WorldWideScience

Sample records for andrew zoltan fenves

  1. A Conversation with Zoltan P. Dienes

    Science.gov (United States)

    Sriraman, Bharath; Lesh, Richard

    2007-01-01

    The name of Zoltan P. Dienes (1916- ) stands with those of Jean Piaget, Jerome Bruner, Edward Begle, and Robert Davis as a legendary figure whose work left a lasting impression on the field of mathematics education. Dienes' name is synonymous with the multibase blocks that he invented for the teaching of place value. Among numerous other things,…

  2. The Zoltan and Isorropia Parallel Toolkits for Combinatorial Scientific Computing: Partitioning, Ordering and Coloring

    Directory of Open Access Journals (Sweden)

    Erik G. Boman

    2012-01-01

    Full Text Available Partitioning and load balancing are important problems in scientific computing that can be modeled as combinatorial problems using graphs or hypergraphs. The Zoltan toolkit was developed primarily for partitioning and load balancing to support dynamic parallel applications, but has expanded to support other problems in combinatorial scientific computing, including matrix ordering and graph coloring. Zoltan is based on abstract user interfaces and uses callback functions. To simplify the use and integration of Zoltan with other matrix-based frameworks, such as the ones in Trilinos, we developed Isorropia as a Trilinos package, which supports most of Zoltan's features via a matrix-based interface. In addition to providing an easy-to-use matrix-based interface to Zoltan, Isorropia also serves as a platform for additional matrix algorithms. In this paper, we give an overview of the Zoltan and Isorropia toolkits, their design, capabilities and use. We also show how Zoltan and Isorropia enable large-scale, parallel scientific simulations, and describe current and future development in the next-generation package Zoltan2.

  3. Evaluating Zoltan for Static Load Balancing on BlueGene Architectures

    Energy Technology Data Exchange (ETDEWEB)

    Kumfert, G

    2007-11-15

    The purpose of this TechBase was to evaluate the Zoltan load-balancing library from Sandia National Laboratories as a possible replacement for ParMetis, which had been the load balancer of choice for nearly a decade but does not scale to the full 64,000 processors of BlueGene/L. This evaluation was successful in producing a clear result, but the result was unfortunately negative. Although Zoltan presents a collection load-balancing algorithms, none were able to meet or exceed the combined scalability and quality of ParMetis on representative datasets.

  4. George Andrew Olah

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 12. George Andrew ... Hungarian born American chemist, George Andrew Olah wasa prolific researcher. The central theme ... He leavesbehind a large body of work comprising almost 1500 papersand twenty books for the scientific community.

  5. George Andrews' Game

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 2. George Andrews' Game. Jerold Mathews. General Article Volume 14 Issue 2 February 2009 pp 172-178. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/014/02/0172-0178. Keywords. Fibonacci ...

  6. Millikan, Prof. Robert Andrews

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1935 Honorary. Millikan, Prof. Robert Andrews Nobel Laureate (Physics) - 1923. Date of birth: 22 March 1868. Date of death: 19 December 1953. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the ...

  7. George Andrews' Game

    Indian Academy of Sciences (India)

    Admin

    helping international students learn English. Keywords. Fibonacci numbers, Zecken- dorf's theorem, Andrew's game, greedy algorithm. T his is an expository article show ing how Zeck- endorf's T heorem (every positive integer can be represented in one and only one w ay as the sum of non-consecutive Fibonacci num bers) ...

  8. Interview with Andrew Dalby

    OpenAIRE

    Mac Con Iomaire, Máirtín

    2016-01-01

    Andrew Dalby (born 1947 in Liverpool) is an English linguist, translator and historian and author of numerous articles and several books on a wide range of topics including food history, language, and Classical texts. Dalby studied Latin, French and Greek at the Bristol Grammar School and University of Cambridge. Here he also studied Romance languages and linguistics, earning a bachelor's degree in 1970. Dalby worked for fifteen years at Cambridge University Library, eventually specialising i...

  9. Mortality from Hurricane Andrew.

    Science.gov (United States)

    Lew, E O; Wetli, C V

    1996-05-01

    Hurricane Andrew, a category 4 storm, made landfall in South Florida on August 24, 1992, and caused extensive structural and environmental damage. The Dade County Medical Examiner Department investigated 15 deaths directly related to the storm and another 15 natural deaths indirectly related to the storm. The aftermath of the hurricane continued to create circumstances that lead to 32 accidental deaths, five suicides, and four homicides over the next six months. Traffic fatalities due to uncontrolled intersections accounted for one-third of the post-storm accidental deaths. Dyadic deaths (homicide-suicide) doubled in rate for the six months following the storm. The limited number of direct hurricane deaths is attributed to advance storm warnings, its occurrence on a weekend, the storm's passage through less populated areas of the county, and the relatively modest amount of accompanying rainfall.

  10. Andrew spares Florida Coast

    Science.gov (United States)

    Bush, Susan

    When geologists heard of the intensity of Hurricane Andrew, which struck the Florida coast on August 25 and then moved on to southern Louisiana, they were expecting the same kinds of coastal damage that Hurricane Hugo brought to the Caribbean and Carolina shores in 1989. Both storms were category 4 hurricanes, having winds of 131-155 mph and surges of 13-18 feet. However, the coastal damage never materialized, leaving geologists to analyze the factors that lessened the impact of the storm. “For minimum coastal damage, you couldn't have designed a better storm,” said Orrin Pilkey, director of the Program for the Study of Developed Shorelines (PSDS) in Durham, N.C. This was due in part to the nature of the storm itself and where it hit land, and in part to the regional geology, said Rob Thieler of PSDS. Despite the huge amounts of damage to buildings, there was virtually no evidence of coastal process destruction, he said.

  11. In Memoriam: George Andrew Olah

    Indian Academy of Sciences (India)

    A Nobel Laureate in chemistry, George Andrew Olah, was a giant who transformed many ideas of fundamental organic chemistry. A kind and generous gentleman, ... cluded investigations into superacids and ways to generate and study long-lived carbocations. These investigations led him to distinguish between classical ...

  12. Andrew A. Benson: personal recollections.

    Science.gov (United States)

    Nonomura, Arthur; Lorimer, George; Holtz, Barry; Vacquier, Victor; Biel, Karl Y; Govindjee

    2016-03-01

    Andrew A. Benson, one of the greatest and much loved scientists of our century, passed away on January 16, 2015; he was born on September 24, 1917. A grand celebration of his life was held on February 6, 2015, in California. Here, we present one of his photographs and key excerpts from what was said then, and soon thereafter.

  13. The Americas and Hurricane Andrew

    Science.gov (United States)

    1992-01-01

    Image taken on August 25, 1992 by NOAA GOES-7 of the Americas and Hurricane Andrew.Photo Credit: Image produced by F. Hasler, M. Jentoft-Nilsen, H. Pierce, K. Palaniappan, and M. Manyin. NASA Goddard Lab for Atmospheres - Data from National Oceanic and Atmospheric Administration (NOAA).

  14. Safety and design impact of hurricane Andrew

    International Nuclear Information System (INIS)

    Guey, Ching N.

    2004-01-01

    Turkey Point completed the IPE in June of 1991. Hurricane Andrew landed at Turkey Point on August 24, 1992. Although the safety related systems, components and structures were not damaged by the Hurricane Andrew, certain nonsafety related components and the neighboring fossil plant sustained noticeable damage. Among the major components that were nonsafety related but would affect the PRA of the plant included the service water pumps and the high tower. This paper discusses the safety and design impact of Hurricane Andrew on Turkey Point Nuclear Power Plant. The risk of hurricanes on the interim and evolving plant configurations are briefly described. The risk of the plant from internal events as a result of damage incurred during Hurricane Andrew are discussed. The design change as the result of Hurricane Andrew and its impact on the PRA are presented. (author)

  15. Psychiatric morbidity following Hurricane Andrew.

    Science.gov (United States)

    David, D; Mellman, T A; Mendoza, L M; Kulick-Bell, R; Ironson, G; Schneiderman, N

    1996-07-01

    The nature of psychiatric morbidity in previously non-ill subjects from the area most affected by Hurricane Andrew was investigated at 6-12 months posthurricane. Preliminary associations of morbidity with personal and event-related risk factors were also determined. Fifty one percent (31/61) met criteria for a new-onset disorder, including posttraumatic stress disorder (PTSD) in 36%, major depression (MD) in 30%, and other anxiety disorders in 20%. Thirty four subjects (56%) had significant symptoms persisting beyond 6 months. Having sustained "severe damage" was the risk factor most strongly associated with outcome. Our data underscore the range of psychiatric morbidity related to a natural disaster, and suggest a relationship to chronic stressors.

  16. Obituary: Andrew Stephen Wilson, 1947-2008

    Science.gov (United States)

    Veilleux, Sylvain

    2009-01-01

    On 24 May 2008, Andrew Stephen Wilson passed away at the age of 61, in his home in Silver Spring, Maryland, from complications resulting from a painful spinal illness. Andrew was arguably one of the first truly multi-wavelength astronomers of his generation. His scientific work on active galactic nuclei [AGN] spanned the entire electromagnetic spectrum from the radio to the X-rays. Andrew was born in Doncaster, Yorkshire, England, on 26 March 1947. He was the younger of two brothers whose births were separated by the Second World War. His father, Norman, came from a relatively affluent family who were coal merchants. His mother, Mary, came from a less comfortable background, one of seven children, daughter of a skilled cabinet maker/French polisher, who went through a very hard time during the depression. As a teacher, she placed enormous value on hard work and education as a way of gaining advancement in life. When Andrew was four, the family moved to Skipton, a nice market town in the Yorkshire dales. Andrew went to a small village school until age eleven when he entered Ermysted's Grammar School. He was an enthusiastic soccer and cricket player. He never lost his enthusiasm for soccer and supported the local soccer team, Leeds United, for all his life. Andrew also followed the Yorkshire county cricket team. Andrew's interest in astronomy stemmed from the fact that at Ermysted's Grammar School someone donated a four-inch refracting telescope, so he and his friends used to go back in the evenings to investigate the rings of Saturn, the moons of Jupiter, and various nebulae. While an undergraduate at Cambridge, Andrew joined the astronomy club and ground an 8-inch mirror by hand as a part of a telescope that he set up in the backyard of his parents' house. Andrew spent hours observing with this telescope, and it was the wonder of the family. At Cambridge, Andrew obtained his bachelor's degree with first-class honors in 1969. During a short visit in London with his

  17. A Reanalysis of Hurricane Andrew's Intensity.

    Science.gov (United States)

    Landsea, Christopher W.; Franklin, James L.; McAdie, Colin J.; Beven, John L., II; Gross, James M.; Jarvinen, Brian R.; Pasch, Richard J.; Rappaport, Edward N.; Dunion, Jason P.; Dodge, Peter P.

    2004-11-01

    Hurricane Andrew of 1992 caused unprecedented economic devastation along its path through the Bahamas, southeastern Florida, and Louisiana. Damage in the United States was estimated to be $26 billion (in 1992 dollars), making Andrew one of the most expensive natural disasters in U.S. history. This hurricane struck southeastern Florida with maximum 1-min surface winds estimated in a 1992 poststorm analysis at 125 kt (64 m s-1). This original assessment was primarily based on an adjustment of aircraft reconnaissance flight-level winds to the surface.Based on recent advancements in the understanding of the eyewall wind structure of major hurricanes, the official intensity of Andrew was adjusted upward for five days during its track across the Atlantic Ocean and Gulf of Mexico by the National Hurricane Center Best Track Change Committee. In particular, Andrew is now assessed by the National Hurricane Center to be a Saffir Simpson Hurricane Scale category-5 hurricane (the highest intensity category possible) at its landfall in southeastern Florida, with maximum 1-min winds of 145 kt (75 m s-1). This makes Andrew only the third category-5 hurricane to strike the United States since at least 1900. Implications for how this change impacts society's planning for such extreme events are discussed.

  18. Andrew A. Benson, 1917-2015.

    Science.gov (United States)

    Lichtenthaler, Hartmut K; Buchanan, Bob B; Douce, Roland; Govindjee

    2015-05-01

    On January 16, 2015, Professor Andrew Alm Benson, one of the leading plant biochemists of the twentieth century, died in La Jolla, California, at the age of 97; he was born on September 24, 1917. Benson was known especially for his pioneering studies on photosynthesis (CO2 assimilation, carbon reduction cycle) and plant lipids (phospholipid phosphatidyl glycerol; and the sulfolipid, sulfoquinovosyl diglyceride). A photograph of Benson is shown in Fig. 1. Fig. 1 Photograph of Andrew A. Benson. Annual Review of Plant Biology, Vol. 53, 2002, published with permission.

  19. Dr. Andrew Foster: A Literature Review

    Science.gov (United States)

    Runnels, Joel

    2017-01-01

    Often compared to Laurent Clerc, Thomas Gallaudet, and Alexander Graham Bell, Dr. Andrew Foster was a deaf African American who founded 32 schools for the deaf in 13 African nations. The 60th anniversary of his arrival in Liberia and Ghana and the 30th anniversary of his tragic death in a Rwanda airplane accident both occur in 2017. Renewed…

  20. George Andrew Olah: Across Conventional Lines

    Indian Academy of Sciences (India)

    Permanent link: https://www.ias.ac.in/article/fulltext/reso/022/12/1111-1153. Keywords. Electron-deficient intermediates, Friedel–Crafts chemistry, carbocations, carbanions, methanol economy, anthropogenic chemical carbon cycle. Abstract. Hungarian born American chemist, George Andrew Olah wasa prolific researcher.

  1. Obituary: Andrew Lange (1957-2010)

    Science.gov (United States)

    Kamionkowski, Marc

    2011-12-01

    The worlds of physics and astrophysics were stunned to learn on 22 January 2010 that Andrew Lange, the Marvin L. Goldberger Professor of Physics at Caltech, had taken his own life the night before. He had succumbed to the severe depression that he had suffered from for many years, unbeknownst to even his closest colleagues. Lange will perhaps be best remembered as the co-leader of Boomerang, the balloon-borne experiment that provided the first high-angular-resolution map of the cosmic microwave background (CMB). And while this was certainly his most notable achievement, Andrew amassed a record of accomplishment as an instrumentalist, leader, mentor, and communicator that extended much further. Andrew was born in Urbana, Illinois on July 23, 1957, the son of an architect and a librarian, and raised primarily in Connecticut. His family and early friends remember him as a serious and extremely intelligent child and young man. Andrew Lange's lifelong interest in the CMB was nurtured as an undergraduate at Princeton University by David Wilkinson, and he recalled fondly a summer spent working with John Mather at Goddard Space Flight Center. Andrew Lange went to graduate school in physics at Berkeley where he worked in Paul Richards' group. Although his thesis project, the Berkeley-Nagoya rocket experiment, showed an anomalous sub-millimeter excess in the CMB spectrum that was shortly thereafter shown by a later flight of the same rocket and COBE-FIRAS to be incorrect, Lange's talents were recognized by the physics department at Berkeley who appointed him shortly after his PhD (1987) to their faculty. While on the Berkeley faculty, Andrew obtained early detections of the Sunyaev-Zeldovich effect, upper limits to small-angle CMB fluctuations, and important infrared constraints to the interstellar medium. He also led a pioneering instrument operating 300 mK detectors for a small infrared satellite experiment. This early work showed high ambition and daring, and it pioneered

  2. A History of the Andrew File System

    CERN Multimedia

    CERN. Geneva; Altman, Jeffrey

    2011-01-01

    Derrick Brashear and Jeffrey Altman will present a technical history of the evolution of Andrew File System starting with the early days of the Andrew Project at Carnegie Mellon through the commercialization by Transarc Corporation and IBM and a decade of OpenAFS. The talk will be technical with a focus on the various decisions and implementation trade-offs that were made over the course of AFS versions 1 through 4, the development of the Distributed Computing Environment Distributed File System (DCE DFS), and the course of the OpenAFS development community. The speakers will also discuss the various AFS branches developed at the University of Michigan, Massachusetts Institute of Technology and Carnegie Mellon University.

  3. Andrew shortens lifetime of Louisiana Barrier Islands

    Science.gov (United States)

    Bush, Susan

    Because the Isles Dernieres, a series of four barrier islands off the coast of Louisiana, have one of the most rapidly eroding shorelines in the world, geologists at the U.S. Geological Survey and the Louisiana Geological Survey have been monitoring erosion activity over the last several years, said Jeff Williams of the USGS in Reston, Va. Hurricane Andrew, which struck the state on August 26, caused severe erosional damage to these islands that has shortened their lifetimes.Before Andrew struck, geologists projected that Raccoon Island would disappear below sea level by the year 2001 and that Whiskey Island would disappear by 2016. Now, due to the severe erosion from Hurricane Andrew, the scientists claim that the islands may disappear before the turn of the century, and the other islands in the Dernieres chain are expected to follow suit within 2 decades. Raccoon, Whiskey, Trinity, and East islands make up the Isles Dernieres, which existed as one island, known as the Isle Derniere, before an 1856 hurricane and subsequent erosion.

  4. Children describe life after Hurricane Andrew.

    Science.gov (United States)

    Coffman, S

    1994-01-01

    Hurricane Andrew, which devastated the south Florida coast in August 1992, left over 250,000 people homeless with multiple health and social problems. This nursing study explored the experiences of 17 children, ages 5 through 12, who lived in the geographic area of storm damage. Common experiences described by the children included remembering the storm, dealing with after-effects, and reestablishing a new life. In general, children described a sense of strangeness, articulated as "life is weird" after the hurricane. In addition to stressful responses, many positive reactions were described by children in the study, revealing that the disaster also had a maturing effect.

  5. Shallow water currents during Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Glenn, Scott M.

    1999-10-01

    Oceanographic measurements are used in combination with a numerical model to examine the influence of stratification on shallow water currents during the directly forced stage of a tropical cyclone (Hurricane Andrew) on the continental shelf. The following stratification-dependent coastal processes are examined: (1) turbulent mixing, (2) coastally trapped waves, (3) near-inertial oscillations, and (4) upwelling and downwelling. Turbulent mixing was strong within 1 Rw (radius of maximum winds) of the storm track, and stratification was nearly destroyed. Turbulent mixing was weak at distances greater than 2 Rw. The dominant coastal wave was a barotropic Kelvin wave generated as the storm surge relaxed after landfall. Baroclinic near-inertial oscillations were dominant at the shelf break and occurred along with a barotropic response on the middle shelf. Downwelling-favorable flow developed east of the track prior to the storm peak, and upwelling-favorable flow evolved west of the track as the eye crossed the shelf. The idealized storm flow was modified by local barotropic and baroclinic pressure gradients on the shelf. Ocean circulation during Hurricane Andrew was hindcast using both stratified and unstratified three-dimensional numerical models. For areas within 1 Rw of the storm track, the unstratified model matched the observed currents better than the stratified model, partly because of errors in the initial stratification. At distances greater than 2 Rw the influence of stratification increases, and the unstratified model does not reproduce the observed upwelling-favorable flow.

  6. Remote sensing for hurricane Andrew impact assessment

    Science.gov (United States)

    Davis, Bruce A.; Schmidt, Nicholas

    1994-01-01

    Stennis Space Center personnel flew a Learjet equipped with instrumentation designed to acquire imagery in many spectral bands into areas most damaged by Hurricane Andrew. The calibrated airborne multispectral scanner (CAMS), a NASA-developed sensor, and a Zeiss camera acquired images of these areas. The information derived from the imagery was used to assist Florida officials in assessing the devastation caused by the hurricane. The imagery provided the relief teams with an assessment of the debris covering roads and highways so cleanup plans could be prioritized. The imagery also mapped the level of damage in residential and commercial areas of southern Florida and provided maps of beaches and land cover for determination of beach loss and vegetation damage, particularly the mangrove population. Stennis Space Center personnel demonstrated the ability to respond quickly and the value of such response in an emergency situation. The digital imagery from the CAMS can be processed, analyzed, and developed into products for field crews faster than conventional photography. The resulting information is versatile and allows for rapid updating and editing. Stennis Space Center and state officials worked diligently to compile information to complete analyses of the hurricane's impact.

  7. Hurricane Andrew and a pediatric emergency department.

    Science.gov (United States)

    Quinn, B; Baker, R; Pratt, J

    1994-04-01

    To determine the effect of Hurricane Andrew on a pediatric emergency department. A retrospective analysis of ED visits through the use of computerized records and chart review. A children's hospital in South Florida. All patients presenting to the ED during the control week and the two study weeks after the hurricane. Census, diagnoses, admission rate, and patient geographic origin and age. During week 1, there was an average daily increase of 40.7% in patient volume (P < .01) and a 3.3% decrease in the admission rate (P < .01). The increased census was due mainly to local patients, rather than those from the most devastated areas. More patients were seen with open wounds, gastroenteritis, and impetigo (all, P < .05); more were more than 18 years old (P < .05). By the second week, both census and admission rate returned to normal; cases of cellulitis (P < .05) and open wounds (P < .001) were increased. Although not statistically significant, a higher percentage of hydrocarbon and/or bleach ingestions was seen for both weeks. Following a hurricane, personnel in a pediatric ED can expect to see an increased census, with more diagnoses of open wounds, gastroenteritis, and skin infections. They may also see hydrocarbon and bleach ingestions. Alerting parents to the potential for injury and accidental poisoning in their children after a hurricane may help prevent the reported morbidity.

  8. Andrew Smith: peame leidma tee majanduskasvuni, mis põhineb säästmisel, investeeringutel ja ekspordil / Andrew Smith

    Index Scriptorium Estoniae

    Smith, Andrew

    2010-01-01

    KPMG (UK) peaökonomist Andrew Smith vastab küsimustele, mis puudutavad majanduskriisi tekkimist, olukorra paranemist, majandusolukorda Suurbritannias, erinevusi Euroopa ja muude maailma piirkondade vahel, sarnasusi Eesti ja Suurbritannia majandusolukorra vahel ning prognoose edaspidiste arengute osas

  9. Appreciating Unity in Diversity: An Interview with Andrew Solomon

    Science.gov (United States)

    Peters, Dane L.

    2014-01-01

    The theme of the AMS 2014 Annual Conference is "Unity in Diversity," a concept that also describes the work of conference keynote speaker Andrew Solomon. Solomon is a writer and lecturer on psychology and politics; winner of the National Book Award; and an activist for LGBT [lesbian, gay, bisexual, and transgender] rights, mental health,…

  10. Hurricane Andrew in Florida: Dynamics of a Disaster.

    Science.gov (United States)

    Willoughby, H. E.; Black, P. G.

    1996-03-01

    Four meteorological factors aggravated the devastation when Hurricane Andrew struck South Florida: completed replacement of the original eyewall by an outer, concentric eyewall while Andrew was still at sea; storm translation so fast that the eye crossed the populated coastline before the influence of land could weaken it appreciably, extreme wind speed, 82 m s1 winds measured by aircraft flying at 2.5 km; and formation of an intense, but nontornadic, convective vortex in the eyewall at the time of landfall. Although Andrew weakened for 12 h during the eyewall replacement, it contained vigorous convection and was reintensifying rapidly as it passed onshore. The Gulf Stream just offshore was warm enough to support a sea level pressure 20-30 hPa lower than the 922 hPa attained, but Andrew bit land before it could reach this potential. The difficult-to-predict mesoscale and vortex-scale phenomena determined the course of events on that windy morning, not a long-term trend toward worse hurricanes.

  11. Hurricane Andrew: Parent Conflict As a Moderator of Children's Adjustment.

    Science.gov (United States)

    Wasserstein, Shari B.; La Greca, Annette M.

    1998-01-01

    Three months after Hurricane Andrew, 89 children in grades four to six who lived in two-parent families and had experienced the hurricane were tested. Children's symptoms of posttraumatic stress disorder were related to their perceptions of parental conflict; this relationship was stronger for Hispanic children than for other ethnic groups.…

  12. The Mental Health Counselor's Role in Hurricane Andrew.

    Science.gov (United States)

    Dingman, Robert L.

    1995-01-01

    Discusses the effects of Hurricane Andrew on disaster workers, followed by some reported experiences of workers as well as victims. Background on natural disasters in general is given, along with information about crisis intervention. Discusses mental health interventions and various skills needed by disaster mental health counselors. (Author/KW)

  13. Andrew Tracey: Performer, Scholar, Teacher, Mentor | Thram | South ...

    African Journals Online (AJOL)

    A Legacy to Uphold Born to follow in his father Hugh Tracey's footsteps, Andrew Tracey has inspired countless people with his knowledge of African music. This he has done through his publications and films and his teaching and performing from the early days of his career in the 1960s through his Directorship of the ...

  14. Interview with Abel Laureate Sir Andrew J. Wiles

    DEFF Research Database (Denmark)

    Raussen, Martin Hubert; Skau, Christian

    2017-01-01

    Andrew J. Wiles is the recipient of the 2016 Abel Prize of the Norwegian Academy of Science and Letters. The interview was conducted by Martin Raussen And Christian Skau in Oslo on May 23, 2016, in conjunction with the Abel Prize celebration....

  15. Impact of Hurricane Andrew on FPL generation facilities

    International Nuclear Information System (INIS)

    Brannen, W.F.; Adams, R.L.

    1993-01-01

    In the pre-dawn hours of August 25, 1992, Hurricane Andrew made landfall in southern Dade County, Florida. The storm approached directly from the east and moved rapidly across the State and into the Gulf of Mexico. Andrew's intense winds caused unprecedented devastation to structures and facilities in its path. Not surprisingly, Florida Power and Light's (FPL) generation, transmission and distribution facilities in south Florida also suffered extensive damage. Two of FPL's electrical generating sites were located in the direct path of the storm and received its full brunt. This paper presents a review of the damage sustained by those plants, an overview of the unique recovery challenges encountered and a summary of the lessons learned from this experience

  16. Injuries and illnesses related to Hurricane Andrew--Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    On August 26, 1992, Hurricane Andrew struck Louisiana. On August 24, in anticipation of hurricane-related injuries and illnesses, the Office of Public Health (OPH), Louisiana Department of Health and Hospitals, in cooperation with hospital emergency room (ER) and public utility personnel and coroners, established an active emergency surveillance system in 19 parishes to monitor these events. This report summarizes the findings from this emergency surveillance system.

  17. Interview with 2018 Hooke medal winner Andrew McAinsh.

    Science.gov (United States)

    2018-03-14

    Andrew McAinsh received his PhD from the University of Cambridge, UK, working in the laboratory of Steve Jackson on DNA damage and repair mechanisms in yeast. He then joined the laboratory of Peter Sorger as a Jane Coffin Childs Fellow to work as a post-doc on kinetochore biology at the Massachusetts Institute of Technology, Boston, USA. In 2005, he returned to the UK to establish his independent laboratory at the Marie Curie Research Institute, Surrey, before moving to the University of Warwick in 2009 to co-found the Centre for Mechanochemical Cell Biology (CMCB). Subsequently, Andrew was appointed Professor of Cell Biology and became a Wellcome Senior Investigator, and was awarded a Royal Society Wolfson Research Merit Award. He co-directs the MRC Doctoral Training Partnership in Interdisciplinary Biomedical Research, and in 2017 became Head of Division of Biomedical Sciences at Warwick Medical School. Andrew is interested in understanding how the chromosomal multi-protein complex, the kinetochore, ensures error-free chromosome segregation. He is the recipient of the 2018 Hooke medal, established to recognize an emerging leader in cell biology. The Hooke medal is awarded at the annual spring meeting of the British Society for Cell Biology (BSCB). © 2018. Published by The Company of Biologists Ltd.

  18. A pioneer of tropical medicine worldwide: Andrew Balfour, of Khartoum.

    Science.gov (United States)

    Adeel, Ahmed A A

    2013-01-01

    This is an archival account of the career of Sir Andrew Balfour in Khartoum, Sudan during the period 1902 to 1913. As the first director of the Wellcome Tropical Research Laboratories in Khartoum during the period, Andrew Balfour was tasked with establishing the laboratories and at the same time he was engaged in founding the health services in Khartoum. Balfour worked in close collaboration and support from Henry Wellcome and Reginald Wingate, the Governor General of the Sudan. The energetic and meticulous sanitary work of Balfour had a remarkable impact, with Khartoum declared mosquito-free by 1910. Establishing a research base in the laboratories was met with many challenges but eventually Balfour managed to recruit a team of dedicated researchers and to produce well-circulated publications in tropical medicine. Balfour's work in Khartoum later lead him to a distinguished career in tropical medicine. In 1923 he was appointed the first Director of London School of Hygiene and Tropical Medicine. He was also elected President of the Royal Society of Tropical Medicine and Hygiene (1925-27). Sir Andrew Balfour, KCMG, CB, LL D (1873 -1931).

  19. The MacAndrew Scale as a measure of substance of abuse and delinquency among adolescents.

    Science.gov (United States)

    Rathus, S A; Fox, J A; Ortins, J B

    1980-04-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 suburban high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse, but was also shown to be related to crimes against property and persons and to marijuana usage. It was concluded that the MacAndrew Alcoholism Scale may not be uniquely sensitive to alcohol abuse among the population sampled.

  20. The Center for Adventist Research at Andrews University

    Directory of Open Access Journals (Sweden)

    Terry Dwain Robertson

    2015-01-01

    Full Text Available The Center for Adventist Research (CAR, an Andrews University and General Conference of Seventh-day Adventist organization, seeks to promote an understanding and appreciation of the heritage and mission of the Seventh-day Adventist Church (SDA. It combines the resources of the James White Library’s Adventist Heritage Center and the Ellen G. White Estate Branch Office to provide the most extensive collection of Adventist related resources in the world, both physically and digitally. An introduction to the background, collections, and activities of CAR is presented. Of particular interest are the digitization projects.

  1. Micropropagation and in vitro conservation of vanilla (Vanilla planifolia Andrews).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal

    2009-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a source of natural vanillin, plays a major positive role in the economy of several countries. A native to the Central America, its primary gene pool is threatened by deforestation and over collection that has resulted in disappearance of natural habitats and wild species. Therefore, multiplication and conservation of vanilla diversity is of paramount importance because of its narrow genetic base. It plays an important role in the production of disease free planting material for commercial cultivation. Simple protocols for micropropagation, in vitro conservation and synthetic seed production are described in this chapter which could further be applied to other related vanilla species as well.

  2. Prediction of posttraumatic stress symptoms in children after hurricane Andrew.

    Science.gov (United States)

    Vernberg, E M; Silverman, W K; La Greca, A M; Prinstein, M J

    1996-05-01

    The authors used an integrative conceptual model to examine the emergence of posttraumatic stress disorder (PTSD) symptoms in 568 elementary school-age children 3 months after Hurricane Andrew. The model included 4 primary factors: Exposure to Traumatic Events, Child Characteristics, Access to Social Support, and Children's Coping. Overall, 62% of the variance in children's self-reported PTSD symptoms was accounted for by the 4 primary factors, and each factor improved overall prediction of symptoms when entered in the analyses in the order specified by the conceptual model. The findings suggest that the conceptual model may be helpful to organize research and intervention efforts in the wake of natural disasters.

  3. Pharmaceutical services at a medical site after Hurricane Andrew.

    Science.gov (United States)

    Nestor, A; Aviles, A I; Kummerle, D R; Barclay, L P; Rey, J A

    1993-09-01

    The experiences of a group of volunteer clinical pharmacists who provided pharmacy services as part of a disaster relief effort following a hurricane are reported. Hurricane Andrew left many people in southern Florida without shelter and other basic necessities, including health care services. A group of seven pharmacists volunteered to provide services at a temporary medical site set up in a community center. The pharmacy stock consisted of donated drugs. The pharmacists dispensed medications directly to patients and worked closely with other volunteer medical personnel to make sure proper medications were used. Because the pharmacy stock was limited, physicians relied upon the pharmacists for information about therapeutic interchanges, dosage conversions, and new medications. Prescriptions were often ordered and dispensed with only oral instructions. The pharmacists also provided patient counseling, although problems caused by inexperience with certain types of patients, a language barrier, and substandard living conditions after the hurricane made counseling more difficult. The contributions of seven pharmacists who provided services at an emergency medical site after Hurricane Andrew were well received by other health care personnel and by the community.

  4. Posttraumatic stress disorder in adolescents after Hurricane Andrew.

    Science.gov (United States)

    Garrison, C Z; Bryant, E S; Addy, C L; Spurrier, P G; Freedy, J R; Kilpatrick, D G

    1995-09-01

    To examine rates and correlates of posttraumatic stress disorder (PTSD) in adolescents after Hurricane Andrew. A random-digit dialing sample of 158 Hispanic, 116 black, and 104 white adolescent-parent pairs were surveyed in high- and low-impact areas within Dade County, Florida, 6 months after Hurricane Andrew. Subjects completed a structured telephone interview focused on within-disaster experiences and emotional reaction, disaster-related losses, lifetime exposure to violent or traumatic events, recent stressful experiences, and psychiatric symptomatology. Approximately 3% of males (95% confidence interval 0.4 to 5.3) and 9% of females (95% confidence interval 4.6 to 13.7) met the criteria for PTSD. Rates were highest among blacks (8.3%, 95% confidence interval 2.3 to 14.2) and Hispanics (6.1%, 95% confidence interval 2.2 to 9.9) and increased with age (odds ratio of 1.34, 95% confidence interval 1.04 to 1.72) and the number of undesirable events reported (odds ratio of 1.38, 95% confidence interval 1.21 to 1.57). While only a relatively small percentage of adolescents reported symptoms consistent with a diagnosis of PTSD, most reported some posttraumatic symptoms. Postdisaster planning should recognize that common stressful events occurring after disasters may be more strongly associated with PTSD than magnitude of contact with the actual disaster.

  5. Hurricane Andrew-related injuries and illnesses, Louisiana, 1992.

    Science.gov (United States)

    McNabb, S J; Kelso, K Y; Wilson, S A; McFarland, L; Farley, T A

    1995-06-01

    To determine the extent and types of injuries and illnesses in Louisiana associated with or related to Hurricane Andrew, we gathered data from hospital emergency departments and coroner's offices on demographic variables, institution, nature and cause of the injury or illness, body part affected, location, and date and time of the event. A hurricane-related injury or illness was defined as one that occurred from noon on August 24, 1992, through midnight on September 21, 1992, as a direct or indirect result of the preparation for (preimpact), the impact of, or the clean-up after the hurricane (postimpact). Nineteen parishes in south-central Louisiana that were most affected by Hurricane Andrew provided data from patients seen in emergency departments and reports from coroner's offices. Active, advance surveillance of this type promotes and facilitates the reporting of disaster-related health outcomes. Future planning for hurricanes should take into account the high rate of cuts, lacerations, and puncture wounds, particularly during the postimpact phase.

  6. Vroeë Oos-Kaapse tekste: Andrew Geddes Bain (1797-1864) | van ...

    African Journals Online (AJOL)

    Early Eastern Cape Texts: Andrew Geddes Bain (1797-1864) [Afrikaans] Andrew Geddes Bain: fervent letter writer of satirical sketches of contemporary life, transport entrepeneur, military man, farmer, builder of bridges in the dry stone walling technique, autodidact, discoverer of the "Blinkwater Monster" fossil, as well as ...

  7. The Implementation of IAS 16 and IAS 41 at Andrew Peller Limited

    Science.gov (United States)

    Lapointe-Antunes, Pascale; Moore, James

    2013-01-01

    This case asks students to play the role of Doug Grodeckie, Manager of Financial Reporting at Andrew Peller Limited (APL). Doug was asked to prepare a report analyzing Andrew Peller Limited's current tangible long-lived assets disclosures and making recommendations on how best to comply with International Accounting Standard (IAS) 16 Property,…

  8. The MacAndrew Scale as a Measure of Substance Abuse and Delinquency among Adolescents.

    Science.gov (United States)

    Rathus, Spencer A.; And Others

    1980-01-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse but was also related to crimes against property and persons and to marijuana usage. (Author)

  9. Pamela Ngesa A Review of George Gonaís Andrew Mtagwaba ...

    African Journals Online (AJOL)

    Jimmy Gitonga

    Review of George Gona's Andrew Mtagwaba Kailembo: The Life and Times of an African Trade Unionist 173. Review of ... renowned Tanzanian labour movement leader, Andrew Mtagwaba Kailembo has received little .... hanging rather loosely, without clearly showing their role on the road to Pan-African trade union unity.

  10. The paths of Andrew A. Benson: a radio-autobiography.

    Science.gov (United States)

    Nonomura, Arthur M; Holtz, Barry; Biel, Karl Y; Cooney, Robert; Lorimer, George; Govindjee

    2017-10-01

    Andrew A. Benson, one of the greatest biochemists of our time, is celebrated on his centennial by the authors with whom he interacted performing experiments or contemplating metabolic pathways in a wide range of biological kingdoms. He charted the chemical flow of energy in cells, tissues, organs, plants, animals, and ecosystems. Benson collaborated with hundreds of colleagues to examine the natural history of autotrophy, mixotrophy, and heterotrophy while elucidating metabolic pathways. We present here a biological perspective of his body of studies. Benson lived from September 24, 1917, to January 16, 2015. Out of over 1000 autoradiograms he produced in his life, he left a legacy of 50 labeled autoradiograms to the authors who tell the story of his life's work that resulted in Benson's Protocol (Nonomura et al., Photosynth Res 127:369-378, 2016) that has been applied, over the years, for the elucidation of major metabolic pathways by many scientists.

  11. Measurement of perceived disruption during rebuilding following Hurricane Andrew.

    Science.gov (United States)

    Burnett, K; Ironson, G; Benight, C; Wynings, C; Greenwood, D; Carver, C S; Cruess, D; Baum, A; Schneiderman, N

    1997-10-01

    The purpose of this study was to develop and evaluate a measure of perceived disruption during rebuilding following a disaster. Two eight-item scales, which measured intensity of disruption during the entire repair phase (Intensity-RP) and intensity of disruption during the past month (Intensity-PM) were developed and administered to 135 survivors of Hurricane Andrew. At 9 to 12 months postdisaster, Intensity-RP and Intensity-PM were both significantly associated with scores on the Global Severity Index of the SCL-90-R, and with scores on the Impact of Event-Intrusion Scale; Intensity-PM alone was significantly associated with PTSD scores. Regression analyses indicated that each scale contributed significant unique variance in predicting mental health symptoms, even after controlling for relevant demographic and initial disaster exposure variables.

  12. Food-related coping strategies after Hurricane Andrew.

    Science.gov (United States)

    Magnus, M H

    1994-06-01

    This telephone survey examined food-related coping strategies in Floridian households after Hurricane Andrew. Approximately 137 households of university faculty and staff who lived in hurricane-damaged areas were interviewed. The average respondent was a college-educated woman between 41 and 60 years old. Prevailing food-purchasing problems included food stores that were either closed, without perishable food, distant, or crowded. In the absence of electricity and water, changes in food preparation included preparation of meals without a stove, more frequent use of grills and canned food, simpler meals, and less cooking. Changes in kitchen cleanup included using more disposables, cleaning more often, washing dishes by hand, and cleaning up less often because of damage in the kitchen. Respondents indicated that the hurricane experience taught them that they should have acquired more general supplies (eg, coolers, thermoses, propane stoves, and gas burners), more water and ice, and more nonperishable foods before the hurricane.

  13. Philip Andrew Traynor, DDS, FACD, (1874-1962).

    Science.gov (United States)

    Reed, R V

    1996-11-01

    Philip Andrew Traynor was arguably Delaware's most peerless dentist during his lifetime and even until today. He touched many lives, advanced the prestige of the dental profession, and served his state and country unselfishly as a national legislator. Forceful, no nonsense, take charge, persuasive, athlete, soldier, politico, legislator, canine judge, vocalist, dentist--all words that have been used to identify and describe this remarkable, unwonted, and extraordinary man--truly a dental diamond from the Diamond State. Historically it is important to view Traynor's wide ranging accomplishments in perspective. An Irish Catholic and son of the nation's second smallest state, Dr. Traynor affected the lives of thousands of people the length and breadth of his state and even his nation. Whether at the dental chair or congressional lecturn, Philip A. Traynor, a dual savant, imprinted his hallmark. This paper details the unselfish life of a perspicacious man and exceptional dentist, Philip A. Traynor, DDS.

  14. Deaths related to Hurricane Andrew in Florida and Louisiana, 1992.

    Science.gov (United States)

    Combs, D L; Parrish, R G; McNabb, S J; Davis, J H

    1996-06-01

    Information about circumstances leading to disaster-related deaths helps emergency response coordinators and other public health officials respond to the needs of disaster victims and develop policies for reducing the mortality and morbidity of future disasters. In this paper, we describe the decedent population, circumstances of death, and population-based mortality rates related to Hurricane Andrew, and propose recommendations for evaluating and reducing the public health impact of natural disasters. To ascertain the number and circumstances of deaths attributed to Hurricane Andrew in Florida and Louisiana, we contacted medical examiners in 11 Florida counties and coroners in 36 Louisiana parishes. In Florida medical examiners attributed 44 deaths to the hurricane. The mortality rate for directly-related deaths was 4.4 per 1 000 000 population and that for indirectly-related deaths was 8.5 per 1 000 000 population. In Louisiana, coroners attributed 11 resident deaths to the hurricane. Mortality rates were 0.6 per 1000 000 population for deaths directly related to the storm and 2.8 for deaths indirectly related to the storm. Six additional deaths occurred among non-residents who drowned in international waters in the Gulf of Mexico. In both Florida and Louisiana, mortality rates generally increased with age and were higher among whites and males. In addition to encouraging people to follow existing recommendations, we recommend emphasizing safe driving practices during evacuation and clean-up, equipping shelters with basic medical needs for the population served, and modifying zoning and housing legislation. We also recommend developing and using a standard definition for disaster-related deaths, and using population-based statistics to describe the public health effectiveness of policies intended to reduce disaster-related mortality.

  15. Third-order gas-liquid phase transition and the nature of Andrews critical point

    Directory of Open Access Journals (Sweden)

    Tian Ma

    2011-12-01

    Full Text Available The main objective of this article is to study the nature of the Andrews critical point in the gas-liquid transition in a physical-vapor transport (PVT system. A dynamical model, consistent with the van der Waals equation near the Andrews critical point, is derived. With this model, we deduce two physical parameters, which interact exactly at the Andrews critical point, and which dictate the dynamic transition behavior near the Andrews critical point. In particular, it is shown that 1 the gas-liquid co-existence curve can be extended beyond the Andrews critical point, and 2 the transition is first order before the critical point, second-order at the critical point, and third order beyond the Andrews critical point. This clearly explains why it is hard to observe the gas-liquid phase transition beyond the Andrews critical point. Furthermore, the analysis leads naturally the introduction of a general asymmetry principle of fluctuations and the preferred transition mechanism for a thermodynamic system. The theoretical results derived in this article are in agreement with the experimental results obtained in (K. Nishikawa and T. Morita, Fluid behavior at supercritical states studied by small-angle X-ray scattering, Journal of Supercritical Fluid, 13 (1998, pp. 143-148. Also, the derived second-order transition at the critical point is consistent with the result obtained in (M. Fisher, Specific heat of a gas near the critical point, Physical Review, 136:6A (1964, pp. A1599-A1604.

  16. A transnational conference romance: Elsie Andrews, Hildegarde Kneeland, and the Pan-Pacific Women's Association.

    Science.gov (United States)

    Laurie, Alison J

    2009-01-01

    Elsie Andrews, a feminist activist from New Zealand, met Dr. Hildegarde Kneeland, a progressive economist from the United States, at the 1934 Pan-Pacific Women's Association conference in Honolulu. Andrews wrote diaries of her attendance at conferences, and in these writes openly of her attraction and romantic feelings for Kneeland, despite her own long-term domestic partnership back in New Plymouth with Muriel Kirton. This article considers the role conference romances may have played for Andrews and others in encouraging their interest in women's organizations, in the context of literature on romantic friendships and lesbianism.

  17. Cloud-to-ground lightning in Hurricane Andrew

    Science.gov (United States)

    Molinari, John; Moore, Paul K.; Idone, Vincent P.; Henderson, Ronald W.; Saljoughy, Arsalan B.

    1994-08-01

    The spatial and temporal distribution of cloud-to-ground lightning was examined in Hurricane Andrew of 1992. Lightning locations available from the National Lightning Detection Network were superimposed on infrared satellite images to relate lightning activity to hurricane cloud structure. A distinct radial variation occurred in time-averaged flash density, with a weak maximum in the eye wall, a region of near-zero flash density 40 to 100 km from the center, and a steady increase to a large maximum in the outer rainbands 190 km from the center. This radial distribution is consistent with the convective structure of mature hurricanes. Eye wall lightning tended to be episodic, occurring almost exclusively prior to and during periods of intensification of the storm. During these periods, negative flashes occurred several kilometers inward from the highest eye wall cloud tops, in the region of the largest radar reflectivity. Positive eye wall flashes, while small in number, tended to occur directly under the highest cloud tops. The results are suggestive of a normal dipole in sign but outwardly tilted along the sloping eye wall. In general, hurricane flash characteristics resembled those for a background data set of nonhurricane flashes from the same area. The exception occurred for negative flashes in the eye wall, which had a much smaller mean peak current than the background (25.3 kA versus 44.9 kA).

  18. Psychological effects of Hurricane Andrew on an elementary school population.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Tanner, S; Perez, D; Rothe, E; Campo-Bowen, A E; Lahey, B L

    1995-09-01

    To explore the prevalence and progression of posttraumatic symptomatology (PTS), using emotional and behavioral indices of psychopathology in school-age children in the pathway of Hurricane Andrew (HI-IMPACT) and in a comparison group north of Miami (LO-IMPACT). Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form (TRF) were administered 8 weeks and 32 weeks after the hurricane. In addition, 21 measures of disruptive behavior cataloged by Dade County Public Schools were aggregated and compared by grading period between pre- and posthurricane school years. There were no statistically significant differences between the two schools in PTS at 8 weeks after the hurricane, although the children in the HI-IMPACT school were more likely to have severe PTS. TRF findings at 8 weeks revealed that children in the HI-IMPACT school evidenced lower means on the eight TRF scales and on the broader Internalizing and Externalizing measures. Analysis of the disruptive behavior revealed a drop in the marking period immediately after the hurricane in the HI-IMPACT area, but an opposite effect was observed in the LO-IMPACT area. After the hurricane there was an initial increase in PTS and a concomitant decrease in other measures of behavior and psychopathology. PTS remained relatively high throughout the school year, but there was a rebound and subsequent normalization of the measures of disruptive behavior.

  19. Andrew Liehr and the structure of Jahn-Teller surfaces

    Science.gov (United States)

    Chibotaru, Liviu F.; Iwahara, Naoya

    2017-05-01

    The present article is an attempt to draw attention to a seminal work by Andrew Liehr “Topological aspects of conformational stability problem” [1, 2] issued more than half century ago. The importance of this work stems from two aspects of static Jahn-Teller and pseudo-Jahn-Teller problems fully developed by the author. First, the work of Liehr offers an almost complete overview of adiabatic potential energy surfaces for most known Jahn-Teller problems including linear, quadratic and higher-order vibronic couplings. Second, and most importantly, it identifies the factors defining the structure of Jahn-Teller surfaces. Among them, one should specially mention the minimax principle stating that the distorted Jahn-Teller systems tend to preserve the highest symmetry consistent with the loss of their orbital degeneracy. We believe that the present short reminiscence not only will introduce a key Jahn-Teller scientist to the young members of the community but also will serve as a vivid example of how a complete understanding of a complex problem, which the Jahn-Teller effect certainly was in the beginning of 1960s, can be achieved.

  20. Does Andrews facial analysis predict esthetic sagittal maxillary position?

    Science.gov (United States)

    Resnick, Cory M; Daniels, Kimberly M; Vlahos, Maryann

    2018-04-01

    Cephalometric analyses have limited utility in planning maxillary sagittal position for orthognathic surgery. In Six Elements of Orofacial Harmony, Andrews quantified maxillary position relative to forehead projection and angulation and proposed an ideal relationship. The purpose of this study was to investigate the ability of this technique to predict esthetic sagittal maxillary position. Survey study including a male and female with straight facial profiles, normal maxillary incisor angulations, and Angle's Class I. Maxillary position was modified on lateral photographs to create 5 images for each participant with incisor-goal anterior limit line (GALL) distances of -4, -2, 0, +2, and +4 mm. A series of health care professionals and laypeople were asked to rate each photo in order of attractiveness. A total of 100 complete responses were received. Incisor-GALL distances of +4 mm (41%) and +2 mm (40%) were most commonly considered "most esthetic" for the female volunteer (P < .001). For the male volunteer, there were 2 peak "most esthetic" responses: incisor-GALL distances of 0 mm (37%) and -4 mm (32%) (P < .001). Respondents considered maxillary incisor position 2 to 4 mm anterior to GALL most attractive in a woman and 0 to 4 mm posterior to GALL most esthetic in a man. Using these modified target distances, this analysis may be useful for orthognathic surgery planning. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Mida mõtleb professor Andrew Mayo? / Anne-Mari Ernesaks

    Index Scriptorium Estoniae

    Ernesaks, Anne-Mari

    2005-01-01

    PARE koordinaator tutvustab tuntud inimkapitali ideoloogi Andrew Mayo raamatut "Ettevõtte inimväärtus". Raamatu autori hinnangul on tänapäeva organisatsioonides juhtimise olulisim ülesanne inimese juhtimine varana. Lisa: Konverents

  2. Traditional values and Inglehart constructs / Zoltan Lakatos

    Index Scriptorium Estoniae

    Lakatos, Zoltan

    2015-01-01

    Autor väidab, et Ronald Ingleharti kolm kõige mõjukamat kultuuriväärtuste mõõtmise instrumenti – postmaterialismi indeks, eneseväljenduslikud väärtused ja traditsioonilised vs sekulaarsed väärtused – võivad hägustada väärtusi indiviidi tasandil ning pakub välja alternatiivse meetodi, teiste riikide seas käsitletakse ka Eestit

  3. Active morbidity surveillance after Hurricane Andrew--Florida, 1992.

    Science.gov (United States)

    Lee, L E; Fonseca, V; Brett, K M; Sanchez, J; Mullen, R C; Quenemoen, L E; Groseclose, S L; Hopkins, R S

    1993-08-04

    To describe the health status of and to detect disease outbreaks in the population affected by Hurricane Andrew in south Dade County, Florida. The Florida Department of Health and Rehabilitative Services and the US Army conducted active surveillance for gastrointestinal illness, respiratory illness, injury, and other index conditions by monitoring civilian and service member visits to care sites (civilian and military free care sites and hospital emergency departments) from August 30 (1 week after the hurricane's landfall) through September 30, 1992. South Dade County, Florida. Proportional morbidity: the number of daily visits for each index condition divided by the total number of visits, expressed as a percentage. Morbidity rate: the total number of daily visits by service members divided by the total number of service members, expressed as a percentage. Six index conditions accounted for 41.3% of visits to civilian free care sites: diarrhea (4.7%), cough (4.7%), other infection (9.6%), rash (5.4%), animal bite (1.2%), and injury (15.7%). At military free care sites, five index conditions accounted for 75.7% of civilian visits: injury (23.7%), dermatologic illness (12.4%), respiratory illness (9.9%), gastrointestinal illness (5.3%), and other medical conditions (24.4%). Two index conditions accounted for 54.1% of service member visits: injury (36.2%) and dermatologic illness (17.9%). During the 5 weeks after the hurricane, proportional morbidity from injury decreased; proportional morbidity from respiratory illness increased; and proportional morbidity from diarrhea was stable. No infectious disease outbreaks occurred. Injuries were an important source of morbidity throughout the surveillance period, especially among service members. Enteric and respiratory agents did not cause disease outbreaks, despite alarming rumors to the contrary.

  4. Preliminary report: medical examiner reports of deaths associated with Hurricane Andrew--Florida, August 1992.

    Science.gov (United States)

    1992-09-04

    On August 24, 1992, at 1:40 a.m. eastern daylight time (EDT), rain bands associated with Hurricane Andrew reached the eastern coast of Florida. At 4:45 a.m. EDT, Hurricane Andrew made landfall 35 miles southeast of Miami at Homestead, with sustained winds of 145 miles per hour (mph) and gusts of 164 mph. These winds extended 45 miles outward of the storm center. The storm moved across the state at 18 mph toward the Gulf of Mexico (Figure 1). The tidal surge on the eastern coast was estimated at 7-19 feet. During the storm, approximately 2.5 million Florida residents were left without electrical power, and approximately 56,000 family dwelling units were destroyed or severely damaged. This report presents preliminary data from Florida medical examiner (ME) offices about deaths attributed to Hurricane Andrew.

  5. Analyzing after-action reports from Hurricanes Andrew and Katrina: repeated, modified, and newly created recommendations.

    Science.gov (United States)

    Knox, Claire Connolly

    2013-01-01

    Thirteen years after Hurricane Andrew struck Homestead, FL, Hurricane Katrina devastated the Gulf Coast of Mississippi, Alabama, and southeastern Louisiana. Along with all its destruction, the term "catastrophic" was redefined. This article extends the literature on these hurricanes by providing a macrolevel analysis of The Governor's Disaster Planning and Response Review Committee Final Report from Hurricane Andrew and three federal after-action reports from Hurricane Katrina, as well as a cursory review of relevant literature. Results provide evidence that previous lessons have not been learned or institutionalized with many recommendations being repeated or modified. This article concludes with a discussion of these lessons, as well as new issues arising during Hurricane Katrina.

  6. Capacities of template-type platforms in the Gulf of Mexico during hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Bea, R.G.; Loch, K.J.; Young, P.L. [Univ. of California, Berkeley, CA (United States)

    1997-02-01

    This paper details results from nonlinear analyses of the ultimate limit state performance characteristics of four Gulf of Mexico (GOM) platforms subjected to intense loadings from hurricane Andrew. These four platforms were located to the east of the track of hurricane Andrew, and were thus in the most intense portion of the storm (Smith, 1993). The nonlinear analyses are able to replicate details of the observed behavior of the four structures. This replication is very dependent on realistic characterization of the performance characteristics of the pile foundations and on accurate information on the as is condition of the platforms before the storm.

  7. The Role of the U.S. Army Medical Department in Domestic Disaster Assistance Operations. Lessons Learned from Hurricane Andrew.

    Science.gov (United States)

    1996-04-15

    Hurricane Andrew , which struck South Dade County, Florida on the morning of 24 August 1992, was the ’worst natural disaster ever to hit the United...and Medical). The study also addresses the Army Medical Department’s role in the Hurricane Andrew operations and closes with a review of the medically

  8. On the Record: with Olly Owen and Andrew Faull | Owen | South ...

    African Journals Online (AJOL)

    ... of International Development at the University of Oxford. In 2012 he completed his doctorate in Social and Cultural Anthropology at Oxford. This involved an ethnographic study of, and fieldwork with, the Nigerian Police Force. Andrew Faull is a doctoral research student at the Centre for Criminology, University of Oxford.

  9. Joshua Rodda: Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History

    Directory of Open Access Journals (Sweden)

    Joachim Schwend

    2015-01-01

    Full Text Available This contribution offers a review of Joshua Rodda's Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History. Farnham, Surrey: Ashgate, 2014. 252 pages, regular price £ 70, 234 x 156 mm, ISBN 978–1–4724–1555–4.

  10. Commentary on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence"

    Science.gov (United States)

    Wolfram, Gary; Coulson, Andrew J.

    2009-01-01

    In this article, the authors comment on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence." The authors believe that Coulson's paper is a very interesting review of the literature on the ability of market-produced education to outperform government-produced education. Coulson's response on this commentary…

  11. Crisis Intervention with Survivors of Natural Disaster: Lessons from Hurricane Andrew.

    Science.gov (United States)

    Shelby, Janine S.; Tredinnick, Michael G.

    1995-01-01

    Crisis intervention has typically been conceptualized as seeking a return of clients to a state of equilibrium. Personal work experience with Hurricane Andrew survivors has led to an appreciation of the importance of several considerations. Develops a proactive approach, attempting to recognize and extend clients' preexisting strengths. Offers…

  12. News of Hurricane Andrew: The Agenda of Sources and the Sources' Agendas.

    Science.gov (United States)

    Salwen, Michael B.

    1995-01-01

    Studies quotations in newspaper coverage of Hurricane Andrew, showing that individuals who were not affiliated with government or business were quoted most often. Shows that most sources were quoted as experts, with individuals represented as suffering victims, providing the news media with human interest quotations. Notes that most sources…

  13. Posttraumatic Stress, Depression, and Social Support among College Students after Hurricane Andrew.

    Science.gov (United States)

    Pickens, Jeffrey; And Others

    1995-01-01

    One month after Hurricane Andrew, surveyed students who reported experiencing the most severe impact damage from the storm also reported experiencing the most stress, anxiety, and depressive symptoms. Regression analyses revealed that material and emotional social support were significant predictors of anxiety and depression scores after the…

  14. Stressing Memory: Long-Term Relations among Children's Stress, Recall and Psychological Outcome following Hurricane Andrew

    Science.gov (United States)

    Sales, Jessica McDermott; Fivush, Robyn; Parker, Janat; Bahrick, Lorraine

    2005-01-01

    We examined relations among stress, children's recall, and psychological functioning following Hurricane Andrew. Thirty-five children from mixed socioeconomic backgrounds were divided into low-, moderate-, and high-stress groups and were interviewed about the hurricane immediately after the storm and 6 years later. Our primary interest, stemming…

  15. Airborne Videography and GPS for Assessment of Forest Damage in Southern Louisiana from Hurricane Andrew

    Science.gov (United States)

    D.M. Jacobs; Susan Eggen-McIntosh

    1993-01-01

    Abstract: One week after Hurricane Andrew made landfall in Louisiana in August 1992, an airborne videography system, with a global positioning system (GPS) receiver, was used to assess timberland damage across a 1.7 million-ha (4.2 million-acre) study area. Ground observations were made to identify different intensities of timber damage and then...

  16. Visions and Vanities: John Andrew Rice of Black Mountain College. Southern Biography Series.

    Science.gov (United States)

    Reynolds, Katherine Chaddock

    This biography presents the life of John Andrew Rice, who founded Black Mountain College (North Carolina) in 1933 to implement his philosophy of education, including the centrality of artistic experience and emotional development to learning in all disciplines and the need for democratic governance shared between faculty and students. Born in…

  17. Building a "cyber forest" in complex terrain at the Andrews Experimental Forest

    Science.gov (United States)

    Donald L. Henshaw; Fred Bierlmaier; Barbara J. Bond; Kari B. O' Connell

    2008-01-01

    Our vision for a future "cyber forest" at the Andrews Experimental Forest foresees high performance wireless communications enhancing connectivity among remote field research locations, station headquarters, and beyond to the university and outside world. New sensor technologies and collaboration tools foretell exponential increases in data and information...

  18. Impact of an extreme event on the sediment budget: Hurricane Andrew in the Louisiana barrier islands

    Science.gov (United States)

    List, Jeffrey H.; Hansen, Mark E.; Sallenger,, Asbury H.; Jaffe, Bruce E.; Edge, B.L

    1997-01-01

    This paper examines the influence of Hurricane Andrew on the sediment budget of an 80-kilometer section of the Louisiana barrier islands west of the modern Mississippi delta. Because long-term bathymetric change has been extensively studied in this area, excellent baseline data are available for evaluating the impact of Hurricane Andrew. Results show that despite the high intensity of the storm and a storm track optimally positioned to impact the study area, the storm did not have an overwhelming influence on the sediment budget when compared to the changes occurring over the previous 50 years. For the Louisiana barrier islands, a 50-year record appears to be adequate for averaging the long-term contributions of both major and minor storm events to the sediment budget.

  19. Geologic impact of Hurricane Andrew on Everglades coast of southwest Florida

    Science.gov (United States)

    Davis, R. A.

    1995-04-01

    Hurricane Andrew, one of the strongest storms of the century, crossed the southern part of the Florida peninsula on 24 August 1992. Its path crossed the Florida Everglades and exited in the national park across a mangrove-dominated coast onto the shallow, low-energy, inner shelf. The storm caused extensive breakage and defoliation in the mangrove community; full recovery will take decades. It produced no extensive sedimentation unit; only local and ephemeral ebb-surge deposits. The discontinuous shelly storm beach ridge was breached at multiple locations, and it moved landward a few meters. After seven months, there was little geologic indication that the storm had passed. It is likely that the stratigraphic record in this area will not contain any recognizable features of the passage of Hurricane Andrew.

  20. Rapid health needs assessment following hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1992-09-18

    Following the impact phase of Hurricane Andrew in Florida (August 24) and Louisiana (August 26) (Figure 1), the primary objectives of the public health response have been to address the health and medical needs of residents in the storm-damaged areas and to provide data for relief interventions and decision-making. This report presents the combined findings from rapid health needs assessment surveys conducted by state health departments with CDC assistance 3-10 days postimpact.

  1. Andrew Wyeth and N.C. Wyeth: a psychodynamic perspective on father and son.

    Science.gov (United States)

    Shaw, Jon A

    2013-01-01

    This paper examines the relationship between two extraordinary artists, father and son--N.C. Wyeth (1882-1945) and Andrew Wyeth (1917-2009)--and their art. N.C. Wyeth, the father, the most famous illustrator of his day, painted scenes full of drama and action, often of men engaged in violent life and death struggles. N.C. was unable to separate from his powerful mother and yearned for his iconic father. He thought himself an artistic failure and dedicated himself to raising his children to be geniuses. The youngest son, Andrew Wyeth, who lived a "secret life," painted scenes often characterized by pathos: bleak and barren landscapes, leaden skies, tire tracks, gray framed houses, desiccated fields, and circling buzzards. In the father-son relationship, we often seen three themes perpetuated developmentally: (1) the son's identification with the innermost conflicts of his father; (2) the yearning for the iconic father of his youth; and (3) a continuation and disavowal of his father's life. These themes are played out in the relationship between Andrew Wyeth and his father.

  2. Raymond Andrews as Griot: Privileging Southern Black Communities through Oral Storytelling and Cultural History

    Directory of Open Access Journals (Sweden)

    Brennan Collins

    2012-01-01

    Full Text Available Raymond Andrews’ novels celebrate rural Black life by focusing on the customs and traditions of Southern African American communities. Critical to this celebration are the rhetorical strategies Andrews uses that privilege oral over literary storytelling. Using Geneva Smitherman’s discussion of the griot and Henry Louis Gates, Jr.’s concept of the speakerly text in the context of John Miles Foley’s work on comparative oral traditions, this essay explores the possibility and implications of describing Andrews’ written work as a form of oral storytelling.

  3. Emergency mosquito control associated with Hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    Hurricane Andrew crossed south Florida on August 24, 1992 entered the Gulf of Mexico, and struck the Louisiana coast on August 26. In Florida, an estimated 25,000 housing units were destroyed and 37,000 severely damaged in a 200,000-acre area in the southern portion of Dade County; in Louisiana, an estimated 25,000 housing units were destroyed or severely damaged by the storm, primarily in the coastal sections of the 36-parish disaster area. Initial assessment of the disaster areas indicated a need for vector surveillance and control (1). This report summarizes actions to assess and alleviate mosquito-related problems in Florida and Louisiana.

  4. Cognition About the Creative Process – Interview With Dr Andrew P. Allen

    Directory of Open Access Journals (Sweden)

    Andrew P. Allen

    2016-11-01

    Full Text Available What is the relationship between the creative process and cognition and perception? Lynda Loughnane, a master’s student in Art and Process in Crawford College of Art and Design, Cork, Ireland interviewed Dr Andrew P. Allen about the subject. Areas covered include mindfulness, Type 1 and Type 2 thinking, stage theories of creativity, engagement with the art process and the artwork, phenomenology and consciousness with and without self report. The interview was constructed to cover a wide range of subject matter, so as to gather as much information as possible in layman's language about the cognitive process in relation to creativity and interaction with art.

  5. Sleep disturbance and its relationship to psychiatric morbidity after Hurricane Andrew.

    Science.gov (United States)

    Mellman, T A; David, D; Kulick-Bell, R; Hebding, J; Nolan, B

    1995-11-01

    Sleep disturbance is an important dimension of posttraumatic stress disorder (PTSD), but most of the limited available data were obtained years after the original traumatic event. This study provides information on sleep disturbance and its relationship to posttraumatic morbidity from evaluations done within a year after the trauma. Sleep and psychiatric symptoms of 54 victims (12 men and 42 women) of Hurricane Andrew who had no psychiatric illness in the 6 months before the hurricane were evaluated. A subset of hurricane victims with active psychiatric morbidity (N = 10) and nine comparison subjects who were unaffected by the hurricane were examined in a sleep laboratory. A broad range of sleep-related complaints were rated as being greater after the hurricane, and psychiatric morbidity (which was most commonly PTSD, followed by depression) had a significant effect on most of the subjective sleep measures. In addition, subjects with active morbidity endorsed greater frequencies of "bad dreams" and general sleep disturbances before the hurricane. Polysomnographic results for the hurricane victims revealed a greater number of arousals and entries into stage 1 sleep. REM density correlated positively with both the PTSD symptom of reexperiencing trauma and global distress. Subjects affected by Hurricane Andrew reported sleep disturbances, particularly those subjects with psychiatric morbidity. Tendencies to experience bad dreams and interrupted sleep before a trauma appear to mark vulnerability to posttraumatic morbidity. Results of sleep laboratory evaluations suggested brief shifts toward higher arousal levels during sleep for PTSD subjects and a relationship of REM phasic activity and symptom severity.

  6. Delayed tree mortality in the Atchafalaya Basin of Southern Louisiana following Hurricane Andrew

    Science.gov (United States)

    Keeland, B.D.; Gorham, L.E.

    2009-01-01

    Hurricanes can damage trees in forested wetlands, and the potential for mortality related to these storms exists due to the effects of tree damage over time. In August 1992, Hurricane Andrew passed through the forested wetlands of southern Louisiana with winds in excess of 225 kph. Although more than 78 of the basal area was destroyed in some areas, most trees greater than 2.5 cm dbh were alive and resprouting prolifically the following year (98.8). Survival of most tree species was similarly high two years after the hurricane, but mortality rates of some species increased dramatically. For example, Populus heterophylla (swamp cottonwood) mortality increased from 7.8 to 59.2 (n 76) and Salix interior (sandbar willow) mortality increased from 4.5 to 57.1 (n 21). Stem sprouts on many up-rooted hardwood trees of other species were still alive in 1998, 6 years after the hurricane. Due to the understory tree species composition, regeneration, and high levels of resprouting, there was little change in species composition or perhaps a slight shift toward more shade and flood tolerant species six years following the hurricane event. Triadica sebifera (Chinese tallow) was found on some of the sites heavily disturbed by Hurricane Andrew, and may proliferate at the expense of native tree species. ?? 2009 The Society of Wetland Scientists.

  7. Impacts of Hurricane Andrew on carbonate platform environments, northern Great Bahama Bank

    Science.gov (United States)

    Boss, Stephen K.; Neumann, A. Conrad

    1993-10-01

    The northern (most energetic) quadrant of Hurricane Andrew (August 1992) passed over leeward-margin sand waves, bank-top sand shoals, reefs, and low islands of Great Bahama Bank for which an extensive prestorm data base exists. A reconnaissance survey seven weeks after Hurricane Andrew evaluated storm impacts on these bank-top settings. Resurveyed seismic profiles showed that positions, dimensions, and orientations of platform sand bodies were unchanged relative to fixed bedrock features. Surveys of reef communities indicated only minor storm-related disturbance. Coral bleaching may be due to storm-induced environmental stress. In addition, storm-wave plucking of boulders from emergent rocky cays resulted in localized crushing of reef biota. On low islands, beach erosion and storm surge were insignificant, and storm damage to Casuarina forests was minor and substrate-specific. Observed minimal hurricane impacts on northern Great Bahama Bank environments lying 10-75 km from the hurricane eye are reconciled by analysis of meteorological data, which show significant weakening of the storm (expressed as a rise in central barometric pressure of ˜20 mbar) during passage across the bank-top. This study demonstrates the importance of specific dynamic aspects of hurricanes (e.g., varying intensity, strength, size, forward speed, duration) which influence their geologic potential, even over relatively short distances along the storm track of an individual hurricane.

  8. Demographic effects of natural disasters: a case study of Hurricane Andrew.

    Science.gov (United States)

    Smith, S K; McCarty, C

    1996-05-01

    Many studies have considered the economic, social, and psychological effects of hurricanes, earthquakes, floods, tornadoes, and other natural disasters, but few have considered their demographic effects. In this paper we describe and evaluate a method for measuring the effects of Hurricane Andrew on the housing stock and population distribution in Dade County, Florida. Using information collected through sample surveys and from other data sources, we investigate the extent of housing damages, the number of people forced out of their homes, where they went, how long they stayed, and whether they returned to their prehurricane residences. We conclude that more than half the housing units in Dade County were damaged by Hurricane Andrew; that more than 353,000 people were forced to leave their homes, at least temporarily; and that almost 40,000 people left the county permanently as a direct result of the hurricane. We believe that this study will provide methodological guidance to analysts studying the demographic effects of other large-scale natural disasters.

  9. Development of pile foundation bias factors using observed behavior of platforms during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Aggarwal, R.K.; Litton, R.W.; Cornell, C.A.; Tang, W.H.; Chen, J.H.; Murff, J.D.

    1996-12-31

    The performance of more than 3,000 offshore platforms in the Gulf of Mexico was observed during the passage of Hurricane Andrew in August 1992. This event provided an opportunity to test the procedures used for platform analysis and design. A global bias was inferred for overall platform capacity and loads in the Andrew Joint Industry Project (JIP) Phase 1. It was predicted that the pile foundations of several platforms should have failed, but did not. These results indicated that the biases specific to foundation failure modes may be higher than those of jacket failure modes. The biases in predictions of foundation failure modes were therefore investigated further in this study. The work included capacity analysis and calibration of predictions with the observed behavior for 3 jacket platforms and 3 caissons using Bayesian updating. Bias factors for two foundation failure modes, lateral shear and overturning, were determined for each structure. Foundation capacity estimates using conventional methods were found to be conservatively biased overall.

  10. Specific features of basalts from the western part of Andrew Bain Fault, Southwest Indian Ridge

    Science.gov (United States)

    Peyve, A. A.; Skolotnev, S. G.

    2017-12-01

    This paper reports original data on the composition of volcanic rocks in the western part of the Andrew Bain Fault of the South-West Indian Ridge obtained in the 23rd voyage of R/V Akademik Nikolai Strakhov. In accordance with high La/Th and low Nb/U ratios, the basalt compositions of stations S2317, S2318, and S2330 could result from melting of the DM-type source with HIMU traces. Meanwhile, the enriched samples of station S2326 correspond to a mantle source with a considerable contribution of recycled sediments (EM). Sample S2326/35, which is composed of a melt almost completely depleted in EM material, corresponds to the volcanic rocks of the Marion and Prince Edward islands. The obtained and available data on the SWIR segment from Bouvet Island to Andrew Bain Fault are indicative of small mantle heterogeneities in this region. Two possible variants of their origin are considered: either preservation of the enriched material fragments in the depleted mantle during the split of Gondwana or "contamination" of the mantle with plume material with the formation of vein irregularities before opening of the ocean in this region. In the latter case, the plume material could cover a huge area not constrained by the young plume magmatism regions on Bouvet, Marion, and Prince Edward islands.

  11. Ecological evaluation of proposed dredged material from St. Andrew Bay, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Mayhew, H.L.; Word, J.Q.; Kohn, N.P.; Pinza, M.R.; Karle, L.M.; Ward, J.A. [Battelle/Marine Sciences Lab., Sequim, WA (United States)

    1993-10-01

    The US Army Corps of Engineers (USACE), Mobile District, requested that the Battelle/Marine Sciences Laboratory (MSL) conduct field sampling and chemical and biological testing to determine the suitability of potential dredged material for open ocean disposal. Sediment from St. Andrew Bay was chemically characterized and evaluated for biological toxicity and bioaccumulation of contaminants. The Tier III guidance for ocean disposal testing requires tests of water column effects (following dredged material disposal), deposited sediment toxicity, and bioaccumulation of contaminants from deposited sediment (dredged material). To meet these requirements, the MSL conducted suspended-particulate-phase (SPP) toxicity tests, solid-phase toxicity tests, and bioaccumulation testing on sediment representing potential dredged material from Panama City Harbor. Physical and chemical characterization of sediment to support toxicity and bioaccumulation results was also conducted on both the test and reference sediments. The MSL collected sediment samples from five sites in St. Andrew Bay and one reference site near Lands End Peninsula. The five test sediments and the reference sediment were analyzed for physical and chemical sediment characteristics, SPP chemical contaminants, solid-phase toxicity, SPP toxicity, and bioaccumulation of contaminants.

  12. Discriminative validity of the MacAndrew Alcoholism Scale with Cluster B personality disorders.

    Science.gov (United States)

    Smith, S R; Hilsenroth, M J

    2001-06-01

    This study was designed to assess the ability of the Minnesota Multiphasic Personality Inventory (MMPI-2) MacAndrew Alcoholism Scale (MAC-R) to differentiate between outpatients with personality disorders with Substance-Related Disorders (SRDs) and without SRDs. MMPI-2 validity, clinical, and MAC-R scale scores were compared in an SRD Cluster B group (comprised of Narcissistic, Antisocial, Borderline, and Histrionic; n = 15), a non-SRD Cluster B group (n = 33), and a non-SRD group with personality disorders from Clusters A and C (n = 18). Results revealed that the substance-abusing Cluster B group scored significantly higher on the MAC-R ( p Personality Disorder (r =.60, p Personality Disorders were most related to MAC-R scores (R =.78, R(2) =.60). This indicates that the MAC-R may be more related to the presence of an SRD than has been suggested, and when used in outpatient settings as MacAndrew (1965) intended, the MAC-R may be useful as a screening device for assessing SRD among outpatients with Axis II psychopathology.

  13. 33 CFR 334.680 - Gulf of Mexico, southeast of St. Andrew Bay East Entrance, small-arms firing range, Tyndall Air...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico, southeast of St... AND RESTRICTED AREA REGULATIONS § 334.680 Gulf of Mexico, southeast of St. Andrew Bay East Entrance... the Gulf of Mexico, southeast of St. Andrew Bay East Entrance within a rectangular area beginning at a...

  14. 33 CFR 334.770 - Gulf of Mexico and St. Andrew Sound, south of East Bay, Fla., Tyndall Drone Launch Corridor...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico and St. Andrew... ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.770 Gulf of Mexico and St....; restricted area. (a) The area. The waters of the Gulf of Mexico and St. Andrew Sound within an area described...

  15. Protocols for Biotechnological Interventions in Improvement of Vanilla (Vanilla planifolia Andrews.).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal; Peter, K V

    2016-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a native of Central America, is the primary source of natural vanillin and plays a major role in the global economy. The gene pool of vanilla is threatened by deforestation and overcollection that has resulted in disappearance of natural habitats and wild species. Continuous vegetative propagation and lack of natural seed set and sufficient variations in the gene pool hamper crop improvement programs. In vitro techniques, one of the key tools of plant biotechnology, can be employed for overcoming specific problems, viz. production of disease-free clones, inducing somaclonal variations, developing hybrids, gene pool conservation, incorporating desired traits by distant hybridization, genetic engineering, etc. However, realization of these objectives necessitates standardization of protocols. This chapter describes the various protocols optimized for crop improvement in Vanilla species.

  16. A conversation with Andrew Benson: reflections on the discovery of the Calvin-Benson cycle.

    Science.gov (United States)

    Benson, Andrew

    2013-03-01

    On June 26-27, 2012, one of us (BBB) made a video based on an interview conducted with Andrew A. Benson, Professor Emeritus, Scripps Institution of Oceanography, University of California, San Diego, CA, USA. The video was first shown in a seminar presented by BBB on July 27, 2012 at the Calvin Laboratory, University of California, Berkeley, to mark the departure of the Energy Biosciences Institute to a new building. Here we record the conversation taking place during the interview. The Brancraft Library on the Berkeley campus will house the video's transcript in its oral histories collection, and the video will be housed in its motion picture collection. The video and the transcript have also been posted on You Tube (http://youtu.be/GfQQJ2vR_xE).

  17. Prosthetic rehabilitation of severe Siebert′s Class III defect with modified Andrews bridge system

    Directory of Open Access Journals (Sweden)

    Manu Rathee

    2015-01-01

    Full Text Available Prosthetic dentistry involves the replacement of missing and contiguous tissues with artificial substitutes to restore and maintain the oral functions, appearance, and health of the patient. The treatment of edentulous areas with ridge defects poses a challenging task for the dentist. Management of such cases involves a wide range of treatment options comprising mainly of surgical interventions and non surgical techniques such as use of removable, fixed or fixed- removable partial dentures. But each treatment plan undertaken should be customized according to patient needs. A variety of factors such as quality and quantity of existing contiguous hard and soft tissues, systemic condition and economic status of the patient play an important role in treatment planning, clinical outcome and prognosis. This case report presents the restoration of a Seibert′s Class III ridge defect by an economical modification of Andrews Bridge in a 32 Year old patient.

  18. Symptoms of posttraumatic stress in children after Hurricane Andrew: a prospective study.

    Science.gov (United States)

    La Greca, A; Silverman, W K; Vernberg, E M; Prinstein, M J

    1996-08-01

    The authors examined symptoms of posttraumatic stress in 3rd-5th grade children during the school year after Hurricane Andrew. From a conceptual model of the effects of traumatic events, 442 children were evaluated 3, 7, and 10 months postdisaster with respect to (a) their exposure to traumatic events during and after the disaster, (b) their preexisting demographic characteristics, (c) the occurrence of major life stressors, (d) the availability of social support, and (e) the type of coping strategies used to cope with disaster-related distress. Although symptoms of posttraumatic stress disorder (PTSD) declined over time, a substantial level of symptomatology was observed up to 10 months after the disease. All 5 factors in the conceptual model were predictive of children's PTSD symptoms 7 and 10 months postdisaster. Findings are discussed in terms of the potential utility of the model for organizing thinking about factors that predict the emergence and persistence of PTSD symptoms in children.

  19. Comprehensive assessment of health needs 2 months after Hurricane Andrew--Dade County, Florida, 1992.

    Science.gov (United States)

    1993-06-11

    On August 24, 1992, Hurricane Andrew struck southern Florida. More than 28,000 houses, mobile homes, and apartment buildings were destroyed, and approximately 107,000 additional dwellings sustained major damage. An estimated 180,000 persons were left homeless; insured damages were estimated at $15.5 billion and total damages at more than $30 billion. During the recovery period, many private and public health-care facilities damaged or destroyed in the storm were not functional. During November 3-13, to help prioritize health needs and direct public health resources, the Dade County Public Health Unit of the Florida Department of Health and Rehabilitative Services conducted a survey to assess health needs and the availability of health-care services during the recovery phase with funds provided by the Federal Emergency Management Agency (FEMA). This report summarizes the results of the survey.

  20. Damage Survey of Hurricane Andrew and Its Relationship to the Eyewall.

    Science.gov (United States)

    Wakimoto, Roger M.; Black, Peter G.

    1994-02-01

    A damage map documenting Hurricane Andrew's destructive land fall over southern Florida is presented. Vectors that represent the direction of winds causing damage to trees and structures are shown along with an F-scale rating in order to assess the strength of the near-surface winds. It is hypothesized that increased surface roughness once the hurricane made landfall may have contributed to a surface wind enhancement resulting in the strongest winds ever estimated (F3) for a landfall hurricane. This intense damage occurred primarily during the "second" period of strong winds associated with the east side of the eyewall. For the first time, a well-defined circulation in the damage pattern by the second wind was documented. A superposition of radar data from Miami and Key West on top of the damage map provides the first detailed examination of the relationship between the eyewall and the surface flow field as estimated from the damage vectors.

  1. Children's predisaster functioning as a predictor of posttraumatic stress following Hurricane Andrew.

    Science.gov (United States)

    La Greca, A M; Silverman, W K; Wasserstein, S B

    1998-12-01

    This study examined (a) children's predisaster behavioral and academic functioning as a predictor of posttraumatic stress (PTS) following Hurricane Andrew and (b) whether children who were exposed to the disaster would display a worsening of prior functioning. Fifteen months before the disaster, 92 4th through 6th graders provided self-reports of anxiety; peers and teachers rated behavior problems (anxiety, inattention, and conduct) and academic skills. Measures were repeated 3 months postdisaster; children also reported PTS symptoms and hurricane-related experiences (i.e., exposure). PTS symptoms were again assessed 7 months postdisaster. At 3 months postdisaster, children's exposure to the disaster, as well as predisaster ratings of anxiety, inattention, and academic skills, predicted PTS symptoms. By 7 months, only exposure, African American ethnicity, and predisaster anxiety predicted PTS. Prior anxiety levels also worsened as a result of exposure to the disaster. The findings have implications for identifying and treating children at risk for stress reactions following a catastrophic disaster.

  2. Stability and change in stress, resources, and psychological distress following natural disaster: Findings from hurricane Andrew.

    Science.gov (United States)

    Norris, F H; Perilla, J L; Riad, J K; Kaniasty, K; Lavizzo, E A

    1999-01-01

    Abstract The stress, resource, and symptom levels of 241 residents of southern Dade County, Florida were assessed 6 and 30 months after Hurricane Andrew. Percentages meeting study criteria for depression and PTSD did not change over time. Whereas mean levels of intrusion and arousal decreased, depressive symptoms remained stable, and avoidance/numbing symptoms actually increased. Intrusion and arousal were associated more strongly with pre-disaster factors (gender, ethnicity) and within-disaster factors (injury, property loss) than with post-disaster factors (stress, resources), but the reverse was true for depression and avoidance. Changes over time in symptoms were largely explained by changes over time in stress and resources. The findings indicate that ongoing services are needed to supplement the crisis-oriented assistance typically offered to disaster victims.

  3. Tilting at wave beams: a new perspective on the St Andrew's Cross

    Science.gov (United States)

    Akylas, T. R.; Kataoka, T.; Ghaemsaidi, S. J.; Holzenberger, N.; Peacock, T.

    2017-11-01

    The generation of internal gravity waves by a vertically oscillating cylinder that is tilted to the horizontal in a stratified fluid of constant buoyancy frequency, is investigated theoretically and experimentally. This forcing arrangement leads to a variant of the classical St Andrew's Cross that has certain unique features: (i) radiation of wave beams is limited due to a lower cut-off frequency set by the cylinder tilt angle to the horizontal; (ii) the response is essentially three-dimensional, as end effects eventually come into play when the cut-off frequency is approached, however long a cylinder might be. These results follow from kinematic considerations and are also confirmed by laboratory experiments. The kinematic analysis, moreover, suggests a resonance phenomenon near the cut-off frequency, where viscous and nonlinear effects are likely to play an important part. This scenario is examined by an asymptotic model as well as experimentally. Supported in part by NSF Grant DMS-1512925.

  4. Memorial Camels and Design by Committee: St Andrews Black Saturday Memorials

    Directory of Open Access Journals (Sweden)

    SueAnne Ware

    2015-02-01

    Full Text Available This paper examines a work in progress, the St Andrews Bushfire Memorial, which commemorates victims of the 7 February 2009 bushfires in Victoria, Australia. The paper’s intent is threefold: to describe and reflect on a current and ongoing memorial design project; to frame this project within a larger series of design discourses; and to examine the processes by which this memorial, but also many other grassroots or ‘bottom-up’ memorials, come into being. By examining the design process, I aim to open up various memorialisation and consultation methods for review. More importantly, however, by framing this project in contemporary discussions regarding socially engaged design practices, I offer a critique of the dictator–democrat binaries mentioned above and offer another way forward.

  5. Physical symptoms of chronic fatigue syndrome are exacerbated by the stress of Hurricane Andrew.

    Science.gov (United States)

    Lutgendorf, S K; Antoni, M H; Ironson, G; Fletcher, M A; Penedo, F; Baum, A; Schneiderman, N; Klimas, N

    1995-01-01

    This study examined the effects of Hurricane Andrew on physical symptoms and functional impairments in a sample of chronic fatigue syndrome (CFS) patients residing in South Florida. In the months after Hurricane Andrew (September 15-December 31, 1992), 49 CFS patients were assessed for psychosocial and physical functioning with questionnaires, interviews, and physical examinations. This sample was made up of 25 CFS patients living in Dade county, a high impact area, and 24 patients in Broward and Palm Beach counties, areas less affected by the hurricane. Based on our model for stress-related effects on CFS, we tested the hypothesis that the patients who had the greatest exposure to this natural disaster would show the greatest exacerbation in CFS symptoms and related impairments in activities of daily living (illness burden). In support of this hypothesis, we found that the Dade county patients showed significant increases in physician-rated clinical relapses and exacerbations in frequency of several categories of self-reported CFS physical symptoms as compared to the Broward/Palm Beach county patients. Illness burden, as measured on the Sickness Impact Profile, also showed a significant increase in the Dade county patients. Although extent of disruption due to the storm was a significant factor in predicting relapse, the patient's posthurricane distress response was the single strongest predictor of the likelihood and severity of relapse and functional impairment. Additionally, optimism and social support were significantly associated with lower illness burden after the hurricane, above and beyond storm-related disruption and distress responses. These findings provide information on the impact of environmental stressors and psychosocial factors in the exacerbation of CFS symptoms.

  6. Posttraumatic stress symptoms, intrusive thoughts, loss, and immune function after Hurricane Andrew.

    Science.gov (United States)

    Ironson, G; Wynings, C; Schneiderman, N; Baum, A; Rodriguez, M; Greenwood, D; Benight, C; Antoni, M; LaPerriere, A; Huang, H S; Klimas, N; Fletcher, M A

    1997-01-01

    To examine the impact of and relationship between exposure to Hurricane Andrew, a severe stressor, posttraumatic stress symptoms and immune measures. Blood draws and questionnaires were taken from community volunteer subjects living in the damaged neighborhoods between 1 and 4 months after the Hurricane. The sample exhibited high levels of posttraumatic stress symptoms by questionnaire (33% overall; 76% with at least one symptom cluster), and 44% scored in the high impact range on the Impact of Events (IES) scale. A substantial proportion of variance in posttraumatic stress symptoms could be accounted for by four hurricane experience variables (damage, loss, life threat, and injury), with perceived loss being the highest correlate. Of the five immune measures studied Natural Killer Cell Cytotoxicity (NKCC) was the only measure that was meaningfully related (negatively) to both damage and psychological variables (loss, intrusive thoughts, and posttraumatic stress disorder (PTSD). White blood cell counts (WBCs) were significantly positively related with the degree of loss and PTSD experienced. Both NKCC (lower) and WBC were significantly related to retrospective self-reported increase of somatic symptoms after the hurricane. Overall, the community sample was significantly lower in NKCC, CD4 and CD8 number, and higher in NK cell number compared to laboratory controls. Finally, evidence was found for new onset of sleep problems as a mediator of the posttraumatic symptom-NKCC relationship. Several immune measures differed from controls after Hurricane Andrew. Negative (intrusive) thoughts and PTSD were related to lower NKCC. Loss was a key correlate of both posttraumatic symptoms and immune (NKCC, WBC) measures.

  7. Hurricane Andrew Damage in Relation to Wood Decay Fungi and Insects in Bottomland Hardwoods of the Atchafalaya Basin, Louisiana

    Science.gov (United States)

    Theodor D. Leininger; A. Dan Wilson; Donald G. Lester

    1997-01-01

    Hurricane Andrew caused damage to more than 780 sq.km of bottomland hardwood and cypress-tupelo forests in the Atchafalaya Basin of Louisiana in August 1992. Trees in bottomland hardwood sites were examined, in early May 1994, for signs and symptoms of wood decay fungi, and for insect damage, ostensibly present before the hurricane, which may have predisposed trees to...

  8. The Psychological Effects of Hurricane Andrew on Ethnic Minority and Caucasian Children and Adolescents: A Case Study.

    Science.gov (United States)

    Jones, Russell T.; Frary, Robert; Cunningham, Phillippe; Weddle, J. David; Kaiser, Lisa

    2001-01-01

    Several measures of children's reactions to disasters were employed with 212 elementary and middle school students 6 months after experiencing Hurricane Andrew. Higher levels of intrusive symptomatology were found for girls and for elementary school children. Discusses lack of findings concerning race and implications for future research.…

  9. The role of the U.S. Army Medical Department in domestic disaster assistance operations - lessons learned from hurricane Andrew.

    Science.gov (United States)

    1996-04-01

    Hurricane Andrew, which struck South Dade County, Florida on the morning of 24 August 1992, was the "worst natural disaster ever to hit the United States..." The capabilities of the local and state governments to respond to the disaster were quickly ...

  10. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly

    Science.gov (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.

    2016-01-01

    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  11. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: III. The Orthoptera (Grasshoppers and Crickets).

    Science.gov (United States)

    David C. Lightfoot

    1986-01-01

    An inventory of Orthoptera (grasshoppers and crickets) at the H.J. Andrews Experimental Forest, near Blue River, Oregon, was conducted to determine the species present and ecological relationships. A key for identification and an annotated list are presented. From qualitative assessments of successional habitat relationships, generalized species associations of forest...

  12. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascade Mountains, Oregon: IV. The Oribatid Mites (Acari: Cryptostigmata).

    Science.gov (United States)

    Andrew Moldenke; Becky. Fichter

    1988-01-01

    A fully illustrated key is presented for identifying genera of oribatid mites known from or suspected of occurring in the Pacific Northwest. The manual includes an introduction detailing sampling methodology; an illustrated glossary of all terminology used; two color plates of all taxa from the H. J. Andrews Experimental Forest; a diagrammatic key to the 16 major...

  13. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: I. An annotated checklist of fleas.

    Science.gov (United States)

    Robert E. Lewis; Chris. Maser

    1981-01-01

    During a trapping survey of small mammals (approximately 3,000 individuals), species of fleas (1,632 specimens) were collected in the H.J. Andrews Experimental Forest, Western Cascades, Oregon. Host mammals were represented by 15 species—6 insectivores and 9 rodents captured from June through September. The collections extend our knowledge of the fauna of Oregon.

  14. Invertebrates of the H.J. Andrews Experimental Forest, western Cascades, Oregon II. an annotated checklist of caddisflies (Trichoptera)

    Science.gov (United States)

    N.H. Anderson; G.M. Cooper; D.G Denning

    1982-01-01

    At least 99 species, representing 14 families of Trichoptera, are recorded from the H.J. Andrews Experimental Forest, near Blue River, Oregon. The collecting sites include a wide diversity of environmental conditions in a 6000-hectare watershed of the western Cascade Range (from 400 to 1 630 meters in altitude and from 1st- to 7th-order streams).

  15. 77 FR 15600 - Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL

    Science.gov (United States)

    2012-03-16

    ...-AA08 Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL... navigable waters during the Emerald Coast Super Boat Grand Prix high speed boat races. Entry into... needed to safeguard persons and vessels from safety hazards associated with the Emerald Coast Super Boat...

  16. Religious Literacy or Spiritual Awareness? Comparative Critique of Andrew Wright's and David Hay's Approaches to Spiritual Education

    Science.gov (United States)

    Filipsone, Anta

    2009-01-01

    On the basis of a comparison of the educational approaches of Andrew Wright and David Hay this paper illustrates the persisting problem of dichotomising cognitive and trans-cognitive aspects of spiritual development and education. Even though both Wright and Hay speak of the same topic--spirituality and spiritual education--they define these terms…

  17. Climatic summaries and documentation for the primary meteorological station, H.J. Andrews Experimental Forest, 1972 To 1984.

    Science.gov (United States)

    Frederick A. Bierlmaler; Arthur. McKee

    1989-01-01

    This report describes the primary meteorological station at the H.J. Andrews Experimental Forest (elev. 426 m, lat. 44°15' N., long. 122°10' W.) in the Willamette National Forest, the automatic digital data logger, sensors, and data-processing procedures used in measuring air temperature, dewpoint temperature, windspeed, precipitation, and solar radiation....

  18. Book received: Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

    Directory of Open Access Journals (Sweden)

    Alois Riegl

    2010-12-01

    Full Text Available Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

  19. Occurrence of Cucumber mosaic virus on vanilla (Vanilla planifolia Andrews) in India.

    Science.gov (United States)

    Madhubala, R; Bhadramurthy, V; Bhat, A I; Hareesh, P S; Retheesh, S T; Bhai, R S

    2005-06-01

    Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, Cucurbitaceae, Fabaceae and Solanaceae. Nicotiana benthamiana was found to be a suitable host for the propagation of CMV. The virus was purified from inoculated N. benthamiana plants and negatively stained purified preparations contained isometric particles of about 28 nm in diameter. The molecular weight of the viral coat protein subunits was found to be 25.0 kDa. Polyclonal antiserum was produced in New Zealand white rabbit, immunoglobulin G (IgG) was purified and conjugated with alkaline phosphatase enzyme. Double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) method was standardized for the detection of CMV infection in vanilla plants. CP gene of the virus was amplified using reverse transcriptase-polymerase chain reaction (RT-PCR), cloned and sequenced. Sequenced region contained a single open reading frame of 657 nucleotides potentially coding for 218 amino acids. Sequence analyses with other CMV isolates revealed the greatest identity with black pepper isolate of CMV (99%) and the phylogram clearly showed that CMV infecting vanilla belongs to subgroup IB. This is the first report of occurrence of CMV on V. planifolia from India.

  20. Wind damage effects of Hurricane Andrew on mangrove communities along the southwest coast of Florida, USA

    Science.gov (United States)

    Doyle, T.W.; Smith, T. J.; Robblee, M.B.

    1995-01-01

    On August 24, 1992, Hurricane Andrew downed and defoliated an extensive swath of mangrove trees across the lower Florida peninsula. Permanent field sites were established to assess the extent of forest damage and to monitor the rate and process of forest recovery. Canopy trees suffered the highest mortality particularly for sites within and immediately north of the storm's eyewall. The type and extent of site damage, windthrow, branch loss, and defoliation generally decreased exponentially with increasing distance from the storm track. Forest damage was greater for sites in the storm's right quadrant than in the left quadrant tor the same given distance from the storm center. Stand exposure, both horizontally and vertically, increased the susceptibility and probability of forest damage and accounted for much of the local variability. Slight species differences were found. Laguncularia racemosa exceeded Avicennia germinans and Rhizophora mangle in damage tendency under similar wind conditions. Azimuths of downed trees were strongly correlated with maximum wind speed and vector based on a hurricane simulation of the storm. Lateral branch loss and leaf defoliation on sites without windthrow damage indicated a degree of crown thinning and light penetration equivalent to treefall gaps under normally intact forest conditions. Mangrove species and forests are susceptible to catastrophic disturbance by hurricanes; the impacts of which are significant to changes in forest structure and function.

  1. William Horner Andrews (1887–1953 – First Professor of Physiology at Onderstepoort

    Directory of Open Access Journals (Sweden)

    D. W. Verwoerd

    2011-04-01

    Full Text Available WHAndrews qualified as a veterinarian in London in 1908 and was recruited soon after, in 1909, by Sir Arnold Theiler to join the staff of the newly established veterinary laboratory at Onderstepoort. After initial studies on the treatment of trypanosomosis and on snake venoms he was deployed by Theiler in 1911 to start research on lamsiekte (botulismat a field station on the farm Kaffraria near Christiana, where he met and married his wife Doris. After a stint as Captain in the SA Veterinary Corps during World War I he succeeded D T Mitchell as head of the Allerton Laboratory in 1918, where he excelled in research on toxic plants, inter alia identifying Matricaria nigellaefolia as the cause of staggers in cattle.Whenthe Faculty ofVeterinary Science was established in 1920 he was appointed as the first Professor of Physiology. After the graduation of the first class in 1924, and due to health problems, he returned to the UK, first to the Royal Veterinary College and then to the Weybridge Veterinary Laboratories of which he became Director in 1927.After his retirement in 1947 he returned to South Africa as a guest worker at Onderstepoort where he again became involved in teaching physiologywhenProf. Quin unexpectedly died in 1950. Andrews died in Pretoria in 1953 and was buried in the Rebecca Street Cemetery.

  2. Analysis of medical treatment at a field hospital following Hurricane Andrew, 1992.

    Science.gov (United States)

    Alson, R; Alexander, D; Leonard, R B; Stringer, L W

    1993-11-01

    To determine what medical care was required of a special operations response team by a community devastated by a major hurricane. Retrospective analysis of 1,544 patient encounter forms generated at a field hospital set up in Homestead, Florida, after Hurricane Andrew in August 1992 and staffed by the special operations response team from Forsyth County, North Carolina. All persons presenting for treatment. One thousand two hundred three adult patients and 336 pediatric patients were seen by the special operations response team. Only five of the injuries treated were due directly to the hurricane, whereas 285 of the treated injuries were sustained during clean-up activities. Most of the care provided was routine medical care denied the citizens due to the loss of their physicians' offices and clinics. Supplies of tetanus toxoid, antibiotics, and insulin were depleted in 24 hours. Resupplying these items and acquiring other medication to refill prescriptions constituted a pressing problem. The primary function of medical personnel responding to an area hit by a major hurricane will be to provide general medical care. Any trauma encountered will be primarily due to clean-up activities and not due to the hurricane itself. Responding medical personnel should plan on providing their own food and water for the first 72 hours and be well stocked with antibiotics, tetanus toxoid, and insulin.

  3. The generation of internal waves on the continental shelf by Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Allen, Susan E.

    2000-11-01

    Observed currents, temperature, and salinity from moored instruments on the Louisiana continental slope and shelf reveal multiple baroclinic oscillations during Hurricane Andrew in August 1992. These measurements are supplemented by numerical models in order to identify possible internal wave generation mechanisms. The Princeton Ocean Model is run with realistic topography, stratification, and wind forcing to extend the observations to Mississippi Canyon and other areas on the shelf. A two-layer isopycnal model is used with idealized topography and spatially uniform winds to isolate internal waves generated in and around the canyon. The combination of the observations and the results from the numerical models indicates several possible mechanisms for generating long internal waves: (1) near-inertial internal waves were generated across the slope and shelf by dislocation of the thermocline by the wind stress; (2) interaction of inertial flow with topography generated internal waves along the shelf break, which bifurcated into landward and seaward propagating phases; (3) downwelling along the coast depressed the thermocline; after downwelling relaxes, an internal wave front propagates as a Kelvin wave; and (4) Poincaré waves generated within Mississippi Canyon propagate seaward while being advected westward over the continental slope. These processes interact to produce a three-dimensional internal wave field, which was only partly captured by the observations.

  4. Weathering the storm: children's long-term recall of Hurricane Andrew.

    Science.gov (United States)

    Fivush, Robyn; Sales, Jessica McDermott; Goldberg, Amy; Bahrick, Lorraine; Parker, Janat

    2004-01-01

    Children who experienced a highly stressful natural disaster, Hurricane Andrew, were interviewed within a few months of the event, when they were 3-4 years old, and again 6 years later, when they were 9-10 years old. Children were grouped into low, moderate, or high stress groups depending on the severity of the experienced storm. All children were able to recall this event in vivid detail 6 years later. In fact, children reported over twice as many propositions at the second interview as at the first. At the initial interview, children in the high stress group reported less information than children in the moderate stress group, but 6 years later, children in all three stress groups reported similar amounts of information. However children in the high stress group needed more questions and prompts than children in the other stress groups. Yet children in the high stress group also reported more consistent information between the two interviews, especially about the storm, than children in the other stress groups. Implications for children's developing memory of stressful events are discussed.

  5. Storm-tide elevations produced by Hurricane Andrew along the southern Florida coasts, August 24, 1992

    Science.gov (United States)

    Murray, Mitchell H.

    1994-01-01

    On August 24, 1992, Hurricane Andrew crossed southern peninsular Florida. The combined effects of storm surge from the hurricane and astronomical tide, referred to as storm tide, caused flooding over a large part of southern Florida. Subsequent to the flooding, many high-water marks were identified, described, and surveyed along the south- eastern coast of Florida (Miami to Key Largo) and at selected areas along the southwestern coast of Florida (Flamingo to Goodland). Descriptions of these 336 high-water makrs are presented in tabular form in this report and their locations are plotted on nineteen 7.5-minute topographic quadrangle maps. For the southeastern coast, north-south profiles of the high-water makrs along the outher and inner barrier islands and the western shoreline of Biscayne Bay are presented. Average storm-tide elevations (relative to sea level) ranged from 4 to 6 feet in northern Biscayne Bay, were as much as 17 feet on the western shoreline near the center of the bay and ranged from 3 to 6 feet in southern Biscayne Bay and Barnes Sound. Storm-tide elevations along the southwestern coast ranged from 4 to 5 feet at Flamingo and 5 to 7 feet at Goodland in the Ten Thousand Islands area.

  6. Use of a modified cluster sampling method to perform rapid needs assessment after Hurricane Andrew.

    Science.gov (United States)

    Hlady, W G; Quenemoen, L E; Armenia-Cope, R R; Hurt, K J; Malilay, J; Noji, E K; Wurm, G

    1994-04-01

    To rapidly obtain population-based estimates of needs in the early aftermath of Hurricane Andrew in South Florida. We used a modified cluster-sampling method (the Expanded Programme on Immunization [EPI] method) for three surveys. We selected a systematic sample of 30 quarter-mile square clusters for each survey and, beginning from a random start, interviewed members of seven consecutive occupied households in each cluster. Two surveys were of the most affected area (1990 population, 32,672) at three and ten days after the hurricane struck; one survey was of a less affected area (1990 population, 15,576) seven days after the hurricane struck. Results were available within 24 hours of beginning each survey. Initial findings emphasized the need for restoring utilities and sanitation and helped to focus medical relief on primary care and preventive services. The second survey of the most affected area showed improvement in the availability of food, water, electricity, and sanitation (P < or = .05). There was no evidence of disease outbreaks. For the first time, the EPI method provided population-based information to guide and evaluate relief operations after a sudden-impact natural disaster. An improvement over previous approaches, the EPI method warrants further evaluation as a needs assessment tool in acute disasters.

  7. Business closure and relocation: a comparative analysis of the Loma Prieta earthquake and Hurricane Andrew.

    Science.gov (United States)

    Wasileski, Gabriela; Rodríguez, Havidán; Diaz, Walter

    2011-01-01

    The occurrence of a number of large-scale disasters or catastrophes in recent years, including the Indian Ocean tsunami (2004), the Kashmir earthquake (2005), Hurricane Katrina (2005) and Hurricane Ike (2008), have raised our awareness regarding the devastating effects of disasters on human populations and the importance of developing mitigation and preparedness strategies to limit the consequences of such events. However, there is still a dearth of social science research focusing on the socio-economic impact of disasters on businesses in the United States. This paper contributes to this research literature by focusing on the impact of disasters on business closure and relocation through the use of multivariate logistic regression models, specifically focusing on the Loma Prieta earthquake (1989) and Hurricane Andrew (1992). Using a multivariate model, we examine how physical damage to the infrastructure, lifeline disruption and business characteristics, among others, impact business closure and relocation following major disasters. © 2011 The Author(s). Disasters © Overseas Development Institute, 2011.

  8. Long-term effects of Hurricane Andrew: revisiting mental health indicators.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-09-01

    Two population-based surveys of South Dade County, Florida, were conducted after Hurricane Andrew to compare hurricane-related symptoms of mental distress and describe the impact of mental health outreach teams. Households were selected by three-stage cluster sampling and findings from the two surveys, 13 months apart, were compared. Response rates were 75 per cent and 84 per cent. The prevalence of symptoms of mental distress decreased over time. However, in the households contacted by the teams (25 per cent of sample), the prevalence of symptoms (50 per cent) did not differ from households not contacted (43 per cent). Households contacted by teams that reported symptoms were just as likely to have been referred for help by the teams (72 per cent) as those without symptoms (68 per cent). Households reporting symptoms were equally likely to get counselling regardless of whether the teams visited. Mental health teams had no significant impact on mental health symptoms or the use of mental health services. Alternative approaches to mental health outreach teams need to be explored.

  9. The post-disaster negative health legacy: pregnancy outcomes in Louisiana after Hurricane Andrew.

    Science.gov (United States)

    Antipova, Anzhelika; Curtis, Andrew

    2015-10-01

    Disasters and displacement increasingly affect and challenge urban settings. How do pregnant women fare in the aftermath of a major disaster? This paper investigates the effect of pregnancies in disaster situations. The study tests a hypothesis that pregnant women residing in hurricane-prone areas suffer higher health risks. The setting is Louisiana in the Gulf Coast, United States, a state that continually experiences hurricane impacts. The time period for the analysis is three years following the landfall of Hurricane Andrew in 1992. We analysed low birth weight and preterm deliveries before and after landfall, as a whole and by race. Findings support an association between hazards and health of a community and indicate that pregnant women in the affected area, irrespective of race, are more likely to experience preterm deliveries compared to pre-event births. Results suggest there is a negative health legacy impact in Louisiana as a result of hurricane landfall. © 2015 The Author(s). Disasters © Overseas Development Institute, 2015.

  10. Predicting the Path to Recovery from Hurricane Katrina through the Lens of Hurricane Andrew and the Rodney King Riots

    OpenAIRE

    Robert Baade; Robert Baumann; Victor Matheson

    2005-01-01

    Hurricane Katrina caused the greatest damage of any hurricane in American history. We look at the rebuilding effort in New Orleans through the lens of two other disasters that occurred in 1992: Hurricane Andrew in Miami and the Rodney King riots in Los Angeles. The rebuilding effort in New Orleans shares similarities with both events, combining the impact of a hurricane on infrastructure and private businesses, and the prospect of an uneven recovery biased against racial minorities and the ec...

  11. Commentary on "The Perception and Cognition of Time in Balinese Music" by Andrew Clay McGraw

    OpenAIRE

    Ian Cross; Satinder Gill; Sarah Knight; Chris Nash; Tal-Chen Rabinowitch; Lydia Slobodian; Neta Spiro; Ghofur Woodruff; Matthew Woolhouse

    2008-01-01

    We review the paper by Andrew Clay McGraw, noting that it represents an interesting and valuable contribution to the study of music in cognition in its informed exploration of non-western musical perceptions. We raise a number of concerns about the methods used, and make suggestions as to how the issues that were empirically addressed in the paper might have been tackled in ways that would have enhanced the interpretability of its findings.

  12. Final Environmental Assessment for FY07-11 BRAC Construction Requirements at Andrews Air Force Base, Maryland

    Science.gov (United States)

    2007-09-01

    Branch Library of the Prince George’s County Memorial Library System at 14730 Main St. Upper Marlboro, MD 20772 and at the Andrews AFB Library at 1642...latifolia), highbush blueberry (Vaccinium corymbosum), and Christmas fern (Polystichium acrostichoides) (USAF 2001). Approximately 720 acres of...parks; national parks that exceeded 6,000 acres; and national wilderness areas and memorial parks that exceeded 5,000 acres if these areas were in

  13. National Status and Trends: Bioeffects Program - Magnitude and Extent of Sediment Toxicity in Four Bays of the Florida Panhandle: Pensacola, Choctawhatchee, St. Andrew and Apalachicola

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The toxicity of sediments in Pensacola, Choctawhatchee, St. Andrew and Apalachicola Bays was determined as part of bioeffects assessments performed by NOAA's...

  14. Cinema and the Great War - Andrew Kelly, 1997. History by Hollywood. The use and abuse of the American past - Robert Brant Toplin, 1996

    NARCIS (Netherlands)

    Kester, Bernadette

    1998-01-01

    textabstractReview of: Cinema and the Great War. Andrew Kelly, Londen, New York (Routledge), 1997, 219 p.History by Hollywood. The use and abuse of the American past. Robert Brant Toplin, Chicago (Urbana), 1996, 267 p.

  15. Twenty-one-month follow-up study of school-age children exposed to Hurricane Andrew.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Schorr, C

    1996-03-01

    To explore the 21-month course of posttraumatic stress symptomatology (PTSS) and psychological morbidity in 30 school-age children (7 to 13 years) after exposure to Hurricane Andrew. Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form were administered at 8 and 21 months after Hurricane Andrew. At 21 months 70% of the children endorsed moderate-severe PTSS. The reduction in PTSS was greater for boys than girls. Psychopathology as measured by the Teacher's Report Form increased over the 19-month period. Boys demonstrated significant increases in internalizing symptoms and in Withdrawn, Anxious/Depressed, Social Problems, and Attention Problems scales, and girls showed a significant increase in the Anxious/Depressed scale. Twenty-one months after exposure to Hurricane Andrew, there were continuing high levels of PTSS and evidence of increasing emotional and behavioral problems. While girls sustained higher levels of PTSS, boys demonstrated higher indices of other psychopathology. The enduring effects of disaster associated with secondary stressors and "traumatic reminders" continue to be etiologically important for continuing psychological morbidity.

  16. Damage to unburied flowlines in the Gulf of Mexico during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Collins, J.I.

    1995-12-31

    The US Minerals Management Service reported that 454 sub-sea pipelines were damaged during Hurricane Andrew. Previously, damage to pipelines and flowlines has been reported in a series of papers by Blumberg (1964). In the present paper a formulation of the hydrodynamic loads acting on a flowline which is lying on the seafloor in the presence of waves and currents is summarized. In general, the line dynamics can be represented by a fourth order differential equation with nonlinear forcing but a method is presented which assumes that the complete response can be broken down into distinct phases from ``early motion`` to ``taut line`` to ``yield and breaking``. The selection of appropriate force coefficients and boundary layer interactions is discussed. The initial stages of pipeline migration across the seafloor is shown to be followed by loading of the flowline once all of the ``slack`` is taken up. The loads are shown to be a function of the current orientation and the maximum tension is approximately proportional to the square of the distance between risers. Comparisons of predicted and observed damages confirm that ``effective`` boundary layer thicknesses at the seafloor and typical drag and lift coefficients which were selected based on available literature are consistent with observed flowline damage. The results of sidescan sonar mosaics of pipeline migrations and reported damage are consistent with the loads predicted by relatively simple hydrodynamic/structural models. The material presented in this paper permits the evaluation of the risk of damage to unburied flowlines using relatively simple tools. Guidelines to the assumptions of force coefficients and flowline responses are provided. 20 refs., 11 figs., 2 tabs.

  17. Low-Frequency Response Following the Passage of Hurricane Andrew on the Texas-Louisiana Shelf

    Science.gov (United States)

    Pearce, S. M.; Smith, D. C.; Dimarco, S. F.

    2009-12-01

    During August 24th through 27th in 1992, Hurricane Andrew passed through the Gulf Of Mexico almost directly over several moorings on the easternmost Louisiana shelf portion of the Texas-Louisiana Shelf (LATEX) coastal ocean monitoring program. Examination of the current meter time-series showed the existence of fast moving, long shelf waves over the entire Texas-Louisiana shelf west of the storm passage for up to 12 days after direct forcing ceased. The LATEX program featured 31 moorings each with 3 current meters over the 10, 20, 50, and 200 meter isobaths in 5 cross sectional lines with additional coverage on the 200 meter isobath from the Louisiana-Mississippi River delta, to Corpus Christi, Texas. Additionally, several pressure records from LATEX and several NOAA historical coastal tide gauge data from Sabine Pass to Port Isabella, Texas were incorporated. Raw, 3-hour low pass filtered, and 40-hour low pass filtered versions of the current data were analyzed. The pressure data used were detided using a least squares fit, and the tidal records were detided using the NOAA predicted tides for that location. All data were analyzed using a wavelet analysis to determine the spectra over time. The analyzed data shows that the shelf response was largely dominated in the internal Kelvin wave mode. The wave propagated towards the west on the shelf at approximately 400 km/day. These results are contrasted and compared with wave modes predicted for coastal trapped wave solutions. The output of a coastal ocean model simulation using a forced wind field similar to the storm are also contrasted and compared with the observed data.

  18. Tests of executive functioning predict scores on the MacAndrew Alcoholism Scale.

    Science.gov (United States)

    Deckel, A W

    1999-02-01

    1. Previous work reported that tests of executive functioning (EF) predict the risk of alcoholism in subject populations selected for a "high density" of a family history of alcoholism and/or the presence of sociopathic traits. The current experiment examined the ability of EF tests to predict the risk of alcoholism, as measured by the MacAndrew Alcoholism Scale (MAC), in outpatient subjects referred to a general neuropsychological testing service. 2. Sixty-eight male and female subjects referred for neuropsychological testing were assessed for their past drinking histories and administered the Wisconsin Card Sorting Test, the Wechsler Adult Intelligence Scale-Revised, the Trails (Part B) Test, and the MAC. Principal Components analysis (PCA) reduced the number of EF tests to two measures, including one that loaded on the WCST, and one that loaded on the Similarities, Picture Arrangement, and Trails tests. Multiple hierarchical regression first removed the variance from demographic variables, alcohol consumption, and verbal (i.e., Vocabulary) and non-verbal (i.e., Block Design) IQ, and then entered the executive functioning factors into the prediction of the MAC. 3. Seventy-six percent of the subjects were classified as either light, infrequent, or non-drinkers on the Quantity-Frequency-Variability scale. The factor derived from the WCST on PCA significantly added to the prediction of risk on the MAC (p = .0063), as did scores on Block Design (p = .033). Relatively more impaired scores on the WCST factor and Block Design were predictive of higher scores on the MAC. The other factors were not associated with MAC scores. 4. These results support the hypothesis that decrements in EF are associated with risk factors for alcoholism, even in populations where the density of alcoholic behaviors are not unusually high. When taken in conjunction with other findings, these results implicate EF test scores, and prefrontal brain functioning, in the neurobiology of the risk for

  19. Glass Cathedral: Gay Novel or Liberation Theology? An Interview with Andrew Koh

    Directory of Open Access Journals (Sweden)

    Angus Whitehead

    2013-05-01

    Full Text Available Singaporean Andrew Koh was a founding member of the groundbreaking Necessary Stage theatre company in 1987. In Singapore he is best remembered as the author of Glass Cathedral (1995, Singapore's second gay novel[la], which won the 1994 Singapore Literature Prize Commendation Award and was subsequently shortlisted for the 1996 Commonwealth Writers Prize for the Best First Novel Regional Awards. A collection of poetry, Hybrid from the East, was published in the UK in 1997. A second novel awaits publication. After initially leaving Singapore for London in the mid-1990s he now lives in Sydney as a healthcare worker and qualified Chinese medicine practitioner. Sixteen years after its initial publication, Glass Cathedral the novel is finally receiving attention and reappraisal in the wake of its Glass Cathedral's republication by Epigram Books as a Singapore Classic, alongside works such as Goh Poh Seng's The Immolation, Robert Yeo's The Adventures of Holden Heng and Lloyd Fernando's Scorpion Orchid. The interview took place on 8 November 2011 at a restaurant on the site of Koh's alma mater St Joseph's Institution, Bras Basah Road, Singapore, just days after Koh returned to the city-state and gave a spirited reading from and talk about Glass Cathedral at the Singapore Writers Festival. In this interview Koh discusses his Catholic upbringing, and his employment as a policeman during Singapore's policy of entrapment of homosexual men during the 1990s. Koh goes on to discuss how he came to write Glass Cathedral, his leaving Singapore in response to the nation-state's repressive climate and unsympathetic response to queer writing. In the second half of the interview Koh discusses homophobia in Singapore, the Catholic Church, and elsewhere and its roots in misogyny. Koh also draws attention to other issues explored in Glass Cathedral: the marginalisation of minorities in a supposedly multicultural nation state and the impact of Singapore's secret history

  20. The effect of potassium and mycorrhiza on growth of vanilla (Vanilla planifolia Andrew

    Directory of Open Access Journals (Sweden)

    I GEDE TIRTA

    2006-04-01

    Full Text Available The few and shallow roots caused slow growth of vanilla seedling. Mycorrhiza may increased the absorption of water and nutrients, while potassium may increased the rate of growth and strength of seedlings. This study was conducted at Sambangan Village, Buleleng, Bali in 2003 (April-Agustus 2003. The experiment was done in polybag and was arranged in Randomized Block Design with three replications. The treatments were consisted of two factors. The first factor was the rates of KCl fertilizer ( 0, 100 and 200 kg ha-1 or 0, 0,10 and 0,20 9 plant-1 and the second factor was the rates of mycorrhiza (0, 20 and 30 g plant-1. The aim of the research to study interactions between potassium and mycorrhiza and The optimum dosage the mycorrhiza on growth of vanilla (Vanilla planifolia Andrew. The resultes showed that there were interactions between potassium and mycorrhiza on fresh weight of the new shoot, root length and fresh root weight. The optimum dosage of the mycorrhiza was 20 g plant-1 with new shoot fresh weight was 25.63 g plant-1. The longest root (24.67 cm plant-1 was observed at the treatment without potasium with 20 g plant-1 mycorrhiza and this was 23% longer than control (19.93 cm plant-1. The highest fresh root weight (2.48 g plant-1 was observed at the dosage of 200 kg KCl ha-1 and 20 g mycorrhiza plant-1 and that was 55% heavier than control (1.60 g plant-1. The leaf number of the plant with 20 g plant-1 mycorrhiza was 6.22 and that was 18% more than control with leaf number 5.25. The total fresh weight of the seedling with 20 g plant-1 mycorrhiza was 86.74 g plant-1or 15% higher compared with control (75.18 g plant-1. The dosage of 100 kg KCl ha-1 increased the K content of the plant (2.45%K or 35% higher than control (1.81%K.

  1. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992. [Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hebdon, F.J. [Institute of Nuclear Power Operations, Atlanta, GA (United States)

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility`s actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities.

  2. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992

    International Nuclear Information System (INIS)

    Hebdon, F.J.

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility's actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities

  3. The Andrews' Principles of Risk, Need, and Responsivity as Applied in Drug Abuse Treatment Programs: Meta-Analysis of Crime and Drug Use Outcomes.

    Science.gov (United States)

    Prendergast, Michael L; Pearson, Frank S; Podus, Deborah; Hamilton, Zachary K; Greenwell, Lisa

    2013-09-01

    The purpose of the present meta-analysis was to answer the question: Can the Andrews principles of risk, needs, and responsivity, originally developed for programs that treat offenders, be extended to programs that treat drug abusers? Drawing from a dataset that included 243 independent comparisons, we conducted random-effects meta-regression and ANOVA-analog meta-analyses to test the Andrews principles by averaging crime and drug use outcomes over a diverse set of programs for drug abuse problems. For crime outcomes, in the meta-regressions the point estimates for each of the principles were substantial, consistent with previous studies of the Andrews principles. There was also a substantial point estimate for programs exhibiting a greater number of the principles. However, almost all of the 95% confidence intervals included the zero point. For drug use outcomes, in the meta-regressions the point estimates for each of the principles was approximately zero; however, the point estimate for programs exhibiting a greater number of the principles was somewhat positive. All of the estimates for the drug use principles had confidence intervals that included the zero point. This study supports previous findings from primary research studies targeting the Andrews principles that those principles are effective in reducing crime outcomes, here in meta-analytic research focused on drug treatment programs. By contrast, programs that follow the principles appear to have very little effect on drug use outcomes. Primary research studies that experimentally test the Andrews principles in drug treatment programs are recommended.

  4. Mangroves, hurricanes, and lightning strikes: Assessment of Hurricane Andrew suggests an interaction across two differing scales of disturbance

    Science.gov (United States)

    Smith, Thomas J.; Robblee, Michael B.; Wanless, Harold R.; Doyle, Thomas W.

    1994-01-01

    The track of Hurricane Andrew carried it across one of the most extensive mangrove for ests in the New World. Although it is well known that hurricanes affect mangrove forests, surprisingly little quantitative information exists concerning hurricane impact on forest structure, succession, species composition, and dynamics of mangrove-dependent fauna or on rates of eco-system recovery (see Craighead and Gilbert 1962, Roth 1992, Smith 1992, Smith and Duke 1987, Stoddart 1969).After Hurricane Andrew's passage across south Florida, we assessed the environmental damage to the natural resources of the Everglades and Biscayne National Parks. Quantitative data collected during subsequent field trips (October 1992 to July 1993) are also provided. We present measurements of initial tree mortality by species and size class, estimates of delayed (or continuing) tree mortality, and observations of geomorphological changes along the coast and in the forests that could influence the course of forest recovery. We discuss a potential interaction across two differing scales of disturbance within mangrove forest systems: hurricanes and lightning strikes.

  5. Evaluation of long-term community recovery from Hurricane Andrew: sources of assistance received by population sub-groups.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-12-01

    Two three-stage cluster surveys were conducted in South Dade County, Florida, 14 months apart, to assess recovery following Hurricane Andrew. Response rates were 75 per cent and 84 per cent. Sources of assistance used in recovery from Hurricane Andrew differed according to race, per capita income, ethnicity, and education. Reports of improved living situation post-hurricane were not associated with receiving relief assistance, but reports of a worse situation were associated with loss of income, being exploited, or job loss. The number of households reporting problems with crime and community violence doubled between the two surveys. Disaster relief efforts had less impact on subjective long-term recovery than did job or income loss or housing repair difficulties. Existing sources of assistance were used more often than specific post-hurricane relief resources. The demographic make-up of a community may determine which are the most effective means to inform them after a disaster and what sources of assistance may be useful.

  6. The brain and the biology of belief: An interview with Andrew Newberg, MD. Interview by Nancy Nachman-Hunt.

    Science.gov (United States)

    Newberg, Andrew

    2009-01-01

    Andrew Newberg, MD, is an associate professor in the Department of Radiology, Division of Nuclear Medicine, at the Hospital of the University of Pennsylvania, Philadelphia, with secondary appointments in the Departments of Psychiatry and Religious Studies. He is actively involved in neuroimaging research projects, including the study of the neurophysiological correlates of meditation and other types of complementary therapies. Dr Newberg's research now largely focuses on how brain function is associated with various mental states, in particular, the relationship between brain function and mystical or religious experiences. He has authored several books, including Why God Won't Go Away: Brain Science and the Biology of Belief (Ballantine/Random House, 2001) and coauthor with Eugene G. d'Aquili, MD, of The Mystical Mind: Probing the Biology of Religious Experience (Fortress Press, 1999). His most recent book is How God Changes Your Brain, with coauthor Mark Waldman (Ballantine Books, 2009).

  7. Enhancing breast projection in autologous reconstruction using the St Andrew's coning technique and 3D volumetric analysis.

    Science.gov (United States)

    Chae, Michael P; Rozen, Warren Matthew; Patel, Nakul Gamanlal; Hunter-Smith, David J; Ramakrishnan, Venkat

    2017-12-01

    An increasing number of women undergo mastectomy for breast cancer and post-mastectomy autologous breast reconstruction has been shown to significantly improve the psychosexual wellbeing of the patients. A goal of treatment is to achieve symmetry and projection to match the native breast, and/or the contralateral breast in the case of a unilateral reconstruction. Autologous reconstruction, particularly with the deep inferior epigastric artery perforator (DIEP) flap, is particularly advantageous as it can be manipulated to mimic the shape and turgor of the native breast. However, very few techniques of shaping the breast conus when insetting the DIEP flap to enhance aesthetic outcome have been reported to date. With the aide of three-dimension (3D) photography and 3D-printed mirrored image of the contralateral breast as a guide intraoperatively, we describe our St Andrew's coning technique to create a personalized flap projection. We report a prospective case series of 3 delayed unilateral breast reconstructions where symmetrization procedure to the contralateral breast was not indicated. Using a commercial 3D scanner (VECTRA XR, Canfield Scientific), the breast region was imaged. The mirrored image was 3D-printed in-house using a desktop 3D printer. In all cases, projection of the breast mound was able to be safely achieved, with a demonstrated central volume (or 'cone') able to be highlighted on imaging and a 3D printed breast. A 3D print of the contralateral breast was able to be used intraoperatively to guide the operative approach. The St Andrew's coning technique is a useful aesthetic maneuver for achieving breast projection during DIEP flap breast reconstruction, with 3D imaging techniques able to assist in perioperative assessment of breast volume.

  8. 78 FR 76812 - In the Matter of: Andrew Vincent O'Donnell, Inmate Number-62355-019, USP Atlanta, U.S...

    Science.gov (United States)

    2013-12-19

    ... DEPARTMENT OF COMMERCE Bureau of Industry and Security In the Matter of: Andrew Vincent O'Donnell... the Internal Security Act of 1950 (50 U.S.C. 783(b)), or section 38 of the Arms Export Control Act (22... 750.8 of the Regulations states that the Bureau of Industry and Security's Office of Exporter Services...

  9. Invertebrates of The H.J. Andrews Experimental Forest, western Cascade Range, Oregon. V: An annotated list of insects and other arthropods.

    Science.gov (United States)

    Gary L. Parson; Gerasimos Cassis; Andrew R. Moldenke; John D. Lattin; Norman H. Anderson; Jeffrey C Miller; Paul Hammond; Timothy D. Schowalter

    1991-01-01

    An annotated list of species of insects and other arthropods that have been collected and studies on the H.J. Andrews Experimental forest, western Cascade Range, Oregon. The list includes 459 families, 2,096 genera, and 3,402 species. All species have been authoritatively identified by more than 100 specialists. Information is included on habitat type, functional group...

  10. Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia

    OpenAIRE

    Chung Ming CHIN; Punggol Secondary School

    2014-01-01

    Book Review of the edited compilation: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia, Washington DC: The World Bank, ISBN: 978-0-8213-8626-2, 264 pages

  11. Segmentation and Accretionary Processes Near the Andrew Bain Mega-Transform Fault: The Southwest Indian Ridge 25°-35°E

    Science.gov (United States)

    Takeuchi, C. S.; Sclater, J. G.; Grindlay, N. R.; Madsen, J. A.; Rommevaux-Jestin, C.

    2008-12-01

    The ultra-slow spreading Southwest Indian Ridge (SWIR) separates the Antarctic and African plates. We present results from two surveys covering the SWIR between 26° and 27°30'E and between 32° and 35°E, lying on either side of the long-offset Andrew Bain transform fault. The objectives of the surveys were to characterize the segmentation of an ultra-slow spreading ridge on either side of a long-offset transform fault and to examine the structure of the individual segments. Four transform faults, the Du Toit, Andrew Bain, Marion, and Prince Edward, and one non-transform discontinuity bound four accretionary segments in the survey areas. Two segments lie northeast of the Andrew Bain (32°-35°E). Large central axial volcanoes, deep, broad mantle Bouguer anomaly (MBA) lows, and high magnetization intensities centered on the spreading axis result from high magmatic activity. Increased magmatism on the ridge axis is likely caused by high mantle temperatures produced by the close proximity of the Marion Plume, which abuts the northern end of the Andrew Bain. Two segments lie southwest of the Andrew Bain (26°-27°30'E). Discrepancies in the locations of the axial rift valley, central magnetization high, and an irregularly-shaped MBA low suggest complex accretionary processes at the western segment (~26°-27° E). The eastern segment (~27°-27°30'E), which abuts the southwest end of the Andrew Bain, shows a deep axial valley, MBA values which increase to the east, and nearly nonexistent magnetization intensity. These features are probably the result of amagmatic accretion caused by the transform edge effect of the Andrew Bain. A transition in the character of topography at 26°45'E suggests that the current segment configuration may not be temporally stable. High-relief (~1 km) ridge-trough structures south of the spreading axis may be the result of an episodic interplay between accretion, both magmatic and amagmatic, and tectonic extension.

  12. Inhibition of the gastric H+,K+ -ATPase by plectrinone A, a diterpenoid isolated from Plectranthus barbatus Andrews.

    Science.gov (United States)

    Schultz, Carla; Bossolani, Myllene P; Torres, Luce M B; Lima-Landman, Maria Teresa R; Lapa, Antonio J; Souccar, Caden

    2007-04-20

    This work assessed the mechanism underlying the antisecretory gastric acid effect of Plectranthus barbatus Andrews (Lamiaceae) and active constituents. Popularly known as "false-boldo", this plant is used in Brazilian folk medicine to treat gastrointestinal and hepatic ailments. The plant aqueous extract (AE) and isolated compounds were assayed in vivo in pylorus-ligated mice, and in vitro on acid secretion measured as [(14)C]-aminopyrine ([(14)C]-AP) accumulation in rabbit gastric glands and gastric H(+),K(+)-ATPase preparations. Injected into the duodenal lumen, the AE of the plant leaves (0.5 and 1.0 g/kg) decreased the volume (62 and 76%) and total acidity (23 and 50%) of gastric acid secretion in pylorus-ligated mice. Bioguided purification of the AE yielded an active fraction (IC(50)=24 microg/ml) that inhibited acid secretion in rabbit gastric glands with a potency 10 to 18 times greater than that of the originating extract, on both the basal and stimulated acid secretion by histamine (His) (1 microM) or bethanechol (100 microM). At the same concentrations the gastric H(+),K(+)-ATPase activity was also inhibited. The active constituent was chemically identified as the abietanoid dienedione plectrinone A which reduced the H(+),K(+)-ATPase activity with IC(50)=171 microM. The results indicate that inhibition of the gastric proton pump by this diterpenoid may account for the antisecretory acid effect and reputed anti ulcer activity of Plectranthus barbatus.

  13. Genetic fidelity of long-term micropropagated shoot cultures of vanilla (Vanilla planifolia Andrews) as assessed by molecular markers.

    Science.gov (United States)

    Sreedhar, Reddampalli V; Venkatachalam, Lakshmanan; Bhagyalakshmi, Neelwarne

    2007-08-01

    Occurrence of genetic variants during micropropagation is occasionally encountered when the cultures are maintained in vitro for long period. Therefore, the micropropagated multiple shoots of Vanilla planifolia Andrews developed from axillary bud explants established 10 years ago were used to determine somaclonal variation using random amplified polymorphic DNA (RAPD) and intersimple sequence repeats markers (ISSR). One thousand micro-plants were established in soil of which 95 plantlets (consisting of four phenotypes) along with the mother plant were subjected to genetic analyses using RAPD and ISSR markers. Out of the 45 RAPD and 20 ISSR primers screened, 30 RAPD and 7 ISSR primers showed 317 clear, distinct and reproducible band classes resulting in a total of 30 115 bands. However, no difference was observed in banding patterns of any of the samples for a particular primer, indicating the absence of variation among the micropropagated plants. Our results allow us to conclude that the micropropagation protocol that we have used for in vitro proliferation of vanilla plantlets for the last 10 years might be applicable for the production of clonal plants over a considerable period of time.

  14. Lessons learned from Hurricane Andrew: recommendations for care of the elderly in long-term care facilities.

    Science.gov (United States)

    Silverman, M A; Weston, M; Llorente, M; Beber, C; Tam, R

    1995-06-01

    We report on the experience of a 500-bed, long-term care facility in Miami, Fla, which provides housing and nursing care units for patients--ranging from those who are independently ambulatory to those who are acutely ill and feeble--in preparing for, during, and in the immediate aftermath of Hurricane Andrew, which struck on August 24, 1992. The problems encountered included a massive influx of evacuated elderly to the facility, facility isolation, loss of electrical power, loss of running water, special dietary needs, and limited professional staffing due to personal property losses or loss of transportation. Overwhelmed county emergency medical services, limited access to hospitals and patient care, and difficulty in procuring supplies exacerbated the already complicated situation resulting from the storm. As a result of these catastrophic conditions, a number of challenges specific to the care of the elderly were identified. In conjunction with the Florida Department of Elder Affairs, we drafted a comprehensive blueprint that could serve as a disaster plan for other long-term care facilities facing a similar threat during the hurricane season.

  15. Apocalyptic Kingship, Harmony and Political Expediency: the Challenges and Paradoxes of Andrew Marvell’s “First Anniversary”

    Directory of Open Access Journals (Sweden)

    Jajtner Tomáš

    2015-07-01

    Full Text Available The following paper deals with the interpretation of one of the major “Cromwellian” poems of Andrew Marvell (1621-1678, “The First Anniversary of the Government under His Highness the Lord Protector”, 1655. The poem is first set in the context of Marvell’s poetry and his public career in the period between 1637 and 1660. The article then identifies and analyses three main themes of “The First Anniversary”: the notion of a new aeon starting with Cromwell’s rule and the apocalyptical imagery related to his Protectorate, the concept of his power and authority between liberty and tyranny, and the relation between the harmony established by Cromwell and classical Pythagorean harmonious lore. The author argues that the imagery Marvell uses to describe the nature of the regime (especially the concept of Cromwell’s “no-kingship” shows a deeply paradoxical structure, which uncovers the frailty and insecurity of Cromwell’s dictatorship as well as the circular logic of its justification. In that sense, the poem can be read as a vivid manifestation of the dilemmas and tensions of this period.

  16. The Impact of Structural Break(s on the Validity of Purchasing Power Parity in Turkey: Evidence from Zivot-Andrews and Lagrange Multiplier Unit Root Tests

    Directory of Open Access Journals (Sweden)

    Hakan Kum

    2012-01-01

    Full Text Available This study examines the validity of the purchasing power parity (PPP in Turkey for annual data from 1953 to 2009. While results from both the ADF unit root and the DF-GLS unit root test indicate mixed results, PPP holds for Turkey with the presence of structural breaks which are obtained by Zivot and Andrews and Lagrange Multiplier unit root tests.

  17. Hurricane Andrew causes major oil spill at Florida Power ampersand Light Company's Turkey Point Power Plant, Homestead, Florida

    International Nuclear Information System (INIS)

    Jones, M.A.; Butts, R.L.; Lindsay, J.R.; McCully, B.S.; Pickering, T.H.

    1993-01-01

    On August 24, 1992, Hurricane Andrew slammed into South Florida with wind gusts in excess of 160 mph. At 4:00 a.m. that day, the eye of this category four storm passed over Florida Power ampersand Light Company's Turkey Point power plant, south of Miami. Although the plant's two nuclear units escaped any significant damage, the storm caused extensive destruction to buildings and transmission facilities, and damaged two 400 foot tall emission stacks associated with the site's two fossil fuel generating units. In addition, a 90,000 to 110,000 gallon spill of No. 6 fuel oil resulted when a piece of wind-blown debris punctured the steel of the unit One 12,000 barrel fuel oil metering tank approximately 30 feet up from the tank bottom. Despite the presence of a secondary containment structure around the tank, the intense wind blew oil throughout the plant site. The damage to the metering tank apparently occurred during the first half hour of the hurricane. As the tank's oil level fell due to the puncture, transfer pumps from the bulk oil storage tanks received a low level alarm which automatically began transferring oil to the damaged metering tank. To prevent the further discharge of oil, plant personnel entered the power block and secured the pumps during the passage of the hurricane eye. Immediately following the storm, facility personnel deployed booms across the barge canal and the Units 1 and 2 intake canal to contain the oil which had entered the water. The response strategy and implementation is described in detail. The remediation costs were approximately $14/gallon spilled, including 54,000 gallons recovered for electricity generation

  18. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    et al 2000). CMV is a multicomponent virus with a single stranded positive sense RNA. .... sense primer 5′ ATGGACAAATCTGAATCAAC 3′ was derived from the beginning of the first 20 bases of the ..... Pappu S S, Brand R, Pappu H R, Rybicki E, Gough K H, Frenkel. M J and Niblett C L 1993 A polymerase chain reaction.

  19. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    species including cereals, fruits, vegetables and ornamentals. (Roossinck 1999). CMV is readily transmitted in a non-per- sistent manner by more than 75 species of aphids (Palukaitis et al 1992). Weed hosts function as a reservoir for the virus and serve as sources of inoculum for the development of disease epidemics.

  20. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews

    Directory of Open Access Journals (Sweden)

    Haryuni Haryuni

    2016-09-01

    Full Text Available Vanilla (Vanilla planifolia Andrews is one of the important exported commodities in Indonesia. Indonesia is one of top five major vanilla exporters in the world, that produce the high quality of Indonesian vanilla with high vanillin content (2.75%. The aims of this research were to determine the effects of dose binukleat Rhizoctonia (BNR and phosphorus as well as the interaction of the nitrate reductase activity (NRA and chlorophyll of the vanilla seedling (Vanilla planifolia Andrew. Method in this research used completely randomized factorial design, by involving two factors (dose of BNR inoculation and Phosphor. The first factor is without inoculation and inoculation BNR (M0, M1, M2, M3 wich consists of (0,5, 10, 15 g/polybag, the second factor is the dose of phosphorus fertilizer (P0, P1, P2, P3 which consists of (0, 3, 6, 9 g/polibag. The results showed that the inoculation dose of BNR and doses of phosphorus not significant and lower levels of NRA and chlorophyll while the interaction dose of BNR and phosphorus significantly and increase levels of NRA and chlorophyll of vanilla seedling. Nitrate Reductase Activity and chlorophyll has important role in metabolism process as a plant growth indicator.How to CiteHaryuni, H., & Dewi, T. S. K. (2016. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews. Biosaintifika: Journal of Biology & Biology Education, 8(2, 141-147.

  1. Maaleht soovitab : Anu Tali dirigeerib Vanemuises "Toscat". Vivaldi, Casanova ja Veneetsia. "Uinuv kaunitar" Vanemuises. Andrew Lloyd Webberi juubelikontserdid. Pärimusmuusika lõiluspidu

    Index Scriptorium Estoniae

    2008-01-01

    27. sept. juhatab Anu Tali Vanemuise teatris Mikk Mikiveri lavastatud ja Ervin Õunapuu taastatud Puccini ooperilavastust "Tosca". Barokkansambel Corelli Consort ja Raivo Järvi esitavad kava "Vivaldi, Casanova ja Veneetsia" 15. okt. Maardu mõisa muusikasalongis, 18. okt. Pärnus sarjas "Café Grand muusikasalong" ja 19. okt. Eesti Teaduste Akadeemia majas sarjas "Toompea muusikasalong". Vanemuisees esietendub 4. okt. Pjotr Tshaikovski ballett "Uinuv kaunitar". Tallinnas Saku Suurhallis toimuvad 18. okt. briti muusikalihelilooja Andrew Lloyd Webberi 60. sünnipäevale pühendatud juubelikontserdid. Viljandi Pärimusmuusika Aidas peetakse 10.-11. okt. "Pärimusmuusika lõikuspidu"

  2. Fuel to the nuclear debate : [Rezension von:] Nuclear power in crisis, Andrew Blowers and David Pepper (editors), New York, Nichols; London ..., Croom Helm, 1987

    OpenAIRE

    Renn, Ortwin

    1988-01-01

    Nuclear energy is one of the most popular topics of today’s publication market. The literature about the pros and cons of nuclear power may easily fill a whole library. Is there anything new to add to this voluminous body of arguments and contra-arguments that would justify editing another book on nuclear energy? Andrew Blowers and David Pepper obviously felt that way and published a reader on Nuclear Power in Crisis. The book consists of 13 articles covering mainly the political, social and ...

  3. Nomina nova in Platyhelminthes pro Macrorhynchus von Graff, 1882 (non [Gmelin, 1801]; non Dunker, 1843), and Leptocleidus Mueller, 1936 (non Andrews, 1922).

    Science.gov (United States)

    Hornung, Jahn J

    2016-08-19

    Two genus-group names of flat-worms-Leptocleidus Mueller, 1936 and Macrorhynchus von Graff, 1882-are junior homonyms that are preoccupied by fossil diapsid reptile genera-Leptocleidus Andrews, 1922, and Macrorhynchus Dunker, 1843-and an extant teleost fish genus-Macrorhynchus [Gmelin, 1801] ex La Cépède, 1800. These are replaced by nomina nova (Pharyngodytes nom. nov.; Graffiellus nom. nov.). Macrorhynchus [Gmelin, 1801] is an objective senior synonym of Macrorhyncus Dumeríl, 1805 ex La Cépède, 1800 (syn. nov.), and a senior homonym of Macrorhynchus Dunker, 1843, and Macrorhynchus von Graff, 1882.

  4. Utilizing NASA Earth Observations to Assess Impacts of Hurricanes Andrew and Irma on Mangrove Forests in Biscayne Bay National Park, FL

    Science.gov (United States)

    Kumar, A.; Weber, S.; Remillard, C.; Escobar Pardo, M. L.; Hashemi Tonekaboni, N.; Cameron, C.; Linton, S.; Rickless, D.; Rivero, R.; Madden, M.

    2017-12-01

    Extreme weather events, such as hurricanes, pose major threats to coastal communities around the globe. However, mangrove forests along coastlines act as barriers and subdue the impacts associated with these catastrophic events. The Biscayne Bay National Park mangrove forest located near the city of Miami Beach was recently affected by the category four hurricane Irma in September of 2017. This study analyzed the impact of Hurricane Irma on Biscayne Bay National Park mangroves. Several remote sensing datasets including Landsat 8 Operational Land Imager (OLI), Sentinel 2-Multi Spectral Imager (MSI), PlanetScope, and aerial imagery were utilized to assess pre-and post-hurricane conditions. The high-resolution aerial imagery and PlanetScope data were used to map damaged areas within the national park. Additionally, Landsat 8 OLI and Sentinel-2 MSI data were utilized to estimate changes in biophysical parameters, including gross primary productivity (GPP), before and after Hurricane Irma. This project also examined damages associated with Hurricane Andrew (1992) using historical Landsat 5 Thematic Mapper (TM) data. These results were compared to GPP estimates following Hurricane Irma and suggested that Hurricane Andrew's impact was greater than that of Irma in Biscayne Bay National Park. The results of this study will help to enhance the mangrove health monitoring and shoreline management programs led by officials at the City of Miami Beach Public Works Department.

  5. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-β -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae

    Directory of Open Access Journals (Sweden)

    Roberta T. dos Santos

    2012-01-01

    Full Text Available MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae, showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG, after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC50 value of 67 µM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature.

  6. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    International Nuclear Information System (INIS)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia

    2012-01-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC 50 value of 67 μM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  7. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia [Universidade Federal de Sao Paulo (UNIFESP), Diadema, SP (Brazil). Inst. de Ciencias Ambientais, Quimicas e Farmaceuticas; Tempone, Andre G.; Pinto, Erika G. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil). Dept. de Parasitologia; Lorenzi, Harri, E-mail: psartorelli@unifesp.br [Instituto Plantarum de Estudos da Flora, Nova Odessa, SP (Brazil)

    2012-07-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-{beta}-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC{sub 50} value of 67 {mu}M, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  8. Public health assessment for Wheeling Disposal Service Company Landfill, Amazonia, Andrew County, Missouri, Region 7, CERCLIS number MOD000830554. Final report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-08-25

    The Wheeling Disposal Service Company, Inc., (Wheeling Disposal) site is a closed municipal and industrial waste landfill, approximately 1 mile southeast of Amazonia, Andrew County, Missouri. On-site shallow groundwater is contaminated with Volatile Organic Compounds (VOCs) (methylene chloride, carbon tetrachloride, trichloroethylene) and metals; however, no one is using that water for potable purposes at present. Isolated farm houses are situated in the vicinity of the site, but the houses that would most likely be affected are connected to the public water system. From the information reviewed, DOH concludes that the Wheeling Disposal site currently poses no apparent public health hazard. No exposures are known to be occurring at this time. Potential exposure pathways have been identified, but remedial actions eliminated them.

  9. The impact of Hurricane Andrew on deviant behavior among a multi-racial/ethnic sample of adolescents in Dade County, Florida: a longitudinal analysis.

    Science.gov (United States)

    Khoury, E L; Warheit, G J; Hargrove, M C; Zimmerman, R S; Vega, W A; Gil, A G

    1997-01-01

    Findings from a longitudinal study are presented on the relationships between the problems and stresses resulting from Hurricane Andrew and posthurricane minor deviant behavior. The sample (N = 4,978) included Hispanic, African-American, and White non-Hispanic middle school students enrolled in Dade County, Florida public schools. Two waves of data were collected prior to the hurricane; a third was obtained approximately 6 months following the storm. Results indicated that females were likely to report higher levels of hurricane-related stress symptoms than males. After controlling for prehurricane levels of minor deviance, family support, and race/ethnicity, hurricane stress symptom level remained a significant predictor of posthurricane minor deviant behavior. The findings lend support to stress theories of social deviance.

  10. Die erediens as fees of die fees as erediens?: �n Andrew Murray pryswenner �n kwarteeu later herlees

    Directory of Open Access Journals (Sweden)

    Cas Wepener

    2014-08-01

    Full Text Available Worship as feast or feast as worship? Re-reading an Andrew Murray prizewinner one quarter of a century later. The aim of this contribution is to bring the book Die erediens as fees into discussion with the surrounding culture almost one quarter of a century after its publication. The surrounding culture, we shall call, following Martin Stringer and his so-called discourse of globalisation and consumerism, �the feast as worship service�. Based on this discussion, our research question pertains to the value of Die erediens as fees for the field of Liturgical Studies today. An answer is attempted by, firstly, sketching the liturgical landscape as well as national and international liturgical-scientific developments in our day and, secondly, providing a liturgical-aesthetical exploration and positioning Die erediens as fees within these developments and exploration.

  11. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    Energy Technology Data Exchange (ETDEWEB)

    Moniz, Ernest [U.S. Energy Secretary

    2014-02-03

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  12. An Analysis and Comparison of Two Short Writings: "Inaugural Address at the University of St. Andrew's" by J.S. Mill and "The University of Utopia" by R.M. Hutchins, Based on Five Criteria.

    Science.gov (United States)

    Poirier, Jeannine M.

    Focusing on the concept of education for work vs. education for living, the author presents a comparative analysis of two works on liberal education, each of which was originally delivered orally to university students: "The Inaugural Address at the University of St. Andrew" by John Stuart Mill and "The University of Utopia" by…

  13. Book Review: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia

    OpenAIRE

    Chung Ming CHIN

    2014-01-01

    Book Review of the edited compilation: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia, Washington DC: The World Bank, ISBN: 978-0-8213-8626-2, 264 pages

  14. Environmental Assessment for the Construction and Operation of a New Shoppette/Gas Station, Class Six Store, and Name-Brand Fast Food Store at Joint Base Andrews Camp Springs, Prince George’s County, Maryland

    Science.gov (United States)

    2010-02-01

    construction standards to mitigate antiterrorism vulnerabilities and terrorist threats. These requirements are incorporated in the Andrews AFB General...Regulation .03B(7) of this chapter, shall: (1) Use a method approved by the Department to: (a) Test all spill catchment basins and containment sumps in

  15. Promoting Technology Uses in the Elementary Mathematics Classroom: Lessons in Pedagogy from Zoltan Dienes

    Science.gov (United States)

    Connell, Michael; Abramovich, Sergei

    2016-01-01

    Today technology allows for the utilization of new classes of mathematical objects which are themselves subject to new modes of student interaction. A series of notable examples may be found in the National Library of Virtual Manipulatives. These virtual manipulatives draw much of their power from their physical embodiment in the form of hand-on…

  16. Nagy, Zoltan, A.: A history of modern immunology: the path toward understanding.

    Science.gov (United States)

    Dembic, Zlatko

    2014-11-29

    This book provides a detailed survey of the major advances made in the field of immunology in a period corresponding approximately to the last third of the twentieth century. In the first chapter, referred to as Pre-History, the Author, an experienced senior immunologist, briefly summarizes the preceding era often called "immunological revolution", in which the foundations of a new science, immunobiology, were laid down. The subsequent chapters (The History) then deal in detail with a number of topics within immunobiology, such as, the generation of antibody diversity, monoclonal antibodies, the major histocompatibility complex, antigen presentation, T cell biology, self tolerance, and autoimmunity. The fact that the Author contributed himself to most of these topics lends the text more depth and authenticity. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. Evaluation of the use of Ocimum suave Willd. (Lamiaceae), Plectranthus barbatus Andrews (Lamiaceae) and Zanthoxylum chalybeum Engl. (Rutaceae) as antimalarial remedies in Kenyan folk medicine.

    Science.gov (United States)

    Kiraithe, Micheni N; Nguta, Joseph M; Mbaria, James M; Kiama, Stephen G

    2016-02-03

    Crude extracts from the leaves of Ocimum suave Willd (Lamiaceae) and the root barks of Plectranthus barbatus Andrews (Lamiaceae) and Zanthoxylum chalybeum Engl. (Rutaceae) were studied to ascertain the ethnopharmacological standing of their antimalarial usage in Kenyan folk medicine. Aqueous and Chloroform: Methanol (1:1) extracts of the plants were used in this study. Toxicity of the extracts was investigated by using brine shrimp lethality test and acute oral toxicity in mice. The antimalarial activity at a dose of 100 mg/kg was screened in Swiss albino mice against chloroquine sensitive Plasmodium berghei (D6) using Peters 4-day suppressive test. Chloroquine, at a dosage rate of 20 mg/kg was used as a reference drug. The extracts showed some signs of acute toxicity in the brine shrimp lethality test. However, no signs of toxicity were observed in the mice at a dose of 2000 mg/kg of the crude extracts. The results revealed that all the tested crude extracts were safe. Z. chalybeum aqueous extract and P. barbatus organic extract showed chemosuppressive activities of 81.45% and 78.69%, respectively. This antimalarial activity was not significantly different from that of chloroquine (P<0.05). The findings suggest that the Kenyan folkloric medicinal application of these plants has a pharmacological basis. Bioactivity guided fractionation and isolation of bioactive molecules from the two species could lead to new hits against Plasmodium falciparum malaria. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Small-scale variations of climate change in mountainous forested terrain - a regional study from H.J. Andrews Long Term Ecological Research site in Oregon, USA

    Science.gov (United States)

    Honzakova, Katerina; Hoffmann, Peter; Jones, Julia; Thomas, Christoph

    2017-04-01

    There has been conflicting evidence as to whether high elevations are experiencing more pronounced climate warming than lower elevations in mountainous regions. In this study we analyze temperature records from H.J. Andrews Long Term Ecological Research, Oregon, USA and several nearby areas, comprising together 28 stations located in Cascade Mountains. The data, starting in 1958, are first checked for quality and homogenized using the Standard Normal Homogeneity Test. As a reference, composite climate time series based on the Global Historic Climate Network is created and together with cross-referencing against station records used to correct breaks and shifts in the data. In the next step, we investigate temperature patterns of the study site from 1958 to 2016 and compare them for valley and hill stations. In particular, we explore seasonality and inter-annual variability of the records and trends of the last day of frost. Additionally, 'cold' sums (positive and negative) are calculated to obtain a link between temperature and ecosystems' responses (such as budbreaks). So far, valley stations seem to be more prone to climate change than ridge or summit stations, contrary to current thinking. Building on previous knowledge, we attempt to provide physical explanations for the temperature records, focusing on wind patterns and associated phenomena such as cold air drainage and pooling. To aid this we analyze wind speed and direction data available for some of the stations since 1996, including seasonality and inter-annual variability of the observed flows.

  19. Geographic variation in life-history traits: growth season affects age structure, egg size and clutch size in Andrew's toad (Bufo andrewsi).

    Science.gov (United States)

    Liao, Wen Bo; Luo, Yi; Lou, Shang Ling; Lu, Di; Jehle, Robert

    2016-01-01

    Environmental variation associated with season length is likely to promote differentiation in life-history traits, but has been little studied in natural populations of ectotherms. We investigated patterns of variation in egg size, clutch size, age at sexual maturity, maximum age, mean age, growth rate and adult body size in relation to growth season length among 17 populations of Andrew's toad (Bufo andrewsi) at different latitudes and altitudes in the Hengduan Mountains, western China. We found that egg size, age at sexual maturity, and mean age increased with decreasing length of the growth season, whereas clutch size showed a converse cline. Body size did not increase with decreasing length of the growth season, but was tightly linked to lifetime activity (i.e. the estimated number of active days during lifetime). Males and females differed in their patterns of geographic variation in growth rates, which may be the result of forces shaping the trade-off between growth and reproduction in different environments. Our findings suggest that growth season plays an important role in shaping variation in life-history traits in B. andrewsi across geographical gradients.

  20. Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

    Science.gov (United States)

    Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

    2015-07-01

    The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

  1. Computer Modeling of Hydrology, Weathering, and Isotopic Fractionation in Andrews Creek, Rocky Mountain National Park, Colorado for Water Years 1992 through 2012

    Science.gov (United States)

    Webb, R. M. T.; Parkhurst, D. L.; Mast, A.; Clow, D. W.

    2014-12-01

    The U.S. Geological Survey's (USGS) Water, Energy, and Biogeochemical Model (WEBMOD) was used to simulate hydrology, weathering, and isotopic fractionation in the 1.7 square kilometer Andrews Creek alpine watershed. WEBMOD includes hydrologic modules derived from the USGS Precipitation Runoff Modeling System, the National Weather Service Hydro-17 snow model, and TOPMODEL. PHREEQC, a geochemical reaction model, is coupled with the hydrologic model to simulate the geochemical evolution of waters as they evaporate, mix, and react within the landscape. Major solute concentrations and δ18O were modeled over the period 1992-2012. Variations of chloride and inorganic nitrogen respond almost entirely to variations in atmospheric deposition and preferential elution of snowpack. Both evaporation and melting result in isotopic enrichment of heavy isotopes in the residual snowpack throughout the summer. Magnesium and potassium, derived mostly from weathering with some atmospheric inputs, vary seasonally with uptake during the growing season and release during the fall and winter. The weathering of granitic minerals—oligoclase, biotite, chlorite, pyrite, calcite, and formation of secondary minerals—kaolinite, goethite, gibbsite, and smectite-illite—were selected as primary reactions based on mole-balance modeling of basin outflows. The rates of these reactions were quantified by calibrating WEBMOD to match observed concentrations and loads. Exported annual loads of most weathering products are highly correlated with discharge, whereas silica loads are less correlated with discharge, suggesting a source that is more active during dry years and less active during wet years. Potential sources include net dissolution of kaolinite and smectite-illite or mineralization of colloids with high silica content. WEBMOD is a valuable tool for simulating water quality variations in response to climate change, acid mine drainage, acid rain, biological transformations, and other

  2. Feeding behavior of hummingbirds and perching birds on Erythrina speciosa Andrews (Fabaceae flowers in an urban area, Londrina, Paraná, Brazil Comportamento alimentar de beija-flores e Passeriformes nas flores de Erytrhina speciosa Andrews (Fabaceae em uma área urbana de Londrina, Paraná, Brasil

    Directory of Open Access Journals (Sweden)

    Luciana Baza Mendonça

    2006-03-01

    Full Text Available Nine species of birds - seven hummingbirds (Trochilidae and two Passeriformes - were observed visiting the flowers of Erythrina speciosa Andrews (Fabaceae, a hummingbird-pollinated species present on the campus of Londrina State University, Paraná State, Brazil. Nectar in bagged flowers bore little relationship with nectar in flowers opened to foragers either regarding quantity or diurnal pattern of availability. Birds were more frequent early in the morning and their activity on flowers further declined, apparently following the pattern of nectar availability. The manner to which birds probed the flowers and, in consequence, their role on pollination were greatly determined by morphological traits and approaching behavior of birds. E. speciosa seemed best suited for pollination by long-billed hummingbirds but some short to medium-billed species may play some role on its pollination.Nove espécies de aves - sete beija-flores (Trochilidae e duas aves Passeriformes - foram observados visitando as flores de Erythrina speciosa Andrews (Fabaceae, uma espécie polinizada por beija-flores presente no campus da Universidade Estadual de Londrina, Paraná, Brasil. O néctar em flores ensacadas apresentou pouca relação com aquele em flores expostas aos visitantes, tanto em termos de quantidade como em temos de padrão diurno de disponibilidade. As aves foram mais freqüentes de manhã e sua atividade nas flores diminuiu no transcorrer do dia, coincidindo com o padrão de disponibilidade de néctar. O comportamento de visita das aves e, em conseqüência, sua atuação na polinização da espécie foram em grande parte determinadas por características morfológicas e comportamentais destas. E. speciosa parece ser adaptada para polinização por beija-flores de bicos longos, embora espécies com bicos de comprimento curto a médio possam ter algum papel em sua polinização.

  3. Mesnevî Şârihi Şem’î Şem’ullah’ın Şerh Yöntemi İle Walter G. Andrews'un Sözdizimsel Metin Yorumlama Yöntemi Arasındaki Benzerlik Similarity Between Commentator Şem'î Şem'ullah's Method Of Interpretation For Mesnevî And Walter G. Andrews's Syntactical Text Interpretation

    Directory of Open Access Journals (Sweden)

    Turgut KOÇOĞLU

    2012-12-01

    Full Text Available From the past to present texts, needed to explain, have beeninterpreted by people who think that they have better understandingthan the others. Islamic literature, in order to understand the basics oftexts beginning with the Koran and the hadith also interpretationactivities affect literary works. After acceptance of Islam, particularlyreligious works and the other many works were translated and wereinterpreted from Persian and Arabic to Turkish. In time, these activitieshave caused to appear annotation system. In Turkish literature, literarytexts were interpreted with traditional annotation system until thetwentieth century. On the other hand after this century differentmethods can be considered a modern interpretation, literary textscontinued efforts understanding and expressing. Each method hasconsidered these texts in terms of different perspectives and it hasinterpreted.In recent times, Andrews who has interpreted Ottoman poem witha different point of view emphasized that using a unique feature ofTurkish syntax, the meaning of a sentence refers to both stress andintensity. According to Andrews, Divan poetry has the syntactic freedomand comfort like colloquial Turkish. Thanks to this flexibility, in the textoccurs ambiguity. Therefore, it supplies multiple meanings, differentinterpretation and understanding.From past to present, Andrews says that texts are not taken intoaccount syntactic features and nobody makes efforts to interpret thetexts in such a way. However Şem’i Şem’ullah who, is one of the majorpoets of the sixteenth century, used a method close the mentionedmethod of Andrews. In this article are examined that syntactic methodspoint of view of Şem’i Şem’ullah and Andrews. Geçmişten günümüze, izaha ihtiyaç duyulan eserler o eserleri başkalarından daha iyi anladığını düşünen insanlar tarafından açıklanmış ve yorumlanmıştır. İslam edebiyatında Kur'an ve hadisleri anlama gayretleriyle ba

  4. In Memoriam: George Andrew Olah

    Indian Academy of Sciences (India)

    The curriculum emphasized humanities and included a rigorous study of Latin, French, and. German along with history and literature. Olah remained deeply interested in these subjects throughout his life and was known to devour books in a single sitting. It was only after he graduated from high school, having survived the ...

  5. Spatial and Temporal Trends in the Carbon, Nitrogen, and Sulfur Isotopes of Stream DOM From 10 Watersheds at the HJ Andrews Experimental Forest.

    Science.gov (United States)

    Frentress, J.; Kendall, C.; Lajtha, K.; Jones, J.

    2008-12-01

    In order to better understand sources of dissolved organic matter (DOM) in streams from the small to large watershed scales, we initiated a one-year investigation of the chemical and isotopic characteristics of DOM at the HJ Andrews Experimental Forest (HJA) in Blue River, OR. DOM is a biologically significant loss from these watersheds, but its sources (forest floor, mineral soil, riparian zones, stream biota) are debated. Traditional chemical characterizations of DOM like SUVA and FI have been useful in conceptualizing and modeling streamflow sources, however, an improved method for assessing DOM quality is needed to adequately differentiate DOM from sources within the watershed. The isotopic characterization of inorganic molecules like nitrate has provided insight to the role of subsurface and surface processes governing the production and transport of critical nutrients, and yet to date, little work has been done to examine the usefulness of isotopic characterization of organically bound nutrients. We apply the isotopic characterization approach to DOM in order to better understand DOM production, transformation, and transport to streams in a range of watershed sizes. Major questions addressed in this research are: 1) Where in the watershed does stream DOM come from? 2) How do DOM sources vary temporally? 3) How do physical attributes of the watershed mediate DOM quality? A relatively new solid-phase extraction technique using C-18 resin was used to isolate DOM in water samples from 10 watersheds, ranging in size from 10 to 6200 hectares, on 3-week intervals from May 2007 to June 2008. The modified technique allowed for small (1 Liter) sample sizes and short processing times to reduce the costs of analysis. The capacity of carbon, nitrogen and sulfur isotopic characterizations of DOM, as well as traditional methods like SUVA and C:N, to predict physical watershed attributes (i.e. mean residence time, soil depth, elevation, gradient) and land use history (timber

  6. Deep versus shallow melt stagnation in an ultra-slow / ultra-cold ridge segment: the Andrew Bain southern RTI (SWIR)

    Science.gov (United States)

    Paganelli, E.; Brunelli, D.; Seyler, M.; Bonatti, E.; Cipriani, A.; Ligi, M.

    2011-12-01

    The Andrew Bain Fracture Zone (ABFZ) represents one of the largest transform faults in the ridge system spanning 750 km in length with a characteristic lens-shape structure. The southern Ridge-Transform Intersection represents the deepest sector of the whole South West Indian Ridge system. During the Italian-Russian expedition S23-AB06, the seafloor in the Southern Ridge Transform Intersection (RTI) has been sampled recovering only ultramafic material in the majority of the dredging sites. The sampled spinel and plagioclase peridotites show hybrid textures, characterized either by deep spinel-field impregnation assemblages (sp+cpx±opx±ol) or by plagioclase-field equilibrated patches and mineral trails (pl+cpx±ol) marked by both crystallization of newly formed plagioclase-field equilibrated trails and formation of plagioclase coronas around spinel. The ones collected from ridge axis show also late gabbroic pockets and veins, variably enriched in clinopyroxene. Overall textures account for important melt percolation/stagnation events occurred in the plagioclase and spinel field. Major and trace element distribution in pyroxenes and spinels from spinel-bearing peridotites overall follow a general melting trend accompanied by a progressive re-equilibration to lower P/T facies at all scales. However, only few samples can be linked to near fractional melting, while the majority of them shows REE pattern and trace element concentrations that cannot be reproduced by fractional melting process. Open-system melting (OSM) better reproduces measured REE patterns. Modeling melting in an open system scenario requires high residual porosity to be accounted for along with generally enriched melts to influx the melting parcel at depth. Melting at high residual porosity suggests a near-batch regime in which enriched melts stagnate in the spinel field. Inhibition of melt segregation during melt/rock interaction asks for a permeability barrier to develop in the region where the

  7. Sir Henry Solomon Wellcome and Dr Andrew Balfour: an enterprise on the Nile and the early foundation of public health and medical research in the Sudan (1899-1935).

    Science.gov (United States)

    Elhadd, T A

    2015-01-01

    In Sudan, modern medical practice and medical research began soon after the creation of Anglo-Egyptian Sudan at the turn of the 20th century. The benevolent involvement of Sir Henry Solomon Wellcome, and the ingenious feat of his protégé Sir Andrew Balfour, was crucial to the strong foundation of that establishment. Sir Henry Wellcome provided the financial sponsorship plus influential, logistical and moral support. Dr Balfour put great energy into making the enterprise one of the most amazing medical achievements in colonial medicine. Improvement in the public health of the capital Khartoum was emulated by other doctors working in this vast country. Research was not restricted to tropical medicine; it also encompassed agricultural and chemical research. This helped with the establishment of the first modern medical school in the country in 1924 and resulted in the medical service in Sudan being described as one of the best in the world. Many British doctors flocked to Sudan to make a fortune and to set a path for their career back in Britain.

  8. Globalisation, transport and HIV | Andrews | Southern African ...

    African Journals Online (AJOL)

    No Abstract Southern African Journal of HIV Medicine Vol. 5 (4) 2004: 41-44. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

  9. Globalisation, transport and HIV | Andrews | Southern African ...

    African Journals Online (AJOL)

    Southern African Journal of HIV Medicine. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 5, No 4 (2004) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected ...

  10. 431-IJBCS-Article-Andrew H Siwela

    African Journals Online (AJOL)

    User

    Oxidative stress associated with nematode infections in sheep: ... Keywords: Glutathione peroxidase, malondialdehyde, succinate dehydrogenase, nematode .... Gastrointestinal parasites cause marked production losses in farm animals throughout the world (Sykes, 1994) and their control is difficult because of their ...

  11. The Future of the Andrew File System

    CERN Multimedia

    CERN. Geneva; Altman, Jeffrey

    2011-01-01

    The talk will discuss the ten operational capabilities that have made AFS unique in the distributed file system space and how these capabilities are being expanded upon to meet the needs of the 21st century. Derrick Brashear and Jeffrey Altman will present a technical road map of new features and technical innovations that are under development by the OpenAFS community and Your File System, Inc. funded by a U.S. Department of Energy Small Business Innovative Research grant. The talk will end with a comparison of AFS to its modern days competitors.

  12. 7__51 - 55_Andrew_Isoniazid

    African Journals Online (AJOL)

    pc

    major adverse effects, including hepatitis, periphe neuropathy, neurotoxicity, hypersensitivity reactio. (fever, skin eruptions or hematologic alterations alo with lupus-like syndrome that is reversible discontinuation of INH. The most notable adve effect is hepatitis. The estimated rate of clin hepatitis in patients given INH alone ...

  13. Celebrating Andrew Alm Benson's 93rd birthday.

    Science.gov (United States)

    Govindjee

    2010-09-01

    We celebrate Andy Benson's 93rd birthday on September 24, 2010 through this Editorial. This short account about Andy Benson should serve as a prelude to the short article that Andy has written for the entire photosynthesis community, which gives a glimpse of why he left the field of the "path of carbon in photosynthesis," when he had already discovered, together with Melvin Calvin, James Alan Bassham, and others, most of the major steps in what we now call the Calvin-Benson cycle.

  14. Comments on Marianne Celce-Murcia, Zoltan Dornyei, and Sarah Thurrell's "Direct Approaches in L2 Instruction: A Turning Point in Communicative Language Teaching."

    Science.gov (United States)

    Thornbury, Scott; Celce-Murcia, Marianne; Dornyei, Zoltan; Thurrell, Sarah; Davidson, Bruce W.; Gieve, Simon; Hawkins, Margaret R.; Atkinson, Dwight

    1998-01-01

    Scott Thornbury's response to the Forum article, "Direct Approaches in L2 Instruction: A Turning Point in Communicative Language Teaching" is followed by a response from the authors of that article. Three readers react to another article, "A Critical Approach to Critical Thinking in TESOL." The author of that article then responds to the comments.…

  15. Tensions at EU-Russia Summit / Andrew Rettman

    Index Scriptorium Estoniae

    Rettman, Andrew

    2009-01-01

    Enne Euroopa Liidu-Venemaa tippkohtumist Kaug-Idas ütles Tšehhi president Vaclav Klaus päevalehes Lidove Noviny, et ta ei näe Venemaas ohtu, vaid suurt, tugevat ja ambitsioonikat riiki, millele tuleb rohkem tähelepanu pöörata kui riikidele nagu Eesti ja Leedu. President Toomas Hendrik Ilves väljendas üllatust, et selliste kahetsusväärsete sõnadega - mis jagavad Euroopa riigid olulisteks ja ebaolulisteks - esines just tšehh

  16. Frederic Andrews Gibbs and the Assassination of John Fitzgerald Kennedy.

    Science.gov (United States)

    Bhattacharyya, Kalyan B

    2017-01-01

    Frederic Gibbs, the peerless expert on electroencephalogrphy was summoned to provide opinion on the EEG tracing of Jack Ruby, who murdered Lee Harvey Oswald, the assassin of John Fitzgerald Kennedy, the American President, in 1963. Gibbs pleaded that the tracing suggested features indicative of psychomotor epilepsy and Ruby killed Oswald in a state of fugue. His view was not agreed upon but Gibbs stood his ground unflinchingly. Subsequent appeals to the higher court spared Ruby from imminent execution and finally he died a natural death from metastatic complications of carcinoma of the lung in 1967.

  17. Correspondence REFERENCES Response to N.B. Andrews

    African Journals Online (AJOL)

    The above article contains no reference to any peer- reviewed paper published on the clinical presentation of brain tumours in Ghana, but at least one such paper is available.1 The article, however, quotes a reference to research done on Brain Tumours in Ghana from an in- ternet article from a newsite intended for ...

  18. Parents' struggles to rebuild family life after Hurricane Andrew.

    Science.gov (United States)

    Coffman, S

    1996-01-01

    The purpose of this phenomenological study was to gain a deeper understanding of the meaning of parents' everyday experiences after a major natural disaster. In-depth interviews were conducted with 13 parents who lived in the hurricane-damaged area. The essence of being a parent emerged as "struggling to rebuild family life." The struggles were superimposed on top of ongoing issues such as divorce and job responsibilities. Parents described feelings of being thankful to be alive, being overwhelmed, being limited by environmental aftereffects, being responsible for children, balancing needs and roles, constantly changing amidst uncertainty, and finding meaning in the disaster. Study findings support the need for nursing interventions that address family needs, support strengths, and involve parents as active decision makers.

  19. Andrew Hoberek, ed. The Cambridge Companion to John F. Kennedy

    OpenAIRE

    Gratale, Joseph Michael

    2016-01-01

    John. F. Kennedy served as president of the United States of America for about one thousand days.  Despite the brief duration of his administration, President Kennedy’s impact and legacy continues to attract discussion and debate amongst scholars and laypersons alike over half a century after he entered the oval office in 1961.  What is it about him and his presidency that sustains public curiosity and appeal? Is it his relatively young age, and youthful appearance? Perhaps it is his optimism...

  20. 76 FR 48168 - Andrew K. Choi: Debarment Order

    Science.gov (United States)

    2011-08-08

    .... Choi was convicted of a misdemeanor under Federal law for conduct relating to the regulation of a drug... misdemeanor under Federal law for conduct relating to the regulation of drug products under the FD&C Act, and... of drug products under the FD&C Act, and that the conduct that served as a basis for the conviction...

  1. q -Engel Series Expansions and Slaters Identities | Andrews ...

    African Journals Online (AJOL)

    We describe the q-Engel series expansion for Laurent series discovered by. John Knopfmacher and use this algorithm to shed new light on partition identities related to two entries from Slater's list. In our study Al-Salam/Ismail and. Santos polynomials play a crucial role. Mathematics Subject Classification (1991): Primary: ...

  2. Public participation and the politics of environmentalism | Andrew ...

    African Journals Online (AJOL)

    As a result, in recent years a discourse of global ecology has developed that is largely devoid of any consideration of power relations, cultural authenticity and moral choice; instead, it rather promotes the aspirations of a rising eco-cracy to manage nature and regulate people worldwide. Ironically, a movement which once ...

  3. USA hiiglane GE Healthcare korraldab meditsiinis revolutsiooni / Andrew Jack

    Index Scriptorium Estoniae

    Jack, Andrew

    2006-01-01

    General Electricu tütarettevõte GE Healthcare võttis üle Briti diagnostika- ja bioteaduse uurimisfirma Amersham, firma strateegia tuum on võimsa skaneerimistehnoloogia ja meditsiinilise diagnostika üksteisele lähendamine. Lisa: Aeg sorteerida andmeid infotehnoloogia abil

  4. Surviving Sepsis in High HIV Prevalence Settings | Andrews ...

    African Journals Online (AJOL)

    No Abstract. Keywords: minimally invasive surgery, sclerotherapy, transfusion, HIV, occupational exposure. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors ...

  5. General Andrew Wauchope of Niddrie Marischal. A character sketch ...

    African Journals Online (AJOL)

    am too old at the business not to realise how uncertain war is, especially in South Africa .... " (Douglas, 1904:369) Perhaps he was mindful also of the British disaster .... and with courtesy and respect offered help where they could. The week of defeats, Black Week, led to the replacement of Buller by Roberts who embarked.

  6. Bovine Related Head Trauma in Tema- A Case Report. | Andrews ...

    African Journals Online (AJOL)

    ... scan revealed a left temporal bone non-depressed skull fracture, pneumocephalus, an intraaxial temporal lobe hematoma and subarachnoid hemorrhage. Intervention: The patient was treated non-operatively with antibiotics and Nimodopine. He became symptom free with radiographic resolution of the intracranial lesion.

  7. Application of Andrew's Plots to Visualization of Multidimensional Data

    Science.gov (United States)

    Grinshpun, Vadim

    2016-01-01

    Importance: The article raises a point of visual representation of big data, recently considered to be demanded for many scientific and real-life applications, and analyzes particulars for visualization of multi-dimensional data, giving examples of the visual analytics-related problems. Objectives: The purpose of this paper is to study application…

  8. SINK OR SWIM? DEBT REVIEW'S AMBIVALENT "LIFELINE" ---- A SECOND SEQUEL TO "… A TALE OF TWO JUDGMENTS" NEDBANK V ANDREWS (240/2011 2011 ZAECPEHC 29 (10 May 2011; FIRSTRAND BANK LTD V EVANS 2011 4 SA 597 (KZD AND FIRSTRAND BANK LTD V JANSE VAN RENSBURG 2012 2 All SA 186 (ECP

    Directory of Open Access Journals (Sweden)

    L Steyn

    2012-11-01

    Full Text Available The interface between the National Credit Act 34 of 2005 and the Insolvency Act 24 of 1936 has been the object of our courts' attention in a number of recent cases including Ex parte Ford and Two Similar Cases 2009 3 SA 376 (WCC, Investec Bank Ltd v Mutemeri 2010 1 SA 265 (GSJ, Naidoo v ABSA Bank Ltd 2010 4 SA 597 (SCA and, more recently, Nedbank v Andrews (240/2011 2011 ZAECPEHC 29 (10 May 2011, FirstRand Bank Ltd v Evans 2011 4 597 (KZD and FirstRand Bank Ltd v Janse van Rensburg 2012 2 All SA 186 (ECP. The question raised in all of the three most recent cases was whether or not a debtor's application for debt review in terms of the National Credit Act constitutes an "act of insolvency" in terms of section 8 of the Insolvency Act, upon which a creditor may rely in an application for the compulsory sequestration of the debtor's estate. If it does, it would mean that by resorting to the debt relief measures provided by the National Credit Act a debtor commits the very act on which a creditor may base an application for a sequestration order which, if granted, will render the debtor's estate insolvent and bring about the liquidation of his assets. From the debtor's perspective, this is probably precisely the situation that he seeks to avert by applying for debt review. Further, sequestration would frustrate the stated purpose of the National Credit Act, which is that debtors should take responsibility for their debts by satisfying them in full. Concurrent creditors might also ultimately receive a dividend which falls far short of what is due to them. The question of whether a debtor's resorting to debt review may or should be the very act that triggers his estate's sequestration and its attendant consequences is an important issue, the treatment of which impacts significantly on the efficacy of the South African consumer debt relief system. This article analyses the most recent judgments and considers whether or not statutory regulation of the

  9. Andrew Smith: Lääne ja Aasia firmad reageerivad kriisile erinevalt / Andrew Smith ; intervjueerinud Mikk Salu

    Index Scriptorium Estoniae

    Smith, Andrew

    2009-01-01

    Intervjuu KPMG peaökonomistiga majanduslangusest Euroopas, Eesti ja Suurbritannia käitumisest kriisi ajal, lääneriikide ja Aasia erinevast reageeringust majanduskriisile, Suurbritannia mitteliitumisest euroga, peaminister Gordon Brownist

  10. Alkaloids from flowers and leaves of Erythrina speciosa Andrews; Alcaloides de flores e folhas de Erythrina speciosa Andrews

    Energy Technology Data Exchange (ETDEWEB)

    Faria, Terezinha de Jesus; Cafeu, Mariana Carrara; Akiyoshi, Gisele; Ferreira, Dalva Trevisan; Galao, Olivio Fernandes; Andrei, Cesar Cornelio [Universidade Estadual de Londrina, PR (Brazil). Dept. de Quimica]. E-mail: tjfaria@uel.br; Pinge Filho, Phileno; Paiva, Manoel Ronaldo Carvalho [Universidade Estadual de Londrina, PR (Brazil). Dept. de Ciencias Patologicas; Universidade Estadual de Londrina, PR (Brazil). Dept. de Biologia Animal e Vegetal; Barbosa, Aneli de Melo [Universidade Estadual de Londrina, PR (Brazil). Dept. de Bioquimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, RJ (Brazil). Setor de Quimica de Produtos Naturais

    2007-05-15

    In vitro bioassays with leave extracts of Erythrina speciosa showed promising activity against Trypanosoma cruzi. From the flowers of E. speciosa two alkaloids were isolated: erysotrine and erythartine. The leaves furnished one alkaloid, nororientaline. The structures were determined on the basis of spectroscopic evidence. This is the first report about the investigation of alkaloids in flowers and leaves of this species, as well the first report of nororientaline occurrence in this plant. (author)

  11. Ungari uuemad filmid Tartus ja Tallinnas / Viia-Kadi Raudalainen

    Index Scriptorium Estoniae

    Raudalainen, Viia-Kadi

    2003-01-01

    Ungari instituut esitles Tallinnas ja Tartus viit uuemat Ungari filmi - Zoltan Kamondi "Kiusatused", Gabor Dettre "Pilv Gangese kohal", Peter Bacso "Kustuv sigaretikoni", Agnes Incze "I love Budapest"

  12. OPTIMASI PROSES MASERASI VANILI (Vanilla planifolia Andrews HASIL MODIFIKASI PROSES KURING [Maceration Process Optimation of Vanili (Vanilla Planifolia Andrews from Modified Curing

    Directory of Open Access Journals (Sweden)

    Ika Mariska3

    2006-08-01

    Full Text Available Modified cured vanilla was processed to vanilla extract by maceration method. The aim of this research were to optimize the method of maceration, type of vanilla bean with highest vanillin content, extraction solvent composition,and other variables that could optimize the vanillin content and characterize the extract from half dried cured vanilla. The optimation used response surface method with 22 factorial and 23 factorial. One step of maceration could extract vanillin (average 2.3 g/l much more than two steps maceration (average 2.1 g/l. Vanillin content of the half dried cured vanilla (average 0.98 g/l was higher than cured vanilla 1 and cured vanilla 2 (average 0.41 g/l and 0.32 g/l. The suitable ethanol-water composition for half dried cured vanilla was 7:3 (vanillin content 1.78 g/l. The first optimation was conducted with two variables maceration time and sucrose concentrations. The maximum vanillin content of the first optimation was 4.5 g/l at maceration time of15.9 days and sucrose concentration of 7.3 g. The second optimation used two variables: maceration time and glycerol concentrations. The maximum vanillin content of the second optimation was 3.8 g/l at maceration time of 22 days and glycerol concentration 19.9 ml. The third optimation process used three variables:maceration time, sucrose concentrations and glycerol concentrations. The maximum vanillin content of the third optimation was 3.4 g/l at maceration time of 12 days sucrose concentration of 7 g, and glycerol concentration 4.7 ml. The characteristic of vanilla extract resulted from half dried cured vanilla maceration were vanillin content (3.4-4.5 g/l, total acid (380-410 ml 0.1 N NaOH/l, total ash (1.3-3.4 g/l, total soluble ash (0.8-2.9 g/l, alkalinity of total ash (462.6-536.7, alkalinity of soluble ash (139.1-216.5, and lead number (4.5-4.6.

  13. Diterpenos tipo abietano isolados de Plectranthus barbatus Andrews Abitane diterpenoids isolation from Plectranthus barbatus

    Directory of Open Access Journals (Sweden)

    Roberto L. de Albuquerque

    2007-01-01

    Full Text Available Plectranthus barbatus is largely used in the Northeast region of Brazil by the local population for treatment of digestive problems as substitute of boldo (Pneumus boldus. Phytochemical analysis of the leaf extracts of Plectranthus barbatus (Labiatae cultivated in this region yielded two abietane diterpenoids, cyclobubatusin (1 and barbatusin (2 and a new one named 7beta-acetyl-12-deacetoxycyclobutatusin (3. The structures of the isolated compounds were established by spectral analysis, using mainly mass spectra and ¹H and 13CNMR (1D and 2D. These procedures permitted the assignment of all chemical shifts in the diterpenoids.

  14. Abitane diterpenoids isolation from Plectranthus barbatus; Diterpenos tipo abietano isolados de Plectranthus barbatus Andrews

    Energy Technology Data Exchange (ETDEWEB)

    Albuquerque, Roberto L. de; Kentopff, Marta R.; Machado, Maria Iracema L.; Silva, Maria Goretti V.; Matos, Francisco Jose de A. [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Dept. de Quimica Analitica e Fisico-Quimica; Morais, Selene M. [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil); Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense (UENF), Campos dos Goytacazes, RJ (Brazil). Centro de Ciencia e Tecnologia. Setor de Quimica de Produtos Naturais]. E-mail: braz@uenf.br

    2007-07-01

    Plectranthus barbatus is largely used in the Northeast region of Brazil by the local population for treatment of digestive problems as substitute of boldo (Pneumus boldus). Phytochemical analysis of the leaf extracts of Plectranthus barbatus (Labiatae) cultivated in this region yielded two abietane diterpenoids, cyclobubatusin (1) and barbatusin (2) and a new one named 7beta-acetyl-12-deacetoxycyclobutatusin (3). The structures of the isolated compounds were established by spectral analysis, using mainly mass spectra and {sup 1}H and {sup 13}CNMR (1D and 2D). These procedures permitted the assignment of all chemical shifts in the diterpenoids. (author)

  15. Environmental Assessment for Aerial Application of Pesticide for Gypsy Moth Control, Andrews Air Force Base, Maryland

    Science.gov (United States)

    2008-04-01

    limited quantities by a cooperative effort of the USDA Forest Service and the Animal Plant Health Inspection Service (APHIS). The active...AFB, 2007 18 SECTION 12 - ACRONYMS AND ABBREVIATIONS AFB Air Force Base AFI Air Force Instruction APHIS Animal Plant Health Inspection Service AWS

  16. Localization of beta-D-glucosidase activity and glucovanillin in vanilla bean (Vanilla planifolia Andrews).

    Science.gov (United States)

    Odoux, E; Escoute, J; Verdeil, J-L; Brillouet, J-M

    2003-09-01

    The morphology, anatomy and histology of mature green vanilla beans were examined by light and transmission electron microscopy. Beans have a triangular cross-section with a central cavity containing seeds. Each angle is lined with tubular cells, or papillae, while the cavity sides consist of placental laminae. The epicarp and endocarp are formed by one or two layers of very small cells, while the mesocarp contains large, highly vacuolarized cells, the cytoplasm being restricted to a thin layer along the cell walls. The radial distributions of glucovanillin and beta-glucosidase activity, measured on p-nitrophenyl-beta-glucopyranoside and glucovanillin, are superimposable and show how beta-glucosidase activity increases from the epicarp towards the placental zone, whereas glucovanillin is exclusively located in the placentae and papillae. Subcellular localization of beta-glucosidase activity was achieved by incubating sections of vanilla beans in a buffer containing 5-bromo-4-chloro-3-indolyl-beta-d-glucopyranoside as a substrate. Activity was observed in the cytoplasm (and/or the periplasm) of mesocarp and endocarp cells, with a more diffuse pattern observed in the papillae. A possible mechanism for the hydrolysis of glucovanillin and release of the aromatic aglycon vanillin involves the decompartmentation of cytoplasmic (and/or periplasmic) beta-glucosidase and vacuolar glucovanillin.

  17. Purification and characterization of vanilla bean (Vanilla planifolia Andrews) beta-D-glucosidase.

    Science.gov (United States)

    Odoux, Eric; Chauwin, Audrey; Brillouet, Jean-Marc

    2003-05-07

    Vanilla bean beta-D-glucosidase was purified to apparent homogeneity by successive anion exchange, hydrophobic interaction, and size-exclusion chromatography. The enzyme is a tetramer (201 kDa) made up of four identical subunits (50 kDa). The optimum pH was 6.5, and the optimum temperature was 40 degrees C at pH 7.0. K(m) values for p-nitrophenyl-beta-D-glucopyranoside and glucovanillin were 1.1 and 20.0 mM, respectively; V(max) values were 4.5 and 5.0 microkat.mg(-1). The beta-D-glucosidase was competitively inhibited by glucono-delta-lactone and 1-deoxynojirimycin, with respective K(i) values of 670 and 152 microM, and not inhibited by 2 M glucose. The beta-D-glucosidase was not inhibited by N-ethylmaleimide and DTNB and fully inhibited by 1.5-2 M 2-mercaptoethanol and 1,4-dithiothreitol. The enzyme showed decreasing activity on p-nitrophenyl-beta-D-fucopyranoside, p-nitrophenyl-beta-D-glucopyranoside, p-nitrophenyl-beta-D-galactopyranoside, and p-nitrophenyl-beta-D-xylopyranoside. The enzyme was also active on prunasin, esculin, and salicin and inactive on cellobiose, gentiobiose, amygdalin, phloridzin, indoxyl-beta-D-glucopyranoside, and quercetin-3-beta-D-glucopyranoside.

  18. Involvement of Colonizing Bacillus Isolates in Glucovanillin Hydrolysis during the Curing of Vanilla planifolia Andrews.

    Science.gov (United States)

    Chen, Yonggan; Gu, Fenglin; Li, Jihua; He, Shuzhen; Xu, Fei; Fang, Yiming

    2015-08-01

    Vanilla beans were analyzed using biochemical methods, which revealed that glucovanillin disperses from the inner part to the outer part of the vanilla bean during the curing process and is simultaneously hydrolyzed by β-d-glucosidase. Enzymatic hydrolysis was found to occur on the surface of the vanilla beans. Transcripts of the β-d-glucosidase gene (bgl) of colonizing microorganisms were detected. The results directly indicate that colonizing microorganisms are involved in glucovanillin hydrolysis. Phylogenetic analysis based on 16S rRNA gene sequences showed that the colonizing microorganisms mainly belonged to the Bacillus genus. bgl was detected in all the isolates and presented clustering similar to that of the isolate taxonomy. Furthermore, inoculation of green fluorescent protein-tagged isolates showed that the Bacillus isolates can colonize vanilla beans. Glucovanillin was metabolized as the sole source of carbon in a culture of the isolates within 24 h. These isolates presented unique glucovanillin degradation capabilities. Vanillin was the major volatile compound in the culture. Other compounds, such as α-cubebene, β-pinene, and guaiacol, were detected in some isolate cultures. Colonizing Bacillus isolates were found to hydrolyze glucovanillin in culture, indirectly demonstrating the involvement of colonizing Bacillus isolates in glucovanillin hydrolysis during the vanilla curing process. Based on these results, we conclude that colonizing Bacillus isolates produce β-d-glucosidase, which mediates glucovanillin hydrolysis and influences flavor formation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Localization of β-d-Glucosidase Activity and Glucovanillin in Vanilla Bean (Vanilla planifolia Andrews)

    Science.gov (United States)

    ODOUX, E.; ESCOUTE, J.; VERDEIL, J. -L.; BRILLOUET, J. -M.

    2003-01-01

    The morphology, anatomy and histology of mature green vanilla beans were examined by light and transmission electron microscopy. Beans have a triangular cross-section with a central cavity containing seeds. Each angle is lined with tubular cells, or papillae, while the cavity sides consist of placental laminae. The epicarp and endocarp are formed by one or two layers of very small cells, while the mesocarp contains large, highly vacuolarized cells, the cytoplasm being restricted to a thin layer along the cell walls. The radial distributions of glucovanillin and β-glucosidase activity, measured on p-nitrophenyl-β-glucopyranoside and glucovanillin, are superimposable and show how β-glucosidase activity increases from the epicarp towards the placental zone, whereas glucovanillin is exclusively located in the placentae and papillae. Subcellular localization of β-glucosidase activity was achieved by incubating sections of vanilla beans in a buffer containing 5-bromo-4-chloro-3-indolyl-β-d-glucopyranoside as a substrate. Activity was observed in the cytoplasm (and/or the periplasm) of mesocarp and endocarp cells, with a more diffuse pattern observed in the papillae. A possible mechanism for the hydrolysis of glucovanillin and release of the aromatic aglycon vanillin involves the decompartmentation of cytoplasmic (and/or periplasmic) β-glucosidase and vacuolar glucovanillin. PMID:12871846

  20. Fascia Research Congress evidence from the 100 year perspective of Andrew Taylor Still.

    Science.gov (United States)

    Findley, Thomas W; Shalwala, Mona

    2013-07-01

    More than 100 years ago A.T. Still MD founded osteopathic medicine, and specifically described fascia as a covering, with common origins of layers of the fascial system despite diverse names for individual parts. Fascia assists gliding and fluid flow and is highly innervated. Fascia is intimately involved with respiration and with nourishment of all cells of the body, including those of disease and cancer. This paper reviews information presented at the first three International Fascia Research Congresses in 2007, 2009 and 2012 from the perspective of Dr Still, that fascia is vital for organism's growth and support, and it is where disease is sown. Published by Elsevier Ltd.

  1. Additional dates of Sir Andrew Smith's Illustrations of the Zoology of South Africa.

    Science.gov (United States)

    Low, Martyn E Y; Evenhuis, Neal L

    2014-05-14

    We update the collation of the dates of publication of Smith's Illustrations of the Zoology of South Africa provided by Waterhouse (1880) and Barnard (1950, 1952). In the case of nine parts, we are able to provide more accurate dates of publication (including day-dates for seven of these parts). For workers of invertebrate taxonomy, we provide an accurate date of publication for W. S. Macleay's volume on Annulosa. 

  2. 77 FR 59163 - Andrew Pickens Ranger District; South Carolina; AP Loblolly Pine Removal and Restoration Project

    Science.gov (United States)

    2012-09-26

    ... 8, 2010, the Forest Service published a NOT to prepare and EIS to disclose the effects of removing... Preparation and Release (3,421 Acres) for Reforestation by Planting 7. In the Federal Register of March 8, 2010, in FR/Vol. 75, No. 44, on page 10459, in the second column, correct the ``Reforestation...

  3. Effects of light intensity on the morphology and CAM photosynthesis of Vanilla planifolia Andrews

    Directory of Open Access Journals (Sweden)

    María Claudia Díez

    2017-01-01

    Full Text Available Vanilla planifolia is a neotropical orchid, whose fruits produce the natural vanilla, a fundamental ingredient for the food and cosmetic industry. Because of its importance in the world market, it is cultivated in many tropical countries and recently its cultivation has started in Colombia. This species requires shade for its development; however, the optimal of light conditions are unknown. This work evaluates the effect of different light intensities on CAM photosynthesis, physiology, morphology, and growth of this species. For this, vanilla seedlings were subjected to four treatments of relative illumination (RI (T1=8%, T2=17%, T3=31% and T4=67%. Most CO2 assimilation occurred along night in all treatments, which confirms that vanilla is a strong CAM species. Plants grown under high lighting (67% RI had almost half of the photosynthesis in treatments of intermediate lighting (17 and 31%, which is consistent with the lower nocturnal acid accumulation in that treatment. Likewise, the photochemical efficiency of photosystem II (Fv / Fm showed that in plants of the 67% RI occurred high radiation stress. On the other hand, vanilla plants reached greater length, leaf area, and total biomass when grown under intermediate radiation (17 and 31% RI. These results suggest that high radiation alters the functioning of vanilla plants, inhibiting photosynthesis and growth, and that highly shaded environments not significantly affected the CAM photosynthesis of vanilla; however, in the long-term this species showed higher photosynthesis and growth under intermediate levels of radiation

  4. Kashechewan First Nation St. Andrews School oil remediation project: a case study

    International Nuclear Information System (INIS)

    Gable, S. W.

    1997-01-01

    Case study of the remediation of an oil seepage into a school building in a First Nations community, on the shores of the Albany River, in the James Bay region of northern Ontario, was discussed. The spill has created significant health hazards as manifested by nausea, vomiting and severe headaches among both students and teachers. Investigation determined that the O-ring fittings of the pipe joints, used during the installation of the oil pipeline linking the above-ground oil tank farm and the school building, were unsuitable for the intended use. They subsequently failed, allowing heating oil to leak from the pipes along the building and migrating into the gymnasium. A variety of remediation alternatives have been considered. The remedial actions taken include: in-situ containment using an impermeable membrane with passive venting and continuous air quality monitoring for the area below the recreation complex, excavation to create draining trenches, replacement of contaminated soil around the building and from the building to the river, and installation of a clay collar and oil/water separator in each drain line. The work was completed in January 1996. To date, all systems function satisfactorily

  5. Surprising similarities: Recent monetary regimes of small economies / Andrew K. Rose

    Index Scriptorium Estoniae

    Rose, Andrew K.

    2014-01-01

    Artikkel keskendub väikese majandusega riikide (sh Eesti) rahapoliitikale enne ja pärast ülemaailmset finantskriisi. Kokku analüüsitakse 170 riigi näitajaid aastatest 2007-2012 ning jõutakse järeldusele, et riikide rahapoliitika mõju makromajanduslikele ja finantstagajärgedele on tegelikult üllatavalt väike

  6. The conservation of helicity in hurricane Andrew (1992) and the formation of the spiral rainband

    Science.gov (United States)

    Xu, Yamei; Wu, Rongsheng

    2003-11-01

    The characteristics of helicity in a hurricane are presented by calculating the MM5 model output in addition to theoretical analysis. It is found that helicity in a hurricane mainly depends on its horizontal component, whose magnitude is about 100 to 1000 times larger than its vertical component. It is also found that helicity is approximately conserved in the hurricane. Since the fluid has the intention to adjust the wind shear to satisfy the conservation of helicity, the horizontal vorticity is even larger than the vertical vorticity, and the three-dimensional vortices slant to the horizontal plane except in the inner eye. There are significant horizontal vortices and inhomogeneous helical flows in the hurricane. The formation of the spiral rainband is discussed by using the law of horizontal helical flows. It is closely related to the horizontal strong vortices and inhomogeneous helical flows.

  7. Utilization of Special Forces medical assets during disaster relief: the Hurricane Andrew experience.

    Science.gov (United States)

    Godbee, D C; Odom, J W

    1997-02-01

    Special Forces units and their innate assets are presented as the ideal first-response unit to natural disasters due to their breadth of skill, speed of response, and ability to work independently in remote areas. "Green Beret" soldiers are particularly suited to work under the most extreme hardships, with little or no supervision, and can demonstrate tremendous amounts of initiative and creativity in unique and changing situations. The compact, versatile, and adaptable detachments of which Special Forces Groups are composed can serve as vital resources in humanitarian and disaster relief operations as well as in combat.

  8. Graafika, graafika! / Jan Kenneth Weckman, Sue Gollifer, Andrew Atkinson...[jt.] ; interv. Kaisa Puustak, Ando Pajus

    Index Scriptorium Estoniae

    2001-01-01

    II rahvusvahelisest vabagraafika konverentsist "Impact" Helsingis 29. VIII-2. IX. Tutvuti ka Tallinnas eesti graafikute loominguga, Tallinna Graafikakoja ja Tallinna XII graafikatriennaaliga. Eesti ja euroopa graafikast, Tallinna graafikatriennaalist

  9. The harmonization of the avoidance rules in European Union insolvencies / Andrew Keay

    Index Scriptorium Estoniae

    Keay, Andrew

    2017-01-01

    Piiriülestest tehingutest ja sellest tulenevatest probleemidest piiriülestes kohtumenetlustes, õiguse kohaldamise probleemidest piiriüleste tehingute korral. Piiriülestest maksejõuetusmenetlustest Euroopa Liidus

  10. Pepsi kerkib Coca-Cola varjust / Andrew Ward ; tõlk. Erik Aru

    Index Scriptorium Estoniae

    Ward, Andrew

    2005-01-01

    Firma PepsiCo edust viimastel aastatel. Autori sõnul on suurim firma ees seisev väljakutse Põhja-Ameerika ja Lääne-Euroopa tarbija üha kasvav mure ülekaalu pärast, firma juht Steve Reinemund näeb selles firmale pigem võimalusi kui ohtu. Firma on USA-s kasutusele võtnud märgisüsteemi, et näidata, millised tooted on tervislikumad. Diagrammid: Kasumiallikad; Turuliidrid. Lisa: Vastasseis

  11. Kuus turundusüksuse tüüpi / Edward Landry, Andrew Tipping, Brodie Dixon

    Index Scriptorium Estoniae

    Landry, Edward

    2005-01-01

    Konsultatsioonifirma Booz Allen Hamilton ja Association of National Advertisers välja töötatud turundusüksuste tüüpidest ja asjaoludest, mida peaks arvesse võtma firma olemasoleva turundusüksuse välja selgitamiseks

  12. Kas sinu firma on oskuslikult üles ehitatud? / Michael Goold, Andrew Campbell

    Index Scriptorium Estoniae

    Goold, Michael

    2002-01-01

    Londoni Ashridge Strategic Management Centre-i direktorid kirjeldavad üheksat testi, millest juhil ettevõtte struktuuri loomisel kasu on - turu eeliste, emafirma eeliste, inimeste, teostatavuse, subkultuuride, raskete lülide, üleliigse hierarhia, vastutuse ning paindlikkuse test. Lisad: Kuidas emafirmad väärtusi loovad; Kuidas üksused suhtlevad; Probleemide kõrvaldamine

  13. Andrews AFB, Washington DC Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F.

    Science.gov (United States)

    1981-10-15

    dust. Contnued on Reverse A- 1 Blowing spray - This item if reported, is not shown in a separate category on this form but is included in the computation...m m ad m )v I, - GLCBAL CLIMATOLOGY BRANCHS AFETAC PSYCHROMETRIC SUMMARY AT9 wEATHER SERVICE/MAC 0 13715

  14. Tom Fraser, Andrew Mango, Robert McNamar, The Makers of the Modern Middle East

    OpenAIRE

    AKAN, SELEN

    2013-01-01

    maneuvers did not reject his demand but kept him on hold, as Lord Kitchener recommended not alienating the Arabs (p.61). Not informing Hussein, Britain made a secret agreement with France; Sykes-Picot Agreement regarding the division of the Middle East (p.63). On the other hand, for the negotiations

  15. Andrew Milner, ed., Tenses of Imagination: Raymond Williams on Science Fiction, Utopia and Dystopia.

    Directory of Open Access Journals (Sweden)

    Antonis Balasopoulos

    2011-03-01

    Full Text Available Tenses of Imagination, an anthology of Raymond Williams’s writings on science fiction, utopia and dystopia is the seventh volume in the growing Ralahine Utopian Studies Series. It is also, in my view, something of a treasure. For it not only offers an illuminating compendium of Williams’s most important engagements, critical and creative, with SF, utopia and dystopia, but also furnishes us with a heretofore unavailable account of the long-term significance of these frequently spurned genres a...

  16. The Performance of by Turns Fermentation- Dryer for Vanilla (Vanilla Planifolia Andrews Processing

    Directory of Open Access Journals (Sweden)

    Haerani Haerani

    2011-05-01

    Full Text Available The drying and fermentation are the processing steps which influence the quality of vanilla. Thus, an effort to produce instrument which can dry and ferment vanilla by turns automatically was done. Based on the test result on the instrument, it was known that the heater and heat-exchanger can function excellently. It can be seen from the increase of temperature after passing heater and heat-exchanger; and the decrease of air humidity in the drying chamber. The small differences of air flow speed between racks proved the uniformity of air flow speed in the drying chamber. The time and temperature control system showed temperature stability on drying process (i.e. 60°C and on fermentation process (i.e. 40°C; moreover, temperature response reached 60°C and did not exceed the setting time (maximum 30 minutes. The water percentage depletion from 88% to 55% is relatively slow (in 5 days fermentation-drying process. The depletion is appropriate with the recommendation for fermentation-drying vanilla processing.

  17. Chadwick: Symphony No. 3 in F; Barber: Vanessa-Intermezzo / Andrew Achenbach

    Index Scriptorium Estoniae

    Achenbach, Andrew

    1994-01-01

    Uuest heliplaadist "Chadwick: Symphony No. 3 in F; Barber: Vanessa-Intermezzo, Under the Willow Tree. Music for a scene from Shelley, Op. 7. Medea's Meditation and Dance of Vengeance, Op. 23a. Detroit Symphony Orchestra / Neeme Järvi." Chandos CD CHAN 9253

  18. General Plan Environmental Assessment for Joint Base Andrews-Naval Air Facility, Washington, Maryland

    Science.gov (United States)

    2011-04-01

    at the Upper Marlboro Branch Library of the Prince George’s County Memorial Library System at 14 730 Main St. Upper Marlboro, MD 20772 and on the...quality in all international parks; national parks that exceeded 6,000 acres; and national wilderness areas and memorial parks that exceeded 5,000 acres...plants found in wooded areas include mountain laurel (Kalmia latifolia), highbush blueberry (Vaccinium corymbosum), and Christmas fern (Polystichium

  19. Environmental Assessment of the Privatization of Military Family Housing at Andrews Air Force Base, Maryland

    Science.gov (United States)

    2007-05-01

    American holly (Ilex opaca). Mountain laurel (Kalmia latifolia), highbush blueberry (Vaccinium corymbosum), and Christmas fern (Polystichium...made available for the public to review in the Prince George’s County Memorial Library System Upper Marlboro Branch Library for the 30-day public...analysis are available for review at the Prince George’s County Memorial Library System Upper Marlboro Branch Library, 14730 Main St., Upper Marlboro

  20. Prosthetic rehabilitation of severe Siebert's Class III defect with modified Andrews bridge system

    OpenAIRE

    Rathee, Manu; Sikka, Neha; Jindal, Sahil; Kaushik, Ashutosh

    2015-01-01

    Prosthetic dentistry involves the replacement of missing and contiguous tissues with artificial substitutes to restore and maintain the oral functions, appearance, and health of the patient. The treatment of edentulous areas with ridge defects poses a challenging task for the dentist. Management of such cases involves a wide range of treatment options comprising mainly of surgical interventions and non surgical techniques such as use of removable, fixed or fixed- removable partial dentures. B...

  1. Analgesic and anticonvulsant effects of extracts from the leaves of Kalanchoe crenata (Andrews) Haworth (Crassulaceae).

    Science.gov (United States)

    Nguelefack, T B; Nana, P; Atsamo, A D; Dimo, T; Watcho, P; Dongmo, A B; Tapondjou, L A; Njamen, D; Wansi, S L; Kamanyi, A

    2006-06-15

    Kalanchoe crenata Andr. (Crassulaceae) is a fleshy herbaceous plant used in the African traditional medicine as remedies against otitis, headache, inflammations, convulsions and general debility. In the present work, the analgesic effects of methylene chloride/methanol (1:1) (CH(2)Cl(2)/CH(3)OH) extract and its hexane, methylene chloride (CH(2)Cl(2)), ethyl acetate, n-butanol fractions and aqueous residue have been evaluated using acetic acid, formalin and pressure test. The anticonvulsant effects of the CH(2)Cl(2)/CH(3)OH extract were also investigated on seizures induced by pentylenetetrazol (PTZ 70 mg/kg), strychnine sulphate (STN 2.5 mg/kg) and thiosemicarbazide (TSC 50 mg/kg). CH(2)Cl(2)/CH(3)OH extract and its fractions, administered orally at the doses of 150 and 300 mg/kg, exhibited protective effect of at least 30% on the pain induced by acetic acid. The CH(2)Cl(2) fraction at 300 mg/kg showed a maximal effect of 78.49%. The CH(2)Cl(2)/CH(3)OH extract and its CH(2)Cl(2) fraction at the doses of 150 and 300 mg/kg significantly reduced the first phase of pain induced by formalin while the second phase was completely inhibited. The CH(2)Cl(2) fraction produced more than 45% reduction in the sensitivity to pain induced by pressure. The CH(2)Cl(2)/CH(3)OH extract of Kalanchoe crenata significantly increased the latency period in seizures induced by PTZ and significantly reduced the duration of seizures induced by the three convulsant agents. The extract protected 20% of animals against death in seizures induced by TSC and STN. These results suggest a peripheral and central analgesic activities as well as an anticonvulsant effect of the leaves of Kalanchoe crenata.

  2. 76 FR 57043 - Andrew N. Finkel; Analysis of Proposed Consent Order to Aid Public Comment

    Science.gov (United States)

    2011-09-15

    ... respondent developed and sold in Google's Android Marketplace. Respondent claimed that Acne Pwner effectively... provisions regarding recordkeeping, dissemination of the order to officers and employees, prior notification...

  3. Estonia still keen on single currency / Andrew Ward, Peter Spiegel, Joshua Chaffin

    Index Scriptorium Estoniae

    Ward, Andrew

    2010-01-01

    Eesti üleminekust eurole. President Toomas Hendrik Ilvese sõnul kõnnib Eesti teiste väiksemate põhjamaiste riikide jälgedes. Tema sõnul on väikese riigi ainus võimalus ellujäämiseks reeglite järgimine ning nõudmine, et ka teised seda teeksid

  4. Detecting Outliers in Marathon Data by Means of the Andrews Plot

    Science.gov (United States)

    Stehlík, Milan; Wald, Helmut; Bielik, Viktor; Petrovič, Juraj

    2011-09-01

    For an optimal race performance, it is important, that the runner keeps steady pace during most of the time of the competition. First time runners or athletes without many competitions often experience an "blow out" after a few kilometers of the race. This could happen, because of strong emotional experiences or low control of running intensity. Competition pace of half marathon of the middle level recreational athletes is approximately 10 sec quicker than their training pace. If an athlete runs the first third of race (7 km) at a pace that is 20 sec quicker than is his capacity (trainability), he would experience an "blow out" in the last third of the race. This would be reflected by reducing the running intensity and inability to keep steady pace in the last kilometers of the race and in the final time as well. In sports science, there are many diagnostic methods ([3], [2], [6]) that are used for prediction of optimal race pace tempo and final time. Otherwise there is lacking practical evidence of diagnostics methods and its use in the field (competition, race). One of the conditions that needs to be carried out is that athletes have not only similar final times, but it is important that they keep constant pace as much as possible during whole race. For this reason it is very important to find outliers. Our experimental group consisted of 20 recreational trained athletes (mean age 32,6 years±8,9). Before the race the athletes were instructed to run on the basis of their subjective feeling and previous experience. The data (running pace of each kilometer, average and maximal heart rate of each kilometer) were collected by GPS-enabled personal trainer Forerunner 305.

  5. Pärt, Arvo. Cantus in memory of Benjamin Britten / Andrew Achenbach

    Index Scriptorium Estoniae

    Achenbach, Andrew

    1995-01-01

    Uuest heliplaadist "Pärt, Arvo. Cantus in memory of Benjamin Britten. BBC Northern Symphony Orchestra / Norman del Mar; BBC Symphony Orchestra / Gennady Rozhdestvensky". BBC Radio Classics CD BBCRD 9129 (71 minutes)

  6. Origins, Phytochemistry, Pharmacology, Analytical Methods and Safety of Cortex Moutan (Paeonia suffruticosa Andrew): A Systematic Review.

    Science.gov (United States)

    Wang, Zhiqiang; He, Chunnian; Peng, Yong; Chen, Feihu; Xiao, Peigen

    2017-06-07

    Cortex Moutan (CM), a well-known traditional Chinese medicine, is commonly used for treating various diseases in China and other eastern Asian countries. Recorded in Pharmacopeias of several countries, CM is now drawing increasing attention and under extensive studies in various fields. Phytochemical studies indicate that CM contains many valuable secondary metabolites, such as monoterpene glycosides and phenols. Ample evidence from pharmacological researches suggest that CM has a wide spectrum of activities, such as anti-inflammatory, anti-oxidant, anti-tumor, anti-diabetic, cardiovascular protective, neuroprotective, hepatoprotective effects. Moreover, various analytical methods were established for the quality evaluation and safety control of CM. This review synopsizes updated information concerning the origins, phytochemistry, pharmacology, analytical method and safety of CM, aiming to provide favorable references for modern CM research and application. In conclusion, continuing pharmacological investigations concerning CM should be conducted to unravel its pharmacological mechanisms. Further researches are necessary to obtain comprehensive and applicable analytical approach for quality evaluation and establish harmonized criteria of CM.

  7. 75 FR 10457 - Andrew Pickens Ranger District; South Carolina; AP Loblolly Pine Removal and Restoration Project

    Science.gov (United States)

    2010-03-08

    ... compartments were converted to pine plantations 30 to 40 years ago by clear cutting more diverse stands and planting them to loblolly pine (Pinus taeda) after intensive site preparation treatments. Few hardwood...: Regeneration Harvest, With Reserves (Cut-and-Remove--3,679 Acres) Timber harvesting would occur in timber...

  8. Casting Net Assessment: Andrew W. Marshall and the Epistemic Community of the Cold War

    Science.gov (United States)

    2015-02-01

    and intangible elements of military power proved difficult. John Williams, the “ obese , genial, and charmingly eccentric” head of RAND’s Mathematics...It seemed a breeding ground for fertile minds and soul-searching discussions.25 Unlike RAND’s Washington offices, the atmosphere in its Santa Monica...Carlo techniques. However, his fertile and active mind found venues other than contemplating Armageddon to express itself. Las Vegas beckoned. Earlier

  9. Fremantle Media ekspordib seriaale kogu maailma / Andrew Edgecliffe-Johnson ; tõlk. Erik Aru

    Index Scriptorium Estoniae

    Edgecliffe-Johnson, Andrew

    2007-01-01

    Teleproduktsioonifirmast Fremantle Media. Saateformaatide eksportimisel saavutatud edu teeb firmast õpikunäite, kuidas viia tooteid üle maailma, muutes neid just piisavalt, et sobida kohaliku maitsega, jäädes samas truuks algideele. Edu ei vaja tõlget

  10. BBC rajab üleilmset internetibrändi / Andrew Edgecliffe-Johnson

    Index Scriptorium Estoniae

    Edgecliffe-Johnson, Andrew

    2006-01-01

    Suurbritannias on riik mitte ainult toetanud, vaid ka nõudnud BBC kujunemist Suurbritannia tugevaimaks kodumaiseks internetibrändiks. BBC võrguväljaande kasvust. Tabel: Maailma populaarseimad uudisteportaalid jaanuaris 2006

  11. Solubility of nitrogen in iron alloys with vanadium and niobium

    International Nuclear Information System (INIS)

    Pomarin, Yu.M.; Grigorenko, G.M.; Lakomskij, V.I.

    1975-01-01

    The solubility of nitrogen in the concentration range under study in Fe-N-V and Fe-N-Nb systems is in compliance with Syverts' law. An equation has been set up so as to estimate the nitrogen solubility in the iron alloys containing up to 10 per cent of vanadium and niobium in the wide temperature range

  12. Comparison of four kinds of extraction techniques and kinetics of microwave-assisted extraction of vanillin from Vanilla planifolia Andrews.

    Science.gov (United States)

    Dong, Zhizhe; Gu, Fenglin; Xu, Fei; Wang, Qinghuang

    2014-04-15

    Vanillin yield, microscopic structure, antioxidant activity and overall odour of vanilla extracts obtained by different treatments were investigated. MAE showed the strongest extraction power, shortest time and highest antioxidant activity. Maceration gave higher vanillin yields than UAE and PAE, similar antioxidant activity with UAE, but longer times than UAE and PAE. Overall odour intensity of different vanilla extracts obtained by UAE, PAE and MAE were similar, while higher than maceration extracts. Then, powered vanilla bean with a sample/solvent ratio of 4 g/100 mL was selected as the optimum condition for MAE. Next, compared with other three equations, two-site kinetic equation with lowest RMSD and highest R²(adj) was shown to be more suitable in describing the kinetics of vanillin extraction. By fitting the parameters C(eq), k₁, k₂, and f, a kinetics model was constructed to describe vanillin extraction in terms of irradiation power, ethanol concentration, and extraction time. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Proceedings of the Defense Readiness and Requirements Symposium Held at Andrews AFB, Maryland on 24-25 September 1980.

    Science.gov (United States)

    1980-09-25

    Information Center .......... . 228 Panel Members: Charles Groover Deputy Assistant Secretary of Defense (Requirements, Resources, and Analysis...date on that program. Our first member of the panel is Mr. Charles W. Groover , the Deputy Assistant Secretary of Defense for Requirements, Resources...and Analysis. Mr. Groover had a long and distinguished career in the service and for a number of years has been in the Office of the Assistant Secretary

  14. Andrew Wright’s critical radicalism, Clive Erricker’s radical postmodernism and teenage perceptions of spirituality

    Directory of Open Access Journals (Sweden)

    Barbara Wintersgill

    2009-01-01

    Full Text Available This article is a report of the author's doctoral research completed in 2007. The research was carried out among secondary school pupils in England aged 12–17. Its purpose was to find out what they understood spirituality to be. ‘Spirituality’ here does not mean religious spirituality or the ‘alternative’ or ‘countercultural’ spirituality which was the primary focus of this conference. Instead the author addresses the distinctive debate in England about the nature of that spirituality, or to use the exact term, ‘spiritual development’, which has to be promoted by law in English schools. This is referred to this as spirituality-in-education. Students’ rationales for selecting religious education are dependent on their understanding and experience of the subject and what they get out of it. Students regard content as more important in religious education than any other subject, but as a means to ends (developing beliefs, developing in one’s religion, understanding others than as an end in itself. What is apparent here is that many students from different perspectives have found religious education to make a significant contribution to their spiritual development, but that contribution varies for each person.

  15. Installation Development Environmental Assessment at Joint Base Andrews-Naval Air Facility Washington Prince George’s County, Maryland

    Science.gov (United States)

    2013-04-01

    Migratory birds, especially waterfowl, are common at JBA because of the ponds and wetlands and the proximity of JBA to the Chesapeake Bay. Reptiles found at...activity and related personnel, resources, and facilities. • The Director of National Intelligence may exempt an intelligence activity and related

  16. Hongos endófitos de orquídeas y su efecto sobre el crecimiento en Vanilla planifolia Andrews

    Directory of Open Access Journals (Sweden)

    Nancy Fiorela Ordóñez C

    2012-07-01

    Full Text Available Los endófitos son microorganismos que crecen dentro de los tejidos vegetales sin causar síntomas de enfermedad. Aquellos asociados a las raíces tienen, entre otros posibles beneficios la defensa contra patógenos y un aumento en la disponibilidad de nutrientes. En el presente estudio se aislaron hongos endófitos de raíces de orquídeas del género Vanilla en estado silvestre, con el fin de determinar su efecto sobre el crecimiento de plantas de V. planifolia cuando se inocularon en el sustrato. Los resultados mostraron que variables como biomasa aérea, longitud de raíces y altura de la planta son afectadas por la inoculación de estos endófitos. La efectividad de estos hongos sobre la protección de plantas o la estimulación en el crecimiento contribuye a la generación de herramientas para el uso de bioinoculantes. De esta forma se reduce el uso de insumos químicos y se promueven prácticas amigables con el ambiente en sistemas de cultivo de vainilla.

  17. 78 FR 27126 - East Bay, St. Andrews Bay and the Gulf of Mexico at Tyndall Air Force Base, Florida; Restricted...

    Science.gov (United States)

    2013-05-09

    ... your comment. Electronic comments should avoid the use of any special characters, any form of... use of the area, the Corps expects that this regulation, if adopted, will not have a significant... and Apalachicola Bay south of Apalachicola, Fla., Drone Recovery Area, Tyndall Air Force Base, Fla...

  18. Final Environmental Assessment Airfield Storm Drainage System Repair Joint Base Andrews-Naval Air Facility Washington, MD

    Science.gov (United States)

    2015-06-01

    conducted at JBA require the use and storage of hazardous materials, including flammable and combustible liquids, acids, aerosols, batteries, and petroleum...materials of any kind, including the driving of piles and placing of obstructions; changing existing drainage characteristics, sedimentation patterns

  19. In response to "The Knowledge of Our Knowledge": a reflection on McAndrews' view of epistemology.

    Science.gov (United States)

    Winterstein, James

    2012-12-01

    This commentary considers one of the articles published in the first volume of this journal and reflects on the status of research and knowledge at that time. The chiropractic profession has witnessed advancement in the use of the scientific method in the past several decades, and scholarly journals have helped support this substantial growth.

  20. Assessing the skill of hydrology models at simulating the water cycle in the HJ Andrews LTER: Assumptions, strengths and weaknesses

    Science.gov (United States)

    Simulated impacts of climate on hydrology can vary greatly as a function of the scale of the input data, model assumptions, and model structure. Four models are commonly used to simulate streamflow in model assumptions, and model structure. Four models are commonly used to simu...

  1. Back to the future: the UK’s EU exit and the conflict of laws / Andrew Dickinson

    Index Scriptorium Estoniae

    Dickinson, Andrew

    2016-01-01

    Suurbritannia EList lahkumise mõjust Suurbritannia tsiviilkohtusüsteemile ja rahvusvahelise eraõiguse normide kohaldamisele piiriüleste kaubandus- ja tsiviilvaidluste lahendamisel; rahvusvahelise eraõiguse, ELi õiguse ja riigisisese õiguse tõlgendamisest

  2. St Andrews Bay, Florida, Juvenile Reeffish Survey from 2002-07-05 to 2015-08-13 (NCEI Accession 0156994)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains Excel and CSV files containing fish length of Juvenile Reeffish. Trawls were made during the summer months in shallow seagrass beds to monitor...

  3. 75 FR 81637 - Endangered and Threatened Wildlife and Plants; Notice of Availability of the St. Andrew Beach...

    Science.gov (United States)

    2010-12-28

    ... of the primary and secondary dunes) and adjacent inland scrub dunes within the coastal ecosystem... erosion to beach mouse habitat. (c) Impact of artificial lighting on beach mouse habitat. (d) Control of... erosion to beach mouse habitat. (c) Impact of artificial lighting on beach mouse habitat. (d) Control of...

  4. Andrews AFB, Washington, District of Columbia. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1974-03-14

    FIRUCSSINC) 4RANH(’-SAF Es TA . EXTREME VALUES J] AIR ;EAT-;ER 5ERVICE/hAC, +- Hi ++N,4I D PTH u+ tFROM DAILY OBSERVATIONSI 137?j,’ ANiPREWS APP 11hASI... MOVIl (LIT.) { CONITION SPEED MEAN (KNTS) 1- 3 4.6 7. 10 11. 16 17-21 22 -27 28 -33 34-40 41 -47 48 - 55 k56 % WIND DIR. I SPEED N 61.1 4 . NNE 6.4...TOTAL MONTH HOURS -- TENTHS OF NO OF (LTI 0 3 5 6 7 1 8 9 T O ISKY COVER OBS APP i0o-o02 3Z*,7 28 4.4 .0 , ._ 1.9 3.1 3.8I 3.8 2.oL3.4 __ _ 103-05 39

  5. 'What matters to Andrew'. The problem of premissary relevance in automated health advisors. Insights from pragma-dialectics.

    Science.gov (United States)

    Rubinelli, Sara; Labrie, Nanon H M; O'Keefe, Daniel J

    2013-08-01

    To influence health behavior, communication has to be relevant on an individual level and, thus, fulfill the requirement of premissary relevance. This paper attempts to enrich the design of automated health advisors by, first, reviewing main solutions to the challenge of premissary relevance found in the literature and, second, highlighting the value in this field of the theory of argumentation known as pragma-dialectics. A conceptual paper grounded in persuasion research and argumentation theory. Automated health advisors enable argumentative exchanges with users. But there is a need to design these systems as to make them work in an audience-centered perspective. The theory of pragma-dialectics can be used to analyze the factors that favor or hinder the agreement of users to engage in certain health behaviors, and to identify argumentation strategies targeted to behavior change. Pragma-dialectics can be used to enhance the design of automated health advisors as it operationalizes the dialogical nature of the reasoning process that can influence health behavior. Premissary relevance is a challenge of communication for health promotion at large that can be promisingly addressed through synergies among persuasion research, argumentation theory and Artificial Intelligence. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. An Increasing Need for Productive and Stress Resilient Festulolium Amphiploids: What Can Be Learnt from the Stable Genomic Composition of Festuca pratensis subsp. apennina (De Not.) Hegi?

    Czech Academy of Sciences Publication Activity Database

    Kopecký, David; Harper, J.; Bartoš, Jan; Gasior, D.; Vrána, Jan; Hřibová, Eva; Boller, T.; Ardenghi, N.M.G.; Šimoníková, Denisa; Doležel, Jaroslav; Humphreys, M.W.

    2016-01-01

    Roč. 4, Oct 14 (2016), č. článku 66. E-ISSN 2296-665X R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : amphiploidy * Festuca pratensis subsp. apennina (De Not.) Hegi * chromosome pairing Subject RIV: EB - Genetics ; Molecular Biology http://journal.frontiersin.org/article/10.3389/fenvs.2016.00066/full

  7. Muusikauudiseid maailmast / Nele-Eva Steinfeld

    Index Scriptorium Estoniae

    Steinfeld, Nele-Eva

    2016-01-01

    Lühisõnumeid maailmast: Suri Leonhard Cohen. Veriko Tchumburidze võitis rahvusvahelise Wieniawski konkursi. Suri ungari pianist, dirigent ja helilooja Zoltan KOcsis. Rahvusvahelise konkursi võit peaks pakkuma väärt võimalusi. Martyn Brabbins nimetati Inglise Rahvusooperi muusikajuhiks

  8. The Kodaly Concept: A Bibliography for Music Education. Kodaly: A Dynamic Tradition I.

    Science.gov (United States)

    Kaplan, Barbara, Ed.

    This bibliography brings together a collection of materials dedicated to the Zoltan Kodaly philosophy of music education. Included in this volume are ten units; (1) books and monographs; (2) articles; (3) reports and papers; (4) dissertations and theses; (5) music, song collections, textbook series, and didactic materials; (6) selected titles in…

  9. Keila vabrikuala ideevõistluse võitsid noored Leedu arhitektid / Piret Peensoo

    Index Scriptorium Estoniae

    Peensoo, Piret

    2007-01-01

    Keila endise riidevabriku kinnistu planeerimise võistluse võitsid Leedu arhitektid Andrius Uogintas, Margarita Podagelyte ja Matas Cirtautas ("Active edge"), teise koha sai PiKaSch Architecture Studio Zoltan Schrammeli juhtimisel Ungarist ("Keila 14") ja kolmanda koha Hannes Koppel ja Sander Aas ("Kegel") arhitektuuribüroost Asum Arhitektid

  10. SH Wave Scattering from a Sinusoidal Grating

    Science.gov (United States)

    1989-08-01

    63156 Dr. Zoltan A. Der Prof. Bryan Isacks ENSCO, Inc. Cornell University 5400 Port Royal Road Department of Geological Sciences Springfield, VA...L-205 Attn: NVCG Livermore, CA 94550 P.O. Box 98539 Las Vegas, NV 89193 Dr. Carl Newton Dr. George Rothe Los Alamos National Laboratory HQ AFTAC/TGR

  11. Disainikaart : Ungari

    Index Scriptorium Estoniae

    2008-01-01

    Ungari disaini esindavad Ernö Rubiku kuubik, Ungari vabadussamba autor Zsigmond Kisfaludi Strobl, disainerid Andras Göczey, Gabor Szilasi, Zoltan Lonovics ja Kormos Balint, orgaanilise arhitektuuri esindaja Imre Makovecz, mootorrattamargi Danuvia looja Biczo Levente, moedisainer Mester D̤ra ning ehtekunstnik Gera Noémi

  12. Kodaly, Literacy, and the Brain: Preparing Young Music Students to Read Pitch on the Staff

    Science.gov (United States)

    Jacobi, Bonnie S.

    2012-01-01

    The principles of Hungarian music educator Zoltan Kodaly can be particularly useful not only in teaching children how to read music notation but also in creating curiosity and enjoyment for reading music. Many of Kodaly's ideas pertaining to music literacy have been echoed by educators such as Jerome Bruner and Edwin Gordon, as well as current…

  13. Testing the Andrews Framework of Strategy Formulation and Implementation: Case Study of the University of Cape Coast Digital Library in Ghana

    Directory of Open Access Journals (Sweden)

    Nesba Yaa Anima Adzobu

    2014-12-01

    Full Text Available This paper investigates how strategy formulation and implementation processes used by the University of Cape Coast (UCC in building its digital collections compare with the Andrew’s strategic formulation and implementation theoretical framework. Theory-testing case study methodology was used. The data collection instruments were the key informant interview technique and document reviews. During the formulation phase, two aspects (resources and aspirations of senior management were emergent. During the implementation phase, five aspects (achieving results, processes and behaviour, standards, motivation, personal were emergent. All other elements of building the UCC digital collections were planned during both the formulation and implementation phases. Although the emphasis on students and learning is laudable and apt, there seems to be lack of focus on research support beyond digital collection building, despite the fact that research excellence is one of the UCC’s key priorities. Opportunities exist for improving feedback mechanisms between the users, digital library staff and the university management; and inclusion of social media tools in the digital library project. Since only the experience of a single institution of higher learning is considered, it cannot be definitively stated that strategy formulation and implementation will be similar in every institutional context. However, the results provide a basis for academic digital libraries to draw lessons from this case. In African public universities, there is little earlier research on strategy formulation and implementation in digital library management. Strategy formulation and implementation is a critical issue for higher education academic libraries especially in developing countries like Ghana, due to limited financial resources and the rapid change in the information environment during the last several decades.

  14. Cultural, Linguistic, Curricular and Financial Stories of Andrews University International Undergraduate Students and Their Experiences of Coping during the Academic Year 2014-2015: A Narrative Study

    Science.gov (United States)

    Saint-Phard, Renaude Etienne

    2017-01-01

    The internationalization trends indicate that global growth of international students moving from one country to another is predicted to exceed 7.2 billion in 2025 (IIE, 2011). This crossing of borders inevitably evokes that international students confront multifaceted challenges in their host country. Although many facets of research have…

  15. Environmental Assessment for the Expansion and Consolidation of the Base Exchange at Joint Base Andrews-Naval Air Facility Washington, Prince George’s County, Maryland

    Science.gov (United States)

    2013-08-01

    foundation and floor, utility and infrastructure systems, a concrete block exterior with brick facing, a standing seam metal roof, a fire suppression...84,000 square feet. Construction would include site clearance, excavation, a reinforced concrete foundation and floor, masonry exterior with brick, a...transportation principles such as providing alternatives to automobiles (pedestrian, bicycles, mass transit) as well minimizing impermeable parking surfaces

  16. Society News: RAS Awards 2012; Prof. Andy Fabian; Prof. John C Brown; Prof. Andrew Fazakerley; Dr. Mike Irwin; Joss Bland-Hawthorn

    Science.gov (United States)

    2012-02-01

    Each year the RAS recognizes outstanding achievement in astronomy and geophysics by the award of medals and prizes. Candidates are nominated by Fellows and the awards made by a committee of Fellows, ensuring that these scientists have earned the respect and admiration of their peers in the research community.

  17. On the dates of publication of the parts of Sir Andrew Smith’s illustrations of the Zoology of South Africa

    NARCIS (Netherlands)

    Jentink, F.A.

    1893-01-01

    Under the above title there has been published a very valuable paper in the P. Z. S. L. 1880, p. 489, written by Mr. F. H. Waterhouse. The author remarked: »As the copy here alluded to, did not contain plates XVIII and XXXVIII (Mammalia), I have examined three or four other copies; and as neither of

  18. Economic strain and perceptions of social cohesion in Europe: does institutional trust matter? / Rhys Andrews, Sebastian Jilke, Steven van de Walle

    Index Scriptorium Estoniae

    Andrews, Rhys

    2014-01-01

    Artikkel analüüsib, kuidas eurooplased tajuvad sotsiaalset ühtekuuluvust, võttes sealjuures arvesse majandussurvet ja institutsionaalset usaldust. Aluseks on Eurobaromeetri uuring vaesusest ja sotsiaalsest tõrjutusest (2010), mis haaras 27 liikmesriiki (sh Eesti)

  19. Environmental Assessment for Taxiway Whiskey Supplemental Projects at Joint Base Andrews-Naval Air Facility Washington, Prince George’s County, Maryland

    Science.gov (United States)

    2015-09-01

    Additionally Federal Agencies are required to improve data center energy efficiency, meet electric and thermal energy requirements with clean energy... Mammals known to occur at JBA are also those common in the region, including white-tailed deer (Odocoileus virginianus), raccoon (Procyon lotor...Years of Experience: 11 Samuel Pett M.S., Environmental Science and Policy, University of Massachusetts/Boston B.S., Wildlife Biology and Zoology

  20. Interactions among soil biology, nutrition, and performance of actinorhizal plant species in the H.J. Andrews Experimental Forest of Oregon.

    Science.gov (United States)

    N.S. Rojas; D.A. Perry; C.Y. Li; L.M. Ganio

    2002-01-01

    The study examined the effect of Frankia, macronutrients, micronutrients, mycorrhizal fungi, and plant-growth-promoting fluorescent Pseudomonas sp. on total biomass, nodule weight, and nitrogen fixation of red aider (Alnus rubra) and snowbrush (Ceanothus velutinus) under greenhouse conditions. The soil...

  1. Hans Rose, Commentary to Heinrich Wölfflin, Renaissance and Baroque, fourth edition, Munich: Bruckmann, 1926, 181-328, translation by Arnold Witte and Andrew Hopkins

    Directory of Open Access Journals (Sweden)

    Arnold Witte

    2016-06-01

    Full Text Available The Commentary by Hans Rose was published as an appendix to the fourth edition of Heinrich Wölfflin’s Renaissance und Barock - eine Untersuchung über Wesen und Entstehung des Barockstils in Italien, published in 1926. It was almost as long as the original text by Wölfflin and intended to discuss the new approaches on the Italian Baroque developed in German academia in the 1920s. It was divided up into four sections of unequal length, which discuss Subjectivism, Material and Colour, Urban Planning, and St Peter’s respectively.

  2. Democratic civilian control of the Nepalese Army

    Science.gov (United States)

    2013-06-14

    control over the budget Officer promotions Reinsertion of combatants into society Source: Zoltan D. Barany, The Soldier and the Changing State...the peace accord focused on creating conditions for economic growth and development in war-afflicted areas of El Salvador. Reinsertion programs...civilian life described uneven progress and were far from encouraging. Those who were reinserted into civilian and productive life were just as poor

  3. Understanding Alliance Formation Patterns

    Science.gov (United States)

    2015-12-01

    might take a different trend in different eras, in which it is either positive, leading to a bigger chance of alliance formation , or negative, leading...of war and peace with regard to systemic analysis. Therefore, it is reasonable that there is a deviation in the trends of alliance formation during...ALLIANCE FORMATION PATTERNS by Wael Abbas Zoltan Schneider December 2015 Thesis Advisor: William P. Fox Second Reader: Heather S. Gregg

  4. AcEST: BP917847 [AcEST

    Lifescience Database Archive (English)

    Full Text Available p|P31795|POL_MLVRK Pol polyprotein (Fragment) OS=Radiation muri... 71 3e-12 sp|P1...1227|POL_MLVRD Pol polyprotein OS=Radiation murine leukemia... 71 3e-12 sp|P31792|POL_FENV1 Pol polyprotein ...Sbjct: 975 -NTPGQFGLTPYEILHG 990 >sp|P31795|POL_MLVRK Pol polyprotein (Fragment) OS=Radiation murine leukemi...GTGFTSFHLVYG 97 + G T + ++YG Sbjct: 431 -NTPGPHGLTPYEILYG 446 >sp|P11227|POL_MLVRD Pol polyprotein OS=Radiation

  5. God and the World of Signs

    DEFF Research Database (Denmark)

    Kristensen, Johanne Stubbe T

    2016-01-01

    Review of Robinson, Andrew (Andrew John Nottage). God and the world of signs: Trinity, evolution, and the metaphysical semiotics of C. S. Peirce. Publisher: Leiden: Brill, 2010. ISBN: 9789004187993......Review of Robinson, Andrew (Andrew John Nottage). God and the world of signs: Trinity, evolution, and the metaphysical semiotics of C. S. Peirce. Publisher: Leiden: Brill, 2010. ISBN: 9789004187993...

  6. Sometimes we can see some mental states. Comment on "Seeing mental states: An experimental strategy for measuring the observability of other minds" by Cristina Becchio, Atesh Koul, Caterina Asuini, Cesare Bertone, and Andrew Cavallo

    Science.gov (United States)

    Tversky, Barbara

    2018-03-01

    Seeing mental states[1] poses an ambitious question: Is it possible to perceive the mental states of others? According to the authors, the answer is yes. To that end, they overview some 15 studies showing that observers of a reaching arm can discern the intentions of the reaching, specifically, whether to grasp, to place, to pass, or to pour. The judgments are made before the hand arrives at the glass so the act that observers are predicting is never seen. In addition, they show how the kinematics of the reaching differ for each case, allowing the perceivers judgments. These findings are remarkable given that the kinematic differences among the actions are subtle. The overview cogently, elegantly, and convincingly summarizes the findings and in doing so, addresses criticisms that have been directed at the methods and conclusions. It is impressive how much can be reliably inferred just from the kinematics of a reaching arm. This is a significant set of findings and it is good to have them in one place.

  7. Finding of No Significant Impact and Finding of No Practicable Aleternative for the Environmental Assessment for the 21 Point Enclosed Firing Range at Joint-Base Andrews-Naval Air Facility Washington, Maryland

    Science.gov (United States)

    2015-03-02

    a calendar year basis for all permitted stationary sources: external combustion units (e.g. boilers, heaters); emergency generators; gasoline...or discharging of, or filling a nontidal wetland with materials of any kind, including the driving of piles and placing of obstructions; changing

  8. Environmental Assessment for Replacement of Taxiway Sierra, Taxiway Whiskey, Pad 12, and Pad 13 at Joint Base Andrews-Naval Air Facility Washington, Prince George’s County, Maryland

    Science.gov (United States)

    2013-04-01

    overlay bedrock. The surficial geologic deposits range in thickness from 10 to 20 feet and include irregularly bedded cobbles , gravel, and fine...Type Number of Units Days on Site Hours Per Day Operating Hours Excavators 2 575 12 13,800 Rollers 2 575 12 13,800 Rubber Tired Dozers 2 575 12...SOx PM10 PM2.5 CO2 Excavators 0.5828 1.3249 0.1695 0.0013 0.0727 0.0727 119.6 Rollers 0.4341 0.8607 0.1328 0.0008 0.0601 0.0601 67.1 Rubber

  9. Environmental Assessment for the Construction and Operation of a Battalion Headquarters for the U.S. Army Priority Air Transport at Joint Base Andrews-Naval Air Facility Washington, Prince George’s County, Maryland

    Science.gov (United States)

    2012-12-01

    bedded cobbles , gravel, and fine sand that are mixed with silt and clay. Surface formations at JBA have largely been previously disturbed by grading...Per Day Operating Hours Excavators Composite 1 115 4 460 Rollers Composite 1 173 8 1,384 Rubber Tired Dozers Composite 1 115 8 920 Plate Compactors...0.8607 0.1328 0.0008 0.0601 0.0601 67.1 Rubber Tired Dozers Composite 1.5961 3.2672 0.3644 0.0025 0.1409 0.1409 239.1 Plate Compactors Composite

  10. Retraction: 'Number needed to treat with 4-factor prothrombin complex concentrate for urgent warfarin reversal' by Andrew Chua, Vishal Patel, Allison Perrin, Lee Stern, Jenifer Ehreth, Laurel Omert, Christopher Hood, Julie Farley, Michael McGlynn and Liping Huang.

    Science.gov (United States)

    2017-04-01

    The above abstract from the THSNA 2016 Summit Abstract Proceedings, first published online in the American Journal of Hematology on 20 July 2016 in Wiley OnlineLibrary (www.onlinelibrary.wiley.com), and in Volume 91, Issue 9, p. E427, has been retracted by agreement between the authors, the journal Editor-in-Chief, Carlo Brugnara, and Wiley Periodicals, Inc. The retraction has been agreed due to concerns from the submitting authors that the abstract was inadvertently submitted prior to receiving approval from all authors and proper review of data analytics, thereby rendering it incomplete. THSNA 2016 Summit Abstract Proceedings (2016). Am. J. Hematol., 91: E427. https://doi.org/10.1002/ajh.24471. © 2017 Wiley Periodicals, Inc.

  11. Installation Restoration Program Phase 2. Confirmation/Quantification Stage 1 for Otis Air National Guard Base, Massachusetts, Air National Guard Support Center, Andrews Air Force Base, Maryland. Volume 2. Appendices

    Science.gov (United States)

    1985-10-01

    petrochemical, metal plating, food industries and DoD. identify and develop treatment methods/technology for Applied research on a number of advanced... food packaging and transformer Jersey, 19-23 March 1979. manufacturing. Mady, N., D. Smith, J. Smith, and C. Wezwick, "The Analysis of Kepone in...FID, NPD , TCD, search Institute he also supported re- FPD). search in organic synthesis, fuel char- acterization, electronic component

  12. Creating a multi-gas proxy for Delta 14C and atmospheric fossil fuel-CO2. Kevin Coakley, John Miller , Scott Lehman, Stephen Montzka, Colm Sweeney, Arlyn Andrews , Ben Miller

    Science.gov (United States)

    Coakley, K. J.; Miller, J. B.; Lehman, S.; Montzka, S. A.; Andrews, A. E.; Miller, B. R.

    2013-12-01

    The C14:C12 ratio of atmospheric CO2 (expressed as Delta 14C) is the gold standard measurement to derive the portion of observed atmospheric CO2 gradients resulting from combustion of fossil fuels (CO2-ff). This is because fossil fuels are devoid of 14C, unlike all other sources and sinks that impact atmospheric Delta14C. With enough 14C measurements, independent, 'top-down', estimation of US fossil fuel-CO2 emissions should be possible. However, our ability to make carbon-14 measurements is severely constrained by cost, accessibility to accelerator mass spectrometers (AMS) and the volume of air required to make high precision (~0.2 %) measurements of 14CO2 (mixing ratio is ~ 4e-16 mol/mol). Thus, Delta 14C is currently measured in only a small subset of NOAA/ESRL Global Monitoring Division (GMD) tall-tower and aircraft air samples. Here, we present a Projection Pursuit Regression (PPR) model to predict CO2-ff measured at different times and altitudes in terms of surrogate gases that are more widespread and relatively inexpensive to measure. This method would, in effect, allow expansion of Delta 14C measurements by factor of ~3 or 4 throughout North America. To create a proxy for CO2-ff, we take advantage of the observed correlations between (Delta 14C-derrived) CO2-ff and regional-scale enhancements of a wide array of anthropogenic gases, like CO, SF6, and halo- and hydro-carbons. We select the complexity and form of the PPR model by cross validation where validation data prediction error is minimized. In cross validation, the prediction model is based on the training data and not the validation data. We quantify prediction model performance with test data excluded from the model development process. According to cross validation, the PPR model is superior to a simpler linear model. Comparison with test CO2-ff data shows that CO2-ff can be predicted with a root mean square error of 1.1 ppm, only slightly higher than the Delta 14C-precision limit for CO2-ff of 1 ppm. Applying the PPR model to the large NOAA/ESRL/GMD database of surrogate gases, we can create a large set of synthetic CO2-ff data for the US. Finally, we will discuss the application of this large data set of lower-precision CO2-ff to top down determination of US fossil fuel CO2 emissions by presenting results from an Observation System Simulation Experiment (OSSE).

  13. Making sense of the ECG: cases for self-assessment Making Sense of the ECG: Cases for Self-Assessment Houghton Andrew and Gray David Hodder Education £18.99 290pp 9780340946893 034094689X [Formula: see text].

    Science.gov (United States)

    2011-02-10

    This practical pocket-book approach to electrocardiogram (ECG) interpretation accompanies Making sense of the eCg by the same authors. it is also designed to be used alone to test knowledge of ECG interpretation and to make clinical decisions based on presented scenarios.

  14. Making Sense of the ECG - Cases for Self-Assessment Houghton Andrew R Gray David Making Sense of the ECG - Cases for Self-Assessment 290pp Hodder Education 9780340946893 034094689X [Formula: see text].

    Science.gov (United States)

    2010-10-27

    This practical, pocket-book approach to ECG interpretation accompanies the well-known text Making Sense of the ECG, by the same authors. It is also designed to be used alone to test knowledge of ECG interpretation and to make clinical decisions based on presented scenarios.

  15. The Role of Science in Managed Aquifer Recharge--the Equus Beds aquifer near Wichita, Kansas Andrew Ziegler, Director Brian Kelly, Office Chief Michael Jacobs, Manager of Water Planning and Production Debra Ary, Engineer, Water Systems Planning (Invited)

    Science.gov (United States)

    Ziegler, A. C.; Jacobs, M.; Ary, D.; Kelly, B.

    2013-12-01

    Data collection and interpretation using statistical, geochemical, and numerical simulation tools are essential parts of a long-term cooperative study between the city of Wichita, U.S. Geological Survey, and others to describe water quantity and quality conditions in a 165 square-mile part of the Equus Beds aquifer and Arkansas and Little Arkansas Rivers. The Equus Beds aquifer, eastern part of the High Plains Aquifer in south-central Kansas, is a vital water resource for agriculture and city of Wichita. Withdrawals for public supply began in the 1940s and agricultural irrigation began in the 1950-60s. These withdrawals led to water-level declines of up to 40 feet (historic low in 1993), a storage loss of 250,000 acre feet compared to predevelopment, and may enhance movement of chloride contamination from a past oilfield disposal area near Burrton and from natural chloride along the Arkansas River. Monitoring data and modeling show chloride near Burrton moved about 3 miles in 45 years, is about 1 mile away from the nearest public supply wells, and will continue to move for decades to centuries making the water unusable for irrigation or water supply without treatment. These concerns led to development of Wichita's 1993 integrated local water-supply plan that increased use of Cheney Reservoir and implemented aquifer storage and recovery (ASR) within the aquifer using high flows from the Little Arkansas River. ASR benefits include replacing depleted storage and slowing chloride movement. Decreased withdrawals, increased precipitation, and artificial recharge increased water levels and added 100,000 acre feet of storage through 2010, but drought since 2011 has increased withdrawals. A calibrated model will be used to simulate transport of chloride under several withdrawal scenarios using MODFLOW coupled with SEAWAT. Since 1995, water-quality data collection for more than 400 organic and inorganic compounds in surface water, treated source water for artificial recharge, and groundwater identified indicator bacteria, atrazine, chloride, sodium, nitrate, arsenic, iron, and manganese as constituents of concern exceeding water-quality criteria in baseline samples. Techniques were developed to estimate Little Arkansas River water quality in real-time for treatment. Geochemical modeling using PHREEQC and PHAST shows that groundwater quality is not changed if groundwater and recharge water are of similar redox potential. If different, calcite or metal hydroxides may precipitate and decrease water infiltration. A network of 38 locations with shallow and deep wells characterizes the recharge quantities and qualities for the city of Wichita to withdraw when needed from storage. Through 2013, the Demonstration project and Phase 1 and 2 facilities (capacity 40 MGD) have artificially recharged about 2 billion gallons. Total construction costs are about $300,000,000. Data-collection, interpretative geochemical and numerical simulations and water-quality transport modeling tools developed in the past 70 years are a scientific foundation to effectively and objectively manage this aquifer system.

  16. Paving the Road to Success: A Framework for Implementing the ...

    African Journals Online (AJOL)

    Paving the Road to Success: A Framework for Implementing the Success Tutoring Approach Danie de Klerk,** Tshepiso Maleswena*** & Andrew Jones. Linda Spark, Danie de Klerk, Tshepiso Maleswena, Andrew Jones ...

  17. Webberi juubel algab Tallinnas / Ülle Hallik

    Index Scriptorium Estoniae

    Hallik, Ülle, 1963-

    2008-01-01

    Kahest kontserdist "The Music of Andrew Lloyd Webber" 18. okt. Tallinnas Saku Suurhallis, mis on pühendatud Briti muusikalihelilooja Sir Andrew Lloyd Webberi 60. sünnipäevale ja on avalöögiks juubeliturneele

  18. Resonance – Journal of Science Education | News

    Indian Academy of Sciences (India)

    Box. In Memoriam: George Andrew Olah · Ripudaman Malhotra · More Details Abstract Fulltext PDF. pp 1111-1153 General Article. George Andrew Olah: Across Conventional Lines · Ripudaman Malhotra Thomas Mathew G K Suryaprakash.

  19. Drug therapy for gastrointestinal and liver diseases

    National Research Council Canada - National Science Library

    Ballinger, Anne; Farthing, M. J. G. (Michael J. G.)

    2001-01-01

    ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Peptic ulcer disease Erik AJ Rauws, Guido NJ Tytgat . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21 Emesis Gareth J Sanger, Paul LR Andrews...

  20. Strength and Fatigue of NT551 Silicon Nitride and NT551 Diesel Exhaust Valves

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, M.J.; Wereszczak, A.A.; Kirkland, T.P.; Breder, K.

    2000-02-01

    The content of this report is excerpted from Mark Andrew's Ph.D. Thesis (Andrews, 1999), which was funded by a DOEYOTT High Temperature Materials Laboratory Graduate Fellowship. It involves the characterization of NT551 and valves fabricated with it. Greater detail of the described issues may be found in that reference or through communications with Andrew Wereszczak.

  1. Long term monitoring of currents, conductivity, temperature, salinity, sigma-theta, pressure, waves, chlorophyll A, oxygen, and meteorology from moorings deployed at two locations in Massachusetts Bay from the platforms WHITE HEATH, ASTERIAS, CHRISTOPHER ANDREW, MARCUS HANNA, ABBIE BURGESS, LOONEY, and ARGO MAINE from January 1, 1986 to February 8, 2006 (NODC Accession 0060062)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Measurements of currents and other oceanographic properties were made at two locations to understand the transport and long-term fate of sediments and associated...

  2. PDA Use by Clinicians has a Positive Impact on Clinical Decision Making. A review of: Dee, Cheryl R., Marilyn Teolis, and Andrew D. Todd. “Physicians’ use of the personal digital assistant (PDA in clinical decision making.” Journal of the Medical Library Association 93.4 (October 2005: 480-6.

    Directory of Open Access Journals (Sweden)

    Suzanne P. Lewis

    2006-06-01

    Full Text Available Objective – To examine how frequently attending physicians and physicians in training (medical students, interns and residents used PDAs for patient care and to explore physicians’ perceptions of the impact of PDA use on several aspects of clinical care. Design – User study via a questionnaire. Setting – Teaching hospitals in Tennessee, Florida, Alabama, Kentucky, and Pennsylvania in the United States. Subjects – A convenience sample of fifty nine attending physicians and forty-nine physicians in training (108 total, spread unevenly across the five states. Methods – Subjects were recruited by librarians at teaching hospitals to answer a questionnaire which was distributed and collected at medical meetings, as well as by email, mail, and fax. The subjects were required to have and use a PDA, but prior training on PDA use was not a requirement, nor was it offered to the subjects before the study. Most of the questions required the respondent to choose from five Likert scale answers regarding frequency of PDA use: almost always, often, a few times, rarely, or never. In the reporting of results, the options ‘almost always’ and ‘often’ were combined and reported as ‘frequent’, and the options ‘a few times’ and ‘rarely’, were combined and reported as ‘occasional’. Subjects could also record comments for each question, but only for affirmative responses. Subjects were asked about their frequency of PDA use before, during, or after a patient encounter. They were also asked if PDA use had influenced one or more of five aspects of clinical care – decision making, diagnosis, treatment, test ordering, and in-patient hospital length of stay. Data analysis included chi square tests to assess differences between attending physicians and physicians in training regarding frequency of PDA use and the influence of PDA use on the five aspects of clinical care. The subject population was also divided into frequent and occasional users of PDAs, and chi square testing was used to assess differences between these two groups regarding the influence of PDA use on clinical care. A significance value of PMain results – Ninety‐four (87% of the 108 respondents used PDAs for patient encounters. Of this group, 59 were frequent users and 35 were occasional users. There were no significant differences between attending physicians and physicians in training with regard to frequency of PDA use in patient encounters. Sixty-seven percent of the 108 respondents reported that using a PDA had influenced their clinical decision making; over 50% reported that PDA use had influenced changes in patient treatment; 16% reported that PDA use had helped avoid unnecessary tests; 10% reported that PDA use had helped change a patient’s diagnosis; and 6% reported that PDA use had helped shorten a patient’s length of stay. Within these results, there were no statistically significant differences between the attending physicians and the physicians in training. More than 85% of the frequent PDA users (n=59, and 60% of the occasional PDA users (n=35, reported that PDA use had influenced their clinical decision making. The difference between these two groups was statistically significant (PConclusion – PDA use has a positive impact on clinical decision making and patient care. Frequency of PDA use appears to be a factor in determining the perceived impact of PDAs on clinical decision making. However, even those physicians who used PDAs only occasionally reported a positive impact of PDA use on clinical decision making. The status of physicians (attending or in training does not appear to be a determining factor in the frequency of PDA use for patient encounters. Health sciences librarians are well positioned to provide resources and training for PDA use by clinicians.

  3. Comment on "Nanosecond laser textured superhydrophobic metallic surfaces and their chemical sensing applications" by Duong V. Ta, Andrew Dunn, Thomas J. Wasley, Robert W. Kay, Jonathan Stringer, Patrick J. Smith, Colm Connaughton, Jonathan D. Shephard (Appl. Surf. Sci. 357 (2015) 248-254)

    Science.gov (United States)

    Boinovich, L. B.; Emelyanenko, A. M.; Emelyanenko, K. A.; Domantovsky, A. G.; Shiryaev, A. A.

    2016-08-01

    Nowadays the problem of design of durable ecologically friendly superhydrophobic surfaces is of great importance for science and technology. A recent paper in Applied Surface Science reports the method of fabricating the superhydrophobic metallic surfaces by infrared nanosecond laser surface texturing without using hydrophobic agents. Since this method of surface texturing can be considered as one of the most suitable for various industrial applications, the nature of superhydrophobic state of surfaces produced by laser texturing in the abovementioned paper deserves to be analyzed in detail. Authors of the commented paper attributed the change in wettability to the partial deoxidation of CuO into Cu2O on the surface during storage in atmosphere. However, such interpretation of the results contradicts to the basic notions in the theory of wetting and to more accurate and detailed data. In our Comment we discuss these contradictions point by point.

  4. Genetic Characterization of Spondweni and Zika Viruses and Susceptibility of Geographically Distinct Strains of Aedes aegypti, Aedes albopictus, and Culex quinquefasciatus (Diptera: Culicidae) to Spondweni Virus

    Science.gov (United States)

    2016-10-26

    and Culex quinquefasciatus (Diptera: Culicidae) to Spondweni virus Andrew D . Haddow1,2*, Farooq Nasar1,2, Hilda Guzman1, Alongkot Ponlawat3...antimouse immunoglobulin G (Sigma Aldrich, St. Louis, MO, USA) 180 [32,33]. 181 182 TR-16-162 DISTRIBUTION STATEMENT A: Approved for public...of Thailand. 303 304 Contributor information 305 306 Andrew D . Haddow, Email: adhaddow@gmail.com or andrew.d.haddow.ctr@mail.mil 307 308

  5. C2 Failures: A Taxonomy and Analysis

    Science.gov (United States)

    2013-06-01

    1989, Apr. 15 United Kingdom (Sheffield, England) 96 deaths [15] Hurricane Andrew 1992, Aug. 24 United States (Florida) 26 direct deaths, 39...Victorian Bushfires Royal Commission (2010), p.8 Hurricane Andrew Response "...failure to have a single person in charge with a clear chain of command...communications infrastructure. This happened during Hurricane Andrew , 31 Hurricane Katrina, 32 and the Indian Ocean Tsunami. 33 Even if not substantially

  6. Geomorphologic Evolution of Barrier Islands along the Northern U.S. Gulf of Mexico and Implications for Engineering Design in Barrier Restoration

    Science.gov (United States)

    2009-01-01

    In a follow-on study, DINGLER and REISS (1995) studied this same 400-m section of the Isle Dernieres after Hurricane Andrew , a Category 3 Hurricane...that made landfall near Point Au Fer Island, Louisiana, on August 25, 1992 (see STONE and FINKL, 1995). Hurricane Andrew eroded the sub- aerial beach...by Hurricane Andrew were found to have occurred along the margins of existing inlets and newly formed hurricane breaches. Bayside erosion occurred as a

  7. Cephalopod-INspired Adaptive Photonic SystEms (CINAPSE)

    Science.gov (United States)

    2013-09-13

    Andrew Magyar , Evelyn Hu Patents Awarded Awards David Awschalom: David Turnbull Award, Materials Research Society (2010), election to National Academy of...Equivalent: 4Total Number: Names of Post Doctorates PERCENT_SUPPORTEDNAME Igor Aharonovich, Harvard 0.00 Andrew Magyar , Harvard 1.00 Lee Bassett, UCSB...contracting officer? (5e) N Foreign Countries of application (5g-2): 5 Leila Deravi, Kevin Kit Parker, Andrew Magyar , Evelyn Hu Harvard University 29 Oxford

  8. Psychophysical measures of visual function and everyday perceptual experience in a case of congenital stationary night blindness

    OpenAIRE

    Cammack, Jocelyn; Whight,John; Cross,VInette; Rider,Andrew; Webster,Andrew; Stockman,Andrew

    2016-01-01

    Jocelyn Cammack,1 John Whight,2 Vinette Cross,3 Andrew T Rider,1 Andrew R Webster,1,2 Andrew Stockman1 1Department of Visual Neuroscience, UCL Institute of Ophthalmology, 2Moorfields Eye Hospital, London, 3Centre for Health and Social Care Improvement, University of Wolverhampton, Wolverhampton, UK Abstract: An appreciation of the relation between laboratory measures of visual deficit and everyday perceptual experience is fundamental to understanding the impact of a visual conditio...

  9. African Journal of Psychiatry: Contact

    African Journals Online (AJOL)

    Principal Contact. Andrew Thomas Division of Psychiatry, Department of Neurosciences, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, SOUTH AFRICA Email: inhouse@iafrica.com ...

  10. Flexible Transpiration Cooled Thermal Protection System for Inflatable Atmospheric Capture and Entry Systems, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Andrews Space, Inc. proposes an innovative transpiration cooled aerobrake TPS design that is thermally protective, structurally flexible, and lightweight. This...

  11. Flexible Transpiration Cooled Thermal Protection System for Inflatable Atmospheric Capture and Entry Systems, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Andrews Space, Inc. proposes an innovative transpiration cooled aerobrake TPS design that is thermally protective, structurally flexible, and lightweight. This...

  12. 29 CFR 1420.5 - Optional input of parties to Board of Inquiry selection.

    Science.gov (United States)

    2010-07-01

    ..., Marion, White, Hamilton, Wayne, Edwards, Wabash, Lawrence, Richland, Clay, Effingham, Jasper, and..., Adair, Sullivan, Grundy, Daviess, Gentry, DeKalb, Andrew, Holt, Buchanan, Clinton, Caldwell, Livingston...

  13. Efficient Simulation and Downscaling of Large Non-Stationary Fields with Varying Local Anisotropy

    Science.gov (United States)

    Dodov, B.

    2015-12-01

    Simulation of locally anisotropic, non-stationary random fields is a relatively new topic in geostatistics with applications currently restricted to the construction of an admissible covariance matrix. In this paper, we introduce an efficient algorithm for constructing large non-stationary random fields with arbitrary local covariance structure and anisotropy. At the heart of our approach is a newly developed robust directional multiresolution framework combined with a local tensor anisotropy model. The use of our algorithm is illustrated with local anisotropy analysis, simulation and downscaling of complex pseudo-precipitation (PP) fields* related to tropical and extra-tropical cyclones. The efficiency of the algorithm allows obtaining realistic downscaled global GCM precipitation fields down to a few kilometers resolution in seconds.* Reference: Unpublished work by Huiling Yuan and Zoltan Toth. PP fields are constructed by taking the precipitation as the positive component of the field and the water vapor saturation deficit as its negative complement.

  14. Sound experiences: the vision of experimental musician on the folkloric music in modern society

    Directory of Open Access Journals (Sweden)

    Rieko Tanaka

    2016-11-01

    Full Text Available This work begins narrating how folk music has always been a remnant in the influence on classical composers. It makes special mention of origin Hungarian musicians Bela Bartok, Zoltan Kodaly. This Musicians are considerate in this work as the most immediate ancestors of an experimental musicians northamericans, because both are influenced by their passion for folk music. We select as musicians principals exponents of American experimental music to John Cage, Lou Harrison and Carl Ruggles. Their works will be considered and analyzed in this text as the sounds as the experiences. Composers that will analyze the sound as experience, as feeling, as emotion, as time and origin. related traits in folk music and experimental music. Not forgetting in this work, and in his final considerations, the relationship between the musician, creation, society and art.

  15. Combinatorial Algorithms to Enable Computational Science and Engineering: Work from the CSCAPES Institute

    Energy Technology Data Exchange (ETDEWEB)

    Boman, Erik G. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States). Scalable Algorithms Dept.; Catalyurek, Umit V. [The Ohio State Univ., Columbus, OH (United States). Biomedical Informatics. Electrical and Computer Engineering; Chevalier, Cedric [Alternative Energies and Atomic Energy Commission (CEA), Cadarache (France); Devine, Karen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States). Scalable Algorithms Dept.; Gebremedhin, Assefaw H. [Purdue Univ., West Lafayette, IN (United States). Computer Science; Hovland, Paul D. [Argonne National Lab. (ANL), Argonne, IL (United States). Mathematics and Computer Science Division; Pothen, Alex [Purdue Univ., West Lafayette, IN (United States). Computer Science; Rajamanickam, Sivasankaran [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States). Scalable Algorithms Dept.; Safro, Ilya [Argonne National Lab. (ANL), Argonne, IL (United States). Mathematics and Computer Science Division; Wolf, Michael M. [Massachusetts Inst. of Technology (MIT), Lexington, MA (United States). Lincoln Lab.; Zhou, Min [Rensselaer Polytechnic Inst., Troy, NY (United States). Scientific Computation Research Center

    2015-01-16

    This final progress report summarizes the work accomplished at the Combinatorial Scientific Computing and Petascale Simulations Institute. We developed Zoltan, a parallel mesh partitioning library that made use of accurate hypergraph models to provide load balancing in mesh-based computations. We developed several graph coloring algorithms for computing Jacobian and Hessian matrices and organized them into a software package called ColPack. We developed parallel algorithms for graph coloring and graph matching problems, and also designed multi-scale graph algorithms. Three PhD students graduated, six more are continuing their PhD studies, and four postdoctoral scholars were advised. Six of these students and Fellows have joined DOE Labs (Sandia, Berkeley), as staff scientists or as postdoctoral scientists. We also organized the SIAM Workshop on Combinatorial Scientific Computing (CSC) in 2007, 2009, and 2011 to continue to foster the CSC community.

  16. Seismic fragility of RC shear walls in nuclear power plant Part 1: Characterization of uncertainty in concrete constitutive model

    Energy Technology Data Exchange (ETDEWEB)

    Syed, Sammiuddin [Department of Civil, Construction, and Environmental Engineering, North Carolina State University, 426 Mann Hall, Campus Box 7908, Raleigh, NC 27695-7908 (United States); Gupta, Abhinav, E-mail: agupta1@ncsu.edu [Department of Civil, Construction, and Environmental Engineering, North Carolina State University, 413 Mann Hall, Campus Box 7908, Raleigh, NC 27695-7908 (United States)

    2015-12-15

    Highlights: • A framework is proposed for seismic fragility assessment of Reinforced Concrete structures. • Experimentally validated finite element models are used to conduct nonlinear simulations. • Critical parameters in concrete constitutive model are identified to conduct nonlinear simulations. • Uncertainties in model parameters of concrete damage plasticity model is characterized. • Closed form expressions are used to compute the damage variables and plasticity. - Abstract: This two part manuscript proposes a framework for seismic fragility assessment of reinforced concrete structures in nuclear energy facilities. The novelty of the proposed approach lies in the characterization of uncertainties in the parameters of the material constitutive model. Concrete constitutive models that comprehensively address different damage states such as tensile cracking, compression failure, stiffness degradation, and recovery of degraded stiffness due to closing of previously formed cracks under dynamic loading are generally defined in terms of a large number of variables to characterize the plasticity and damage at material level. Over the past several years, many different studies have been presented on evaluation of fragility for reinforced concrete structures using nonlinear time history simulations. However, almost all of these studies do not consider uncertainties in the parameters of a comprehensive constitutive model. Part-I of this two-part manuscript presents a study that is used to identify uncertainties associated with the critical parameters in nonlinear concrete damage plasticity model proposed by Lubliner et al. (1989. Int. J. Solids Struct., 25(3), 299) and later modified by Lee and Fenves (1998a. J. Eng. Mech., ASCE, 124(8), 892) and Lee and Fenves (1998b. Earthquake Eng. Struct. Dyn., 27(9), 937) for the purpose of seismic fragility assessment. The limitations in implementation of the damage plasticity model within a finite element framework and

  17. Seismic fragility of RC shear walls in nuclear power plant Part 1: Characterization of uncertainty in concrete constitutive model

    International Nuclear Information System (INIS)

    Syed, Sammiuddin; Gupta, Abhinav

    2015-01-01

    Highlights: • A framework is proposed for seismic fragility assessment of Reinforced Concrete structures. • Experimentally validated finite element models are used to conduct nonlinear simulations. • Critical parameters in concrete constitutive model are identified to conduct nonlinear simulations. • Uncertainties in model parameters of concrete damage plasticity model is characterized. • Closed form expressions are used to compute the damage variables and plasticity. - Abstract: This two part manuscript proposes a framework for seismic fragility assessment of reinforced concrete structures in nuclear energy facilities. The novelty of the proposed approach lies in the characterization of uncertainties in the parameters of the material constitutive model. Concrete constitutive models that comprehensively address different damage states such as tensile cracking, compression failure, stiffness degradation, and recovery of degraded stiffness due to closing of previously formed cracks under dynamic loading are generally defined in terms of a large number of variables to characterize the plasticity and damage at material level. Over the past several years, many different studies have been presented on evaluation of fragility for reinforced concrete structures using nonlinear time history simulations. However, almost all of these studies do not consider uncertainties in the parameters of a comprehensive constitutive model. Part-I of this two-part manuscript presents a study that is used to identify uncertainties associated with the critical parameters in nonlinear concrete damage plasticity model proposed by Lubliner et al. (1989. Int. J. Solids Struct., 25(3), 299) and later modified by Lee and Fenves (1998a. J. Eng. Mech., ASCE, 124(8), 892) and Lee and Fenves (1998b. Earthquake Eng. Struct. Dyn., 27(9), 937) for the purpose of seismic fragility assessment. The limitations in implementation of the damage plasticity model within a finite element framework and

  18. First Person Past: American Autobiographies, Volume 2

    DEFF Research Database (Denmark)

    American literature, biography, Tunis Campbell, Black Elk, Andrew Carnegie, Booker T. Washington, Mary Antin, Mary Jones, Frederic Howe, Anna Howard Shaw, Woody Guthrie, Monica Sone, Anne Moody, Ron Kovic......American literature, biography, Tunis Campbell, Black Elk, Andrew Carnegie, Booker T. Washington, Mary Antin, Mary Jones, Frederic Howe, Anna Howard Shaw, Woody Guthrie, Monica Sone, Anne Moody, Ron Kovic...

  19. Institutional Support : Centre for Population and Environmental ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Chargé(e) de projet. Mr. Johnson E. Dudu. Chargé(e) de projet. Andrew G. Onokerhoraye. Chargé(e) de projet. Andrew G. Onokerhoraye. Institution. Centre for Population and Environmental Development. Pays d' institution. Nigeria. Site internet. http://www.cpedng.org. Contenus connexes. Bulletin de BRAS - juin 2017.

  20. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 9. Perkin's Mauve: The History of the Chemistry. Andrew Filarowski. Reflections Volume 15 Issue 9 September 2010 pp 850-855 ... Author Affiliations. Andrew Filarowski1. Technical Director of the Society of Dyers and Colorists, UK.

  1. High Impact Technology Compact Combustion (HITCC) Compact Core Technologies

    Science.gov (United States)

    2016-01-01

    were combusted in a vitiated stream. The molecular weight and hydrogen -to-carbon ratios of these fuels were measured by Princeton University [17...AFRL-RQ-WP-TR-2016-0010 HIGH IMPACT TECHNOLOGY COMPACT COMBUSTION (HITCC) COMPACT CORE TECHNOLOGIES Andrew W. Caswell Combustion ...ANDREW W. CASWELL CHARLES J. CROSS, Branch Chief Program Engineer Combustion Branch Combustion Branch Turbine Engine Division Turbine

  2. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Andrew Filarowski. Articles written in Resonance – Journal of Science Education. Volume 15 Issue 9 September 2010 pp 850-855 Reflections. Perkin's Mauve: The History of the Chemistry · Andrew Filarowski · More Details Fulltext PDF. Volume 16 Issue 12 ...

  3. 78 FR 52943 - Changes in Flood Hazard Determinations

    Science.gov (United States)

    2013-08-27

    ..., Department, 126 www.bakeraecom.com/ City of Dothan North St. index.php/alabama/ ,P.O. Box 2128, Andrews.../ City of Dothan, North St. index.php/alabama/ P.O. Box 2128, Andrews, Dothan, houston/. Dothan, AL 36302........ 010174 (13-04-2273P). Strange, Mayor, Department, 25 www.bakeraecom.com/ City of Washington index.php...

  4. Measures for Measures

    DEFF Research Database (Denmark)

    Jørgensen, Sune Lehman; A.D., Jackson; Lautrup, B.E.

    2006-01-01

    Are some ways of measuring scientific quality better than others? Sune Lehmann, Andrew D. Jackson and Benny E. Lautrup analyse the reliability of commonly used methods for comparing citation records.......Are some ways of measuring scientific quality better than others? Sune Lehmann, Andrew D. Jackson and Benny E. Lautrup analyse the reliability of commonly used methods for comparing citation records....

  5. Click-on-Knowledge: Web-Based Knowledge and Contemporary Scholarship,

    DEFF Research Database (Denmark)

    Jensen-Rix, Robert William; Lock, Charles; Miller, Andrew David

    2012-01-01

    Co-edited by Robert W. Rix, Andrew Miller and Charles Lock; produced by IT-Media, Faculty of Humanities, University of Copenhagen.......Co-edited by Robert W. Rix, Andrew Miller and Charles Lock; produced by IT-Media, Faculty of Humanities, University of Copenhagen....

  6. Guidelines for Hosted Payloads Integration Product Overview

    Science.gov (United States)

    2014-05-08

    Aerojet Carlo Abesamis abesamis@jpl.nasa.gov NASA Andrew Adams andrew.c.adams@boeing.com Boeing David Adcock adcock.david@orbital.com Orbital Robert...ULA Launch Shawn Cullen shawn.cullen@jdsu.com JDSU Louis D’Angelo louis.a.d’angelo@lmco.com Lockheed Martin David Davis David.Davis.3@us.af.mil SMC

  7. Mitrohhini arhiiv / Boris Merilain

    Index Scriptorium Estoniae

    Merilain, Boris

    2008-01-01

    KGB ohvitserist Vassili Mitrohhinist (1922-2004), tema arhiividest ja nende kohta ilmunud raamatutest: Andrew, Christopher. Mitrohhini arhiiv. [I], KGB Euroopas ja mujal läänemaailmas. Tallinn : Sinisukk, 2002 ; Andrew, Christopher. Mitrohhini arhiiv. II, KGB ja maailm. Tallinn : Sinisukk, 2007

  8. Designed Electroresponsive Biomaterials: Sequence-Controlled Behavior

    Science.gov (United States)

    2010-06-29

    Andrew Magyar 0.50 0.50FTE Equivalent: 1Total Number: Names of Post Doctorates PERCENT_SUPPORTEDNAME FTE Equivalent: Total Number: Names of Faculty...during this period: 0.00...... Names of Personnel receiving masters degrees NAME Total Number: Names of personnel receiving PHDs NAME Andrew Magyar

  9. Root Cause Investigation (RCI) Best Practices Guide Product Overview

    Science.gov (United States)

    2014-05-08

    micropac.com Andrew King Boeing andrew.m.king@boeing.com Byron Knight NRO knightby@nro.mil Hans Koenigsmann SpaceX hans.koenigsmann@spacex.com James Koory...ghislain.turgeon@sslmda.com Deborah Valley MIT deborah.valley@ll.mit.edu Fred Van Milligen JDSU fvanmilligen@jdsu.com Marvin VanderWeg SpaceX marvin.vanderwag

  10. From CERN to Entrepreneurship: we don't know what we don't know

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    Piero Zucchelli is founder and CEO of Andrew Alliance, a company specialising in novel liquid handling robots designed to enhance the reproducibility and efficiency of the pipetting process. Before founding Andrew Alliance, Piero was CTO of SpinX Technologies for 8 years and prior to that a staff member at CERN.    

  11. CQ No. 25

    African Journals Online (AJOL)

    2013-06-10

    Jun 10, 2013 ... RESPECT. Andrew Faull**. Andrew.faull@crim.ox.ac.uk. This paper presents preliminary reflections1on station-level discourse and practice in relation to violence and authority in two police precincts. The data were gathered during the six months following the Marikana massacre. The response of police ...

  12. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Andrew Granville. Articles written in Resonance – Journal of Science Education. Volume 3 Issue 3 March 1998 pp 71-72 Research News. International Team Shows that Primes Can Be Found in Surprising Places · Andrew Granville · More Details Fulltext PDF ...

  13. Soutien institutionnel au Centre for Population and Environmental ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Agent(e) responsable du CRDI. Sanogo, Diakalia. Financement total. CAD$ 1,812,500. Pays. Nigéria, Nord du Sahara, Sud du Sahara, Niger. Chargé(e) de projet. Mr. Johnson E. Dudu. Chargé(e) de projet. Andrew G. Onokerhoraye. Chargé(e) de projet. Andrew G. Onokerhoraye. Institution. Centre for Population and ...

  14. A Unified Approach to Abductive Inference

    Science.gov (United States)

    2014-09-30

    srikanth.doss@gmail.com) Netflix Qi Zhong (no longer at Netflix ) Yahoo Andrew Gelfand (agelfand@ics.uci.edu) Vibhor Rastogi (no longer...Srikanth Doss (srikanth.doss@gmail.com)  ● Netflix   ○ Qi Zhong (no longer at  Netflix )   ● Yahoo   ○ Andrew Gelfand (agelfand@ics.uci.edu

  15. CINRG: Infrastructure for Clinical Trials in Duchenne Dystrophy

    Science.gov (United States)

    2013-09-01

    National Med- ical Center: Robert Leshner, MD, Carolina Tesi - Rocha, MD; Royal Children’s Hospital: Andrew Korn- berg, MD, Monique Ryan, MD; Hadassah...Robert Leshner, MD, Carolina Tesi -Rocha, MD; Royal Children’s Hospital: Andrew Kornberg, MD, Monique Ryan, MD; Hadassah Hebrew University Hos- pital

  16. Understanding the photometric variability of ζ Ori Aa

    Science.gov (United States)

    Buysschaert, B.; Neiner, C.; Ramiaramanantsoa, T.; Richardson, N. D.; David-Uraz, A.; Moffat, A. F. J.

    2017-09-01

    We studied the variability of the magnetic O-type supergiant ζ Ori Aa using multi-colour BRITE photometry. We confirmed the known rotation frequency f_{rot} = 0.15 ± 0.02 c/d, and detected some of its higher harmonics, of which 4f_{rot} is compatible with the known DAC recurrence timescale. Thanks to simultaneous high-resolution CHIRON spectroscopy, we could identify another frequency f_{env} = 0.10 ± 0.02 c/d, caused by the circumstellar environment. Variations in the circumstellar environment are believed to cause the observed difference between the BRITE lightcurves. Based on data collected by the BRITE Constellation satellite mission, designed, built, launched, operated and supported by the Austrian Research Promotion Agency (FFG), the University of Vienna, the Technical University of Graz, the Canadian Space Agency (CSA), the University of Toronto Institute for Aerospace Studies (UTIAS), the Foundation for Polish Science & Technology (FNiTP MNiSW), and National Science Centre (NCN). Based on CHIRON spectra collected under CNTAC proposal CN2015A-122.),

  17. Time, Cost, Information Seeking Skills and Format of Resources Present Barriers to Information Seeking by Primary Care Practitioners in a Research Environment. A review of: Andrews James E., Kevin A. Pearce, Carol Ireson, and Margaret M. Love. “Information‐Seeking Behaviors of Practitioners in a Primary Care Practice‐Based Research Network (PBRN.” Journal of the Medical Library Association 93.2 (Apr. 2005: 206‐12.

    Directory of Open Access Journals (Sweden)

    Martha Ingrid Preddie

    2007-09-01

    Full Text Available Objective – To determine the information seeking behaviors of primary care practitioners in order to inform future efforts towards the design of information services that would support quality inprimary care.Design – A cross‐sectional survey.Setting – A primary care practice based research network (PBRN of caregivers who serve a broad population while simultaneously studying and disseminating innovations aimed at improvements in quality, efficiency and/or safety of primaryhealth care in the United States.Subjects – All primary care practitioners in the PBRN including family practitioners, general practitioners, nurse practitioners and physician assistants.Methods – A questionnaire comprising twenty‐six questions was distributed to 116 practitioners. Practitioners attached to academic centres (who were also members of the PBRN were excluded in order “to achieve a sample of practices more representative of the primary care practising population” (208. Descriptive data were collected and analyzed. SPSS v11.5 was used for statistical analyses.Main results – There was a response rate of 51% (59 of 116. Fifty‐eight percent of the respondents stated that they sought information (excluding drug dosing or drug interactions information to support patient care several times a week. Sixty‐eight per cent sought this information while the patient waited. Almost half of therespondents had access to a small medical library (48% or a hospital library (46%, while 21% used a university medical library.Approximately 14% had no immediate access to a medical library. Almost 60% of practitioners stated that they had an e‐mail account. Thirty‐four percent agreed that the use of e‐mail to communicate with patients enhanced medical practice, while 24% disagreed. There was frequent prescribing of Internet‐based consumer health information to patients by only 16% of the practitioners, while Internet support groups were frequently recommended by 5%. Themain barriers to information seeking were lack of time (76%, cost (33%, information seeking skills (25%, and format of information sources (22%. The use of EBM resources was fairly low, while there was a high preference for ready reference and interpersonal sources. When compared with print information resources, the use ofonline resources was moderate. A significant correlation was found between use of online sources and use of print sources, namely, that practitioners who used online sources more frequently, also soughtinformation from print sources more frequently, with the inverse being true for those who sought information less frequently from either electronic or print sources.Conclusion – Primary care practitioners in this rural PBRN used print and interpersonal sources more than online sources. Practitioners who are more likely to use print sources are also more likely to seek online information. Librarians working in PBRN environments will need to identify interventions that address barriers such as time, cost, and information‐seeking skills.

  18. Feministid põõsas / Olev Remsu

    Index Scriptorium Estoniae

    Remsu, Olev, 1947-

    1996-01-01

    Feminismist seoses ameerika filmiga 'Striptiis' ("Striptease", re̓issöör Andrew Bergman, USA 1996). Vastukaja: Kivimaa, Katrin. Feminist tuleb põõsast välja // Eesti Päevaleht. - 1996. - 4. dets. - Lk. 7

  19. Various / Barry Witherden

    Index Scriptorium Estoniae

    Witherden, Barry

    1996-01-01

    Uuest heliplaadist "Various. John Keys (organ), Andrew Angus (bass). Vasari Singers / Jeremy Backhouse". EMI Eminence 7243 5 65 903 2. 74:09 DDD. Plaadil ka A. Pärdi "Summa", "The Beautitudes", "Seven Magnificat Antiphons"

  20. Tanzania Journal of Forestry and Nature Conservation - Vol 77, No 1

    African Journals Online (AJOL)

    The Role Of Urban Forestry In Mitigating Climate Change And Performing Environmental Services In Tanzania · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. PK Munishi, M Mhagama, R Muheto, SM Andrew, 25-34 ...

  1. 2. Home 3. Journals 4. Resonance–Journal of Science Education 5 ...

    Indian Academy of Sciences (India)

    IAS Admin

    . GENERALARTICLES. 1077 Early Developments in Crystallography. Shekhar Mande. 1087 Why do We Trust X-ray Crystallography? Andrew D Bond. 1093 Crystallography and Drug Design. K Suguna. 1104 The Art of in situ ...

  2. What Does Syria Want? A Presentation by Raymond Hinnebusch for the Center for Naval Analyses and the Forum du Futur (France)

    National Research Council Canada - National Science Library

    Hinnebusch, Raymond

    2008-01-01

    The distinguished American academic Raymond Hinnebusch, Director of the Centre for Syrian Studies and Professor of International Relations and Middle East Politics at the University of St. Andrews (UK...

  3. 75 FR 69080 - Federal Management Regulation; FMR Bulletin PBS-2010-B5; Redesignations of Federal Buildings

    Science.gov (United States)

    2010-11-10

    ... follows: Former Name Federal Building 1220 Echelon Parkway Jackson, MS 39213 New Name James Chaney, Andrew Goodman, Michael Schwerner, and Roy K. Moore Federal Building 1220 Echelon Parkway Jackson, MS 39213 5...

  4. Fulltext PDF

    Indian Academy of Sciences (India)

    Sensitized Solar Cells: Recent Developments. N Sekar and Vishal Y Gehlot. Reproduced with permission: Society of Dyers and. Colourists, UK ... Perkin's Mauve: The History of the Chemistry. Andrew Filarowski. Information & Announcements.

  5. Seiklused kapitaguses maailmas / Karin Hansson

    Index Scriptorium Estoniae

    Hansson, Karin

    2007-01-01

    C.S. Lewise 1950.a. ilmunud romaani järgi "Narnia lood : Lõvi, nõid ja riidekapp" ("Chronicles of Narnia : The Lion, the Witch and the Wardrobe") valminud Andrew Adamsoni samanimelisest mängufilmist

  6. Algkoolilastega kinno!

    Index Scriptorium Estoniae

    2008-01-01

    Lühike arvustus järjefilmile "Narnia lood : prints Caspian" ("The Chronicles of Narnia : Prince Caspian") C.S. Lewise muinasjutu ainetel : režissöör Andrew Adamson : Ameerika Ühendriigid - Suurbritannia 2008

  7. Pop / Tristan Priimägi

    Index Scriptorium Estoniae

    Priimägi, Tristan, 1976-

    2007-01-01

    Heliplaatidest: Rufus Wainwright "Release The Stars", Poiskõsõ "Tii päält iist!", Mice Parade "Mice Parade", John Martyn "BBC Live In Concert", Feedle "Leave Now for Adventure", Korpi Ensemble "Trails", Michael Andrews "Hand On String"

  8. Narnia 1300 aastat hiljem / Timo Diener

    Index Scriptorium Estoniae

    Diener, Timo

    2008-01-01

    Mängufilm "Narnia lood : prints Caspian" ("The Chronicles of Narnia : Prince Caspian") C.S. Lewise muinasjutu ainetel : peaosas Ben Barnes : režissöör Andrew Adamson : Ameerika Ühendriigid - Suurbritannia 2008

  9. Fulltext PDF

    Indian Academy of Sciences (India)

    Unknown

    , St. Andrews. R Medhamurthy, Bangalore. DeForest Mellon, Charlottesville. P K Mohanty, New Delhi. Arundhati Mukhopadhyay, New Delhi. K Muniyappa, Bangalore. K S Murali, Bangalore. R Nagaraja, Hyderabad. V Nagaraja, Bangalore.

  10. Exploring the Uses of RNAi — Gene Knockdown and the Nobel Prize

    NARCIS (Netherlands)

    Bernards, R.A.

    2006-01-01

    The Nobel Prize in Physiology or Medicine was awarded this year to Andrew Fire (Stanford University School of Medicine) and Craig Mello (University of Massachusetts Medical School) for their discovery of a new form of gene silencing.

  11. 76 FR 12137 - Entergy Operations, Inc. Waterford Steam Electric Station, Unit 3 Exemption

    Science.gov (United States)

    2011-03-04

    ... (ADAMS Accession No. ML083450028); NRC Information Notice 93-53, ``Effect of Hurricane Andrew on Turkey.... ML031070364); NRC Information Notice 93-53, Supplement 1, ``Effect of Hurricane [[Page 12138

  12. Open access to large scale datasets is needed to translate knowledge of cancer heterogeneity into better patient outcomes.

    Directory of Open Access Journals (Sweden)

    Andrew H Beck

    2015-02-01

    Full Text Available In this guest editorial, Andrew Beck discusses the importance of open access to big data for translating knowledge of cancer heterogeneity into better outcomes for cancer patients.

  13. 76 FR 54767 - Environmental Impact Statements; Notice of Availability

    Science.gov (United States)

    2011-09-02

    ... Delivery of Water, City of Logan, Cache County, UT, Review Period Ends: 10/03/2011, Contact: Bronson Smart... Facility, City of White Salmon, Skamania County, WA, Review Period Ends: 10/03/ 2011, Contact: Andrew M...

  14. When will Summer Arctic Sea Ice Disappear?

    OpenAIRE

    Maslowski, Wieslaw

    2008-01-01

    Collaborators: Jaclyn Clement Kinney, Andrew Miller, Terry McNamara , John Whelan - Naval Postgraduate School Jay Zwally - NASA / GSFC Jaromir Jakacki, Waldemar Walczowski - Institute of Oceanology, PAS Agnieszka Beszczynska-Möller - AWI Ron Kwok - NASA / JPL Marika Holland - NCAR

  15. Kas müürilill prooviruumi nurgas või kardetud politseinik? / Maris Peters

    Index Scriptorium Estoniae

    Peters, Maris

    2008-01-01

    Andrew James Hartley raamatust "The Shakespearean dramaturg: a theoretical and practical guide" (2005). Raamat annab ülevaate dramaturgi võimalikest tööülesannetest, dramaturgia teoreetilisetest põhimõtetest ja praktilisest osast

  16. Paranoiline ellujääja / Vello Rääk

    Index Scriptorium Estoniae

    Rääk, Vello

    2004-01-01

    Ungari emigrandist USA juhtimisguruks tõusnud Andras Grofi alias Andrew S. Grove'i elust ja karjäärist, juhtimispõhimõtteist ning olulisematest saavutustest maailma suurima mikroprotsessorite tootja Intel eesotsas. Vt. samas: Intelis tormilised ajad

  17. UCMR3 data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Zipped UCMR3 data. This dataset is associated with the following publication: HU, X., D. Andrews, T. Bruton, A. Lindstrom, L. Schaider, P. Grandjean, R. Lohmann, C....

  18. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Andrew Das Arulsamy1 2. School of Physics, The University of Sydney, Sydney, New South Wales 2006, Australia; Jožef Stefan Institute, Jamova Cesta 39, SI-1000 Ljubljana, Slovenia ...

  19. Sõjaväeeksootika jäi omaette / Anneli Remme

    Index Scriptorium Estoniae

    Remme, Anneli, 1968-

    1999-01-01

    West End Musicals ja Eesti Riiklik Sümfooniaorkester, Oratooriumikoor ja Urmas Lattikase ansambel esitamas Andrew Lloyd Webberi ja Leonard Bernsteini laule muusikalidest Paldiski Sõjaväebaasi riviväljakul 29. augustil

  20. Applying Just-In-Time to Army Operations

    National Research Council Canada - National Science Library

    Walden, Joseph

    2000-01-01

    .... These requirements include Stability and Support Operations in locations such as Somalia and Rwanda, disaster support for Hurricane Andrew and the Northridge earthquake, and support to forces in Bosnia and Kosovo...

  1. Improving the U.S. Military's Response to Homeland Humanitarian Assistance Operations

    National Research Council Canada - National Science Library

    O'Brien, Joseph

    2006-01-01

    ...) in support of over-tasked state and local agencies. Hurricanes Andrew and Katrina highlighted the limitations of the current ad-hoc based approach to dealing with these disasters in the United States...

  2. Aiming high but keeping costs low.

    Science.gov (United States)

    Hough, Steve; Nicholls, Andrew

    2010-04-01

    Steve Hough, national sales manager, CEP Claddings, and Andrew Nicholls, sales director, CEP Ceilings, explain how modern cladding and ceiling materials can enhance the appearance of modern hospital buildings while offering practical, cost-saving, and environmental advantages.

  3. Londonis annavad tooni "Ooperifantoom" ja tsirkus / Erkki Otsman

    Index Scriptorium Estoniae

    Otsman, Erkki, 1966-

    2007-01-01

    Eesti kabareeartist Erkki Otsman külastas Euroopa muusikalipealinna Londonit ja vaatas ära juba 20 aastat laval püsinud Andrew Lloyd Webberi "Ooperifantoomi" ning Montreali tsirkusetrupi Cirque du Soleil etenduse Royal Albert Hallis

  4. Pop / Tõnu Kaalep

    Index Scriptorium Estoniae

    Kaalep, Tõnu, 1966-

    2003-01-01

    Heliplaatidest: Mihkel Kleis "Quest For Fire/Visit To Minotaur", Andrew W. K. "The Wolf",Client "Client", Bubba Sparxxx "Deliverance", Yes "The Ultimate Yes - 35th Anniversary Collection", Joseph Suchy "calabi.yau", Luomo "Present Lover"

  5. KCA Journal of Business Management - Vol 5, No 1 (2013)

    African Journals Online (AJOL)

    Exploring the Opportunities and Challenges of Network Formation for Cooperatives in South Africa · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Andrew Emmanuel Okem, Ralph Lawrence, 16-33 ...

  6. Mentoring in Medicine | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... version of this page please turn Javascript on. Mentoring In Medicine Past Issues / Summer 2013 Table of ... Hardin, Montana, got hands-on healthcare experience through Mentoring in Medicine (MIM). At front is Andrew Morrison, ...

  7. The New York Review of Books : (1998, 14. mai), nr. 8 : [ülevaade] / vahendanud Anne Lange

    Index Scriptorium Estoniae

    1998-01-01

    Ka John Keatsi käsitlusest: Nicholase Roe' 'John Keats and the culture of dissent' ja Andrew Motioni 'Keats : a biography'; Nadine Gordimer romaanist 'The house of gun'; Franz Kafka 'Lossi' uustõlkest inglise keelde

  8. 76 FR 17400 - Proposed Priorities: Interventions To Promote Community Living Among Individuals With Disabilities

    Science.gov (United States)

    2011-03-29

    ... . Parish, S, Rose, R, & Andrews, M. (2009). Income Poverty and Material Hardship among US Women with....iqsolutions.com/2020/topicsobjectives2020/overview.aspx?topicid=9 . White, G, Simpson, J, Gonda, C, Coble, Z...

  9. Maass waveforms arising from sigma and related indefinite theta functions

    OpenAIRE

    Zwegers, Sander

    2010-01-01

    In this paper we consider an example of a Maass waveform which was constructed by Cohen from a function $\\sigma$, studied by Andrews, Dyson and Hickerson, and it's companion $\\sigma^*$. We put this example in a more general framework.

  10. Responses to disasters, natural and man-made, and interventions with social supports.

    Science.gov (United States)

    1994-08-01

    This volume focuses on the effects of a range of traumatic events: a natural disaster (Hurricane Andrew), working with the dead (dental identification of bodies following the Mt. Carmel conflagration), and the trauma attendant to the diagnosis of a l...

  11. Kaks meremaali New Yorgi Eesti Majas / Olga Paris Berendsen

    Index Scriptorium Estoniae

    Berendsen, Olga, 1916-2003

    1980-01-01

    Artiklis on kirjeldatud kahte New Yorgi Eesti Haridusseltsile kuuluvat maali, mis restaureeriti 1979. a ja eksponeeritakse Eesti Maja ruumides. Antakse ülevaade ka Andrew Winteri ja Amandus Adamsoni elust ja loomingust

  12. The African Women's Protocol: bringing attention to reproductive rights and the MDGs.

    Directory of Open Access Journals (Sweden)

    Liesl Gerntholtz

    2011-04-01

    Full Text Available Andrew Gibbs and colleagues discuss the African Women's Protocol, a framework for ensuring reproductive rights are supported throughout the continent and for supporting interventions to improve women's reproductive health, including the MDGs.

  13. The African Women's Protocol: bringing attention to reproductive rights and the MDGs.

    Science.gov (United States)

    Gerntholtz, Liesl; Gibbs, Andrew; Willan, Samantha

    2011-04-01

    Andrew Gibbs and colleagues discuss the African Women's Protocol, a framework for ensuring reproductive rights are supported throughout the continent and for supporting interventions to improve women's reproductive health, including the MDGs.

  14. Paremad filmid 6 : Põrgulik amet / Jaanus Noormets

    Index Scriptorium Estoniae

    Noormets, Jaanus

    2006-01-01

    Hongkongi põnevusfilm "Põrgulik amet" ("Mou gaan dou") : režissöörid Andrew Lau, Alan Mak : 2002. Film on aluseks Martin Scorsese uuele filmile "Kahe tule vahel" ("The Departed"). Lisa "Originaali tegija kiitis uut filmi"

  15. Visuaalne uurimus ja uued jutustusviisid graafikas = Visual Analysis and a New Means of Narration in the Graphic Arts / Martin Rünk

    Index Scriptorium Estoniae

    Rünk, Martin, 1982-

    2011-01-01

    Tallinna XV graafikatriennaal "Armastuse, mitte raha pärast" Kumu Kunstimuuseumis. Peapreemia Edmunds Jansonsi tööle "Väikese linnukese päevik". Andrew Raftery suureformaadilistest vasegravüüridest

  16. USA paneb välisabi kaitsma oma huve maailmas / Markus Larsson

    Index Scriptorium Estoniae

    Larsson, Markus

    2003-01-01

    USA valitsuse raporti kohaselt tuleb riigi välisabiprogramme hakata kohandama nii, et need oleksid suunatud USA rahvuslike huvide kaitsele ning vabaduse ja julgeoleku laiendamisele kogu maailmas. USAID juhataja Andrew Natsiose seisukohti

  17. Primer registro de Coccidae (Hemiptera: Coccoidea sobre Duchesnea indica (Rosaceae “frutilla silvestre” en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Patri GONZÁLEZ

    2015-01-01

    Full Text Available Se da a conocer el primer registro de la Argentina y el mundo del Coccidae Saissetia coffeae (Walker sobre Duchesnea indica (Andrews Focke, frutilla silvestre relacionada con frutilla cultivada (Fragaria x ananassa Duch.

  18. Incontinentia pigmenti

    Science.gov (United States)

    ... Because the gene defect occurs on the X chromosome, the condition is most often seen in females. ... WD, Berger TG, Elston DM. Genodermatoses and congenital anomalies. James WD, Berger TG, Elston DM, eds. Andrews' ...

  19. Multfilm "V poiskah Nemo" delajet detei ubiitsami rõbok

    Index Scriptorium Estoniae

    2004-01-01

    Animafilm "Kalapoeg Nemo" : režissöör Andrew Stanton : Ameerika Ühendriigid 2003. Filmi vaatamise järgselt on tuhanded lapsed lasknud oma akvaariumikalad vabadusse, põhjustades sellega nende huku või keskkonnaprobleeme

  20. Puitpilvelõhkuja on valmis!

    Index Scriptorium Estoniae

    2008-01-01

    Üheksakorruseline ristkihtpuitpaneelidest korterelamu Londonis. Arhitektid: Sophie Goldhill, Chris Gray, Kristen Haggart, Andrew Waugh arhitektuuribüroost Waugh Thistleton. Konstruktorid: Megan Yates, Matthew Linegar, Bruno Dujič. Ristlamineeritud puitpaneelid valmistas Austria firma KLH

  1. Tuna & täna / Mati Soomre

    Index Scriptorium Estoniae

    Soomre, Mati, 1944-2015

    2007-01-01

    1981 esietendus Londonis New Londoni teatris Andrew Lloyd Webberi muusikal "Kassid" Viimane, 8950. etendus oli 11. mail 2002, lavastuse 21. sünnipäeval. Kokku nägi seda lavastust 8 miljonit inimest

  2. Jewish community indignant over press, legislation

    Index Scriptorium Estoniae

    2005-01-01

    Ameerika Juudikomitee rahvusvaheliste küsimuste direktor Andrew Baker avaldas pahameelt, et prokuratuur lõpetas uurimise Leedu päevalehe antisemitistlike artiklite suhtes. Leedu juudi kogukond esitas valitsusele nimekirja ehitistest, mille tagastamist nad soovivad

  3. Contrasting phytoplankton community structure and associated light absorption characteristics of the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Pandi, S.R.; Kiran, R.; Sarma, N.S.; Srikanth, A.S.; Sarma, V.V.S.S.; Krishna, M.S.; Bandyopadhyay, D.; Prasad, V.R.; Acharyya, T.; Reddy, K.G.

    improved the manuscript. Financial assistance from INCOIS (INCOIS/093/2007), and further financial assistance from CSIR (21(0802)/10/EMR-II) are gratefully acknowledged. References Andrew AA, Del Vicchio R, Subramaniam A, Blough NV (2013...

  4. Anemia in the Newborn

    Science.gov (United States)

    ... Overview of Biliary Atresia Additional Content Medical News Anemia in the Newborn By Andrew W. Walter, MS ... for the Professional Version Blood Problems in Newborns Anemia in the Newborn Hemolytic Disease of the Newborn ...

  5. Surge ammonium uptake in macroalgae from a coral atoll

    Digital Repository Service at National Institute of Oceanography (India)

    Raikar, V.; Wafar, M.V.M.

    autotrophs would have to depend on sources such as upwelling near the reef (Andrews and Gentien, 1982), endogenous upwelling within the reef frame (Rougerie and Wauthy, 1993), ground water seepage (Naim, 1993) and regeneration in sediments (Williams et al...

  6. SHORT COMMUNICATION

    African Journals Online (AJOL)

    PROF P.T. KAYE

    . SHORT COMMUNICATION. Formation and Structural Analysis of Novel Dibornyl Ethers. Perry T. Kaye*, Andrew R. Duggan, Joseph M. Matjila, Warner E. Molema, and. Swarnam S. Ravindran. Department of Chemistry, Rhodes University, Grahamstown, ...

  7. Inflation, financial development and human capital-based endogenous growth: an explanation of ten empirical findings

    Czech Academy of Sciences Publication Activity Database

    Gillman, M.; Kejak, Michal

    -, CDMC07/03 (2007), s. 1-31 Institutional research plan: CEZ:AV0Z70850503 Keywords : inflation * financial development * growth Subject RIV: AH - Economics http://www.st-andrews.ac.uk/economics/CDMA/papers/cp0703.pdf

  8. Allergy and allergic diseases

    National Research Council Canada - National Science Library

    Kay, A. B

    2008-01-01

    ... and Other Tolerogenic Mechanisms in Allergy and Asthma, 83 Catherine Hawrylowicz and Cezmi A. Akdis 5 IgE and IgE Receptors, 103 Brian J. Sutton, Andrew J. Beavil, Rebecca L. Beavil and James Hunt...

  9. 78 FR 32367 - Foreign-Trade Zone 146-Lawrence County, Illinois; Application for Reorganization and Expansion...

    Science.gov (United States)

    2013-05-30

    ... grantee's proposed service area under the ASF would be Clay, Crawford, Edwards, Hamilton, Lawrence... (202) 482-0473. Dated: May 20, 2013. Andrew McGilvray, Executive Secretary. BILLING CODE 3510-DS-P ...

  10. Quality factor of aberrated gaussian laser beams

    CSIR Research Space (South Africa)

    Mafusire, C

    2010-09-01

    Full Text Available Optics research team! Opportunities: MSc and PhD studentships, Post docs and Sabbaticals Contact: Prof Andrew Forbes or Dr Stef Roux www.csir.co.za/lasers/index_mathematical_optics.html ...

  11. Fundamentals of Combinatorial Optimization and Algorithms Design: December Report

    National Research Council Canada - National Science Library

    Shepherd, F. B

    2005-01-01

    ... special issue devoted to selected papers in FOCS 2005. A summer intern was hosted, Andrew McGregor from UPenn, who worked with Shepherd on recognizing Hilbert Bases and other theoretical topics in Math Programming...

  12. Pärt: Berliner Messe / Rob Cowan

    Index Scriptorium Estoniae

    Cowan, Rob

    1998-01-01

    Uuest heliplaadist "Pärt: Berliner Messe. The Beatitudes. Annum per Annum. Magnificat. Seven Magnificat Antiphons. De profundis. Polyphony / Steven Layton with Andrew Lucas" Hyperion CDA66960 (74 minutes:DDD)

  13. Re-use of seedling containers and Fusarium circinatum association ...

    African Journals Online (AJOL)

    Re-use of seedling containers and Fusarium circinatum association with asymptomatic Pinus patula planting stock. Andrew R Morris, Gerda Fourie, Izette Greyling, Emma T Steenkamp, Nicoletta B Jones ...

  14. African Journal of AIDS Research - Vol 13, No 3 (2014)

    African Journals Online (AJOL)

    Developing and implementing global gender policy to reduce HIV and AIDS in low- and middle -income countries: Policy makers' perspectives · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Shannon Olinyk, Andrew Gibbs, Catherine Campbell.

  15. 2015 USACE NAE Topobathy Lidar DEM: Massachusetts

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These data were collected for the USACE New England District (NAE). The data set is made up of 21 small projects in Massachusetts. These projects are: Andrews River,...

  16. Performance of chicken broilers fed with diets substituted with ...

    African Journals Online (AJOL)

    Performance of chicken broilers fed with diets substituted with mulberry leaf powder. Carlina Freddie Simol, Andrew Alek Tuen, Humrawali Hazid Ahmad Khan, John Keen Chubo, Patricia Jie Hung King, Kian Huat Ong ...

  17. The Roswell Report: Fact versus Fiction in the New Mexico Desert

    National Research Council Canada - National Science Library

    Weaver, Richard

    1995-01-01

    ...). It was written as a result of Colonel Weaver's and Lieutenant McAndrew's efforts to locate the records that explain the events of July 1947 leading to what is popularly known as the Roswell Incident...

  18. Understanding Cancer Prognosis

    Medline Plus

    Full Text Available ... doctor to give you an accurate prognosis. Understanding the Difference Between Cure and Remission Cure means that ... about her colorectal cancer prognosis. Diving Out of the Dark View this video on YouTube. Andrew wants ...

  19. Preliminary wave and hydrostatic pressure data collected from moored directional wave gauges in the Gulf of Mexico as part of the LATEX project from 19920825 to 19920826 (NODC Accession 9400018)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data is a special submission to NODC containing wave data during Hurricane Andrew August 25-26, 1992. This data file contains 24 bursts spaced at 2 hour...

  20. Autumn MIST 2009

    Science.gov (United States)

    Forsyth, Colin

    2010-02-01

    MEETING REPORT Colin Forsyth, Nicola Longden, Andrew Walsh and Robert Wicks summarize a MIST meeting where ground-based ionospheric science came under the spotlight, amid the broader concerns of the MIST community.

  1. The (nano) entrepreneur's dilemma

    Science.gov (United States)

    Maynard, Andrew D.

    2015-03-01

    Emerging technologies need to be developed responsibly if their benefits are to outweigh any potential risks. Yet do entrepreneurs really have the luxury of grappling with future consequences from the get-go, asks Andrew D. Maynard.

  2. Optical delivery of ARV drugs into HIV-1 permissive cells

    CSIR Research Space (South Africa)

    Khanyile, T

    2013-10-01

    Full Text Available into HIV-1 permissive cells Thulile Khanyile1,2, Maria Papathanasopoulos2, Andrew Forbes1 and Patience Mthunzi1* 1. National Laser Centre, Council for Scientific and Industrial Research, PO Box 395, Pretoria, 0001, South Africa 2. HIV Pathogenesis... perspectives Dr Patience Mthunzi (NLC-CSIR) Prof Maria Papathanasopoulos (Wits) Prof Andrew Forbes (NLC-CSIR) Dr Hazel Mufhandu (Biosciences – CSIR) Dr Dalu Ncama (Biosciences – CSIR) Acknowledgements Thank you ...

  3. Validity and Usefulness of Enlistment Intention Information

    Science.gov (United States)

    1992-01-01

    Series of Cross Sections Model, RAND, R-3252-FMP, July 1986. Davidson, Andrew R., and James J. Jaccard , "Population Psychology: A New Look at an Old...1985. Jaccard , James , and Andrew R. Davidson, "A Comparison of Two Models of Social Behavior: Results of a Survey Sample," Soci- ometry, Vol. 38, No...S. James Press, The Enlist- ment Bonus Experiment, RAND, R-3353-FMP, April 1986. Pomazal, Richard J., and James J. Jaccard , "An Informational

  4. Population Density Modeling Tool

    Science.gov (United States)

    2012-06-26

    194 POPULATION DENSITY MODELING TOOL by Davy Andrew Michael Knott David Burke 26 June 2012 Distribution...MARYLAND NAWCADPAX/TR-2012/194 26 June 2012 POPULATION DENSITY MODELING TOOL by Davy Andrew Michael Knott David Burke...information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE 26

  5. Eesti noored tulid harrastusfilmide festivalilt kolme karva medalitega / Kaarel Kressa

    Index Scriptorium Estoniae

    Kressa, Kaarel, 1983-

    2010-01-01

    Šveitsis Einsiedelnis toimunud 72. rahvusvahelisel sõltumatute filmide festivalil UNICA võitis kuldmedali Andrew Bond Balti Filmi- ja Meediakoolist lühimängufilmiga "Vene suurus", hõbemedali Vallo Toomla Balti Filmi- ja Meediakoolist lühimängufilmiga "Koolja" ja pronksmedali Katre Haav Eesti Kunstiakadeemiast animafilmiga "Valel poolel". Riikide arvestuses saavutas Eesti filmikava teise koha. 2011. a. ekraanile jõudvast Andrew Bondi lühifilmist "Legend vägevast seebist"

  6. Feasibility of Underwater Friction Stir Welding of Hardenable Alloy Steel

    Science.gov (United States)

    2010-12-01

    Base Material CNC – Computer Numerical Controlled EDM – Electrical Discharge Machining FSP – Friction Stir Processing FSW – Friction Stir Welding...emission spectroscopy according to ASTM E 1097-07. C. MICROSTRUCTURE ANALYSIS 1. Specimen Preparation A Charmilles Andrew EF630 CNC Wire EDM...Andrew EF630 CNC Wire EDM system. The shape and dimensions of these specimens are shown in Figure 5. The thickness of each specimen varied from 1.0

  7. Shaping the U.S. Military for the Global Security Environment of the Year 2000

    Science.gov (United States)

    1990-11-19

    Strategy. Andrew W. Marshall and Charles Wolf , Chairmen, (Washington, DC: USGPO, 1988). 3The GLOBUS Research Group, Berlin Scientific Center for Social...Social-Political Structures in the Iberian World. Edited by Fredrick B. Pike and Thomas Stritch. London & Notre Dame: University of Notre Dame Press...Environment. Report of the Future Security Environment Working Group. Andrew W. Marshall and Charles Wolf , Chairmen. Washington, DC: USGPO, 1988

  8. The Impact of Resource Wealth On Economic Growth, Governance, and Conflict in Afghanistan

    Science.gov (United States)

    2013-09-01

    game is already on to exploit the nation’s buried wealth. Both 2 Jeffrey D. Sachs and Andrew M. Warner... Jeffrey D. Sachs and Andrew M. Warner, where evidence showed slow growth rates between 1971–1989 for countries possessing high ratios of primary...15 Ibid., 332. 16 Macartan Humphreys, Jeffrey D. Sachs , and Joseph E. Stiglitz, eds, Escaping the Resource Curse. (New York: Columbia University

  9. Mokhtar Belmokhtar: One-Eyed Firebrand of North Africa and the Sahel

    Science.gov (United States)

    2015-02-01

    Mokhtar Belmokhtar: One-Eyed Firebrand of North Africa and the Sahel Author: Andrew Wojtanik Jihadi Bios Project Editor: Nelly Lahoud Report...REPORT TYPE 3. DATES COVERED 00-00-2015 to 00-00-2015 4. TITLE AND SUBTITLE Mokhtar Belmokhtar: One-Eyed Firebrand of North Africa and the Sahel ...Eyed Firebrand of North Africa and the Sahel By Andrew Wojtanik The views expressed in this report are the author’s and do not

  10. Afghanistan’s Local War: Building Local Defense Forces

    Science.gov (United States)

    2010-01-01

    James Dobbins, Seth G. Jones, Keith Crane, Andrew Rathmell, Brett Steele, Richard Teltschik, and Anga R. Timilsina, The UN’s Role in Nation-Building...Movements of Money,” in Jeanne K. Giraldo and Harold A. Trinkunas, eds., Terrorism Financing and State Responses: A Comparative Perspective, Stan- ford...Jones, Keith Crane, Andrew Rathmell, Brett Steele, Richard Teltschik, and Anga R. Timilsina, The UN’s Role in Nation-Building: From the Congo to Iraq

  11. Effect of Prazosin and Naltrexone on Script Induced Alcohol Craving in Veterans with Alcohol Use Disorders with and without Co-Occurring PTSD

    Science.gov (United States)

    2016-01-01

    of DoD initiated changes, and ultimately permission to enroll participants, on 10/16/14. The late 2015 beginning of our enrollment, coupled with a...PI Name: Andrew Saxon , MD Project Role: Co-PI Nearest person month worked: 1.2 Contribution: PI Name: Robert Lyons Project...Tracy Simpson, PhD / Andrew Saxon , MD Org: Seattle Institute for Biomedical and Clinical Research Award Amount: $802,000 Approach Recently

  12. Cyberspace Warfare: A New DoD Core Mission Area

    Science.gov (United States)

    2013-05-01

    7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION Joint Forces Staff College REPORT NUMBER Joint Advanced Warfighting...According to Andrew F. Krepinevich cyberspace warfare is defined as: The actions by nation-states and non-state actors to penetrate computers or... actors conducting cyberspace operations in, through, and from cyberspace as a 1 Andrew F. Krepinevich, “Cyber Warfare: A Nuclear Option,” Center for

  13. Environmental Conditions in Coastal Waters Near Panama City, Florida

    Science.gov (United States)

    1978-08-01

    GRANT NUMBER(*) G. G.Salsman sA A. J./Ciesluk 1. PERFORMING ORGANIZATION NAME AND ADDRESS 10. PROGR. ELEENT. PROJECT, TASK AREA &RL UN IT NUMBERS...waters Tidal currents Biofouling Environmental measurement techniques St. Andrew Bay Marine biology Environmental data Gulf of Mexico Seasonal...and bottom characteristics of the nearby Gulf of Mexico and St. Andrew Bay, as well as descriptions of local weather phenomena, wave action, tides

  14. Orienteering Club

    CERN Multimedia

    Club d'orientation

    2010-01-01

    COURSE D’ORIENTATION La finale de la coupe de printemps Après avoir remporté le challenge club, samedi 29 juin lors du relais inter-club à Lausanne, le Club d’orientation du CERN organisait la dernière étape de la coupe genevoise de printemps samedi 5 juin à Saint-Cergue dans les bois de Monteret (Canton de Vaud). Plus de 100 participants se sont déplacés pour venir participer à la finale et découvrir une toute nouvelle carte dans une forêt vallonnée. Les résultats pour chaque circuit de cette étape sont : Technique long : 1. Jurg Niggli du club O’Jura, 2. Clément Poncet, 3. Oystein Midttun. Technique moyen : 1. Zoltan Trocsanyi CO CERN, 2. Christophe Ingold, 3. Christina Falga. Technique court : 1. Pierre-Andre Baum, CARE Vevey, 2. Emese Szunyog, 3. Solène Balay. Facile moyen : 1. Elisa P...

  15. Dynamic Load Balancing Strategies for Parallel Reacting Flow Simulations

    Science.gov (United States)

    Pisciuneri, Patrick; Meneses, Esteban; Givi, Peyman

    2014-11-01

    Load balancing in parallel computing aims at distributing the work as evenly as possible among the processors. This is a critical issue in the performance of parallel, time accurate, flow simulators. The constraint of time accuracy requires that all processes must be finished with their calculation for a given time step before any process can begin calculation of the next time step. Thus, an irregularly balanced compute load will result in idle time for many processes for each iteration and thus increased walltimes for calculations. Two existing, dynamic load balancing approaches are applied to the simplified case of a partially stirred reactor for methane combustion. The first is Zoltan, a parallel partitioning, load balancing, and data management library developed at the Sandia National Laboratories. The second is Charm++, which is its own machine independent parallel programming system developed at the University of Illinois at Urbana-Champaign. The performance of these two approaches is compared, and the prospects for their application to full 3D, reacting flow solvers is assessed.

  16. The Dark Side of Addiction: The Horsley Gantt to Joseph Brady Connection.

    Science.gov (United States)

    Koob, George F

    2017-04-01

    W. Horsley Gantt and Joseph V. Brady laid a rich foundation for understanding the concept of emotion, derived from 2 prominent traditions of physiology and psychology: classic conditioning and operant conditioning, respectively. This framework guided my fierce interest in motivation in general and the interaction between reward and stress, which began at John Hopkins with my thesis work under the guidance of Drs. Zoltan Annau, Solomon Synder, and Joseph Brady, among many others. Using the study of the neurobiology of addiction as a framework, I argue that drug addiction not only involves positive reinforcement associated with the rewarding effects of drugs of abuse but also involves another major source of reinforcement, specifically negative reinforcement driven by negative emotional states (termed the "dark side" of addiction). Excessive activation of the brain reward systems leads to antireward or a decrease in the function of normal reward-related neurocircuitry and persistent recruitment of the brain stress systems, both of which may be neurobiologically linked. Understanding the neuroplasticity of the neurocircuitry that comprises the negative reinforcement associated with addiction is a key to understanding negative emotional states in general and their pathophysiology.

  17. Maternal hurricane exposure and fetal distress risk.

    Science.gov (United States)

    Zahran, Sammy; Snodgrass, Jeffrey G; Peek, Lori; Weiler, Stephan

    2010-10-01

    Logistic regression and spatial analytic techniques are used to model fetal distress risk as a function of maternal exposure to Hurricane Andrew. First, monthly time series compare the proportion of infants born distressed in hurricane affected and unaffected areas. Second, resident births are analyzed in Miami-Dade and Broward counties, before, during, and after Hurricane Andrew. Third, resident births are analyzed in all Florida locales with 100,000 or more persons, comparing exposed and unexposed gravid females. Fourth, resident births are analyzed along Hurricane Andrew's path from southern Florida to northeast Mississippi. Results show that fetal distress risk increases significantly with maternal exposure to Hurricane Andrew in second and third trimesters, adjusting for known risk factors. Distress risk also correlates with the destructive path of Hurricane Andrew, with higher incidences of fetal distress found in areas of highest exposure intensity. Hurricane exposed African-American mothers were more likely to birth distressed infants. The policy implications of in utero costs of natural disaster exposure are discussed. © 2010 Society for Risk Analysis.

  18. Le culte et l’iconographie des deux st. Andre de Crete

    Directory of Open Access Journals (Sweden)

    Pavlović Dragana

    2012-01-01

    Full Text Available This paper discusses the cult and iconography on frescoes of two St. Andrews developed within the Byzantine world, one being an archbishop of Crete and the other, his homonym, a saint from the same island, known as Saint Andrew “in Crisi”. Those researches proved that both homonym saints were venerated not only through the entire medieval period but moreover, their cults developed equally, however St. Andrew, the archbishop of Crete, was more prominent figure than his homonym. Nevertheless, the same epithet and name brings to confusion in their later identification. After a thorough examination of iconography of two saints in certain representations of Crete’s archbishop, the other saint is identified, a homonym of the famous byzantine writer.[Projekat Ministarstva nauke Republike Srbije, br. 177036 – Srpska srednjovekovna umetnost i njen evropski kontekst

  19. Simulation of a Smith-Purcell free-electron laser with sidewalls: Copious emission at the fundamental frequency

    International Nuclear Information System (INIS)

    Donohue, J. T.; Gardelle, J.

    2011-01-01

    The two-dimensional theory of the Smith-Purcell free-electron laser of Andrews and Brau [H. L. Andrews and C. A. Brau, Phys. Rev. ST Accel. Beams 7, 070701 (2004)] predicts that coherent Smith-Purcell radiation can occur only at harmonics of the frequency of the evanescent wave that is resonant with the beam. A particle-in-cell simulation shows that in a three-dimensional context, where the lamellar grating has sidewalls, coherent Smith-Purcell radiation can be copiously emitted at the fundamental frequency, for a well-defined range of beam energy.

  20. Adobe Photoshop Elements 11 for photographers

    CERN Document Server

    Andrews, Philip

    2013-01-01

    To coincide with some of the biggest changes in Photoshop Elements for years, Philip Andrews completely revises his bestselling title to include all the new features of this release. See how the new interface works alongside new tools, techniques and workflows to make editing, enhancing and sharing your pictures easier than ever. And as always, he introduces the changed and improved features with colorful illustrations and the clear step-by-step instruction that has made his books the go-to titles for photographers the world over. ????In this edition Andrews highlights followi

  1. A Randomized Effectiveness Trial of a Systems Level Approach to Stepped Care for War Related PTSD

    Science.gov (United States)

    2015-09-01

    Investi- gators: Fort Bliss—Melissa Molina, MD, Stanley Harmon, RN, MSN, FNP ; Fort Bragg—Lillie Walker, MPAS, PA-C, Andrew Fletcher, MD, LTC, MC, Thurman...Saunders, MSN, FNP -C, MAJ, AN; Fort Campbell—Lisa Ford, LTC, AN, FNP -BC, Vlatka Plymale, DO, CPT, MC, Jason Dailey, MD, MAJ, MC; Fort Carson—Nicholas...Harmon, RN, MSN, FNP ; Fort Bragg - Lillie Walker, MPAS, PA-C, Andrew Fletcher, MD, LTC, MC, Thurman Saunders, MSN, FNP -C, MAJ, AN; Fort Campbell - Lisa

  2. Design of a Multi-Week Sound and Motion Recording and Telemetry (SMRT) Tag for Behavioral Studies on Whales

    Science.gov (United States)

    2015-09-30

    Telemetry (SMRT) Tag for Behavioral Studies on Whales Mark Johnson & Bernie McConnell University of St. Andrews St. Andrews, Fife KY16 8LB, UK...behavior and exposure metrics in real-time while attached to an animal. This project led to the concept of a tag that would collect data over an interval...The tag would also contain a partial data archive in case it was possible to retrieve it. In support of this concept , we developed a suite of robust

  3. Smile designing for cleft lip and palate patient: The prosthodontic approach

    Directory of Open Access Journals (Sweden)

    Karuna Gajanan Pawashe

    2017-01-01

    Full Text Available The case report describes smile designing of a 22-year-old male patient who was surgically operated for unilateral cleft lip (left side with Andrew's Bridge system. It is composed of two components: Fixed component (retainers on abutments joined by bar and removable component. The patient exhibited maxillary anterior defect (Siebert's Class-III anterior ridge defect, teeth transposition, increased mesiodistal edentulous space, bilaterally missing lateral incisor. When there is a limitation of bone grafting/surgical augmentation, alternative treatment modalities such as removable partial dentures, fixed partial dentures with gingival porcelain and/or fixed-removable partial dentures known as Andrew's bridge are indicated.

  4. Unravelling Bessel beams: Presentation

    CSIR Research Space (South Africa)

    Mhlanga, T

    2013-07-01

    Full Text Available Mhlanga1,3, Angela Dudley1, Martin Lavery2, Miles Padgett2 and Andrew Forbes1,3 1CSIR National Laser Centre, PO Box 395, Pretoria, 0001, South Africa 2Department of Physics & Astronomy, University of Glasgow, Glasgow, UK 3College of Agriculture...,* Thandeka Mhlanga,1Martin Lavery,2 Andre McDonald,1 Filippus S. Roux,1 Miles Padgett,2 and Andrew Forbes1 1CSIR National Laser Centre, PO Box 395, Pretoria 0001, South Africa 2 Department of Physics & Astronomy, University of Glasgow, Glasgow, UK *adudley...

  5. MMS

    International Nuclear Information System (INIS)

    Koen, A.D.

    1992-01-01

    This paper reports that two more months could be needed to restore Gulf of Mexico oil and gas production shut in because of Hurricane Andrew, Minerals Management Service estimates. Hurricane Andrew swept west across South Florida into the gulf, then turned north and struck the Louisiana coast Aug. 25. Operators last week continued filing with MMS district offices in the New Orleans region reports of newly discovered damage to offshore oil and gas structures. By midweek, MMS listed more that 241 platforms, well satellites, and other offshore structures and 135 pipelines damaged by the storm

  6. The chiropractic heritage of Paul Caster: magnetic healer.

    Science.gov (United States)

    Jackson, R B

    1996-12-01

    Magnetic healers were a phenomenon in America's heartland, from Iowa, Kansas, Missouri in Illinois in the late 1860s. Three noted magnetics in this region were Paul Caster, Andrew Still and Daniel Palmer; the first and third would have a chiropractic legacy, while Dr. Andrew Taylor Still would found osteopathy. This is the story of the chiropractic heritage from Paul Caster via his son, Jacob, to his grandson, Charles E. Caster, D.C. Magnetic healing in this family was considered by Paul to be a divine gift, while Still and Palmer would be rejected by the clergy and believed their skills could be learned, thus passed on.

  7. A Note on Order Statistics and Property Losses from Catastrophic Hurricanes and Floods in the USA.

    OpenAIRE

    G.J. MacDonald

    2000-01-01

    The relative short time scale and limited spatial scales of hurricanes allow a normalization of damages to the present time. The most damaging hurricane in the period 1925-1995 was one that hit South Florida in 1926, following a path north of that followed by Hurricane Andrew in 1992, and also caused damage along the Alabama coast. The normalized losses from the 1926 hurricane totaled $72 billion compared with the normalized $33 billion loss caused by Andrew. The most probable loss for a hurr...

  8. Evaluation of capacities of template-type Gulf of Mexico platforms

    Energy Technology Data Exchange (ETDEWEB)

    Bea, R.G.; Loch, K.J.; Young, P.L. [Univ. of California, Berkeley, CA (United States)

    1995-12-31

    This paper details results from nonlinear analyses of the ultimate limit state performance characteristics of four Gulf of Mexico (GOM) platforms subjected to intense loadings from hurricane Andrew. These four platforms were located to the east of the track of hurricane Andrew, and were thus in the most intense portion of the storm. The nonlinear analyses are able to replicate details of the observed behavior of the four structures. This replication is very dependent on realistic characterization of the performance characteristics of the pile foundations and an accurate information on the ``as is`` condition of the platforms before the storm.

  9. Gulf of Mexico production still recovering

    International Nuclear Information System (INIS)

    Koen, A.D.

    1992-01-01

    This paper reports that the extent of damage caused by Hurricane Andrew to Gulf of Mexico oil and gas installations continues coming into focus. A preliminary tally by Minerals Management Service offers a reasonably complete summary of gulf production and pipeline systems damage detectable at the surface. MMS requires Outer Continental Shelf operators to inspect for underwater damage all platforms, pipelines, risers, and other structures within an 85 mile corridor along the path of Andrew's eye as it churned through the gulf. OCS operators have until Oct. 16 to submit plans for the Level II surveys

  10. The Concept of Fit in Contingency Theory.

    Science.gov (United States)

    1984-11-01

    RD-fli52 683 THE CONCEPT OF FIT IN CONTINGENCY THEORY (U) M INNESOTA ill. UNIV MINNEAPOLIS STRATEGIC MANAGEMENT RESEARCH CENTER R H VAN DE YEN ET AL...IN CONTINGENCY THEORY N by Andrew H. Van de Ven I and Robert Drazin THESTRATEGIC MANAGEMENT RUEzFAIRCH CENTER DTIC’ * fb ELECTE AR19 98 for ’. :- 1...821712 • , .d Andrew H. Van de Ven ( to and Robert Drazin -it’ Codes QUALITY INSPECTED Discussion Paper #19 August 1984 Strategic Management Research

  11. Strength and fatigue of NT551 silicon nitride and NT551 diesel exhaust valves

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, M.J.; Werezczak, A.A.; Kirkland, T.P.; Breder, K.

    2000-02-01

    The content of this report is excerpted from Mark Andrew's Ph.D. Thesis (Andrews, 1999), which was funded by a DOE/OTT High Temperature Materials Laboratory Graduate Fellowship. It involves the characterization of NT551 and valves fabricated with it. The motivations behind using silicon nitride (Si{sub 3}N{sub 4}) as an exhaust valve for a diesel engine are presented in this section. There are several economic factors that have encouraged the design and implementation of ceramic components for internal combustion (IC) engines. The reasons for selecting the diesel engine valve for this are also presented.

  12. HOW THE ARMY NATIONAL GUARD CAN LEVERAGE SOCIAL MEDIA TO INCREASE VISIBILITY AND RECRUTING

    Science.gov (United States)

    2016-02-16

    an 8 Oct 2015 Pew Research Center report on social media usage , 90 percent of individuals aged 18-29 use SM as a way to get and share information...1 Perrin, Andrew, “ Social Media Usage : 2005-2015,” 8 October 2015, http://www.pewinternet.org/2015/10/08/ social -networking- usage -2005-2015...to Personal Social Media Use. Washington, DC: Office of Government Ethics, April 2015 Andrew Perrin. “ Social Media Usage : 2005-2015.” Pew Research

  13. Strong Coupling Gauge Theories in LHC ERA

    Science.gov (United States)

    Fukaya, H.; Harada, M.; Tanabashi, M.; Yamawaki, K.

    2011-01-01

    Higgs, or techni-dilaton - composite Higgs near conformality / Koichi Yamawaki -- Phase diagram of strongly interacting theories / Francesco Sannino -- Resizing conformal windows / O. Antipin and K. Tuominen -- Nearly conformal gauge theories on the lattice / Zoltan Fodor ... [et al.] -- Going beyond QCD in lattice gauge theory / G. T. Fleming -- Phases of QCD from small to large N[symbol]: (some) lattice results / A. Deuzeman, E. Pallante and M. P. Lombardo -- Lattice gauge theory and (quasi)-conformal technicolor / D. K. Sinclair and J. B. Kogut -- Study of the running coupling constant in 10-flavor QCD with the Schrodinger functional method / N. Yamada ... [et al.] -- Study of the running coupling in twisted Polyakov scheme / T. Aoyama ... [et al.].Running coupling in strong gauge theories via the lattice / Zoltan Fodor ... [et al.] -- Higgsinoless supersymmetry and hidden gravity / Michael L. Graesser, Ryuichiro Kitano and Masafumi Kurachi -- The latest status of LHC and the EWSB physics / S. Asai -- Continuum superpartners from supersymmetric unparticles / Hsin-Chia Cheng -- Review of minimal flavor constraints for technicolor / Hidenori S. Fukano and Francesco Sannino -- Standard model and high energy Lorentz violation / Damiano Anselmi -- Dynamical electroweak symmetry breaking and fourth family / Michio Hashimoto -- Holmorphic supersymmetric Nambu-Jona-Lasino model and dynamical electroweak symmetry breaking / Dong-Won Jung, Otto C. W. Kong and Jae Sik Lee -- Ratchet model of Baryogenesis / Tatsu Takeuchi, Azusa Minamizaki and Akio Sugamoto -- Classical solutions of field equations in Einstein Gauss-Bonnet gravity / P. Suranyi, C. Vaz and L. C. R. Wijewardhana -- Black holes constitute all dark matter / Paul H. Frampton -- Electroweak precision test and Z [symbol] in the three site Higgsless model / Tomohiro Abe -- Chiral symmetry and BRST symmetry breaking, quaternion reality and the lattice simulation / Sadataka Furui -- Holographic techni-dilaton, or

  14. CHURCH, Category, and Speciation

    Directory of Open Access Journals (Sweden)

    Rinderknecht Jakob Karl

    2018-01-01

    Full Text Available The Roman Catholic definition of “church”, especially as applied to groups of Protestant Christians, creates a number of well-known difficulties. The similarly complex category, “species,” provides a model for applying this term so as to neither lose the centrality of certain examples nor draw a hard boundary to rule out border cases. In this way, it can help us to more adequately apply the complex ecclesiology of the Second Vatican Council. This article draws parallels between the understanding of speciation and categorization and the definition of Church since the council. In doing so, it applies the work of cognitive linguists, including George Lakoff, Zoltan Kovecses, Giles Fauconnier and Mark Turner on categorization. We tend to think of categories as containers into which we sort objects according to essential criteria. However, categories are actually built inductively by making associations between objects. This means that natural categories, including species, are more porous than we assume, but nevertheless bear real meaning about the natural world. Taxonomists dispute the border between “zebras” and “wild asses,” but this distinction arises out of genetic and evolutionary reality; it is not merely arbitrary. Genetic descriptions of species has also led recently to the conviction that there are four species of giraffe, not one. This engagement will ground a vantage point from which the Council‘s complex ecclesiology can be more easily described so as to authentically integrate its noncompetitive vision vis-a-vis other Christians with its sense of the unique place held by Catholic Church.

  15. Measure for measure: curriculum requirements and children's achievement in music education.

    Science.gov (United States)

    Bond, Trevor; Bond, Marie

    2010-01-01

    Children in all public primary schools in Queensland, Australia have weekly music lessons designed to develop key musical concepts such as reading, writing, singing and playing simple music notation. Their understanding of basic musical concepts is developed through a blend of kinaesthetic, visual and auditory experiences. In keeping with the pedagogical principles outlined by the Hungarian composer, Zoltan Kodaly, early musical experiences are based in singing well-known children's chants - usually restricted to notes of the pentatonic scale. In order to determine the extent to which primary school children's musical understandings developed in response to these carefully structured developmental learning experiences, the Queensland Primary Music Curriculum was examined to yield a set of over 70 indicators of musical understanding in the areas of rhythm, melody and part-work,the essential skills for choral singing. Data were collected from more than 400 children's attempts at elicited musical performances. Quantitative data analysis procedures derived from the Rasch model for measurement were used to establish the sequence of children's mastery of key musical concepts. Results suggested that while the music curriculum did reflect the general development of musical concepts, the grade allocation for a few concepts needed to be revised. Subsequently, children's performances over several years were also analysed to track the musical achievements of students over time. The empirical evidence confirmed that children's musical development was enhanced by school learning and that indicators can be used to identify both outstanding and atypical development of musical understanding. It was concluded that modest adjustments to the music curriculum might enhance children's learning opportunities in music.

  16. Feasibility study for GCOM-C/SGLI: Retrieval algorithms for carbonaceous aerosols

    Science.gov (United States)

    Mukai, Sonoyo; Sano, Itaru; Yasumoto, Masayoshi; Fujito, Toshiyuki; Nakata, Makiko; Kokhanovsky, Alexander

    2016-04-01

    possibility of GCOM-C1 / SGLI related to remote sensing for aerosols and/or clouds can be examined. [1] Mukai, S., M. Yasumoto and M. Nakata, 2014: Estimation of biomass burning influence on air pollution around Beijing from an aerosol retrieval model. The Scientific World Journal, Article ID 649648. [2] Mukai, S., M. Nakata, M. Yasumoto, I. Sano and A. Kokhanovsky, 2015:A study of aerosol pollution episode due to agriculture biomass burning in the east-central China using satellite data, Front. Environ. Sci., 3:57, doi: 10.3389/fenvs.2015.00057.

  17. A bidirectional coupling procedure applied to multiscale respiratory modeling

    Energy Technology Data Exchange (ETDEWEB)

    Kuprat, A.P., E-mail: andrew.kuprat@pnnl.gov [Fundamental and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, WA (United States); Kabilan, S., E-mail: senthil.kabilan@pnnl.gov [Fundamental and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, WA (United States); Carson, J.P., E-mail: james.carson@pnnl.gov [Fundamental and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, WA (United States); Corley, R.A., E-mail: rick.corley@pnnl.gov [Fundamental and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, WA (United States); Einstein, D.R., E-mail: daniel.einstein@pnnl.gov [Fundamental and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, WA (United States)

    2013-07-01

    In this study, we present a novel multiscale computational framework for efficiently linking multiple lower-dimensional models describing the distal lung mechanics to imaging-based 3D computational fluid dynamics (CFDs) models of the upper pulmonary airways in order to incorporate physiologically appropriate outlet boundary conditions. The framework is an extension of the modified Newton’s method with nonlinear Krylov accelerator developed by Carlson and Miller [1], Miller [2] and Scott and Fenves [3]. Our extensions include the retention of subspace information over multiple timesteps, and a special correction at the end of a timestep that allows for corrections to be accepted with verified low residual with as little as a single residual evaluation per timestep on average. In the case of a single residual evaluation per timestep, the method has zero additional computational cost compared to uncoupled or unidirectionally coupled simulations. We expect these enhancements to be generally applicable to other multiscale coupling applications where timestepping occurs. In addition we have developed a “pressure-drop” residual which allows for stable coupling of flows between a 3D incompressible CFD application and another (lower-dimensional) fluid system. We expect this residual to also be useful for coupling non-respiratory incompressible fluid applications, such as multiscale simulations involving blood flow. The lower-dimensional models that are considered in this study are sets of simple ordinary differential equations (ODEs) representing the compliant mechanics of symmetric human pulmonary airway trees. To validate the method, we compare the predictions of hybrid CFD–ODE models against an ODE-only model of pulmonary airflow in an idealized geometry. Subsequently, we couple multiple sets of ODEs describing the distal lung to an imaging-based human lung geometry. Boundary conditions in these models consist of atmospheric pressure at the mouth and intrapleural

  18. A bidirectional coupling procedure applied to multiscale respiratory modeling

    International Nuclear Information System (INIS)

    Kuprat, A.P.; Kabilan, S.; Carson, J.P.; Corley, R.A.; Einstein, D.R.

    2013-01-01

    In this study, we present a novel multiscale computational framework for efficiently linking multiple lower-dimensional models describing the distal lung mechanics to imaging-based 3D computational fluid dynamics (CFDs) models of the upper pulmonary airways in order to incorporate physiologically appropriate outlet boundary conditions. The framework is an extension of the modified Newton’s method with nonlinear Krylov accelerator developed by Carlson and Miller [1], Miller [2] and Scott and Fenves [3]. Our extensions include the retention of subspace information over multiple timesteps, and a special correction at the end of a timestep that allows for corrections to be accepted with verified low residual with as little as a single residual evaluation per timestep on average. In the case of a single residual evaluation per timestep, the method has zero additional computational cost compared to uncoupled or unidirectionally coupled simulations. We expect these enhancements to be generally applicable to other multiscale coupling applications where timestepping occurs. In addition we have developed a “pressure-drop” residual which allows for stable coupling of flows between a 3D incompressible CFD application and another (lower-dimensional) fluid system. We expect this residual to also be useful for coupling non-respiratory incompressible fluid applications, such as multiscale simulations involving blood flow. The lower-dimensional models that are considered in this study are sets of simple ordinary differential equations (ODEs) representing the compliant mechanics of symmetric human pulmonary airway trees. To validate the method, we compare the predictions of hybrid CFD–ODE models against an ODE-only model of pulmonary airflow in an idealized geometry. Subsequently, we couple multiple sets of ODEs describing the distal lung to an imaging-based human lung geometry. Boundary conditions in these models consist of atmospheric pressure at the mouth and intrapleural

  19. 78 FR 26867 - Quarterly Publication of Individuals, Who Have Chosen To Expatriate

    Science.gov (United States)

    2013-05-08

    ... YONG JIN PARSONS JR THOMAS HENRY PELIZZON MARINA SYLVIA PELUSO FREDERICK JOSEPH PENG SHI FEN PERRY... LAURENT FRANCOIS SPERB FERDINAND SPYRIS-METAXAS ANDREW PHILLIP ST. JOHNSTON FREDERICK IAN STAEHELIN NANCY... ANNA GUEK YONG TAN JUI HANG BEJAMIN TAN LISA MARIE TANG XIN-YI DANIEL TASILLO-HIRT ANN M. TAYLOR CURTIS...

  20. Ülesande lahendamise eest saab miljon dollarit / Harli Uljas

    Index Scriptorium Estoniae

    Uljas, Harli

    2000-01-01

    Maailma tippmatemaatikutele pakutakse seitset miljonit dollarit seitsme raske võrduse lahendamise eest. Clay Mathematics Institute pani probleemi üles oma internetileheküljele ja teatas sellest Pariisis toimunud konverentsil. Princetoni ülikooli matemaatikaprofessori Andrew Wilesi sõnul on need seitse matemaatilist probleemi selle ala kõige suuremad lahendamata väljakutsed

  1. Browse Author Index

    African Journals Online (AJOL)

    Items 251 - 300 of 1046 ... Ekore, Rabi Ilemona · Ekundayo, OO · Ekundayo, OS · Elegbeleye, AO · Elegbeleye, Ayotunde Oluwadamilola · Emmanuel, CO · Engelbrecht, Natasjha · Eni-Olorunda, T · Ephraim-Oluwanuga, Sola · Epie, C · Erhabor, SI · Eromonsele, O Andrew · Esere, M.O · Esmeranda, Manful · Ettang, Dorcas

  2. Browse Author Index

    African Journals Online (AJOL)

    Items 1 - 37 of 37 ... Ekore, Rabi Ilemona · Ekundayo, OO · Ekundayo, OS · Elegbeleye, AO · Elegbeleye, Ayotunde Oluwadamilola · Emmanuel, CO · Engelbrecht, Natasjha · Eni-Olorunda, T · Ephraim-Oluwanuga, Sola · Epie, C · Erhabor, SI · Eromonsele, O Andrew · Esere, M.O · Esmeranda, Manful · Ettang, Dorcas · Evbouma ...

  3. African Journal of Neurological Sciences - 2009 Vol. 28 No 1

    African Journals Online (AJOL)

    ADELOLA ADOLOYE. Neurosurgery in Africa. 1st ed. Ibadan: Ibadan University Press 1989:386. 2. ANDREW T PARSA, JANET LEE, IAN F PARNEY, PHILIP WEINSTEIN, PAUL C. MC CORMICK,. CHRISTOPHER AMES. Spinal cord and intradural-extraparenchymal spinal tumors: current best care practices and strategies.

  4. African Health Sciences - Vol 1, No 1 (2001)

    African Journals Online (AJOL)

    BOOK REVIEW: Neurosurgery in the Tropics: A practical approach to common problems By Jeffrey V. Rosenfeld MBBS, MS, FRACS, FRCS (Ed), FACS, FACTM and David A.K Watters ChM, FRACS, FRCS (Ed) Macmillan Education LTD 2000, Price $ 50 US ISBN 0-333-68412-5 · EMAIL FREE ... Andrew D Weeks, 36-41 ...

  5. High-frequency field-deployable isotope analyzer for hydrological applications

    Science.gov (United States)

    Elena S.F. Berman; Manish Gupta; Chris Gabrielli; Tina Garland; Jeffrey J. McDonnell

    2009-01-01

    A high-frequency, field-deployable liquid water isotope analyzer was developed. The instrument was deployed for 4 contiguous weeks in the H. J. Andrews Experimental Forest Long-term Ecological Research site in western Oregon, where it was used for real-time measurement of the isotope ratios of precipitation and stream water during three large storm events. We were able...

  6. The Proceedings of the Conference on Assessment of Ecological Impacts of Oil Spills Held 14-17 Jun 1978, Keystone, Colorado.

    Science.gov (United States)

    1978-01-01

    ends of man to the maximum extent, and which at the same time meet legal and political criteria of justice and equity ? Surely these are the most...marine ciliate protozoan Euplotes diadaleos. This organism was chosen because members of the genus Euplotes were reported by Andrews and Floodgate (1974

  7. 75 FR 53017 - Office of the General Counsel; Appointment of Members of the Legal Division to the Performance...

    Science.gov (United States)

    2010-08-30

    ... Division to the Performance Review Board, Internal Revenue Service Under the authority granted to me as... following persons to the Legal Division Performance Review Board, Internal Revenue Service Panel: 1.... Andrew Keyso, Deputy Associate Chief Counsel (Income Tax & Accounting) 5. Drita Tonuzi, Deputy Division...

  8. Does Neuroscience Matter for Education?

    Science.gov (United States)

    Schrag, Francis

    2011-01-01

    In this review essay, Francis Schrag focuses on two recent anthologies dealing completely or in part with the role of neuroscience in learning and education: The "Jossey-Bass Reader on the Brain and Learning", edited by Jossey-Bass Publishers, and "New Philosophies of Learning", edited by Ruth Cigman and Andrew Davis. Schrag argues that…

  9. Pop nädal : popsündmus. POPtabel : DAC Deutsche Alternative Charts

    Index Scriptorium Estoniae

    2002-01-01

    13.-14. juulil toimuvast Baltimaade suurimast tantsumuusika festivalist Sun Dance Music Festivalist. Augustis tuleb müüki George Michaeli uus singel "Shoot the Dog". Ansambli Depeche Mode liige Andrew Fletcher loob oma plaadifirma. Ansambli Duran Duran uuest albumist

  10. Reference: 136 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 136 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u15548601i Woodward A...r PEX7 is necessary for peroxisome function and dependent on PEX5. 2 573-83 15548601 2005 Feb Molecular biology of the cell Bartel Bonnie|Woodward Andrew W

  11. Big Data, Small Media

    Directory of Open Access Journals (Sweden)

    Grant Bollmer

    2014-08-01

    Andrew Dubber Radio in the Digital Age Polity, Cambridge, 2013   Charles Ess Digital Media Ethics, Second Edition Polity, Cambridge, 2014   Graeme Kirkpatrick Computer Games and the Social Imaginary Polity, Cambridge, 2013   Dhiraj Murthy Twitter: Social Communication in the Twitter Age Polity, Cambrige, 2013   Jill Walker Rettberg Blogging, Second Edition Polity, Cambridge, 2014

  12. "O Bottom, Thou Art Translated": Directing a Bilingual Dream in the Marshall Islands

    Science.gov (United States)

    Garrod, Andrew

    2005-01-01

    A unique production of Shakespeare's "A Midsummer Night's Dream" was staged in early 2004 by students of the Marshall Islands High School, Majuro, in the Central Pacific. The play's director, Andrew Garrod, describes the rehearsal process and performance of the play, in which the school students were supported by undergraduates from the…

  13. Browse Title Index

    African Journals Online (AJOL)

    Items 101 - 150 of 1346 ... Grant PJ, Clatworthy JN, Goldschmidt WB. Vol 4, No 1 (1969), An experimental sod seeder, Abstract. Krog MM, Theron EP, Andrews C. Vol 5, No 1 (1988), An extension approach for the National Grazing Strategy based on farmer characteristics in the Eastern Cape. Abstract. King P.G., Bembridge T.J..

  14. African Zoology - Vol 41, No 2 (2006)

    African Journals Online (AJOL)

    Thermoregulation under semi-natural conditions in speckled mousebirds: the role of communal roosting · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Andrew E. McKechnie, Gerhard Körtner, Barry G. Lovegrove, 155-163.

  15. Perversities of Extreme Dependence and Unequal Growth in the TAR

    NARCIS (Netherlands)

    A.M. Fischer (Andrew Martín)

    2007-01-01

    textabstractThis first in a series of independent analyses by Andrew Martin Fischer, commissioned by Tibet Watch, a research-based organisation established in London in 2006, examines the rapid growth that has been generated in the Tibetan Autonomous Region (TAR) through the extremely heavy

  16. Identification of the GnRH-(1-5) Receptor and Signaling Pathway

    Science.gov (United States)

    2013-03-22

    chondrodysplasia punctata, ichthyosis , and Kallmann syndrome due to an Xp deletion. Prenatal diagnosis 12:19-29 6. Cariboni A, Hickok J, Rakic S, Andrews...chondrodysplasia punctata, ichthyosis , and Kallmann syndrome due to an Xp deletion. Prenatal diagnosis 12:19-29 5. Bicknell AB. 2008. The tissue

  17. 76 FR 22681 - Defense Logistics Agency (DLA) Address Directory

    Science.gov (United States)

    2011-04-22

    ... DEPARTMENT OF DEFENSE Office of the Secretary Defense Logistics Agency (DLA) Address Directory AGENCY: Department of Defense. ACTION: Notice. SUMMARY: The Defense Logistics Agency (DLA) is updating... Directory: Defense Logistics Agency Headquarters, Andrew T. McNamara Building, 8725 John J. Kingman Road...

  18. Relationship between Admission Selection Criteria and Academic Progression for Student Nurse Anesthetists

    Science.gov (United States)

    Burns, Sharon M.

    2009-01-01

    Today's admission selection criteria require refinement with the intention of fostering academic progression for students entering nurse anesthesia programs (Reese, 2002).With the escalating cost of graduate education coupled with the current economic crisis, efforts by educational leaders to minimize attrition remains pivotal (Andrews, Johansson,…

  19. Paving the Road to Success: A Framework for Implementing the ...

    African Journals Online (AJOL)

    Paving the Road to Success: A Framework for. Implementing the Success Tutoring Approach. Linda Spark,* Danie de Klerk,** Tshepiso Maleswena*** & Andrew Jones****. * Linda Spark is a Senior Tutor and Grant Holder: Road to Success Programme, Faculty of Commerce, Law, and Management, University of the ...

  20. VALIDITY, RELIABILITY AND UTILITY OF THE 6-YEAR AGES AND STAGES QUESTIONNAIRE

    OpenAIRE

    Ajay SINGH

    2015-01-01

    This dissertation has been accepted and approved in partial fulfillment of the requirements for the requirements for the Doctor of Philosophy degree in the Department of Special Education and Clinical Sciences by: Professor Jane Squires, Professor Michael Bullis, Profes-sor Debra Eisert, Dr. Deborah Olson, and Professor J. Andrew Berglund. Original approval signatures are on file with the University of Oregon Graduate School.

  1. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 3; Issue 3. Issue front cover thumbnail Issue back cover ... More Details Fulltext PDF. pp 5-5 Science Smiles. Science Smiles ... pp 71-72 Research News. International Team Shows that Primes Can Be Found in Surprising Places · Andrew Granville.

  2. 77 FR 71575 - Initiation of Antidumping and Countervailing Duty Administrative Reviews and Request for...

    Science.gov (United States)

    2012-12-03

    ... sellers who purchase and export subject merchandise to the United States. Entities that currently do not... foreign sellers that purchase and export subject merchandise to the United States. \\1\\ Such entities... Shoes Plant Shaoxing Andrew Metal Manufactured Shaoxing Dingli Metal Clotheshorse Co., Ltd. Shaoxing...

  3. Romanticism, Representations of Religion and Critical Religious Education

    Science.gov (United States)

    Barnes, L. Philip; Wright, Andrew

    2006-01-01

    Geoff Teece has recently (in "BJRE", 27, 2005, pp. 29-40) come to the defence of modern religious education and contended that many of the criticisms brought against it are based on mistaken interpretations. More particularly, Teece accuses Andrew Wright of misinterpreting the position of Professor John Hick and of failing to appreciate…

  4. 33 CFR 100.1301 - Seattle seafair unlimited hydroplane race.

    Science.gov (United States)

    2010-07-01

    ... hydroplane race. 100.1301 Section 100.1301 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF... unlimited hydroplane race. (a) This section is in effect annually during the last week in July and the first... hydroplane race course and then to the northerly tip of Ohlers Island in Andrews Bay. The western zone is...

  5. The Grief Account: Dimensions of a Contemporary Bereavement Genre

    Science.gov (United States)

    Dennis, Michael Robert

    2008-01-01

    The genre of the grief account is identified to include published narratives of surviving grief. Thematic analysis of Andrew Holleran's (2006) "Grief: A Novel," Lolly Winston's (2004) "Good Grief: A Novel," Joan Didion's (2005) "The Year of Magical Thinking," and J. Canfield and M. V. Hansen's (2003) "Chicken Soup for the Grieving Soul: Stories…

  6. Pop / Mart Juur

    Index Scriptorium Estoniae

    Juur, Mart, 1964-

    2002-01-01

    Heliplaatidest Kiss "The Very Best of Kiss". Andrew Lloyd Webber presents: "A R Rahman's Bombay Dreams". Naughty By Nature "Ilkons". Erinevad esinejad "One word one sound". Diana King "Respect". Caater "Club Space (Estonian Edition)". J.M.K.E. "Ainult planeet". Collage "Parimad lood 1970-1976". Cinematic Orchestra "Every Day". Catatonia "Greatest Hits". Boards of Canada "Geogaddi"

  7. Hypoxia: Exposure Time Until Significant Performance Effects

    Science.gov (United States)

    2016-03-07

    1994). Acute hypoxia fails to influence two aspects of short-term memory : implications for the source of cognitive deficits. Aviation, Space...Naval Medical Research Unit Dayton HYPOXIA : EXPOSURE TIME UNTIL SIGNIFICANT PERFORMANCE EFFECTS PHILLIPS, J.P., DRUMMOND, L.A...Andrews, CAPT, MSC, USN Commanding Officer i 1 ARTICLE TYPE: Research Article TITLE: Hypoxia : Exposure Time Until Significant Performance

  8. Author Details

    African Journals Online (AJOL)

    ... in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives. Okhueleigbe, Andrew O. Vol 30 (2015) - Articles Dynamic Calculation Design of Vertical Wind Turbine Abstract. ISSN: 1116-4336.

  9. Browse Title Index

    African Journals Online (AJOL)

    Vol 16, No 3 (2016), The revolving door of mental, neurological, and substance use disorders re-hospitalization in rural KwaZulu-Natal Province, South Africa, Abstract PDF. Andrew Tomita, Yoshan Moodley. Vol 15, No 3 (2015), The role of non-governmental organizations in providing curative health services in North ...

  10. Incorporating Human Rights into the Sustainability Agenda: A Commentary on "Corporate Responsibility to Respect Human Rights and Business Schools' Responsibility to Teach It"

    Science.gov (United States)

    Andrew, Jane

    2013-01-01

    In her commentary of McPhail's 2013 article "Corporate Responsibility to Respect Human Rights and Business Schools' Responsibility to Teach It: Incorporating Human Rights into the Sustainability Agenda," Jane Andrew begins by highlighting a number of McPhail's primary arguments. She points out that McPhail sets out to achieve two things…

  11. 2006 Program of Study: Ice

    Science.gov (United States)

    2007-03-01

    will slow the hleave rate, andl thle leI )s f’ronlt will move forwardl (increasing z). Physically, a (decrease in p)ermleability limits t,he allionuilt of...ermnittinig me to pick their esteemed brains; George VI for introdlucing mec to the national pastime. andl his owm: and Andrew Folwer (sic) for thatt

  12. Papers and Studies in Contrastive Linguistics, Volume Eleven. The Polish-English Contrastive Project.

    Science.gov (United States)

    Fisiak, Jacek, Ed.

    This volume contains ten articles and a book review. Josef Vachek talks about "Vilem Mathesius as Forerunner of Contrastive Linguistic Studies." In "Contrastive Generative Grammar and the Psycholinguistic Fallacy," Andrew Chesterman discusses methods for accounting for simplification in foreign language learning. Michael Post compares "English…

  13. Real moments of the restrictive factor

    Indian Academy of Sciences (India)

    ... Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Proceedings – Mathematical Sciences; Volume 119; Issue 4. Real Moments of the Restrictive Factor. Andrew Ledoan Alexandru Zaharescu. Volume 119 Issue 4 September 2009 pp 559-566 ...

  14. Retention Matters: Academic Libraries Leading the Way

    Science.gov (United States)

    Oliveira, Silas M.

    2018-01-01

    Academic libraries have always strived to be purposively involved in the university's mission attainment efforts. Today, the increase of retention levels is paramount, and, in many cases, it is at the center of higher education institution's strategic plans. For Andrews University, for example, the goal is to reach 80% in the next five years. In…

  15. Pseudo q -Engel expansions and Rogers-Ramanujan type identities ...

    African Journals Online (AJOL)

    Abstract. Andrews, Knopfmacher and Knopfmacher have used the Schur polynomials to consider the celebrated Rogers-Ramanujan identities in the context of q-Engel expansions. We extend this view using similar polynomials, provided by Sills, in the context of Slater's list of 130 Rogers-Ramanujan type identities.

  16. Combinatorial identities for tenth order mock theta functions

    Indian Academy of Sciences (India)

    44

    References. [1] A.K. Agarwal, Lattice paths and mock theta functions, In: Proceedings of the 4th international conference of the Society for Special Functions and their Applications (SSFA), 6, 95–102, SSFA, Chennai, India,. 2005. [2] A.K. Agarwal and G.E. Andrews, Rogers-Ramanujan identities for partitions with “n copies of ...

  17. Browse Title Index

    African Journals Online (AJOL)

    Items 601 - 650 of 763 ... Vol 9, No 11 (2015), Scrap metals' role in circular economy in Ghana, using Sunyani as a case study, Abstract PDF. Andrews Nkansah, Francis Attiogbe, Engelbert Kumi. Vol 7, No 11 (2013), Seasonal fluctuations of phlebotomines sand fly populations (Diptera: Psychodidae) in the Moulay Yacoub ...

  18. African Journal of Environmental Science and Technology - Vol 9 ...

    African Journals Online (AJOL)

    Scrap metals' role in circular economy in Ghana, using Sunyani as a case study · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Andrews Nkansah, Francis Attiogbe, Engelbert Kumi, 793-799. http://dx.doi.org/10.5897/AJEST2015.2000 ...

  19. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Ripudaman Malhotra. Articles written in Resonance – Journal of Science Education. Volume 22 Issue 12 December 2017 pp 1109-1110 Article-in-a-Box. In Memoriam: George Andrew Olah · Ripudaman Malhotra · More Details Abstract Fulltext PDF. Volume 22 ...

  20. Ezeja et al., Afr J Tradit Complement Altern Med. (2013) 10(5):394 ...

    African Journals Online (AJOL)

    cadewumi

    pylori) and protective mechanism (mucus and bicarbonate secretion, increased blood flow, cell turn over, impermeability to .... Bioassay-guided fractionation of the methanolic root extract of C. planchonii. Fractionation was done using column chromatography according to the methods of Abbot and Andrew (1970) and.

  1. Grass seeding as a control for roadbank erosion.

    Science.gov (United States)

    A.G. Wollum

    1962-01-01

    Grass, seeded on a steep roadcut in western Oregon, reduced erosion but caused increased surface runoff during a 3-year period of observation. These results were obtained at H. J. Andrews Experimental Forest from a study designed to measure effectiveness of grass in controlling soil erosion from exposed roadbanks. Additional measurements for varying soil types will be...

  2. a preliminary assessment for groundwater in a part of north central ...

    African Journals Online (AJOL)

    Olabanji

    geology; the structures obtained from the field very much correlate with those obtained from satellite imagery, most of ... structures on the earth surface. Therefore, such features and their trends consequent on the ... of the electromagnetic spectrum (Drury and Andrews-. Deller, 2002). This fact is well illustrated in the research.

  3. Author Details

    African Journals Online (AJOL)

    McKechnie, Andrew E. Vol 81, No 2 (2010) - Articles Thermoregulation under seminatural conditions in two species of African barbets (Piciformes: Lybiidae) Abstract. ISSN: 0030-6525. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  4. Optimization-Based Selection of Influential Agents in a Rural Afghan Social Network

    Science.gov (United States)

    2010-06-01

    Awakens: The Tipping Point," Military Review, pp. 41-52, March-April 2008. [54] Fotini Christia , "Flipping the Taliban," Foreign Affairs, vol. 88, no. 4...183 [92] Andrew Beath, Fotini Christia , and Ruben Enikolopov, "Baseline Survey Report," Randomized Impact Evaluation of Afghanistan’s National

  5. Development Programs and the Maoist Insurgency in Andhra Pradesh and Chhattisgarh: A Comparative Analysis

    Science.gov (United States)

    2012-12-01

    Fotinin Christia , Ruben Enikolopov, “Winning Hearts and Minds? Evidence from a Field Experiment in Afghanistan” (Cambridge, Massachusetts...the Americans in Afghanistan? Interview with KPS Gill.” Tehelka Magazine 6, no. 42 (October 24, 2009). Beath, Andrew, Fontin Christia , and Ruben

  6. Browse Title Index

    African Journals Online (AJOL)

    Items 451 - 500 of 503 ... Vol 31, No 1 (2011), The quality of locally-manufactured cornmill grinding plates, Abstract PDF. S Kwofie, A Andrews, E Mensah. Vol 28, No 1 (2008) .... Vol 36, No 3 (2016), Utilization of cullets for the production of glass tiles through likn casting, Abstract PDF. K. Adjei, K. Opoku-Bonsu, E. O. Asiamah.

  7. the quality of locally-manufactured corn- mill grinding plates

    African Journals Online (AJOL)

    User

    THE QUALITY OF LOCALLY-MANUFACTURED CORN-. MILL GRINDING PLATES. S. Kwofie1, A. Andrews2, E. Mensah3. 1,2Department of Materials Engineering, Kwame Nkrumah University of Science and Technology,. Kumasi, Ghana. 3Department of Agricultural Engineering, Kwame Nkrumah University of Science ...

  8. Krasota kak blagotvaritelnost / Igor Saveljev

    Index Scriptorium Estoniae

    Saveljev, Igor

    2008-01-01

    Eesti Sportlaste Ühenduse 9. heategevuslik kunstioksjon Tallinnas Nordic Hotel Forumi restoranis Monaco 20. detsembril 2008. Korraldab galerii Rios. Müügis ligi 30 maali Eesti kunstnikelt. Esile toodud Andrew George Winteri (Sindist pärit Andres Jüri Vinter) maali "Purjelaev merel" ja Franz Karl Eduard von Gebhardti "Kristus haigeid tervendamas". Autoritest

  9. Critical Opalescence

    Indian Academy of Sciences (India)

    The solid, liquid and gaseous phases of matter have been known since the dawn of history; the example of ice, water and steam being the different states of the same material is recorded in the. Egyptian and Chinese literature about four thousand years ago. About ISO years ago, largely due to the careful studies of Andrews.

  10. ISLAM IN THE NON-MUSLIM AREAS OF NORTHERN NIGERIA, c

    African Journals Online (AJOL)

    QUADRI Y A

    Department of Philosophy and Religions,. University of Abuja,. Abuja FCT, Nigeria. Kehinde31@gmail.com or kehinde31@yahoo.com and. Ayuba Yusuf Larry Sanda. Andrew Walls Centre for the ... manipulate nature for the benefit of the witch or the witch‟s client.”2. The ..... (London: SCM Press Ltd., 1973), pp. 175–176.

  11. Authentic Assessment in the First Steiner Academy

    Science.gov (United States)

    Burnett, John

    2009-01-01

    In August 2008, the then Schools Minister, Andrew Adonis, gave the go-ahead for the privately funded Hereford Waldorf School to reopen as a tax-payer-funded Academy, sponsored by the Steiner Waldorf Schools Fellowship of Great Britain. Accordingly, the Steiner Academy Hereford opened in September 2008. In common with the 132 other Academies opened…

  12. n-Colour even self-inverse compositions

    Indian Academy of Sciences (India)

    Introduction. In the classical theory of partitions, compositions were first defined by MacMahon [1] as ordered partitions. For example, there are 5 partitions and 8 compositions of 4. The partitions are 4, 31, 22, 212, 14 and the compositions are 4, 31, 13, 22, 212, 121,. 122, 14. Agarwal and Andrews [2] defined an n-colour ...

  13. Road Materials and Pavement Design, volume 18, issue 1

    CSIR Research Space (South Africa)

    De Beer, Morris

    2017-01-01

    Full Text Available and Pavement Design Volume 18, 2017 - Issue 1 Editorial Board Page ebi | Published online: 03 Oct 2016 http://dx.doi.org/10.1080/14680629.2016.1244475 Editors-in-Chief Hervé DI BENEDETTO - University of Lyon/ENTPE, Vaulx-en-Velin, France Andrew Charles...

  14. Road Materials and Pavement Design, volume 18, issue 2

    CSIR Research Space (South Africa)

    De Beer, Morris

    2017-03-01

    Full Text Available and Pavement Design Volume 18, 2017 - Issue 2 Editorial Board Page ebi | Published online: 03 Oct 2016 http://dx.doi.org/10.1080/14680629.2016.1244475 Editors-in-Chief Hervé DI BENEDETTO - University of Lyon/ENTPE, Vaulx-en-Velin, France Andrew Charles...

  15. Problems in implementing improved range management on ...

    African Journals Online (AJOL)

    Problems in implementing improved range management on common lands in Africa: An Australian perspective. Squires V.R., Mann T.L., Andrew M.H.. Abstract. Rangeland/livestock development in Africa is reviewed and lessons learnt from successes and failures are noted. Focuses on sustainable resource development in ...

  16. New Trends in Electronic Publishing and Electronic Libraries. Publications of Essen University Library 6. Essen Symposium (Essen, West Germany, August 29-31, 1983).

    Science.gov (United States)

    Helal, Ahmed H., Ed.; Weiss, Joachim W., Ed.

    This symposium examined issues in the planning, development, and implementation of library automation and the effects of electronic publishing. The following presentations are included in this collection: (1) "Will There Be Electronic Anarchy?" (Helen Henderson); (2) "Ergonomics in the Electronic Era" (Andrew Torok); (3)…

  17. Fast Transients: Closing the Loop on Air Force Professional Military Education

    Science.gov (United States)

    2013-02-19

    10 Andrew Tolmie, James Boyle. Factors Influencing the Success of Computer Mediated Communication (SMS) Enviroments in...Success of Computer Mediated Communication (SMS) Enviroments in University Teaching: A Review and Case Study.   5   Replicating student collaboration... Enviroments in University Teaching: A Review and Case Study. Case Study, Centre for Research into Interactive Learning, n.d. Walker, S.A., Social

  18. Chelsea lillenäitus 2006 / Merilen Mentaal

    Index Scriptorium Estoniae

    Mentaal, Merilen, 1972-

    2006-01-01

    Lille- ja aiandusnäitusel Londonis võistles 46 aeda. Parim aed - The Daily Telegraph Garden, kujundaja Tom Stuart-Smith. Intervjuu Chelsea Flower Show 2006 žürii liikme, inglise maastikuarhitekti Andrew Wilsoniga (foto). 10 värv. ill.

  19. 21 CFR 169.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... part: (a) The term vanilla beans means the properly cured and dried fruit pods of Vanilla planifolia Andrews and of Vanilla tahitensis Moore. (b) The term unit weight of vanilla beans means, in the case of vanilla beans containing not more than 25 percent moisture, 13.35 ounces of such beans; and, in the case...

  20. Cyber Mutual Assistance Workshop Report

    Science.gov (United States)

    2018-02-01

    discussion presented by Tom O’Brien, Vice President and Chief Information Officer, PJM Interconnection The facilitated session explored a set of nine...Reliability Corporation (NERC) Mr. Daniel Holt-Gosselin NUARI, Norwich University Mr. Andrew Peterson NUARI, Norwich University Mr. Tom O’Brien