM scores compared with the other groups. CONCLUSIONS: The observed interaction effects provide converging evidence that the clock gene and OXT/AVP systems are intertwined and contribute to human prosociality.

  17. Potentially harmful advantage to athletes: a putative connection between UGT2B17 gene deletion polymorphism and renal disorders with prolonged use of anabolic androgenic steroids

    Directory of Open Access Journals (Sweden)

    Barker James

    2010-04-01

    Full Text Available Abstract Background and objective With prolonged use of anabolic androgenic steroids (AAS, occasional incidents of renal disorders have been observed. Independently, it has also been established that there are considerable inter-individual and inter-ethnic differences, in particular with reference to the uridine diphosphate-glucuronosyltransferase 2B17 (UGT2B17 gene, in metabolising these compounds. This report postulates the association of deletion polymorphism in the UGT2B17 gene with the occurrence of renal disorders on chronic exposure to AAS. Presentation of the hypothesis The major deactivation and elimination pathway of AASs is through glucuronide conjugation, chiefly catalyzed by the UGT2B17 enzyme, followed by excretion in urine. Excretion of steroids is affected in individuals with a deletion mutation in the UGT2B17 gene. We hypothesize that UGT2B17 deficient individuals are more vulnerable to developing renal disorders with prolonged use of AAS owing to increases in body mass index and possible direct toxic effects of steroids on the kidneys. Elevated serum levels of biologically active steroids due to inadequate elimination can lead to prolonged muscle build up. An increase in body mass index may cause renal injuries due to sustained elevated glomerular pressure and flow rate. Testing the hypothesis In the absence of controlled clinical trials in humans, observational studies can be carried out. Real time PCR with allelic discrimination should be employed to examine the prevalence of different UGT2B17 genotypes in patients with impaired renal function and AAS abuse. In individuals with the UGT2B17 deletion polymorphism, blood tests, biofluid analyses, urinalysis, and hair analyses following the administration of an anabolic steroid can be used to determine the fate of the substance once in the body. Implications of the hypothesis If the hypothesis is upheld, anabolic steroid users with a deletion mutation in the UGT2B17 gene may be

  18. Localization of genes modulating the predisposition to schizophrenia: a revision

    Directory of Open Access Journals (Sweden)

    E.Z. Lopes-Machado

    2000-09-01

    Full Text Available The genetics of schizophrenia or bipolar affective disorder has advanced greatly at the molecular level since the introduction of probes for the localization of specific genes. Research on gene candidates for susceptibility to schizophrenia can broadly be divided into two types, i.e., linkage studies, where a gene is found near a specific DNA marker on a specific chromosome, and association studies, when a condition is associated with a specific allele of a specific gene. This review covers a decade of publications in this area, from the 1988 works of Bassett et al. and Sherrington et al. on a gene localized on the long arm of chromosome 5 at the 5q11-13 loci, to the 1997 work of Lin et al. pointing to the 13q14.1-q32 loci of chromosome 13 and to the 1998 work of Wright et al. on an HLA DRB1 gene locus on chromosome 6 at 6p21-3. The most replicated loci were those in the long arm of chromosome 22 (22q12-q13.1 and on the short arm of chromosome 6 (6p24-22. In this critical review of the molecular genetic studies involved in the localization of genes which modulate the predisposition to schizophrenia the high variability in the results obtained by different workers suggests that multiple loci are involved in the predisposition to this illness.A genética da esquizofrenia (como também do distúrbio bipolar teve grande avanço a partir da descoberta, a nível de genética molecular, da técnica de localização de genes com uso de sondas de DNA (Botstein et al., 1980. Os estudos que procuram "genes candidatos" a exercerem algum papel na susceptibilidade à esquizofrenia são, basicamente, de dois tipos: de ligação ("linkage" e de associação. Quando, à luz da genética molecular, um gene é localizado próximo a um marcador de DNA específico no cromossomo, fala-se em estudo "de ligação". Por outro lado, quando a doença é associada a um alelo específico de um determinado gene, fala-se em estudo "de associação". Esta revisão cobriu uma d

  19. Androgens and the breast.

    Science.gov (United States)

    Dimitrakakis, Constantine; Bondy, Carolyn

    2009-01-01

    Androgens have important physiological effects in women while at the same time they may be implicated in breast cancer pathologies. However, data on the effects of androgens on mammary epithelial proliferation and/or breast cancer incidence are not in full agreement. We performed a literature review evaluating current clinical, genetic and epidemiological data regarding the role of androgens in mammary growth and neoplasia. Epidemiological studies appear to have significant methodological limitations and thus provide inconclusive results. The study of molecular defects involving androgenic pathways in breast cancer is still in its infancy. Clinical and nonhuman primate studies suggest that androgens inhibit mammary epithelial proliferation and breast growth while conventional estrogen treatment suppresses endogenous androgens. Abundant clinical evidence suggests that androgens normally inhibit mammary epithelial proliferation and breast growth. Suppression of androgens using conventional estrogen treatment may thus enhance estrogenic breast stimulation and possibly breast cancer risk. Addition of testosterone to the usual hormone therapy regimen may diminish the estrogen/progestin increase in breast cancer risk but the impact of this combined use on mammary gland homeostasis still needs evaluation.

  20. Androgen receptor abnormalities

    NARCIS (Netherlands)

    A.O. Brinkmann (Albert); G.G.J.M. Kuiper (George); C. Ris-Stalpers (Carolyn); H.C.J. van Rooij (Henri); G. Romalo (G.); G. Trifiro (Gianluca); E. Mulder (Eppo); L. Pinsky (L.); H.U. Schweikert (H.); J. Trapman (Jan)

    1991-01-01

    markdownabstract__Abstract__ The human androgen receptor is a member of the superfamily of steroid hormone receptors. Proper functioning of this protein is a prerequisite for normal male sexual differentiation and development. The cloning of the human androgen receptor cDNA and the elucidation of t

  1. Building gene expression signatures indicative of transcription factor activation to predict AOP modulation

    Science.gov (United States)

    Building gene expression signatures indicative of transcription factor activation to predict AOP modulation Adverse outcome pathways (AOPs) are a framework for predicting quantitative relationships between molecular initiatin...

  2. The paf gene product modulates asexual development in Penicillium chrysogenum.

    Science.gov (United States)

    Hegedüs, Nikoletta; Sigl, Claudia; Zadra, Ivo; Pócsi, Istvan; Marx, Florentine

    2011-06-01

    Penicillium chrysogenum secretes a low molecular weight, cationic and cysteine-rich protein (PAF). It has growth inhibitory activity against the model organism Aspergillus nidulans and numerous zoo- and phytopathogenic fungi but shows only minimal conditional antifungal activity against the producing organism itself. In this study we provide evidence for an additional function of PAF which is distinct from the antifungal activity against putative ecologically concurrent microorganisms. Our data indicate that PAF enhances conidiation in P. chrysogenum by modulating the expression of brlA, the central regulatory gene for mitospore development. A paf deletion strain showed a significant impairment of mitospore formation which sustains our hypothesis that PAF plays an important role in balancing asexual differentiation in P. chrysogenum.

  3. The AhR Ligand, TCDD, Regulates Androgen Receptor Activity Differently in Androgen-Sensitive versus Castration-Resistant Human Prostate Cancer Cells.

    Science.gov (United States)

    Ghotbaddini, Maryam; Powell, Joann B

    2015-07-06

    The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR). TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to induce degradation of hormone receptors. The studies reported here, evaluate the effect of TCDD exposure on androgen receptor (AR) expression and activity in androgen-sensitive LNCaP and castration-resistant C4-2 prostate cancer cells. Our results show that TCDD exposure does not induce AhR or AR degradation in C4-2 cells. However, both AhR and AR are degraded in LNCaP cells following TCDD exposure. In addition, TCDD enhances AR phosphorylation and induces expression of AR responsive genes in LNCaP cells. Our data reveals that TCDD effect on AR expression and activity differs in androgen-sensitive and castration-resistant prostate cancer cell models.

  4. The AhR Ligand, TCDD, Regulates Androgen Receptor Activity Differently in Androgen-Sensitive versus Castration-Resistant Human Prostate Cancer Cells

    Directory of Open Access Journals (Sweden)

    Maryam Ghotbaddini

    2015-07-01

    Full Text Available The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR. TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to induce degradation of hormone receptors. The studies reported here, evaluate the effect of TCDD exposure on androgen receptor (AR expression and activity in androgen-sensitive LNCaP and castration-resistant C4-2 prostate cancer cells. Our results show that TCDD exposure does not induce AhR or AR degradation in C4-2 cells. However, both AhR and AR are degraded in LNCaP cells following TCDD exposure. In addition, TCDD enhances AR phosphorylation and induces expression of AR responsive genes in LNCaP cells. Our data reveals that TCDD effect on AR expression and activity differs in androgen-sensitive and castration-resistant prostate cancer cell models.

  5. Nonsteroidal selective androgen receptor modulators and selective estrogen receptor β agonists moderate cognitive deficits and amyloid-β levels in a mouse model of Alzheimer's disease.

    Science.gov (United States)

    George, Sonia; Petit, Géraldine H; Gouras, Gunnar K; Brundin, Patrik; Olsson, Roger

    2013-12-18

    Decreases of the sex steroids, testosterone and estrogen, are associated with increased risk of Alzheimer's disease. Testosterone and estrogen supplementation improves cognitive deficits in animal models of Alzheimer's disease. Sex hormones play a role in the regulation of amyloid-β via induction of the amyloid-β degrading enzymes neprilysin and insulin-degrading enzyme. To mimic the effect of dihydrotestosterone (DHT), we administered a selective androgen receptor agonist, ACP-105, alone and in combination with the selective estrogen receptor β (ERβ) agonist AC-186 to male gonadectomized triple transgenic mice. We assessed long-term spatial memory in the Morris water maze, spontaneous locomotion, and anxiety-like behavior in the open field and in the elevated plus maze. We found that ACP-105 given alone decreases anxiety-like behavior. Furthermore, when ACP-105 is administered in combination with AC-186, they increase the amyloid-β degrading enzymes neprilysin and insulin-degrading enzyme and decrease amyloid-β levels in the brain as well as improve cognition. Interestingly, the androgen receptor level in the brain was increased by chronic treatment with the same combination treatment, ACP-105 and AC-186, not seen with DHT or ACP-105 alone. Based on these results, the beneficial effect of the selective ERβ agonist as a potential therapeutic for Alzheimer's disease warrants further investigation.

  6. Androgen circle of polycystic ovary syndrome.

    Science.gov (United States)

    Homburg, Roy

    2009-07-01

    Although the aetiology of polycystic ovary syndrome (PCOS) is still not known and the search for causative genes is proving elusive, it is generally agreed that hyperandrogenism is at the heart of the syndrome. Here, it is proposed that excess androgens are the root cause of PCOS starting from their influence on the female fetus in programming gene expression, producing the characteristic signs and symptoms which are then exacerbated by a propagation of excess ovarian androgen production from multiple small follicles, anovulation and insulin resistance in the reproductive life-span, thus setting up a vicious perpetual circle of androgen excess. This opinion paper, rather than being a full-scale review, is intentionally biased in support of this hypothesis that androgen excess is the 'root of all evil' in PCOS; in the hope that its acceptance could lead to more direct treatment of the syndrome in all its facets rather than the symptomatic treatment of side effects of androgen excess that we are addressing today.

  7. Up-regulation of Bcl-2 is required for the progression of prostate cancer cells from an androgen-dependent to an androgen-independent growth stage

    Institute of Scientific and Technical Information of China (English)

    Yuting Lin; Junichi Fukuchi; Richard A Hiipakka; John M Kokontis; Jialing Xiang

    2007-01-01

    Bcl-2 is an anti-apoptotic oncoprotein and its protein levels are inversely correlated with prognosis in many cancers.However, the role of Bcl-2 in the progression of prostate cancer is not clear. Here we report that Bcl-2 is required for the progression of LNCaP prostate cancer cells from an androgen-dependent to an androgen-independent growth stage. The mRNA and protein levels of Bcl-2 are significantly increased in androgen-independent prostate cancer cells, shRNA-mediated gene silencing of Bcl-2 in androgen-independent prostate cancer cells promotes UV-induced apoptosis and suppresses the growth of prostate tumors in vivo. Growing androgen-dependent cells under androgen-deprivation conditions results in formation of androgen-independent colonies; and the transition from androgen-dependent to androgen-independent growth is blocked by ectopic expression of the Bcl-2 antagonist Bax or Bcl-2 shRNA. Thus, our results demonstrate that Bcl-2 is not only critical for the survival of androgen-independent prostate cancer cells, but is also required for the progression of prostate cancer cells from an androgen-dependent to an androgen-independent growth stage.

  8. Androgen receptor gene CAG repeat length as modifier of the association between Persistent Organohalogen Pollutant exposure markers and semen characteristics

    DEFF Research Database (Denmark)

    Giwercman, Aleksander; Rylander, Lars; Rignell-Hydbom, Anna;

    2007-01-01

    OBJECTIVES: Exposure to persistent organohalogen pollutants was suggested to impair male reproductive function. A gene-environment interaction has been proposed. No genes modifying the effect of persistent organohalogen pollutants on reproductive organs have yet been identified. We aimed...... and morphology) and DNA fragmentation index (DFI) were determined. CAG and GGN repeat lengths were determined by direct sequencing of leukocyte DNA. RESULTS: A statistically significant interaction was found between the CB-153 group and CAG repeat category in relation to sperm concentration and total sperm count...

  9. The microRNA (miRNA): overview of the RNA genes that modulate gene function.

    Science.gov (United States)

    Ying, Shao-Yao; Chang, Donald C; Lin, Shi-Lung

    2008-03-01

    MicroRNAs (miRNAs), widely distributed, small regulatory RNA genes, target both messenger RNA (mRNA) degradation and suppression of protein translation based on sequence complementarity between the miRNA and its targeted mRNA. Different names have been used to describe various types of miRNA. During evolution, RNA retroviruses or transgenes invaded the eukaryotic genome and inserted in the non-coding regions of DNA, conceivably acting as transposon-like jumping genes, providing defense from viral invasion and fine-tuning of gene expression as a secondary level of gene modulation in eukaryotes. When a transposon is inserted in the intron, it becomes an intronic miRNA, taking advantage of the protein synthesis machinery, i.e., mRNA transcription and splicing, as a means for processing and maturation. Recently, miRNAs have been found to play an important, but not life-threatening, role in embryonic development. They might play a pivotal role in diverse biological systems in various organisms, facilitating a quick response and accurate plotting of body physiology and structures. Based on these unique properties, man-made intronic miRNAs have been developed for in vitro evaluation of gene function, in vivo gene therapy and generation of transgenic animal models. The biogenesis and identification of miRNAs, potential applications, and future directions for research are presented, hopefully providing a guideline for further miRNA and gene function studies.

  10. 完全型雄激素不敏感综合征雄激素受体基因突变的鉴定与分析%Identification of a novel frameshift mutation of human androgen receptor gene in a patient featuring complete androgen insensitivity syndrome

    Institute of Scientific and Technical Information of China (English)

    谢建红; 瞿京辉; 肖奇志; 周玉球

    2013-01-01

    目的 对l例完全型雄激素不敏感综合征(complete androgen insensitivity syndrome,CAIS)患者的雄激素受体(androgen receptor,AR)基因进行分析,寻找潜在的突变位点,并进一步分析其发病原因.方法 提取患者外周血全基因组DNA,扩增位于X染色体AR基因8个外显子及邻近外显子与内含子剪切位点DNA序列,对扩增产物直接进行DNA序列测定,与GenBank中的基因序列进行比对.结果 该患者AR基因在第6外显子核苷酸序列3507位点缺失一个碱基C而引起移码突变,致使在第808位密码子出现终止密码子(TGA)使得翻译提前终止形成截短的雄激素受体蛋白.该突变可能诱导雄激素受体结合能力发生功能上的变异,导致CAIS的发生.结论 AR基因第6外显子核苷酸序列3507位点缺失碱基C引起的移码突变是一种导致CAIS新的基因突变方式,该研究丰富了AR基因突变谱,为了解CAIS的发病机制提供了新的依据.%Objective To identify potential mutation of human androgen receptor (AR) gene in a patient with complete androgen insensitivity syndrome (CAIS).Methods DNA sequences of 8 exons and exon/intron boundaries of the AR gene were amplified with PCR and directly sequenced.Results DNA sequencing revealed a frameshift mutation due to deletion of nucleotide C at position 3507 in exon 6,which gave rise to a stop codon resulting premature termination for translation.Conclusion A novel frameshift mutation in exon 6 of AR gene probably underlies the disease in our patient.

  11. Increased risk of breast cancer in women bearing a combination of large CAG and GGN repeats in the exon 1 of the androgen receptor gene.

    Science.gov (United States)

    González, Ana; Javier Dorta, F; Rodriguez, Germán; Brito, Buenaventura; Rodríguez, M A Del Cristo; Cabrera, Antonio; Díaz-Chico, Juan C; Reyes, Ricardo; Aguirre-Jaime, Armando; Nicolás Díaz-Chico, B

    2007-11-01

    The exon 1 of the human androgen receptor gene (AR) contains both CAG (polyglutamine) and GGN (polyglycine) repeat length polymorphisms. Large CAG repeats have been related to an increased risk of breast cancer (BC), whereas the influence of the GGN repeats is still unclear. Here, we have studied how the length of CAG and GGN repeats is associated with the risk of BC in a population from Tenerife (Canary Islands, Spain). The study was carried out on 257 woman diagnosed with BC and 393 controls, nesting in the 'CDC of the Canary Islands' cohort study. The AR CAG and GGN genotyping was performed by means of PCR amplification with specific fluorescently labelled primers followed by a capillary electrophoresis. The allelic distribution of CAG and GGN polymorphisms was similar in cases and controls. The mean of short and long CAG and GGN alleles did not show differences between cases and controls and the same was true when the average length of both CAG alleles (CAG(n)) and GGN alleles (GGN(n)) was considered. However, when CAG(n) and GGN(n) were categorised using 22 and 24 repeats as the cut-off point, respectively, significant differences between cases and controls were observed. The CAG(n)>22 repeats were more frequent in cases than in controls, being associated with an increased risk of BC (OR=1.49; CI(95%)=1.06-2.09; p=0.021). No significant differences were found for categorised GGN(n). For CAG(n)/GGN(n) combinations, the highest BC risk was found to be associated with the CAG(n)>22/GGN(n)24 combination (OR=2.47; CI(95%)=1.37-4.46; p=0.003). In conclusion, our results indicate that longer CAG(n)/GGN(n) combinations increase the risk of BC and suggest that CAG and GGN AR polymorphisms should be considered in order to assess the BC risk.

  12. ANDROGEN INSENSITIVITY SYNDROME

    Directory of Open Access Journals (Sweden)

    Kanan

    2014-01-01

    Full Text Available The condition is inherited as X - linked recessive gene 1 . The underlying pathology is the inability of end organs to respond to androgens. These cases are phenotypically and psychologically female with adequate breast development , normal external genitalia , a vagina with variable depth , absent /sparse pubic hair and axillary hair. The exact incidence in India is not known but the reported incidence is 1 in 2 , 000 to 1 in 62 ,400 worldwide . These patients have male karyotyping (XY wi th negative sex chromatin with undescended gonads. These cases are rarely diagnosed before puberty. Though rare , these are extremely distressing to the concerned individuals requiring expert handling. Management should include psychological counseling not only to determine the sexual mentation but also to help those individuals to cope with their problems. The chance of malignancy developing in the gonad with Y chromosome are about 20%.Surgical removal of the gonad is mandatory but can be delayed till 18 ye ars to permit breast development and epiphyseal closure. The aim of presenting this case is to develop awareness regarding this rare syndrome X - linked genetic disorder which runs in families

  13. The value of integrating pre-clinical data to predict nausea and vomiting risk in humans as illustrated by AZD3514, a novel androgen receptor modulator.

    Science.gov (United States)

    Grant, Claire; Ewart, Lorna; Muthas, Daniel; Deavall, Damian; Smith, Simon A; Clack, Glen; Newham, Pete

    2016-04-01

    Nausea and vomiting are components of a complex mechanism that signals food avoidance and protection of the body against the absorption of ingested toxins. This response can also be triggered by pharmaceuticals. Predicting clinical nausea and vomiting liability for pharmaceutical agents based on pre-clinical data can be problematic as no single animal model is a universal predictor. Moreover, efforts to improve models are hampered by the lack of translational animal and human data in the public domain. AZD3514 is a novel, orally-administered compound that inhibits androgen receptor signaling and down-regulates androgen receptor expression. Here we have explored the utility of integrating data from several pre-clinical models to predict nausea and vomiting in the clinic. Single and repeat doses of AZD3514 resulted in emesis, salivation and gastrointestinal disturbances in the dog, and inhibited gastric emptying in rats after a single dose. AZD3514, at clinically relevant exposures, induced dose-responsive "pica" behaviour in rats after single and multiple daily doses, and induced retching and vomiting behaviour in ferrets after a single dose. We compare these data with the clinical manifestation of nausea and vomiting encountered in patients with castration-resistant prostate cancer receiving AZD3514. Our data reveal a striking relationship between the pre-clinical observations described and the experience of nausea and vomiting in the clinic. In conclusion, the emetic nature of AZD3514 was predicted across a range of pre-clinical models, and the approach presented provides a valuable framework for predicition of clinical nausea and vomiting.

  14. No evidence that 2D:4D is related to the number of CAG repeats in the androgen receptor gene

    Directory of Open Access Journals (Sweden)

    Johannes eHönekopp

    2013-12-01

    Full Text Available The length ratio of the second to the fourth digit (2D:4D is a putative marker of prenatal testosterone (T effects. The number of CAG repeats (CAGn in the AR gene is negatively correlated with T sensitivity in vitro. Results regarding the relationship between 2D:4D and CAGn are mixed but have featured prominently in arguments for and against the validity of 2D:4D. Here, I present random-effects meta-analyses on 14 relevant samples with altogether 1,904 subjects. Results were homogeneous across studies. Even liberal estimates (upper limit of the 95% CI were close to zero and therefore suggested no substantial relationship of CAGn with either right-hand 2D:4D, left-hand 2D:4D, or the difference between the two. However, closer analysis of the effects of CAGn on T dependent gene activation in vitro and of relationships between CAGn and T dependent phenotypic characteristics suggest that normal variability of CAGn has mostly no, very small, or inconsistent effects. Therefore, the lack of a clear association between CAGn and 2D:4D has no negative implications for the latter’s validity as a marker of prenatal T effects.

  15. Mining susceptibility gene modules and disease risk genes from SNP data by combining network topological properties with support vector regression.

    Science.gov (United States)

    Hua, Lin; Zhou, Ping; Liu, Hong; Li, Lin; Yang, Zheng; Liu, Zhi-cheng

    2011-11-21

    Genome-wide association study is a powerful approach to identify disease risk loci. However, the molecular regulatory mechanisms for most complex diseases are still not well understood. Therefore, further investigating the interplay between genetic factors and biological networks is important for elucidating the molecular mechanisms of complex diseases. Here, we proposed a novel framework to identify susceptibility gene modules and disease risk genes by combining network topological properties with support vector regression from single nucleotide polymorphism (SNP) level. We assigned risk SNPs to genes using the University of California at Santa Cruz (UCSC) genome database, and then mapped these genes to protein-protein interaction (PPI) networks. The gene modules implicated by hub genes were extracted using the PPI networks and the topological property was analyzed for these gene modules. For each gene module, risk feature genes were determined by topological property analysis and support vector regression. As a result, five shared risk feature genes, CD80, EGFR, FN1, GSK3B and TRAF6 were found and proven to be associated with rheumatoid arthritis by previous reports. Our approach showed a good performance in comparison with other approaches and can be used for prioritizing candidate genes associated with complex diseases.

  16. Activation of two mutant androgen receptors from human prostatic carcinoma by adrenal androgens and metabolic derivatives of testosterone.

    Science.gov (United States)

    Culig, Z; Stober, J; Gast, A; Peterziel, H; Hobisch, A; Radmayr, C; Hittmair, A; Bartsch, G; Cato, A C; Klocker, H

    1996-01-01

    The androgen receptor (AR) plays a central regulatory role in prostatic carcinoma and is a target of androgen ablation therapy. Recent detection of mutant receptors in tumor specimens suggest a contribution of AR alterations to progression towards androgen independence. In a specimen derived from metastatic prostate cancer we have reported a point mutation in the AR gene that leads to a single amino acid exchange in the ligand binding domain of the receptor. Another amino acid exchange resulting from a point mutation was also identified 15 amino acids away from our mutation. This mutation was detected in the AR gene isolated from an organ-confined prostatic tumor. Here we report the functional characterization of the two mutant receptors in the presence of adrenal androgens and testosterone metabolites. These studies were performed by cotransfecting androgen-responsive reporter genes and either the wild-type or mutant AR expression vectors into receptor negative DU-145 and CV-1 cells. The indicator genes used consisted of the promoter of the androgen-inducible prostate-specific antigen gene or the C' Delta9 enhancer fragment from the promoter of the mouse sex-limited protein driving the expression of the bacterial chloramphenicol acetyl transferase gene. Cotransfection-transactivation assays revealed that the adrenal androgen androstenedione and two products of testosterone metabolism, androsterone and androstandiol, induced reporter gene activity more efficiently in the presence of the mutant receptors than in the presence of the wild-type receptor. No difference between wild-type and mutant receptors was observed in the presence of the metabolite androstandione. The interaction of receptor-hormone complexes with target DNA was studied in vitro by electrophoretic mobility shift assays (EMSA). Dihydrotestosterone and the synthetic androgen mibolerone induced a faster migrating complex with all receptors, whereas the androgen metabolite androstandione induced this

  17. big bang gene modulates gut immune tolerance in Drosophila

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y.; Boulianne, Gabrielle L.; Hoffmann, Jules A.; Matt, Nicolas; Reichhart, Jean-Marc

    2013-01-01

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases. PMID:23378635

  18. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  19. Network statistics of genetically-driven gene co-expression modules in mouse crosses

    Directory of Open Access Journals (Sweden)

    Marie-Pier eScott-Boyer

    2013-12-01

    Full Text Available In biology, networks are used in different contexts as ways to represent relationships between entities, such as for instance interactions between genes, proteins or metabolites. Despite progress in the analysis of such networks and their potential to better understand the collective impact of genes on complex traits, one remaining challenge is to establish the biologic validity of gene co-expression networks and to determine what governs their organization. We used WGCNA to construct and analyze seven gene expression datasets from several tissues of mouse recombinant inbred strains (RIS. For six out of the 7 networks, we found that linkage to module QTLs (mQTLs could be established for 29.3% of gene co-expression modules detected in the several mouse RIS. For about 74.6% of such genetically-linked modules, the mQTL was on the same chromosome as the one contributing most genes to the module, with genes originating from that chromosome showing higher connectivity than other genes in the modules. Such modules (that we considered as genetically-driven had network statistic properties (density, centralization and heterogeneity that set them apart from other modules in the network. Altogether, a sizeable portion of gene co-expression modules detected in mouse RIS panels had genetic determinants as their main organizing principle. In addition to providing a biologic interpretation validation for these modules, these genetic determinants imparted on them particular properties that set them apart from other modules in the network, to the point that they can be predicted to a large extent on the basis of their network statistics.

  20. Effects of 3-beta-diol, an androgen metabolite with intrinsic estrogen-like effects, in modulating the aquaporin-9 expression in the rat efferent ductules

    Directory of Open Access Journals (Sweden)

    Hess Rex A

    2006-10-01

    Full Text Available Abstract Background Fluid homeostasis is critical for normal function of the male reproductive tract and aquaporins (AQP play an important role in maintenance of this water and ion balance. Several AQPs have been identified in the male, but their regulation is not fully comprehended. Hormonal regulation of AQPs appears to be dependent on the steroid in the reproductive tract region. AQP9 displays unique hormonal regulation in the efferent ductules and epididymis, as it is regulated by both estrogen and dihydrotestosterone (DHT in the efferent ductules, but only by DHT in the initial segment epididymis. Recent data have shown that a metabolite of DHT, 5-alpha-androstane-3-beta-17-beta-diol (3-beta-diol, once considered inactive, is also present in high concentrations in the male and indeed has biological activity. 3-beta-diol does not bind to the androgen receptor, but rather to estrogen receptors ER-alpha and ER-beta, with higher affinity for ER-beta. The existence of this estrogenic DHT metabolite has raised the possibility that estradiol may not be the only estrogen to play a major role in the male reproductive system. Considering that both ER-alpha and ER-beta are highly expressed in efferent ductules, we hypothesized that the DHT regulation of AQP9 could be due to the 3-beta-diol metabolite. Methods To test this hypothesis, adult male rats were submitted to surgical castration followed by estradiol, DHT or 3-beta-diol replacement. Changes in AQP9 expression in the efferent ductules were investigated by using immunohistochemistry and Western blotting assay. Results Data show that, after castration, AQP9 expression was significantly reduced in the efferent ductules. 3-beta-diol injections restored AQP9 expression, similar to DHT and estradiol. The results were confirmed by Western blotting assay. Conclusion This is the first evidence that 3-beta-diol has biological activity in the male reproductive tract and that this androgen metabolite has

  1. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells.

    Science.gov (United States)

    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W; Hussain, Arif; Ross, Douglas D

    2015-03-01

    Phosphorylated cyclic-AMP (cAMP) response element binding protein (p-CREB) is a downstream effector of a variety of important signaling pathways. We investigated whether the human BCRP promoter contains a functional cAMP response element (CRE). 8Br-cAMP, a cAMP analogue, increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Epidermal growth factor receptor (EGFR) pathway activation also led to an increase in p-CREB and in BCRP promoter reporter activity via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound p-CREB by a point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in several human cancer cell lines following activation of multiple cancer-relevant signaling pathways.

  2. Gene Networks in the Wild: Identifying Transcriptional Modules that Mediate Coral Resistance to Experimental Heat Stress.

    Science.gov (United States)

    Rose, Noah H; Seneca, Francois O; Palumbi, Stephen R

    2015-12-28

    Organisms respond to environmental variation partly through changes in gene expression, which underlie both homeostatic and acclimatory responses to environmental stress. In some cases, so many genes change in expression in response to different influences that understanding expression patterns for all these individual genes becomes difficult. To reduce this problem, we use a systems genetics approach to show that variation in the expression of thousands of genes of reef-building corals can be explained as variation in the expression of a small number of coexpressed "modules." Modules were often enriched for specific cellular functions and varied predictably among individuals, experimental treatments, and physiological state. We describe two transcriptional modules for which expression levels immediately after heat stress predict bleaching a day later. One of these early "bleaching modules" is enriched for sequence-specific DNA-binding proteins, particularly E26 transformation-specific (ETS)-family transcription factors. The other module is enriched for extracellular matrix proteins. These classes of bleaching response genes are clear in the modular gene expression analysis we conduct but are much more difficult to discern in single gene analyses. Furthermore, the ETS-family module shows repeated differences in expression among coral colonies grown in the same common garden environment, suggesting a heritable genetic or epigenetic basis for these expression polymorphisms. This finding suggests that these corals harbor high levels of gene-network variation, which could facilitate rapid evolution in the face of environmental change.

  3. 青少年痤疮患者雄激素受体水平、雄激素受体基因 CAG 多态性的研究%Research on adolescent androgen receptor level in patients with acne,androgen receptor gene CAG polymorphism

    Institute of Scientific and Technical Information of China (English)

    吴波; 邵晓珊; 吴文锦

    2014-01-01

    目的:探讨青少年痤疮患者雄激素受体(A R )水平的变化情况以及患者雄激素受体基因CAG多态性的分布情况。方法选择100例(其中男性50例、女性50例)面部明显痤疮在校高中生作为观察组,再按照1∶1匹配原则选择100例面部无痤疮的在校高中生作为对照组,检查患者外周血雄激素水平、白细胞雄激素受体(AR)以及雄激素受体基因CAG多态性。结果男性和女性痤疮患者其血浆睾酮水平、AR水平比正常对照组均升高,差异具有统计学意义(P<0.05);随着男性痤疮患者其痤疮越严重,其血浆睾酮有所升高,但是差异不具有统计学意义(P>0.05),而不同程度女性痤疮患者其血浆睾酮水平具有统计学意义(P<0.05);随着痤疮患者其痤疮越严重,AR水平有所升高,差异具有统计学意义(P<0.05);痤疮患者携带CAG短片段的比例显著高于对照组携带比例(P<0.05)。结论痤疮发生与发展过程中,雄激素以及雄激素受体增高起着重要的作用,特别对于女性痤疮患者而言,其影响更为显著;携带雄激素受体基因CAG短片段的人群,其患痤疮的危险性更大。%Objective To investigate the adolescent patients with acne androgen receptor (AR) levels and the distribution of androgen receptor gene CAG polymorphism .Methods 100 cases (inclu-ding 50 male and 50 female) the obvious facial acne high school student as the observation group ,1∶1 according to the matching principle to select 100 cases of facial acne free high school students as the control group .Patients were examined for peripheral androgen levels ,androgen receptor (AR) and androgen receptor gene CAG polymorphism .Results The male and female patients with acne and the plasma levels of testosterone ,AR levels were higher than the normal control group ,there were statis-tically significant differences (P0 .05) ,and in pa

  4. Characterization of chemically induced liver injuries using gene co-expression modules.

    Directory of Open Access Journals (Sweden)

    Gregory J Tawa

    Full Text Available Liver injuries due to ingestion or exposure to chemicals and industrial toxicants pose a serious health risk that may be hard to assess due to a lack of non-invasive diagnostic tests. Mapping chemical injuries to organ-specific damage and clinical outcomes via biomarkers or biomarker panels will provide the foundation for highly specific and robust diagnostic tests. Here, we have used DrugMatrix, a toxicogenomics database containing organ-specific gene expression data matched to dose-dependent chemical exposures and adverse clinical pathology assessments in Sprague Dawley rats, to identify groups of co-expressed genes (modules specific to injury endpoints in the liver. We identified 78 such gene co-expression modules associated with 25 diverse injury endpoints categorized from clinical pathology, organ weight changes, and histopathology. Using gene expression data associated with an injury condition, we showed that these modules exhibited different patterns of activation characteristic of each injury. We further showed that specific module genes mapped to 1 known biochemical pathways associated with liver injuries and 2 clinically used diagnostic tests for liver fibrosis. As such, the gene modules have characteristics of both generalized and specific toxic response pathways. Using these results, we proposed three gene signature sets characteristic of liver fibrosis, steatosis, and general liver injury based on genes from the co-expression modules. Out of all 92 identified genes, 18 (20% genes have well-documented relationships with liver disease, whereas the rest are novel and have not previously been associated with liver disease. In conclusion, identifying gene co-expression modules associated with chemically induced liver injuries aids in generating testable hypotheses and has the potential to identify putative biomarkers of adverse health effects.

  5. Characterization of Chemically Induced Liver Injuries Using Gene Co-Expression Modules

    Science.gov (United States)

    Tawa, Gregory J.; AbdulHameed, Mohamed Diwan M.; Yu, Xueping; Kumar, Kamal; Ippolito, Danielle L.; Lewis, John A.; Stallings, Jonathan D.; Wallqvist, Anders

    2014-01-01

    Liver injuries due to ingestion or exposure to chemicals and industrial toxicants pose a serious health risk that may be hard to assess due to a lack of non-invasive diagnostic tests. Mapping chemical injuries to organ-specific damage and clinical outcomes via biomarkers or biomarker panels will provide the foundation for highly specific and robust diagnostic tests. Here, we have used DrugMatrix, a toxicogenomics database containing organ-specific gene expression data matched to dose-dependent chemical exposures and adverse clinical pathology assessments in Sprague Dawley rats, to identify groups of co-expressed genes (modules) specific to injury endpoints in the liver. We identified 78 such gene co-expression modules associated with 25 diverse injury endpoints categorized from clinical pathology, organ weight changes, and histopathology. Using gene expression data associated with an injury condition, we showed that these modules exhibited different patterns of activation characteristic of each injury. We further showed that specific module genes mapped to 1) known biochemical pathways associated with liver injuries and 2) clinically used diagnostic tests for liver fibrosis. As such, the gene modules have characteristics of both generalized and specific toxic response pathways. Using these results, we proposed three gene signature sets characteristic of liver fibrosis, steatosis, and general liver injury based on genes from the co-expression modules. Out of all 92 identified genes, 18 (20%) genes have well-documented relationships with liver disease, whereas the rest are novel and have not previously been associated with liver disease. In conclusion, identifying gene co-expression modules associated with chemically induced liver injuries aids in generating testable hypotheses and has the potential to identify putative biomarkers of adverse health effects. PMID:25226513

  6. Wnt inhibitory factor 1 (Wif1) is regulated by androgens and enhances androgen-dependent prostate development.

    Science.gov (United States)

    Keil, Kimberly P; Mehta, Vatsal; Branam, Amanda M; Abler, Lisa L; Buresh-Stiemke, Rita A; Joshi, Pinak S; Schmitz, Christopher T; Marker, Paul C; Vezina, Chad M

    2012-12-01

    Fetal prostate development from urogenital sinus (UGS) epithelium requires androgen receptor (AR) activation in UGS mesenchyme (UGM). Despite growing awareness of sexually dimorphic gene expression in the UGS, we are still limited in our knowledge of androgen-responsive genes in UGM that initiate prostate ductal development. We found that WNT inhibitory factor 1 (Wif1) mRNA is more abundant in male vs. female mouse UGM in which its expression temporally and spatially overlaps androgen-responsive steroid 5α-reductase 2 (Srd5a2). Wif1 mRNA is also present in prostatic buds during their elongation and branching morphogenesis. Androgens are necessary and sufficient for Wif1 expression in mouse UGS explant mesenchyme, and testicular androgens remain necessary for normal Wif1 expression in adult mouse prostate stroma. WIF1 contributes functionally to prostatic bud formation. In the presence of androgens, exogenous WIF1 protein increases prostatic bud number and UGS basal epithelial cell proliferation without noticeably altering the pattern of WNT/β-catenin-responsive Axin2 or lymphoid enhancer binding factor 1 (Lef1) mRNA. Wif1 mutant male UGSs exhibit increased (Sfrp)2 and (Sfrp)3 expression and form the same number of prostatic buds as the wild-type control males. Collectively our results reveal Wif1 as one of the few known androgen-responsive genes in the fetal mouse UGM and support the hypothesis that androgen-dependent Wif1 expression is linked to the mechanism of androgen-induced prostatic bud formation.

  7. Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

    Directory of Open Access Journals (Sweden)

    Martina Koeva

    Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

  8. Visualising androgen receptor activity in male and female mice.

    Directory of Open Access Journals (Sweden)

    D Alwyn Dart

    Full Text Available Androgens, required for normal development and fertility of males and females, have vital roles in the reproductive tract, brain, cardiovascular system, smooth muscle and bone. Androgens function via the androgen receptor (AR, a ligand-dependent transcription factor. To assay and localise AR activity in vivo we generated the transgenic "ARE-Luc" mouse, expressing a luciferase reporter gene under the control of activated endogenous AR. In vivo imaging of androgen-mediated luciferase activity revealed several strongly expressing tissues in the male mouse as expected and also in certain female tissues. In males the testes, prostate, seminal vesicles and bone marrow all showed high AR activity. In females, strong activity was seen in the ovaries, uterus, omentum tissue and mammary glands. In both sexes AR expression and activity was also found in salivary glands, the eye (and associated glands, adipose tissue, spleen and, notably, regions of the brain. Luciferase protein expression was found in the same cell layers as androgen receptor expression. Additionally, mouse AR expression and activity correlated well with AR expression in human tissues. The anti-androgen bicalutamide reduced luciferase signal in all tissues. Our model demonstrates that androgens can act in these tissues directly via AR, rather than exclusively via androgen aromatisation to estrogens and activation of the estrogen receptor. Additionally, it visually demonstrates the fundamental importance of AR signalling outside the normal role in the reproductive organs. This model represents an important tool for physiological and developmental analysis of androgen signalling, and for characterization of known and novel androgenic or antiandrogenic compounds.

  9. Update on androgenicity.

    Science.gov (United States)

    Thorneycroft, I H

    1999-02-01

    The development of a new generation of progestins deemed less androgenic than their earlier counterparts has led to a number of misconceptions regarding their possible benefits in combination oral contraceptives. All combination oral contraceptives are beneficial for treating such androgenic conditions as acne and hirsutism. The only expressed androgenic effect of some first- and second-generation combined oral contraceptives are changes in plasma lipid and lipoprotein levels. However, the overall effect of today's low-dose oral contraceptives is largely lipid neutral, and human and monkey studies have shown that oral contraceptive use is associated with reduced, not increased, atherosclerosis rates. Myocardial infarction rates are not increased among oral contraceptive users, except among those who are heavy smokers.

  10. Obstructing Androgen Receptor Activation in Prostate Cancer Cells Through Post-translational Modification by NEDD8

    Science.gov (United States)

    2012-11-01

    Nonidet P - 40 ). Pre-cleared with 25 µl protein-A/G agarose beads, 700 µg lysate was subjected to immunoprecipitation with 20 µl anti-FLAG antibody...cell growth. REPORTABLE OUTCOMES: 1. Chang, K. H., Hsiao, P .-W. and Chen, J. D. Modulation of Androgen Receptor Activity by Reversible NEDD8...Hsiao, P .-W. and Chen, J. D. Modulation of Androgen Receptor Activity by Reversible NEDD8 Modification. (under revision) 1 Modulation of

  11. Improving functional modules discovery by enriching interaction networks with gene profiles

    KAUST Repository

    Salem, Saeed

    2013-05-01

    Recent advances in proteomic and transcriptomic technologies resulted in the accumulation of vast amount of high-throughput data that span multiple biological processes and characteristics in different organisms. Much of the data come in the form of interaction networks and mRNA expression arrays. An important task in systems biology is functional modules discovery where the goal is to uncover well-connected sub-networks (modules). These discovered modules help to unravel the underlying mechanisms of the observed biological processes. While most of the existing module discovery methods use only the interaction data, in this work we propose, CLARM, which discovers biological modules by incorporating gene profiles data with protein-protein interaction networks. We demonstrate the effectiveness of CLARM on Yeast and Human interaction datasets, and gene expression and molecular function profiles. Experiments on these real datasets show that the CLARM approach is competitive to well established functional module discovery methods.

  12. Epigenetic Editing : targeted rewriting of epigenetic marks to modulate expression of selected target genes

    NARCIS (Netherlands)

    de Groote, Marloes L.; Verschure, Pernette J.; Rots, Marianne G.

    2012-01-01

    Despite significant advances made in epigenetic research in recent decades, many questions remain unresolved, especially concerning cause and consequence of epigenetic marks with respect to gene expression modulation (GEM). Technologies allowing the targeting of epigenetic enzymes to predetermined D

  13. Epigenetic Editing: targeted rewriting of epigenetic marks to modulate expression of selected target genes.

    NARCIS (Netherlands)

    de Groote, M.L.; Verschure, P.J.; Rots, M.G.

    2012-01-01

    Despite significant advances made in epigenetic research in recent decades, many questions remain unresolved, especially concerning cause and consequence of epigenetic marks with respect to gene expression modulation (GEM). Technologies allowing the targeting of epigenetic enzymes to predetermined D

  14. Reinforcing aspects of androgens.

    Science.gov (United States)

    Wood, Ruth I

    2004-11-15

    Are androgens reinforcing? Androgenic-anabolic steroids (AAS) are drugs of abuse. They are taken in large quantities by athletes and others to increase performance, often with negative long-term health consequences. As a result, in 1991, testosterone was declared a controlled substance. Recently, Brower [K.J. Brower, Anabolic steroid abuse and dependence. Curr. Psychiatry Rep. 4 (2002) 377-387.] proposed a two-stage model of AAS dependence. Users initiate steroid use for their anabolic effects on muscle growth. With continued exposure, dependence on the psychoactive effects of AAS develops. However, it is difficult in humans to separate direct psychoactive effects of AAS from the user's psychological dependence on the anabolic effects of AAS. Thus, studies in laboratory animals are useful to explore androgen reinforcement. Testosterone induces a conditioned place preference in rats and mice, and is voluntarily consumed through oral, intravenous, and intracerebroventricular self-administration in hamsters. Active, gonad-intact male and female hamsters will deliver 1 microg/microl testosterone into the lateral ventricles. Indeed, some individuals self-administer testosterone intracerebroventricularly to the point of death. Male rats develop a conditioned place preference to testosterone injections into the nucleus accumbens, an effect blocked by dopamine receptor antagonists. These data suggest that androgen reinforcement is mediated by the brain. Moreover, testosterone appears to act through the mesolimbic dopamine system, a common substrate for drugs of abuse. Nonetheless, androgen reinforcement is not comparable to that of cocaine or heroin. Instead, testosterone resembles other mild reinforcers, such as caffeine, nicotine, or benzodiazepines. The potential for androgen addiction remains to be determined.

  15. Male osteoporosis and androgenic therapy: from testosterone to SARMs.

    Science.gov (United States)

    Cilotti, Antonio; Falchetti, Alberto

    2009-09-01

    As in the women, male osteoporosis represents an important social problem, amplified by the increasing life expectance.Differently from women, 50% of male osteoporosis is secondary to treatments and/or diseases that make mandatory their search through an accurate clinical investigations in every newly diagnosed osteoporotic men. Male osteoporosis is frequently underdiagnosed and consequently undertreated, and too often it is revealed only after the occurrence of a fragility fracture. Androgens may prevent the loss of cancellous bone and stimulate periosteal cortical bone apposition. The anabolic effect of testosterone on both bone and muscle, is limited by the high incidence of androgenic side effects. Hypogonadism is the only situation where the benefits of the use of testosterone formulations exceed the side effects. Selective androgen receptor modulators can dissociate androgenic and anabolic effect on different tissues with various strategies. Many compounds have been studied with positive results in vivo and in clinical trials.

  16. Red Maca (Lepidium meyenii) did not affect cell viability despite increased androgen receptor and prostate-specific antigen gene expression in the human prostate cancer cell line LNCaP.

    Science.gov (United States)

    Díaz, P; Cardenas, H; Orihuela, P A

    2016-10-01

    We examined whether aqueous extract of Lepidium meyenii (red Maca) could inhibit growth, potentiate apoptotic activity of two anticancer drugs Taxol and 2-methoxyestradiol (2ME) or change mRNA expression for the androgen target genes, androgen receptor (Ar) and prostate-specific antigen (Psa) in the human prostate cancer cell line LNCaP. Red Maca aqueous extract at 0, 10, 20, 40 or 80 μg/ml was added to LNCaP cells, and viability was evaluated by the MTS assay at 24 or 48 hr after treatment. Furthermore, LNCaP cells were treated with 80 μg/ml of red Maca plus Taxol or 2ME 5 μM and viability was assessed 48 hr later. Finally, LNCaP cells were treated with red Maca 0, 20, 40 or 80 μg/ml, and 12 hr later, mRNA level for Ar or Psa was assessed by real-time PCR. Treatment with red Maca did not affect viability of LNCaP cells. Apoptotic activity induced by Taxol and 2ME in LNCaP cells was not altered with red Maca treatment. Relative expression of the mRNA for Ar and Psa increased with red Maca 20 and 40 μg/ml, but not at 80 μg/ml. We conclude that red Maca aqueous extract does not have toxic effects, but stimulates androgen signalling in LNCaP cells.

  17. Androgen receptor and histone lysine demethylases in ovine placenta.

    Directory of Open Access Journals (Sweden)

    Ellane R Cleys

    Full Text Available Sex steroid hormones regulate developmental programming in many tissues, including programming gene expression during prenatal development. While estradiol is known to regulate placentation, little is known about the role of testosterone and androgen signaling in placental development despite the fact that testosterone rises in maternal circulation during pregnancy and in placenta-induced pregnancy disorders. We investigated the role of testosterone in placental gene expression, and focused on androgen receptor (AR. Prenatal androgenization decreased global DNA methylation in gestational day 90 placentomes, and increased placental expression of AR as well as genes involved in epigenetic regulation, angiogenesis, and growth. As AR complexes with histone lysine demethylases (KDMs to regulate AR target genes in human cancers, we also investigated if the same mechanism is present in the ovine placenta. AR co-immunoprecipitated with KDM1A and KDM4D in sheep placentomes, and AR-KDM1A complexes were recruited to a half-site for androgen response element (ARE in the promoter region of VEGFA. Androgenized ewes also had increased cotyledonary VEGFA. Finally, in human first trimester placental samples KDM1A and KDM4D immunolocalized to the syncytiotrophoblast, with nuclear KDM1A and KDM4D immunostaining also present in the villous stroma. In conclusion, placental androgen signaling, possibly through AR-KDM complex recruitment to AREs, regulates placental VEGFA expression. AR and KDMs are also present in first trimester human placenta. Androgens appear to be an important regulator of trophoblast differentiation and placental development, and aberrant androgen signaling may contribute to the development of placental disorders.

  18. Cytotoxic Effects and Androgen Receptor Expression According to Concentrations of Genistein with Silencing Cyclooxygenase–2 Gene Expression in Prostate Cancer Cells

    OpenAIRE

    Kim, Jin Woo; Gotoh, Takafumi; Lim, Hyoun–Sub; Song, Ki Hak; Sul, Chong Koo

    2014-01-01

    COX–2 has major roles in inflammatory reaction, and COX–2 inhibitor and genistein have a chemopreventive effect on some cancers such as colorectal, breast, and prostate cancer (PCa). The aims of this study was to investigate combined effect of COX–2 inhibition and genistein treatment. To address this issue, we tested the degree of cell survival and the changes of androgen receptor in PCa cells with silencing of COX–2 according to concentrations of genistein. DU–145 PCa cells were transfected ...

  19. From gene engineering to gene modulation and manipulation: can we prevent or detect gene doping in sports?

    Science.gov (United States)

    Fischetto, Giuseppe; Bermon, Stéphane

    2013-10-01

    During the last 2 decades, progress in deciphering the human gene map as well as the discovery of specific defective genes encoding particular proteins in some serious human diseases have resulted in attempts to treat sick patients with gene therapy. There has been considerable focus on human recombinant proteins which were gene-engineered and produced in vitro (insulin, growth hormone, insulin-like growth factor-1, erythropoietin). Unfortunately, these substances and methods also became improper tools for unscrupulous athletes. Biomedical research has focused on the possible direct insertion of gene material into the body, in order to replace some defective genes in vivo and/or to promote long-lasting endogenous synthesis of deficient proteins. Theoretically, diabetes, anaemia, muscular dystrophies, immune deficiency, cardiovascular diseases and numerous other illnesses could benefit from such innovative biomedical research, though much work remains to be done. Considering recent findings linking specific genotypes and physical performance, it is tempting to submit the young athletic population to genetic screening or, alternatively, to artificial gene expression modulation. Much research is already being conducted in order to achieve a safe transfer of genetic material to humans. This is of critical importance since uncontrolled production of the specifically coded protein, with serious secondary adverse effects (polycythaemia, acute cardiovascular problems, cancer, etc.), could occur. Other unpredictable reactions (immunogenicity of vectors or DNA-vector complex, autoimmune anaemia, production of wild genetic material) also remain possible at the individual level. Some new substances (myostatin blockers or anti-myostatin antibodies), although not gene material, might represent a useful and well-tolerated treatment to prevent progression of muscular dystrophies. Similarly, other molecules, in the roles of gene or metabolic activators [5-aminoimidazole-4

  20. Regulation of androgen action during establishment of pregnancy.

    Science.gov (United States)

    Gibson, Douglas A; Simitsidellis, Ioannis; Saunders, Philippa T K

    2016-07-01

    During the establishment of pregnancy, the ovarian-derived hormones progesterone and oestradiol regulate remodelling of the endometrium to promote an environment that is able to support and maintain a successful pregnancy. Decidualisation is characterised by differentiation of endometrial stromal cells that secrete growth factors and cytokines that regulate vascular remodelling and immune cell influx. This differentiation process is critical for reproduction, and inadequate decidualisation is implicated in the aetiology of pregnancy disorders such as foetal growth restriction and preeclampsia. In contrast to progesterone and oestradiol, the role of androgens in regulating endometrial function is poorly understood. Androgen receptors are expressed in the endometrium, and androgens are reported to regulate both the transcriptome and the secretome of endometrial stromal cells. In androgen-target tissues, circulating precursors are activated to mediate local effects, and recent studies report that steroid concentrations detected in endometrial tissue are distinct to those detected in the peripheral circulation. New evidence suggests that decidualisation results in dynamic changes in the expression of androgen biosynthetic enzymes, highlighting a role for pre-receptor regulation of androgen action during the establishment of pregnancy. These results suggest that such enzymes could be future therapeutic targets for the treatment of infertility associated with endometrial dysfunction. In conclusion, these data support the hypothesis that androgens play a beneficial role in regulating the establishment and maintenance of pregnancy. Future studies should be focussed on investigating the safety and efficacy of androgen supplementation with the potential for utilisation of novel therapeutics, such as selective androgen receptor modulators, to improve reproductive outcomes in women.

  1. 雄激素受体基因动态突变及线粒体基因分析诊断Kennedy病1例报告%A case report on Kennedy' s disease diagnosed by dynamic mutation of androgen receptor gene and mitochondrial gene analysis

    Institute of Scientific and Technical Information of China (English)

    梁晓瑜; 勾晨雨

    2013-01-01

    目的 通过对一例肌肉活检提示线粒体肌病的患者进行雄激素受体基因(androgen receptor gene,AR)进行动态突变分析和全线粒体(mtDNA)基因扫描明确诊断.方法 使用PCR方法分析患者雄激素受体(androgen receptor gene,AR)基因的CAG重复序列数,使用Touch Down PCR方法分析患者全线粒体基因突变.结果 该患者雄激素受体基因第一个外显子(Xqll-12)上存在46个三核普酸(CAG)重复,确诊Kennedy病.全线粒体(mtDNA)基因分析未显示线粒体疾病的相关致病突变.结论 AR基因CAG动态突变分析和全mtDNA基因扫描是KD与线粒体脑肌病鉴别诊断或KD并发线粒体脑肌病诊断的重要依据.%Objective To diagnose a patient Kennedy' s disease,who was considered as mitochondrial myopathy by dynamic mutation of androgen receptor gene (AR) and mitochondrial gene analysis.Methods Dynamic mutation of AR gene was analyzed by PCR and sequencing,and mtDNA gene was analyzed by touch down PCR and sequencing.Results trinucleotide repeats of CAG were up to 46,and no pathological mutation of mtDNA was found.Conclusion Dynamic mutation analysis of AR gene and mitochondrial gene analysis are indispensable in diagnosing Kennedy' s disease.

  2. Gene set-based module discovery in the breast cancer transcriptome

    Directory of Open Access Journals (Sweden)

    Zhang Michael Q

    2009-02-01

    Full Text Available Abstract Background Although microarray-based studies have revealed global view of gene expression in cancer cells, we still have little knowledge about regulatory mechanisms underlying the transcriptome. Several computational methods applied to yeast data have recently succeeded in identifying expression modules, which is defined as co-expressed gene sets under common regulatory mechanisms. However, such module discovery methods are not applied cancer transcriptome data. Results In order to decode oncogenic regulatory programs in cancer cells, we developed a novel module discovery method termed EEM by extending a previously reported module discovery method, and applied it to breast cancer expression data. Starting from seed gene sets prepared based on cis-regulatory elements, ChIP-chip data, and gene locus information, EEM identified 10 principal expression modules in breast cancer based on their expression coherence. Moreover, EEM depicted their activity profiles, which predict regulatory programs in each subtypes of breast tumors. For example, our analysis revealed that the expression module regulated by the Polycomb repressive complex 2 (PRC2 is downregulated in triple negative breast cancers, suggesting similarity of transcriptional programs between stem cells and aggressive breast cancer cells. We also found that the activity of the PRC2 expression module is negatively correlated to the expression of EZH2, a component of PRC2 which belongs to the E2F expression module. E2F-driven EZH2 overexpression may be responsible for the repression of the PRC2 expression modules in triple negative tumors. Furthermore, our network analysis predicts regulatory circuits in breast cancer cells. Conclusion These results demonstrate that the gene set-based module discovery approach is a powerful tool to decode regulatory programs in cancer cells.

  3. Androgen receptor function links human sexual dimorphism to DNA methylation.

    Directory of Open Access Journals (Sweden)

    Ole Ammerpohl

    Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.

  4. FUMET: A fuzzy network module extraction technique for gene expression data

    Indian Academy of Sciences (India)

    Priyakshi Mahanta; Hasin Afzal Ahmed; Dhruba Kumar Bhattacharyya; Ashish Ghosh

    2014-06-01

    Construction of co-expression network and extraction of network modules have been an appealing area of bioinformatics research. This article presents a co-expression network construction and a biologically relevant network module extraction technique based on fuzzy set theoretic approach. The technique is able to handle both positive and negative correlations among genes. The constructed network for some benchmark gene expression datasets have been validated using topological internal and external measures. The effectiveness of network module extraction technique has been established in terms of well-known p-value, Q-value and topological statistics.

  5. Androgens Regulate T47D Cells Motility and Invasion through Actin Cytoskeleton Remodeling

    Science.gov (United States)

    Montt-Guevara, Maria Magdalena; Shortrede, Jorge Eduardo; Giretti, Maria Silvia; Giannini, Andrea; Mannella, Paolo; Russo, Eleonora; Genazzani, Alessandro David; Simoncini, Tommaso

    2016-01-01

    The relationship between androgens and breast cancer is controversial. Androgens have complex effects on breast cancer progression and metastasis. Moreover, androgen receptor (AR) is expressed in approximately 70 to 90% of invasive breast carcinomas, which has prognostic relevance in basal-like cancers and in triple-negative breast cancers. Recent studies have associated the actin-binding proteins of the ezrin–radixin–moesin (ERM) family with metastasis in endocrine-sensitive cancers. We studied on T47D breast cancer cells whether androgens with different characteristics, such as testosterone (T), dihydrotestosterone (DHT), and dehydroepiandrosterone (DHEA) may regulate breast cancer cell motility and invasion through the control of actin remodeling. We demonstrate that androgens promote migration and invasion in T47D via Moesin activation. We show that T and DHEA exert their actions via the AR and estrogen receptor (ER), while the non-aromatizable androgen – DHT – only recruits AR. We further report that androgen induced significant changes in actin organization with pseudopodia along with membrane ruffles formation, and this process is mediated by Moesin. Our work identifies novel mechanisms of action of androgens on breast cancer cells. Through the modulation of Moesin, androgens alter the architecture of cytoskeleton in T47D breast cancer cell and promote cell migration and invasion. These results could help to understand the biological actions of androgens on breast cancer and, eventually, to develop new strategies for breast cancer treatment. PMID:27746764

  6. ANDROGENS REGULATE T47D CELLS MOTILITY AND INVASION THROUGH ACTIN CYTOSKELETON REMODELLING

    Directory of Open Access Journals (Sweden)

    Maria Magdalena Montt-Guevara

    2016-09-01

    Full Text Available The relationship between androgens and breast cancer is controversial. Androgens have complex effects on breast cancer progression and metastasis. Moreover, androgens receptor (AR is expressed in approximately 70% to 90% of invasive breast carcinomas, which has prognostic relevance in basal-like cancers and in triple negative breast cancers. Recent studies have associated the actin-binding proteins of the Ezrin-Radixin-Moesin (ERM family with metastasis in endocrine-sensitive cancers. We studied on T47D breast cancer cells whether androgens with different characteristics, such as testosterone (T, dihydrotestosterone (DHT and dehydroepiandrosterone (DHEA may regulate breast cancer cell motility and invasion through the control of actin remodelling. We demonstrate that androgens promote migration and invasion in T47D via Moesin activation. We show that T and DHEA exert their actions via the AR and estrogen receptor (ER, while the non aromatizable androgen – DHT only recruits AR. We further report that androgen induced significant changes in actin organization with pseudopodia along with membrane ruffles formation, and this process is mediated by Moesin. Our work identifies novel mechanisms of action of androgens on breast cancer cells. Through the modulation of Moesin, androgens alter the architecture of cytoskeleton in T47D breast cancer cell and promote cell migration and invasion. These results could help to understand the biological actions of androgens on breast cancer, and eventually to develop new strategies for treatment of breast cancer.

  7. Partial Androgen Insensitivity Syndrome

    OpenAIRE

    Sindhu Sharma, Kuldeep Singh, Sanjay Dhar*,Yudhvir Gupta

    2010-01-01

    Androgen insensitivity syndrome (AIS) present at several differentiation from genetic defects to endorgan resistance thereby producing gender dilema dispelled by sex hormones signature.It is quite traumaticfor the patients and family of the affected baby. Extreme sensitivity and awareness on the part of thecaring doctor is necessary for early diagnosis of case of AIS &for successful outcome.

  8. Partial Androgen Insensitivity Syndrome

    Directory of Open Access Journals (Sweden)

    Sindhu Sharma, Kuldeep Singh, Sanjay Dhar*,Yudhvir Gupta

    2010-01-01

    Full Text Available Androgen insensitivity syndrome (AIS present at several differentiation from genetic defects to endorgan resistance thereby producing gender dilema dispelled by sex hormones signature.It is quite traumaticfor the patients and family of the affected baby. Extreme sensitivity and awareness on the part of thecaring doctor is necessary for early diagnosis of case of AIS &for successful outcome.

  9. Androgen insensitivity syndrome

    Science.gov (United States)

    ... syndrome URL of this page: //medlineplus.gov/ency/article/001180.htm Androgen insensitivity syndrome To use the ... a condition in which the opening of the urethra is on the underside of the penis, instead of ... they can develop cancer, just like any undescended testicle. Estrogen replacement is ...

  10. Modulation of R-gene expression across environments.

    Science.gov (United States)

    MacQueen, Alice; Bergelson, Joy

    2016-03-01

    Some environments are more conducive to pathogen growth than others, and, as a consequence, plants might be expected to invest more in resistance when pathogen growth is favored. Resistance (R-) genes in Arabidopsis thaliana have unusually extensive variation in basal expression when comparing the same R-gene among accessions collected from different environments. R-gene expression variation was characterized to explore whether R-gene expression is up-regulated in environments favoring pathogen proliferation and down-regulated when risks of infection are low; down-regulation would follow if costs of R-gene expression negatively impact plant fitness in the absence of disease. Quantitative reverse transcription-PCR was used to quantify the expression of 13 R-gene loci in plants grown in eight environmental conditions for each of 12 A. thaliana accessions, and large effects of the environment on R-gene expression were found. Surprisingly, almost every change in the environment--be it a change in biotic or abiotic conditions--led to an increase in R-gene expression, a response that was distinct from the average transcriptome response and from that of other stress response genes. These changes in expression are functional in that environmental change prior to infection affected levels of specific disease resistance to isolates of Pseudomonas syringae. In addition, there are strong latitudinal clines in basal R-gene expression and clines in R-gene expression plasticity correlated with drought and high temperatures. These results suggest that variation in R-gene expression across environments may be shaped by natural selection to reduce fitness costs of R-gene expression in permissive or predictable environments.

  11. Prioritization of gene regulatory interactions from large-scale modules in yeast

    Directory of Open Access Journals (Sweden)

    Bringas Ricardo

    2008-01-01

    Full Text Available Abstract Background The identification of groups of co-regulated genes and their transcription factors, called transcriptional modules, has been a focus of many studies about biological systems. While methods have been developed to derive numerous modules from genome-wide data, individual links between regulatory proteins and target genes still need experimental verification. In this work, we aim to prioritize regulator-target links within transcriptional modules based on three types of large-scale data sources. Results Starting with putative transcriptional modules from ChIP-chip data, we first derive modules in which target genes show both expression and function coherence. The most reliable regulatory links between transcription factors and target genes are established by identifying intersection of target genes in coherent modules for each enriched functional category. Using a combination of genome-wide yeast data in normal growth conditions and two different reference datasets, we show that our method predicts regulatory interactions with significantly higher predictive power than ChIP-chip binding data alone. A comparison with results from other studies highlights that our approach provides a reliable and complementary set of regulatory interactions. Based on our results, we can also identify functionally interacting target genes, for instance, a group of co-regulated proteins related to cell wall synthesis. Furthermore, we report novel conserved binding sites of a glycoprotein-encoding gene, CIS3, regulated by Swi6-Swi4 and Ndd1-Fkh2-Mcm1 complexes. Conclusion We provide a simple method to prioritize individual TF-gene interactions from large-scale transcriptional modules. In comparison with other published works, we predict a complementary set of regulatory interactions which yields a similar or higher prediction accuracy at the expense of sensitivity. Therefore, our method can serve as an alternative approach to prioritization for

  12. A satellite cell-specific knockout of the androgen receptor reveals myostatin as a direct androgen target in skeletal muscle.

    Science.gov (United States)

    Dubois, Vanessa; Laurent, Michaël R; Sinnesael, Mieke; Cielen, Nele; Helsen, Christine; Clinckemalie, Liesbeth; Spans, Lien; Gayan-Ramirez, Ghislaine; Deldicque, Louise; Hespel, Peter; Carmeliet, Geert; Vanderschueren, Dirk; Claessens, Frank

    2014-07-01

    Androgens have well-established anabolic actions on skeletal muscle, although the direct effects of the androgen receptor (AR) in muscle remain unclear. We generated satellite cell-specific AR-knockout (satARKO) mice in which the AR is selectively ablated in satellite cells, the muscle precursor cells. Total-limb maximal grip strength is decreased by 7% in satARKO mice, with soleus muscles containing ∼10% more type I fibers and 10% less type IIa fibers than the corresponding control littermates. The weight of the perineal levator ani muscle is markedly reduced (-52%). Thus, muscle AR is involved in fiber-type distribution and force production of the limb muscles, while it is a major determinant of the perineal muscle mass. Surprisingly, myostatin (Mstn), a strong inhibitor of skeletal muscle growth, is one of the most androgen-responsive genes (6-fold reduction in satARKO) through direct transcription activation by the AR. Consequently, muscle hypertrophy in response to androgens is augmented in Mstn-knockout mice. Our finding that androgens induce Mstn signaling to restrain their own anabolic actions has implications for the treatment of muscle wasting disorders.-Dubois, V., Laurent, M. R., Sinnesael, M., Cielen, N., Helsen, C., Clinckemalie, L., Spans, L., Gayan-Ramirez, G., Deldicque, L., Hespel, P., Carmeliet, G., Vanderschueren, D., and Claessens, F. A satellite cell-specific knockout of the androgen receptor reveals myostatin as a direct androgen target in skeletal muscle.

  13. Complete Androgen Insensitivity Syndrome: A Rare Case of Disorder of Sex Development

    OpenAIRE

    Alfonsa Pizzo; Antonio Simone Laganà; Irene Borrielli; Nella Dugo

    2013-01-01

    Androgen Insensitivity Syndrome (AIS) could be considered as a disease that causes resistance to androgens actions, influencing both the morphogenesis and differentiation of the body structures, and systems in which this hormone exerts its effects. It depends on an X-linked mutations in the Androgen Receptor (AR) gene that express a variety of phenotypes ranging from male infertility to completely normal female external genitalia. The clinical phenotypes of AIS could vary and be classified in...

  14. GO-2D: identifying 2-dimensional cellular-localized functional modules in Gene Ontology

    Directory of Open Access Journals (Sweden)

    Yang Da

    2007-01-01

    Full Text Available Abstract Background Rapid progress in high-throughput biotechnologies (e.g. microarrays and exponential accumulation of gene functional knowledge make it promising for systematic understanding of complex human diseases at functional modules level. Based on Gene Ontology, a large number of automatic tools have been developed for the functional analysis and biological interpretation of the high-throughput microarray data. Results Different from the existing tools such as Onto-Express and FatiGO, we develop a tool named GO-2D for identifying 2-dimensional functional modules based on combined GO categories. For example, it refines biological process categories by sorting their genes into different cellular component categories, and then extracts those combined categories enriched with the interesting genes (e.g., the differentially expressed genes for identifying the cellular-localized functional modules. Applications of GO-2D to the analyses of two human cancer datasets show that very specific disease-relevant processes can be identified by using cellular location information. Conclusion For studying complex human diseases, GO-2D can extract functionally compact and detailed modules such as the cellular-localized ones, characterizing disease-relevant modules in terms of both biological processes and cellular locations. The application results clearly demonstrate that 2-dimensional approach complementary to current 1-dimensional approach is powerful for finding modules highly relevant to diseases.

  15. Reconstruction of gene regulatory modules in cancer cell cycle by multi-source data integration.

    Directory of Open Access Journals (Sweden)

    Yuji Zhang

    Full Text Available BACKGROUND: Precise regulation of the cell cycle is crucial to the growth and development of all organisms. Understanding the regulatory mechanism of the cell cycle is crucial to unraveling many complicated diseases, most notably cancer. Multiple sources of biological data are available to study the dynamic interactions among many genes that are related to the cancer cell cycle. Integrating these informative and complementary data sources can help to infer a mutually consistent gene transcriptional regulatory network with strong similarity to the underlying gene regulatory relationships in cancer cells. RESULTS AND PRINCIPAL FINDINGS: We propose an integrative framework that infers gene regulatory modules from the cell cycle of cancer cells by incorporating multiple sources of biological data, including gene expression profiles, gene ontology, and molecular interaction. Among 846 human genes with putative roles in cell cycle regulation, we identified 46 transcription factors and 39 gene ontology groups. We reconstructed regulatory modules to infer the underlying regulatory relationships. Four regulatory network motifs were identified from the interaction network. The relationship between each transcription factor and predicted target gene groups was examined by training a recurrent neural network whose topology mimics the network motif(s to which the transcription factor was assigned. Inferred network motifs related to eight well-known cell cycle genes were confirmed by gene set enrichment analysis, binding site enrichment analysis, and comparison with previously published experimental results. CONCLUSIONS: We established a robust method that can accurately infer underlying relationships between a given transcription factor and its downstream target genes by integrating different layers of biological data. Our method could also be beneficial to biologists for predicting the components of regulatory modules in which any candidate gene is involved

  16. Neonatal androgenization exacerbates alcohol-induced liver injury in adult rats, an effect abrogated by estrogen.

    Directory of Open Access Journals (Sweden)

    Whitney M Ellefson

    Full Text Available Alcoholic liver disease (ALD affects millions of people worldwide and is a major cause of morbidity and mortality. However, fewer than 10% of heavy drinkers progress to later stages of injury, suggesting other factors in ALD development, including environmental exposures and genetics. Females display greater susceptibility to the early damaging effects of ethanol. Estrogen (E2 and ethanol metabolizing enzymes (cytochrome P450, CYP450 are implicated in sex differences of ALD. Sex steroid hormones are developmentally regulated by the hypothalamic-pituitary-gonadal (HPG axis, which controls sex-specific cycling of gonadal steroid production and expression of hepatic enzymes. The aim of this study was to determine if early postnatal inhibition of adult cyclic E2 alters ethanol metabolizing enzyme expression contributing to the development of ALD in adulthood. An androgenized rat model was used to inhibit cyclic E2 production. Control females (Ctrl, androgenized females (Andro and Andro females with E2 implants were administered either an ethanol or isocalorically-matched control Lieber-DeCarli diet for four weeks and liver injury and CYP450 expression assessed. Androgenization exacerbated the deleterious effects of ethanol demonstrated by increased steatosis, lipid peroxidation, profibrotic gene expression and decreased antioxidant defenses compared to Ctrl. Additionally, CYP2E1 expression was down-regulated in Andro animals on both diets. No change was observed in CYP1A2 protein expression. Further, continuous exogenous administration of E2 to Andro in adulthood attenuated these effects, suggesting that E2 has protective effects in the androgenized animal. Therefore, early postnatal inhibition of cyclic E2 modulates development and progression of ALD in adulthood.

  17. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    OpenAIRE

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e...

  18. Modules for C-terminal epitope tagging of Tetrahymena genes

    Science.gov (United States)

    Kataoka, Kensuke; Schoeberl, Ursula E.; Mochizuki, Kazufumi

    2010-01-01

    Although epitope tagging has been widely used for analyzing protein function in many organisms, there are few genetic tools for epitope tagging in Tetrahymena. In this study, we describe several C-terminal epitope tagging modules that can be used to express tagged proteins in Tetrahymena cells by both plasmid- and PCR-based strategies. PMID:20624430

  19. TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes.

    Science.gov (United States)

    Matys, V; Kel-Margoulis, O V; Fricke, E; Liebich, I; Land, S; Barre-Dirrie, A; Reuter, I; Chekmenev, D; Krull, M; Hornischer, K; Voss, N; Stegmaier, P; Lewicki-Potapov, B; Saxel, H; Kel, A E; Wingender, E

    2006-01-01

    The TRANSFAC database on transcription factors, their binding sites, nucleotide distribution matrices and regulated genes as well as the complementing database TRANSCompel on composite elements have been further enhanced on various levels. A new web interface with different search options and integrated versions of Match and Patch provides increased functionality for TRANSFAC. The list of databases which are linked to the common GENE table of TRANSFAC and TRANSCompel has been extended by: Ensembl, UniGene, EntrezGene, HumanPSD and TRANSPRO. Standard gene names from HGNC, MGI and RGD, are included for human, mouse and rat genes, respectively. With the help of InterProScan, Pfam, SMART and PROSITE domains are assigned automatically to the protein sequences of the transcription factors. TRANSCompel contains now, in addition to the COMPEL table, a separate table for detailed information on the experimental EVIDENCE on which the composite elements are based. Finally, for TRANSFAC, in respect of data growth, in particular the gain of Drosophila transcription factor binding sites (by courtesy of the Drosophila DNase I footprint database) and of Arabidopsis factors (by courtesy of DATF, Database of Arabidopsis Transcription Factors) has to be stressed. The here described public releases, TRANSFAC 7.0 and TRANSCompel 7.0, are accessible under http://www.gene-regulation.com/pub/databases.html.

  20. One and the same androgen for all? towards designer androgens

    Institute of Scientific and Technical Information of China (English)

    LouisJGGooren; NhuThanhNguyen

    1999-01-01

    The introduction of designer oestrogens as a treatment medality in hormone replacement in women has invited to consider the concept of compounds with selective androgenic effects for male honnone replacement therapy. The full spectrum of the actions of testosterone may not be necessary of even undesired for certain indications for testosterone treatment, To define for what indications certain androgenic properties are desired and undesired more insight in basic androgen (patho)physiology is required. There is convincing evidence that aromatization of androgenic compounds to nestrogens might be an advantage for maintenance of bone mass and it might also mitigate negative effects of androgens on bichemical parameters of cardiovascular risks: the potentially negative effects of oestmgens on prostate pathology in ageing men needs further elucidation. While the role of dihydro-testosterone (DHT) for the male sexual differentiation and for pubertal sexual maturation is evident, its role in mature and ageing males seems less significant or may even be harmful. It is, however, of note that a negative effect of DHT on prostate pathophysiolog~ is certainly not proven.For male contraception a progestational agent with strong androgenic properties might be an asset. For most of the androgenic actions the critical levels of androgens are not well established. The latter is relevant since the large amount of androgen molecules required for its biological actions (as compared to oestrogens) is an impediment in androgen replacement medalities. There may be room for more biopotent androgens since delivery of large amounts of androgen molecules to the circulation poses problems fur treatment modalities. ( Asian J Andro11999 Jun; 1:21 -28)

  1. Liquid chromatography-high resolution/ high accuracy (tandem) mass spectrometry-based identification of in vivo generated metabolites of the selective androgen receptor modulator ACP-105 for doping control purposes.

    Science.gov (United States)

    Thevis, Mario; Thomas, Andreas; Piper, Thomas; Krug, Oliver; Delahaut, Philippe; Schänzer, Wilhelm

    2014-01-01

    Selective androgen receptor modulators (SARMs) represent an emerging class of therapeutics which have been prohibited in sport as anabolic agents according to the regulations of the World Anti-Doping Agency (WADA) since 2008. Within the past three years, numerous adverse analytical findings with SARMs in routine doping control samples have been reported despite missing clinical approval of these substances. Hence, preventive doping research concerning the metabolism and elimination of new therapeutic entities of the class of SARMs are vital for efficient and timely sports drug testing programs as banned compounds are most efficiently screened when viable targets (for example, characteristic metabolites) are identified. In the present study, the metabolism of ACP-105, a novel SARM drug candidate, was studied in vivo in rats. Following oral administration, urine samples were collected over a period of seven days and analyzed for metabolic products by Liquid chromatography-high resolution/high accuracy (tandem) mass spectrometry. Samples were subjected to enzymatic hydrolysis prior to liquid-liquid extraction and a total of seven major phase-I metabolites were detected, three of which were attributed to monohydroxylated and four to bishydroxylated ACP-105. The hydroxylation sites were assigned by means of diagnostic product ions and respective dissociation pathways of the analytes following positive or negative ionization and collisional activation as well as selective chemical derivatization. The identified metabolites were used as target compounds to investigate their traceability in a rat elimination urine samples study and monohydroxylated and bishydroxylated species were detectable for up to four and six days post-administration, respectively.

  2. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2015-08-01

    dependent compound screen, aided by the University of Michigan Center for Chemical Genomics . Differential AR activation in transfected cells was assessed...WR, Parker JS, Lee MX, Kass EM, Spratt DE, Iaquinta PJ, Arora VK, Yen WF, Cai L, Zheng D, Carver BS, Chen Y, Watson PA, Shah NP, Fujisawa S, Goglia...for known genes and genome -wide by ChIP-seq. Results will strengthen our overall hypothesis that genes with similar function (i.e

  3. Metabolic syndrome, androgens, and hypertension.

    Science.gov (United States)

    Moulana, Mohadetheh; Lima, Roberta; Reckelhoff, Jane F

    2011-04-01

    Obesity is one of the constellation of factors that make up the definition of the metabolic syndrome. Metabolic syndrome is also associated with insulin resistance, dyslipidemia, hypertriglyceridemia, and type 2 diabetes mellitus. The presence of obesity and metabolic syndrome in men and women is also associated with increased risk of cardiovascular disease and hypertension. In men, obesity and metabolic syndrome are associated with reductions in testosterone levels. In women, obesity and metabolic syndrome are associated with increases in androgen levels. In men, reductions in androgen levels are associated with inflammation, and androgen supplements reduce inflammation. In women, increases in androgens are associated with increases in inflammatory cytokines, and reducing androgens reduces inflammation. This review discusses the possibility that the effects of androgens on metabolic syndrome and its sequelae may differ between males and females.

  4. Complete Androgen Insensitivity Syndrome: A Rare Case of Disorder of Sex Development

    Directory of Open Access Journals (Sweden)

    Alfonsa Pizzo

    2013-01-01

    Full Text Available Androgen Insensitivity Syndrome (AIS could be considered as a disease that causes resistance to androgens actions, influencing both the morphogenesis and differentiation of the body structures, and systems in which this hormone exerts its effects. It depends on an X-linked mutations in the Androgen Receptor (AR gene that express a variety of phenotypes ranging from male infertility to completely normal female external genitalia. The clinical phenotypes of AIS could vary and be classified into three categories, as complete (CAIS, partial (PAIS, and mild (MAIS forms, according to the severity of androgen resistance. We will describe a case of CAIS in a 16-year-old patient.

  5. Research Resource: Androgen Receptor Activity Is Regulated Through the Mobilization of Cell Surface Receptor Networks.

    Science.gov (United States)

    Hsiao, Jordy J; Ng, Brandon H; Smits, Melinda M; Martinez, Harryl D; Jasavala, Rohini J; Hinkson, Izumi V; Fermin, Damian; Eng, Jimmy K; Nesvizhskii, Alexey I; Wright, Michael E

    2015-08-01

    The aberrant expression of androgen receptor (AR)-dependent transcriptional programs is a defining pathology of the development and progression of prostate cancers. Transcriptional cofactors that bind AR are critical determinants of prostate tumorigenesis. To gain a deeper understanding of the proteins linked to AR-dependent gene transcription, we performed a DNA-affinity chromatography-based proteomic screen designed to identify proteins involved in AR-mediated gene transcription in prostate tumor cells. Functional experiments validated the coregulator roles of known AR-binding proteins in AR-mediated transcription in prostate tumor cells. More importantly, novel coregulatory functions were detected in components of well-established cell surface receptor-dependent signal transduction pathways. Further experimentation demonstrated that components of the TNF, TGF-β, IL receptor, and epidermal growth factor signaling pathways modulated AR-dependent gene transcription and androgen-dependent proliferation in prostate tumor cells. Collectively, our proteomic dataset demonstrates that the cell surface receptor- and AR-dependent pathways are highly integrated, and provides a molecular framework for understanding how disparate signal-transduction pathways can influence AR-dependent transcriptional programs linked to the development and progression of human prostate cancers.

  6. Ethanol modulation of gene networks: implications for alcoholism.

    Science.gov (United States)

    Farris, Sean P; Miles, Michael F

    2012-01-01

    Alcoholism is a complex disease caused by a confluence of environmental and genetic factors influencing multiple brain pathways to produce a variety of behavioral sequelae, including addiction. Genetic factors contribute to over 50% of the risk for alcoholism and recent evidence points to a large number of genes with small effect sizes as the likely molecular basis for this disease. Recent progress in genomics (microarrays or RNA-Seq) and genetics has led to the identification of a large number of potential candidate genes influencing ethanol behaviors or alcoholism itself. To organize this complex information, investigators have begun to focus on the contribution of gene networks, rather than individual genes, for various ethanol-induced behaviors in animal models or behavioral endophenotypes comprising alcoholism. This chapter reviews some of the methods used for constructing gene networks from genomic data and some of the recent progress made in applying such approaches to the study of the neurobiology of ethanol. We show that rapid technology development in gathering genomic data, together with sophisticated experimental design and a growing collection of analysis tools are producing novel insights for understanding the molecular basis of alcoholism and that such approaches promise new opportunities for therapeutic development.

  7. Predictability of Genetic Interactions from Functional Gene Modules

    Directory of Open Access Journals (Sweden)

    Jonathan H. Young

    2017-02-01

    Full Text Available Characterizing genetic interactions is crucial to understanding cellular and organismal response to gene-level perturbations. Such knowledge can inform the selection of candidate disease therapy targets, yet experimentally determining whether genes interact is technically nontrivial and time-consuming. High-fidelity prediction of different classes of genetic interactions in multiple organisms would substantially alleviate this experimental burden. Under the hypothesis that functionally related genes tend to share common genetic interaction partners, we evaluate a computational approach to predict genetic interactions in Homo sapiens, Drosophila melanogaster, and Saccharomyces cerevisiae. By leveraging knowledge of functional relationships between genes, we cross-validate predictions on known genetic interactions and observe high predictive power of multiple classes of genetic interactions in all three organisms. Additionally, our method suggests high-confidence candidate interaction pairs that can be directly experimentally tested. A web application is provided for users to query genes for predicted novel genetic interaction partners. Finally, by subsampling the known yeast genetic interaction network, we found that novel genetic interactions are predictable even when knowledge of currently known interactions is minimal.

  8. Differential modulation of expression of nuclear receptor mediated genes by tris(2-butoxyethyl) phosphate (TBOEP) on early life stages of zebrafish (Danio rerio)

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Zhiyuan, E-mail: zhiyuan_nju@163.com [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, Jiangsu 210023 (China); Yu, Yijun, E-mail: yjun.yu@gmail.com [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, Jiangsu 210023 (China); Tang, Song [School of Environment and Sustainability, University of Saskatchewan, Saskatoon, SK S7N 5B3 (Canada); Liu, Hongling, E-mail: hlliu@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, Jiangsu 210023 (China); Su, Guanyong; Xie, Yuwei [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, Jiangsu 210023 (China); Giesy, John P. [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, Jiangsu 210023 (China); Toxicology Centre, University of Saskatchewan, Saskatoon, SK S7N 5B3 (Canada); Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, SK S7N 5B3 (Canada); Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong Special Administrative Region (Hong Kong); Hecker, Markus [School of Environment and Sustainability, University of Saskatchewan, Saskatoon, SK S7N 5B3 (Canada); Toxicology Centre, University of Saskatchewan, Saskatoon, SK S7N 5B3 (Canada); Yu, Hongxia [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, Jiangsu 210023 (China)

    2015-12-15

    Highlights: • Effects of TBOEP on expression of genes of several nuclear hormone receptors and their relationship with adverse effect pathways in zebrafish. • TBOEP was neither an agonist nor antagonist of AR or AhR as determined by use of in vitro mammalian cell-based receptor transactivation assays. • Modulation of ER- and MR-dependent pathways allowed for development of feasible receptor-mediated, critical mechanisms of toxic action. - Abstract: As one substitute for phased-out brominated flame retardants (BFRs), tris(2-butoxyethyl) phosphate (TBOEP) is frequently detected in aquatic organisms. However, knowledge about endocrine disrupting mechanisms associated with nuclear receptors caused by TBOEP remained restricted to results from in vitro studies with mammalian cells. In the study, results of which are presented here, embryos/larvae of zebrafish (Danio rerio) were exposed to 0.02, 0.1 or 0.5 μM TBOEP to investigate expression of genes under control of several nuclear hormone receptors (estrogen receptors (ERs), androgen receptor (AR), thyroid hormone receptor alpha (TRα), mineralocorticoid receptor (MR), glucocorticoid receptor (GR), aryl hydrocarbon (AhR), peroxisome proliferator-activated receptor alpha (PPARα), and pregnane × receptor (P × R)) pathways at 120 hpf. Exposure to 0.5 μM TBOEP significantly (p < 0.05, one-way analysis of variance) up-regulated expression of estrogen receptors (ERs, er1, er2a, and er2b) genes and ER-associated genes (vtg4, vtg5, pgr, ncor, and ncoa3), indicating TBOEP modulates the ER pathway. In contrast, expression of most genes (mr, 11βhsd, ube2i,and adrb2b) associated with the mineralocorticoid receptor (MR) pathway were significantly down-regulated. Furthermore, in vitro mammalian cell-based (MDA-kb2 and H4IIE-luc) receptor transactivation assays, were also conducted to investigate possible agonistic or antagonistic effects on AR- and AhR-mediated pathways. In mammalian cells, none of these pathways were

  9. Complete androgen insensitivity syndrome

    Directory of Open Access Journals (Sweden)

    Tančić-Gajić Milina

    2015-01-01

    Full Text Available Introduction. Androgen insensitivity syndrome (AIS belongs to disorders of sex development, resulting from complete or partial resistance to the biological actions of androgens in persons who are genetically males (XY with normally developed testes and age-appropriate for males of serum testosterone concentration. Case Outline. A 21-year-old female patient was admitted at our Clinic further evaluation and treatment of testicular feminization syndrome, which was diagnosed at the age of 16 years. The patient had never menstruated. On physical examination, her external genitalia and breast development appeared as completely normal feminine structures but pubic and axillary hair was absent. Cytogenetic analysis showed a 46 XY karyotype. The values of sex hormones were as in adult males. The multisliced computed tomography (MSCT showed structures on both sides of the pelvic region, suggestive of testes. Bilateral orchiectomy was performed. Hormone replacement therapy was prescribed after gonadectomy. Vaginal dilatation was advised to avoid dyspareunia. Conclusion. The diagnosis of complete androgen insensitivity is based on clinical findigs, hormonal analysis karyotype, visualization methods and genetic analysis. Bilateral gonadectomy is generally recommended in early adulthood to avoid the risk of testicular malignancy. Vaginal length may be short requiring dilatation in an effort to avoid dyspareunia. Vaginal surgery is rarely indicated for the creation of a functional vagina. [Projekat Ministarstva nauke Republike Srbije, br. 175067

  10. Gene Targeting and Expression Modulation by Peptide Nucleic Acids (PNA)

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2010-01-01

    Peptide nucleic acids (PNA) are artificial structural mimics of nucleic acids capable of sequence specific hybridization to both RNA and DNA. Thus they have obvious potential as gene targeting agents for drug discovery approaches. An overview with emphasis on recent progress on RNA "interference"...

  11. The PSE1 gene modulates lead tolerance in Arabidopsis

    Science.gov (United States)

    Fan, Tingting; Yang, Libo; Wu, Xi; Ni, Jiaojiao; Jiang, Haikun; Zhang, Qi’an; Fang, Ling; Sheng, Yibao; Ren, Yongbing; Cao, Shuqing

    2016-01-01

    Lead (Pb) is a dangerous heavy metal contaminant with high toxicity to plants. However, the regulatory mechanism of plant Pb tolerance is poorly understood. Here, we showed that the PSE1 gene confers Pb tolerance in Arabidopsis. A novel Pb-sensitive mutant pse1-1 (Pb-sensitive1) was isolated by screening T-DNA insertion mutants. PSE1 encodes an unknown protein with an NC domain and was localized in the cytoplasm. PSE1 was induced by Pb stress, and the pse1-1 loss-of-function mutant showed enhanced Pb sensitivity; overexpression of PSE1 resulted in increased Pb tolerance. PSE1-overexpressing plants showed increased Pb accumulation, which was accompanied by the activation of phytochelatin (PC) synthesis and related gene expression. In contrast, the pse1-1 mutant showed reduced Pb accumulation, which was associated with decreased PC synthesis and related gene expression. In addition, the expression of PDR12 was also increased in PSE1-overexpressing plants subjected to Pb stress. Our results suggest that PSE1 regulates Pb tolerance mainly through glutathione-dependent PC synthesis by activating the expression of the genes involved in PC synthesis and at least partially through activating the expression of the ABC transporter PDR12/ABCG40. PMID:27335453

  12. Identification of a gene module associated with BMD through the integration of network analysis and genome-wide association data.

    Science.gov (United States)

    Farber, Charles R

    2010-11-01

    Bone mineral density (BMD) is influenced by a complex network of gene interactions; therefore, elucidating the relationships between genes and how those genes, in turn, influence BMD is critical for developing a comprehensive understanding of osteoporosis. To investigate the role of transcriptional networks in the regulation of BMD, we performed a weighted gene coexpression network analysis (WGCNA) using microarray expression data on monocytes from young individuals with low or high BMD. WGCNA groups genes into modules based on patterns of gene coexpression. and our analysis identified 11 gene modules. We observed that the overall expression of one module (referred to as module 9) was significantly higher in the low-BMD group (p = .03). Module 9 was highly enriched for genes belonging to the immune system-related gene ontology (GO) category "response to virus" (p = 7.6 × 10(-11)). Using publically available genome-wide association study data, we independently validated the importance of module 9 by demonstrating that highly connected module 9 hubs were more likely, relative to less highly connected genes, to be genetically associated with BMD. This study highlights the advantages of systems-level analyses to uncover coexpression modules associated with bone mass and suggests that particular monocyte expression patterns may mediate differences in BMD.

  13. Identification of Comamonas testosteroni as an androgen degrader in sewage

    Science.gov (United States)

    Chen, Yi-Lung; Wang, Chia-Hsiang; Yang, Fu-Chun; Ismail, Wael; Wang, Po-Hsiang; Shih, Chao-Jen; Wu, Yu-Ching; Chiang, Yin-Ru

    2016-01-01

    Numerous studies have reported the masculinization of freshwater wildlife exposed to androgens in polluted rivers. Microbial degradation is a crucial mechanism for eliminating steroid hormones from contaminated ecosystems. The aerobic degradation of testosterone was observed in various bacterial isolates. However, the ecophysiological relevance of androgen-degrading microorganisms in the environment is unclear. Here, we investigated the biochemical mechanisms and corresponding microorganisms of androgen degradation in aerobic sewage. Sewage samples collected from the Dihua Sewage Treatment Plant (Taipei, Taiwan) were aerobically incubated with testosterone (1 mM). Androgen metabolite analysis revealed that bacteria adopt the 9, 10-seco pathway to degrade testosterone. A metagenomic analysis indicated the apparent enrichment of Comamonas spp. (mainly C. testosteroni) and Pseudomonas spp. in sewage incubated with testosterone. We used the degenerate primers derived from the meta-cleavage dioxygenase gene (tesB) of various proteobacteria to track this essential catabolic gene in the sewage. The amplified sequences showed the highest similarity (87–96%) to tesB of C. testosteroni. Using quantitative PCR, we detected a remarkable increase of the 16S rRNA and catabolic genes of C. testosteroni in the testosterone-treated sewage. Together, our data suggest that C. testosteroni, the model microorganism for aerobic testosterone degradation, plays a role in androgen biodegradation in aerobic sewage. PMID:27734937

  14. Light Controlled Modulation of Gene Expression by Chemical Optoepigenetic Probes

    OpenAIRE

    Reis, Surya A.; Ghosh, Balaram; Hendricks, J. Adam; Szantai-Kis, D. Miklos; Törk, Lisa; Ross, Kenneth N.; Lamb, Justin; Read-Button, Willis; Zheng, Baixue; Wang, HongTao; Salthouse, Christopher; Haggarty, Stephen J.; Mazitschek, Ralph

    2016-01-01

    Epigenetic gene regulation is a dynamic process orchestrated by chromatin-modifying enzymes. Many of these master regulators exert their function through covalent modification of DNA and histone proteins. Aberrant epigenetic processes have been implicated in the pathophysiology of multiple human diseases. Small-molecule inhibitors have been essential to advancing our understanding of the underlying molecular mechanisms of epigenetic processes. However, the resolution offered by small molecule...

  15. Altered theca and cumulus oocyte complex gene expression, follicular arrest and reduced fertility in cows with dominant follicle follicular fluid androgen excess.

    Directory of Open Access Journals (Sweden)

    Adam F Summers

    Full Text Available Aspiration of bovine follicles 12-36 hours after induced corpus luteum lysis serendipitously identified two populations of cows, one with High androstenedione (A4; >40 ng/ml; mean = 102 and another with Low A4 (<20 ng/ml; mean = 9 in follicular fluid. We hypothesized that the steroid excess in follicular fluid of dominant follicles in High A4 cows would result in reduced fertility through altered follicle development and oocyte maternal RNA abundance. To test this hypothesis, estrous cycles of cows were synchronized and ovariectomy was performed 36 hours later. HPLC MS/MS analysis of follicular fluid showed increased dehydroepiandrosterone (6-fold, A4 (158-fold and testosterone (31-fold in the dominant follicle of High A4 cows. However, estrone (3-fold and estradiol (2-fold concentrations were only slightly elevated, suggesting a possible inefficiency in androgen to estrogen conversion in High A4 cows. Theca cell mRNA expression of LHCGR, GATA6, CYP11A1, and CYP17A1 was greater in High A4 cows. Furthermore, abundance of ZAR1 was decreased 10-fold in cumulus oocyte complexes from High A4 cows, whereas NLRP5 abundance tended to be 19.8-fold greater (P = 0.07. There was a tendency for reduction in stage 4 follicles in ovarian cortex samples from High A4 cows suggesting that progression to antral stages were impaired. High A4 cows tended (P<0.07 to have a 17% reduction in calving rate compared with Low A4 cows suggesting reduced fertility in the High A4 population. These data suggest that the dominant follicle environment of High A4 cows including reduced estrogen conversion and androgen excess contributes to infertility in part through altered follicular and oocyte development.

  16. Modulation of social behavior by the agouti pigmentation gene

    Directory of Open Access Journals (Sweden)

    Valeria eCarola

    2014-08-01

    Full Text Available Agouti is a secreted neuropeptide that acts as an endogenous antagonist of melanocortin receptors. Mice and rats lacking agouti (called non-agouti have dark fur due to a disinhibition of melanocortin signaling and pigment deposition in the hair follicle. Non-agouti animals have also been reported to exhibit altered behavior, despite no evidence for the expression of agouti outside the skin. Here we confirm that non-agouti mice show altered social behavior and uncover expression of agouti in the preputial gland, a sebaceous organ in the urinary tract that secretes molecules involved in social behavior. Non-agouti mice had enlarged preputial glands and altered levels of putative preputial pheromones and surgical removal of the gland reversed the behavioral phenotype. These findings demonstrate the existence of an autologous, out-of-skin pathway for the modulation of social behavior.

  17. Gene Network for Identifying the Entropy Changes of Different Modules in Pediatric Sepsis

    Directory of Open Access Journals (Sweden)

    Jing Yang

    2016-12-01

    Full Text Available Background/Aims: Pediatric sepsis is a disease that threatens life of children. The incidence of pediatric sepsis is higher in developing countries due to various reasons, such as insufficient immunization and nutrition, water and air pollution, etc. Exploring the potential genes via different methods is of significance for the prevention and treatment of pediatric sepsis. This study aimed to identify potential genes associated with pediatric sepsis utilizing analysis of gene network and entropy. Methods: The mRNA expression in the blood samples collected from 20 septic children and 30 healthy controls was quantified by using Affymetrix HG-U133A microarray. Two condition-specific protein-protein interaction networks (PINs, one for the healthy control and the other one for the children with sepsis, were deduced by combining the fundamental human PINs with gene expression profiles in the two phenotypes. Subsequently, distinct modules from the two conditional networks were extracted by adopting a maximal clique-merging approach. Delta entropy (ΔS was calculated between sepsis and control modules. Results: Then, key genes displaying changes in gene composition were identified by matching the control and sepsis modules. Two objective modules were obtained, in which ribosomal protein RPL4 and RPL9 as well as TOP2A were probably considered as the key genes differentiating sepsis from healthy controls. Conclusion: According to previous reports and this work, TOP2A is the potential gene therapy target for pediatric sepsis. The relationship between pediatric sepsis and RPL4 and RPL9 needs further investigation.

  18. Application of random matrix theory to microarray data for discovering functional gene modules

    Energy Technology Data Exchange (ETDEWEB)

    Luo, F. [Xiangtan University, Xiangtan Hunan, China; Zhong, Jianxin [ORNL; Yang, Y. F. [unknown; Zhou, Jizhong [ORNL

    2006-03-01

    We show that spectral fluctuation of coexpression correlation matrices of yeast gene microarray profiles follows the description of the Gaussian orthogonal ensemble (GOE) of the random matrix theory (RMT) and removal of small values of the correlation coefficients results in a transition from the GOE statistics to the Poisson statistics of the RMT. This transition is directly related to the structural change of the gene expression network from a global network to a network of isolated modules.

  19. Application of random matrix theory to microarray data for discovering functional gene modules.

    Science.gov (United States)

    Luo, Feng; Zhong, Jianxin; Yang, Yunfeng; Zhou, Jizhong

    2006-03-01

    We show that spectral fluctuation of coexpression correlation matrices of yeast gene microarray profiles follows the description of the Gaussian orthogonal ensemble (GOE) of the random matrix theory (RMT) and removal of small values of the correlation coefficients results in a transition from the GOE statistics to the Poisson statistics of the RMT. This transition is directly related to the structural change of the gene expression network from a global network to a network of isolated modules.

  20. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    OpenAIRE

    Anam eYousaf; Abdul eQadir; Tehmina eAnjum; Aqeel eAhmad

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four ...

  1. Chloroquine mediated modulation of Anopheles gambiae gene expression.

    Directory of Open Access Journals (Sweden)

    Patrícia Abrantes

    Full Text Available BACKGROUND: Plasmodium development in the mosquito is crucial for malaria transmission and depends on the parasite's interaction with a variety of cell types and specific mosquito factors that have both positive and negative effects on infection. Whereas the defensive response of the mosquito contributes to a decrease in parasite numbers during these stages, some components of the blood meal are known to favor infection, potentiating the risk of increased transmission. The presence of the antimalarial drug chloroquine in the mosquito's blood meal has been associated with an increase in Plasmodium infectivity for the mosquito, which is possibly caused by chloroquine interfering with the capacity of the mosquito to defend against the infection. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we report a detailed survey of the Anopheles gambiae genes that are differentially regulated by the presence of chloroquine in the blood meal, using an A. gambiae cDNA microarray. The effect of chloroquine on transcript abundance was evaluated separately for non-infected and Plasmodium berghei-infected mosquitoes. Chloroquine was found to affect the abundance of transcripts that encode proteins involved in a variety of processes, including immunity, apoptosis, cytoskeleton and the response to oxidative stress. This pattern of differential gene expression may explain the weakened mosquito defense response which accounts for the increased infectivity observed in chloroquine-treated mosquitoes. CONCLUSIONS/SIGNIFICANCE: The results of the present study suggest that chloroquine can interfere with several putative mosquito mechanisms of defense against Plasmodium at the level of gene expression and highlight the need for a better understanding of the impacts of antimalarial agents on parasite transmission.

  2. In Silico and In Vitro Investigation of the Piperine's Male Contraceptive Effect: Docking and Molecular Dynamics Simulation Studies in Androgen-Binding Protein and Androgen Receptor.

    Science.gov (United States)

    Chinta, Gopichand; Ramya Chandar Charles, Mariasoosai; Klopčič, Ivana; Sollner Dolenc, Marija; Periyasamy, Latha; Selvaraj Coumar, Mohane

    2015-07-01

    Understanding the molecular mechanism of action of traditional medicines is an important step towards developing marketable drugs from them. Piperine, an active constituent present in the Piper species, is used extensively in Ayurvedic medicines (practiced on the Indian subcontinent). Among others, piperine is known to possess a male contraceptive effect; however, the molecular mechanism of action for this effect is not very clear. In this regard, detailed docking and molecular dynamics simulation studies of piperine with the androgen-binding protein and androgen receptors were carried out. Androgen receptors control male sexual behavior and fertility, while the androgen-binding protein binds testosterone and maintains its concentration at optimal levels to stimulate spermatogenesis in the testis. It was found that piperine docks to the androgen-binding protein, similar to dihydrotestosterone, and to androgen receptors, similar to cyproterone acetate (antagonist). Also, the piperine-androgen-binding protein and piperine-androgen receptors interactions were found to be stable throughout 30 ns of molecular dynamics simulation. Further, two independent simulations for 10 ns each also confirmed the stability of these interactions. Detailed analysis of the piperine-androgen-binding protein interactions shows that piperine interacts with Ser42 of the androgen-binding protein and could block the binding with its natural ligands dihydrotestosterone/testosterone. Moreover, piperine interacts with Thr577 of the androgen receptors in a manner similar to the antagonist cyproterone acetate. Based on the in silico results, piperine was tested in the MDA-kb2 cell line using the luciferase reporter gene assay and was found to antagonize the effect of dihydrotestosterone at nanomolar concentrations. Further detailed biochemical experiments could help to develop piperine as an effective male contraceptive agent in the future.

  3. Bordetella pertussis modulates human macrophage defense gene expression.

    Science.gov (United States)

    Valdez, Hugo Alberto; Oviedo, Juan Marcos; Gorgojo, Juan Pablo; Lamberti, Yanina; Rodriguez, Maria Eugenia

    2016-08-01

    Bordetella pertussis, the etiological agent of whooping cough, still causes outbreaks. We recently found evidence that B. pertussis can survive and even replicate inside human macrophages, indicating that this host cell might serve as a niche for persistence. In this work, we examined the interaction of B. pertussis with a human monocyte cell line (THP-1) that differentiates into macrophages in culture in order to investigate the host cell response to the infection and the mechanisms that promote that intracellular survival. To that end, we investigated the expression profile of a selected number of genes involved in cellular bactericidal activity and the inflammatory response during the early and late phases of infection. The bactericidal and inflammatory response of infected macrophages was progressively downregulated, while the number of THP-1 cells heavily loaded with live bacteria increased over time postinfection. Two of the main toxins of B. pertussis, pertussis toxin (Ptx) and adenylate cyclase (CyaA), were found to be involved in manipulating the host cell response. Therefore, failure to express either toxin proved detrimental to the development of intracellular infections by those bacteria. Taken together, these results support the relevance of host defense gene manipulation to the outcome of the interaction between B. pertussis and macrophages.

  4. Testicular steroidogenesis is locally regulated by androgen via suppression of Nur77.

    Science.gov (United States)

    Song, Chin-Hee; Gong, Eun-Yeung; Park, Ji soo; Lee, Keesook

    2012-06-01

    Steroidogenesis in the testis is regulated by a negative feedback mechanism through the hypothalamus-pituitary-testis axis. Recent studies suggest that besides this long-loop regulation, testicular steroidogenesis is also locally regulated by androgen. However, the molecular mechanism behind this additional regulatory pathway has been poorly addressed. In the present study, we demonstrate that liganded androgen receptor (AR) suppresses the transcriptional activity of Nur77 on steroidogenic enzyme gene promoters, affecting testicular steroidogenesis. AR physically interacts and colocalizes with Nur77 in the nucleus in the presence of androgen. AR inhibits Nur77 transactivation by competing mainly with coactivators such as SRC-1 for Nur77 binding. These results suggest that androgen, through binding to AR, directly acts as a signal inhibiting the expression of steroidogenic enzyme genes in Leydig cells, eventually resulting in decreased testicular steroidogenesis. These findings strongly support the hypothesis that androgen acts locally to regulate testicular steroidogenesis, and may provide its action mechanism.

  5. Nigribactin, a Novel Siderophore from Vibrio nigripulchritudo, Modulates Staphylococcus aureus Virulence Gene Expression

    DEFF Research Database (Denmark)

    Nielsen, Anita; Månsson, Maria; Wietz, Matthias;

    2012-01-01

    Staphylococcus aureus is a serious human pathogen that employs a number of virulence factors as part of its pathogenesis. The purpose of the present study was to explore marine bacteria as a source of compounds that modulate virulence gene expression in S. aureus. During the global marine Galathe...

  6. Therapeutic modulation of endogenous gene function by agents with designed DNA-sequence specificities

    NARCIS (Netherlands)

    Uil, T.G.; Haisma, H.J.; Rots, Marianne

    2003-01-01

    Designer molecules that can specifically target pre-determined DNA sequences provide a means to modulate endogenous gene function. Different classes of sequence-specific DNA-binding agents have been developed, including triplex-forming molecules, synthetic polyamides and designer zinc finger protein

  7. Steroid Androgen Exposure during Development Has No Effect on Reproductive Physiology of Biomphalaria glabrata.

    Science.gov (United States)

    Kaur, Satwant; Baynes, Alice; Lockyer, Anne E; Routledge, Edwin J; Jones, Catherine S; Noble, Leslie R; Jobling, Susan

    2016-01-01

    Gastropod mollusks have been proposed as alternative models for male reproductive toxicity testing, due to similarities in their reproductive anatomy compared to mammals, together with evidence that endocrine disrupting chemicals can cause effects in some mollusks analogous to those seen in mammals. To test this hypothesis, we used the freshwater pulmonate snail, Biomphalaria glabrata, for which various genetic tools and a draft genome have recently become available, to investigate the effects of two steroid androgens on the development of mollusk secondary sexual organs. Here we present the results of exposures to two potent androgens, the vertebrate steroid; 5α-dihydrotestosterone (DHT) and the pharmaceutical anabolic steroid; 17α-methyltestosterone (MT), under continuous flow-through conditions throughout embryonic development and up to sexual maturity. Secondary sexual gland morphology, histopathology and differential gene expression analysis were used to determine whether steroid androgens stimulated or inhibited organ development. No significant differences between tissues from control and exposed snails were identified, suggesting that these androgens elicited no biologically detectable response normally associated with exposure to androgens in vertebrate model systems. Identifying no effect of androgens in this mollusk is significant, not only in the context of the suitability of mollusks as alternative model organisms for testing vertebrate androgen receptor agonists but also, if applicable to other similar mollusks, in terms of the likely impacts of androgens and anti-androgenic pollutants present in the aquatic environment.

  8. Steroid Androgen Exposure during Development Has No Effect on Reproductive Physiology of Biomphalaria glabrata.

    Directory of Open Access Journals (Sweden)

    Satwant Kaur

    Full Text Available Gastropod mollusks have been proposed as alternative models for male reproductive toxicity testing, due to similarities in their reproductive anatomy compared to mammals, together with evidence that endocrine disrupting chemicals can cause effects in some mollusks analogous to those seen in mammals. To test this hypothesis, we used the freshwater pulmonate snail, Biomphalaria glabrata, for which various genetic tools and a draft genome have recently become available, to investigate the effects of two steroid androgens on the development of mollusk secondary sexual organs. Here we present the results of exposures to two potent androgens, the vertebrate steroid; 5α-dihydrotestosterone (DHT and the pharmaceutical anabolic steroid; 17α-methyltestosterone (MT, under continuous flow-through conditions throughout embryonic development and up to sexual maturity. Secondary sexual gland morphology, histopathology and differential gene expression analysis were used to determine whether steroid androgens stimulated or inhibited organ development. No significant differences between tissues from control and exposed snails were identified, suggesting that these androgens elicited no biologically detectable response normally associated with exposure to androgens in vertebrate model systems. Identifying no effect of androgens in this mollusk is significant, not only in the context of the suitability of mollusks as alternative model organisms for testing vertebrate androgen receptor agonists but also, if applicable to other similar mollusks, in terms of the likely impacts of androgens and anti-androgenic pollutants present in the aquatic environment.

  9. Steroid Androgen Exposure during Development Has No Effect on Reproductive Physiology of Biomphalaria glabrata

    Science.gov (United States)

    Lockyer, Anne E.; Routledge, Edwin J.; Jones, Catherine S.; Noble, Leslie R.; Jobling, Susan

    2016-01-01

    Gastropod mollusks have been proposed as alternative models for male reproductive toxicity testing, due to similarities in their reproductive anatomy compared to mammals, together with evidence that endocrine disrupting chemicals can cause effects in some mollusks analogous to those seen in mammals. To test this hypothesis, we used the freshwater pulmonate snail, Biomphalaria glabrata, for which various genetic tools and a draft genome have recently become available, to investigate the effects of two steroid androgens on the development of mollusk secondary sexual organs. Here we present the results of exposures to two potent androgens, the vertebrate steroid; 5α-dihydrotestosterone (DHT) and the pharmaceutical anabolic steroid; 17α-methyltestosterone (MT), under continuous flow-through conditions throughout embryonic development and up to sexual maturity. Secondary sexual gland morphology, histopathology and differential gene expression analysis were used to determine whether steroid androgens stimulated or inhibited organ development. No significant differences between tissues from control and exposed snails were identified, suggesting that these androgens elicited no biologically detectable response normally associated with exposure to androgens in vertebrate model systems. Identifying no effect of androgens in this mollusk is significant, not only in the context of the suitability of mollusks as alternative model organisms for testing vertebrate androgen receptor agonists but also, if applicable to other similar mollusks, in terms of the likely impacts of androgens and anti-androgenic pollutants present in the aquatic environment. PMID:27448327

  10. Targeting of Androgen Receptor Expression by Andro-miRs as Novel Adjunctive Therapeutics in Prostate Cancer.

    Science.gov (United States)

    Ebron, Jey Sabith; Weyman, Crystal M; Shukla, Girish C

    2013-04-01

    Prostate cancer begins as an androgen-responsive disease. However, subsequent accumulation of multiple sequential genetic and epigenetic alterations transforms the disease into an aggressive, castration-resistant prostate cancer (CRPC). The monoallelic Androgen Receptor (AR) is associated with the onset, growth and development of Prostate cancer. The AR is a ligand-dependent transcription factor, and the targeting of androgen- and AR-signaling axis remains the primary therapeutic option for Prostate cancer (PCa) treatment. A durable and functional disruption of AR signaling pathways combining both traditional and novel therapeutics is likely to provide better treatment options for CRPC. Recent work has indicated that expression of AR is modulated at the posttranscriptional level by regulatory miRNAs. Due to a relatively long 3' untranslated region (UTR) of AR mRNA, the posttranscription expression is likely to be regulated by hundreds of miRNAs in normal as well as in disease state. The main objective of the article is to offer a thought-provoking concept of "andro-miRs" and their potential application in AR gene expression targeting. This new paradigm for targeting constitutively active AR and its tumor specific splicing isoforms using andro-miRs may pave the way for a novel adjunctive therapy and improved treatment of CRPC.

  11. Differential regulation of horizontally acquired and core genome genes by the bacterial modulator H-NS.

    Directory of Open Access Journals (Sweden)

    Rosa C Baños

    2009-06-01

    Full Text Available Horizontal acquisition of DNA by bacteria dramatically increases genetic diversity and hence successful bacterial colonization of several niches, including the human host. A relevant issue is how this newly acquired DNA interacts and integrates in the regulatory networks of the bacterial cell. The global modulator H-NS targets both core genome and HGT genes and silences gene expression in response to external stimuli such as osmolarity and temperature. Here we provide evidence that H-NS discriminates and differentially modulates core and HGT DNA. As an example of this, plasmid R27-encoded H-NS protein has evolved to selectively silence HGT genes and does not interfere with core genome regulation. In turn, differential regulation of both gene lineages by resident chromosomal H-NS requires a helper protein: the Hha protein. Tight silencing of HGT DNA is accomplished by H-NS-Hha complexes. In contrast, core genes are modulated by H-NS homoligomers. Remarkably, the presence of Hha-like proteins is restricted to the Enterobacteriaceae. In addition, conjugative plasmids encoding H-NS variants have hitherto been isolated only from members of the family. Thus, the H-NS system in enteric bacteria presents unique evolutionary features. The capacity to selectively discriminate between core and HGT DNA may help to maintain horizontally transmitted DNA in silent form and may give these bacteria a competitive advantage in adapting to new environments, including host colonization.

  12. ANDROGEN LEVELS IN PREECLAMPSIA

    Directory of Open Access Journals (Sweden)

    M. Valadan

    2006-08-01

    Full Text Available Preeclampsia is a major cause of morbidity and mortality during pregnancy. Several independent investigators have demonstrated the association of androgens with hypertension. The main purpose of this study was to determine whether maternal levels of sex hormones, especially testosterone, are higher in patients with preeclampsia than in matched normotensive control subjects. Serum levels of testosterone, free testosterone, dehydroepiandrosterone sulfate (DHEA-S and estradiol were measured in 60 subjects in the 3rd trimester of pregnancy with documented preeclampsia (including 30 cases of mild and 30 cases of severe preeclampsia and 60 healthy normotensive women with similar maternal and gestational ages and body mass index (BMI and neonatal sex. All subjects were primigravid with singleton pregnancies. Cases of polycystic ovary (PCO, diabetes, chronic hypertension and chronic systemic diseases such as lupus and patients using steroid hormones and anti-hypertensive drugs were excluded. Levels of testosterone, DHEA-S and estradiol were not higher in primigravid women with preeclampsia than in normotensive women with similar gestational and maternal ages, BMI and neonatal sex. There were no significant differences in sex hormones measured between groups of mild and severe preeclampsia and normotensive women. There were also no significant differences in sex hormone levels according to neonatal sex. These findings are against the hypothesis of mediating or amplifying role of high androgen levels in pathophysiology of preeclampsia.

  13. Identification of Antithrombin-Modulating Genes. Role of LARGE, a Gene Encoding a Bifunctional Glycosyltransferase, in the Secretion of Proteins?

    Science.gov (United States)

    de la Morena-Barrio, María Eugenia; Buil, Alfonso; Antón, Ana Isabel; Martínez-Martínez, Irene; Miñano, Antonia; Gutiérrez-Gallego, Ricardo; Navarro-Fernández, José; Aguila, Sonia; Souto, Juan Carlos; Vicente, Vicente; Soria, José Manuel; Corral, Javier

    2013-01-01

    The haemostatic relevance of antithrombin together with the low genetic variability of SERPINC1, and the high heritability of plasma levels encourage the search for modulating genes. We used a hypothesis-free approach to identify these genes, evaluating associations between plasma antithrombin and 307,984 polymorphisms in the GAIT study (352 individuals from 21 Spanish families). Despite no SNP reaching the genome wide significance threshold, we verified milder positive associations in 307 blood donors from a different cohort. This validation study suggested LARGE, a gene encoding a protein with xylosyltransferase and glucuronyltransferase activities that forms heparin-like linear polysaccharides, as a potential modulator of antithrombin based on the significant association of one SNPs, rs762057, with anti-FXa activity, particularly after adjustment for age, sex and SERPINC1 rs2227589 genotype, all factors influencing antithrombin levels (p = 0.02). Additional results sustained this association. LARGE silencing inHepG2 and HEK-EBNA cells did not affect SERPINC1 mRNA levels but significantly reduced the secretion of antithrombin with moderate intracellular retention. Milder effects were observed on α1-antitrypsin, prothrombin and transferrin. Our study suggests LARGE as the first known modifier of plasma antithrombin, and proposes a new role for LARGE in modulating extracellular secretion of certain glycoproteins. PMID:23705025

  14. Identification of antithrombin-modulating genes. Role of LARGE, a gene encoding a bifunctional glycosyltransferase, in the secretion of proteins?

    Directory of Open Access Journals (Sweden)

    María Eugenia de la Morena-Barrio

    Full Text Available The haemostatic relevance of antithrombin together with the low genetic variability of SERPINC1, and the high heritability of plasma levels encourage the search for modulating genes. We used a hypothesis-free approach to identify these genes, evaluating associations between plasma antithrombin and 307,984 polymorphisms in the GAIT study (352 individuals from 21 Spanish families. Despite no SNP reaching the genome wide significance threshold, we verified milder positive associations in 307 blood donors from a different cohort. This validation study suggested LARGE, a gene encoding a protein with xylosyltransferase and glucuronyltransferase activities that forms heparin-like linear polysaccharides, as a potential modulator of antithrombin based on the significant association of one SNPs, rs762057, with anti-FXa activity, particularly after adjustment for age, sex and SERPINC1 rs2227589 genotype, all factors influencing antithrombin levels (p = 0.02. Additional results sustained this association. LARGE silencing inHepG2 and HEK-EBNA cells did not affect SERPINC1 mRNA levels but significantly reduced the secretion of antithrombin with moderate intracellular retention. Milder effects were observed on α1-antitrypsin, prothrombin and transferrin. Our study suggests LARGE as the first known modifier of plasma antithrombin, and proposes a new role for LARGE in modulating extracellular secretion of certain glycoproteins.

  15. Gene modulation associated with inhibition of liver regeneration in hepatitis B virus X transgenic mice

    Institute of Scientific and Technical Information of China (English)

    Malgorzata Sidorkiewicz; Jean-Philippe Jais; Guilherme Tralhao; Serban Morosan; Carlo Giannini; Nicolas Brezillon; Patrick Soussan; Oona Delpuech; Dina Kremsdorf

    2008-01-01

    AIM: To analyze the modulation of gene expression profile associated with inhibition of liver regeneration in hepatitis B X (HBx)-expressing transgenic mice.METHODS: Microarray technology was performed on liver tissue obtained from 4 control (LacZ) and 4 transgenic mice (HBx-LacZ), 48 h after partial hepatectomy. The significance of the normalized log-ratios was assessed for each gene, using robust Mests under an empirical Bayes approach. Microarray hybridization data was verified on selected genes by quantitative PCR.RESULTS: The comparison of gene expression patterns showed a consistent modulation of the expression of 26 genes, most of which are implicated in liver regeneration. Up-regulated genes included DNA repair proteins (Rad-52, MSH6) and transmembrane proteins (syndecan 4, tetraspanin), while down-regulated genes were connected to the regulation of transcription (histone deacetylase, Zfp90, MyoDl) and were involved in the cholesterol metabolic pathway and isoprenoidbiosynthesis (farnesyl diphosphate synthase, Cyp7b1, geranylgeranyl diphosphate synthase, SAA3).CONCLUSION: Our results provide a novel insight into the biological activities of HBx, implicated in the inhibition of liver regeneration.

  16. Modules Identification in Gene Positive Networks of Hepatocellular Carcinoma Using Pearson Agglomerative Method and Pearson Cohesion Coupling Modularity

    OpenAIRE

    Hu, Jinyu; Gao, Zhiwei

    2012-01-01

    In this study, a gene positive network is proposed based on a weighted undirected graph, where the weight represents the positive correlation of the genes. A Pearson agglomerative clustering algorithm is employed to build a clustering tree, where dotted lines cut the tree from bottom to top leading to a number of subsets of the modules. In order to achieve better module partitions, the Pearson correlation coefficient modularity is addressed to seek optimal module decomposition by selecting an...

  17. Androgen and prostatic stroma

    Institute of Scientific and Technical Information of China (English)

    Yuan-JieNIU; Teng-XiangMA; IuZHANG; YongXU; Rui-FaHAN; GuangSUN

    2003-01-01

    Aim:To investigate the effect of androgen on the proliferation,differentiation and regression of canine prostatic stromal cells in vivo and human stromal cells in vitro.Methods:Twenty-two dogs,including 15 normal prostate doge and 7 prostatic hyperplasia dogs,had their serum concentration of testosterone and estrodiol determined by radioimmunoassay before and after castration.The expression of androgen receptor(AR)and estrogen receptor(ER)in the prostate were analysed by immunohistochemistry and semi-quantitative RT-PCR before and after castration.Light microscopy,transmission electron microscopy and TUNEL assay were carried out successively before and after castration to evaluate the prostatic histomorphology.In vitro serum-free cell cultures from human prostatic stroma were established and exposed to dihydrotestosterone(DHT).The proliferation of the cell culture was detected by MTT assay.The expression of TGFβ bFGF,AR,and smooth muscle cell(SMC) specific proteins (myosin and/or smoothelin)were detected using immunohistochemistry and RT-PCR.The differentiation from fibroblasts to smooth muscle cells was deduced by measuring the expression of SMC specific proteins.Results:Before castration,the serum concentrations of testosterone and estrodiol were not statistically different between normal and hyperplasia groups.Following castration,the serum concentration of testerone decreased rapidly in 2 days,and the concentration of estrodiol had no significant change compared with the pre-castration data.In the prostate,AR was presented in both the epithelial and stromal cells and the AR mRNA level was higher in hyperplasia than in normal prostate tissues(P<0.05).While ER predominantly existed in the prostate stromal cells and the ER mRNA had no difference between the hyperplasia and the normal group.Within the early phase of castration(

  18. Modulation of Aanat gene transcription in the rat pineal gland.

    Science.gov (United States)

    Ho, Anthony K; Chik, Constance L

    2010-01-01

    The main function of the rat pineal gland is to transform the circadian rhythm generated in the suprachiasmatic nucleus into a rhythmic signal of circulating melatonin characterized by a large nocturnal increase that closely reflects the duration of night period. This is achieved through the tight coupling between environmental lighting and the expression of arylalkylamine-N-acetyltransferase, the rhythm-controlling enzyme in melatonin synthesis. The initiation of Aanat transcription at night is controlled largely by the norepinephrine-stimulated phosphorylation of cAMP response element-binding protein by protein kinase A. However, to accurately reflect the duration of darkness, additional signaling mechanisms also participate to fine-tune the temporal profile of adrenergic-induced Aanat transcription. Here, we reviewed some of these signaling mechanisms, with emphasis on the more recent findings. These signaling mechanisms can be divided into two groups: those involving modification of constitutively expressed proteins and those requiring synthesis of new proteins. This review highlights the pineal gland as an excellent model system for studying neurotransmitter-regulated rhythmic gene expression.

  19. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang

    2004-04-01

    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  20. Symbiosis-related pea genes modulate fungal and plant gene expression during the arbuscule stage of mycorrhiza with Glomus intraradices.

    Science.gov (United States)

    Kuznetsova, Elena; Seddas-Dozolme, Pascale M A; Arnould, Christine; Tollot, Marie; van Tuinen, Diederik; Borisov, Alexey; Gianinazzi, Silvio; Gianinazzi-Pearson, Vivienne

    2010-08-01

    The arbuscular mycorrhiza association results from a successful interaction between genomes of the plant and fungal symbiotic partners. In this study, we analyzed the effect of inactivation of late-stage symbiosis-related pea genes on symbiosis-associated fungal and plant molecular responses in order to gain insight into their role in the functional mycorrhizal association. The expression of a subset of ten fungal and eight plant genes, previously reported to be activated during mycorrhiza development, was compared in Glomus intraradices-inoculated wild-type and isogenic genotypes of pea mutated for the PsSym36, PsSym33, and PsSym40 genes where arbuscule formation is inhibited or fungal turnover modulated, respectively. Microdissection was used to corroborate arbuscule-related fungal gene expression. Molecular responses varied between pea genotypes and with fungal development. Most of the fungal genes were downregulated when arbuscule formation was defective, and several were upregulated with more rapid fungal development. Some of the plant genes were also affected by inactivation of the PsSym36, PsSym33, and PsSym40 loci, but in a more time-dependent way during root colonization by G. intraradices. Results indicate a role of the late-stage symbiosis-related pea genes not only in mycorrhiza development but also in the symbiotic functioning of arbuscule-containing cells.

  1. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.

    Science.gov (United States)

    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S

    2005-10-03

    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  2. MODULATION OF MDR-1 GENE IN HUMAN BREAST CANCER CELLS BY SODIUM BUTYRATE AND DMSO

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective: To analyze the regulation effect of MDR-1 gene inhuman breast cancer cell by the differentiating agents, sodium butyrate and dimethyl sulfoxide. Methods: 1. A sensitive assay, RT-PCR, was used to measure the mRNA level before and after the treatment of sodium butyrate, DMSO, using b -actin as control; 2. Evaluated the effect of sodium butyrate, DMSO on MDR-1 gene expression of human breast cancer at the protein level by immunoflow cytometry; 3. P-glycoprotein function was examined after accumulation of the fluorescent drug, Phodamine-123, by flow cytometry; 4. Chemosensitivity to doxorubicin was analyzed using the MTT assay. Results: Sodium butyrate and DMSO were found to increase the MDR characteristics on MDR-1 gene, MDR-1 expression levels, P-glycoprotein function and chemosensitivity to doxorubicin. Conclusion: sodium butyrate, DMSO can modulate the MDR-1 gene at gene level, protein level, protein function level and cell level.

  3. Cytogenetic and molecular analysis of the Y chromosome: absence of a significant relationship between CAG repeat length in exon 1 of the androgen receptor gene and infertility in Indian men.

    Science.gov (United States)

    Dhillon, Varinderpal S; Husain, Syed A

    2003-10-01

    The genetic basis of male infertility remains unclear in the majority of cases. Recent studies have indicated an association between microdeletions of the azoospermia factor a (AZFa)-AZFc regions of Yq and severe oligospermia or azoospermia. Increased (CAG)n repeat lengths in the androgen receptor (AR) gene have also been reported in infertile men. Therefore, in order to assess the prevalence of these genetic defects to male infertility, 183 men with non-obstructive azoospermia (n = 70), obstructive azoospermia (n = 33), severe oligospermia (n = 80) and 59 fertile men were examined cytogenetically and at molecular level for Yq deletions, microdeletions, and AR-CAG repeat lengths along with hormonal profiles [luteinizing hormone (LH), follicle-stimulating hormone (FSH) and testosterone (T)]. We used high resolution cytogenetics to detect chromosome deletions and multiplex polymerase chain reaction (PCR) involving 27 sequence-tagged site (STS) markers on Yq to determine the rate and extent of Yq microdeletions. PCR amplification with primers flanking exon 1 of AR gene was used to determine the AR-(CAG)n repeat lengths. Hormonal profiles (LH, FSH and T levels) were also analysed in infertile and fertile men. Testicular biopsies showed Sertoli cell only (SCO) morphology, maturation arrests (MA) and hypospermatogenesis. No chromosome aberrations were found in infertile men but there was a significant increase (p CAG repeats in AR gene was observed between infertile and fertile men (22.2 +/- 1.5 and 21.5 +/- 1.4 respectively). No significant increase or decrease in levels of LH, FSH and T was observed in infertile and fertile men. In some infertile men, significantly elevated levels of FSH alone or in combination with LH were found to be indicative of failure of spermatogenesis and/or suggestive of testicular failure. Y-chromosome microdeletions contribute to infertility in some patients but no relationship could be established with the (CAG)n repeat lengths in exon 1 of

  4. Environmental polycyclic aromatic hydrocarbons affect androgen receptor activation in vitro

    DEFF Research Database (Denmark)

    Vinggaard, Anne Marie; Hnida, Christina; Larsen, John Christian

    2000-01-01

    Nine structurally different polycyclic aromatic hydrocarbons (PAHs) were tested for their ability to either agonize or antagonize the human androgen receptor (hAR) in a sensitive reporter gene assay based on CHO cells transiently cotransfected with a hAR vector and an MMTV-LUC vector. Benz...

  5. Androgenic Regulation of White Adipose Tissue-Prostate Cancer Interactions

    Science.gov (United States)

    2015-08-01

    oncogenes; inactivation of tumor suppression genes; and interaction between cancer cells and tumor-associated stroma and tumor- associated macrophages ...into inflamed tissue and dif- ferentiate into macrophages , which coordinate inflammatory re- sponses by producing chemokines and clearing debris by...AWARD NUMBER: W81XWH-10-1-0275 TITLE: Androgenic Regulation of White Adipose Tissue-Prostate Cancer Interactions PRINCIPAL INVESTIGATOR

  6. The Detection of Metabolite-Mediated Gene Module Co-Expression Using Multivariate Linear Models.

    Directory of Open Access Journals (Sweden)

    Trishanta Padayachee

    Full Text Available Investigating whether metabolites regulate the co-expression of a predefined gene module is one of the relevant questions posed in the integrative analysis of metabolomic and transcriptomic data. This article concerns the integrative analysis of the two high-dimensional datasets by means of multivariate models and statistical tests for the dependence between metabolites and the co-expression of a gene module. The general linear model (GLM for correlated data that we propose models the dependence between adjusted gene expression values through a block-diagonal variance-covariance structure formed by metabolic-subset specific general variance-covariance blocks. Performance of statistical tests for the inference of conditional co-expression are evaluated through a simulation study. The proposed methodology is applied to the gene expression data of the previously characterized lipid-leukocyte module. Our results show that the GLM approach improves on a previous approach by being less prone to the detection of spurious conditional co-expression.

  7. Development of an endogenous androgen receptor-mediated luciferase expression assay (AR-LUX) for interactive androgenic action

    NARCIS (Netherlands)

    Blankvoort, B.M.G.

    2003-01-01

    The research described in this thesis was aimed at developing an in vitro cell-based reporter gene system applicable to the detection of the illegal use of androgenic growth promoters in cattle, and the presence of potential endocrine disrupters present in surface waters and interfering with androge

  8. Two cases of androgen insensitivity due to somatic mosaicism

    Directory of Open Access Journals (Sweden)

    Natalie J. Nokoff

    2015-03-01

    Full Text Available Androgen insensitivity syndrome (AIS is caused by mutations in the gene encoding the androgen receptor (AR. The incidence of AIS is estimated to be 1 in 99,000. Complete androgen insensitivity syndrome (CAIS is characterized by a 46,XY karyotype with external genitalia that appear typically female and results from mutations that render the androgen receptor non-functional. Partial androgen insensitivity syndrome (PAIS results from partial loss of function mutations in AR. Rarely, PAIS results from somatic mosaicism for an AR mutation and not from a hypomorphic variant. We present two cases of PAIS due to somatic mosaicism, one caused by a novel nonsense mutation and one caused by a missense mutation previously reported in CAIS. Two patients with atypical genitalia presented to our multidisciplinary clinic for disorders of sex development and sequencing of AR was performed as part of the diagnostic evaluation. In case one, AR sequencing revealed mosaicism for a nonsense mutation, c.1331T > A; p.Leu444Ter. This mutation has not previously been reported, but is presumed to be pathogenic. In case two, AR sequencing revealed a mosaic missense mutation, c.2279 C > A; p.Ser760Tyr, which has previously been reported in CAIS but not in PAIS. Similar phenotypes may result from AR mutations that are present in a mosaic state with full loss of function or hypomorphic mutations that partially impair the function of the protein in either all tissues or in a mosaic state.

  9. Prevalent flucocorticoid and androgen activity in US water sources

    Science.gov (United States)

    Stavreva, Diana A.; George, Anuja A.; Klausmeyer, Paul; Varticovski, Lyuba; Sack, Daniel; Voss, Ty C.; Schiltz, R. Louis; Blazer, Vicki; Iwanowiczl, Luke R.; Hager, Gordon L.

    2012-01-01

    Contamination of the environment with endocrine disrupting chemicals (EDCs) is a major health concern. The presence of estrogenic compounds in water and their deleterious effect are well documented. However, detection and monitoring of other classes of EDCs is limited. Here we utilize a high-throughput live cell assay based on sub-cellular relocalization of GFP-tagged glucocorticoid and androgen receptors (GFP-GR and GFP-AR), in combination with gene transcription analysis, to screen for glucocorticoid and androgen activity in water samples. We report previously unrecognized glucocorticoid activity in 27%, and androgen activity in 35% of tested water sources from 14 states in the US. Steroids of both classes impact body development, metabolism, and interfere with reproductive, endocrine, and immune systems. This prevalent contamination could negatively affect wildlife and human populations.

  10. Ekspresi Gen CYP19 Aromatase, Estrogen, Androgen pada penderita Periodontitis Agresif

    Directory of Open Access Journals (Sweden)

    Dahlia Herawati

    2016-11-01

    Full Text Available Kepadatan tulang tubuh ditentukan oleh gen CYP19 aromatase, hormon estrogen dan androgen. Pada periodontitis agresif terjadi perkembangan cepat kerusakan tulang alveolar, dan kerusakan tulang alveoler tersebut tidak diimbangioleh regenerasi tulang. Tujuan penelitian ini adalah menunjukkan ekspresi gen CYP19 aromatase, estrogen, androgen pada penderita periodontitis agresif agar dapat untuk menjadi pertimbangan pada saat melakukan perawatan periodontal. Metode penelitian, pemeriksaan ekspresi gen aromatse CYP19 berasal dari spesimen tulang alveolar menggunakan imunohistokimia, pengukuran hormon estrogen dan androgen dari serum menggunakan Vidas: Elfa. Hasil penelitian ekspresi gene CYP19 aromatase pada periodontitis agresif menunjukkan gambaran lebih rendah densitasnya dibandingkan pada nonperiodontitis. Estrogen dan androgen pad aperiodontitis agresif ada kecenderungan lebih rendah dibandingkan pada nonperiodontitis. Kesimpulan regenerasi tulang alveoler pad a periodontitis agresif terhambat karena sedikitnya gen CYP19 aromatase dan hormon estrogen dan androgen yang berperan pada pembentukan tulang alveoler kurang memadai.

  11. Physical exercise as an epigenetic modulator: Eustress, the "positive stress" as an effector of gene expression.

    Science.gov (United States)

    Sanchis-Gomar, Fabian; Garcia-Gimenez, Jose Luis; Perez-Quilis, Carme; Gomez-Cabrera, Mari Carmen; Pallardo, Federico V; Lippi, Giuseppe

    2012-12-01

    Physical exercise positively influences epigenetic mechanisms and improves health. Several issues remain unclear concerning the links between physical exercise and epigenetics. There is growing concern about the negative influence of excessive and persistent physical exercise on health. How an individual physically adapts to the prevailing environmental conditions might influence epigenetic mechanisms and modulate gene expression. In this article, we put forward the idea that physical exercise, especially long-term repetitive strenuous exercise, positively affects health, reduces the aging process, and decreases the incidence of cancer through induced stress and epigenetic mechanisms. We propose herein that stress may stimulate genetic adaptations through epigenetics that, in turn, modulate the link between the environment, human lifestyle factors, and genes.

  12. Insulin signaling genes modulate nicotine-induced behavioral responses in Caenorhabditis elegans.

    Science.gov (United States)

    Wescott, Seth A; Ronan, Elizabeth A; Xu, X Z Shawn

    2016-02-01

    Insulin signaling has been suggested to modulate nicotine dependence, but the underlying genetic evidence has been lacking. Here, we used the nematode, Caenorhabditis elegans, to investigate whether genetic alterations in the insulin signaling pathway affect behavioral responses to nicotine. For this, we challenged drug-naive C. elegans with an acute dose of nicotine (100 μmol/l) while recording changes in their locomotion speed. Although nicotine treatment stimulated locomotion speed in wild-type C. elegans, the same treatment reduced locomotion speed in mutants defective in insulin signaling. This phenotype could be suppressed by mutations in daf-16, a gene encoding a FOXO transcription factor that acts downstream of insulin signaling. Our data suggest that insulin signaling genes, daf-2, age-1, pdk-1, akt-1, and akt-2, modulate behavioral responses to nicotine in C. elegans, indicating a genetic link between nicotine behavior and insulin signaling.

  13. Microarray analysis identifies a common set of cellular genes modulated by different HCV replicon clones

    Directory of Open Access Journals (Sweden)

    Gerosolimo Germano

    2008-06-01

    Full Text Available Abstract Background Hepatitis C virus (HCV RNA synthesis and protein expression affect cell homeostasis by modulation of gene expression. The impact of HCV replication on global cell transcription has not been fully evaluated. Thus, we analysed the expression profiles of different clones of human hepatoma-derived Huh-7 cells carrying a self-replicating HCV RNA which express all viral proteins (HCV replicon system. Results First, we compared the expression profile of HCV replicon clone 21-5 with both the Huh-7 parental cells and the 21-5 cured (21-5c cells. In these latter, the HCV RNA has been eliminated by IFN-α treatment. To confirm data, we also analyzed microarray results from both the 21-5 and two other HCV replicon clones, 22-6 and 21-7, compared to the Huh-7 cells. The study was carried out by using the Applied Biosystems (AB Human Genome Survey Microarray v1.0 which provides 31,700 probes that correspond to 27,868 human genes. Microarray analysis revealed a specific transcriptional program induced by HCV in replicon cells respect to both IFN-α-cured and Huh-7 cells. From the original datasets of differentially expressed genes, we selected by Venn diagrams a final list of 38 genes modulated by HCV in all clones. Most of the 38 genes have never been described before and showed high fold-change associated with significant p-value, strongly supporting data reliability. Classification of the 38 genes by Panther System identified functional categories that were significantly enriched in this gene set, such as histones and ribosomal proteins as well as extracellular matrix and intracellular protein traffic. The dataset also included new genes involved in lipid metabolism, extracellular matrix and cytoskeletal network, which may be critical for HCV replication and pathogenesis. Conclusion Our data provide a comprehensive analysis of alterations in gene expression induced by HCV replication and reveal modulation of new genes potentially useful

  14. In silico and biological analysis of anti-androgen activity of the brominated flame retardants ATE, BATE and DPTE in zebrafish.

    Science.gov (United States)

    Pradhan, Ajay; Asnake, Solomon; Kharlyngdoh, Joubert Banjop; Modig, Carina; Olsson, Per-Erik

    2015-05-25

    The brominated flame retardants (BFRs) 1,2-dibromo-4-(1,2-dibromoethyl)cyclohexane (TBECH or DBE-DCBH) and allyl 2,4,6-tribromophenyl ether (ATE or TBP-AE) are alternative BFRs that have been introduced to replace banned BFRs. TBECH is a potential endocrine disrupter in human, chicken and zebrafish and in a recent study we showed that ATE, along with the structurally similar BFR 2,3-dibromopropyl 2,4,6-tribromophenyl ether (DPTE or TBP-DBPE) and its metabolite 2-bromoallyl 2,4,6-tribromophenyl ether (BATE or TBP-BAE) are potential endocrine and neuronal disrupters in human. In this study we analyzed ATE, BATE and DPTE for zebrafish androgen receptor (zAR) modulating properties. In silico analysis with two softwares, Molecular Operating Environment (MOE) and Internal Coordinate Mechanics (ICM), showed that ATE, BATE and DPTE bind to zAR. In vitro AR activation assay revealed that these three BFRs down-regulate 11-ketotestosterone (KT) mediated zAR activation. Exposure to 10 μM DPTE resulted in reduced hatching success and like TBECH, BATE and DPTE at 10 μM also had teratogenic properties with 20% and 50% back-bone curvature respectively. Gene transcription analysis in zebrafish embryos as well as in juveniles showed down-regulation of the androgen receptor and androgen response genes, which further support that these BFRs are androgen antagonists and potential endocrine disrupting compounds. Genes involved in steroidogenesis were also down-regulated by these BFRs. In view of this, the impact of these BFRs on humans and wildlife needs further analysis.

  15. BTG2 is an LXXLL-dependent co-repressor for androgen receptor transcriptional activity

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Xu-Dong [School of Radiation Medicine and Public Health, Medical College of Soochow University, Suzhou 215123 (China); Meng, Qing-Hui [Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057 (United States); Xu, Jia-Ying; Jiao, Yang [School of Radiation Medicine and Public Health, Medical College of Soochow University, Suzhou 215123 (China); Ge, Chun-Min [Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057 (United States); Jacob, Asha; Wang, Ping [North Shore University Hospital-Long Island Jewish Medical Center and The Feinstein Institute for Medical Research, Manhasset, NY 11030 (United States); Rosen, Eliot M [Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057 (United States); Fan, Saijun, E-mail: sjfan@suda.edu.cn [School of Radiation Medicine and Public Health, Medical College of Soochow University, Suzhou 215123 (China)

    2011-01-28

    Research highlights: {yields} BTG2 associates with AR, androgen causes an increase of the interaction. {yields} BTG2 as a co-repressor inhibits the AR-mediated transcription activity. {yields} BTG2 inhibits the transcription activity and expression of PSA. {yields} An intact {sup 92}LxxLL{sup 96} motif is essential and necessary for these activities of BTG2, while the {sup 20}LxxLL{sup 24} motif is not required. {yields} Ectopic expression of BTG2 reduces proliferation of prostate cancer cells. -- Abstract: The tumor suppressor gene, BTG2 has been down-regulated in prostate cancer and the ectopic expression of this gene has been shown to inhibit prostate cancer cell growth. Sequence analysis revealed that the BTG2 protein contains two leucine-rich motifs ({sup 20}LxxLL{sup 24} and {sup 92}LxxLL{sup 96}), which are usually found in nuclear receptor co-factors. Based on this, we postulated that there will be an association between BTG2 and AR. In this study, we discovered that BTG2 directly bound to the androgen receptor (AR) in the absence of 5{alpha}-dihydrotestosterone (DHT), and in the presence of the androgen, this interaction was increased. BTG2 bearing the mutant {sup 20}LxxLL{sup 24} motif bound to AR equally efficient as the wild-type BTG2, while BTG2 bearing the mutant {sup 92}LxxLL{sup 96} motif failed to interact with AR. Functional studies indicated that ectopic expression of BTG2 caused a significant inhibition of AR-mediated transcriptional activity and a decreased growth of prostate cancer cells. Androgen-induced promoter activation and expression of prostate-specific antigen (PSA) are significantly attenuated by BTG2. The intact {sup 92}LxxLL{sup 96} motif is required for these activities. These findings, for the first time, demonstrate that BTG2 complexes with AR via an LxxLL-dependent mechanism and may play a role in prostate cancer via modulating the AR signaling pathway.

  16. Microarray analysis identifies a common set of cellular genes modulated by different HCV replicon clones

    OpenAIRE

    Gerosolimo Germano; Dallapiccola Bruno; Bruni Roberto; Ferraris Alessandro; Tataseo Paola; Tritarelli Elena; Marcantonio Cinzia; Ciccaglione Anna; Costantino Angela; Rapicetta Maria

    2008-01-01

    Abstract Background Hepatitis C virus (HCV) RNA synthesis and protein expression affect cell homeostasis by modulation of gene expression. The impact of HCV replication on global cell transcription has not been fully evaluated. Thus, we analysed the expression profiles of different clones of human hepatoma-derived Huh-7 cells carrying a self-replicating HCV RNA which express all viral proteins (HCV replicon system). Results First, we compared the expression profile of HCV replicon clone 21-5 ...

  17. Androgen suppresses the proliferation of androgen receptor-positive castration-resistant prostate cancer cells via inhibition of Cdk2, CyclinA, and Skp2.

    Directory of Open Access Journals (Sweden)

    John M Kokontis

    Full Text Available The majority of prostate cancer (PCa patient receiving androgen ablation therapy eventually develop castration-resistant prostate cancer (CRPC. We previously reported that androgen treatment suppresses Skp2 and c-Myc through androgen receptor (AR and induced G1 cell cycle arrest in androgen-independent LNCaP 104-R2 cells, a late stage CRPC cell line model. However, the mechanism of androgenic regulation of Skp2 in CRPC cells was not fully understood. In this study, we investigated the androgenic regulation of Skp2 in two AR-positive CRPC cell line models, the LNCaP 104-R1 and PC-3AR Cells. The former one is an early stage androgen-independent LNCaP cells, while the later one is PC-3 cells re-expressing either wild type AR or mutant LNCaP AR. Proliferation of LNCaP 104-R1 and PC-3AR cells is not dependent on but is suppressed by androgen. We observed in this study that androgen treatment reduced protein expression of Cdk2, Cdk7, Cyclin A, cyclin H, Skp2, c-Myc, and E2F-1; lessened phosphorylation of Thr14, Tyr15, and Thr160 on Cdk2; decreased activity of Cdk2; induced protein level of p27(Kip1; and caused G1 cell cycle arrest in LNCaP 104-R1 cells and PC-3AR cells. Overexpression of Skp2 protein in LNCaP 104-R1 or PC-3AR cells partially blocked accumulation of p27(Kip1 and increased Cdk2 activity under androgen treatment, which partially blocked the androgenic suppressive effects on proliferation and cell cycle. Analyzing on-line gene array data of 214 normal and PCa samples indicated that gene expression of Skp2, Cdk2, and cyclin A positively correlates to each other, while Cdk7 negatively correlates to these genes. These observations suggested that androgen suppresses the proliferation of CRPC cells partially through inhibition of Cyclin A, Cdk2, and Skp2.

  18. Androgen suppresses the proliferation of androgen receptor-positive castration-resistant prostate cancer cells via inhibition of Cdk2, CyclinA, and Skp2.

    Science.gov (United States)

    Kokontis, John M; Lin, Hui-Ping; Jiang, Shih Sheng; Lin, Ching-Yu; Fukuchi, Junichi; Hiipakka, Richard A; Chung, Chi-Jung; Chan, Tzu-Min; Liao, Shutsung; Chang, Chung-Ho; Chuu, Chih-Pin

    2014-01-01

    The majority of prostate cancer (PCa) patient receiving androgen ablation therapy eventually develop castration-resistant prostate cancer (CRPC). We previously reported that androgen treatment suppresses Skp2 and c-Myc through androgen receptor (AR) and induced G1 cell cycle arrest in androgen-independent LNCaP 104-R2 cells, a late stage CRPC cell line model. However, the mechanism of androgenic regulation of Skp2 in CRPC cells was not fully understood. In this study, we investigated the androgenic regulation of Skp2 in two AR-positive CRPC cell line models, the LNCaP 104-R1 and PC-3AR Cells. The former one is an early stage androgen-independent LNCaP cells, while the later one is PC-3 cells re-expressing either wild type AR or mutant LNCaP AR. Proliferation of LNCaP 104-R1 and PC-3AR cells is not dependent on but is suppressed by androgen. We observed in this study that androgen treatment reduced protein expression of Cdk2, Cdk7, Cyclin A, cyclin H, Skp2, c-Myc, and E2F-1; lessened phosphorylation of Thr14, Tyr15, and Thr160 on Cdk2; decreased activity of Cdk2; induced protein level of p27(Kip1); and caused G1 cell cycle arrest in LNCaP 104-R1 cells and PC-3AR cells. Overexpression of Skp2 protein in LNCaP 104-R1 or PC-3AR cells partially blocked accumulation of p27(Kip1) and increased Cdk2 activity under androgen treatment, which partially blocked the androgenic suppressive effects on proliferation and cell cycle. Analyzing on-line gene array data of 214 normal and PCa samples indicated that gene expression of Skp2, Cdk2, and cyclin A positively correlates to each other, while Cdk7 negatively correlates to these genes. These observations suggested that androgen suppresses the proliferation of CRPC cells partially through inhibition of Cyclin A, Cdk2, and Skp2.

  19. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress.

    Science.gov (United States)

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-08-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes' transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions.

  20. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress.

    Directory of Open Access Journals (Sweden)

    Isidoro Feliciello

    2015-08-01

    Full Text Available Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes' transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions.

  1. Role of androgen receptor in prostate cancer

    Institute of Scientific and Technical Information of China (English)

    HiroyoshiSuzuki; HaruoIto

    1999-01-01

    The growth of prostate cancer is sensitive to androgen, and hormonal therapy has been used for treatment of ad-vanced cancer. About 80 % of prostate cancers initially respond to hormonal therapy, howcrver, more than half of the re-sponders gradtmlly become resistant to this therapy. Changes in tumors from an androgen-responsive to an androgen-unre-sponsive state have been widely discussed. Since androgen action is mediated by androgen receptor (AR), abnonnalitiesof AR is believed to play an important role of the loss of androgen responsiveness in prostate cancer. "Ilais article focusedon the role of AR in the progression of prostate cancer.

  2. Study Design and Rationale for the Phase 3 Clinical Development Program of Enobosarm, a Selective Androgen Receptor Modulator, for the Prevention and Treatment of Muscle Wasting in Cancer Patients (POWER Trials).

    Science.gov (United States)

    Crawford, Jeffrey; Prado, Carla M M; Johnston, Mary Ann; Gralla, Richard J; Taylor, Ryan P; Hancock, Michael L; Dalton, James T

    2016-06-01

    Muscle wasting in cancer is a common and often occult condition that can occur prior to overt signs of weight loss and before a clinical diagnosis of cachexia can be made. Muscle wasting in cancer is an important and independent predictor of progressive functional impairment, decreased quality of life, and increased mortality. Although several therapeutic agents are currently in development for the treatment of muscle wasting or cachexia in cancer, the majority of these agents do not directly inhibit muscle loss. Selective androgen receptor modulators (SARMs) have the potential to increase lean body mass (LBM) and hence muscle mass, without the untoward side effects seen with traditional anabolic agents. Enobosarm, a nonsteroidal SARM, is an agent in clinical development for prevention and treatment of muscle wasting in patients with cancer (POWER 1 and 2 trials). The POWER trials are two identically designed randomized, double-blind, placebo-controlled, multicenter, and multinational phase 3 trials to assess the efficacy of enobosarm for the prevention and treatment of muscle wasting in subjects initiating first-line chemotherapy for non-small-cell lung cancer (NSCLC). To assess enobosarm's effect on both prevention and treatment of muscle wasting, no minimum weight loss is required. These pivotal trials have pioneered the methodological and regulatory fields exploring a therapeutic agent for cancer-associated muscle wasting, a process hereby described. In each POWER trial, subjects will receive placebo (n = 150) or enobosarm 3 mg (n = 150) orally once daily for 147 days. Physical function, assessed as stair climb power (SCP), and LBM, assessed by dual-energy X-ray absorptiometry (DXA), are the co-primary efficacy endpoints in both trials assessed at day 84. Based on extensive feedback from the US Food and Drug Administration (FDA), the co-primary endpoints will be analyzed as a responder analysis. To be considered a physical function responder, a

  3. Growing functional modules from a seed protein via integration of protein interaction and gene expression data

    Directory of Open Access Journals (Sweden)

    Dimitrakopoulou Konstantina

    2007-10-01

    Full Text Available Abstract Background Nowadays modern biology aims at unravelling the strands of complex biological structures such as the protein-protein interaction (PPI networks. A key concept in the organization of PPI networks is the existence of dense subnetworks (functional modules in them. In recent approaches clustering algorithms were applied at these networks and the resulting subnetworks were evaluated by estimating the coverage of well-established protein complexes they contained. However, most of these algorithms elaborate on an unweighted graph structure which in turn fails to elevate those interactions that would contribute to the construction of biologically more valid and coherent functional modules. Results In the current study, we present a method that corroborates the integration of protein interaction and microarray data via the discovery of biologically valid functional modules. Initially the gene expression information is overlaid as weights onto the PPI network and the enriched PPI graph allows us to exploit its topological aspects, while simultaneously highlights enhanced functional association in specific pairs of proteins. Then we present an algorithm that unveils the functional modules of the weighted graph by expanding a kernel protein set, which originates from a given 'seed' protein used as starting-point. Conclusion The integrated data and the concept of our approach provide reliable functional modules. We give proofs based on yeast data that our method manages to give accurate results in terms both of structural coherency, as well as functional consistency.

  4. H-ferritin-regulated microRNAs modulate gene expression in K562 cells.

    Directory of Open Access Journals (Sweden)

    Flavia Biamonte

    Full Text Available In a previous study, we showed that the silencing of the heavy subunit (FHC offerritin, the central iron storage molecule in the cell, is accompanied by a modification in global gene expression. In this work, we explored whether different FHC amounts might modulate miRNA expression levels in K562 cells and studied the impact of miRNAs in gene expression profile modifications. To this aim, we performed a miRNA-mRNA integrative analysis in K562 silenced for FHC (K562shFHC comparing it with K562 transduced with scrambled RNA (K562shRNA. Four miRNAs, namely hsa-let-7g, hsa-let-7f, hsa-let-7i and hsa-miR-125b, were significantly up-regulated in silenced cells. The remarkable down-regulation of these miRNAs, following FHC expression rescue, supports a specific relation between FHC silencing and miRNA-modulation. The integration of target predictions with miRNA and gene expression profiles led to the identification of a regulatory network which includes the miRNAs up-regulated by FHC silencing, as well as91 down-regulated putative target genes. These genes were further classified in 9 networks; the highest scoring network, "Cell Death and Survival, Hematological System Development and Function, Hematopoiesis", is composed by 18 focus molecules including RAF1 and ERK1/2. We confirmed that, following FHC silencing, ERK1/2 phosphorylation is severely impaired and that RAF1 mRNA is significantly down-regulated. Taken all together, our data indicate that, in our experimental model, FHC silencing may affect RAF1/pERK1/2 levels through the modulation of a specific set of miRNAs and add new insights in to the relationship among iron homeostasis and miRNAs.

  5. Functional analysis of novel androgen receptor mutations in a unique cohort of Indonesian patients with a disorder of sex development

    NARCIS (Netherlands)

    P. Elfferich (Peter); A.Z. Juniarto (Achmad); H.J. Dubbink (Erik Jan); M.E. Royen (Martin); M. Molier; J.W. Hoogerbrugge (Jos); A.B. Houtsmuller (Adriaan); J. Trapman (Jan); A. Santosa; F.H. de Jong (Frank); S.L.S. Drop (Stenvert); S.M.H. Faradz (Sultana); H.T. Brüggenwirth (Hennie); A.O. Brinkmann (Albert)

    2009-01-01

    textabstractMutations in the androgen receptor (AR) gene, rendering the AR protein partially or completely inactive, cause androgen insensitivity syndrome, which is a form of a 46,XY disorder of sex development (DSD). We present 3 novel AR variants found in a cohort of Indonesian DSD patients: p.I60

  6. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    Science.gov (United States)

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  7. Androgens and estrogens in skeletal sexual dimorphism.

    Science.gov (United States)

    Laurent, Michaël; Antonio, Leen; Sinnesael, Mieke; Dubois, Vanessa; Gielen, Evelien; Classens, Frank; Vanderschueren, Dirk

    2014-01-01

    Bone is an endocrine tissue expressing androgen and estrogen receptors as well as steroid metabolizing enzymes. The bioactivity of circulating sex steroids is modulated by sex hormone-binding globulin and local conversion in bone tissue, for example, from testosterone (T) to estradiol (E2) by aromatase, or to dihydrotestosterone by 5α-reductase enzymes. Our understanding of the structural basis for gender differences in bone strength has advanced considerably over recent years due to increasing use of (high resolution) peripheral computed tomography. These microarchitectural insights form the basis to understand sex steroid influences on male peak bone mass and turnover in cortical vs trabecular bone. Recent studies using Cre/LoxP technology have further refi ned our mechanistic insights from global knockout mice into the direct contributions of sex steroids and their respective nuclear receptors in osteoblasts, osteoclasts, osteocytes, and other cells to male osteoporosis. At the same time, these studies have reinforced the notion that androgen and estrogen defi ciency have both direct and pleiotropic effects via interaction with, for example, insulin-like growth factor 1, inflammation, oxidative stress, central nervous system control of bone metabolism, adaptation to mechanical loading, etc., This review will summarize recent advances on these issues in the fi eld of sex steroid actions in male bone homeostasis.

  8. Androgens and estrogens in skeletal sexual dimorphism

    Directory of Open Access Journals (Sweden)

    Michaël Laurent

    2014-04-01

    Full Text Available Bone is an endocrine tissue expressing androgen and estrogen receptors as well as steroid metabolizing enzymes. The bioactivity of circulating sex steroids is modulated by sex hormone-binding globulin and local conversion in bone tissue, for example, from testosterone (T to estradiol (E2 by aromatase, or to dihydrotestosterone by 5α-reductase enzymes. Our understanding of the structural basis for gender differences in bone strength has advanced considerably over recent years due to increasing use of (high resolution peripheral computed tomography. These microarchitectural insights form the basis to understand sex steroid influences on male peak bone mass and turnover in cortical vs trabecular bone. Recent studies using Cre/LoxP technology have further refi ned our mechanistic insights from global knockout mice into the direct contributions of sex steroids and their respective nuclear receptors in osteoblasts, osteoclasts, osteocytes, and other cells to male osteoporosis. At the same time, these studies have reinforced the notion that androgen and estrogen defi ciency have both direct and pleiotropic effects via interaction with, for example, insulin-like growth factor 1, inflammation, oxidative stress, central nervous system control of bone metabolism, adaptation to mechanical loading, etc., This review will summarize recent advances on these issues in the fi eld of sex steroid actions in male bone homeostasis.

  9. Par-3 partitioning defective 3 homolog (C. elegans and androgen-induced prostate proliferative shutoff associated protein genes are mutationally inactivated in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Ivanov Igor

    2009-09-01

    Full Text Available Abstract Background Gene identification by nonsense-mediated mRNA decay inhibition (GINI has proven its usefulness in identifying mutant genes in cancer cell lines. An increase in transcription in response to NMD inhibition of a subset of genes is a major cause of false positives when genes are selected for sequencing analysis. To distinguish between mRNA accumulations caused by stress response-induced transcription and nonsense-containing mRNA stabilizations is a challenge in identifying mutant genes using GINI. Methods To identify potential tumor-suppressor genes mutated in prostate cancer cell lines, we applied a version of GINI that involves inhibition of NMD in two steps. In the first step, NMD is inhibited in duplicate tissue-culture plates. During this step, both the substrate for NMD and stress-response mRNA transcripts are accumulated in cells. In the second step, transcription is inhibited in both plates and NMD is inhibited in one plate and released in the second plate. Microarray analysis of gene-expression profiles in both plates after the second step detects only the differences in mRNA degradation but not in mRNA accumulation. Results Analyzing gene expression profile alterations in 22RV1 and LNCaP prostate cancer cells following NMD inhibition we selected candidates for sequencing analysis in both cell lines. Sequencing identified inactivating mutations in both alleles of the PARD3 and AS3 genes in the LNCaP and 22RV1 cells, respectively. Introduction of a wild-type PARD3 cDNA into the LNCaP cells resulted in a higher proliferation rate in tissue culture, a higher adhesion of LNCaP cells to the components of extracellular matrix and impaired the growth of the LNCaP cells in soft agar and in a three-dimensional cell-culture. Conclusion The mutational inactivation in a prostate cancer cell line of the PARD3 gene involved in asymmetric cell division and maintenance of cell-polarity suggests that the loss of cell-polarity contributes

  10. MFSD2A is a novel lung tumor suppressor gene modulating cell cycle and matrix attachment

    Directory of Open Access Journals (Sweden)

    Shames David S

    2010-03-01

    Full Text Available Abstract Background MFSD2A (major facilitator superfamily domain containing 2 gene maps on chromosome 1p34 within a linkage disequilibrium block containing genetic elements associated with progression of lung cancer. Results Here we show that MFSD2A expression is strongly downregulated in non-small cell lung cancer cell lines of different histotypes and in primary lung adenocarcinomas. Experimental modulation of MFSD2A in lung cancer cells is associated with alteration of mRNA levels of genes involved in cell cycle control and interaction with the extracellular matrix. Exogenous expression of MFSD2A in lung cancer cells induced a G1 block, impaired adhesion and migration in vitro, and significantly reduced tumor colony number in vitro (4- to 27-fold, P in vivo (~3-fold, P Conclusion Together these data suggest that MFSD2A is a novel lung cancer tumor suppressor gene that regulates cell cycle progression and matrix attachment.

  11. bc-GenExMiner 3.0: new mining module computes breast cancer gene expression correlation analyses.

    Science.gov (United States)

    Jézéquel, Pascal; Frénel, Jean-Sébastien; Campion, Loïc; Guérin-Charbonnel, Catherine; Gouraud, Wilfried; Ricolleau, Gabriel; Campone, Mario

    2013-01-01

    We recently developed a user-friendly web-based application called bc-GenExMiner (http://bcgenex.centregauducheau.fr), which offered the possibility to evaluate prognostic informativity of genes in breast cancer by means of a 'prognostic module'. In this study, we develop a new module called 'correlation module', which includes three kinds of gene expression correlation analyses. The first one computes correlation coefficient between 2 or more (up to 10) chosen genes. The second one produces two lists of genes that are most correlated (positively and negatively) to a 'tested' gene. A gene ontology (GO) mining function is also proposed to explore GO 'biological process', 'molecular function' and 'cellular component' terms enrichment for the output lists of most correlated genes. The third one explores gene expression correlation between the 15 telomeric and 15 centromeric genes surrounding a 'tested' gene. These correlation analyses can be performed in different groups of patients: all patients (without any subtyping), in molecular subtypes (basal-like, HER2+, luminal A and luminal B) and according to oestrogen receptor status. Validation tests based on published data showed that these automatized analyses lead to results consistent with studies' conclusions. In brief, this new module has been developed to help basic researchers explore molecular mechanisms of breast cancer. DATABASE URL: http://bcgenex.centregauducheau.fr

  12. Androgen excess fetal programming of female reproduction: a developmental aetiology for polycystic ovary syndrome?

    Science.gov (United States)

    Abbott, D H; Barnett, D K; Bruns, C M; Dumesic, D A

    2005-01-01

    The aetiology of polycystic ovary syndrome (PCOS) remains unknown. This familial syndrome is prevalent among reproductive-aged women and its inheritance indicates a dominant regulatory gene with incomplete penetrance. However, promising candidate genes have proven unreliable as markers for the PCOS phenotype. This lack of genetic linkage may represent both extreme heterogeneity of PCOS and difficulty in establishing a universally accepted PCOS diagnosis. Nevertheless, hyperandrogenism is one of the most consistently expressed PCOS traits. Animal models that mimic fetal androgen excess may thus provide unique insight into the origins of the PCOS syndrome. Many female mammals exposed to androgen excess in utero or during early post-natal life typically show masculinized and defeminized behaviour, ovulatory dysfunction and virilized genitalia, although behavioural and ovulatory dysfunction can coexist without virilized genitalia based upon the timing of androgen excess. One animal model shows particular relevance to PCOS: the prenatally androgenized female rhesus monkey. Females exposed to androgen excess early in gestation exhibit hyperandrogenism, oligomenorrhoea and enlarged, polyfollicular ovaries, in addition to LH hypersecretion, impaired embryo development, insulin resistance accompanying abdominal obesity, impaired insulin response to glucose and hyperlipidaemia. Female monkeys exposed to androgen excess late in gestation mimic these programmed changes, except for LH and insulin secretion defects. In utero androgen excess may thus variably perturb multiple organ system programming and thereby provide a single, fetal origin for a heterogeneous adult syndrome.

  13. Hypochlorite Oxidation of Select Androgenic Steroids

    Science.gov (United States)

    Steroid hormones are vital for regulation of various biological functions including sexual development. Elevated concentrations of natural and synthetic androgenic steroids have been shown to adversely affect normal development in indigenous aqueous species. Androgens and their s...

  14. Cigarette smoke modulates expression of human rhinovirus-induced airway epithelial host defense genes.

    Directory of Open Access Journals (Sweden)

    David Proud

    Full Text Available Human rhinovirus (HRV infections trigger acute exacerbations of chronic obstructive pulmonary disease (COPD and asthma. The human airway epithelial cell is the primary site of HRV infection and responds to infection with altered expression of multiple genes, the products of which could regulate the outcome to infection. Cigarette smoking aggravates asthma symptoms, and is also the predominant risk factor for the development and progression of COPD. We, therefore, examined whether cigarette smoke extract (CSE modulates viral responses by altering HRV-induced epithelial gene expression. Primary cultures of human bronchial epithelial cells were exposed to medium alone, CSE alone, purified HRV-16 alone or to HRV-16+ CSE. After 24 h, supernatants were collected and total cellular RNA was isolated. Gene array analysis was performed to examine mRNA expression. Additional experiments, using real-time RT-PCR, ELISA and/or western blotting, validated altered expression of selected gene products. CSE and HRV-16 each induced groups of genes that were largely independent of each other. When compared to gene expression in response to CSE alone, cells treated with HRV+CSE showed no obvious differences in CSE-induced gene expression. By contrast, compared to gene induction in response to HRV-16 alone, cells exposed to HRV+CSE showed marked suppression of expression of a number of HRV-induced genes associated with various functions, including antiviral defenses, inflammation, viral signaling and airway remodeling. These changes were not associated with altered expression of type I or type III interferons. Thus, CSE alters epithelial responses to HRV infection in a manner that may negatively impact antiviral and host defense outcomes.

  15. A modest but significant effect of CGB5 gene promoter polymorphisms in modulating the risk of recurrent miscarriage

    DEFF Research Database (Denmark)

    Rull, Kristiina; Christiansen, Ole Bjarne; Nagirnaja, Liina

    2013-01-01

    To confirm the effect of single nucleotide polymorphisms (SNPs) in chorionic gonadotropin beta (CGB) genes in modulating the susceptibility to recurrent miscarriage (RM) in Danes and in a meta-analysis across Danes and the discovery samples from Estonia and Finland.......To confirm the effect of single nucleotide polymorphisms (SNPs) in chorionic gonadotropin beta (CGB) genes in modulating the susceptibility to recurrent miscarriage (RM) in Danes and in a meta-analysis across Danes and the discovery samples from Estonia and Finland....

  16. Effects of androgen and leptin on behavioral and cellular responses in female rats.

    Science.gov (United States)

    Feng, Yi; Shao, Ruijin; Weijdegård, Birgitta; Wang, Tienpei; Johansson, Julia; Sun, Shan; Wang, Wei; Egecioglu, Emil; Billig, Håkan; Stener-Victorin, Elisabet

    2011-09-01

    The causes of anxiety and depression in women with polycystic ovary syndrome (PCOS) remain elusive. To identify steps linking androgen signaling to the regulation of affective symptoms in vivo, we compared behavioral responses in female rats continuously exposed to DHT from puberty (a model of DHT-induced PCOS) and in rats exposed to DHT for 1week. Continuous and 1week of DHT exposure resulted in a general decrease in locomotor activity and time spent on the open arms in the elevated plus maze, indicating anxiety-like behavior. Rats with DHT-induced PCOS have increases in adiposity and circulating leptin levels accompanied by leptin resistance. One week of DHT exposure decreased androgen receptor (AR) expression in the hypothalamus and leptin synthesis and function in adipocytes; it also inhibited signal transducer and activator of transcription 3 (STAT3) and attenuated leptin activity by increasing levels of soluble leptin receptor, a leptin-binding protein, in the hypothalamus. This may affect the androgen-induced anxiety-related behavior in female rats. In conclusion, our results highlight the central role of androgens in behavioral function in female rats and suggest that androgens directly regulate the AR by decreasing its hypothalamic expression. Androgens also increase leptin synthesis in adipocytes, which drives central leptin signaling, and may regulate anxiety-related behaviors. Elucidating mechanisms by which androgens modulate female anxiety-like behavior may uncover useful approaches for treating women with PCOS who have symptoms of anxiety.

  17. Androgen effects on skeletal muscle: implications for the development and management of frailty

    Directory of Open Access Journals (Sweden)

    Matthew DL O'Connell

    2014-04-01

    Full Text Available Androgens have potent anabolic effects on skeletal muscle and decline with age in parallel to losses in muscle mass and strength. This loss of muscle mass and function, known as sarcopenia, is the central event in development of frailty, the vulnerable health status that presages adverse outcomes and rapid functional decline in older adults. The potential role of falling androgen levels in the development of frailty and their utility as function promoting therapies in older men has therefore attracted considerable attention. This review summarizes current concepts and definitions in muscle ageing, sarcopenia and frailty, and evaluates recent developments in the study of androgens and frailty. Current evidence from observational and interventional studies strongly supports an effect of androgens on muscle mass in ageing men, but effects on muscle strength and particularly physical function have been less clear. Androgen treatment has been generally well-tolerated in studies of older men, but concerns remain over higher dose treatments and use in populations with high cardiovascular risk. The first trials of selective androgen receptor modulators (SARMs suggest similar effects on muscle mass and function to traditional androgen therapies in older adults. Important future directions include the use of these agents in combination with exercise training to promote functional ability across different populations of older adults, as well as more focus on the relationships between concurrent changes in hormone levels, body composition and physical function in observational studies.

  18. Androgen effects on skeletal muscle: implications for the development and management of frailty.

    Science.gov (United States)

    O'Connell, Matthew D L; Wu, Frederick C W

    2014-01-01

    Androgens have potent anabolic effects on skeletal muscle and decline with age in parallel to losses in muscle mass and strength. This loss of muscle mass and function, known as sarcopenia, is the central event in development of frailty, the vulnerable health status that presages adverse outcomes and rapid functional decline in older adults. The potential role of falling androgen levels in the development of frailty and their utility as function promoting therapies in older men has therefore attracted considerable attention. This review summarizes current concepts and definitions in muscle ageing, sarcopenia and frailty, and evaluates recent developments in the study of androgens and frailty. Current evidence from observational and interventional studies strongly supports an effect of androgens on muscle mass in ageing men, but effects on muscle strength and particularly physical function have been less clear. Androgen treatment has been generally well-tolerated in studies of older men, but concerns remain over higher dose treatments and use in populations with high cardiovascular risk. The first trials of selective androgen receptor modulators (SARMs) suggest similar effects on muscle mass and function to traditional androgen therapies in older adults. Important future directions include the use of these agents in combination with exercise training to promote functional ability across different populations of older adults, as well as more focus on the relationships between concurrent changes in hormone levels, body composition and physical function in observational studies.

  19. Modules Identification in Gene Positive Networks of Hepatocellular Carcinoma Using Pearson Agglomerative Method and Pearson Cohesion Coupling Modularity

    Directory of Open Access Journals (Sweden)

    Jinyu Hu

    2012-01-01

    Full Text Available In this study, a gene positive network is proposed based on a weighted undirected graph, where the weight represents the positive correlation of the genes. A Pearson agglomerative clustering algorithm is employed to build a clustering tree, where dotted lines cut the tree from bottom to top leading to a number of subsets of the modules. In order to achieve better module partitions, the Pearson correlation coefficient modularity is addressed to seek optimal module decomposition by selecting an optimal threshold value. For the liver cancer gene network under study, we obtain a strong threshold value at 0.67302, and a very strong correlation threshold at 0.80086. On the basis of these threshold values, fourteen strong modules and thirteen very strong modules are obtained respectively. A certain degree of correspondence between the two types of modules is addressed as well. Finally, the biological significance of the two types of modules is analyzed and explained, which shows that these modules are closely related to the proliferation and metastasis of liver cancer. This discovery of the new modules may provide new clues and ideas for liver cancer treatment.

  20. Impact of circulating cholesterol levels on growth and intratumoral androgen concentration of prostate tumors.

    Directory of Open Access Journals (Sweden)

    Elahe A Mostaghel

    Full Text Available Prostate cancer (PCa is the second most common cancer in men. Androgen deprivation therapy (ADT leads to tumor involution and reduction of tumor burden. However, tumors eventually reemerge that have overcome the absence of gonadal androgens, termed castration resistant PCa (CRPC. Theories underlying the development of CRPC include androgen receptor (AR mutation allowing for promiscuous activation by non-androgens, AR amplification and overexpression leading to hypersensitivity to low androgen levels, and/or tumoral uptake and conversion of adrenally derived androgens. More recently it has been proposed that prostate tumor cells synthesize their own androgens through de novo steroidogenesis, which involves the step-wise synthesis of androgens from cholesterol. Using the in vivo LNCaP PCa xenograft model, previous data from our group demonstrated that a hypercholesterolemia diet potentiates prostatic tumor growth via induction of angiogenesis. Using this same model we now demonstrate that circulating cholesterol levels are significantly associated with tumor size (R = 0.3957, p = 0.0049 and intratumoral levels of testosterone (R = 0.41, p = 0.0023 in LNCaP tumors grown in hormonally intact mice. We demonstrate tumoral expression of cholesterol uptake genes as well as the spectrum of steroidogenic enzymes necessary for androgen biosynthesis from cholesterol. Moreover, we show that circulating cholesterol levels are directly correlated with tumoral expression of CYP17A, the critical enzyme required for de novo synthesis of androgens from cholesterol (R = 0.4073, p = 0.025 Since hypercholesterolemia does not raise circulating androgen levels and the adrenal gland of the mouse synthesizes minimal androgens, this study provides evidence that hypercholesterolemia increases intratumoral de novo steroidogenesis. Our results are consistent with the hypothesis that cholesterol-fueled intratumoral androgen synthesis may accelerate the

  1. Gene Expression Measurement Module (GEMM) - a fully automated, miniaturized instrument for measuring gene expression in space

    Science.gov (United States)

    Karouia, Fathi; Ricco, Antonio; Pohorille, Andrew; Peyvan, Kianoosh

    2012-07-01

    The capability to measure gene expression on board spacecrafts opens the doors to a large number of experiments on the influence of space environment on biological systems that will profoundly impact our ability to conduct safe and effective space travel, and might also shed light on terrestrial physiology or biological function and human disease and aging processes. Measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, determine metabolic basis of microbial pathogenicity and drug resistance, test our ability to sustain and grow in space organisms that can be used for life support and in situ resource utilization during long-duration space exploration, and monitor both the spacecraft environment and crew health. These and other applications hold significant potential for discoveries in space biology, biotechnology and medicine. Accordingly, supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measuring microbial expression of thousands of genes from multiple samples. The instrument will be capable of (1) lysing bacterial cell walls, (2) extracting and purifying RNA released from cells, (3) hybridizing it on a microarray and (4) providing electrochemical readout, all in a microfluidics cartridge. The prototype under development is suitable for deployment on nanosatellite platforms developed by the NASA Small Spacecraft Office. The first target application is to cultivate and measure gene expression of the photosynthetic bacterium Synechococcus elongatus, i.e. a cyanobacterium known to exhibit remarkable metabolic diversity and resilience to adverse conditions

  2. How strong is the association between CAG and GGN repeat length polymorphisms in the androgen receptor gene and prostate cancer risk?

    NARCIS (Netherlands)

    Zeegers, M.P.; Kiemeney, L.A.L.M.; Nieder, A.M.; Ostrer, H.

    2004-01-01

    OBJECTIVE: Although narrative reviews have suggested an association between (CAG)n and (GGN)n polymorphisms in the AR gene and prostate cancer, it has never been quantified systematically. The purpose of this meta-analysis was to provide relative and absolute quantitative summary estimates with suff

  3. Crosstalk between androgen and pro-inflammatory signaling remodels androgen receptor and NF-κB cistrome to reprogram the prostate cancer cell transcriptome

    Science.gov (United States)

    Malinen, Marjo; Niskanen, Einari A.; Kaikkonen, Minna U.; Palvimo, Jorma J.

    2017-01-01

    Inflammatory processes and androgen signaling are critical for the growth of prostate cancer (PC), the most common cancer among males in Western countries. To understand the importance of potential interplay between pro-inflammatory and androgen signaling for gene regulation, we have interrogated the crosstalk between androgen receptor (AR) and NF-κB, a key transcriptional mediator of inflammatory responses, by utilizing genome-wide chromatin immunoprecipitation sequencing and global run-on sequencing in PC cells. Co-stimulation of LNCaP cells with androgen and pro-inflammatory cytokine TNFα invoked a transcriptome which was very distinct from that induced by either stimulation alone. The altered transcriptome that included gene programs linked to cell migration and invasiveness was orchestrated by significant remodeling of NF-κB and AR cistrome and enhancer landscape. Although androgen multiplied the NF-κB cistrome and TNFα restrained the AR cistrome, there was no general reciprocal tethering of the AR to the NF-κB on chromatin. Instead, redistribution of FOXA1, PIAS1 and PIAS2 contributed to the exposure of latent NF-κB chromatin-binding sites and masking of AR chromatin-binding sites. Taken together, concomitant androgen and pro-inflammatory signaling significantly remodels especially the NF-κB cistrome, reprogramming the PC cell transcriptome in fashion that may contribute to the progression of PC. PMID:27672034

  4. LSD1 controls metastasis of androgen-independent prostate cancer cells through PXN and LPAR6.

    Science.gov (United States)

    Ketscher, A; Jilg, C A; Willmann, D; Hummel, B; Imhof, A; Rüsseler, V; Hölz, S; Metzger, E; Müller, J M; Schüle, R

    2014-10-06

    Lysine-specific demethylase 1 (LSD1) was shown to control gene expression and cell proliferation of androgen-dependent prostate cancer (PCa) cells, whereas the role of LSD1 in androgen-independent metastatic prostate cancer remains elusive. Here, we show that depletion of LSD1 leads to increased migration and invasion of androgen-independent PCa cells. Transcriptome and cistrome analyses reveal that LSD1 regulates expression of lysophosphatidic acid receptor 6 (LPAR6) and cytoskeletal genes including the focal adhesion adaptor protein paxillin (PXN). Enhanced LPAR6 signalling upon LSD1 depletion promotes migration with concomitant phosphorylation of PXN. In mice LPAR6 overexpression enhances, whereas knockdown of LPAR6 abolishes metastasis of androgen-independent PCa cells. Taken together, we uncover a novel mechanism of how LSD1 controls metastasis and identify LPAR6 as a promising therapeutic target to treat metastatic prostate cancer.

  5. Light-controlled modulation of gene expression by chemical optoepigenetic probes.

    Science.gov (United States)

    Reis, Surya A; Ghosh, Balaram; Hendricks, J Adam; Szantai-Kis, D Miklos; Törk, Lisa; Ross, Kenneth N; Lamb, Justin; Read-Button, Willis; Zheng, Baixue; Wang, Hongtao; Salthouse, Christopher; Haggarty, Stephen J; Mazitschek, Ralph

    2016-05-01

    Epigenetic gene regulation is a dynamic process orchestrated by chromatin-modifying enzymes. Many of these master regulators exert their function through covalent modification of DNA and histone proteins. Aberrant epigenetic processes have been implicated in the pathophysiology of multiple human diseases. Small-molecule inhibitors have been essential to advancing our understanding of the underlying molecular mechanisms of epigenetic processes. However, the resolution offered by small molecules is often insufficient to manipulate epigenetic processes with high spatiotemporal control. Here we present a generalizable approach, referred to as 'chemo-optical modulation of epigenetically regulated transcription' (COMET), enabling high-resolution, optical control of epigenetic mechanisms based on photochromic inhibitors of human histone deacetylases using visible light. COMET probes may be translated into new therapeutic strategies for diseases where conditional and selective epigenome modulation is required.

  6. Androgen receptor roles in insulin resistance and obesity in males: the linkage of androgen-deprivation therapy to metabolic syndrome.

    Science.gov (United States)

    Yu, I-Chen; Lin, Hung-Yun; Sparks, Janet D; Yeh, Shuyuan; Chang, Chawnshang

    2014-10-01

    Prostate cancer (PCa) is one of the most frequently diagnosed malignancies in men. Androgen-deprivation therapy (ADT) is the first-line treatment and fundamental management for men with advanced PCa to suppress functions of androgen/androgen receptor (AR) signaling. ADT is effective at improving cancer symptoms and prolonging survival. However, epidemiological and clinical studies support the notion that testosterone deficiency in men leads to the development of metabolic syndrome that increases cardiovascular disease risk. The underlying mechanisms by which androgen/AR signaling regulates metabolic homeostasis in men are complex, and in this review, we discuss molecular mechanisms mediated by AR signaling that link ADT to metabolic syndrome. Results derived from various AR knockout mouse models reveal tissue-specific AR signaling that is involved in regulation of metabolism. These data suggest that steps be taken early to manage metabolic complications associated with PCa patients receiving ADT, which could be accomplished using tissue-selective modulation of AR signaling and by treatment with insulin-sensitizing agents.

  7. Pleiotropic Genes Affecting Carcass Traits in Bos indicus (Nellore Cattle Are Modulators of Growth.

    Directory of Open Access Journals (Sweden)

    Anirene G T Pereira

    Full Text Available Two complementary methods, namely Multi-Trait Meta-Analysis and Versatile Gene-Based Test for Genome-wide Association Studies (VEGAS, were used to identify putative pleiotropic genes affecting carcass traits in Bos indicus (Nellore cattle. The genotypic data comprised over 777,000 single-nucleotide polymorphism markers scored in 995 bulls, and the phenotypic data included deregressed breeding values (dEBV for weight measurements at birth, weaning and yearling, as well visual scores taken at weaning and yearling for carcass finishing precocity, conformation and muscling. Both analyses pointed to the pleomorphic adenoma gene 1 (PLAG1 as a major pleiotropic gene. VEGAS analysis revealed 224 additional candidates. From these, 57 participated, together with PLAG1, in a network involved in the modulation of the function and expression of IGF1 (insulin like growth factor 1, IGF2 (insulin like growth factor 2, GH1 (growth hormone 1, IGF1R (insulin like growth factor 1 receptor and GHR (growth hormone receptor, suggesting that those pleiotropic genes operate as satellite regulators of the growth pathway.

  8. Pleiotropic Genes Affecting Carcass Traits in Bos indicus (Nellore) Cattle Are Modulators of Growth

    Science.gov (United States)

    Milanesi, Marco; Torrecilha, Rafaela B. P.; Carmo, Adriana S.; Neves, Haroldo H. R.; Carvalheiro, Roberto; Ajmone-Marsan, Paolo; Sonstegard, Tad S.; Sölkner, Johann; Contreras-Castillo, Carmen J.; Garcia, José F.

    2016-01-01

    Two complementary methods, namely Multi-Trait Meta-Analysis and Versatile Gene-Based Test for Genome-wide Association Studies (VEGAS), were used to identify putative pleiotropic genes affecting carcass traits in Bos indicus (Nellore) cattle. The genotypic data comprised over 777,000 single-nucleotide polymorphism markers scored in 995 bulls, and the phenotypic data included deregressed breeding values (dEBV) for weight measurements at birth, weaning and yearling, as well visual scores taken at weaning and yearling for carcass finishing precocity, conformation and muscling. Both analyses pointed to the pleomorphic adenoma gene 1 (PLAG1) as a major pleiotropic gene. VEGAS analysis revealed 224 additional candidates. From these, 57 participated, together with PLAG1, in a network involved in the modulation of the function and expression of IGF1 (insulin like growth factor 1), IGF2 (insulin like growth factor 2), GH1 (growth hormone 1), IGF1R (insulin like growth factor 1 receptor) and GHR (growth hormone receptor), suggesting that those pleiotropic genes operate as satellite regulators of the growth pathway. PMID:27410030

  9. Estrogens and selective estrogen receptor modulators regulate gene and protein expression in the mesenteric arteries.

    Science.gov (United States)

    Mark-Kappeler, Connie J; Martin, Douglas S; Eyster, Kathleen M

    2011-01-01

    Estrogen has both beneficial and detrimental effects on the cardiovascular system. Selective estrogen receptor modulators (SERMs) exhibit partial estrogen agonist/antagonist activity in estrogen target tissues. Gene targets of estrogen and SERMs in the vasculature are not well-known. Thus, the present study tested the hypothesis that estrogens (ethinyl estradiol, estradiol benzoate, and equilin) and SERMs (tamoxifen and raloxifene) cause differential gene and protein expression in the vasculature. DNA microarray and real-time RT-PCR were used to investigate gene expression in the mesenteric arteries of estrogen and SERM treated ovariectomized rats. The genes shown to be differentially expressed included stearoyl-CoA desaturase (SCD), soluble epoxide hydrolase (sEH), secreted frizzled related protein-4 (SFRP-4), insulin-like growth factor-1 (IGF-1), phospholipase A2 group 1B (PLA2-G1B), and fatty acid synthase (FAS). Western blot further confirmed the differential expression of sEH, SFRP-4, FAS, and SCD protein. These results reveal that estrogens and SERMs cause differential gene and protein expression in the mesenteric artery. Consequently, the use of these agents may be associated with a unique profile of functional and structural changes in the mesenteric arterial circulation.

  10. DNMT3B modulates the expression of cancer-related genes and downregulates the expression of the gene VAV3 via methylation.

    Science.gov (United States)

    Peralta-Arrieta, Irlanda; Hernández-Sotelo, Daniel; Castro-Coronel, Yaneth; Leyva-Vázquez, Marco Antonio; Illades-Aguiar, Berenice

    2017-01-01

    Altered promoter DNA methylation is one of the most important epigenetic abnormalities in human cancer. DNMT3B, de novo methyltransferase, is clearly related to abnormal methylation of tumour suppressor genes, DNA repair genes and its overexpression contributes to oncogenic processes and tumorigenesis in vivo. The purpose of this study was to assess the effect of the overexpression of DNMT3B in HaCaT cells on global gene expression and on the methylation of selected genes to the identification of genes that can be target of DNMT3B. We found that the overexpression of DNMT3B in HaCaT cells, modulate the expression of genes related to cancer, downregulated the expression of 151 genes with CpG islands and downregulated the expression of the VAV3 gene via methylation of its promoter. These results highlight the importance of DNMT3B in gene expression and human cancer.

  11. DNMT3B modulates the expression of cancer-related genes and downregulates the expression of the gene VAV3 via methylation

    Science.gov (United States)

    Peralta-Arrieta, Irlanda; Hernández-Sotelo, Daniel; Castro-Coronel, Yaneth; Leyva-Vázquez, Marco Antonio; Illades-Aguiar, Berenice

    2017-01-01

    Altered promoter DNA methylation is one of the most important epigenetic abnormalities in human cancer. DNMT3B, de novo methyltransferase, is clearly related to abnormal methylation of tumour suppressor genes, DNA repair genes and its overexpression contributes to oncogenic processes and tumorigenesis in vivo. The purpose of this study was to assess the effect of the overexpression of DNMT3B in HaCaT cells on global gene expression and on the methylation of selected genes to the identification of genes that can be target of DNMT3B. We found that the overexpression of DNMT3B in HaCaT cells, modulate the expression of genes related to cancer, downregulated the expression of 151 genes with CpG islands and downregulated the expression of the VAV3 gene via methylation of its promoter. These results highlight the importance of DNMT3B in gene expression and human cancer. PMID:28123849

  12. Androgen Receptor Gene Polymorphism and Breast Cancer Risk%AR基因外显子1的CAG重复多态性与乳腺癌发生的关系

    Institute of Scientific and Technical Information of China (English)

    孟洁; 付丽

    2012-01-01

    Objective To assess the association between AR ( Androgen Receptor ) gene polymorphism[ CAG ]n in exon 1 and breast cancer. Methods 50 cases of breast cancer and 50 controls were collected. DNA was extracted from peripheral blood leukocytes. The encoding sequence of AR gene exonl was amplified by PCR. After direct sequencing of PCR products,the CAG repeats were calculated. The Wilcoxon rank test was used to compare the distributions of the [ CAG ]n. Breast cancer risk was assessed using multivariate logistic regression. Results The [ CAG ]n was 15 ~26 for cases and was 16 ~26 for controls. The distribution of [ CAG ]n for cases and controls was different P =0.015 ). Women for whom the [ CAG ]n was ≥24 units had approximately 5. 6 risk of breast cancer compared [ CAG ]n ≤20 ( P =0. 04,OR =5. 6 ). Conclusion These data suggest that AR gene exonl[ CAG ]n has influence on breast cancer, and longer AR [ CAG ]n may increase breast cancer risk.%目的 探讨AR(雄激素受体)基因外显子1的CAG重复多态性与乳腺癌发生的关系.方法 研究对象为50例乳腺癌患者和50例健康者,从外周血淋巴细胞中提取基因组DNA,对AR基因外显子1的编码序列进行PCR扩增,扩增产物进行DNA序列测定,计算CAG重复频率.Wilcoxon rank test 比较病例组和对照组的[CAG]n分布,采用多因素log回归分析[CAG]n对乳腺癌发病风险的影响.结果 病例组[CAG]n为15~26,对照组为16~26;两组重复频率分布有差异(P=0.015),[CAG]n≥24时乳腺癌发病风险为[CAG]n≤20的5.6倍(P=0.04,OR=5.6).结论 AR基因外显子1的CAG重复频率对乳腺癌风险发病有影响,长[CAG]n可增大乳腺癌发病风险.

  13. Gene Expression Measurement Module (GEMM) - A Fully Automated, Miniaturized Instrument for Measuring Gene Expression in Space

    Science.gov (United States)

    Pohorille, Andrew; Peyvan, Kia; Karouia, Fathi; Ricco, Antonio

    2012-01-01

    The capability to measure gene expression on board spacecraft opens the door to a large number of high-value experiments on the influence of the space environment on biological systems. For example, measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, and determine the metabolic bases of microbial pathogenicity and drug resistance. These and other applications hold significant potential for discoveries in space biology, biotechnology, and medicine. Supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measurement of expression of several hundreds of microbial genes from multiple samples. The instrument will be capable of (1) lysing cell walls of bacteria sampled from cultures grown in space, (2) extracting and purifying RNA released from cells, (3) hybridizing the RNA on a microarray and (4) providing readout of the microarray signal, all in a single microfluidics cartridge. The device is suitable for deployment on nanosatellite platforms developed by NASA Ames' Small Spacecraft Division. To meet space and other technical constraints imposed by these platforms, a number of technical innovations are being implemented. The integration and end-to-end technological and biological validation of the instrument are carried out using as a model the photosynthetic bacterium Synechococcus elongatus, known for its remarkable metabolic diversity and resilience to adverse conditions. Each step in the measurement process-lysis, nucleic acid extraction, purification, and hybridization to an array-is assessed through comparison of the results obtained using the instrument with

  14. EPI-001, A Compound Active against Castration-Resistant Prostate Cancer, Targets Transactivation Unit 5 of the Androgen Receptor.

    Science.gov (United States)

    De Mol, Eva; Fenwick, R Bryn; Phang, Christopher T W; Buzón, Victor; Szulc, Elzbieta; de la Fuente, Alex; Escobedo, Albert; García, Jesús; Bertoncini, Carlos W; Estébanez-Perpiñá, Eva; McEwan, Iain J; Riera, Antoni; Salvatella, Xavier

    2016-09-16

    Castration-resistant prostate cancer is the lethal condition suffered by prostate cancer patients that become refractory to androgen deprivation therapy. EPI-001 is a recently identified compound active against this condition that modulates the activity of the androgen receptor, a nuclear receptor that is essential for disease progression. The mechanism by which this compound exerts its inhibitory activity is however not yet fully understood. Here we show, by using high resolution solution nuclear magnetic resonance spectroscopy, that EPI-001 selectively interacts with a partially folded region of the transactivation domain of the androgen receptor, known as transactivation unit 5, that is key for the ability of prostate cells to proliferate in the absence of androgens, a distinctive feature of castration-resistant prostate cancer. Our results can contribute to the development of more potent and less toxic novel androgen receptor antagonists for treating this disease.

  15. Effects of modulation of calcium levels and calcium fluxes on ABA- induced gene expression in barley aleurone

    NARCIS (Netherlands)

    Meulen, R.M. van der; Visser, K.; Wang, M.

    1996-01-01

    We present data to elucidate the involvement of calcium ions in abscisic acid (ABA)-induced gene expression. Modulation of external calcium concentrations was able to affect ABA-induced specific RAB gene expression. At a constant ABA level with increasing extracellular calcium level, an increasing R

  16. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

    Directory of Open Access Journals (Sweden)

    Giuseppe Fiume

    2016-11-01

    Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  17. Protein interactions of the MLL PHD fingers modulate MLL target gene regulation in human cells.

    Science.gov (United States)

    Fair, K; Anderson, M; Bulanova, E; Mi, H; Tropschug, M; Diaz, M O

    2001-05-01

    The PHD fingers of the human MLL and Drosophila trx proteins have strong amino acid sequence conservation but their function is unknown. We have determined that these fingers mediate homodimerization and binding of MLL to Cyp33, a nuclear cyclophilin. These two proteins interact in vitro and in vivo in mammalian cells and colocalize at specific nuclear subdomains. Overexpression of the Cyp33 protein in leukemia cells results in altered expression of HOX genes that are targets for regulation by MLL. These alterations are suppressed by cyclosporine and are not observed in cell lines that express a mutant MLL protein without PHD fingers. These results suggest that binding of Cyp33 to MLL modulates its effects on the expression of target genes.

  18. Establishment of the methods for searching eukaryotic gene cis-regulatory modules.

    Science.gov (United States)

    Zhong, Dong; Zhang, Zhen-shu; Liu, Yu-hu; Zheng, Guo-qing; Liu, Xiao-yi; Lu, Yang; Zhao, Gui-jun; Xu, An-long

    2004-02-01

    On the basis of the knowledge of eukaryotic gene regulation, we modified the method in three aspects: (1) Searching the cis-regulatory modules (CRM) according Fasta or Blast sequence with multiple sequence and low E value, followed by mutual scoring of these sequence with Smith-Waterman algorithms and finally by clustering analysis; (2) Searching the transcription factor-binding site using International Union of Pure and Applied Chemistry, Position-Weight Matrix(PWM) and Dyed method; (3) Designing and implementation of data analysis based on the software in Windows 2000 and UNIX using object-oriented technology. The results of analysis of the major histocompatibility complex gene family show that this procedure may accurately locate the regions that contain some of the CRMs.

  19. MR-Guided Pulsed High-Intensity Focused Ultrasound Enhancement of Gene Therapy Combined With Androgen Deprivation and Radiotherapy for Prostate Cancer Treatment

    Science.gov (United States)

    2009-09-01

    ultrasound . J. Acoust. Soc.Am. 72 1926-1932, (1982) (7) Neppiras E A. Acoustic cavitation . Physics reports 61(3): 159-251, (1980) (8) ter Haar G R, Daniels...Guided Pulsed High-Intensity Focused Ultrasound Enhancement of 5b. GRANT NUMBER W81XWH-08-1-0469 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...failing to This work is aimed to study MR guided high intensity focused ultrasound (MRgHIFU) enhancement of gene therapy for Prostate Cancer. The

  20. Androgen responsiveness of the new human endometrial cancer cell line MFE-296.

    Science.gov (United States)

    Hackenberg, R; Beck, S; Filmer, A; Hushmand Nia, A; Kunzmann, R; Koch, M; Slater, E P; Schulz, K D

    1994-04-01

    MFE-296 endometrial cancer cells express androgen receptors in vitro. These cells, which are tumorigenic in nude mice, are derived from a moderately differentiated human endometrial adenocarcinoma. They express vimentin and the cytokeratins 7, 8, 18, and 19. Karyotyping revealed near-tetraploidy for most of the cells. No marker chromosomes were observed. DNA analyses confirmed the genetic identity of the cell line and the patient from whom the cell line was derived. Proliferation of MFE-296 cells was inhibited by the progestin R5020 and the androgen dihydrotestosterone (DHT). The inhibition of proliferation by DHT was antagonized by the antiandrogen Casodex, demonstrating the involvement of the androgen receptor. Androgen binding was determined at 22,000 binding sites per cell using a whole-cell assay (KD = 0.05 nM) and 30 fmol/mg protein with the dextran charcoal method; 7 fmol/mg protein of progesterone receptors were found, whereas estrogen receptors were below 5 fmol/mg protein. The androgen receptor was functionally intact, as demonstrated by transfection experiments with a reporter-gene construct, containing an androgen-responsive element. In MFE-296 cells the content of the androgen receptor was up-regulated by its own ligand.

  1. The expression of melanopsin and clock genes in Xenopus laevis melanophores and their modulation by melatonin

    Energy Technology Data Exchange (ETDEWEB)

    Bluhm, A.P.C.; Obeid, N.N.; Castrucci, A.M.L.; Visconti, M.A. [Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil)

    2012-05-25

    Vertebrates have a central clock and also several peripheral clocks. Light responses might result from the integration of light signals by these clocks. The dermal melanophores of Xenopus laevis have a photoreceptor molecule denominated melanopsin (OPN4x). The mechanisms of the circadian clock involve positive and negative feedback. We hypothesize that these dermal melanophores also present peripheral clock characteristics. Using quantitative PCR, we analyzed the pattern of temporal expression of Opn4x and the clock genes Per1, Per2, Bmal1, and Clock in these cells subjected to a 14-h light:10-h dark (14L:10D) regime or constant darkness (DD). Also, in view of the physiological role of melatonin in the dermal melanophores of X. laevis, we determined whether melatonin modulates the expression of these clock genes. These genes show a time-dependent expression pattern when these cells are exposed to 14L:10D, which differs from the pattern observed under DD. Cells kept in DD for 5 days exhibited overall increased mRNA expression for Opn4x and Clock, and a lower expression for Per1, Per2, and Bmal1. When the cells were kept in DD for 5 days and treated with melatonin for 1 h, 24 h before extraction, the mRNA levels tended to decrease for Opn4x and Clock, did not change for Bmal1, and increased for Per1 and Per2 at different Zeitgeber times (ZT). Although these data are limited to one-day data collection, and therefore preliminary, we suggest that the dermal melanophores of X. laevis might have some characteristics of a peripheral clock, and that melatonin modulates, to a certain extent, melanopsin and clock gene expression.

  2. Frequency modulation of stochastic gene expression bursts by strongly interacting small RNAs

    Science.gov (United States)

    Kumar, Niraj; Jia, Tao; Zarringhalam, Kourosh; Kulkarni, Rahul V.

    2016-10-01

    The sporadic nature of gene expression at the single-cell level—long periods of inactivity punctuated by bursts of mRNA or protein production—plays a critical role in diverse cellular processes. To elucidate the cellular role of bursting in gene expression, synthetic biology approaches have been used to design simple genetic circuits with bursty mRNA or protein production. Understanding how such genetic circuits can be designed with the ability to control burst-related parameters requires the development of quantitative stochastic models of gene expression. In this work, we analyze stochastic models for the regulation of gene expression bursts by strongly interacting small RNAs. For the parameter range considered, results based on mean-field approaches are significantly inaccurate and alternative analytical approaches are needed. Using simplifying approximations, we obtain analytical results for the corresponding steady-state distributions that are in agreement with results from stochastic simulations. These results indicate that regulation by small RNAs, in the strong interaction limit, can be used to effectively modulate the frequency of bursting. We explore the consequences of such regulation for simple genetic circuits involving feedback effects and switching between promoter states.

  3. Frequency modulation of stochastic gene expression bursts by strongly interacting small RNAs.

    Science.gov (United States)

    Kumar, Niraj; Jia, Tao; Zarringhalam, Kourosh; Kulkarni, Rahul V

    2016-10-01

    The sporadic nature of gene expression at the single-cell level-long periods of inactivity punctuated by bursts of mRNA or protein production-plays a critical role in diverse cellular processes. To elucidate the cellular role of bursting in gene expression, synthetic biology approaches have been used to design simple genetic circuits with bursty mRNA or protein production. Understanding how such genetic circuits can be designed with the ability to control burst-related parameters requires the development of quantitative stochastic models of gene expression. In this work, we analyze stochastic models for the regulation of gene expression bursts by strongly interacting small RNAs. For the parameter range considered, results based on mean-field approaches are significantly inaccurate and alternative analytical approaches are needed. Using simplifying approximations, we obtain analytical results for the corresponding steady-state distributions that are in agreement with results from stochastic simulations. These results indicate that regulation by small RNAs, in the strong interaction limit, can be used to effectively modulate the frequency of bursting. We explore the consequences of such regulation for simple genetic circuits involving feedback effects and switching between promoter states.

  4. Pitx2 modulates a Tbx5-dependent gene regulatory network to maintain atrial rhythm

    Science.gov (United States)

    Nadadur, Rangarajan D.; Broman, Michael T.; Boukens, Bastiaan; Mazurek, Stefan R.; Yang, Xinan; van den Boogaard, Malou; Bekeny, Jenna; Gadek, Margaret; Ward, Tarsha; Zhang, Min; Qiao, Yun; Martin, James F.; Seidman, Christine E.; Seidman, Jon; Christoffels, Vincent; Efimov, Igor R.; McNally, Elizabeth M.; Weber, Christopher R.; Moskowitz, Ivan P.

    2017-01-01

    Cardiac rhythm is extremely robust, generating 2 billion contraction cycles during the average human life span. Transcriptional control of cardiac rhythm is poorly understood. We found that removal of the transcription factor gene Tbx5 from the adult mouse caused primary spontaneous and sustained atrial fibrillation (AF). Atrial cardiomyocytes from the Tbx5-mutant mice exhibited action potential abnormalities, including spontaneous depolarizations, which were rescued by chelating free calcium. We identified a multitiered transcriptional network that linked seven previously defined AF risk loci: TBX5 directly activated PITX2, and TBX5 and PITX2 antagonistically regulated membrane effector genes Scn5a, Gja1, Ryr2, Dsp, and Atp2a2. In addition, reduced Tbx5 dose by adult-specific haploinsufficiency caused decreased target gene expression, myocardial automaticity, and AF inducibility, which were all rescued by Pitx2 haploinsufficiency in mice. These results defined a transcriptional architecture for atrial rhythm control organized as an incoherent feed-forward loop, driven by TBX5 and modulated by PITX2. TBX5/PITX2 interplay provides tight control of atrial rhythm effector gene expression, and perturbation of the co-regulated network caused AF susceptibility. This work provides a model for the molecular mechanisms underpinning the genetic implication of multiple AF genome-wide association studies loci and will contribute to future efforts to stratify patients for AF risk by genotype. PMID:27582060

  5. Pharmacological and Genetic Modulation of REV-ERB Activity and Expression Affects Orexigenic Gene Expression.

    Directory of Open Access Journals (Sweden)

    Ariadna Amador

    Full Text Available The nuclear receptors REV-ERBα and REV-ERBβ are transcription factors that play pivotal roles in the regulation of the circadian rhythm and various metabolic processes. The circadian rhythm is an endogenous mechanism, which generates entrainable biological changes that follow a 24-hour period. It regulates a number of physiological processes, including sleep/wakeful cycles and feeding behaviors. We recently demonstrated that REV-ERB-specific small molecules affect sleep and anxiety. The orexinergic system also plays a significant role in mammalian physiology and behavior, including the regulation of sleep and food intake. Importantly, orexin genes are expressed in a circadian manner. Given these overlaps in function and circadian expression, we wanted to determine whether the REV-ERBs might regulate orexin. We found that acute in vivo modulation of REV-ERB activity, with the REV-ERB-specific synthetic ligand SR9009, affects the circadian expression of orexinergic genes in mice. Long term dosing with SR9009 also suppresses orexinergic gene expression in mice. Finally, REV-ERBβ-deficient mice present with increased orexinergic transcripts. These data suggest that the REV-ERBs may be involved in the repression of orexinergic gene expression.

  6. Pitx2 modulates a Tbx5-dependent gene regulatory network to maintain atrial rhythm.

    Science.gov (United States)

    Nadadur, Rangarajan D; Broman, Michael T; Boukens, Bastiaan; Mazurek, Stefan R; Yang, Xinan; van den Boogaard, Malou; Bekeny, Jenna; Gadek, Margaret; Ward, Tarsha; Zhang, Min; Qiao, Yun; Martin, James F; Seidman, Christine E; Seidman, Jon; Christoffels, Vincent; Efimov, Igor R; McNally, Elizabeth M; Weber, Christopher R; Moskowitz, Ivan P

    2016-08-31

    Cardiac rhythm is extremely robust, generating 2 billion contraction cycles during the average human life span. Transcriptional control of cardiac rhythm is poorly understood. We found that removal of the transcription factor gene Tbx5 from the adult mouse caused primary spontaneous and sustained atrial fibrillation (AF). Atrial cardiomyocytes from the Tbx5-mutant mice exhibited action potential abnormalities, including spontaneous depolarizations, which were rescued by chelating free calcium. We identified a multitiered transcriptional network that linked seven previously defined AF risk loci: TBX5 directly activated PITX2, and TBX5 and PITX2 antagonistically regulated membrane effector genes Scn5a, Gja1, Ryr2, Dsp, and Atp2a2 In addition, reduced Tbx5 dose by adult-specific haploinsufficiency caused decreased target gene expression, myocardial automaticity, and AF inducibility, which were all rescued by Pitx2 haploinsufficiency in mice. These results defined a transcriptional architecture for atrial rhythm control organized as an incoherent feed-forward loop, driven by TBX5 and modulated by PITX2. TBX5/PITX2 interplay provides tight control of atrial rhythm effector gene expression, and perturbation of the co-regulated network caused AF susceptibility. This work provides a model for the molecular mechanisms underpinning the genetic implication of multiple AF genome-wide association studies loci and will contribute to future efforts to stratify patients for AF risk by genotype.

  7. Androgen receptor (CAG)n polymorphisms and breast cancer risk in a Han Chinese population.

    Science.gov (United States)

    Dang, J; Peng, L; Zhong, H J; Huo, Z H

    2015-08-28

    The androgen receptor (AR) is involved in the differentiation and growth of breast cancer. Genetic markers in the AR gene have a plausible role in modulating the risk of breast cancer. In this study, we studied the association of breast cancer and the trinucleotide repeat polymorphism (CAG)n in exon 1 of the AR gene in 202 patients with breast cancer and 183 healthy controls from our hospital (Yinchuan, China). Repeat lengths were determined by fluorescent DNA fragment analysis using the ABI GeneScan software and DNA sequencing. We detected 17 short tandem repeat alleles in exon 1 in the Han population of Ningxia Province, China. The CAG repeat number ranged from 14 to 31 and the frequency ranged from 0.339 to 24.460%. Generally, (CAG)n repeat lengths 22 were classified as long (L). No association was found between breast cancer and the S/L (CAG) variants. However, the frequency of the (CAG)25 repeats in the breast cancer group was significantly higher than that in the control group (P = 0.033, odds ratio = 1.790, 95% confidence interval = 1.044-3.069). These findings indicate a role for AR gene (CAG)n variations in breast cancer and might be informative for future genetic or biological studies on breast cancer, although these findings need replication in other populations.

  8. Oxytocin receptor gene polymorphism modulates the effects of social support on heart rate variability.

    Science.gov (United States)

    Kanthak, Magdalena K; Chen, Frances S; Kumsta, Robert; Hill, LaBarron K; Thayer, Julian F; Heinrichs, Markus

    2016-05-01

    A large body of empirical research has demonstrated stress-buffering effects of social support. However, recent studies suggest that genetic variation of the oxytocin system (specifically, a common single nucleotide polymorphism, rs53576, of the oxytocin receptor gene) modulates the efficacy of social support. The timing and neurobiological basis of this genetic modulation were investigated using a standardized, laboratory-based psychological stress procedure (Trier Social Stress Test for Groups, TSST-G). To index potential stress buffering effects of social support mediated by the oxytocin system, heart rate variability (HRV) was obtained before and during the TSST-G from 40 healthy participants. Results indicate that social support is associated with higher HRV only in G allele carriers. Specifically, social support increased heart rate variability during direct social interaction and only in individuals with at least one copy of the G allele of rs53576. These findings support the idea that the stress-attenuating effects of social support are modulated by genetic variation of the oxytocin system.

  9. FOXO3 modulates endothelial gene expression and function by classical and alternative mechanisms.

    Science.gov (United States)

    Czymai, Tobias; Viemann, Dorothee; Sticht, Carsten; Molema, Grietje; Goebeler, Matthias; Schmidt, Marc

    2010-04-02

    FOXO transcription factors represent targets of the phosphatidylinositol 3-kinase/protein kinase B survival pathway controlling important biological processes, such as cell cycle progression, apoptosis, vascular remodeling, stress responses, and metabolism. Recent studies suggested the existence of alternative mechanisms of FOXO-dependent gene expression beyond classical binding to a FOXO-responsive DNA-binding element (FRE). Here we analyzed the relative contribution of those mechanisms to vascular function by comparing the transcriptional and cellular responses to conditional activation of FOXO3 and a corresponding FRE-binding mutant in human primary endothelial cells. We demonstrate that FOXO3 controls expression of vascular remodeling genes in an FRE-dependent manner. In contrast, FOXO3-induced cell cycle arrest and apoptosis occurs independently of FRE binding, albeit FRE-dependent gene expression augments the proapoptotic response. These findings are supported by bioinformatical analysis, which revealed a statistical overrepresentation of cell cycle regulators and apoptosis-related genes in the group of co-regulated genes. Molecular analysis of FOXO3-induced endothelial apoptosis excluded modulators of the extrinsic death receptor pathway and demonstrated important roles for the BCL-2 family members BIM and NOXA in this process. Although NOXA essentially contributed to FRE-dependent apoptosis, BIM was effectively induced in the absence of FRE-binding, and small interfering RNA-mediated BIM depletion could rescue apoptosis induced by both FOXO3 mutants. These data suggest BIM as a critical cell type-specific mediator of FOXO3-induced endothelial apoptosis, whereas NOXA functions as an amplifying factor. Our study provides the first comprehensive analysis of alternatively regulated FOXO3 targets in relevant primary cells and underscores the importance of such genes for endothelial function and integrity.

  10. Expression of specific inflammasome gene modules stratifies older individuals into two extreme clinical and immunological states

    Science.gov (United States)

    Furman, David; Chang, Junlei; Lartigue, Lydia; Bolen, Christopher R; Haddad, François; Gaudilliere, Brice; Ganio, Edward A; Fragiadakis, Gabriela K; Spitzer, Matthew H; Douchet, Isabelle; Daburon, Sophie; Moreau, Jean-François; Nolan, Garry P; Blanco, Patrick; Déchanet-Merville, Julie; Dekker, Cornelia L; Jojic, Vladimir; Kuo, Calvin J; Davis, Mark M; Faustin, Benjamin

    2017-01-01

    Low-grade, chronic inflammation has been associated with many diseases of aging, but the mechanisms responsible for producing this inflammation remain unclear. Inflammasomes can drive chronic inflammation in the context of an infectious disease or cellular stress, and they trigger the maturation of interleukin-1β (IL-1β). Here we find that the expression of specific inflammasome gene modules stratifies older individuals into two extremes: those with constitutive expression of IL-1β, nucleotide metabolism dysfunction, elevated oxidative stress, high rates of hypertension and arterial stiffness; and those without constitutive expression of IL-1β, who lack these characteristics. Adenine and N4-acetylcytidine, nucleotide-derived metabolites that are detectable in the blood of the former group, prime and activate the NLRC4 inflammasome, induce the production of IL-1β, activate platelets and neutrophils and elevate blood pressure in mice. In individuals over 85 years of age, the elevated expression of inflammasome gene modules was associated with all-cause mortality. Thus, targeting inflammasome components may ameliorate chronic inflammation and various other age-associated conditions. PMID:28092664

  11. Androgen excess: Investigations and management.

    Science.gov (United States)

    Lizneva, Daria; Gavrilova-Jordan, Larisa; Walker, Walidah; Azziz, Ricardo

    2016-11-01

    Androgen excess (AE) is a key feature of polycystic ovary syndrome (PCOS) and results in, or contributes to, the clinical phenotype of these patients. Although AE will contribute to the ovulatory and menstrual dysfunction of these patients, the most recognizable sign of AE includes hirsutism, acne, and androgenic alopecia or female pattern hair loss (FPHL). Evaluation includes not only scoring facial and body terminal hair growth using the modified Ferriman-Gallwey method but also recording and possibly scoring acne and alopecia. Moreover, assessment of biochemical hyperandrogenism is necessary, particularly in patients with unclear or absent hirsutism, and will include assessing total and free testosterone (T), and possibly dehydroepiandrosterone sulfate (DHEAS) and androstenedione, although these latter contribute limitedly to the diagnosis. Assessment of T requires use of the highest quality assays available, generally radioimmunoassays with extraction and chromatography or mass spectrometry preceded by liquid or gas chromatography. Management of clinical hyperandrogenism involves primarily either androgen suppression, with a hormonal combination contraceptive, or androgen blockade, as with an androgen receptor blocker or a 5α-reductase inhibitor, or a combination of the two. Medical treatment should be combined with cosmetic treatment including topical eflornithine hydrochloride and short-term (shaving, chemical depilation, plucking, threading, waxing, and bleaching) and long-term (electrolysis, laser therapy, and intense pulse light therapy) cosmetic treatments. Generally, acne responds to therapy relatively rapidly, whereas hirsutism is slower to respond, with improvements observed as early as 3 months, but routinely only after 6 or 8 months of therapy. Finally, FPHL is the slowest to respond to therapy, if it will at all, and it may take 12 to 18 months of therapy for an observable response.

  12. Identification of Gene Modules Associated with Low Temperatures Response in Bambara Groundnut by Network-Based Analysis.

    Directory of Open Access Journals (Sweden)

    Venkata Suresh Bonthala

    Full Text Available Bambara groundnut (Vigna subterranea (L. Verdc. is an African legume and is a promising underutilized crop with good seed nutritional values. Low temperature stress in a number of African countries at night, such as Botswana, can effect the growth and development of bambara groundnut, leading to losses in potential crop yield. Therefore, in this study we developed a computational pipeline to identify and analyze the genes and gene modules associated with low temperature stress responses in bambara groundnut using the cross-species microarray technique (as bambara groundnut has no microarray chip coupled with network-based analysis. Analyses of the bambara groundnut transcriptome using cross-species gene expression data resulted in the identification of 375 and 659 differentially expressed genes (p<0.01 under the sub-optimal (23°C and very sub-optimal (18°C temperatures, respectively, of which 110 genes are commonly shared between the two stress conditions. The construction of a Highest Reciprocal Rank-based gene co-expression network, followed by its partition using a Heuristic Cluster Chiseling Algorithm resulted in 6 and 7 gene modules in sub-optimal and very sub-optimal temperature stresses being identified, respectively. Modules of sub-optimal temperature stress are principally enriched with carbohydrate and lipid metabolic processes, while most of the modules of very sub-optimal temperature stress are significantly enriched with responses to stimuli and various metabolic processes. Several transcription factors (from MYB, NAC, WRKY, WHIRLY & GATA classes that may regulate the downstream genes involved in response to stimulus in order for the plant to withstand very sub-optimal temperature stress were highlighted. The identified gene modules could be useful in breeding for low-temperature stress tolerant bambara groundnut varieties.

  13. Castration induces up-regulation of intratumoral androgen biosynthesis and androgen receptor expression in an orthotopic VCaP human prostate cancer xenograft model.

    Science.gov (United States)

    Knuuttila, Matias; Yatkin, Emrah; Kallio, Jenny; Savolainen, Saija; Laajala, Teemu D; Aittokallio, Tero; Oksala, Riikka; Häkkinen, Merja; Keski-Rahkonen, Pekka; Auriola, Seppo; Poutanen, Matti; Mäkelä, Sari

    2014-08-01

    Androgens are key factors involved in the development and progression of prostate cancer (PCa), and PCa growth can be suppressed by androgen deprivation therapy. In a considerable proportion of men receiving androgen deprivation therapy, however, PCa progresses to castration-resistant PCa (CRPC), making the development of efficient therapies challenging. We used an orthotopic VCaP human PCa xenograft model to study cellular and molecular changes in tumors after androgen deprivation therapy (castration). Tumor growth was monitored through weekly serum prostate-specific antigen measurements, and mice with recurrent tumors after castration were randomized to treatment groups. Serum prostate-specific antigen concentrations showed significant correlation with tumor volume. Castration-resistant tumors retained concentrations of intratumoral androgen (androstenedione, testosterone, and 5α-dihydrotestosterone) at levels similar to tumors growing in intact hosts. Accordingly, castration induced up-regulation of enzymes involved in androgen synthesis (CYP17A1, AKR1C3, and HSD17B6), as well as expression of full-length androgen receptor (AR) and AR splice variants (AR-V1 and AR-V7). Furthermore, AR target gene expression was maintained in castration-resistant xenografts. The AR antagonists enzalutamide (MDV3100) and ARN-509 suppressed PSA production of castration-resistant tumors, confirming the androgen dependency of these tumors. Taken together, the findings demonstrate that our VCaP xenograft model exhibits the key characteristics of clinical CRPC and thus provides a valuable tool for identifying druggable targets and for testing therapeutic strategies targeting AR signaling in CRPC.

  14. Matrix factorization reveals aging-specific co-expression gene modules in the fat and muscle tissues in nonhuman primates

    Science.gov (United States)

    Wang, Yongcui; Zhao, Weiling; Zhou, Xiaobo

    2016-10-01

    Accurate identification of coherent transcriptional modules (subnetworks) in adipose and muscle tissues is important for revealing the related mechanisms and co-regulated pathways involved in the development of aging-related diseases. Here, we proposed a systematically computational approach, called ICEGM, to Identify the Co-Expression Gene Modules through a novel mathematical framework of Higher-Order Generalized Singular Value Decomposition (HO-GSVD). ICEGM was applied on the adipose, and heart and skeletal muscle tissues in old and young female African green vervet monkeys. The genes associated with the development of inflammation, cardiovascular and skeletal disorder diseases, and cancer were revealed by the ICEGM. Meanwhile, genes in the ICEGM modules were also enriched in the adipocytes, smooth muscle cells, cardiac myocytes, and immune cells. Comprehensive disease annotation and canonical pathway analysis indicated that immune cells, adipocytes, cardiomyocytes, and smooth muscle cells played a synergistic role in cardiac and physical functions in the aged monkeys by regulation of the biological processes associated with metabolism, inflammation, and atherosclerosis. In conclusion, the ICEGM provides an efficiently systematic framework for decoding the co-expression gene modules in multiple tissues. Analysis of genes in the ICEGM module yielded important insights on the cooperative role of multiple tissues in the development of diseases.

  15. Aberrant AR Signaling as a Function of Declining Androgen

    Science.gov (United States)

    2005-03-01

    CAG are associated with diseases such as Huntington disease and spinal and bulbar muscular atro- phy, which is commonly called Kennedy’s disease . This...Sequence variation and size ranges of CAG repeats in the Machado-Joseph disease , spinocerebellar ataxia type I and androgen receptor genes. Hutm. Mot...Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author( s ) and should not be

  16. Loss of exogenous androgen dependence by prostate tumor cells is associated with elevated glucuronidation potential

    S