WorldWideScience

Sample records for andrew von eschenbach

  1. Nomina nova in Platyhelminthes pro Macrorhynchus von Graff, 1882 (non [Gmelin, 1801]; non Dunker, 1843), and Leptocleidus Mueller, 1936 (non Andrews, 1922).

    Science.gov (United States)

    Hornung, Jahn J

    2016-08-19

    Two genus-group names of flat-worms-Leptocleidus Mueller, 1936 and Macrorhynchus von Graff, 1882-are junior homonyms that are preoccupied by fossil diapsid reptile genera-Leptocleidus Andrews, 1922, and Macrorhynchus Dunker, 1843-and an extant teleost fish genus-Macrorhynchus [Gmelin, 1801] ex La Cépède, 1800. These are replaced by nomina nova (Pharyngodytes nom. nov.; Graffiellus nom. nov.). Macrorhynchus [Gmelin, 1801] is an objective senior synonym of Macrorhyncus Dumeríl, 1805 ex La Cépède, 1800 (syn. nov.), and a senior homonym of Macrorhynchus Dunker, 1843, and Macrorhynchus von Graff, 1882.

  2. Muusikamaailm : Philadelphiasse tuleb Eschenbach. Menotti taas Washingtonis. Monteverdi festival Pariisis. Esietendused New Yorgis ja Milanos / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2001-01-01

    C. Eschenbach määrati PO järgmiseks peadirigendiks aastast 2003, dirigendi senisest tegevusest. G.C.Menotti lavastab Washingtoni Ooperis oma ooperit "Konsul". Pariisi Champs Elysees' teatris toimuvast Monteverdi ooperite festivalist. Esietendustest ئ Busoni "Doktor Faust" New Yorgi Metropolitan Operas ja Bellini "La sonnambula" Milano La Scalas

  3. Fuel to the nuclear debate : [Rezension von:] Nuclear power in crisis, Andrew Blowers and David Pepper (editors), New York, Nichols; London ..., Croom Helm, 1987

    OpenAIRE

    Renn, Ortwin

    1988-01-01

    Nuclear energy is one of the most popular topics of today’s publication market. The literature about the pros and cons of nuclear power may easily fill a whole library. Is there anything new to add to this voluminous body of arguments and contra-arguments that would justify editing another book on nuclear energy? Andrew Blowers and David Pepper obviously felt that way and published a reader on Nuclear Power in Crisis. The book consists of 13 articles covering mainly the political, social and ...

  4. First light from student Pascal Keller, Eschenbach/Switzerland on 6-8 June 2014

    Science.gov (United States)

    Monstein, Christian

    2014-05-01

    Pascal Keller, a student during his exams for general qualification for university entrance, recently set up a Long Wavelength Array (LWA) antenna and a Callisto system to observe solar radio burst activity in his back yard (figure 1) in Eschenbach, Switzerland. The antenna, spectrometer and software were provided on loan by Institute for Astronomy, ETH Zurich. On the first observation day he observed his 1st light, a type II solar radio burst and some type III bursts. His aim is now to compare this LWA observation with others from the e-Callisto network, which is composed of different antenna types and different antenna sizes as well different locations worldwide. His first four observations on 6 and 8 June 2014 are presented in figures 2 to 5 and associated tables 1 to 4.

  5. George Andrew Olah

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 12. George Andrew ... Hungarian born American chemist, George Andrew Olah wasa prolific researcher. The central theme ... He leavesbehind a large body of work comprising almost 1500 papersand twenty books for the scientific community.

  6. George Andrews' Game

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 2. George Andrews' Game. Jerold Mathews. General Article Volume 14 Issue 2 February 2009 pp 172-178. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/014/02/0172-0178. Keywords. Fibonacci ...

  7. Millikan, Prof. Robert Andrews

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1935 Honorary. Millikan, Prof. Robert Andrews Nobel Laureate (Physics) - 1923. Date of birth: 22 March 1868. Date of death: 19 December 1953. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the ...

  8. George Andrews' Game

    Indian Academy of Sciences (India)

    Admin

    helping international students learn English. Keywords. Fibonacci numbers, Zecken- dorf's theorem, Andrew's game, greedy algorithm. T his is an expository article show ing how Zeck- endorf's T heorem (every positive integer can be represented in one and only one w ay as the sum of non-consecutive Fibonacci num bers) ...

  9. Interview with Andrew Dalby

    OpenAIRE

    Mac Con Iomaire, Máirtín

    2016-01-01

    Andrew Dalby (born 1947 in Liverpool) is an English linguist, translator and historian and author of numerous articles and several books on a wide range of topics including food history, language, and Classical texts. Dalby studied Latin, French and Greek at the Bristol Grammar School and University of Cambridge. Here he also studied Romance languages and linguistics, earning a bachelor's degree in 1970. Dalby worked for fifteen years at Cambridge University Library, eventually specialising i...

  10. Mortality from Hurricane Andrew.

    Science.gov (United States)

    Lew, E O; Wetli, C V

    1996-05-01

    Hurricane Andrew, a category 4 storm, made landfall in South Florida on August 24, 1992, and caused extensive structural and environmental damage. The Dade County Medical Examiner Department investigated 15 deaths directly related to the storm and another 15 natural deaths indirectly related to the storm. The aftermath of the hurricane continued to create circumstances that lead to 32 accidental deaths, five suicides, and four homicides over the next six months. Traffic fatalities due to uncontrolled intersections accounted for one-third of the post-storm accidental deaths. Dyadic deaths (homicide-suicide) doubled in rate for the six months following the storm. The limited number of direct hurricane deaths is attributed to advance storm warnings, its occurrence on a weekend, the storm's passage through less populated areas of the county, and the relatively modest amount of accompanying rainfall.

  11. Andrew spares Florida Coast

    Science.gov (United States)

    Bush, Susan

    When geologists heard of the intensity of Hurricane Andrew, which struck the Florida coast on August 25 and then moved on to southern Louisiana, they were expecting the same kinds of coastal damage that Hurricane Hugo brought to the Caribbean and Carolina shores in 1989. Both storms were category 4 hurricanes, having winds of 131-155 mph and surges of 13-18 feet. However, the coastal damage never materialized, leaving geologists to analyze the factors that lessened the impact of the storm. “For minimum coastal damage, you couldn't have designed a better storm,” said Orrin Pilkey, director of the Program for the Study of Developed Shorelines (PSDS) in Durham, N.C. This was due in part to the nature of the storm itself and where it hit land, and in part to the regional geology, said Rob Thieler of PSDS. Despite the huge amounts of damage to buildings, there was virtually no evidence of coastal process destruction, he said.

  12. In Memoriam: George Andrew Olah

    Indian Academy of Sciences (India)

    A Nobel Laureate in chemistry, George Andrew Olah, was a giant who transformed many ideas of fundamental organic chemistry. A kind and generous gentleman, ... cluded investigations into superacids and ways to generate and study long-lived carbocations. These investigations led him to distinguish between classical ...

  13. Andrew A. Benson: personal recollections.

    Science.gov (United States)

    Nonomura, Arthur; Lorimer, George; Holtz, Barry; Vacquier, Victor; Biel, Karl Y; Govindjee

    2016-03-01

    Andrew A. Benson, one of the greatest and much loved scientists of our century, passed away on January 16, 2015; he was born on September 24, 1917. A grand celebration of his life was held on February 6, 2015, in California. Here, we present one of his photographs and key excerpts from what was said then, and soon thereafter.

  14. The Americas and Hurricane Andrew

    Science.gov (United States)

    1992-01-01

    Image taken on August 25, 1992 by NOAA GOES-7 of the Americas and Hurricane Andrew.Photo Credit: Image produced by F. Hasler, M. Jentoft-Nilsen, H. Pierce, K. Palaniappan, and M. Manyin. NASA Goddard Lab for Atmospheres - Data from National Oceanic and Atmospheric Administration (NOAA).

  15. Safety and design impact of hurricane Andrew

    International Nuclear Information System (INIS)

    Guey, Ching N.

    2004-01-01

    Turkey Point completed the IPE in June of 1991. Hurricane Andrew landed at Turkey Point on August 24, 1992. Although the safety related systems, components and structures were not damaged by the Hurricane Andrew, certain nonsafety related components and the neighboring fossil plant sustained noticeable damage. Among the major components that were nonsafety related but would affect the PRA of the plant included the service water pumps and the high tower. This paper discusses the safety and design impact of Hurricane Andrew on Turkey Point Nuclear Power Plant. The risk of hurricanes on the interim and evolving plant configurations are briefly described. The risk of the plant from internal events as a result of damage incurred during Hurricane Andrew are discussed. The design change as the result of Hurricane Andrew and its impact on the PRA are presented. (author)

  16. Psychiatric morbidity following Hurricane Andrew.

    Science.gov (United States)

    David, D; Mellman, T A; Mendoza, L M; Kulick-Bell, R; Ironson, G; Schneiderman, N

    1996-07-01

    The nature of psychiatric morbidity in previously non-ill subjects from the area most affected by Hurricane Andrew was investigated at 6-12 months posthurricane. Preliminary associations of morbidity with personal and event-related risk factors were also determined. Fifty one percent (31/61) met criteria for a new-onset disorder, including posttraumatic stress disorder (PTSD) in 36%, major depression (MD) in 30%, and other anxiety disorders in 20%. Thirty four subjects (56%) had significant symptoms persisting beyond 6 months. Having sustained "severe damage" was the risk factor most strongly associated with outcome. Our data underscore the range of psychiatric morbidity related to a natural disaster, and suggest a relationship to chronic stressors.

  17. Obituary: Andrew Stephen Wilson, 1947-2008

    Science.gov (United States)

    Veilleux, Sylvain

    2009-01-01

    On 24 May 2008, Andrew Stephen Wilson passed away at the age of 61, in his home in Silver Spring, Maryland, from complications resulting from a painful spinal illness. Andrew was arguably one of the first truly multi-wavelength astronomers of his generation. His scientific work on active galactic nuclei [AGN] spanned the entire electromagnetic spectrum from the radio to the X-rays. Andrew was born in Doncaster, Yorkshire, England, on 26 March 1947. He was the younger of two brothers whose births were separated by the Second World War. His father, Norman, came from a relatively affluent family who were coal merchants. His mother, Mary, came from a less comfortable background, one of seven children, daughter of a skilled cabinet maker/French polisher, who went through a very hard time during the depression. As a teacher, she placed enormous value on hard work and education as a way of gaining advancement in life. When Andrew was four, the family moved to Skipton, a nice market town in the Yorkshire dales. Andrew went to a small village school until age eleven when he entered Ermysted's Grammar School. He was an enthusiastic soccer and cricket player. He never lost his enthusiasm for soccer and supported the local soccer team, Leeds United, for all his life. Andrew also followed the Yorkshire county cricket team. Andrew's interest in astronomy stemmed from the fact that at Ermysted's Grammar School someone donated a four-inch refracting telescope, so he and his friends used to go back in the evenings to investigate the rings of Saturn, the moons of Jupiter, and various nebulae. While an undergraduate at Cambridge, Andrew joined the astronomy club and ground an 8-inch mirror by hand as a part of a telescope that he set up in the backyard of his parents' house. Andrew spent hours observing with this telescope, and it was the wonder of the family. At Cambridge, Andrew obtained his bachelor's degree with first-class honors in 1969. During a short visit in London with his

  18. A Reanalysis of Hurricane Andrew's Intensity.

    Science.gov (United States)

    Landsea, Christopher W.; Franklin, James L.; McAdie, Colin J.; Beven, John L., II; Gross, James M.; Jarvinen, Brian R.; Pasch, Richard J.; Rappaport, Edward N.; Dunion, Jason P.; Dodge, Peter P.

    2004-11-01

    Hurricane Andrew of 1992 caused unprecedented economic devastation along its path through the Bahamas, southeastern Florida, and Louisiana. Damage in the United States was estimated to be $26 billion (in 1992 dollars), making Andrew one of the most expensive natural disasters in U.S. history. This hurricane struck southeastern Florida with maximum 1-min surface winds estimated in a 1992 poststorm analysis at 125 kt (64 m s-1). This original assessment was primarily based on an adjustment of aircraft reconnaissance flight-level winds to the surface.Based on recent advancements in the understanding of the eyewall wind structure of major hurricanes, the official intensity of Andrew was adjusted upward for five days during its track across the Atlantic Ocean and Gulf of Mexico by the National Hurricane Center Best Track Change Committee. In particular, Andrew is now assessed by the National Hurricane Center to be a Saffir Simpson Hurricane Scale category-5 hurricane (the highest intensity category possible) at its landfall in southeastern Florida, with maximum 1-min winds of 145 kt (75 m s-1). This makes Andrew only the third category-5 hurricane to strike the United States since at least 1900. Implications for how this change impacts society's planning for such extreme events are discussed.

  19. Andrew A. Benson, 1917-2015.

    Science.gov (United States)

    Lichtenthaler, Hartmut K; Buchanan, Bob B; Douce, Roland; Govindjee

    2015-05-01

    On January 16, 2015, Professor Andrew Alm Benson, one of the leading plant biochemists of the twentieth century, died in La Jolla, California, at the age of 97; he was born on September 24, 1917. Benson was known especially for his pioneering studies on photosynthesis (CO2 assimilation, carbon reduction cycle) and plant lipids (phospholipid phosphatidyl glycerol; and the sulfolipid, sulfoquinovosyl diglyceride). A photograph of Benson is shown in Fig. 1. Fig. 1 Photograph of Andrew A. Benson. Annual Review of Plant Biology, Vol. 53, 2002, published with permission.

  20. Dr. Andrew Foster: A Literature Review

    Science.gov (United States)

    Runnels, Joel

    2017-01-01

    Often compared to Laurent Clerc, Thomas Gallaudet, and Alexander Graham Bell, Dr. Andrew Foster was a deaf African American who founded 32 schools for the deaf in 13 African nations. The 60th anniversary of his arrival in Liberia and Ghana and the 30th anniversary of his tragic death in a Rwanda airplane accident both occur in 2017. Renewed…

  1. George Andrew Olah: Across Conventional Lines

    Indian Academy of Sciences (India)

    Permanent link: https://www.ias.ac.in/article/fulltext/reso/022/12/1111-1153. Keywords. Electron-deficient intermediates, Friedel–Crafts chemistry, carbocations, carbanions, methanol economy, anthropogenic chemical carbon cycle. Abstract. Hungarian born American chemist, George Andrew Olah wasa prolific researcher.

  2. Obituary: Andrew Lange (1957-2010)

    Science.gov (United States)

    Kamionkowski, Marc

    2011-12-01

    The worlds of physics and astrophysics were stunned to learn on 22 January 2010 that Andrew Lange, the Marvin L. Goldberger Professor of Physics at Caltech, had taken his own life the night before. He had succumbed to the severe depression that he had suffered from for many years, unbeknownst to even his closest colleagues. Lange will perhaps be best remembered as the co-leader of Boomerang, the balloon-borne experiment that provided the first high-angular-resolution map of the cosmic microwave background (CMB). And while this was certainly his most notable achievement, Andrew amassed a record of accomplishment as an instrumentalist, leader, mentor, and communicator that extended much further. Andrew was born in Urbana, Illinois on July 23, 1957, the son of an architect and a librarian, and raised primarily in Connecticut. His family and early friends remember him as a serious and extremely intelligent child and young man. Andrew Lange's lifelong interest in the CMB was nurtured as an undergraduate at Princeton University by David Wilkinson, and he recalled fondly a summer spent working with John Mather at Goddard Space Flight Center. Andrew Lange went to graduate school in physics at Berkeley where he worked in Paul Richards' group. Although his thesis project, the Berkeley-Nagoya rocket experiment, showed an anomalous sub-millimeter excess in the CMB spectrum that was shortly thereafter shown by a later flight of the same rocket and COBE-FIRAS to be incorrect, Lange's talents were recognized by the physics department at Berkeley who appointed him shortly after his PhD (1987) to their faculty. While on the Berkeley faculty, Andrew obtained early detections of the Sunyaev-Zeldovich effect, upper limits to small-angle CMB fluctuations, and important infrared constraints to the interstellar medium. He also led a pioneering instrument operating 300 mK detectors for a small infrared satellite experiment. This early work showed high ambition and daring, and it pioneered

  3. A History of the Andrew File System

    CERN Multimedia

    CERN. Geneva; Altman, Jeffrey

    2011-01-01

    Derrick Brashear and Jeffrey Altman will present a technical history of the evolution of Andrew File System starting with the early days of the Andrew Project at Carnegie Mellon through the commercialization by Transarc Corporation and IBM and a decade of OpenAFS. The talk will be technical with a focus on the various decisions and implementation trade-offs that were made over the course of AFS versions 1 through 4, the development of the Distributed Computing Environment Distributed File System (DCE DFS), and the course of the OpenAFS development community. The speakers will also discuss the various AFS branches developed at the University of Michigan, Massachusetts Institute of Technology and Carnegie Mellon University.

  4. Andrew shortens lifetime of Louisiana Barrier Islands

    Science.gov (United States)

    Bush, Susan

    Because the Isles Dernieres, a series of four barrier islands off the coast of Louisiana, have one of the most rapidly eroding shorelines in the world, geologists at the U.S. Geological Survey and the Louisiana Geological Survey have been monitoring erosion activity over the last several years, said Jeff Williams of the USGS in Reston, Va. Hurricane Andrew, which struck the state on August 26, caused severe erosional damage to these islands that has shortened their lifetimes.Before Andrew struck, geologists projected that Raccoon Island would disappear below sea level by the year 2001 and that Whiskey Island would disappear by 2016. Now, due to the severe erosion from Hurricane Andrew, the scientists claim that the islands may disappear before the turn of the century, and the other islands in the Dernieres chain are expected to follow suit within 2 decades. Raccoon, Whiskey, Trinity, and East islands make up the Isles Dernieres, which existed as one island, known as the Isle Derniere, before an 1856 hurricane and subsequent erosion.

  5. Children describe life after Hurricane Andrew.

    Science.gov (United States)

    Coffman, S

    1994-01-01

    Hurricane Andrew, which devastated the south Florida coast in August 1992, left over 250,000 people homeless with multiple health and social problems. This nursing study explored the experiences of 17 children, ages 5 through 12, who lived in the geographic area of storm damage. Common experiences described by the children included remembering the storm, dealing with after-effects, and reestablishing a new life. In general, children described a sense of strangeness, articulated as "life is weird" after the hurricane. In addition to stressful responses, many positive reactions were described by children in the study, revealing that the disaster also had a maturing effect.

  6. Carl Von Clausewitz's on War A Modern-Day Interpretation of a Strategy Classic

    CERN Document Server

    Holmes, Andrew

    2010-01-01

    Here, Andrew Holmes' interpretation of On War illustrates the timeless nature of von Clausewitz's insights by bringing them to life through 52 modern case studies of business and society. This brilliant interpretation of On War is an entertaining accompaniment to one of the most famous strategy books ever written.

  7. Shallow water currents during Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Glenn, Scott M.

    1999-10-01

    Oceanographic measurements are used in combination with a numerical model to examine the influence of stratification on shallow water currents during the directly forced stage of a tropical cyclone (Hurricane Andrew) on the continental shelf. The following stratification-dependent coastal processes are examined: (1) turbulent mixing, (2) coastally trapped waves, (3) near-inertial oscillations, and (4) upwelling and downwelling. Turbulent mixing was strong within 1 Rw (radius of maximum winds) of the storm track, and stratification was nearly destroyed. Turbulent mixing was weak at distances greater than 2 Rw. The dominant coastal wave was a barotropic Kelvin wave generated as the storm surge relaxed after landfall. Baroclinic near-inertial oscillations were dominant at the shelf break and occurred along with a barotropic response on the middle shelf. Downwelling-favorable flow developed east of the track prior to the storm peak, and upwelling-favorable flow evolved west of the track as the eye crossed the shelf. The idealized storm flow was modified by local barotropic and baroclinic pressure gradients on the shelf. Ocean circulation during Hurricane Andrew was hindcast using both stratified and unstratified three-dimensional numerical models. For areas within 1 Rw of the storm track, the unstratified model matched the observed currents better than the stratified model, partly because of errors in the initial stratification. At distances greater than 2 Rw the influence of stratification increases, and the unstratified model does not reproduce the observed upwelling-favorable flow.

  8. von Neumann Morgenstern Preferences

    DEFF Research Database (Denmark)

    Vind, Karl

    von Neumann Morgenstern utility is generalized to von Neumann Morgenstern preferences. The proof is an application of simple hyperplane theorems......von Neumann Morgenstern utility is generalized to von Neumann Morgenstern preferences. The proof is an application of simple hyperplane theorems...

  9. von Neumann Morgenstern Preferences

    DEFF Research Database (Denmark)

    Vind, Karl

    2000-01-01

    von Neumann Morgenstern utility is generalized to von Neumann Morgenstern preferences. The proof is an application of simple hyperplane theorems......von Neumann Morgenstern utility is generalized to von Neumann Morgenstern preferences. The proof is an application of simple hyperplane theorems...

  10. Remote sensing for hurricane Andrew impact assessment

    Science.gov (United States)

    Davis, Bruce A.; Schmidt, Nicholas

    1994-01-01

    Stennis Space Center personnel flew a Learjet equipped with instrumentation designed to acquire imagery in many spectral bands into areas most damaged by Hurricane Andrew. The calibrated airborne multispectral scanner (CAMS), a NASA-developed sensor, and a Zeiss camera acquired images of these areas. The information derived from the imagery was used to assist Florida officials in assessing the devastation caused by the hurricane. The imagery provided the relief teams with an assessment of the debris covering roads and highways so cleanup plans could be prioritized. The imagery also mapped the level of damage in residential and commercial areas of southern Florida and provided maps of beaches and land cover for determination of beach loss and vegetation damage, particularly the mangrove population. Stennis Space Center personnel demonstrated the ability to respond quickly and the value of such response in an emergency situation. The digital imagery from the CAMS can be processed, analyzed, and developed into products for field crews faster than conventional photography. The resulting information is versatile and allows for rapid updating and editing. Stennis Space Center and state officials worked diligently to compile information to complete analyses of the hurricane's impact.

  11. Hurricane Andrew and a pediatric emergency department.

    Science.gov (United States)

    Quinn, B; Baker, R; Pratt, J

    1994-04-01

    To determine the effect of Hurricane Andrew on a pediatric emergency department. A retrospective analysis of ED visits through the use of computerized records and chart review. A children's hospital in South Florida. All patients presenting to the ED during the control week and the two study weeks after the hurricane. Census, diagnoses, admission rate, and patient geographic origin and age. During week 1, there was an average daily increase of 40.7% in patient volume (P < .01) and a 3.3% decrease in the admission rate (P < .01). The increased census was due mainly to local patients, rather than those from the most devastated areas. More patients were seen with open wounds, gastroenteritis, and impetigo (all, P < .05); more were more than 18 years old (P < .05). By the second week, both census and admission rate returned to normal; cases of cellulitis (P < .05) and open wounds (P < .001) were increased. Although not statistically significant, a higher percentage of hydrocarbon and/or bleach ingestions was seen for both weeks. Following a hurricane, personnel in a pediatric ED can expect to see an increased census, with more diagnoses of open wounds, gastroenteritis, and skin infections. They may also see hydrocarbon and bleach ingestions. Alerting parents to the potential for injury and accidental poisoning in their children after a hurricane may help prevent the reported morbidity.

  12. Andrew Smith: peame leidma tee majanduskasvuni, mis põhineb säästmisel, investeeringutel ja ekspordil / Andrew Smith

    Index Scriptorium Estoniae

    Smith, Andrew

    2010-01-01

    KPMG (UK) peaökonomist Andrew Smith vastab küsimustele, mis puudutavad majanduskriisi tekkimist, olukorra paranemist, majandusolukorda Suurbritannias, erinevusi Euroopa ja muude maailma piirkondade vahel, sarnasusi Eesti ja Suurbritannia majandusolukorra vahel ning prognoose edaspidiste arengute osas

  13. Rheologie von Beschichtungen

    Science.gov (United States)

    Schäffler, Michael

    Die Rheologie beschreibt die Fließ- und Deformationseigenschaften von Materialien. Der Begriff Rheologie ist aus dem Griechischen abgeleitet: rhein - fließen. Erst im Jahre 1930 entwickelte E.C. Bingham und M. Reiner in Easton (USA) die Rheologie zu einer eigenständigen Wissenschaft. Aber bereits seit dem 17. Jahrhundert wurden wesentliche Einzelbeiträge zu Fließphänomenen veröffentlich, so z.B. 1676 von R. Hooke (Hookesches Gesetz) und 1687 von I. Newton (Newtonsches Gesetz). Die Rheologie hat sich bis heute immer mehr zu einer interdisziplinären Wissenschaft entwickelt, die die mechanischen Eigenschaften von Materialien charakterisiert.

  14. Appreciating Unity in Diversity: An Interview with Andrew Solomon

    Science.gov (United States)

    Peters, Dane L.

    2014-01-01

    The theme of the AMS 2014 Annual Conference is "Unity in Diversity," a concept that also describes the work of conference keynote speaker Andrew Solomon. Solomon is a writer and lecturer on psychology and politics; winner of the National Book Award; and an activist for LGBT [lesbian, gay, bisexual, and transgender] rights, mental health,…

  15. Hurricane Andrew in Florida: Dynamics of a Disaster.

    Science.gov (United States)

    Willoughby, H. E.; Black, P. G.

    1996-03-01

    Four meteorological factors aggravated the devastation when Hurricane Andrew struck South Florida: completed replacement of the original eyewall by an outer, concentric eyewall while Andrew was still at sea; storm translation so fast that the eye crossed the populated coastline before the influence of land could weaken it appreciably, extreme wind speed, 82 m s1 winds measured by aircraft flying at 2.5 km; and formation of an intense, but nontornadic, convective vortex in the eyewall at the time of landfall. Although Andrew weakened for 12 h during the eyewall replacement, it contained vigorous convection and was reintensifying rapidly as it passed onshore. The Gulf Stream just offshore was warm enough to support a sea level pressure 20-30 hPa lower than the 922 hPa attained, but Andrew bit land before it could reach this potential. The difficult-to-predict mesoscale and vortex-scale phenomena determined the course of events on that windy morning, not a long-term trend toward worse hurricanes.

  16. Hurricane Andrew: Parent Conflict As a Moderator of Children's Adjustment.

    Science.gov (United States)

    Wasserstein, Shari B.; La Greca, Annette M.

    1998-01-01

    Three months after Hurricane Andrew, 89 children in grades four to six who lived in two-parent families and had experienced the hurricane were tested. Children's symptoms of posttraumatic stress disorder were related to their perceptions of parental conflict; this relationship was stronger for Hispanic children than for other ethnic groups.…

  17. The Mental Health Counselor's Role in Hurricane Andrew.

    Science.gov (United States)

    Dingman, Robert L.

    1995-01-01

    Discusses the effects of Hurricane Andrew on disaster workers, followed by some reported experiences of workers as well as victims. Background on natural disasters in general is given, along with information about crisis intervention. Discusses mental health interventions and various skills needed by disaster mental health counselors. (Author/KW)

  18. Andrew Tracey: Performer, Scholar, Teacher, Mentor | Thram | South ...

    African Journals Online (AJOL)

    A Legacy to Uphold Born to follow in his father Hugh Tracey's footsteps, Andrew Tracey has inspired countless people with his knowledge of African music. This he has done through his publications and films and his teaching and performing from the early days of his career in the 1960s through his Directorship of the ...

  19. Interview with Abel Laureate Sir Andrew J. Wiles

    DEFF Research Database (Denmark)

    Raussen, Martin Hubert; Skau, Christian

    2017-01-01

    Andrew J. Wiles is the recipient of the 2016 Abel Prize of the Norwegian Academy of Science and Letters. The interview was conducted by Martin Raussen And Christian Skau in Oslo on May 23, 2016, in conjunction with the Abel Prize celebration....

  20. Von Triers kristendom

    DEFF Research Database (Denmark)

    Søndergaard, Leif

    2009-01-01

    Lars von Trier er i hans film Antichrist i sin negation af kristendommen stærkt bundet til kristendommens dualistiske verdensbillede. Samtidig er filmen kvindefjendsk. Udgivelsesdato: 2. september......Lars von Trier er i hans film Antichrist i sin negation af kristendommen stærkt bundet til kristendommens dualistiske verdensbillede. Samtidig er filmen kvindefjendsk. Udgivelsesdato: 2. september...

  1. Impact of Hurricane Andrew on FPL generation facilities

    International Nuclear Information System (INIS)

    Brannen, W.F.; Adams, R.L.

    1993-01-01

    In the pre-dawn hours of August 25, 1992, Hurricane Andrew made landfall in southern Dade County, Florida. The storm approached directly from the east and moved rapidly across the State and into the Gulf of Mexico. Andrew's intense winds caused unprecedented devastation to structures and facilities in its path. Not surprisingly, Florida Power and Light's (FPL) generation, transmission and distribution facilities in south Florida also suffered extensive damage. Two of FPL's electrical generating sites were located in the direct path of the storm and received its full brunt. This paper presents a review of the damage sustained by those plants, an overview of the unique recovery challenges encountered and a summary of the lessons learned from this experience

  2. Carl von Clausewitz

    DEFF Research Database (Denmark)

    Højrup, Thomas

    2009-01-01

    Forskningsbaseret præsentation af Carl von Clausewitz' krigsteori og dens betydning for statsbegrebet og udviklingen af teori om statsdannelse og statssystem. Krigsbegrebets betydning for politikbegrebet ekspliciteres, og de indre relationer imellem de to begreber demonstreres med konkrete eksemp...

  3. Ellis Von Creveld Syndrome

    Directory of Open Access Journals (Sweden)

    Afshar H

    1999-01-01

    Full Text Available One patient with Ellis Von Creveld syndrome contains: dwarfism, congenital heart"ndisease, ectodermal dysplasia, polyductyly, an abnormally wide labial frenum and maxillary"nmolars with single root.

  4. Injuries and illnesses related to Hurricane Andrew--Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    On August 26, 1992, Hurricane Andrew struck Louisiana. On August 24, in anticipation of hurricane-related injuries and illnesses, the Office of Public Health (OPH), Louisiana Department of Health and Hospitals, in cooperation with hospital emergency room (ER) and public utility personnel and coroners, established an active emergency surveillance system in 19 parishes to monitor these events. This report summarizes the findings from this emergency surveillance system.

  5. Lars von Triers film

    DEFF Research Database (Denmark)

    Nielsen, Lisbeth Overgaard

    2007-01-01

    Afhandlingen undersøger Lars von Triers filmæstetik, som den kommer til udtryk i spillefilmene fra perioden 1984-2007. Afhandlingen analyserer de enkelte films stil, virkningsstrategi og betydningsdannelse.......Afhandlingen undersøger Lars von Triers filmæstetik, som den kommer til udtryk i spillefilmene fra perioden 1984-2007. Afhandlingen analyserer de enkelte films stil, virkningsstrategi og betydningsdannelse....

  6. Interview with 2018 Hooke medal winner Andrew McAinsh.

    Science.gov (United States)

    2018-03-14

    Andrew McAinsh received his PhD from the University of Cambridge, UK, working in the laboratory of Steve Jackson on DNA damage and repair mechanisms in yeast. He then joined the laboratory of Peter Sorger as a Jane Coffin Childs Fellow to work as a post-doc on kinetochore biology at the Massachusetts Institute of Technology, Boston, USA. In 2005, he returned to the UK to establish his independent laboratory at the Marie Curie Research Institute, Surrey, before moving to the University of Warwick in 2009 to co-found the Centre for Mechanochemical Cell Biology (CMCB). Subsequently, Andrew was appointed Professor of Cell Biology and became a Wellcome Senior Investigator, and was awarded a Royal Society Wolfson Research Merit Award. He co-directs the MRC Doctoral Training Partnership in Interdisciplinary Biomedical Research, and in 2017 became Head of Division of Biomedical Sciences at Warwick Medical School. Andrew is interested in understanding how the chromosomal multi-protein complex, the kinetochore, ensures error-free chromosome segregation. He is the recipient of the 2018 Hooke medal, established to recognize an emerging leader in cell biology. The Hooke medal is awarded at the annual spring meeting of the British Society for Cell Biology (BSCB). © 2018. Published by The Company of Biologists Ltd.

  7. A pioneer of tropical medicine worldwide: Andrew Balfour, of Khartoum.

    Science.gov (United States)

    Adeel, Ahmed A A

    2013-01-01

    This is an archival account of the career of Sir Andrew Balfour in Khartoum, Sudan during the period 1902 to 1913. As the first director of the Wellcome Tropical Research Laboratories in Khartoum during the period, Andrew Balfour was tasked with establishing the laboratories and at the same time he was engaged in founding the health services in Khartoum. Balfour worked in close collaboration and support from Henry Wellcome and Reginald Wingate, the Governor General of the Sudan. The energetic and meticulous sanitary work of Balfour had a remarkable impact, with Khartoum declared mosquito-free by 1910. Establishing a research base in the laboratories was met with many challenges but eventually Balfour managed to recruit a team of dedicated researchers and to produce well-circulated publications in tropical medicine. Balfour's work in Khartoum later lead him to a distinguished career in tropical medicine. In 1923 he was appointed the first Director of London School of Hygiene and Tropical Medicine. He was also elected President of the Royal Society of Tropical Medicine and Hygiene (1925-27). Sir Andrew Balfour, KCMG, CB, LL D (1873 -1931).

  8. Lars von Triers filmterapeutiske laboratorium

    DEFF Research Database (Denmark)

    Christoffersen, Erik Exe

    2012-01-01

    Artiklen diskuterer det parataktiske som dramaturgisk princip i forhold til Lars von Triers film.......Artiklen diskuterer det parataktiske som dramaturgisk princip i forhold til Lars von Triers film....

  9. The MacAndrew Scale as a measure of substance of abuse and delinquency among adolescents.

    Science.gov (United States)

    Rathus, S A; Fox, J A; Ortins, J B

    1980-04-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 suburban high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse, but was also shown to be related to crimes against property and persons and to marijuana usage. It was concluded that the MacAndrew Alcoholism Scale may not be uniquely sensitive to alcohol abuse among the population sampled.

  10. The Center for Adventist Research at Andrews University

    Directory of Open Access Journals (Sweden)

    Terry Dwain Robertson

    2015-01-01

    Full Text Available The Center for Adventist Research (CAR, an Andrews University and General Conference of Seventh-day Adventist organization, seeks to promote an understanding and appreciation of the heritage and mission of the Seventh-day Adventist Church (SDA. It combines the resources of the James White Library’s Adventist Heritage Center and the Ellen G. White Estate Branch Office to provide the most extensive collection of Adventist related resources in the world, both physically and digitally. An introduction to the background, collections, and activities of CAR is presented. Of particular interest are the digitization projects.

  11. Micropropagation and in vitro conservation of vanilla (Vanilla planifolia Andrews).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal

    2009-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a source of natural vanillin, plays a major positive role in the economy of several countries. A native to the Central America, its primary gene pool is threatened by deforestation and over collection that has resulted in disappearance of natural habitats and wild species. Therefore, multiplication and conservation of vanilla diversity is of paramount importance because of its narrow genetic base. It plays an important role in the production of disease free planting material for commercial cultivation. Simple protocols for micropropagation, in vitro conservation and synthetic seed production are described in this chapter which could further be applied to other related vanilla species as well.

  12. Prediction of posttraumatic stress symptoms in children after hurricane Andrew.

    Science.gov (United States)

    Vernberg, E M; Silverman, W K; La Greca, A M; Prinstein, M J

    1996-05-01

    The authors used an integrative conceptual model to examine the emergence of posttraumatic stress disorder (PTSD) symptoms in 568 elementary school-age children 3 months after Hurricane Andrew. The model included 4 primary factors: Exposure to Traumatic Events, Child Characteristics, Access to Social Support, and Children's Coping. Overall, 62% of the variance in children's self-reported PTSD symptoms was accounted for by the 4 primary factors, and each factor improved overall prediction of symptoms when entered in the analyses in the order specified by the conceptual model. The findings suggest that the conceptual model may be helpful to organize research and intervention efforts in the wake of natural disasters.

  13. Potenzial von Fahrgemeinschaften

    OpenAIRE

    Mühlethaler, Franz; Axhausen, Kay W.; Ciari, Francesco; Tschannen-Süess, Monika; Gertsch-Jossi, Ursula

    2011-01-01

    Wenn eine Person für eine Fahrt, welche sie ohnehin durchführt, in ihrem Auto andere Personen mitnimmt, dann spricht man von einer Fahrgemeinschaft oder im englischen Sprachgebrauch von Car Pooling. Die Idee, diese Mobilitätsform durch Vermittlung ge- zielt zu fördern, stammt aus der Zeit des „Ölschocks“ in den Siebzigerjahren des letzten Jahrhunderts und wurde seither in vielen Ländern auf unterschiedliche Art verfolgt. Trotz einigen Erfolgen bleibt der Eindruck, dass Car Pooling sein vorhan...

  14. Pharmaceutical services at a medical site after Hurricane Andrew.

    Science.gov (United States)

    Nestor, A; Aviles, A I; Kummerle, D R; Barclay, L P; Rey, J A

    1993-09-01

    The experiences of a group of volunteer clinical pharmacists who provided pharmacy services as part of a disaster relief effort following a hurricane are reported. Hurricane Andrew left many people in southern Florida without shelter and other basic necessities, including health care services. A group of seven pharmacists volunteered to provide services at a temporary medical site set up in a community center. The pharmacy stock consisted of donated drugs. The pharmacists dispensed medications directly to patients and worked closely with other volunteer medical personnel to make sure proper medications were used. Because the pharmacy stock was limited, physicians relied upon the pharmacists for information about therapeutic interchanges, dosage conversions, and new medications. Prescriptions were often ordered and dispensed with only oral instructions. The pharmacists also provided patient counseling, although problems caused by inexperience with certain types of patients, a language barrier, and substandard living conditions after the hurricane made counseling more difficult. The contributions of seven pharmacists who provided services at an emergency medical site after Hurricane Andrew were well received by other health care personnel and by the community.

  15. Posttraumatic stress disorder in adolescents after Hurricane Andrew.

    Science.gov (United States)

    Garrison, C Z; Bryant, E S; Addy, C L; Spurrier, P G; Freedy, J R; Kilpatrick, D G

    1995-09-01

    To examine rates and correlates of posttraumatic stress disorder (PTSD) in adolescents after Hurricane Andrew. A random-digit dialing sample of 158 Hispanic, 116 black, and 104 white adolescent-parent pairs were surveyed in high- and low-impact areas within Dade County, Florida, 6 months after Hurricane Andrew. Subjects completed a structured telephone interview focused on within-disaster experiences and emotional reaction, disaster-related losses, lifetime exposure to violent or traumatic events, recent stressful experiences, and psychiatric symptomatology. Approximately 3% of males (95% confidence interval 0.4 to 5.3) and 9% of females (95% confidence interval 4.6 to 13.7) met the criteria for PTSD. Rates were highest among blacks (8.3%, 95% confidence interval 2.3 to 14.2) and Hispanics (6.1%, 95% confidence interval 2.2 to 9.9) and increased with age (odds ratio of 1.34, 95% confidence interval 1.04 to 1.72) and the number of undesirable events reported (odds ratio of 1.38, 95% confidence interval 1.21 to 1.57). While only a relatively small percentage of adolescents reported symptoms consistent with a diagnosis of PTSD, most reported some posttraumatic symptoms. Postdisaster planning should recognize that common stressful events occurring after disasters may be more strongly associated with PTSD than magnitude of contact with the actual disaster.

  16. Hurricane Andrew-related injuries and illnesses, Louisiana, 1992.

    Science.gov (United States)

    McNabb, S J; Kelso, K Y; Wilson, S A; McFarland, L; Farley, T A

    1995-06-01

    To determine the extent and types of injuries and illnesses in Louisiana associated with or related to Hurricane Andrew, we gathered data from hospital emergency departments and coroner's offices on demographic variables, institution, nature and cause of the injury or illness, body part affected, location, and date and time of the event. A hurricane-related injury or illness was defined as one that occurred from noon on August 24, 1992, through midnight on September 21, 1992, as a direct or indirect result of the preparation for (preimpact), the impact of, or the clean-up after the hurricane (postimpact). Nineteen parishes in south-central Louisiana that were most affected by Hurricane Andrew provided data from patients seen in emergency departments and reports from coroner's offices. Active, advance surveillance of this type promotes and facilitates the reporting of disaster-related health outcomes. Future planning for hurricanes should take into account the high rate of cuts, lacerations, and puncture wounds, particularly during the postimpact phase.

  17. Biologischer Anbau von Strauchbeeren

    OpenAIRE

    Schmid, Andi

    2004-01-01

    Das Merkblatt enthält auf Österreich angepasste, praxisnahe Informationen zur Produktion von hochwertigen Strauchbeeren wie Himbeeren, Brombeeren, Johannisbeeren, Stachelbeeren und Heidelbeeren. Weiterhin: übersichtliche Hinweise zur Planung, Standortwahl, Sortenauswahl, Bodenvorbereitung und Pflanzung, Bewässerung, Nährstoffversorgung, Witterungsschutz, Beikrautregulierung, Ernte und Lagerung. (Diese Publikation enthält spezifische Informationen für Österreich)

  18. Rhizostomeen von Manila

    NARCIS (Netherlands)

    Stiasny, G.

    1924-01-01

    Die hier beschriebene kleine Scyphomedusen-Sammlung wurde von Herrn Director P. B. Sivickis, Dept. of Zoology, University of Philippines, Manila, dem Rijksmuseum van Natuurlijke Historie in Leiden überwiesen. Das Material wurde im December 1922 in Manila-bay gefischt und befindet sich in bestem

  19. Energetische Verwertung von Biomasse

    Science.gov (United States)

    Zahoransky, Richard; Allelein, Hans-Josef; Bollin, Elmar; Oehler, Helmut; Schelling, Udo

    Etwa 0,1% der Solarenergie wandeln sich durch Photosynthese aus dem Kohlendioxid der Luft in Biomasse um. Die Biomassen sind als Festbrennstoff nutzbar oder zu gasförmigen Brennstoffen weiterverarbeitbar. Zwei Arten von Biomassen sind zu unterscheiden: Anfallende Biomasse

  20. Justus Freiherr von Liebig

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 8. Justus Freiherr von Liebig. Gopalpur Nagendrappa. General Article Volume 18 Issue 8 August 2013 pp 691-711. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/018/08/0691-0711. Keywords.

  1. Justus Freiherr von Liebig

    Indian Academy of Sciences (India)

    IAS Admin

    He is currently in Jain Univer- sity, Bangalore. He continues to teach and do research. His work is in the area of organosilicon chemistry, synthetic and ... always openly for truth, who is recognised as supreme not only in his own field, but in the whole realm of thought. Justus von Liebig is his name”. These were the words by ...

  2. Vroeë Oos-Kaapse tekste: Andrew Geddes Bain (1797-1864) | van ...

    African Journals Online (AJOL)

    Early Eastern Cape Texts: Andrew Geddes Bain (1797-1864) [Afrikaans] Andrew Geddes Bain: fervent letter writer of satirical sketches of contemporary life, transport entrepeneur, military man, farmer, builder of bridges in the dry stone walling technique, autodidact, discoverer of the "Blinkwater Monster" fossil, as well as ...

  3. The Implementation of IAS 16 and IAS 41 at Andrew Peller Limited

    Science.gov (United States)

    Lapointe-Antunes, Pascale; Moore, James

    2013-01-01

    This case asks students to play the role of Doug Grodeckie, Manager of Financial Reporting at Andrew Peller Limited (APL). Doug was asked to prepare a report analyzing Andrew Peller Limited's current tangible long-lived assets disclosures and making recommendations on how best to comply with International Accounting Standard (IAS) 16 Property,…

  4. The MacAndrew Scale as a Measure of Substance Abuse and Delinquency among Adolescents.

    Science.gov (United States)

    Rathus, Spencer A.; And Others

    1980-01-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse but was also related to crimes against property and persons and to marijuana usage. (Author)

  5. Pamela Ngesa A Review of George Gonaís Andrew Mtagwaba ...

    African Journals Online (AJOL)

    Jimmy Gitonga

    Review of George Gona's Andrew Mtagwaba Kailembo: The Life and Times of an African Trade Unionist 173. Review of ... renowned Tanzanian labour movement leader, Andrew Mtagwaba Kailembo has received little .... hanging rather loosely, without clearly showing their role on the road to Pan-African trade union unity.

  6. The paths of Andrew A. Benson: a radio-autobiography.

    Science.gov (United States)

    Nonomura, Arthur M; Holtz, Barry; Biel, Karl Y; Cooney, Robert; Lorimer, George; Govindjee

    2017-10-01

    Andrew A. Benson, one of the greatest biochemists of our time, is celebrated on his centennial by the authors with whom he interacted performing experiments or contemplating metabolic pathways in a wide range of biological kingdoms. He charted the chemical flow of energy in cells, tissues, organs, plants, animals, and ecosystems. Benson collaborated with hundreds of colleagues to examine the natural history of autotrophy, mixotrophy, and heterotrophy while elucidating metabolic pathways. We present here a biological perspective of his body of studies. Benson lived from September 24, 1917, to January 16, 2015. Out of over 1000 autoradiograms he produced in his life, he left a legacy of 50 labeled autoradiograms to the authors who tell the story of his life's work that resulted in Benson's Protocol (Nonomura et al., Photosynth Res 127:369-378, 2016) that has been applied, over the years, for the elucidation of major metabolic pathways by many scientists.

  7. Measurement of perceived disruption during rebuilding following Hurricane Andrew.

    Science.gov (United States)

    Burnett, K; Ironson, G; Benight, C; Wynings, C; Greenwood, D; Carver, C S; Cruess, D; Baum, A; Schneiderman, N

    1997-10-01

    The purpose of this study was to develop and evaluate a measure of perceived disruption during rebuilding following a disaster. Two eight-item scales, which measured intensity of disruption during the entire repair phase (Intensity-RP) and intensity of disruption during the past month (Intensity-PM) were developed and administered to 135 survivors of Hurricane Andrew. At 9 to 12 months postdisaster, Intensity-RP and Intensity-PM were both significantly associated with scores on the Global Severity Index of the SCL-90-R, and with scores on the Impact of Event-Intrusion Scale; Intensity-PM alone was significantly associated with PTSD scores. Regression analyses indicated that each scale contributed significant unique variance in predicting mental health symptoms, even after controlling for relevant demographic and initial disaster exposure variables.

  8. Food-related coping strategies after Hurricane Andrew.

    Science.gov (United States)

    Magnus, M H

    1994-06-01

    This telephone survey examined food-related coping strategies in Floridian households after Hurricane Andrew. Approximately 137 households of university faculty and staff who lived in hurricane-damaged areas were interviewed. The average respondent was a college-educated woman between 41 and 60 years old. Prevailing food-purchasing problems included food stores that were either closed, without perishable food, distant, or crowded. In the absence of electricity and water, changes in food preparation included preparation of meals without a stove, more frequent use of grills and canned food, simpler meals, and less cooking. Changes in kitchen cleanup included using more disposables, cleaning more often, washing dishes by hand, and cleaning up less often because of damage in the kitchen. Respondents indicated that the hurricane experience taught them that they should have acquired more general supplies (eg, coolers, thermoses, propane stoves, and gas burners), more water and ice, and more nonperishable foods before the hurricane.

  9. Philip Andrew Traynor, DDS, FACD, (1874-1962).

    Science.gov (United States)

    Reed, R V

    1996-11-01

    Philip Andrew Traynor was arguably Delaware's most peerless dentist during his lifetime and even until today. He touched many lives, advanced the prestige of the dental profession, and served his state and country unselfishly as a national legislator. Forceful, no nonsense, take charge, persuasive, athlete, soldier, politico, legislator, canine judge, vocalist, dentist--all words that have been used to identify and describe this remarkable, unwonted, and extraordinary man--truly a dental diamond from the Diamond State. Historically it is important to view Traynor's wide ranging accomplishments in perspective. An Irish Catholic and son of the nation's second smallest state, Dr. Traynor affected the lives of thousands of people the length and breadth of his state and even his nation. Whether at the dental chair or congressional lecturn, Philip A. Traynor, a dual savant, imprinted his hallmark. This paper details the unselfish life of a perspicacious man and exceptional dentist, Philip A. Traynor, DDS.

  10. Deaths related to Hurricane Andrew in Florida and Louisiana, 1992.

    Science.gov (United States)

    Combs, D L; Parrish, R G; McNabb, S J; Davis, J H

    1996-06-01

    Information about circumstances leading to disaster-related deaths helps emergency response coordinators and other public health officials respond to the needs of disaster victims and develop policies for reducing the mortality and morbidity of future disasters. In this paper, we describe the decedent population, circumstances of death, and population-based mortality rates related to Hurricane Andrew, and propose recommendations for evaluating and reducing the public health impact of natural disasters. To ascertain the number and circumstances of deaths attributed to Hurricane Andrew in Florida and Louisiana, we contacted medical examiners in 11 Florida counties and coroners in 36 Louisiana parishes. In Florida medical examiners attributed 44 deaths to the hurricane. The mortality rate for directly-related deaths was 4.4 per 1 000 000 population and that for indirectly-related deaths was 8.5 per 1 000 000 population. In Louisiana, coroners attributed 11 resident deaths to the hurricane. Mortality rates were 0.6 per 1000 000 population for deaths directly related to the storm and 2.8 for deaths indirectly related to the storm. Six additional deaths occurred among non-residents who drowned in international waters in the Gulf of Mexico. In both Florida and Louisiana, mortality rates generally increased with age and were higher among whites and males. In addition to encouraging people to follow existing recommendations, we recommend emphasizing safe driving practices during evacuation and clean-up, equipping shelters with basic medical needs for the population served, and modifying zoning and housing legislation. We also recommend developing and using a standard definition for disaster-related deaths, and using population-based statistics to describe the public health effectiveness of policies intended to reduce disaster-related mortality.

  11. Optimierung von Kommunikationsnetzen

    Science.gov (United States)

    Eberspächer, Jörg; Kiese, Moritz; Wessäly, Roland

    Die weltweiten Telekommunikationsnetze (Telefon-, Mobilfunknetze, Internet) bilden heute das Nervensystem von Wirtschaft und Gesellschaft. Durch den anhaltenden technologischen Fortschritt in der Elektronik, der Computer- und Kommunikationstechnik steigt nicht nur die Zahl der Teilnehmer in den Netzen ständig, sondern es entstehen auch laufend neue Anwendungen, wie Radio und Fernsehen im Internet, elektronischer Handel und interaktive Spiele im Internet. Auf den Kupfer- und Glasfaserkabeln sowie den Funkstrecken werden gigantische Informationsmengen transportiert. Das Verkehrs-wachstum ist nach wie vor exponentiell.

  12. Kommunikative Konstitution von Organisationen

    DEFF Research Database (Denmark)

    Schoeneborn, Dennis; Wehmeier, Stefan

    2014-01-01

    Beiträge zur Unternehmenskommunikation behandeln in der Regel (strategisch) geplante interne oder externe Kommunikation. Der vorliegende Beitrag stellt einen alternativen Theorieansatz vor, der aktuell im nordamerikanischen Forschungsgebiet „Organizational Communication“ vorherrschend ist....... zunehmende Aufmerksamkeit erhält Der sogenannten „CCO-Perspektive“ („Communicative Constitution of Organizations“) zufolge bestehen Unternehmen aus einer Vielzahl von internen und externen Kommunikationspraktiken, die nur in bedingtem Maße strategisch steuerbar sind. Zugleich sind es eben diese...

  13. Extraktion von Produktfamilienanforderungen aus Benutzerdokumentation

    OpenAIRE

    John, I.; Doerr, J.

    2003-01-01

    Existierende Software wird oft von Dokumentation wie beispielsweise Benutzerhandbüchern begleitet. Diese Dokumentation ist eine wichtige Quelle für eine neue Produktfamilie. Durch das gezielte Nutzen von existierender Dokumentation können Experten entlastet und existierende Systeme reibungsloser integriert werden. Dieses Kapitel beschreibt eine Methode zur strukturierten Extraktion von Anforderungen an eine Produktfamilie aus der Benutzerdokumentation existierender Altsysteme. Mit Hilfe der M...

  14. Nutzerorientiertes Management von materiellen und immateriellen Informationsobjekten

    OpenAIRE

    Hübsch, Chris

    2001-01-01

    Schaffung einer stabilen, erweiterbaren und skalierbaren Infrastruktur für die Bereitstellung von Diensten im Umfeld von Bibliotheken und ähnlichen wissensanbietenden Einrichtungen unter Verwendung von XML-RPC und Python.

  15. Third-order gas-liquid phase transition and the nature of Andrews critical point

    Directory of Open Access Journals (Sweden)

    Tian Ma

    2011-12-01

    Full Text Available The main objective of this article is to study the nature of the Andrews critical point in the gas-liquid transition in a physical-vapor transport (PVT system. A dynamical model, consistent with the van der Waals equation near the Andrews critical point, is derived. With this model, we deduce two physical parameters, which interact exactly at the Andrews critical point, and which dictate the dynamic transition behavior near the Andrews critical point. In particular, it is shown that 1 the gas-liquid co-existence curve can be extended beyond the Andrews critical point, and 2 the transition is first order before the critical point, second-order at the critical point, and third order beyond the Andrews critical point. This clearly explains why it is hard to observe the gas-liquid phase transition beyond the Andrews critical point. Furthermore, the analysis leads naturally the introduction of a general asymmetry principle of fluctuations and the preferred transition mechanism for a thermodynamic system. The theoretical results derived in this article are in agreement with the experimental results obtained in (K. Nishikawa and T. Morita, Fluid behavior at supercritical states studied by small-angle X-ray scattering, Journal of Supercritical Fluid, 13 (1998, pp. 143-148. Also, the derived second-order transition at the critical point is consistent with the result obtained in (M. Fisher, Specific heat of a gas near the critical point, Physical Review, 136:6A (1964, pp. A1599-A1604.

  16. A transnational conference romance: Elsie Andrews, Hildegarde Kneeland, and the Pan-Pacific Women's Association.

    Science.gov (United States)

    Laurie, Alison J

    2009-01-01

    Elsie Andrews, a feminist activist from New Zealand, met Dr. Hildegarde Kneeland, a progressive economist from the United States, at the 1934 Pan-Pacific Women's Association conference in Honolulu. Andrews wrote diaries of her attendance at conferences, and in these writes openly of her attraction and romantic feelings for Kneeland, despite her own long-term domestic partnership back in New Plymouth with Muriel Kirton. This article considers the role conference romances may have played for Andrews and others in encouraging their interest in women's organizations, in the context of literature on romantic friendships and lesbianism.

  17. Ultraproducts of von Neumann algebras

    DEFF Research Database (Denmark)

    Ando, Hiroshi; Haagerup, Uffe

    2014-01-01

    We study several notions of ultraproducts of von Neumann algebras from a unified viewpoint. In particular, we show that for a sigma-finite von Neumann algebra M  , the ultraproduct MωMω introduced by Ocneanu is a corner of the ultraproduct ∏ωM∏ωM introduced by Groh and Raynaud. Using...

  18. Cloud-to-ground lightning in Hurricane Andrew

    Science.gov (United States)

    Molinari, John; Moore, Paul K.; Idone, Vincent P.; Henderson, Ronald W.; Saljoughy, Arsalan B.

    1994-08-01

    The spatial and temporal distribution of cloud-to-ground lightning was examined in Hurricane Andrew of 1992. Lightning locations available from the National Lightning Detection Network were superimposed on infrared satellite images to relate lightning activity to hurricane cloud structure. A distinct radial variation occurred in time-averaged flash density, with a weak maximum in the eye wall, a region of near-zero flash density 40 to 100 km from the center, and a steady increase to a large maximum in the outer rainbands 190 km from the center. This radial distribution is consistent with the convective structure of mature hurricanes. Eye wall lightning tended to be episodic, occurring almost exclusively prior to and during periods of intensification of the storm. During these periods, negative flashes occurred several kilometers inward from the highest eye wall cloud tops, in the region of the largest radar reflectivity. Positive eye wall flashes, while small in number, tended to occur directly under the highest cloud tops. The results are suggestive of a normal dipole in sign but outwardly tilted along the sloping eye wall. In general, hurricane flash characteristics resembled those for a background data set of nonhurricane flashes from the same area. The exception occurred for negative flashes in the eye wall, which had a much smaller mean peak current than the background (25.3 kA versus 44.9 kA).

  19. Psychological effects of Hurricane Andrew on an elementary school population.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Tanner, S; Perez, D; Rothe, E; Campo-Bowen, A E; Lahey, B L

    1995-09-01

    To explore the prevalence and progression of posttraumatic symptomatology (PTS), using emotional and behavioral indices of psychopathology in school-age children in the pathway of Hurricane Andrew (HI-IMPACT) and in a comparison group north of Miami (LO-IMPACT). Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form (TRF) were administered 8 weeks and 32 weeks after the hurricane. In addition, 21 measures of disruptive behavior cataloged by Dade County Public Schools were aggregated and compared by grading period between pre- and posthurricane school years. There were no statistically significant differences between the two schools in PTS at 8 weeks after the hurricane, although the children in the HI-IMPACT school were more likely to have severe PTS. TRF findings at 8 weeks revealed that children in the HI-IMPACT school evidenced lower means on the eight TRF scales and on the broader Internalizing and Externalizing measures. Analysis of the disruptive behavior revealed a drop in the marking period immediately after the hurricane in the HI-IMPACT area, but an opposite effect was observed in the LO-IMPACT area. After the hurricane there was an initial increase in PTS and a concomitant decrease in other measures of behavior and psychopathology. PTS remained relatively high throughout the school year, but there was a rebound and subsequent normalization of the measures of disruptive behavior.

  20. Andrew Liehr and the structure of Jahn-Teller surfaces

    Science.gov (United States)

    Chibotaru, Liviu F.; Iwahara, Naoya

    2017-05-01

    The present article is an attempt to draw attention to a seminal work by Andrew Liehr “Topological aspects of conformational stability problem” [1, 2] issued more than half century ago. The importance of this work stems from two aspects of static Jahn-Teller and pseudo-Jahn-Teller problems fully developed by the author. First, the work of Liehr offers an almost complete overview of adiabatic potential energy surfaces for most known Jahn-Teller problems including linear, quadratic and higher-order vibronic couplings. Second, and most importantly, it identifies the factors defining the structure of Jahn-Teller surfaces. Among them, one should specially mention the minimax principle stating that the distorted Jahn-Teller systems tend to preserve the highest symmetry consistent with the loss of their orbital degeneracy. We believe that the present short reminiscence not only will introduce a key Jahn-Teller scientist to the young members of the community but also will serve as a vivid example of how a complete understanding of a complex problem, which the Jahn-Teller effect certainly was in the beginning of 1960s, can be achieved.

  1. Does Andrews facial analysis predict esthetic sagittal maxillary position?

    Science.gov (United States)

    Resnick, Cory M; Daniels, Kimberly M; Vlahos, Maryann

    2018-04-01

    Cephalometric analyses have limited utility in planning maxillary sagittal position for orthognathic surgery. In Six Elements of Orofacial Harmony, Andrews quantified maxillary position relative to forehead projection and angulation and proposed an ideal relationship. The purpose of this study was to investigate the ability of this technique to predict esthetic sagittal maxillary position. Survey study including a male and female with straight facial profiles, normal maxillary incisor angulations, and Angle's Class I. Maxillary position was modified on lateral photographs to create 5 images for each participant with incisor-goal anterior limit line (GALL) distances of -4, -2, 0, +2, and +4 mm. A series of health care professionals and laypeople were asked to rate each photo in order of attractiveness. A total of 100 complete responses were received. Incisor-GALL distances of +4 mm (41%) and +2 mm (40%) were most commonly considered "most esthetic" for the female volunteer (P < .001). For the male volunteer, there were 2 peak "most esthetic" responses: incisor-GALL distances of 0 mm (37%) and -4 mm (32%) (P < .001). Respondents considered maxillary incisor position 2 to 4 mm anterior to GALL most attractive in a woman and 0 to 4 mm posterior to GALL most esthetic in a man. Using these modified target distances, this analysis may be useful for orthognathic surgery planning. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Mida mõtleb professor Andrew Mayo? / Anne-Mari Ernesaks

    Index Scriptorium Estoniae

    Ernesaks, Anne-Mari

    2005-01-01

    PARE koordinaator tutvustab tuntud inimkapitali ideoloogi Andrew Mayo raamatut "Ettevõtte inimväärtus". Raamatu autori hinnangul on tänapäeva organisatsioonides juhtimise olulisim ülesanne inimese juhtimine varana. Lisa: Konverents

  3. Alejandro Von Humboldt

    Directory of Open Access Journals (Sweden)

    Gerardo Paz Otero

    1965-09-01

    Full Text Available Diverso fue y sigue siéndolo, el destino de los dos hermanos Humboldt, Guillermo y Alejandro. Sino que se inicia con el nacimiento: Guillermo, el mayor, nace el 22 de junio de 1767 en Potsdam, residencia de los emperadores prusianos, la ciudad de los palacios imperiales, el imperio del militarismo germano; su cuna se meció cerca al palacete de Sans-Soussi, donde Federico el Grande forja ba el poderío de Prusia, cultivaba las ciencias y las artes, anfitrionaba a los intelectuales de Europa, y era "vasallo espiritual de Volta ire", según la aguda frase de Goethe. Alejandro viene al mundo dos años después (14 de septiembre de 1769 en Berlín, en la casa burguesa de la Jagerstrasse (calle del cazador que su madre Elizabeth von Humboldt heredara de su primer esposo.

  4. Von der Vielfalt einer Institution

    OpenAIRE

    Kabaum, Marcel; Buck, Marc Fabian

    2013-01-01

    Von der Vielfalt von Universitäten bzw. higher education institutions (HEIs) zu sprechen heißt, sich dem Dickicht an Komplexität zu stellen, das sich zwischen ihren Ideen und Realitäten ausbreitet. Der Text führt in den Sammelband "Ideen und Realitäten von Universitäten" ein und hebt die verschiedenen disziplinären Sichtweisen sowie die internationale Breite - Deutschland, Südamerika, USA, Afghanistan und China - der Beiträge hervor. (DIPF/Orig.)

  5. Von Neumann-Morgenstern Solutions

    Science.gov (United States)

    1975-01-01

    REFERENCES von Neumann, John, and Morgenstern , Oskar , Theory of Games and Economic Behavior, 191+4 2nd ed., 1947 3rd ed., 1953. Dresher, M., Kuhn, H...I n I^I.B.IIHI, IJI ■ , m^ »mi ■■! mi m i ■ mm AD/A-005 417 VON NEJMANN- MORGENSTERN SOLUTIONS William F. Lucas Cornell...COMMERCE m^ ^^^mmm II . REPORT OOCUM[ •H AT:O I PAG[ ~ . CiOVT IICCt:~ Technical Report No. 246 VON NEUMANN- MORGENSTERN SOLUTIONS Cornell University

  6. Active morbidity surveillance after Hurricane Andrew--Florida, 1992.

    Science.gov (United States)

    Lee, L E; Fonseca, V; Brett, K M; Sanchez, J; Mullen, R C; Quenemoen, L E; Groseclose, S L; Hopkins, R S

    1993-08-04

    To describe the health status of and to detect disease outbreaks in the population affected by Hurricane Andrew in south Dade County, Florida. The Florida Department of Health and Rehabilitative Services and the US Army conducted active surveillance for gastrointestinal illness, respiratory illness, injury, and other index conditions by monitoring civilian and service member visits to care sites (civilian and military free care sites and hospital emergency departments) from August 30 (1 week after the hurricane's landfall) through September 30, 1992. South Dade County, Florida. Proportional morbidity: the number of daily visits for each index condition divided by the total number of visits, expressed as a percentage. Morbidity rate: the total number of daily visits by service members divided by the total number of service members, expressed as a percentage. Six index conditions accounted for 41.3% of visits to civilian free care sites: diarrhea (4.7%), cough (4.7%), other infection (9.6%), rash (5.4%), animal bite (1.2%), and injury (15.7%). At military free care sites, five index conditions accounted for 75.7% of civilian visits: injury (23.7%), dermatologic illness (12.4%), respiratory illness (9.9%), gastrointestinal illness (5.3%), and other medical conditions (24.4%). Two index conditions accounted for 54.1% of service member visits: injury (36.2%) and dermatologic illness (17.9%). During the 5 weeks after the hurricane, proportional morbidity from injury decreased; proportional morbidity from respiratory illness increased; and proportional morbidity from diarrhea was stable. No infectious disease outbreaks occurred. Injuries were an important source of morbidity throughout the surveillance period, especially among service members. Enteric and respiratory agents did not cause disease outbreaks, despite alarming rumors to the contrary.

  7. Kleben von Kunststoff mit Metall

    CERN Document Server

    Brockmann, W; Käufer, H

    1989-01-01

    Das Buch behandelt das Kleben von Kunststoffen mit Metallen in einer fur den Praktiker verstandlichen und umsetzbaren Form. Es leitet zu Klebeverfahren an, die optimale Ergebnisse hinsichtlich Qualitat, Dauerhaftigkeit und Wirtschaftlichkeit liefern.

  8. Ueber einige Coelenterata von Australien

    NARCIS (Netherlands)

    Stiasny, G.

    1931-01-01

    I. Hydromedusen. *Olindias singularis Browne. II. Scyphomedusen. *Atolla wyvillei Haeckel. *Linuche unguiculata O. Swartz. Pelagia noctiluca Péron u. Lesueur. Cyanea capillata var. annaskala von Lendenfeld. Netrostoma coerulescens Maas. *Versura anadyomene (Maas) Mayer. Catostylus mosaicus L.

  9. Preliminary report: medical examiner reports of deaths associated with Hurricane Andrew--Florida, August 1992.

    Science.gov (United States)

    1992-09-04

    On August 24, 1992, at 1:40 a.m. eastern daylight time (EDT), rain bands associated with Hurricane Andrew reached the eastern coast of Florida. At 4:45 a.m. EDT, Hurricane Andrew made landfall 35 miles southeast of Miami at Homestead, with sustained winds of 145 miles per hour (mph) and gusts of 164 mph. These winds extended 45 miles outward of the storm center. The storm moved across the state at 18 mph toward the Gulf of Mexico (Figure 1). The tidal surge on the eastern coast was estimated at 7-19 feet. During the storm, approximately 2.5 million Florida residents were left without electrical power, and approximately 56,000 family dwelling units were destroyed or severely damaged. This report presents preliminary data from Florida medical examiner (ME) offices about deaths attributed to Hurricane Andrew.

  10. Analyzing after-action reports from Hurricanes Andrew and Katrina: repeated, modified, and newly created recommendations.

    Science.gov (United States)

    Knox, Claire Connolly

    2013-01-01

    Thirteen years after Hurricane Andrew struck Homestead, FL, Hurricane Katrina devastated the Gulf Coast of Mississippi, Alabama, and southeastern Louisiana. Along with all its destruction, the term "catastrophic" was redefined. This article extends the literature on these hurricanes by providing a macrolevel analysis of The Governor's Disaster Planning and Response Review Committee Final Report from Hurricane Andrew and three federal after-action reports from Hurricane Katrina, as well as a cursory review of relevant literature. Results provide evidence that previous lessons have not been learned or institutionalized with many recommendations being repeated or modified. This article concludes with a discussion of these lessons, as well as new issues arising during Hurricane Katrina.

  11. Capacities of template-type platforms in the Gulf of Mexico during hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Bea, R.G.; Loch, K.J.; Young, P.L. [Univ. of California, Berkeley, CA (United States)

    1997-02-01

    This paper details results from nonlinear analyses of the ultimate limit state performance characteristics of four Gulf of Mexico (GOM) platforms subjected to intense loadings from hurricane Andrew. These four platforms were located to the east of the track of hurricane Andrew, and were thus in the most intense portion of the storm (Smith, 1993). The nonlinear analyses are able to replicate details of the observed behavior of the four structures. This replication is very dependent on realistic characterization of the performance characteristics of the pile foundations and on accurate information on the as is condition of the platforms before the storm.

  12. Bibliographie der Werke von Herbert Spencer

    OpenAIRE

    Schmid, Michael (Prof.)

    1991-01-01

    Bibliographie der Werke von Herbert Spencer / bearb., hrsg., mit e. Einl. u. e. Kurzbiogr. vers. von Michael Schmid u. Margit Weihrich. - München : Inst. für Soziologie u. Gesellschaftspolitik, Univ. d. Bundeswehr, 1991. - 159 S.

  13. John von Neumann selected letters

    CERN Document Server

    2005-01-01

    John von Neuman was perhaps the most influential mathematician of the twentieth century, especially if his broad influence outside mathematics is included. Not only did he contribute to almost all branches of mathematics and created new fields, but he also changed post-World War II history with his work on the design of computers and with being a sought-after technical advisor to many figures in the U.S. military-political establishment in the 1940s and 1950s. The present volume is the first substantial collection of (previously mainly unpublished) letters written by von Neumann to colleagues, friends, government officials, and others. The letters give us a glimpse of the thinking of John von Neumann about mathematics, physics, computer science, science management, education, consulting, politics, and war. Readers of quite diverse backgrounds will find much of interest in this fascinating first-hand look at one of the towering figures of twentieth century science.

  14. The Role of the U.S. Army Medical Department in Domestic Disaster Assistance Operations. Lessons Learned from Hurricane Andrew.

    Science.gov (United States)

    1996-04-15

    Hurricane Andrew , which struck South Dade County, Florida on the morning of 24 August 1992, was the ’worst natural disaster ever to hit the United...and Medical). The study also addresses the Army Medical Department’s role in the Hurricane Andrew operations and closes with a review of the medically

  15. An Invitation from Lars von Trier

    DEFF Research Database (Denmark)

    Skadhauge, Troels; Tønder, Lars

    2015-01-01

    Translation of Martin Krasnik interview with Lars von Trier broadcast on DR2, January 12, 2015. The following is an interview of Lars von Trier (LvT) by the Danish journalist Martin Krasnik (MK). The interview took place in Lars von Trier’s home in Brede, a small town just outside Copenhagen. The...

  16. Homopteren von Java, gesammelt von Herrn Edw. Jacobson

    NARCIS (Netherlands)

    Melichar, L.

    1914-01-01

    Herr Edw. Jacobson hat auf Java in den Jahren 1908— 1910 Homopteren gesammelt und mir die Bearbeitung des gesammelten Materiales übertragen. Die Jacobson’sche Ausbeute ist insoferne bemerkenswert, als dieselbe viele Mikrohomopteren enthält, welche von nichtfachkundigen Sammlern gewöhnlich nicht

  17. On the Record: with Olly Owen and Andrew Faull | Owen | South ...

    African Journals Online (AJOL)

    ... of International Development at the University of Oxford. In 2012 he completed his doctorate in Social and Cultural Anthropology at Oxford. This involved an ethnographic study of, and fieldwork with, the Nigerian Police Force. Andrew Faull is a doctoral research student at the Centre for Criminology, University of Oxford.

  18. Joshua Rodda: Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History

    Directory of Open Access Journals (Sweden)

    Joachim Schwend

    2015-01-01

    Full Text Available This contribution offers a review of Joshua Rodda's Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History. Farnham, Surrey: Ashgate, 2014. 252 pages, regular price £ 70, 234 x 156 mm, ISBN 978–1–4724–1555–4.

  19. Commentary on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence"

    Science.gov (United States)

    Wolfram, Gary; Coulson, Andrew J.

    2009-01-01

    In this article, the authors comment on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence." The authors believe that Coulson's paper is a very interesting review of the literature on the ability of market-produced education to outperform government-produced education. Coulson's response on this commentary…

  20. Crisis Intervention with Survivors of Natural Disaster: Lessons from Hurricane Andrew.

    Science.gov (United States)

    Shelby, Janine S.; Tredinnick, Michael G.

    1995-01-01

    Crisis intervention has typically been conceptualized as seeking a return of clients to a state of equilibrium. Personal work experience with Hurricane Andrew survivors has led to an appreciation of the importance of several considerations. Develops a proactive approach, attempting to recognize and extend clients' preexisting strengths. Offers…

  1. News of Hurricane Andrew: The Agenda of Sources and the Sources' Agendas.

    Science.gov (United States)

    Salwen, Michael B.

    1995-01-01

    Studies quotations in newspaper coverage of Hurricane Andrew, showing that individuals who were not affiliated with government or business were quoted most often. Shows that most sources were quoted as experts, with individuals represented as suffering victims, providing the news media with human interest quotations. Notes that most sources…

  2. Posttraumatic Stress, Depression, and Social Support among College Students after Hurricane Andrew.

    Science.gov (United States)

    Pickens, Jeffrey; And Others

    1995-01-01

    One month after Hurricane Andrew, surveyed students who reported experiencing the most severe impact damage from the storm also reported experiencing the most stress, anxiety, and depressive symptoms. Regression analyses revealed that material and emotional social support were significant predictors of anxiety and depression scores after the…

  3. Stressing Memory: Long-Term Relations among Children's Stress, Recall and Psychological Outcome following Hurricane Andrew

    Science.gov (United States)

    Sales, Jessica McDermott; Fivush, Robyn; Parker, Janat; Bahrick, Lorraine

    2005-01-01

    We examined relations among stress, children's recall, and psychological functioning following Hurricane Andrew. Thirty-five children from mixed socioeconomic backgrounds were divided into low-, moderate-, and high-stress groups and were interviewed about the hurricane immediately after the storm and 6 years later. Our primary interest, stemming…

  4. Airborne Videography and GPS for Assessment of Forest Damage in Southern Louisiana from Hurricane Andrew

    Science.gov (United States)

    D.M. Jacobs; Susan Eggen-McIntosh

    1993-01-01

    Abstract: One week after Hurricane Andrew made landfall in Louisiana in August 1992, an airborne videography system, with a global positioning system (GPS) receiver, was used to assess timberland damage across a 1.7 million-ha (4.2 million-acre) study area. Ground observations were made to identify different intensities of timber damage and then...

  5. Visions and Vanities: John Andrew Rice of Black Mountain College. Southern Biography Series.

    Science.gov (United States)

    Reynolds, Katherine Chaddock

    This biography presents the life of John Andrew Rice, who founded Black Mountain College (North Carolina) in 1933 to implement his philosophy of education, including the centrality of artistic experience and emotional development to learning in all disciplines and the need for democratic governance shared between faculty and students. Born in…

  6. Building a "cyber forest" in complex terrain at the Andrews Experimental Forest

    Science.gov (United States)

    Donald L. Henshaw; Fred Bierlmaier; Barbara J. Bond; Kari B. O' Connell

    2008-01-01

    Our vision for a future "cyber forest" at the Andrews Experimental Forest foresees high performance wireless communications enhancing connectivity among remote field research locations, station headquarters, and beyond to the university and outside world. New sensor technologies and collaboration tools foretell exponential increases in data and information...

  7. Von Krahl ON! / Terje Metsavas

    Index Scriptorium Estoniae

    Metsavas, Terje

    2008-01-01

    Madli Pesti ja Terje Metsavas kohtusid Von Krahli teatri tehnilise meeskonnaga teatri black-box-saalis. Teatri tehniline meeskond on tehnikadirektor Enar Tarmo, video- ja multimeediaga tegelev Lauri Sepp, tehnikud Janno "John" Jaanus, Oliver Kulpsoo ja Allan Räim. Selles, kuidas sünnivad "tehnikaimed" ja kuidas lahendatakse lavastuslikke projekte

  8. von Hippel-Lindau disease

    DEFF Research Database (Denmark)

    Binderup, Marie Louise Mølgaard; Gimsing, Steen; Kosteljanetz, Michael

    2013-01-01

    Endolymphatic sac tumours (ELSTs) of the inner ear occur in 16% of patients with the hereditary tumor syndrome von Hippel-Lindau disease (vHL). ELSTs of all sizes can cause irreversible hearing loss which can, however, be prevented through early diagnosis and treatment. We aim to emphasize...

  9. Properties of von Neumann entropy

    Indian Academy of Sciences (India)

    disentangled) as seen by moving observers, is used to investigate the properties of von Neumann entropy, as a measure of spin–momentum entanglement. To do so, we partition the total Hilbert space into momentum and spin subspaces so that the ...

  10. [Friedrich Ludwig von Maydelli pildid Baltimaade ajaloost = Friedrich Ludwig von Maydells Baltische Geschichte in Bildern = Friedrich Ludwig von Maydell ́s Baltic history in images] / Ulrike Plath

    Index Scriptorium Estoniae

    Plath, Ulrike, 1972-

    2014-01-01

    Arvustus: Friedrich Ludwig von Maydelli pildid Baltimaade ajaloost = Friedrich Ludwig von Maydells Baltische Geschichte in Bildern = Friedrich Ludwig von Maydell ́s Baltic history in images. Eesti kunstimuuseum, Kadrioru kunstimuuseum. Tallinn 2013

  11. Von den Veranschaulichungsmethoden in den Rundfunkpredigten von der Heiligkreuz- Kirche

    Directory of Open Access Journals (Sweden)

    Witold Ostafiński

    2004-12-01

    Full Text Available In der gegenwärtigen Verkündigung des Wortes Gottes spielt die Veranschaulichung der Überlieferung eine nicht zu überschätzende Rolle. Vor diesem Hintergrund wird es sehr wichtig, dass man den Predigern nicht nur auf die Funktion des Bildes in der Verkündigung, sondern auch auf die Art und Weise seines Entstehens auf der narrativen Ebene aufmerksam macht. Während die Kenner der Homiletik die Notwendigkeit des Auftretens der Bildeigenschaften in den Predigten betonen, erinnern sie gleichzeitig daran, dass der moderne, von der „Bild-Zivilisation“ gestaltete Mensch, „immer mehr sehen als hören“ möchte. Der vorliegende, die Rundfunkpredigten von der Heiligkreuz-Kirche analysierende Aufsatz, nimmt auf und bringt zugleich nahe die Problematik der Notwendigkeit des Bildes in der Wort-Gottes-Verkündigung. Der Artikel stellt die Erzählungsform als eine wichtige Möglichkeit der Glaubensüberlieferung dar, behandelt das Problem der Aktualisierung evangelischen Werte, bringt das von den Predigten gestaltete synästhetische Weltbild nahe und analysiert die Rolle des Zitats und Beispiels (exemplum bei der Gestaltung der Bildhaftigkeit einer Predigt. Darüber hinaus überprüft der Aufsatz in seinem letzten Teil die in den gegenwärtigen Rundfunkpredigten meist verwendeten Redefiguren

  12. Shock, diaschisis and von Monakow

    Directory of Open Access Journals (Sweden)

    Eliasz Engelhardt

    2013-07-01

    Full Text Available The concept of shock apparently emerged in the middle of the 18th century (Whyett as an occurrence observed experimentally after spinal cord transection, and identified as "shock" phenomenon one century later (Hall. The concept was extended (Brown-Séquard and it was suggested that brain lesions caused functional rupture in regions distant from the injured one ("action à distance". The term "diaschisis" (von Monakow, proposed as a new modality of shock, had its concept broadened, underpinned by observations of patients, aiming at distinguishing between symptoms of focal brain lesions and transitory effects they produced, attributable to depression of distant parts of the brain connected to the injured area. Presently, diaschisis is related mainly to cerebrovascular lesions and classified according to the connection fibers involved, as proposed by von Monakow. Depression of metabolism and blood flow in regions anatomically separated, but related by connections with the lesion, allows observing diaschisis with neuroimaging.

  13. Evaluierungsbericht Systems Engineer von LBMS

    OpenAIRE

    Herzwurm, Georg

    1994-01-01

    Hersteller von Systems Engineer ist die 1977 gegründete Firma Learmonth and Burchen Management Systems Pie. (LBMS) mit Sitz in London. Systems Engineer ist eine Client-Server-Lösung unter DOS/Windows, die standardmäßig aus den Komponenten Systems Engineer (Analyse und Design, Projektadministration), SE/Repository (Konfigurations management, Entwicklungsdatenmanagement) und SE/Workplace (Dokumentation) besteht. Als jeweils separat zu erwerbende Komponenten werden darüber hinaus Process Enginee...

  14. Didaktische Konzeption von Serious Games: Zur Verknüpfung von Spiel- und Lernangeboten

    Directory of Open Access Journals (Sweden)

    Michael Kerres

    2009-08-01

    Full Text Available Serious Games versuchen Spielen mit Lernen zu verbinden. Der Beitrag problematisiert die Machbarkeit einer solchen Verknüpfung in digitalen Welten und diskutiert verschiedene didaktische Konzepte einer Nutzbarmachung digitaler Spiele für das Lernen und Lehren. Ausgehend von einer Analyse des Erlernens von Spielen werden drei didaktische Konzepte von Serious Games im Hinblick auf ihre didaktischen Potenziale untersucht: (1 der unmittelbare Transfer von Wissen, das im Spiel erworben wird (keine zusätzliche Didaktisierung, (2 Didaktisierung durch Einbettung des Spiels in einer Lernsituation oder (3 Didaktisierung durch Einbettung von Lernaufgaben in ein Spiel. Ergebnisse zur Nutzung von Spielen, bei denen Lernaufgaben in eine Spielwelt eingebettet sind, zeigen, dass Personen die Aufnahme von Wissen in einem expliziten Lernmodus eher zu reduzieren versuchen, um möglichst zügig wieder in den Spielmodus zu wechseln. Diskutiert werden die Konsequenzen dieser Problematik für die didaktische Konzeption von Serious Games.

  15. Impact of an extreme event on the sediment budget: Hurricane Andrew in the Louisiana barrier islands

    Science.gov (United States)

    List, Jeffrey H.; Hansen, Mark E.; Sallenger,, Asbury H.; Jaffe, Bruce E.; Edge, B.L

    1997-01-01

    This paper examines the influence of Hurricane Andrew on the sediment budget of an 80-kilometer section of the Louisiana barrier islands west of the modern Mississippi delta. Because long-term bathymetric change has been extensively studied in this area, excellent baseline data are available for evaluating the impact of Hurricane Andrew. Results show that despite the high intensity of the storm and a storm track optimally positioned to impact the study area, the storm did not have an overwhelming influence on the sediment budget when compared to the changes occurring over the previous 50 years. For the Louisiana barrier islands, a 50-year record appears to be adequate for averaging the long-term contributions of both major and minor storm events to the sediment budget.

  16. Geologic impact of Hurricane Andrew on Everglades coast of southwest Florida

    Science.gov (United States)

    Davis, R. A.

    1995-04-01

    Hurricane Andrew, one of the strongest storms of the century, crossed the southern part of the Florida peninsula on 24 August 1992. Its path crossed the Florida Everglades and exited in the national park across a mangrove-dominated coast onto the shallow, low-energy, inner shelf. The storm caused extensive breakage and defoliation in the mangrove community; full recovery will take decades. It produced no extensive sedimentation unit; only local and ephemeral ebb-surge deposits. The discontinuous shelly storm beach ridge was breached at multiple locations, and it moved landward a few meters. After seven months, there was little geologic indication that the storm had passed. It is likely that the stratigraphic record in this area will not contain any recognizable features of the passage of Hurricane Andrew.

  17. Material recycling; Recycling von Werkstoffen

    Energy Technology Data Exchange (ETDEWEB)

    Eyerer, P. [Fraunhofer-Institut fuer Chemische Technologie (ICT), Pfinztal-Berghausen (Germany)]|[Stuttgart Univ. (Germany). Inst. fuer Kunststoffpruefung und Kunststoffkunde (IKP)

    1996-12-01

    , menschliches Leben auf der Erde zu sichern. Die Wiederverwertung (Recycling) von Werkstoffen ist dann ein Beitrag zu nachhaltigem Wirtschaften, wenn fuer Rezyklate weniger Ressourcen und Energien benoetigt werden als fuer Primaerwerkstoffe. Sortenrein gesammelte Werkstoffe nach der Demontage von Produkten ergeben Sekundaer- oder Tertiaer-Produkte mit nahezu gleichen Eigenschaften wie das Primaerprodukt. Unspezifische Werkstoffkreislaeufe in Verbindung mit Grossverfahren wie Shredder, Hydrierung oder Mischmuell-Recycling ergeben Rezyklate von niederer Qualitaet und Kosten, die ueber denen von Primaerwerkstoffen liegen. Insbesondere Kunststoffe aus Produkten (Fernseher, Surfbrett, Auto-Waschmaschine usw.) erfordern und erlauben im Gegensatz zu Metallen, Papier und Glaesern differenzierte Wiederverwertungswege. Die Auswahl der im Sinne des nachhaltigen Wirtschaftens optimalen Wiederverwertung von Werkstoffen erfolgt ueber ganzheitliche Bilanzierungen und Bewertungen. (orig.)

  18. Auswirkungen von Online Vermittlungsportalen auf traditionelle Vermittler der Parahotellerie im Wallis am Beispiel von Airbnb

    OpenAIRE

    Tscherrig, Jessica; Schegg, Roland

    2018-01-01

    Ziel der vorliegenden Arbeit ist, herauszufinden, inwiefern sich das Unternehmen Airbnb von traditionellen Anbietern von Ferienwohnungen unterscheidet. Dafür wurden die Geschäftsmodelle, die Motivation der Teilnehmer sowie der Buchungsprozess untersucht. Anhand von wissenschaftlichen Quellen konnten Hintergrundinformationen zu diesen drei Zielen beschafft werden. Fünf Experteninterviews, ausgewertet nach der Methode von Mayring (2002), dienten dazu, tiefere Einblicke in das jeweilige Un...

  19. Entwicklung und Anwendung von Methoden zur Bestimmung von Selen-Spezies in human-biologischem Material

    OpenAIRE

    Jäger, Thomas

    2014-01-01

    Selen ist essentieller Bestandteil von mehr als 25 physiologisch wichtigen menschlichen Enzymen. Der tägliche Bedarf wird überwiegend in Form von organischen Selenverbindungen wie Selenmethionin oder Selenocystein aus der Nahrung aufgenommen. Weitere Expositionswege sind die Einnahme von Nahrungsergänzungsmitteln zur Selensupplementation sowie die inhalative oder dermale Aufnahme von in erster Linie anorganischen Selenverbindungen oder elementarem Selen an Arbeitsplätzen der Selen-verarbeiten...

  20. Dr. von Braun Briefing Walt Disney

    Science.gov (United States)

    1965-01-01

    Dr. von Braun began his association with Walt Disney in the 1950s when the rocket scientist appeared in three Disney television productions related to the exploration of space. Years later, Dr. von Braun invited Disney and his associates to tour the Marshall Space Flight Center (MSFC) in Huntsville, Alabama. This photograph is dated April 13, 1965. From left are R.J. Schwinghamer from the MSFC, Disney, B.J. Bernight, and Dr. von Braun.

  1. Rapid health needs assessment following hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1992-09-18

    Following the impact phase of Hurricane Andrew in Florida (August 24) and Louisiana (August 26) (Figure 1), the primary objectives of the public health response have been to address the health and medical needs of residents in the storm-damaged areas and to provide data for relief interventions and decision-making. This report presents the combined findings from rapid health needs assessment surveys conducted by state health departments with CDC assistance 3-10 days postimpact.

  2. Andrew Wyeth and N.C. Wyeth: a psychodynamic perspective on father and son.

    Science.gov (United States)

    Shaw, Jon A

    2013-01-01

    This paper examines the relationship between two extraordinary artists, father and son--N.C. Wyeth (1882-1945) and Andrew Wyeth (1917-2009)--and their art. N.C. Wyeth, the father, the most famous illustrator of his day, painted scenes full of drama and action, often of men engaged in violent life and death struggles. N.C. was unable to separate from his powerful mother and yearned for his iconic father. He thought himself an artistic failure and dedicated himself to raising his children to be geniuses. The youngest son, Andrew Wyeth, who lived a "secret life," painted scenes often characterized by pathos: bleak and barren landscapes, leaden skies, tire tracks, gray framed houses, desiccated fields, and circling buzzards. In the father-son relationship, we often seen three themes perpetuated developmentally: (1) the son's identification with the innermost conflicts of his father; (2) the yearning for the iconic father of his youth; and (3) a continuation and disavowal of his father's life. These themes are played out in the relationship between Andrew Wyeth and his father.

  3. Modellierung von Anwenderverhalten im Social Semantic Web

    Science.gov (United States)

    Ulbrich, Armin; Höfler, Patrick; Lindstaedt, Stefanie

    Ziel dieses Kapitels ist es, gemeinsame Verwendungsszenarien des Semantic Web und des Social Web zu identifizieren und zu benennen. Dabei wird ein Teilaspekt des Themengebiets im Detail betrachtet: die Nutzung von Services, die Beobachtungen des Verhaltens von Anwendern analysieren, um daraus maschinell interpretierbare Informationen zu erhalten und diese als Modelle zu organisieren. Es werden zunächst einige Eigenschaften und Unterscheidungsmerkmale von Anwenderverhalten und organisierten Modellen dargestellt. Anschließend wird der mögliche wechselseitige Nutzen von Anwenderverhalten und Modellen diskutiert. Den Abschluss bildet eine Betrachtung einiger exemplarischer Software-Services, die heute schon verwendet werden, um Anwenderverhalten in Modelle überzuführen.

  4. Wahrnehmung und Bewältigung von Konflikten und die Stabilität von Partnerschaften

    OpenAIRE

    Arránz Becker, Oliver; Rüssmann, Kirsten; Hill, Paul B.

    2005-01-01

    "Der vorliegende Beitrag untersucht die Auswirkungen von Konflikten auf die wahrgenommene Stabilität von Partnerschaften. Besonderes Augenmerk wird dabei auf die vermittelnde Rolle von Paarinteraktion und Partnerschaftszufriedenheit gelegt. Weiterhin werden Wechselwirkungen zwischen Konflikten und Paarinteraktionen und deren Folgen für den Partnerschaftserfolg betrachtet. Die Kernthese lautet dabei, dass Konflikte Partnerschaften weniger stark beeinträchtigen, wenn ausreichend 'positive' bzw....

  5. Über die Zetafunktion von Formen von Fermatgleichungen

    OpenAIRE

    Brünjes, Lars

    2002-01-01

    Wir untersuchen 'Formen der Fermatgleichung' über einem zunächst beliebigen Körper K, d.h. homogene Gleichungen vom Grad d in n Variablen, die nach einer linearen Variablensubstitution über dem algebraischen Abschluß von K in die Fermatgleichung X_1^d + ... + X_n^d übergehen. Wir klassifizieren diese Gleichungen mit Hilfe der Methode des Galois-Descent und erhalten, da jede kubische Gleichung in zwei Variablen eine Form der Fermatgleichung ist, insbesondere eine vollständige und explizite Kla...

  6. Diffusion von Leerstelleninseln auf Cu(111)

    NARCIS (Netherlands)

    Verheij, Laurens K.; Schlößer, Dietmar; Rosenfeld, Georg

    1998-01-01

    Die zufällige Bewegung von Leerstelleninseln wurde bisher vorwiegend in einem Bild beschrieben, das von der Diffusion einzelner Atome ausgeht. In diesem Bild kann man Inseldiffusion durch die Einstein-Beziehung für Brownsche Bewegung ((Δ r)2 = 4 D Δ t) beschreiben. Für die Diffusionskonstante D wird

  7. Sociologisk filmanalyse og Lars von Trier

    DEFF Research Database (Denmark)

    Lauridsen, Palle Schantz

    2016-01-01

    En præsentation af filmsociologisk metode med en analyse af, hvilke publikumsgrupper der ser - og ikke ser - Lars von Triers film......En præsentation af filmsociologisk metode med en analyse af, hvilke publikumsgrupper der ser - og ikke ser - Lars von Triers film...

  8. Kultuuriakadeemias saab kaeda Von Krahli ime tabamist

    Index Scriptorium Estoniae

    2006-01-01

    Marianne Kõrver, Jaak Kilmi, Andres Maimik, Marko Raat, Rainer Sarnet ja Arbo Tammiksaar tegid Eduard Vilde näidendist "Tabamata ime" kuus lühimängufilmi Von Krahli teatris ettekandmiseks. 25. mail tuleb Von Krahli Teater Viljandisse ja näitab teatrifilmi Kultuuriakadeemias

  9. Raymond Andrews as Griot: Privileging Southern Black Communities through Oral Storytelling and Cultural History

    Directory of Open Access Journals (Sweden)

    Brennan Collins

    2012-01-01

    Full Text Available Raymond Andrews’ novels celebrate rural Black life by focusing on the customs and traditions of Southern African American communities. Critical to this celebration are the rhetorical strategies Andrews uses that privilege oral over literary storytelling. Using Geneva Smitherman’s discussion of the griot and Henry Louis Gates, Jr.’s concept of the speakerly text in the context of John Miles Foley’s work on comparative oral traditions, this essay explores the possibility and implications of describing Andrews’ written work as a form of oral storytelling.

  10. Emergency mosquito control associated with Hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    Hurricane Andrew crossed south Florida on August 24, 1992 entered the Gulf of Mexico, and struck the Louisiana coast on August 26. In Florida, an estimated 25,000 housing units were destroyed and 37,000 severely damaged in a 200,000-acre area in the southern portion of Dade County; in Louisiana, an estimated 25,000 housing units were destroyed or severely damaged by the storm, primarily in the coastal sections of the 36-parish disaster area. Initial assessment of the disaster areas indicated a need for vector surveillance and control (1). This report summarizes actions to assess and alleviate mosquito-related problems in Florida and Louisiana.

  11. Cognition About the Creative Process – Interview With Dr Andrew P. Allen

    Directory of Open Access Journals (Sweden)

    Andrew P. Allen

    2016-11-01

    Full Text Available What is the relationship between the creative process and cognition and perception? Lynda Loughnane, a master’s student in Art and Process in Crawford College of Art and Design, Cork, Ireland interviewed Dr Andrew P. Allen about the subject. Areas covered include mindfulness, Type 1 and Type 2 thinking, stage theories of creativity, engagement with the art process and the artwork, phenomenology and consciousness with and without self report. The interview was constructed to cover a wide range of subject matter, so as to gather as much information as possible in layman's language about the cognitive process in relation to creativity and interaction with art.

  12. Lars von Triers billeder rammer os lige i maven

    DEFF Research Database (Denmark)

    Thomsen, Bodil Marie Stavning

    2016-01-01

    Interview om min forskning i Lars von Triers filmværker i anledning af min bogudgivelse på dansk: Lars von Triers fornyelse af filmen 1984-2014.......Interview om min forskning i Lars von Triers filmværker i anledning af min bogudgivelse på dansk: Lars von Triers fornyelse af filmen 1984-2014....

  13. The Digital Von Fahrenheid Pyramid

    Science.gov (United States)

    Bura, M.; Janowski, J.; Wężyk, P.; Zięba, K.

    2017-08-01

    3D Scanners Lab from Digital Humanities Laboratory at the University of Warsaw initiated the scientific project, the purpose of which was to call attention to systematically penetrated and devastated pyramid-shaped tomb from the XVIII/XIX century, of family von Fahrenheid in Rapa in Banie Mazurskie commune (NE Poland). By conducting a series of non-invasive studies, such as 3D inventory using terrestrial laser scanning (TLS), thermal imaging, georadar measurements (around and inside the tomb) and anthropological research of mummified remains as well - the complete dataset was collected. Through the integration of terrestrial (TLS) and airborne laser scanning (ALS) authors managed to analyse the surroundings of Fahrenheid pyriamid and influence of some objects (like trees) on the condition and visibility of the Pyramids in the landscape.

  14. Alexander von Humboldt: Biblioteca digital

    Directory of Open Access Journals (Sweden)

    Sandra Rebok

    2005-10-01

    Full Text Available Article in Spanish, Abstracts in English, Spanish and German.This article presents a project for the digitization of the works of Alexander von Humboldt, which is being undertaken in collaboration with the Ignacio Larramendi Foundation. Like other projects of this type, its aim is to utilize modern technology to make a significant part of Humboldt’s legacy available to researchers and other readers, thereby facilitating the study and reading of these works. This project will focus on the Spanish translations that have been undertaken over the years. Humboldt’s works in their original French and German versions will subsequently be included alongside their respective Spanish translations. Finally, this edition will be accompanied by a comprehensive introduction devoted to the history of these Spanish translations and the impact they have had in Spain, as well as to the people who have dedicated themselves to the translation and dissemination of these works in this country.

  15. Renaturierung und Management von Heiden

    Science.gov (United States)

    Härdtle, Werner; Assmann, Thorsten; van Diggelen, Rudy; von Oheimb, Goddert

    Heiden zählen zu den ältesten und besonders reizvollen Kulturlandschaften Nordwesteuropas. Sie sind bezeichnend für nährstoffarme Böden in wintermilden Gebieten mit hohen Sommerniederschlägen. Während Heiden vor wenigen Jahrhunderten noch weit verbreitet und für manche Landschaften sogar prägend waren, hat sich ihr Areal heute auf wenige, meist in Naturschutzgebieten gelegene Restbestände verkleinert. Zu diesem Rückgang haben maßgeblich Änderungen der Landnutzung, aber auch Nährstoffeinträge aus umgebenden Agrarflächen und atmogene Depositionen beigetragen. In den meisten Ländern der Europäischen Union sind Heiden heute gesetzlich geschützte Ökosysteme, da diese, neben ihrem Erholungswert für den Menschen, Pflanzen- und Tierarten beherbergen, die außerhalb von Heiden nicht oder kaum überlebensfähig sind.

  16. Khazanah: Friedrich Karl von Savigny

    Directory of Open Access Journals (Sweden)

    Atip Latipulhayat

    2015-04-01

    Full Text Available Friedrich Karl von Savigny (1779-1861 adalah ahli hukum Jerman yang juga dianggap sebagai salah satu Bapak hukum Jerman. Savigny adalah tokoh mazhab sejarah (historical school jurisprudence yang dikembangkannya pada paruh pertama abad ke 19. Dia juga dianggap sebagai pelopor kajian mengenai relasi antara perkembangan hukum dan sosial. Sebagai seorang pemikir hukum yang senantiasa kreatif dalam membuat terobosan-terobosan (trail-blazing legal scientist, Savigny memberikan kontribusi penting dalam perkembangan ilmu hukum dan bahkan terhadap ilmu sosial. Dari sekian banyak kontribusinya antara lain teorinya mengenai kontinuitas antara institusi hukum saat ini dengan institusi hukum masa lalu, meletakkan fondasi bagi kajian sosiologi hukum, dan menegaskan mengenai urgensi metode historis dalam kajian hukum.

  17. Jacob Stael von Holstein ja palladionism eesti arhitektuuris / Ants Hein

    Index Scriptorium Estoniae

    Hein, Ants, 1952-

    2005-01-01

    Sõjaväeinsenerist ja arhitektist Jacob Stael von Holsteinist (1628, Pärnu-1679), tema kavandatud hoonetest ja rollist 17. sajandi II poole arhitektuuris. Fabian von Ferseni Toompeal Lossiplatsil asunud elamust (lammutati 1894) ja Maardu mõisahoonest, Hans von Ferseni Mäo mõisahoonest Järvamaal, Otto Wilhelm von Ferseni majast Toompeal, Axel von Roseni majast Tallinnas Pikk t. 28 (1670-74), Otto Reinhold von Taube majast Tartus (hävinud), J. S. von Holsteini enda hoonetest: majast Tallinnas Toompea 1, Anija mõisahoonest, elamust Riias jm. Bibliograafia lk. 452

  18. Untersuchungen von UAV Technologien im DLR

    OpenAIRE

    Schütte, Andreas; Hanke, Michael

    2009-01-01

    Untersuchungen von UCAV Technologien im DLR Die Eckpunkte für die Entwicklung von UCAV-Konfigurationen definiert ein möglicher Bedarf der Luftwaffen an UCAV‘s (Unmanned Combat Air Vehicle) ab 2020. Diese Eckpunkte sind folgende: • voraussichtliche Entwicklungszeit: 8-10 Jahre • Einsatzzweck: Bekämpfung von mobilen Zielen zu Lande und in der Luft • Maximale Überlebensfähigkeit durch hohe Manövrierfähigkeit und Faserverbundleichtbau • passive Gegenmaßnahmen (minimale Signatur...

  19. Indikatorenbasierte Bewertung von Entwurfsentscheidungen auf Systemebene

    Science.gov (United States)

    Freier, M.; Wenzler, A.; Mayer, T.; Gerlach, J.; Rosenstiel, W.

    2013-07-01

    Bei dem Entwurf von anwendungsspezifischen integrierten Schaltungen muss ein Entwickler zusätzliche Funktionen integrieren und die zunehmende Komplexität bewältigen. Für die Reduzierung der Kosten bleibt weiterhin die Verkürzung der benötigten Entwicklungszeit ein Ziel. Ein entscheidender Faktor dabei ist die zuverlässige Absicherung von Entwurfsentscheidungen in einer frühen Entwurfsphase. In der vorliegenden Arbeit wird eine Methode vorgestellt, die eine Bewertung von Entwurfsentscheidungen bei Systemmodellen mittels automatisch ermittelter Indikatoren ermöglichen soll. Die Systemmodelle können mit der Entwurfsumgebung MATLAB/Simulink oder in SystemC beschrieben sein.

  20. Neues über das Tertiär von Java und die mesozoischen Schichten von West-Borneo

    NARCIS (Netherlands)

    Martin, K.

    1888-01-01

    Die Monographie, welche unter dem Titel Die Fossilien von Java herausgegeben wird ¹), ist so weit fortgeschritten, dass sich aus den in ihr beschriebenen Gastropoden bereits eine Anzahl von Schlussfolgerungen ableiten lässt, welche für die in Bearbeitung begriffene, geologische Karte von Java von

  1. Eine Analyse des Zusammenhangs zwischen dem Konsum von Alkopops und dem Problemverhalten von Jugendlichen

    OpenAIRE

    Metzner, Cornelia Beate Isabel

    2007-01-01

    Zielsetzung: In dieser Arbeit wird untersucht, ob bei Jugendlichen ein Zusammenhang zwischen dem Konsum von Alkopops einerseits und dem sonstigen Alkoholtrinkverhalten, dem Konsum von Zigaretten und illegalen Drogen sowie weiteren Risikoverhaltensweisen andererseits besteht, ferner ob sich Unterschiede im Verhalten von Jungen und Mädchen ergeben. Theoretischer und empirischer Hintergrund: �Alkopops�, d. h. Mischgetränke diverser Hersteller aus Likör bzw. Schnaps und Limonade sowie wein- ...

  2. Sleep disturbance and its relationship to psychiatric morbidity after Hurricane Andrew.

    Science.gov (United States)

    Mellman, T A; David, D; Kulick-Bell, R; Hebding, J; Nolan, B

    1995-11-01

    Sleep disturbance is an important dimension of posttraumatic stress disorder (PTSD), but most of the limited available data were obtained years after the original traumatic event. This study provides information on sleep disturbance and its relationship to posttraumatic morbidity from evaluations done within a year after the trauma. Sleep and psychiatric symptoms of 54 victims (12 men and 42 women) of Hurricane Andrew who had no psychiatric illness in the 6 months before the hurricane were evaluated. A subset of hurricane victims with active psychiatric morbidity (N = 10) and nine comparison subjects who were unaffected by the hurricane were examined in a sleep laboratory. A broad range of sleep-related complaints were rated as being greater after the hurricane, and psychiatric morbidity (which was most commonly PTSD, followed by depression) had a significant effect on most of the subjective sleep measures. In addition, subjects with active morbidity endorsed greater frequencies of "bad dreams" and general sleep disturbances before the hurricane. Polysomnographic results for the hurricane victims revealed a greater number of arousals and entries into stage 1 sleep. REM density correlated positively with both the PTSD symptom of reexperiencing trauma and global distress. Subjects affected by Hurricane Andrew reported sleep disturbances, particularly those subjects with psychiatric morbidity. Tendencies to experience bad dreams and interrupted sleep before a trauma appear to mark vulnerability to posttraumatic morbidity. Results of sleep laboratory evaluations suggested brief shifts toward higher arousal levels during sleep for PTSD subjects and a relationship of REM phasic activity and symptom severity.

  3. Delayed tree mortality in the Atchafalaya Basin of Southern Louisiana following Hurricane Andrew

    Science.gov (United States)

    Keeland, B.D.; Gorham, L.E.

    2009-01-01

    Hurricanes can damage trees in forested wetlands, and the potential for mortality related to these storms exists due to the effects of tree damage over time. In August 1992, Hurricane Andrew passed through the forested wetlands of southern Louisiana with winds in excess of 225 kph. Although more than 78 of the basal area was destroyed in some areas, most trees greater than 2.5 cm dbh were alive and resprouting prolifically the following year (98.8). Survival of most tree species was similarly high two years after the hurricane, but mortality rates of some species increased dramatically. For example, Populus heterophylla (swamp cottonwood) mortality increased from 7.8 to 59.2 (n 76) and Salix interior (sandbar willow) mortality increased from 4.5 to 57.1 (n 21). Stem sprouts on many up-rooted hardwood trees of other species were still alive in 1998, 6 years after the hurricane. Due to the understory tree species composition, regeneration, and high levels of resprouting, there was little change in species composition or perhaps a slight shift toward more shade and flood tolerant species six years following the hurricane event. Triadica sebifera (Chinese tallow) was found on some of the sites heavily disturbed by Hurricane Andrew, and may proliferate at the expense of native tree species. ?? 2009 The Society of Wetland Scientists.

  4. Impacts of Hurricane Andrew on carbonate platform environments, northern Great Bahama Bank

    Science.gov (United States)

    Boss, Stephen K.; Neumann, A. Conrad

    1993-10-01

    The northern (most energetic) quadrant of Hurricane Andrew (August 1992) passed over leeward-margin sand waves, bank-top sand shoals, reefs, and low islands of Great Bahama Bank for which an extensive prestorm data base exists. A reconnaissance survey seven weeks after Hurricane Andrew evaluated storm impacts on these bank-top settings. Resurveyed seismic profiles showed that positions, dimensions, and orientations of platform sand bodies were unchanged relative to fixed bedrock features. Surveys of reef communities indicated only minor storm-related disturbance. Coral bleaching may be due to storm-induced environmental stress. In addition, storm-wave plucking of boulders from emergent rocky cays resulted in localized crushing of reef biota. On low islands, beach erosion and storm surge were insignificant, and storm damage to Casuarina forests was minor and substrate-specific. Observed minimal hurricane impacts on northern Great Bahama Bank environments lying 10-75 km from the hurricane eye are reconciled by analysis of meteorological data, which show significant weakening of the storm (expressed as a rise in central barometric pressure of ˜20 mbar) during passage across the bank-top. This study demonstrates the importance of specific dynamic aspects of hurricanes (e.g., varying intensity, strength, size, forward speed, duration) which influence their geologic potential, even over relatively short distances along the storm track of an individual hurricane.

  5. Demographic effects of natural disasters: a case study of Hurricane Andrew.

    Science.gov (United States)

    Smith, S K; McCarty, C

    1996-05-01

    Many studies have considered the economic, social, and psychological effects of hurricanes, earthquakes, floods, tornadoes, and other natural disasters, but few have considered their demographic effects. In this paper we describe and evaluate a method for measuring the effects of Hurricane Andrew on the housing stock and population distribution in Dade County, Florida. Using information collected through sample surveys and from other data sources, we investigate the extent of housing damages, the number of people forced out of their homes, where they went, how long they stayed, and whether they returned to their prehurricane residences. We conclude that more than half the housing units in Dade County were damaged by Hurricane Andrew; that more than 353,000 people were forced to leave their homes, at least temporarily; and that almost 40,000 people left the county permanently as a direct result of the hurricane. We believe that this study will provide methodological guidance to analysts studying the demographic effects of other large-scale natural disasters.

  6. Development of pile foundation bias factors using observed behavior of platforms during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Aggarwal, R.K.; Litton, R.W.; Cornell, C.A.; Tang, W.H.; Chen, J.H.; Murff, J.D.

    1996-12-31

    The performance of more than 3,000 offshore platforms in the Gulf of Mexico was observed during the passage of Hurricane Andrew in August 1992. This event provided an opportunity to test the procedures used for platform analysis and design. A global bias was inferred for overall platform capacity and loads in the Andrew Joint Industry Project (JIP) Phase 1. It was predicted that the pile foundations of several platforms should have failed, but did not. These results indicated that the biases specific to foundation failure modes may be higher than those of jacket failure modes. The biases in predictions of foundation failure modes were therefore investigated further in this study. The work included capacity analysis and calibration of predictions with the observed behavior for 3 jacket platforms and 3 caissons using Bayesian updating. Bias factors for two foundation failure modes, lateral shear and overturning, were determined for each structure. Foundation capacity estimates using conventional methods were found to be conservatively biased overall.

  7. Specific features of basalts from the western part of Andrew Bain Fault, Southwest Indian Ridge

    Science.gov (United States)

    Peyve, A. A.; Skolotnev, S. G.

    2017-12-01

    This paper reports original data on the composition of volcanic rocks in the western part of the Andrew Bain Fault of the South-West Indian Ridge obtained in the 23rd voyage of R/V Akademik Nikolai Strakhov. In accordance with high La/Th and low Nb/U ratios, the basalt compositions of stations S2317, S2318, and S2330 could result from melting of the DM-type source with HIMU traces. Meanwhile, the enriched samples of station S2326 correspond to a mantle source with a considerable contribution of recycled sediments (EM). Sample S2326/35, which is composed of a melt almost completely depleted in EM material, corresponds to the volcanic rocks of the Marion and Prince Edward islands. The obtained and available data on the SWIR segment from Bouvet Island to Andrew Bain Fault are indicative of small mantle heterogeneities in this region. Two possible variants of their origin are considered: either preservation of the enriched material fragments in the depleted mantle during the split of Gondwana or "contamination" of the mantle with plume material with the formation of vein irregularities before opening of the ocean in this region. In the latter case, the plume material could cover a huge area not constrained by the young plume magmatism regions on Bouvet, Marion, and Prince Edward islands.

  8. Ecological evaluation of proposed dredged material from St. Andrew Bay, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Mayhew, H.L.; Word, J.Q.; Kohn, N.P.; Pinza, M.R.; Karle, L.M.; Ward, J.A. [Battelle/Marine Sciences Lab., Sequim, WA (United States)

    1993-10-01

    The US Army Corps of Engineers (USACE), Mobile District, requested that the Battelle/Marine Sciences Laboratory (MSL) conduct field sampling and chemical and biological testing to determine the suitability of potential dredged material for open ocean disposal. Sediment from St. Andrew Bay was chemically characterized and evaluated for biological toxicity and bioaccumulation of contaminants. The Tier III guidance for ocean disposal testing requires tests of water column effects (following dredged material disposal), deposited sediment toxicity, and bioaccumulation of contaminants from deposited sediment (dredged material). To meet these requirements, the MSL conducted suspended-particulate-phase (SPP) toxicity tests, solid-phase toxicity tests, and bioaccumulation testing on sediment representing potential dredged material from Panama City Harbor. Physical and chemical characterization of sediment to support toxicity and bioaccumulation results was also conducted on both the test and reference sediments. The MSL collected sediment samples from five sites in St. Andrew Bay and one reference site near Lands End Peninsula. The five test sediments and the reference sediment were analyzed for physical and chemical sediment characteristics, SPP chemical contaminants, solid-phase toxicity, SPP toxicity, and bioaccumulation of contaminants.

  9. Discriminative validity of the MacAndrew Alcoholism Scale with Cluster B personality disorders.

    Science.gov (United States)

    Smith, S R; Hilsenroth, M J

    2001-06-01

    This study was designed to assess the ability of the Minnesota Multiphasic Personality Inventory (MMPI-2) MacAndrew Alcoholism Scale (MAC-R) to differentiate between outpatients with personality disorders with Substance-Related Disorders (SRDs) and without SRDs. MMPI-2 validity, clinical, and MAC-R scale scores were compared in an SRD Cluster B group (comprised of Narcissistic, Antisocial, Borderline, and Histrionic; n = 15), a non-SRD Cluster B group (n = 33), and a non-SRD group with personality disorders from Clusters A and C (n = 18). Results revealed that the substance-abusing Cluster B group scored significantly higher on the MAC-R ( p Personality Disorder (r =.60, p Personality Disorders were most related to MAC-R scores (R =.78, R(2) =.60). This indicates that the MAC-R may be more related to the presence of an SRD than has been suggested, and when used in outpatient settings as MacAndrew (1965) intended, the MAC-R may be useful as a screening device for assessing SRD among outpatients with Axis II psychopathology.

  10. Carl Von Clausewitz: Two Letters on Strategy

    National Research Council Canada - National Science Library

    Paret, Peter; Moran, Daniel

    1984-01-01

    This edition of Carl von Clausewitz's Two Letters on Strategy was made possible by the Army War College Foundation and by the Art of War Colloquium of the Army War College, which sponsors the volume...

  11. Johann Friedrich Wilhelm Adolf von Baeyer

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 6. Johann Friedrich Wilhelm Adolf von Baeyer: A Pioneer of Synthetic Organic Chemistry. Gopalpur Nagendrappa. General Article Volume 19 Issue 6 June 2014 pp 489-522 ...

  12. Von Onlineplattformen und mittelalterlichen Märkten

    Directory of Open Access Journals (Sweden)

    Claudius Gräbner

    2017-12-01

    Full Text Available Mit der zunehmenden Digitalisierung und Vernetzung ökonomischer Systeme haben plattformbasierte Interaktionsbeziehungen stark an Bedeutung gewonnen. Hier werden zwei oder mehr Nutzungsgruppen durch eine dritte Seite, die Plattform, zusammengebracht. Die Interaktion wird in solchen zweiseitigen Märkten von den Plattformbetreibern kontrolliert. Kreditkartensysteme, Softwaremärkte oder werbefinanzierte Online-Communities stellen typische Beispiele dar. Da die Analyse von zweiseitigen Märkten mit Gleichgewichtsmodellen aufgrund der algebraischen Struktur des Problems in der Regel nicht praktikabel ist, präsentieren wir im vorliegenden Beitrag ein agentenbasiertes Modell, welches in einem kürzlich erschienenen Artikel ausführlicher diskutiert wird. Anhand von illustrativen Beispielen verdeutlichen wir die Implikationen eines agentenbasierten Ansatzes für die Innovationsökonomik im Allgemeinen und das Studium von Technologieentwicklung im Besonderen.

  13. Die Wirkung von Desacetylcefotaxin, einem Metaboliten von Cefotaxim, in vitro und auf die experimentelle Infektion mit Escherichia coli

    OpenAIRE

    Wirbelauer, J.; Hof, H.; Hacker, Jörg

    2009-01-01

    Die MHK-Werte von Desacetylcefotaxim gegen verschiedene, z. T. ampicillinresistente Stämme von Escherichia coH, die mit Hilfe einer Agardilutionsmethode erhoben wurden, waren höher als die von Cefotaxim und Ceftriaxon, jedoch niedriger als die von Cefoxitin. In einem Modell der systemischen Infektion der Maus mit einem plasmidtragenden, betalactamaseproduzierenden Stamm von E. coli führte die Therapie mit Desacetylcefotaxim zu einer starken Reduktion der Keime pro Leber. Im Vergleich zur Ther...

  14. The classification problem for von Neumann factors

    DEFF Research Database (Denmark)

    Sasyk, R.; Törnquist, Asger Dag

    2009-01-01

    We prove that it is not possible to classify separable von Neumann factors of types II, II or III, 0 ≤ λ ≤ 1, up to isomorphism by a Borel measurable assignment of "countable structures" as invariants. In particular the isomorphism relation of type II factors is not smooth. We also prove...... that the isomorphism relation for von Neumann II factors is analytic, but is not Borel....

  15. Hullud päevad von Krahlis

    Index Scriptorium Estoniae

    2006-01-01

    Von Krahli Teatris mängitakse neil päevi neli korda Peeter Jalaka lavastuses Tõnu Kõrvitsa kammeroopereid "Tuliaed" ja "Mu luiged, mu mõtted", mille aluseks on luuletaja Marie Heibergi saatus. Libreto autor on Maarja Kangro. Kammerooperid tulevad lavale Von Krahli Teatri ja Nargen Opera koostöös. Esitavad Kädy Plaas, Helen Lokuta, Nargen Opera koor ja Tallinna Kammerorkester, dirigent Tõnu Kaljuste

  16. 50th birthday of Christian von Ferber

    Directory of Open Access Journals (Sweden)

    2011-06-01

    Full Text Available On May 15, 2011 Christian von Ferber - member of the Editorial Board of "Condensed Matter Physics" and renowned expert in the fields of soft matter physics and complex systems - celebrated his 50th birthday. The Editorial board of CMP, colleagues and friends warmy congratulate Christian von Ferber and wish him and his family continuing good health and to enjoy many adventures and discoveries in his future scientific travels!

  17. Die induzierbare antivirale Immunantwort von Drosophila melanogaster

    OpenAIRE

    Kemp, Cordula

    2010-01-01

    In der vorliegenden Arbeit wurde Drosophila melanogaster als Modell ge- nutzt, um die angeborene Immunantwort gegen virale Infektionen zu studie- ren. Wir untersuchten mit Hilfe von genomweiten microarrays das Transkriptom von Fliegen, welche entweder mit dem Drosophila C Virus (DCV), dem Flock- house Virus (FHV) oder dem Sindbis Virus (SINV) infiziert waren. Infektion mit diesen drei positiv orientierten Einzelstrang RNS Viren führte zu einer starken transkriptionellen Antwort, welche deutlic...

  18. Visualisierung von typisierten Links in Linked Data

    Directory of Open Access Journals (Sweden)

    Georg Neubauer

    2017-09-01

    Full Text Available Das Themengebiet der Arbeit behandelt Visualisierungen von typisierten Links in Linked Data. Die wissenschaftlichen Gebiete, die im Allgemeinen den Inhalt des Beitrags abgrenzen, sind das Semantic Web, das Web of Data und Informationsvisualisierung. Das Semantic Web, das von Tim Berners Lee 2001 erfunden wurde, stellt eine Erweiterung zum World Wide Web (Web 2.0 dar. Aktuelle Forschungen beziehen sich auf die Verknüpfbarkeit von Informationen im World Wide Web. Um es zu ermöglichen, solche Verbindungen wahrnehmen und verarbeiten zu können sind Visualisierungen die wichtigsten Anforderungen als Hauptteil der Datenverarbeitung. Im Zusammenhang mit dem Sematic Web werden Repräsentationen von zuhammenhängenden Informationen anhand von Graphen gehandhabt. Der Grund des Entstehens dieser Arbeit ist in erster Linie die Beschreibung der Gestaltung von Linked Data-Visualisierungskonzepten, deren Prinzipien im Rahmen einer theoretischen Annäherung eingeführt werden. Anhand des Kontexts führt eine schrittweise Erweiterung der Informationen mit dem Ziel, praktische Richtlinien anzubieten, zur Vernetzung dieser ausgearbeiteten Gestaltungsrichtlinien. Indem die Entwürfe zweier alternativer Visualisierungen einer standardisierten Webapplikation beschrieben werden, die Linked Data als Netzwerk visualisiert, konnte ein Test durchgeführt werden, der deren Kompatibilität zum Inhalt hatte. Der praktische Teil behandelt daher die Designphase, die Resultate, und zukünftige Anforderungen des Projektes, die durch die Testung ausgearbeitet wurden.

  19. 33 CFR 334.680 - Gulf of Mexico, southeast of St. Andrew Bay East Entrance, small-arms firing range, Tyndall Air...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico, southeast of St... AND RESTRICTED AREA REGULATIONS § 334.680 Gulf of Mexico, southeast of St. Andrew Bay East Entrance... the Gulf of Mexico, southeast of St. Andrew Bay East Entrance within a rectangular area beginning at a...

  20. 33 CFR 334.770 - Gulf of Mexico and St. Andrew Sound, south of East Bay, Fla., Tyndall Drone Launch Corridor...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico and St. Andrew... ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.770 Gulf of Mexico and St....; restricted area. (a) The area. The waters of the Gulf of Mexico and St. Andrew Sound within an area described...

  1. Thrombosis and von Willebrand Factor.

    Science.gov (United States)

    Shahidi, Minoo

    2017-01-01

    One of the key players in both hemostasis and thrombosis is von Willebrand factor (vWF), which demonstrates a duality between these two processes. Thrombus is structured by numerous elements, including endothelial cells, platelets, plasma proteins and shear stress alteration. In circulation, once a vessel wall is injured, collagen is exposed and platelets attach to the site of injury. Accordingly, vWF mediates adherence of platelets to the damaged vessel wall by binding both to the collagen and platelet receptor. A growing body of data also indicates a role for neutrophil extracellular traps (NETs) in human thrombosis as scaffolds for vWF, promoting thrombosis. VWF also mediates the protection of factor VIII, a main cofactor of the intrinsic clotting pathway. Since vWF plays a critical role in both thrombotic and bleeding events, a decreased plasma level of this factor may point to a bleeding disorder, while an elevated plasma level may predict occurrence of thrombosis. Since thrombotic events are the foremost cause of death, inhibiting the vWF activity would be a novel prophylaxis to reduce these events. Though, accumulated data have made vWF a promising focus for research on cardiovascular diseases (CVD). This chapter, however, aims to clarify the role of vWF in thrombus formation and pathogenesis of thrombosis.

  2. Protocols for Biotechnological Interventions in Improvement of Vanilla (Vanilla planifolia Andrews.).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal; Peter, K V

    2016-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a native of Central America, is the primary source of natural vanillin and plays a major role in the global economy. The gene pool of vanilla is threatened by deforestation and overcollection that has resulted in disappearance of natural habitats and wild species. Continuous vegetative propagation and lack of natural seed set and sufficient variations in the gene pool hamper crop improvement programs. In vitro techniques, one of the key tools of plant biotechnology, can be employed for overcoming specific problems, viz. production of disease-free clones, inducing somaclonal variations, developing hybrids, gene pool conservation, incorporating desired traits by distant hybridization, genetic engineering, etc. However, realization of these objectives necessitates standardization of protocols. This chapter describes the various protocols optimized for crop improvement in Vanilla species.

  3. A conversation with Andrew Benson: reflections on the discovery of the Calvin-Benson cycle.

    Science.gov (United States)

    Benson, Andrew

    2013-03-01

    On June 26-27, 2012, one of us (BBB) made a video based on an interview conducted with Andrew A. Benson, Professor Emeritus, Scripps Institution of Oceanography, University of California, San Diego, CA, USA. The video was first shown in a seminar presented by BBB on July 27, 2012 at the Calvin Laboratory, University of California, Berkeley, to mark the departure of the Energy Biosciences Institute to a new building. Here we record the conversation taking place during the interview. The Brancraft Library on the Berkeley campus will house the video's transcript in its oral histories collection, and the video will be housed in its motion picture collection. The video and the transcript have also been posted on You Tube (http://youtu.be/GfQQJ2vR_xE).

  4. Prosthetic rehabilitation of severe Siebert′s Class III defect with modified Andrews bridge system

    Directory of Open Access Journals (Sweden)

    Manu Rathee

    2015-01-01

    Full Text Available Prosthetic dentistry involves the replacement of missing and contiguous tissues with artificial substitutes to restore and maintain the oral functions, appearance, and health of the patient. The treatment of edentulous areas with ridge defects poses a challenging task for the dentist. Management of such cases involves a wide range of treatment options comprising mainly of surgical interventions and non surgical techniques such as use of removable, fixed or fixed- removable partial dentures. But each treatment plan undertaken should be customized according to patient needs. A variety of factors such as quality and quantity of existing contiguous hard and soft tissues, systemic condition and economic status of the patient play an important role in treatment planning, clinical outcome and prognosis. This case report presents the restoration of a Seibert′s Class III ridge defect by an economical modification of Andrews Bridge in a 32 Year old patient.

  5. Symptoms of posttraumatic stress in children after Hurricane Andrew: a prospective study.

    Science.gov (United States)

    La Greca, A; Silverman, W K; Vernberg, E M; Prinstein, M J

    1996-08-01

    The authors examined symptoms of posttraumatic stress in 3rd-5th grade children during the school year after Hurricane Andrew. From a conceptual model of the effects of traumatic events, 442 children were evaluated 3, 7, and 10 months postdisaster with respect to (a) their exposure to traumatic events during and after the disaster, (b) their preexisting demographic characteristics, (c) the occurrence of major life stressors, (d) the availability of social support, and (e) the type of coping strategies used to cope with disaster-related distress. Although symptoms of posttraumatic stress disorder (PTSD) declined over time, a substantial level of symptomatology was observed up to 10 months after the disease. All 5 factors in the conceptual model were predictive of children's PTSD symptoms 7 and 10 months postdisaster. Findings are discussed in terms of the potential utility of the model for organizing thinking about factors that predict the emergence and persistence of PTSD symptoms in children.

  6. Comprehensive assessment of health needs 2 months after Hurricane Andrew--Dade County, Florida, 1992.

    Science.gov (United States)

    1993-06-11

    On August 24, 1992, Hurricane Andrew struck southern Florida. More than 28,000 houses, mobile homes, and apartment buildings were destroyed, and approximately 107,000 additional dwellings sustained major damage. An estimated 180,000 persons were left homeless; insured damages were estimated at $15.5 billion and total damages at more than $30 billion. During the recovery period, many private and public health-care facilities damaged or destroyed in the storm were not functional. During November 3-13, to help prioritize health needs and direct public health resources, the Dade County Public Health Unit of the Florida Department of Health and Rehabilitative Services conducted a survey to assess health needs and the availability of health-care services during the recovery phase with funds provided by the Federal Emergency Management Agency (FEMA). This report summarizes the results of the survey.

  7. Damage Survey of Hurricane Andrew and Its Relationship to the Eyewall.

    Science.gov (United States)

    Wakimoto, Roger M.; Black, Peter G.

    1994-02-01

    A damage map documenting Hurricane Andrew's destructive land fall over southern Florida is presented. Vectors that represent the direction of winds causing damage to trees and structures are shown along with an F-scale rating in order to assess the strength of the near-surface winds. It is hypothesized that increased surface roughness once the hurricane made landfall may have contributed to a surface wind enhancement resulting in the strongest winds ever estimated (F3) for a landfall hurricane. This intense damage occurred primarily during the "second" period of strong winds associated with the east side of the eyewall. For the first time, a well-defined circulation in the damage pattern by the second wind was documented. A superposition of radar data from Miami and Key West on top of the damage map provides the first detailed examination of the relationship between the eyewall and the surface flow field as estimated from the damage vectors.

  8. Children's predisaster functioning as a predictor of posttraumatic stress following Hurricane Andrew.

    Science.gov (United States)

    La Greca, A M; Silverman, W K; Wasserstein, S B

    1998-12-01

    This study examined (a) children's predisaster behavioral and academic functioning as a predictor of posttraumatic stress (PTS) following Hurricane Andrew and (b) whether children who were exposed to the disaster would display a worsening of prior functioning. Fifteen months before the disaster, 92 4th through 6th graders provided self-reports of anxiety; peers and teachers rated behavior problems (anxiety, inattention, and conduct) and academic skills. Measures were repeated 3 months postdisaster; children also reported PTS symptoms and hurricane-related experiences (i.e., exposure). PTS symptoms were again assessed 7 months postdisaster. At 3 months postdisaster, children's exposure to the disaster, as well as predisaster ratings of anxiety, inattention, and academic skills, predicted PTS symptoms. By 7 months, only exposure, African American ethnicity, and predisaster anxiety predicted PTS. Prior anxiety levels also worsened as a result of exposure to the disaster. The findings have implications for identifying and treating children at risk for stress reactions following a catastrophic disaster.

  9. Stability and change in stress, resources, and psychological distress following natural disaster: Findings from hurricane Andrew.

    Science.gov (United States)

    Norris, F H; Perilla, J L; Riad, J K; Kaniasty, K; Lavizzo, E A

    1999-01-01

    Abstract The stress, resource, and symptom levels of 241 residents of southern Dade County, Florida were assessed 6 and 30 months after Hurricane Andrew. Percentages meeting study criteria for depression and PTSD did not change over time. Whereas mean levels of intrusion and arousal decreased, depressive symptoms remained stable, and avoidance/numbing symptoms actually increased. Intrusion and arousal were associated more strongly with pre-disaster factors (gender, ethnicity) and within-disaster factors (injury, property loss) than with post-disaster factors (stress, resources), but the reverse was true for depression and avoidance. Changes over time in symptoms were largely explained by changes over time in stress and resources. The findings indicate that ongoing services are needed to supplement the crisis-oriented assistance typically offered to disaster victims.

  10. Tilting at wave beams: a new perspective on the St Andrew's Cross

    Science.gov (United States)

    Akylas, T. R.; Kataoka, T.; Ghaemsaidi, S. J.; Holzenberger, N.; Peacock, T.

    2017-11-01

    The generation of internal gravity waves by a vertically oscillating cylinder that is tilted to the horizontal in a stratified fluid of constant buoyancy frequency, is investigated theoretically and experimentally. This forcing arrangement leads to a variant of the classical St Andrew's Cross that has certain unique features: (i) radiation of wave beams is limited due to a lower cut-off frequency set by the cylinder tilt angle to the horizontal; (ii) the response is essentially three-dimensional, as end effects eventually come into play when the cut-off frequency is approached, however long a cylinder might be. These results follow from kinematic considerations and are also confirmed by laboratory experiments. The kinematic analysis, moreover, suggests a resonance phenomenon near the cut-off frequency, where viscous and nonlinear effects are likely to play an important part. This scenario is examined by an asymptotic model as well as experimentally. Supported in part by NSF Grant DMS-1512925.

  11. Memorial Camels and Design by Committee: St Andrews Black Saturday Memorials

    Directory of Open Access Journals (Sweden)

    SueAnne Ware

    2015-02-01

    Full Text Available This paper examines a work in progress, the St Andrews Bushfire Memorial, which commemorates victims of the 7 February 2009 bushfires in Victoria, Australia. The paper’s intent is threefold: to describe and reflect on a current and ongoing memorial design project; to frame this project within a larger series of design discourses; and to examine the processes by which this memorial, but also many other grassroots or ‘bottom-up’ memorials, come into being. By examining the design process, I aim to open up various memorialisation and consultation methods for review. More importantly, however, by framing this project in contemporary discussions regarding socially engaged design practices, I offer a critique of the dictator–democrat binaries mentioned above and offer another way forward.

  12. Physical symptoms of chronic fatigue syndrome are exacerbated by the stress of Hurricane Andrew.

    Science.gov (United States)

    Lutgendorf, S K; Antoni, M H; Ironson, G; Fletcher, M A; Penedo, F; Baum, A; Schneiderman, N; Klimas, N

    1995-01-01

    This study examined the effects of Hurricane Andrew on physical symptoms and functional impairments in a sample of chronic fatigue syndrome (CFS) patients residing in South Florida. In the months after Hurricane Andrew (September 15-December 31, 1992), 49 CFS patients were assessed for psychosocial and physical functioning with questionnaires, interviews, and physical examinations. This sample was made up of 25 CFS patients living in Dade county, a high impact area, and 24 patients in Broward and Palm Beach counties, areas less affected by the hurricane. Based on our model for stress-related effects on CFS, we tested the hypothesis that the patients who had the greatest exposure to this natural disaster would show the greatest exacerbation in CFS symptoms and related impairments in activities of daily living (illness burden). In support of this hypothesis, we found that the Dade county patients showed significant increases in physician-rated clinical relapses and exacerbations in frequency of several categories of self-reported CFS physical symptoms as compared to the Broward/Palm Beach county patients. Illness burden, as measured on the Sickness Impact Profile, also showed a significant increase in the Dade county patients. Although extent of disruption due to the storm was a significant factor in predicting relapse, the patient's posthurricane distress response was the single strongest predictor of the likelihood and severity of relapse and functional impairment. Additionally, optimism and social support were significantly associated with lower illness burden after the hurricane, above and beyond storm-related disruption and distress responses. These findings provide information on the impact of environmental stressors and psychosocial factors in the exacerbation of CFS symptoms.

  13. Posttraumatic stress symptoms, intrusive thoughts, loss, and immune function after Hurricane Andrew.

    Science.gov (United States)

    Ironson, G; Wynings, C; Schneiderman, N; Baum, A; Rodriguez, M; Greenwood, D; Benight, C; Antoni, M; LaPerriere, A; Huang, H S; Klimas, N; Fletcher, M A

    1997-01-01

    To examine the impact of and relationship between exposure to Hurricane Andrew, a severe stressor, posttraumatic stress symptoms and immune measures. Blood draws and questionnaires were taken from community volunteer subjects living in the damaged neighborhoods between 1 and 4 months after the Hurricane. The sample exhibited high levels of posttraumatic stress symptoms by questionnaire (33% overall; 76% with at least one symptom cluster), and 44% scored in the high impact range on the Impact of Events (IES) scale. A substantial proportion of variance in posttraumatic stress symptoms could be accounted for by four hurricane experience variables (damage, loss, life threat, and injury), with perceived loss being the highest correlate. Of the five immune measures studied Natural Killer Cell Cytotoxicity (NKCC) was the only measure that was meaningfully related (negatively) to both damage and psychological variables (loss, intrusive thoughts, and posttraumatic stress disorder (PTSD). White blood cell counts (WBCs) were significantly positively related with the degree of loss and PTSD experienced. Both NKCC (lower) and WBC were significantly related to retrospective self-reported increase of somatic symptoms after the hurricane. Overall, the community sample was significantly lower in NKCC, CD4 and CD8 number, and higher in NK cell number compared to laboratory controls. Finally, evidence was found for new onset of sleep problems as a mediator of the posttraumatic symptom-NKCC relationship. Several immune measures differed from controls after Hurricane Andrew. Negative (intrusive) thoughts and PTSD were related to lower NKCC. Loss was a key correlate of both posttraumatic symptoms and immune (NKCC, WBC) measures.

  14. Hurricane Andrew Damage in Relation to Wood Decay Fungi and Insects in Bottomland Hardwoods of the Atchafalaya Basin, Louisiana

    Science.gov (United States)

    Theodor D. Leininger; A. Dan Wilson; Donald G. Lester

    1997-01-01

    Hurricane Andrew caused damage to more than 780 sq.km of bottomland hardwood and cypress-tupelo forests in the Atchafalaya Basin of Louisiana in August 1992. Trees in bottomland hardwood sites were examined, in early May 1994, for signs and symptoms of wood decay fungi, and for insect damage, ostensibly present before the hurricane, which may have predisposed trees to...

  15. The Psychological Effects of Hurricane Andrew on Ethnic Minority and Caucasian Children and Adolescents: A Case Study.

    Science.gov (United States)

    Jones, Russell T.; Frary, Robert; Cunningham, Phillippe; Weddle, J. David; Kaiser, Lisa

    2001-01-01

    Several measures of children's reactions to disasters were employed with 212 elementary and middle school students 6 months after experiencing Hurricane Andrew. Higher levels of intrusive symptomatology were found for girls and for elementary school children. Discusses lack of findings concerning race and implications for future research.…

  16. The role of the U.S. Army Medical Department in domestic disaster assistance operations - lessons learned from hurricane Andrew.

    Science.gov (United States)

    1996-04-01

    Hurricane Andrew, which struck South Dade County, Florida on the morning of 24 August 1992, was the "worst natural disaster ever to hit the United States..." The capabilities of the local and state governments to respond to the disaster were quickly ...

  17. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly

    Science.gov (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.

    2016-01-01

    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  18. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: III. The Orthoptera (Grasshoppers and Crickets).

    Science.gov (United States)

    David C. Lightfoot

    1986-01-01

    An inventory of Orthoptera (grasshoppers and crickets) at the H.J. Andrews Experimental Forest, near Blue River, Oregon, was conducted to determine the species present and ecological relationships. A key for identification and an annotated list are presented. From qualitative assessments of successional habitat relationships, generalized species associations of forest...

  19. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascade Mountains, Oregon: IV. The Oribatid Mites (Acari: Cryptostigmata).

    Science.gov (United States)

    Andrew Moldenke; Becky. Fichter

    1988-01-01

    A fully illustrated key is presented for identifying genera of oribatid mites known from or suspected of occurring in the Pacific Northwest. The manual includes an introduction detailing sampling methodology; an illustrated glossary of all terminology used; two color plates of all taxa from the H. J. Andrews Experimental Forest; a diagrammatic key to the 16 major...

  20. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: I. An annotated checklist of fleas.

    Science.gov (United States)

    Robert E. Lewis; Chris. Maser

    1981-01-01

    During a trapping survey of small mammals (approximately 3,000 individuals), species of fleas (1,632 specimens) were collected in the H.J. Andrews Experimental Forest, Western Cascades, Oregon. Host mammals were represented by 15 species—6 insectivores and 9 rodents captured from June through September. The collections extend our knowledge of the fauna of Oregon.

  1. Invertebrates of the H.J. Andrews Experimental Forest, western Cascades, Oregon II. an annotated checklist of caddisflies (Trichoptera)

    Science.gov (United States)

    N.H. Anderson; G.M. Cooper; D.G Denning

    1982-01-01

    At least 99 species, representing 14 families of Trichoptera, are recorded from the H.J. Andrews Experimental Forest, near Blue River, Oregon. The collecting sites include a wide diversity of environmental conditions in a 6000-hectare watershed of the western Cascade Range (from 400 to 1 630 meters in altitude and from 1st- to 7th-order streams).

  2. 77 FR 15600 - Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL

    Science.gov (United States)

    2012-03-16

    ...-AA08 Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL... navigable waters during the Emerald Coast Super Boat Grand Prix high speed boat races. Entry into... needed to safeguard persons and vessels from safety hazards associated with the Emerald Coast Super Boat...

  3. Religious Literacy or Spiritual Awareness? Comparative Critique of Andrew Wright's and David Hay's Approaches to Spiritual Education

    Science.gov (United States)

    Filipsone, Anta

    2009-01-01

    On the basis of a comparison of the educational approaches of Andrew Wright and David Hay this paper illustrates the persisting problem of dichotomising cognitive and trans-cognitive aspects of spiritual development and education. Even though both Wright and Hay speak of the same topic--spirituality and spiritual education--they define these terms…

  4. Climatic summaries and documentation for the primary meteorological station, H.J. Andrews Experimental Forest, 1972 To 1984.

    Science.gov (United States)

    Frederick A. Bierlmaler; Arthur. McKee

    1989-01-01

    This report describes the primary meteorological station at the H.J. Andrews Experimental Forest (elev. 426 m, lat. 44°15' N., long. 122°10' W.) in the Willamette National Forest, the automatic digital data logger, sensors, and data-processing procedures used in measuring air temperature, dewpoint temperature, windspeed, precipitation, and solar radiation....

  5. Privatiserung von Geschichte. Probleme einer differenzierten Aufarbeitung

    Directory of Open Access Journals (Sweden)

    Birthe Kundrus

    2000-11-01

    Full Text Available Ausgangspunkt der Untersuchung von Vera Neumann ist die These, daß im Krieg Erlebtes und Erlittenes in den Wiederaufbau- und Wirtschaftswunderjahren Westdeutschlands einem Thematisierungstabu unterlegen sei. Anhand von 50 Interviews, die in den 80er Jahren im Rahmen des von Lutz Niethammer geleiteten Projekts „Lebensgeschichte und Sozialgeschichte im Ruhrgebiet 1930–1960“ (LUSIR entstanden sind und die sie jetzt anhand der Tonbandprotokolle und Abschriften ein zweites Mal auswertet, möchte die Historikerin diese Verschüttungen aufspüren. Im Anschluß an Niethammers These der „Privatisierung von Geschichte“ will sie zeigen, daß seelische und körperliche Kriegsfolgen wie Deprivations- und Überlastungsgefühle, der Verlust von Angehörigen und Kriegsbeschädigungen „privatisiert“, d.h. an die Familien übertragen wurden. Dort seien dann in erster Linie die weiblichen Familienmitglieder mit der Versorgungs- und Pflegearbeit konfrontiert worden. An vier Fallbeispiele schließt sich eine detaillierte Auswertung des gesamten Interviewmaterials an. Diesen Teilen folgt ein Abschnitt zur staatlichen Kriegsopferversorgung in der frühen Bundesrepublik.

  6. Sulfation of von Willebrand factor

    International Nuclear Information System (INIS)

    Carew, J.A.; Browning, P.J.; Lynch, D.C.

    1990-01-01

    von Willebrand factor (vWF) is a multimeric adhesive glycoprotein essential for normal hemostasis. We have discovered that cultured human umbilical vein endothelial cells incorporate inorganic sulfate into vWF. Following immunoisolation and analysis by polyacrylamide or agarose gel electrophoresis, metabolically labeled vWF was found to have incorporated [35S]-sulfate into all secreted multimer species. The time course of incorporation shows that sulfation occurs late in the biosynthesis of vWF, near the point at which multimerization occurs. Quantitative analysis suggests the presence, on average, of one molecule of sulfate per mature vWF subunit. Virtually all the detectable sulfate is released from the mature vWF subunit by treatment with endoglycosidases that remove asparagine-linked carbohydrates. Sulfated carbohydrate was localized first to the N-terminal half of the mature subunit (amino acids 1 through 1,365) by partial proteolytic digestion with protease V8; and subsequently to a smaller fragment within this region (amino acids 273 through 511) by sequential digestions with protease V8 and trypsin. Thus, the carbohydrate at asparagine 384 and/or 468 appears to be the site of sulfate modification. Sodium chlorate, an inhibitor of adenosine triphosphate-sulfurylase, blocks sulfation of vWF without affecting either the ability of vWF to assemble into high molecular weight multimers or the ability of vWF multimers to enter Weible-Palade bodies. The stability of vWF multimers in the presence of an endothelial cell monolayer also was unaffected by the sulfation state. Additionally, we have found that the cleaved propeptide of vWF is sulfated on asparagine-linked carbohydrate

  7. Doença de von Willebrand e anestesia Enfermedad de von Willebrand y anestesia Von Willebrand's disease and anesthesia

    Directory of Open Access Journals (Sweden)

    Fabiano Timbó Barbosa

    2007-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A doença de von Willebrand ocorre devido à mutação no cromossomo 12 e é caracterizada por deficiência qualitativa ou quantitativa do fator de von Willebrand. A diversidade de mutações leva ao aparecimento das mais variadas manifestações clínicas possibilitando a divisão dos pacientes em vários tipos e subtipos clínicos. A coagulopatia se manifesta basicamente através da disfunção plaquetária associada à diminuição dos níveis séricos do fator VIII coagulante. O objetivo dessa revisão foi mostrar os cuidados relacionados aos pacientes portadores da doença de von Willebrand durante o período perioperatório. CONTEÚDO: Foram definidas as características da doença de von Willebrand quanto à fisiopatologia, à classificação, ao diagnóstico laboratorial, ao tratamento atual e aos cuidados com o manuseio do paciente no período perioperatório. CONCLUSÕES: A doença de von Willebrand é o distúrbio hemorrágico hereditário mais comum, porém ela é subdiagnosticada pela complexidade da própria doença. A correta classificação do paciente, o uso apropriado da desmopressina e a transfusão do fator de von Willebrand são medidas fundamentais para a realização do procedimento anestésico bem-sucedido.JUSTIFICATIVA Y OBJETIVOS: La enfermedad de von Willebrand ocurre debido a la mutación en el cromosoma 12 y se caracteriza por la deficiencia cualitativa o cuantitativa del factor de von Willebrand. La diversidad de mutaciones conlleva al aparecimiento de las más variadas manifestaciones clínicas posibilitando la división de los pacientes en varios tipos y subtipos clínicos. La coagulopatía se manifiesta básicamente a través de la disfunción plaquetaria asociada con la disminución de los niveles séricos del factor VIII coagulante. El objetivo de esa revisión fue mostrar los cuidados relacionados con las pacientes portadoras de la enfermedad de von Willebrand durante el per

  8. Gemeinsam hilfreich oder einsam lästig? Beurteilung von praktikumsbegleitenden Weblogs von angehenden Lehrpersonen

    Directory of Open Access Journals (Sweden)

    Nives Egger

    2017-02-01

    Full Text Available Weblogs werden an Hochschulen vermehrt zur Unterstützung von Lern- und Reflexionsprozessen eingesetzt, in der Lehrer/innenbildung auch zunehmend während der berufspraktischen Ausbildung. Die Studierenden beurteilen den Einsatz von Weblogs jedoch unterschiedlich. Dabei ist wenig bekannt, welchen Einfluss die Vergabe und das Erhalten von Peerfeedback auf den Beurteilungsprozess von praktikumsbegleitenden Weblogs sowie auf den Umfang von Blogpostings haben. Im folgenden Beitrag wird dieser Frage mittels einer Befragung von 74 angehenden Lehrpersonen nachgegangen, die praktikumsbegleitende Weblogs mit oder ohne Peerfeedback nutzten, um über herausfordernde Ereignisse im Praktikum zu reflektieren. Die Ergebnisse zeigen, dass Studierende, die Peerfeedback erhielten und andere Blogbeiträge kommentierten, den Weblogeinsatz nützlicher einschätzen sowie eine höhere Motivation und positivere Einstellung gegenüber den Einsatz von Weblogs aufweisen als Studierende, die ohne Peerfeedback bloggen. Keinen Einfluss hat Peerfeedback auf den Umfang der Blogbeiträge und auf die dafür aufgewendete Zeit.

  9. Borel reductibility and classification of von neumann algebras

    DEFF Research Database (Denmark)

    Sasyk, R.; Törnquist, Asger Dag

    2009-01-01

    We announce some new results regarding the classification problem for separable von Neumann algebras. Our results are obtained by applying the notion of Borel reducibility and Hjorth's theory of turbulence to the isomorphism relation for separable von Neumann algebras....

  10. Kerttu Wagner. Die historischen romane von Jaan Kross / Wolfgang Drechsler

    Index Scriptorium Estoniae

    Drechsler, Wolfgang, 1963-

    2001-01-01

    Arvustus: Wagner, Kerttu. Die historischen Romane von Jaan Kross : am Beispiel einer Untersuchung der deutschen und englischen Übersetzungen von "Professor Martensi ärasõit" (1984). Frankfurt am Main [etc.] : P. Lang, 2001.

  11. Gasification of liquid manure; Vergasung von Guelle

    Energy Technology Data Exchange (ETDEWEB)

    Gudenau, H.W.; Hoberg, H.; Hirsch, U. [Technische Hochschule Aachen (Germany). Inst. fuer Eisenhuettenkunde

    1996-12-31

    The potential of thermal use of liquid manure is investigated. It is recommended to separate the liquid and solid fraction. While the liquid fraction can be used as fertilizer, the solid fraction can be used for generating a fuel gas for combined heat and power generation. (orig) [Deutsch] Die Untersuchungen haben ergeben, dass in der thermischen Verwertung von Guelle ein bisher nur wenig genutztes Potential vorliegt. Die zum Anbau von Getreide notwendige Duengung kann durch Separation von Guelle in Fest- und Duennfraktion effektiver und kostenguenstiger durchgefuehrt werden. Der Naehrstoffgehalt des Guellefeststoffs sollte durch thermische Aufbereitung aufkonzentriert werden, so dass eine Vermarktung auch mit laengeren Transpoertwegen darstellbar ist. Die bei der thermischen Behandlung gewonnene Waerme kann prozessintern genutzt und ueberschuessige Waerme an Abnehmer in der naeheren Umgebung geliefert werden. Genauso besteht die Moeglichkeit, ein Brenngas zu erzeugen und die Energie mit Kraft-Waerme-Kopplung zu nutzen. (orig)

  12. [Clinical medicine of P. F. von Siebold].

    Science.gov (United States)

    Nakamura, A

    1995-03-01

    The author elucidates some aspects of the clinical medicine of P.F. von Siebold (1796-1866) by studying a manuscript titled "Rampō-kuden, namely, dictative teaching of Dutch medicine by P.F. von Siebold", which has not been studied enough yet. From this manuscript the author considers the descriptions about cancers, gynecological diseases, syphilitic diseases, urinary diseases, ophthalmic diseases, skin diseases, pulmonary diseases, gastrointestinal diseases and osteo-articular diseases, and thereby shows the concepts and therapeutic techniques of P.F. von Siebold regarding these diseases. To make his therapeutics more clearly understood, the author comments on blood-letting, opiates, emetics, purgatives, peruvian bark, digitalis, physiotherapy, abdominal paracentesis and surgical operations written in this manuscript.

  13. [Anja Wilhelmi. Lebensweltlen von Frauen der deutschen Oberschicht im Baltikum (1800-1939). Eine Untersuchung anhand von Autobiographien] / Alexander Ewig

    Index Scriptorium Estoniae

    Ewig, Alexander, 1980-

    2011-01-01

    Arvustus: Wilhelmi, Anja. Lebenswelten von Frauen der deutschen Oberschicht im Baltikum (1800-1939). Eine Untersuchung anhand von Autobiographien. (Veröffentlichungen des Nordost-Instituts, 10.) (Wiesbaden : HArrassowitz 2008)

  14. Spectral theory and quotients in Von Neumann algebras | West ...

    African Journals Online (AJOL)

    In this note we consider to what extent the functional calculus and the spectral theory in von Neumann algebras are preserved by the taking of quotients relative to two-sided ideals of the von Neumann algebra. Keywords:von Neumann algebra, functional calculus, spectral theory, quotient algebras. Quaestiones ...

  15. Entwicklung von Methoden zur selektiven Trennung von Scandium, Zirkonium und Zinn für radiopharmazeutische Anwendungen

    OpenAIRE

    Dirks-Fandrei, Carina

    2014-01-01

    Die vorliegende Arbeit befasst sich mit der Entwicklung von schnellen und hoch selektiven Methoden für die Trennung und Aufreinigung von Scandium, Zirkonium und Zinn. Diese Radionuklide können aus potentiellen Targetmaterialien gewonnen werden und können Anwendung in der Nuklearmedizin finden. Es wurden verschiedene Resins (von TrisKem International) auf ihre Extraktionsfähigkeit im Hinblick auf eine breite Anzahl von Kat...

  16. Entwicklung und Validierung eines Fragebogens zum Erleben von Computerspielen : Untersuchung von Transfereffekten zwischen virtueller und realer Welt

    OpenAIRE

    Luthman, Stefanie

    2008-01-01

    In der vorliegenden Arbeit wird die Entwicklung und Validierung eines Fragebogens vorgestellt, der auf den Überlegungen von Fritz (1997) zu einem Wirkungsmodell virtueller Welten basiert. Dieses Selbstbeurteilungsinstrument erfasst mit 40 Items Transferprozesse im Zusammenhang mit dem Spielen von Computer- und Videospielen. Die fünf Skalen des Fragebogens zum Erleben von Computerspielen (FEC) wurden durch faktorenanalytische Untersuchungen an einer repräsentativen Stichprobe von insgesamt 597...

  17. Die Verteilung und Eigenschaften von Bodenformen in der Deutschen Bucht, eine Rekonstruktion der Karten von Ulrich (1973)

    DEFF Research Database (Denmark)

    Winter, Christian; Lefebvre, Alice; Benninghoff, Markus

    2015-01-01

    Entstehung, Gestalt und Dynamik von Bodenformen in vergleichsweise kleinen Untersuchungsgebieten ist die Arbeit von ULRICH (1973) über die Verteilung von Bodenformen in der Deutschen Bucht bis heute die einzige verfügbare zusammenhängende Darstellung für die deutsche Nordseeküste. Die analogen Karten und die...

  18. Erwachsenenbildung im Spannungsfeld von Wissenschaft, Politik und Praxis: Heide von Felden, Christiane Hof und Sabine Schmidt-Lauff (Hrsg.). [Rezension

    OpenAIRE

    Filla, Wilhelm

    2016-01-01

    Rezension von: Felden, Heide von/Hof, Christiane/Schmidt-Lauff, Sabine (Hrsg.) (2013): Erwachsenenbildung im Spannungsfeld von Wissenschaft, Politik und Praxis. Dokumentation der Jahrestagung der Sektion Erwachsenenbildung der Deutschen Gesellschaft für Erziehungswissenschaften vom 27. bis 29. September 2012. Baltmannsweiler: Schneider Verlag Hohengehren.

  19. Einfluss von dynamischen Komponentenkennwerten auf die Zuverlässigkeitsanalyse von elektrischen Netzen

    OpenAIRE

    Schrammel, Michael

    2017-01-01

    von Michael Schrammel Arbeit an der Bibliothek noch nicht eingelangt - Daten nicht geprueft - Abweichender Titel nach Übersetzung der Verfasserin/des Verfassers Technische Universität Wien, Diplomarbeit, 2017

  20. Von der Medienwirkungsbehauptung zur erziehungswissenschaftlichen Medienrezeptionsforschung. Vorschlag zur Analyse von Filmkommunikaten

    Directory of Open Access Journals (Sweden)

    Barbara Drinck

    2001-04-01

    Full Text Available Im Hinblick auf die Erforschung spezifischer Zusammenhänge von Medienkonsum und der Herausbildung von Einstellungen und Handlungen wird eine konstruktivistische Theorieorientierung plausibilisiert, indem zunächst auf den Stand der Medienwirkungsforschung eingegangen und vor dem Hintergrund einer begründeten Kritik des Wirkungsverständnisses auf die Notwendigkeit einer medienrezeptionswissenschaftlichen Forschungsalternative hingewiesen wird. Weiterhin wird der Stand der (erziehungswissenschaftlichen Medienrezeptionsforschung erörtert. Sodann werden Elemente einer konstruktivistischen Methodologie von Medienrezeptionsforschung beschrieben, die am Beispiel der Rezeption von Filmen konkretisiert werden. Dabei wird das Konzept des Kommunikates (S.J. Schmidt als Ausgangspunkt genommen, ein Vorschlag für eine Beschreibungssprache für (Film- Kommunikate entwickelt und eine Adaption des Ansatzes filmischer Narration zur Sprache gebracht.

  1. Book received: Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

    Directory of Open Access Journals (Sweden)

    Alois Riegl

    2010-12-01

    Full Text Available Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

  2. Ueberreste vorweltlicher Proboscidier von Java und Banka

    NARCIS (Netherlands)

    Martin, K.

    1884-01-01

    Junghuhn führte in seinem Werke über Java nur einen einzigen Wirbelthierrest, Carcharias megalodon, an (7, IV, pag. 97); es war ihm nicht gelungen bei seinem ersten Aufenthalte auf der Insel Reste von Säugethieren zu finden, so eifrig er auch darnach in den Höhlen des Tertiaergebirges suchte (7, IV,

  3. Alexander von Humboldt and Coenraad Jacob Temminck

    NARCIS (Netherlands)

    Raat, A.J.P.

    1976-01-01

    INTRODUCTION In the archives of the Rijksmuseum van Natuurlijke Historie in Leiden there is a map with three letters written by Alexander von Humboldt (17691859) to the first director of the Museum, Coenraad Jacob Temminck (1778-1858). The map, the hard cover of John Gould's "Synopsis of the birds

  4. Alexander von Humboldt: a revolutionary explorer.

    Science.gov (United States)

    Fara, Patricia

    2008-03-01

    After he returned from his five-year expedition to the New World, Alexander von Humboldt promoted himself as a Romantic explorer. Although this image pervades British perceptions, political movements have fashioned different heroic versions of Humboldt in Germany and South America.

  5. Soolopartiid Von Krahli katuse all / Kristi Eberhart

    Index Scriptorium Estoniae

    Eberhart, Kristi

    2007-01-01

    Von Krahli Teatri kolmest lavastusest: "Erki ja Tiina" (lavastaja Mart Kangro, tantsivad Erki Laur ja Tiina Tauraite), "Faust" (J. W. Goethe ainetel tekst ja lavastus Taavi Eelmaa, muusika ja laulud Chalice, osades Jarek Kasar ja Rein Pakk), "Hamletid" (William Shakespeare'i ainetel kontseptsiooni, lavastuse, koreograafia, kujunduse, valguse autor Sasha Pepeljajev, video- ja helikunstnik Taavet Jansen. Esitaja Juhan Ulfsak)

  6. 489 Johann Friedrich Wilhelm Adolf von Baeyer

    Indian Academy of Sciences (India)

    IAS Admin

    Resonance journal of science education. June 2014 Volume 19 Number 6. GENERALARTICLES. 489 Johann Friedrich Wilhelm Adolf von Baeyer. A Pioneer of Synthetic Organic Chemistry. Gopalpur Nagendrappa. 523 Causality in Classical Physics. Asrarul Haque. 538 Physiology of High-Altitude Acclimatization.

  7. Measurements and von Neumann projection/collapse

    Indian Academy of Sciences (India)

    unwanted superpositions of (system + apparatus)-states can be shown to be suppressed, leading eventually to the projection/collapse rule postulated in von Neumann's treatment of measurements [3]. In the next section, the measurement problem in quantum mechanics (QM) is recalled. In §3, some proposed improvements ...

  8. Laue, Prof. Max Theodor Felix von

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1954 Honorary. Laue, Prof. Max Theodor Felix von. Nobel Laureate (Physics) - 1914. Date of birth: 9 October 1897. Date of death: 24 April 1960. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 January 2018. The 29th Mid-year ...

  9. Euler-Chelpin, Prof. Hans von

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1952 Honorary. Euler-Chelpin, Prof. Hans von. Nobel Laureate (Chemistry) - 1929. Date of birth: 15 February 1873. Date of death: 6 November 1964. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 January 2018. The 29th ...

  10. Hepatic artery pseudoaneurysm in von Willebrand's disease

    International Nuclear Information System (INIS)

    Garaci, Francesco Giuseppe; Gandini, Roberto; Romagnoli, Andrea; Fasoli, Fabrizio; Varrucciu, Viviana; Simonetti, Giovanni

    2003-01-01

    We report a case of hepatic artery pseudoaneurysm which occurred in a patient with von Willebrand's disease. The patient presented with upper abdominal pain and diagnosis was made by US and CT examinations. This case emphasizes the possible association between an established coagulation disorder and pseudoaneurysm. The patient was successfully treated by coil embolization. (orig.)

  11. Active Von Willebrand Factor, thrombocytopenia and thrombosis

    NARCIS (Netherlands)

    Hulstein, J.J.J.

    2006-01-01

    Platelets and von Willebrand factor (VWF) are unable to interact in circulation. To induce an interaction, a conversion of VWF to a platelet-binding conformation is required. At higher shear stresses, the first step in thrombus formation is binding of VWF to the subendothelium. This results in

  12. Euler-Chelpin, Prof. Hans von

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1952 Honorary. Euler-Chelpin, Prof. Hans von. Nobel Laureate (Chemistry) - 1929. Date of birth: 15 February 1873. Date of death: 6 November 1964. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by ...

  13. Laue, Prof. Max Theodor Felix von

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1954 Honorary. Laue, Prof. Max Theodor Felix von. Nobel Laureate (Physics) - 1914. Date of birth: 9 October 1897. Date of death: 24 April 1960. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the ...

  14. Ueber eine Anomalie von Acromitus flagellatus (Stiasny)

    NARCIS (Netherlands)

    Stiasny, G.

    1934-01-01

    Bei erneuter Durchsicht des reichhaltigen Materiales von Acromitus flagellatus (Stiasny) in der Scyphomedusen-Sammlung des Rijksmuseum van Natuurlijke Historie in Leiden (vergl. meine Mitteilungen daruber, 1920, Uebersichtstabelle III und 1921, p. 131/136) fand ich ein Exemplar, das eine

  15. Von Kalifornien nach Taxham / Katri Soe

    Index Scriptorium Estoniae

    Soe, Katri, 1971-

    2005-01-01

    Neljas osa magistritööst "Von Kalifornien nach Taxham: Formen und Strukturen der Kommunikation in Peter Handkes Romanen "Der kurze Brief zum langen Abschied" und "In einer dunklen Nacht ging ich aus meinem stillen Haus"" (Tartu, 2000. Juhendaja: Claus Sommerhage)

  16. Measurements and von Neumann projection/collapse

    Indian Academy of Sciences (India)

    based treatment of quantum measurements, an unambiguous treatment of the apparatus as a quantum system approximated well by a ... leading eventually to the projection/collapse rule postulated in von Neumann's treatment of measurements [3]. ... of Hilbert's sixth problem measurement leaves it in the same state.' In this ...

  17. Von der lernenden Region zur "Smart Region“

    OpenAIRE

    Poschwatta, Wolfgang

    2004-01-01

    Von der lernenden Region zur "Smart Region“ / M. Hilpert, W. Poschwatta. - In: Nabizadeh-Araghi, Nima : Auf dem Weg zur "Smart Region" : regionale Entwicklung am Beispiel der Pistazienproduktion im Iran. - Augsburg : Müllerdruck, 2004. - S. 5-9. - (Terra facta ; 2)

  18. Occurrence of Cucumber mosaic virus on vanilla (Vanilla planifolia Andrews) in India.

    Science.gov (United States)

    Madhubala, R; Bhadramurthy, V; Bhat, A I; Hareesh, P S; Retheesh, S T; Bhai, R S

    2005-06-01

    Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, Cucurbitaceae, Fabaceae and Solanaceae. Nicotiana benthamiana was found to be a suitable host for the propagation of CMV. The virus was purified from inoculated N. benthamiana plants and negatively stained purified preparations contained isometric particles of about 28 nm in diameter. The molecular weight of the viral coat protein subunits was found to be 25.0 kDa. Polyclonal antiserum was produced in New Zealand white rabbit, immunoglobulin G (IgG) was purified and conjugated with alkaline phosphatase enzyme. Double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) method was standardized for the detection of CMV infection in vanilla plants. CP gene of the virus was amplified using reverse transcriptase-polymerase chain reaction (RT-PCR), cloned and sequenced. Sequenced region contained a single open reading frame of 657 nucleotides potentially coding for 218 amino acids. Sequence analyses with other CMV isolates revealed the greatest identity with black pepper isolate of CMV (99%) and the phylogram clearly showed that CMV infecting vanilla belongs to subgroup IB. This is the first report of occurrence of CMV on V. planifolia from India.

  19. Wind damage effects of Hurricane Andrew on mangrove communities along the southwest coast of Florida, USA

    Science.gov (United States)

    Doyle, T.W.; Smith, T. J.; Robblee, M.B.

    1995-01-01

    On August 24, 1992, Hurricane Andrew downed and defoliated an extensive swath of mangrove trees across the lower Florida peninsula. Permanent field sites were established to assess the extent of forest damage and to monitor the rate and process of forest recovery. Canopy trees suffered the highest mortality particularly for sites within and immediately north of the storm's eyewall. The type and extent of site damage, windthrow, branch loss, and defoliation generally decreased exponentially with increasing distance from the storm track. Forest damage was greater for sites in the storm's right quadrant than in the left quadrant tor the same given distance from the storm center. Stand exposure, both horizontally and vertically, increased the susceptibility and probability of forest damage and accounted for much of the local variability. Slight species differences were found. Laguncularia racemosa exceeded Avicennia germinans and Rhizophora mangle in damage tendency under similar wind conditions. Azimuths of downed trees were strongly correlated with maximum wind speed and vector based on a hurricane simulation of the storm. Lateral branch loss and leaf defoliation on sites without windthrow damage indicated a degree of crown thinning and light penetration equivalent to treefall gaps under normally intact forest conditions. Mangrove species and forests are susceptible to catastrophic disturbance by hurricanes; the impacts of which are significant to changes in forest structure and function.

  20. William Horner Andrews (1887–1953 – First Professor of Physiology at Onderstepoort

    Directory of Open Access Journals (Sweden)

    D. W. Verwoerd

    2011-04-01

    Full Text Available WHAndrews qualified as a veterinarian in London in 1908 and was recruited soon after, in 1909, by Sir Arnold Theiler to join the staff of the newly established veterinary laboratory at Onderstepoort. After initial studies on the treatment of trypanosomosis and on snake venoms he was deployed by Theiler in 1911 to start research on lamsiekte (botulismat a field station on the farm Kaffraria near Christiana, where he met and married his wife Doris. After a stint as Captain in the SA Veterinary Corps during World War I he succeeded D T Mitchell as head of the Allerton Laboratory in 1918, where he excelled in research on toxic plants, inter alia identifying Matricaria nigellaefolia as the cause of staggers in cattle.Whenthe Faculty ofVeterinary Science was established in 1920 he was appointed as the first Professor of Physiology. After the graduation of the first class in 1924, and due to health problems, he returned to the UK, first to the Royal Veterinary College and then to the Weybridge Veterinary Laboratories of which he became Director in 1927.After his retirement in 1947 he returned to South Africa as a guest worker at Onderstepoort where he again became involved in teaching physiologywhenProf. Quin unexpectedly died in 1950. Andrews died in Pretoria in 1953 and was buried in the Rebecca Street Cemetery.

  1. Analysis of medical treatment at a field hospital following Hurricane Andrew, 1992.

    Science.gov (United States)

    Alson, R; Alexander, D; Leonard, R B; Stringer, L W

    1993-11-01

    To determine what medical care was required of a special operations response team by a community devastated by a major hurricane. Retrospective analysis of 1,544 patient encounter forms generated at a field hospital set up in Homestead, Florida, after Hurricane Andrew in August 1992 and staffed by the special operations response team from Forsyth County, North Carolina. All persons presenting for treatment. One thousand two hundred three adult patients and 336 pediatric patients were seen by the special operations response team. Only five of the injuries treated were due directly to the hurricane, whereas 285 of the treated injuries were sustained during clean-up activities. Most of the care provided was routine medical care denied the citizens due to the loss of their physicians' offices and clinics. Supplies of tetanus toxoid, antibiotics, and insulin were depleted in 24 hours. Resupplying these items and acquiring other medication to refill prescriptions constituted a pressing problem. The primary function of medical personnel responding to an area hit by a major hurricane will be to provide general medical care. Any trauma encountered will be primarily due to clean-up activities and not due to the hurricane itself. Responding medical personnel should plan on providing their own food and water for the first 72 hours and be well stocked with antibiotics, tetanus toxoid, and insulin.

  2. The generation of internal waves on the continental shelf by Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Allen, Susan E.

    2000-11-01

    Observed currents, temperature, and salinity from moored instruments on the Louisiana continental slope and shelf reveal multiple baroclinic oscillations during Hurricane Andrew in August 1992. These measurements are supplemented by numerical models in order to identify possible internal wave generation mechanisms. The Princeton Ocean Model is run with realistic topography, stratification, and wind forcing to extend the observations to Mississippi Canyon and other areas on the shelf. A two-layer isopycnal model is used with idealized topography and spatially uniform winds to isolate internal waves generated in and around the canyon. The combination of the observations and the results from the numerical models indicates several possible mechanisms for generating long internal waves: (1) near-inertial internal waves were generated across the slope and shelf by dislocation of the thermocline by the wind stress; (2) interaction of inertial flow with topography generated internal waves along the shelf break, which bifurcated into landward and seaward propagating phases; (3) downwelling along the coast depressed the thermocline; after downwelling relaxes, an internal wave front propagates as a Kelvin wave; and (4) Poincaré waves generated within Mississippi Canyon propagate seaward while being advected westward over the continental slope. These processes interact to produce a three-dimensional internal wave field, which was only partly captured by the observations.

  3. Weathering the storm: children's long-term recall of Hurricane Andrew.

    Science.gov (United States)

    Fivush, Robyn; Sales, Jessica McDermott; Goldberg, Amy; Bahrick, Lorraine; Parker, Janat

    2004-01-01

    Children who experienced a highly stressful natural disaster, Hurricane Andrew, were interviewed within a few months of the event, when they were 3-4 years old, and again 6 years later, when they were 9-10 years old. Children were grouped into low, moderate, or high stress groups depending on the severity of the experienced storm. All children were able to recall this event in vivid detail 6 years later. In fact, children reported over twice as many propositions at the second interview as at the first. At the initial interview, children in the high stress group reported less information than children in the moderate stress group, but 6 years later, children in all three stress groups reported similar amounts of information. However children in the high stress group needed more questions and prompts than children in the other stress groups. Yet children in the high stress group also reported more consistent information between the two interviews, especially about the storm, than children in the other stress groups. Implications for children's developing memory of stressful events are discussed.

  4. Storm-tide elevations produced by Hurricane Andrew along the southern Florida coasts, August 24, 1992

    Science.gov (United States)

    Murray, Mitchell H.

    1994-01-01

    On August 24, 1992, Hurricane Andrew crossed southern peninsular Florida. The combined effects of storm surge from the hurricane and astronomical tide, referred to as storm tide, caused flooding over a large part of southern Florida. Subsequent to the flooding, many high-water marks were identified, described, and surveyed along the south- eastern coast of Florida (Miami to Key Largo) and at selected areas along the southwestern coast of Florida (Flamingo to Goodland). Descriptions of these 336 high-water makrs are presented in tabular form in this report and their locations are plotted on nineteen 7.5-minute topographic quadrangle maps. For the southeastern coast, north-south profiles of the high-water makrs along the outher and inner barrier islands and the western shoreline of Biscayne Bay are presented. Average storm-tide elevations (relative to sea level) ranged from 4 to 6 feet in northern Biscayne Bay, were as much as 17 feet on the western shoreline near the center of the bay and ranged from 3 to 6 feet in southern Biscayne Bay and Barnes Sound. Storm-tide elevations along the southwestern coast ranged from 4 to 5 feet at Flamingo and 5 to 7 feet at Goodland in the Ten Thousand Islands area.

  5. Use of a modified cluster sampling method to perform rapid needs assessment after Hurricane Andrew.

    Science.gov (United States)

    Hlady, W G; Quenemoen, L E; Armenia-Cope, R R; Hurt, K J; Malilay, J; Noji, E K; Wurm, G

    1994-04-01

    To rapidly obtain population-based estimates of needs in the early aftermath of Hurricane Andrew in South Florida. We used a modified cluster-sampling method (the Expanded Programme on Immunization [EPI] method) for three surveys. We selected a systematic sample of 30 quarter-mile square clusters for each survey and, beginning from a random start, interviewed members of seven consecutive occupied households in each cluster. Two surveys were of the most affected area (1990 population, 32,672) at three and ten days after the hurricane struck; one survey was of a less affected area (1990 population, 15,576) seven days after the hurricane struck. Results were available within 24 hours of beginning each survey. Initial findings emphasized the need for restoring utilities and sanitation and helped to focus medical relief on primary care and preventive services. The second survey of the most affected area showed improvement in the availability of food, water, electricity, and sanitation (P < or = .05). There was no evidence of disease outbreaks. For the first time, the EPI method provided population-based information to guide and evaluate relief operations after a sudden-impact natural disaster. An improvement over previous approaches, the EPI method warrants further evaluation as a needs assessment tool in acute disasters.

  6. Business closure and relocation: a comparative analysis of the Loma Prieta earthquake and Hurricane Andrew.

    Science.gov (United States)

    Wasileski, Gabriela; Rodríguez, Havidán; Diaz, Walter

    2011-01-01

    The occurrence of a number of large-scale disasters or catastrophes in recent years, including the Indian Ocean tsunami (2004), the Kashmir earthquake (2005), Hurricane Katrina (2005) and Hurricane Ike (2008), have raised our awareness regarding the devastating effects of disasters on human populations and the importance of developing mitigation and preparedness strategies to limit the consequences of such events. However, there is still a dearth of social science research focusing on the socio-economic impact of disasters on businesses in the United States. This paper contributes to this research literature by focusing on the impact of disasters on business closure and relocation through the use of multivariate logistic regression models, specifically focusing on the Loma Prieta earthquake (1989) and Hurricane Andrew (1992). Using a multivariate model, we examine how physical damage to the infrastructure, lifeline disruption and business characteristics, among others, impact business closure and relocation following major disasters. © 2011 The Author(s). Disasters © Overseas Development Institute, 2011.

  7. Long-term effects of Hurricane Andrew: revisiting mental health indicators.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-09-01

    Two population-based surveys of South Dade County, Florida, were conducted after Hurricane Andrew to compare hurricane-related symptoms of mental distress and describe the impact of mental health outreach teams. Households were selected by three-stage cluster sampling and findings from the two surveys, 13 months apart, were compared. Response rates were 75 per cent and 84 per cent. The prevalence of symptoms of mental distress decreased over time. However, in the households contacted by the teams (25 per cent of sample), the prevalence of symptoms (50 per cent) did not differ from households not contacted (43 per cent). Households contacted by teams that reported symptoms were just as likely to have been referred for help by the teams (72 per cent) as those without symptoms (68 per cent). Households reporting symptoms were equally likely to get counselling regardless of whether the teams visited. Mental health teams had no significant impact on mental health symptoms or the use of mental health services. Alternative approaches to mental health outreach teams need to be explored.

  8. The post-disaster negative health legacy: pregnancy outcomes in Louisiana after Hurricane Andrew.

    Science.gov (United States)

    Antipova, Anzhelika; Curtis, Andrew

    2015-10-01

    Disasters and displacement increasingly affect and challenge urban settings. How do pregnant women fare in the aftermath of a major disaster? This paper investigates the effect of pregnancies in disaster situations. The study tests a hypothesis that pregnant women residing in hurricane-prone areas suffer higher health risks. The setting is Louisiana in the Gulf Coast, United States, a state that continually experiences hurricane impacts. The time period for the analysis is three years following the landfall of Hurricane Andrew in 1992. We analysed low birth weight and preterm deliveries before and after landfall, as a whole and by race. Findings support an association between hazards and health of a community and indicate that pregnant women in the affected area, irrespective of race, are more likely to experience preterm deliveries compared to pre-event births. Results suggest there is a negative health legacy impact in Louisiana as a result of hurricane landfall. © 2015 The Author(s). Disasters © Overseas Development Institute, 2015.

  9. [Von Willebrand disease. Molecular biology and diagnosis].

    Science.gov (United States)

    Hernández-Zamora, Edgar; Zavala-Hernández, Cesar; Quintana-González, Sandra; Reyes-Maldonado, Elba

    2015-01-01

    Von Willebrand disease is the most common inherited disorder of the coagulation proteins in humans. There are three types: 1, 2A, 2B, 2N, 2M and 3. It is associated with mutations on chromosome 12 in the region p13.2, encoding the von Willebrand factor (VWF), which is synthesized in endothelial cells and megakaryocytes. The VWF gene has been characterised using molecular biology techniques, which have acquired an important role in diagnosis von Willebrand disease, as well as in the investigation of alterations in other genes, which may be involved in regulating the synthesis, processing, and secretion of VWF. However, there are still no strategies to integrate the molecular biology diagnostic tests available. Analysis of VWF multimers is a methodology that meets the characteristics for diagnosis, but it is not easy to standardise. Considering that even in tertiary centres in our country, von Willebrand patients do not have a definitive diagnosis, it is necessary to implement these methodologies to study and improve diagnosis. Von Willebrand disease is highly heterogeneous due to the molecular mechanisms that produce the various clinical and laboratory phenotypes. In Mexico there are few studies related to this disease; therefore it is essential to conduct a comprehensive study including clinical, basic, and special testing laboratory tests, in order to establish a correct diagnosis, develop new therapeutic approaches, and offer the appropriate medical care and genetic counselling. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

  10. Predicting the Path to Recovery from Hurricane Katrina through the Lens of Hurricane Andrew and the Rodney King Riots

    OpenAIRE

    Robert Baade; Robert Baumann; Victor Matheson

    2005-01-01

    Hurricane Katrina caused the greatest damage of any hurricane in American history. We look at the rebuilding effort in New Orleans through the lens of two other disasters that occurred in 1992: Hurricane Andrew in Miami and the Rodney King riots in Los Angeles. The rebuilding effort in New Orleans shares similarities with both events, combining the impact of a hurricane on infrastructure and private businesses, and the prospect of an uneven recovery biased against racial minorities and the ec...

  11. Commentary on "The Perception and Cognition of Time in Balinese Music" by Andrew Clay McGraw

    OpenAIRE

    Ian Cross; Satinder Gill; Sarah Knight; Chris Nash; Tal-Chen Rabinowitch; Lydia Slobodian; Neta Spiro; Ghofur Woodruff; Matthew Woolhouse

    2008-01-01

    We review the paper by Andrew Clay McGraw, noting that it represents an interesting and valuable contribution to the study of music in cognition in its informed exploration of non-western musical perceptions. We raise a number of concerns about the methods used, and make suggestions as to how the issues that were empirically addressed in the paper might have been tackled in ways that would have enhanced the interpretability of its findings.

  12. Final Environmental Assessment for FY07-11 BRAC Construction Requirements at Andrews Air Force Base, Maryland

    Science.gov (United States)

    2007-09-01

    Branch Library of the Prince George’s County Memorial Library System at 14730 Main St. Upper Marlboro, MD 20772 and at the Andrews AFB Library at 1642...latifolia), highbush blueberry (Vaccinium corymbosum), and Christmas fern (Polystichium acrostichoides) (USAF 2001). Approximately 720 acres of...parks; national parks that exceeded 6,000 acres; and national wilderness areas and memorial parks that exceeded 5,000 acres if these areas were in

  13. National Status and Trends: Bioeffects Program - Magnitude and Extent of Sediment Toxicity in Four Bays of the Florida Panhandle: Pensacola, Choctawhatchee, St. Andrew and Apalachicola

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The toxicity of sediments in Pensacola, Choctawhatchee, St. Andrew and Apalachicola Bays was determined as part of bioeffects assessments performed by NOAA's...

  14. Cinema and the Great War - Andrew Kelly, 1997. History by Hollywood. The use and abuse of the American past - Robert Brant Toplin, 1996

    NARCIS (Netherlands)

    Kester, Bernadette

    1998-01-01

    textabstractReview of: Cinema and the Great War. Andrew Kelly, Londen, New York (Routledge), 1997, 219 p.History by Hollywood. The use and abuse of the American past. Robert Brant Toplin, Chicago (Urbana), 1996, 267 p.

  15. Twenty-one-month follow-up study of school-age children exposed to Hurricane Andrew.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Schorr, C

    1996-03-01

    To explore the 21-month course of posttraumatic stress symptomatology (PTSS) and psychological morbidity in 30 school-age children (7 to 13 years) after exposure to Hurricane Andrew. Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form were administered at 8 and 21 months after Hurricane Andrew. At 21 months 70% of the children endorsed moderate-severe PTSS. The reduction in PTSS was greater for boys than girls. Psychopathology as measured by the Teacher's Report Form increased over the 19-month period. Boys demonstrated significant increases in internalizing symptoms and in Withdrawn, Anxious/Depressed, Social Problems, and Attention Problems scales, and girls showed a significant increase in the Anxious/Depressed scale. Twenty-one months after exposure to Hurricane Andrew, there were continuing high levels of PTSS and evidence of increasing emotional and behavioral problems. While girls sustained higher levels of PTSS, boys demonstrated higher indices of other psychopathology. The enduring effects of disaster associated with secondary stressors and "traumatic reminders" continue to be etiologically important for continuing psychological morbidity.

  16. Doença de von Willebrand e anestesia Enfermedad de von Willebrand y anestesia Von Willebrand's disease and anesthesia

    OpenAIRE

    Fabiano Timbó Barbosa; Rafael Martins da Cunha; Luciano Timbó Barbosa

    2007-01-01

    JUSTIFICATIVA E OBJETIVOS: A doença de von Willebrand ocorre devido à mutação no cromossomo 12 e é caracterizada por deficiência qualitativa ou quantitativa do fator de von Willebrand. A diversidade de mutações leva ao aparecimento das mais variadas manifestações clínicas possibilitando a divisão dos pacientes em vários tipos e subtipos clínicos. A coagulopatia se manifesta basicamente através da disfunção plaquetária associada à diminuição dos níveis séricos do fator VIII coagulante. O objet...

  17. Damage to unburied flowlines in the Gulf of Mexico during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Collins, J.I.

    1995-12-31

    The US Minerals Management Service reported that 454 sub-sea pipelines were damaged during Hurricane Andrew. Previously, damage to pipelines and flowlines has been reported in a series of papers by Blumberg (1964). In the present paper a formulation of the hydrodynamic loads acting on a flowline which is lying on the seafloor in the presence of waves and currents is summarized. In general, the line dynamics can be represented by a fourth order differential equation with nonlinear forcing but a method is presented which assumes that the complete response can be broken down into distinct phases from ``early motion`` to ``taut line`` to ``yield and breaking``. The selection of appropriate force coefficients and boundary layer interactions is discussed. The initial stages of pipeline migration across the seafloor is shown to be followed by loading of the flowline once all of the ``slack`` is taken up. The loads are shown to be a function of the current orientation and the maximum tension is approximately proportional to the square of the distance between risers. Comparisons of predicted and observed damages confirm that ``effective`` boundary layer thicknesses at the seafloor and typical drag and lift coefficients which were selected based on available literature are consistent with observed flowline damage. The results of sidescan sonar mosaics of pipeline migrations and reported damage are consistent with the loads predicted by relatively simple hydrodynamic/structural models. The material presented in this paper permits the evaluation of the risk of damage to unburied flowlines using relatively simple tools. Guidelines to the assumptions of force coefficients and flowline responses are provided. 20 refs., 11 figs., 2 tabs.

  18. Low-Frequency Response Following the Passage of Hurricane Andrew on the Texas-Louisiana Shelf

    Science.gov (United States)

    Pearce, S. M.; Smith, D. C.; Dimarco, S. F.

    2009-12-01

    During August 24th through 27th in 1992, Hurricane Andrew passed through the Gulf Of Mexico almost directly over several moorings on the easternmost Louisiana shelf portion of the Texas-Louisiana Shelf (LATEX) coastal ocean monitoring program. Examination of the current meter time-series showed the existence of fast moving, long shelf waves over the entire Texas-Louisiana shelf west of the storm passage for up to 12 days after direct forcing ceased. The LATEX program featured 31 moorings each with 3 current meters over the 10, 20, 50, and 200 meter isobaths in 5 cross sectional lines with additional coverage on the 200 meter isobath from the Louisiana-Mississippi River delta, to Corpus Christi, Texas. Additionally, several pressure records from LATEX and several NOAA historical coastal tide gauge data from Sabine Pass to Port Isabella, Texas were incorporated. Raw, 3-hour low pass filtered, and 40-hour low pass filtered versions of the current data were analyzed. The pressure data used were detided using a least squares fit, and the tidal records were detided using the NOAA predicted tides for that location. All data were analyzed using a wavelet analysis to determine the spectra over time. The analyzed data shows that the shelf response was largely dominated in the internal Kelvin wave mode. The wave propagated towards the west on the shelf at approximately 400 km/day. These results are contrasted and compared with wave modes predicted for coastal trapped wave solutions. The output of a coastal ocean model simulation using a forced wind field similar to the storm are also contrasted and compared with the observed data.

  19. Tests of executive functioning predict scores on the MacAndrew Alcoholism Scale.

    Science.gov (United States)

    Deckel, A W

    1999-02-01

    1. Previous work reported that tests of executive functioning (EF) predict the risk of alcoholism in subject populations selected for a "high density" of a family history of alcoholism and/or the presence of sociopathic traits. The current experiment examined the ability of EF tests to predict the risk of alcoholism, as measured by the MacAndrew Alcoholism Scale (MAC), in outpatient subjects referred to a general neuropsychological testing service. 2. Sixty-eight male and female subjects referred for neuropsychological testing were assessed for their past drinking histories and administered the Wisconsin Card Sorting Test, the Wechsler Adult Intelligence Scale-Revised, the Trails (Part B) Test, and the MAC. Principal Components analysis (PCA) reduced the number of EF tests to two measures, including one that loaded on the WCST, and one that loaded on the Similarities, Picture Arrangement, and Trails tests. Multiple hierarchical regression first removed the variance from demographic variables, alcohol consumption, and verbal (i.e., Vocabulary) and non-verbal (i.e., Block Design) IQ, and then entered the executive functioning factors into the prediction of the MAC. 3. Seventy-six percent of the subjects were classified as either light, infrequent, or non-drinkers on the Quantity-Frequency-Variability scale. The factor derived from the WCST on PCA significantly added to the prediction of risk on the MAC (p = .0063), as did scores on Block Design (p = .033). Relatively more impaired scores on the WCST factor and Block Design were predictive of higher scores on the MAC. The other factors were not associated with MAC scores. 4. These results support the hypothesis that decrements in EF are associated with risk factors for alcoholism, even in populations where the density of alcoholic behaviors are not unusually high. When taken in conjunction with other findings, these results implicate EF test scores, and prefrontal brain functioning, in the neurobiology of the risk for

  20. Glass Cathedral: Gay Novel or Liberation Theology? An Interview with Andrew Koh

    Directory of Open Access Journals (Sweden)

    Angus Whitehead

    2013-05-01

    Full Text Available Singaporean Andrew Koh was a founding member of the groundbreaking Necessary Stage theatre company in 1987. In Singapore he is best remembered as the author of Glass Cathedral (1995, Singapore's second gay novel[la], which won the 1994 Singapore Literature Prize Commendation Award and was subsequently shortlisted for the 1996 Commonwealth Writers Prize for the Best First Novel Regional Awards. A collection of poetry, Hybrid from the East, was published in the UK in 1997. A second novel awaits publication. After initially leaving Singapore for London in the mid-1990s he now lives in Sydney as a healthcare worker and qualified Chinese medicine practitioner. Sixteen years after its initial publication, Glass Cathedral the novel is finally receiving attention and reappraisal in the wake of its Glass Cathedral's republication by Epigram Books as a Singapore Classic, alongside works such as Goh Poh Seng's The Immolation, Robert Yeo's The Adventures of Holden Heng and Lloyd Fernando's Scorpion Orchid. The interview took place on 8 November 2011 at a restaurant on the site of Koh's alma mater St Joseph's Institution, Bras Basah Road, Singapore, just days after Koh returned to the city-state and gave a spirited reading from and talk about Glass Cathedral at the Singapore Writers Festival. In this interview Koh discusses his Catholic upbringing, and his employment as a policeman during Singapore's policy of entrapment of homosexual men during the 1990s. Koh goes on to discuss how he came to write Glass Cathedral, his leaving Singapore in response to the nation-state's repressive climate and unsympathetic response to queer writing. In the second half of the interview Koh discusses homophobia in Singapore, the Catholic Church, and elsewhere and its roots in misogyny. Koh also draws attention to other issues explored in Glass Cathedral: the marginalisation of minorities in a supposedly multicultural nation state and the impact of Singapore's secret history

  1. Theodor von Grotthuss’ Contribution to Electrochemistry

    International Nuclear Information System (INIS)

    Pauliukaite, Rasa; Juodkazytė, Jurga; Ramanauskas, Rimantas

    2017-01-01

    Freiherr Christian Johann Dietrich Theodor von Grotthuss (1785-1822) lived and worked in Lithuania. Inspired by Volta's pile he proposed the first theory of water electrolysis, which was published in 1805 in Rome. Michael Faraday acknowledged T. Grotthuss for this theory in his further investigations of electrolysis processes. Having studied in Germany and France Grotthuss brought science to province by establishing his laboratory in Gedučiai village in his mother's real estate. Lithuanian scientists are proud that life of Theodor von Grotthuss was related to this country. Many events to remember this prominent scientist are organised in Vilnius and other places. His works and example provided a good basis for further development of electrochemical science in Lithuania. Grotthuss insights into the mechanism of proton transport still are of great relevance to such areas of modern science as membrane biochemistry, energy conversion and storage.

  2. Evolution equations of von Karman type

    CERN Document Server

    Cherrier, Pascal

    2015-01-01

    In these notes we consider two kinds of nonlinear evolution problems of von Karman type on Euclidean spaces of arbitrary even dimension. Each of these problems consists of a system that results from the coupling of two highly nonlinear partial differential equations, one hyperbolic or parabolic and the other elliptic. These systems take their name from a formal analogy with the von Karman equations in the theory of elasticity in two dimensional space. We establish local (respectively global) results for strong (resp., weak) solutions of these problems and corresponding well-posedness results in the Hadamard sense. Results are found by obtaining regularity estimates on solutions which are limits of a suitable Galerkin approximation scheme. The book is intended as a pedagogical introduction to a number of meaningful application of classical methods in nonlinear Partial Differential Equations of Evolution. The material is self-contained and most proofs are given in full detail. The interested reader will gain a ...

  3. Wir zeigen andere Bilder von Frauen ...

    Directory of Open Access Journals (Sweden)

    Bettina Rulofs

    2010-03-01

    Full Text Available Der vorliegende Beitrag beleuchtet die Bedeutung der Geschlechterordnung im Prozess der sportmedialen Kommunikation. Im Kern geht es um die Frage, inwiefern im Prozess der medialen Vermittlung von Sport traditionelle Geschlechterstereotype aufrechterhalten werden oder Möglichkeiten der Irritation solcher Stereotype bestehen. Dazu werden verschiedene Ebenen des massenmedialen Kommunikationsprozesses in den Blick genommen: die Medienprodukte, die Öffentlichkeitsarbeit und Selbst-Präsentation der Sportler/innen, die Medienrezeption und die Herstellungsprozesse von Medien in den Sportredaktionen. This article illustrates the relevance of gender in processes of sports media communication. The question in focus is in what way traditional gender stereotypes are perpetuated in the process of media communication in sport and how such stereotypes can be irritated. Therefore different levels of mass media communication are considered: the media products, the public relations of athletes and the presentation of themselves as athletes, the media-reception and the production processes in sport departments of media institutions.

  4. Management of the von Roos operator

    Science.gov (United States)

    Molinar-Tabares, Martin; Castro-Arce, Lamberto; Figueroa-Navarro, Carlos; Campos-Garcia, Julio

    When an electron is inside a semiconductor medium its effective mass rises from the shielding of the crystalline structure. When we have a semiconductor with a constant concentration the effective mass has a fixed value, and in this case, it can be easy to solve the Schrodinger equation of the particle, but if the concentration varies spatially, the effective mass will no longer constant and the solution can be difficult to find. The general form of the kinetic energy operator for a particle with variable mass is proposed for von Roos, this operator is characterized by some parameters whose values are subjected to a restriction. From a numerical solution of the Schrodinger equation we analyze the energies of an electron with position-dependent effective mass working with some values of the parameter of the von Roos operator. We acknowledge the support of SNI CONACYT.

  5. Funktionsanalyse von Hitzestressproteinen aus Lycopersicon esculentum

    OpenAIRE

    Tripp, Joanna

    2005-01-01

    Die Hitzestressantwort stellt einen universellen Schutzmechanismus aller lebenden Organismen dar. Infolge einer Temperaturerhöhung werden Hitzestresstranskriptionsfaktoren (Hsf) aktiviert und bewirken eine gesteigerte Expression von Hitzestressproteinen (Hsp). Als molekulare Chaperone schützen diese die Zelle vor durch Hitze verursachten Schäden. In höheren Pflanzen ist dieses Phänomen sowohl auf der Ebene der Hsf als auch der Hsp besonders komplex. Das Ziel der vorliegenden Arbeit war die Un...

  6. Von Herzen receives 1998 Maurice Ewing medal

    Science.gov (United States)

    Uyeda, Seiya; Von Herzen, Richard P.

    Richard P Von Herzen was awarded the 1998 Maurice Ewing Medal at the AGU Fall Meeting Honors Ceremony, which was held on December 8, 1998, in San Francisco, California. The medal recognizes significant original contributions to understanding physical, geophysical, and geological processes in the ocean; significant original contributions to scientific ocean engineering, technology and instrumentation; and/or outstanding service to marine sciences. This medal is presented jointly by the U.S. Navy and AGU.

  7. La Medea de Lars von Trier

    Directory of Open Access Journals (Sweden)

    Iratxe Fresneda Delgado

    2013-04-01

    Full Text Available El presente artículo analiza el modo en el que Lars von Trier recrea para el cine el estereotipo de Medea. Mediante el análisis fílmico de la película y apoyándose en los estudios culturales, el texto se interroga acerca de la importancia y el poder potencial del cine a la hora recuperar el antiguo mito y demostrar su vigencia. El análisis amplía horizontes para la compresión de los mecanismos que articulan el entramado de significados de la película, donde Von Trier aporta una nueva visión del arquetipo de Medea uniéndola, a la tradición pictórica del Romanticismo. Una influencia que habita en las posteriores obras del director danés, donde el paisaje, la naturaleza, se erige en elemento catalizador de las pulsiones humanas, en su cómplice y testigo.This paper explores the way that Lars von Trier’s film recreates the stereotype of Medea. Using film analysis and based on cultural studies the article asks about the importance and potential power of cinema to recover the ancient myth and show their effects. The analysis expands horizons for the understanding of the mechanisms that link the network of meanings of the film, where the author offers a new vision of Medea's archetype attaching it to the pictorial tradition tied to the Romanticism. An influence that can be seen in the later works of Lars von Trier, where the landscape, the nature, stands as a catalyst of human drives, as his accomplice and witness.

  8. Herstellung von Chitosan und einige Anwendungen

    Science.gov (United States)

    Struszczyk, Marcin Henryk

    2001-05-01

    1. Die Deacetylierung von crabshell - Chitosan führte gleichzeitig zu einem drastischen Abfall der mittleren viscosimetrischen Molmasse ( Mv), insbesondere wenn die Temperatur und die Konzentration an NaOH erhöht werden. Diese Parameter beeinflussten jedoch nicht den Grad der Deacetylierung (DD). Wichtig ist jedoch die Quelle des Ausgangsmaterials: Chitin aus Pandalus borealis ist ein guter Rohstoff für die Herstellung von Chitosan mit niedrigem DD und gleichzeitig hoher mittlerer Mv, während Krill-Chitin (Euphausia superba) ein gutes Ausgangsmaterial zur Herstellung von Chitosan mit hohem DD und niedrigem Mv ist. Chitosan, das aus Insekten (Calliphora erythrocephala), unter milden Bedingungen (Temperatur: 100°C, NaOH-Konzentration: 40 %, Zeit: 1-2h ) hergestellt wurde, hatte die gleichen Eigenschaften hinsichtlich DD und Mv wie das aus Krill hergestellte Chitosan. Der Bedarf an Zeit, Energie und NaOH ist für die Herstellung von Insekten-Chitosan geringer als für crabshell-Chitosan vergleichbare Resultaten für DD und Mv. 2. Chitosan wurde durch den Schimmelpilz Aspergillus fumigatus zu Chitooligomeren fermentiert. Die Ausbeute beträgt 25%. Die Chitooligomere wurden mit Hilfe von HPLC und MALDI-TOF-Massenspektrmetrie identifiziert. Die Fermentationsmischung fördert die Immunität von Pflanzen gegen Bakterien und Virusinfektion. Die Zunahme der Immunität schwankt jedoch je nach System Pflanze-Pathogen. Die Fermentation von Chitosan durch Aspergillus fumigatus könnte eine schnelle und billige Methode zur Herstellung von Chitooligomeren mit guter Reinheit und Ausbeute sein. Eine partiell aufgereinigte Fermentationsmischung dieser Art könnte in der Landwirtschaft als Pathogeninhibitor genutzt werden. Durch kontrollierte Fermentation, die Chitooligomere in definierter Zusammensetzung (d.h. definierter Verteilung des Depolymerisationsgrades) liefert, könnte man zu Mischungen kommen, die für die jeweilige Anwendung eine optimale Bioaktivität besitzen. 3

  9. Zur Kenntnis von Gnetum neglectum Bl

    NARCIS (Netherlands)

    Markgraf, F.

    1960-01-01

    Gnetum neglectum war nicht nur, wie der Name andeutet, bis zu Blumes Zeit übersehen worden, sondern es wurde von Späteren wiederum verkannt, wie ich in Bull. J. B. Buitenzorg 3. Ser. 10 (1930) 474 näher ausgeführt habe. Die echte Art taucht verhältnismässig selten in den Herbarien auf. Sie ist eine

  10. Von Medien, Übertragungen und Automaten

    Directory of Open Access Journals (Sweden)

    Alessandro Barberi

    2013-12-01

    Full Text Available Im Zuge der Debatten zum Medialen Habitus wurde vielfach betont, dass die >Theorie der Praxispraxeologischen Medientheorie< des Medialen Habitus avant la lettre gesprochen werden kann. Dieser Artikel untersucht – ausgehend von den Debatten zur "Medienkompetenz" – wie Bourdieu Sprache, Sprechen und Diskurs, sowie Akteure, Felder und Habitus als Medien begreift und betont dabei die Nützlichkeit der Bourdieuschen Bildungssoziologie im Rahmen einer sozialwissenschaftlichen Grundlegung der Medienpädagogik.

  11. Retrospektive Analyse von56 Weichteildefekten nach einzeitiger Rekonstruktion unter Verwendung von Dermisersatzpräparaten.

    Science.gov (United States)

    Gümbel, Denis; Ackerl, Martin; Napp, Matthias; Daeschlein, Georg; Spranger, Nikolai; Stope, Matthias B; Ekkernkamp, Axel; Matthes, Gerrit

    2016-06-01

    Der Verschluss von Wunden mit ausgeprägtem Weichteilschaden stellt eine chirurgische Herausforderung dar und erfordert häufig umfangreiche plastische Operationen sowie freie Lappenplastiken. Die Kombination von Dermisersatzpräparaten und Spalthauttransplantationen ist eine innovative Methode die zur Versorgung von komplexen Verletzungen der Extremitäten angewandt werden kann. Wir haben diese Technik in das Standard-Handwerkszeug bei komplexen Verletzungen der Extremitäten aufgenommen. Die klinischen Ergebnisse von 56 behandelten Patienten werden vorgestellt. In 44 Fällen (78,6 %) wurde die beschriebene Methode an Defekten der unteren Extremitäten verwendet, einschließlich sieben Personen (12,5 %), die sich einer Stumpfdeckung nach Amputation unterzogen. Zwölf Defekte (21,4 %) befanden sich an den oberen Extremitäten. In zwei Fällen (3,6 %) wurde die Matriderm(®) -Matrix verwendet, um Nerven von unmittelbar angrenzenden chirurgischen Implantaten zu schützen. Bei 41 Patienten (73,2 %) kam es zur Einheilung des Transplantats ohne Komplikationen. Fünfzehn Patienten (26,8 %) zeigten eine gestörte Wundheilung nach Defektverschluss, die unter konservativer Therapie zur Ausheilung gebracht werden konnte. Ein Patient (1,8 %) zeigte ein Transplantatversagen, was eine Revisionsoperation erforderlich machte. Umfangreiche plastische Rekonstruktionen mussten bei keinem Patienten angewandt werden. Bei Fällen, in denen ausgedehnte plastische Operationen nicht möglich oder nicht erwünscht sind, ist die Verwendung von Dermisersatzpräparaten in Kombination mit Spalthauttransplantationen eine vielversprechende Alternative zum Wundverschluss bei ausgedehnten Weichteilschäden. © 2016 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

  12. Saage tuttavaks : Elisabeth ja Karl von Hoerschelmann / Mai Levin

    Index Scriptorium Estoniae

    Levin, Mai, 1942-

    2004-01-01

    Kuraator M. Levin kuni 10. X 2004 Adamson-Ericu muuseumis avatud näitusest "Tuntud ja tundmatud Elisabeth von Rosendorff-Hoerschelmann ja Karl von Hoerschelmann". Enamik töid on kunstnike laste Konstantin Hoerschelmanni ja Anna Röder-Hoerschelmanni omand. Elisabeth Rosendorff (1898-1984) sündis Virumaal Maidlas eesti perekonnas, Karl von Hoerschelmann (1899-1951) Sevastoopolis saksa perekonnas

  13. Gestalt und Funktion von Animal Design : Versuch einer semiotischen Analyse

    OpenAIRE

    Schlüter, Wolfgang

    2009-01-01

    Dissertation zur Gestalt und Funktion von Animal Design (tieranaloges Design). Untersucht wird eine Auswahl an Produkten, die in ihrem Äußeren an Tiere erinnern. Hierbei stehen Aspekte wie die Emotionalisierung von Produkten, demonstrativer Konsum und die soziale Funktion im Fokus der Analyse. Anhand von Abbildungen und Zeichnungen wird u.a. dargestellt, welche Bedeutung die Tiergestalt für das jeweilige Produktdesign hat. Die Objekte werden jeweils unter phänomenologischen, hermeneutischen u...

  14. Untersuchungen zum Emissionsgeschehen von Ammoniak und Methan in der Mastschweinehaltung

    OpenAIRE

    Gronow-Schubert, Stephanie

    2017-01-01

    Der Anbau von Futtermitteln, die Haltung von Nutztieren, die Verarbeitung der tierischen Produkte und die dadurch ausgeprägte Flächennutzung durch die gesamte landwirtschaftliche Tierhaltung führen weltweit zu Treibhausgasemissionen. In direktem Zusammenhang mit der Haltung von Nutztieren und somit auch in der Mastschweinehaltung stehen die Ammoniak- und Methanemissionen. Das Hauptziel der vorliegenden Arbeit waren Untersuchungen zum Emissionsgeschehen und zu ausgewählten Ansätzen zur Emissio...

  15. Gespiegelte Planeten – Die Anordnung der Pyramiden von Gizeh

    OpenAIRE

    Jelitto, Hans

    2000-01-01

    Antike Bauwerke wurden wiederholt auf astronomische Zusammenhänge hin untersucht, so z. B. ihre Ausrichtung in Bezug auf die Bewegung von Sonne oder Sternen. Vor diesem Hintergrund wurden für die Pyramiden von Gizeh drei ungewöhnliche Gleichungen entdeckt, die die Pyramidengrößen mit einer Genauigkeit von ca. 0,1 % festlegen. Gleichzeitig legen diese drei Gleichungen nahe, die drei Pyramiden in der Reihenfolge Mykerinos-, Chefren- und Cheopspyramide den inneren drei Planeten unseres Sonnensys...

  16. Studien zur Kinetik der Fehlfaltung un Aggregation von Proteinen

    OpenAIRE

    Modler, Andreas Johannes

    2003-01-01

    Diese Arbeit befasst sich mit der Kinetik der Fehlfaltung und Aggregation von Proteinen. Anhand dreier Beispiele, der Phosphoglyceratkinase (PGK) aus Hefe, einer Variante von Barstar und des Prion-Proteins des Syrischen Hamsters (SHaPrP(90-232)) wurde insbesondere die Kinetik der Bildung von Amyloidfibrillen und deren kinetischer Vorläuferstrukturen mittels dynamischer und statischer Lichtstreuung, Circulardichroismus, Infrarotspektroskopie, Elektronenmikroskopie und teilweise analytischer Ch...

  17. Portrait of Dr. Von Braun with Walt Disney, 1954.

    Science.gov (United States)

    1954-01-01

    Marshall Center Director Dr. Wernher Von Braun is pictured with Walt Disney during a visit to the Marshall Space Flight Center in 1954. In the 1950s, Dr. Von Braun while working in California on the Saturn project, also worked with Disney studios as a technical director in making three films about Space Exploration for television. Disney's tour of Marshall in 1965 was Von Braun's hope for a renewed public interest in the future of the Space Program at NASA.

  18. Arbeitszeiten von Professorinnen und Professoren in Deutschland 2016

    OpenAIRE

    Weihs, Claus; Hernández Rodríguez, Tanja; Doeckel, Maximilian; Marty, Christoph; Wormer, Holger

    2018-01-01

    In dieser Studie werden belastbare Prognoseintervalle der wöchentlichen Gesamtarbeitszeit von Universitätsprofessorinnen und -professoren aus Daten einer Umfrage aus dem Jahre 2016 und a-priori Informationen aus früheren Studien bestimmt. Neben der Gesamtarbeitszeit werden auch Teilarbeitszeiten zum Beispiel für Lehre und Forschung ermittelt. Die Ergebnisse von frequentistischer und Bayesianischer Analyse werden verglichen. Aus den gültigen Fragebögen von aktiven Vollzeit arbeitenden Universi...

  19. Verbesserung der seismischen Kapazität von Mauerwerkswänden durch Verwendung von Elastomerlagern

    OpenAIRE

    Aldoghaim, Eyad

    2011-01-01

    Ein großer Teil der Schäden wie auch der Verluste an Gesundheit und Leben im Erdbebenfall hat mit dem frühzeitigen Versagen von Mauerwerksbauten zu tun. Unbewehrtes Mauerwerk, wie es in vielen Ländern üblich ist, weist naturgemäß einen begrenzten Erdbebenwiderstand auf, da Zugspannungen und Zugkräfte nicht wie bei Stahlbeton- oder Stahlbauten aufgenommen werden können. Aus diesem Grund wurde bereits mit verschiedenen Methoden versucht, die Tragfähigkeit von Mauerwerk im Erdbebenfall zu ve...

  20. Untersuchungen zur Farbreaktion von Amilorid, Chlorhexidin und Proguanil mit Hypobromit

    OpenAIRE

    Huth, Silke

    2004-01-01

    Bei der Reaktion von Amiloridhydrochlorid (1· HCl) mit Brom in alkalischer Lösung wird ein gelbbraunes Dehydrierungsprodukt erhalten, daß als 3-(3-Amino-1,2,4-oxadiazol-5-yl)-5-chlor-2,6-pyrazindiamin (6) identifiziert werden konnte. Durch Vergleich von Massen- und NMR-Spektren der Verbindung 6 mit Spektren von 1· HCl und Referenzsubstanzen I-III konnte auf die verbindung 6 geschlossen werden. Die Struktur wurde durch eine Röntgenstrukturanalyse abgesichert. Erhitzen von Amiloridhydrochlorid ...

  1. The effect of potassium and mycorrhiza on growth of vanilla (Vanilla planifolia Andrew

    Directory of Open Access Journals (Sweden)

    I GEDE TIRTA

    2006-04-01

    Full Text Available The few and shallow roots caused slow growth of vanilla seedling. Mycorrhiza may increased the absorption of water and nutrients, while potassium may increased the rate of growth and strength of seedlings. This study was conducted at Sambangan Village, Buleleng, Bali in 2003 (April-Agustus 2003. The experiment was done in polybag and was arranged in Randomized Block Design with three replications. The treatments were consisted of two factors. The first factor was the rates of KCl fertilizer ( 0, 100 and 200 kg ha-1 or 0, 0,10 and 0,20 9 plant-1 and the second factor was the rates of mycorrhiza (0, 20 and 30 g plant-1. The aim of the research to study interactions between potassium and mycorrhiza and The optimum dosage the mycorrhiza on growth of vanilla (Vanilla planifolia Andrew. The resultes showed that there were interactions between potassium and mycorrhiza on fresh weight of the new shoot, root length and fresh root weight. The optimum dosage of the mycorrhiza was 20 g plant-1 with new shoot fresh weight was 25.63 g plant-1. The longest root (24.67 cm plant-1 was observed at the treatment without potasium with 20 g plant-1 mycorrhiza and this was 23% longer than control (19.93 cm plant-1. The highest fresh root weight (2.48 g plant-1 was observed at the dosage of 200 kg KCl ha-1 and 20 g mycorrhiza plant-1 and that was 55% heavier than control (1.60 g plant-1. The leaf number of the plant with 20 g plant-1 mycorrhiza was 6.22 and that was 18% more than control with leaf number 5.25. The total fresh weight of the seedling with 20 g plant-1 mycorrhiza was 86.74 g plant-1or 15% higher compared with control (75.18 g plant-1. The dosage of 100 kg KCl ha-1 increased the K content of the plant (2.45%K or 35% higher than control (1.81%K.

  2. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992. [Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hebdon, F.J. [Institute of Nuclear Power Operations, Atlanta, GA (United States)

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility`s actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities.

  3. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992

    International Nuclear Information System (INIS)

    Hebdon, F.J.

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility's actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities

  4. The Andrews' Principles of Risk, Need, and Responsivity as Applied in Drug Abuse Treatment Programs: Meta-Analysis of Crime and Drug Use Outcomes.

    Science.gov (United States)

    Prendergast, Michael L; Pearson, Frank S; Podus, Deborah; Hamilton, Zachary K; Greenwell, Lisa

    2013-09-01

    The purpose of the present meta-analysis was to answer the question: Can the Andrews principles of risk, needs, and responsivity, originally developed for programs that treat offenders, be extended to programs that treat drug abusers? Drawing from a dataset that included 243 independent comparisons, we conducted random-effects meta-regression and ANOVA-analog meta-analyses to test the Andrews principles by averaging crime and drug use outcomes over a diverse set of programs for drug abuse problems. For crime outcomes, in the meta-regressions the point estimates for each of the principles were substantial, consistent with previous studies of the Andrews principles. There was also a substantial point estimate for programs exhibiting a greater number of the principles. However, almost all of the 95% confidence intervals included the zero point. For drug use outcomes, in the meta-regressions the point estimates for each of the principles was approximately zero; however, the point estimate for programs exhibiting a greater number of the principles was somewhat positive. All of the estimates for the drug use principles had confidence intervals that included the zero point. This study supports previous findings from primary research studies targeting the Andrews principles that those principles are effective in reducing crime outcomes, here in meta-analytic research focused on drug treatment programs. By contrast, programs that follow the principles appear to have very little effect on drug use outcomes. Primary research studies that experimentally test the Andrews principles in drug treatment programs are recommended.

  5. Aino Lepik von Wiren / Aino Lepik von Wiren ; interv. Kadi Alatalu

    Index Scriptorium Estoniae

    Lepik von Wirén, Aino, 1961-

    2007-01-01

    Heinrich Marga eksiilvalitsuse (20.06.1990-7.10.1992) kohtuminister Aino Lepik von Wiren pagulaslapse elust Rootsis, haridusest ja elukutse valikust, tööst eksiilvalitsuses, tööleasumisest Eestisse 1992. aastal, seadusandlikust tegevusest ning aluse panekust välismaalaste- ja kodakondsuspoliitikale, naiste võimalustest poliitilisse tippu tõusmiseks, kodu- ja väliseestlaste vastandamisest

  6. Von den Liven von Oesel / August Ludwig Schlözer

    Index Scriptorium Estoniae

    Schlözer, August Ludwig

    2008-01-01

    Avaldatud Eberhard Winkleri initsiatiivil A. L. Schlözeri teose põhjal: Gesammelte Nachrichten von den Ueberresten der Liven, in Livland und Kurland. (1770), mis moodustab osa teosest: Schlözer, August Ludwig. M. Johann Joseph Haigold's Beylagen zum Neuveränderten Russland. Zweiter Theil. Riga und Leipzig, 1770

  7. Ööklubi Club von Überlingen = Club von Überlingen

    Index Scriptorium Estoniae

    2008-01-01

    Ööklubi Club von Überlingen (Madara 22A, Tallinn) sisekujundusest. Sisearhitekt: Taavi Aunre (Boom.ee OÜ). Taavi Aunrest, tema tähtsamad tööd. I-II korruse plaan, 11 värv. vaadet, foto T. Aunrest

  8. Wirtschaftlichkeit von Facility Management - Entwicklungen und Trends

    Directory of Open Access Journals (Sweden)

    Redlein, Alexander

    2018-01-01

    Full Text Available Das vorliegende Paper baut auf den jährlichen Umfragen bzw. Studien des Immobilien und Facility Management (IFM der Technischen Universität Wien (TU Wien und der Dissertation von Susanne Hauk aus dem Jahr 2007 auf. Neben der Darstellung allgemeiner Daten konzentriert sich die Arbeit im Wesentlichen auf folgende Forschungsfragen:  In welchen Bereichen können Einsparungen generiert werden?  In welchen Bereichen können Produktivitätssteigerungen lukriert werden?  Mit welchen Problemen/Kostentreibern sind Facility Manager bzw. FM-Abteilungen konfrontiert?  Welche (statistisch signifikanten Zusammenhänge bestehen zwischen verschiedenen Merkmalen/Variablen? Seit dem Jahr 2005 wurden jährlich FM-Verantwortliche von den 500 größten Unternehmen Österreichs befragt. Im Rahmen der Umfrage sollen wissenschaftlich fundiert die obigen Forschungsfragen geklärt werden. Als Werkzeuge für die Datenerhebung wurden das Telefon und/oder elektronische Wege gewählt. Die Umfrage wurde anhand eines standardisierten Fragebogens mit 36 Fragen zu den verschiedensten FM-Bereichen durchgeführt. Im Rahmen der vorliegenden Arbeit sollen die Ergebnisse der aktuellen Umfrage dargestellt und mit den Ergebnissen der Studien der letzten Jahre verglichen werden. Die vorliegende Arbeit beschäftigt sich vor allem mit jenem Teil der Umfrage, der die oben genannten Forschungsfragen behandelt. Ziel ist dabei, die wichtigsten Parameter und Einflussfaktoren in den Bereichen Einsparungen, Produktivitätssteigerungen und Kostentreiber zu identifizieren und die Entwicklungen und Trends näher darzustellen. Dabei zeigt sich, dass effizientes FM große Potentiale in den Bereichen Einsparungen und Produktivitätssteigerungen lukrieren kann. Auch wenn die Einführung von FM zu Beginn mit Kosten/Problemen verbunden ist, so kann dies durch spätere Einsparungen und Produktivitätssteigerungen kompensiert werden.

  9. Effekte von Hyperoxie und Stickstoffmonoxid beim Neugeborenen

    OpenAIRE

    Höhn, Thomas

    2002-01-01

    In der vorliegenden Arbeit sind Untersuchungen vorgestellt, die sich mit Wirkungen und Interaktionen von zwei ubiquitär im menschlichen Körper vorkommenden Gasen befassen, i.e. Sauerstoff und Stickstoffmonoxid. Im Falle beider Substanzen ermöglicht die geringe Größe der Moleküle eine freie Diffusion über Membranen hinweg, eine Eigenschaft, die für die Funktion der Signaltransduktion geradezu prädestiniert. Aus den vorgelegten Untersuchungen lassen sich die folgenden Folgerungen ableiten: * S...

  10. A Metabiography of Alexander von Humboldt

    Directory of Open Access Journals (Sweden)

    Nicolaas A. Rupke

    2006-04-01

    Full Text Available Article in English.The author's recently published monograph on Alexander von Humboldt describes the multiple images of this great cultural icon. The book is a metabiographical study that shows how from the middle of the nineteenth century to the present day Humboldt has served as a nucleus of crystallisation for a variety of successive socio-political ideologies, each producing its own distinctive representation of him. The historiographical implications of this biographical diversity are profound and support current attempts to understand historical scholarship in terms of memory cultures.

  11. Unlawfulness of environmental zones; Rechtswidrigkeit von Umweltzonen

    Energy Technology Data Exchange (ETDEWEB)

    Balbach, Jan

    2016-07-01

    The author examines the new findings on the effectiveness of the environmental zones and, in this context, questions their legitimacy. In addition, the efforts of the European and German legislators are analyzed in order to reduce the particulate matter pollution. In addition, legal protection against the exceeding of limits for particulate matter is critically appreciated. [German] Der Autor beleuchtet die neuen Erkenntnisse zur Wirksamkeit der Umweltzonen und hinterfragt vor diesem Hintergrund deren Rechtmaessigkeit. Darueber hinaus werden die Bemuehungen des europaeischen und deutschen Gesetzgebers analysiert, um die Feinstaubbelastung zu senken. Zudem wird der Rechtsschutz gegen die Ueberschreitung von Feinstaubgrenzwerten kritisch gewuerdigt.

  12. Renaturierung von Waldökosystemen

    Science.gov (United States)

    Zerbe, Stefan

    Wälder sind neben der Landwirtschaft und den urban-industriellen Siedlungsflächen flächenmäßig die Hauptnutzungstypen in Mitteleuropa und stellen heute multifunktionale ökosysteme dar. Zusätzlich zur Holzproduktion kommt ihnen eine Regulations-(z.B.Wasserhaushalt), Schutz (z.B. von Biodiversität und gegen Erosion, Lawinen, Immissionen und Lärm) und Erholungsfunktion zu. Zudem haben Wälder als Kohlenstoffsenken auch eine besondere Bedeutung für den Klimaschutz.

  13. Key contributors: Ernst von Glasersfeld's radical constructivism

    Science.gov (United States)

    Tobin, Kenneth

    2007-07-01

    This article reviews the significance of the contributions of Ernst von Glasersfeld to research in science education, especially through his theoretical contributions on radical constructivism. As a field shaper, Glasersfeld's subversive ideas catalyzed debate in the science education community and fuelled transformation of many facets including research methods, ways of thinking about teaching and learning, curriculum, and science teacher education. Perturbations emanating from the debates on constructivism forged new pathways that led to the development and use of many of the sociocultural frameworks employed by authors in Cultural Studies of Science Education.

  14. Von Neumann algebras as complemented subspaces of B(H)

    DEFF Research Database (Denmark)

    Christensen, Erik; Wang, Liguang

    2014-01-01

    Let M be a von Neumann algebra of type II1 which is also a complemented subspace of B( H). We establish an algebraic criterion, which ensures that M is an injective von Neumann algebra. As a corollary we show that if M is a complemented factor of type II1 on a Hilbert space H, then M is injective...

  15. An accurate von Neumann's law for three-dimensional foams

    NARCIS (Netherlands)

    Hilgenfeldt, Sascha; Kraynik, Andrew M.; Koehler, Stephan A.; Stone, Howard A.

    2001-01-01

    The diffusive coarsening of 2D soap froths is governed by von Neumann's law. A statistical version of this law for dry 3D foams has long been conjectured. A new derivation, based on a theorem by Minkowski, yields an explicit analytical von Neumann's law in 3D which is in very good agreement with

  16. Erfahrungen an der Schnittstelle von Medienarbeit und Praxisforschung

    Directory of Open Access Journals (Sweden)

    Peter Holzwarth

    2007-11-01

    Full Text Available Der Beitrag reflektiert die Verbindung von praktischer Medienarbeit und Forschung am Beispiel eines internationalen EU-Forschungsprojekts zum Thema Medien und Migration. Neben didaktischen Prinzipien und Konzepten für die aktive Medienarbeit im Forschungskontext geht es um die Kooperation von medienpädagogischer Begleitung (MB und wissenschaftlicher Begleitung (WB sowie um deren spezifische Kompetenzen.

  17. Die baltischen Kapitulationen von 1710 : Kontext, Wirkungen, Interpretationen / Marten Seppel

    Index Scriptorium Estoniae

    Seppel, Marten, 1979-

    2015-01-01

    Arvustus: Die baltischen Kapitulationen von 1710 : Kontext, Wirkungen, Interpretationen, hrsg. von Karsten Brüggemann, Mati Laur und Pärtel Piirimäe, Queleln und Studien zur baltischen Geschichte, Bd 23 (Köln u.a: Böhlau Verlag, 2014)

  18. Star order and topologies on von Neumann algebras

    OpenAIRE

    Bohata, Martin

    2017-01-01

    The goal of the paper is to study a topology generated by the star order on von Neumann algebras. In particular, it is proved that the order topology under investigation is finer than $\\sigma$-strong* topology. On the other hand, we show that it is comparable with the norm topology if and only if the von Neumann algebra is finite-dimensional.

  19. Huldrich Zwingli se Von dem Touff, vom Widertouff und vom ...

    African Journals Online (AJOL)

    Huldrich Zwingli's 'Von dem Touff, vom Widertouff und vom Kindertouff': Some aspects of Zwringli's theological thought. The aim of this article is to let Zwingli speak for himself as he expresses himself in his treatise on baptism; Von dem Touff, vom Widertouff und vom Kindertouff. The use of secondary literature is avoided in ...

  20. Von Krahli teater mängib Kõrvitsa kammeroopereid

    Index Scriptorium Estoniae

    2006-01-01

    20. apr. esietenduvad Von Krahli Teatris Peeter Jalaka lavastuses Tõnu Kõrvitsa uued kammerooperid "Tuleaed" ja "Mu luiged, mu mõtted", mille aluseks on luuletaja Marie Heibergi saatus. Libretode autor on Maarja Kangro. Kammerooperid tulevad lavale Von Krahli Teatri ja Nargen Opera koostöös. Esitavad Kädy Plaas, Helen Lokuta, Nargen Opera koor ja Tallinna Kammerorkester, dirigent Tõnu Kaljuste

  1. Von Krahli teatris etenduvad Tõnu Kõrvitsa kammerooperid / Esme Kassak

    Index Scriptorium Estoniae

    Kassak, Esme

    2006-01-01

    20. apr. esietenduvad Von Krahli Teatris Peeter Jalaka lavastuses Tõnu Kõrvitsa uued kammerooperid "Tuleaed" ja "Mu luiged, mu mõtted", mille aluseks on luuletaja Marie Heibergi saatus. Libretode autor on Maarja Kangro. Kammerooperid tulevad lavale Von Krahli Teatri ja Nargen Opera koostöös. Esitavad Kädy Plaas, Helen Lokuta, Nargen Opera koor ja Tallinna Kammerorkester, dirigent Tõnu Kaljuste

  2. Compliance with periodic surveillance for Von-Hippel-Lindau disease

    NARCIS (Netherlands)

    Lammens, Chantal R. M.; Aaronson, Neil K.; Hes, Frederik J.; Links, Thera P.; Zonnenberg, Bernard A.; Lenders, Jacques W. M.; Majoor-Krakauer, Danielle; Van Os, Theo A. M.; Gomez-Garcia, Encarna B.; de Herder, Wouter; van der Luijt, Rob B.; van den Ouweland, Ans M. W.; Van Hest, Liselot P.; Verhoef, Senno; Bleiker, Eveline M. A.

    Purpose: To assess compliance with a periodic surveillance regimen for Von Hippel-Lindau disease. Methods: In this nationwide study, Von Hippel-Lindau disease mutation carriers and those at 50% risk were invited to complete a questionnaire assessing (compliance with) advice given for periodic

  3. Compliance with periodic surveillance for Von Hippel-Lindau disease

    NARCIS (Netherlands)

    Lammens, C.R.M.; Aaronson, N.K.; Hes, F.J.; Links, T.P.; Zonnenberg, B.A.; Lenders, J.W.M.; Majoor-Krakauer, D.; van Os, T.A.M.; Gomez-Garcia, E.B.; de Herder, W.; van der Luijt, R.B.; van den Ouweland, A.M.W.; van Hest, L.P.; Verhoef, S.; Bleiker, E.M.A.

    2011-01-01

    Purpose: To assess compliance with a periodic surveillance regimen for Von Hippel-Lindau disease. Methods: In this nationwide study, Von Hippel-Lindau disease mutation carriers and those at 50% risk were invited to complete a questionnaire assessing (compliance with) advice given for periodic

  4. Compliance with periodic surveillance for Von-Hippel-Lindau disease

    NARCIS (Netherlands)

    Lammens, C.R.; Aaronson, N.K.; Hes, F.J.; Links, T.P.; Zonnenberg, B.A.; Lenders, J.W.M.; Majoor-Krakauer, D.; Os, T.A. van; Gomez-Garcia, E.B.; Herder, W.W. de; Luijt, R.B. van der; Ouweland, A.M. van den; Hest, L.P. van; Verhoef, S.; Bleiker, E.M.

    2011-01-01

    PURPOSE: To assess compliance with a periodic surveillance regimen for Von Hippel-Lindau disease. METHODS: In this nationwide study, Von Hippel-Lindau disease mutation carriers and those at 50% risk were invited to complete a questionnaire assessing (compliance with) advice given for periodic

  5. Compliance with periodic surveillance for Von-Hippel-Lindau disease

    NARCIS (Netherlands)

    Lammens, Chantal R. M.; Aaronson, Neil K.; Hes, Frederik J.; Links, Thera P.; Zonnenberg, Bernard A.; Lenders, Jacques W. M.; Majoor-Krakauer, Danielle; van Os, Theo A. M.; Gomez-Garcia, Encarna B.; de Herder, Wouter; van der Luijt, Rob B.; van den Ouweland, Ans M. W.; van Hest, Liselot P.; Verhoef, Senno; Bleiker, Eveline M. A.

    2011-01-01

    To assess compliance with a periodic surveillance regimen for Von Hippel-Lindau disease. In this nationwide study, Von Hippel-Lindau disease mutation carriers and those at 50% risk were invited to complete a questionnaire assessing (compliance with) advice given for periodic surveillance. Medical

  6. Polychaeten aus den Zoologischen Museen von Leiden und Amsterdam I

    NARCIS (Netherlands)

    Augener, H.

    1933-01-01

    In der vorliegenden Arbeit ist die Untersuchung eines sehr umfangreichen Polychaeten-Materials niedergelegt, das mir von Herrn Prof. Dr. E. D. van Oort in Leiden und Herrn Prof. Dr. L. F. de Beaufort in Amsterdam zur Bearbeitung übergeben wurde. Von diesem Material ist der dem Museum in Leiden

  7. Victor or Villain? Wernher von Braun and the Space Race

    Science.gov (United States)

    O'Brien, Jason L.; Sears, Christine E.

    2011-01-01

    Set during the Cold War and space race, this historical role-play focuses on Wernher von Braun's involvement in and culpability for the use of slave laborers to produce V-2 rockets for Nazi Germany. Students will grapple with two central questions. Should von Braun have been allowed to emigrate to the United States given his affiliation with the…

  8. Mangroves, hurricanes, and lightning strikes: Assessment of Hurricane Andrew suggests an interaction across two differing scales of disturbance

    Science.gov (United States)

    Smith, Thomas J.; Robblee, Michael B.; Wanless, Harold R.; Doyle, Thomas W.

    1994-01-01

    The track of Hurricane Andrew carried it across one of the most extensive mangrove for ests in the New World. Although it is well known that hurricanes affect mangrove forests, surprisingly little quantitative information exists concerning hurricane impact on forest structure, succession, species composition, and dynamics of mangrove-dependent fauna or on rates of eco-system recovery (see Craighead and Gilbert 1962, Roth 1992, Smith 1992, Smith and Duke 1987, Stoddart 1969).After Hurricane Andrew's passage across south Florida, we assessed the environmental damage to the natural resources of the Everglades and Biscayne National Parks. Quantitative data collected during subsequent field trips (October 1992 to July 1993) are also provided. We present measurements of initial tree mortality by species and size class, estimates of delayed (or continuing) tree mortality, and observations of geomorphological changes along the coast and in the forests that could influence the course of forest recovery. We discuss a potential interaction across two differing scales of disturbance within mangrove forest systems: hurricanes and lightning strikes.

  9. Evaluation of long-term community recovery from Hurricane Andrew: sources of assistance received by population sub-groups.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-12-01

    Two three-stage cluster surveys were conducted in South Dade County, Florida, 14 months apart, to assess recovery following Hurricane Andrew. Response rates were 75 per cent and 84 per cent. Sources of assistance used in recovery from Hurricane Andrew differed according to race, per capita income, ethnicity, and education. Reports of improved living situation post-hurricane were not associated with receiving relief assistance, but reports of a worse situation were associated with loss of income, being exploited, or job loss. The number of households reporting problems with crime and community violence doubled between the two surveys. Disaster relief efforts had less impact on subjective long-term recovery than did job or income loss or housing repair difficulties. Existing sources of assistance were used more often than specific post-hurricane relief resources. The demographic make-up of a community may determine which are the most effective means to inform them after a disaster and what sources of assistance may be useful.

  10. Auf den Schultern von Riesen und Zwergen Einsteins unvollendete Revolution

    CERN Document Server

    Renn, Jürgen

    2006-01-01

    Dies ist die Geschichte von Einsteins unvollendeter Revolution, einer tiefgreifenden Veränderung unserer Begriffe von Raum, Zeit, Materie und Strahlung. Diese Revolution begann in Einsteins Wunderjahr 1905, wurde durch seine allgemeine Relativitätstheorie aus dem Jahre 1915 fortgesetzt und wirkt in den heutigen Versuchen der Wissenschaft, die Entstehung und das Schicksal des Universums zu verstehen, weiter. Vor dem Hintergrund einer historischen Theorie des wissenschaftlichen Fortschritts wird Einsteins bis heute nicht abgeschlossene Revolution als das Ergebnis einer langfristigen Entwicklung des Wissens verständlich. Anhand der spannenden Geschichte von Einsteins Entdeckungen wird nachvollziehbar, warum große Denker wie Einstein weiter gesehen haben als ihre Vorgänger. Sie standen nicht nur auf den Schultern von Riesen, also den wissenschaftlichen Leistungen einzelner großer Vorgänger wie Newton, sondern auch auf den Schultern von "Zwergen", dem wissenschaftlichen Wissen, dem technischen Wissen, und d...

  11. Die Krakauer Kirche von Karmeliten und Karmelitaninnen

    Directory of Open Access Journals (Sweden)

    Józef Szymon Wronski

    2004-12-01

    Full Text Available 1. Die Klosterkirche der unbeschuhten Karmelitinnen Zum Heiligen Josef. Ein glücklicher Auftakt und somit die charakteristische Einführung in das 20. Jh. für den Kirchenbau von Krakau war die Errichtung der Karmeliterinnen St. Josephs-Kirche an der Lobzowska-Straße 40, in der die Architekten (Tadeusz Stryjeński (1849-1943 - Projektant der Kirche und Franciszek Mączyński (1874-1947 - Ausführer des Bauprojektes mit eigenen Verbesserungen die historisch- eklektizistischen Formen d.h. die mittelalterlichen Formen vor allem des sog. Übergangsstils vereinfachten. Die Kirche, die in den Jahren 1903-1905 errichtet wurde, steht inmitten vom Baukomplex des Klosters, dessen Grundriss das Quadrat ist49. Der Kirchenbau ist ein dem Gesamtbau des Klosters eingefügter Längsraum. Hinter dem Chor liegt das Oratorium des Konvents. Das Material Backstein (mit Verwendung von Stein erinnert an die Baukunst eines der besten Architekten jener Zeit, nämlich Teodor Talowskis (1857-1910, der viele Kirchen in Südpolen, aber auch viele Bürgerhäuser nicht nur in Krakau im ausgehenden 19. Jh. baute. Die Architektur der Karmeliterinnen St. Josephs-Kirche ist immer noch im Malerischen begriffen. Aber die Vereinfachung der historischen Formen führt zu ihrer „Beruhigung” und dadurch zur Wuchtigkeit des Ausdrucks. Bemerkenswert ist die in dieser Zeit (in der Anlage noch seltene ausgewogene Proportionierung des Baukörpers. Das methodische Prinzip jener Zeit ist der Kontrast. Im Kontrast zu den gedrungenen und wuchtigen Formen des Baukörpers stehen z.B. die sich verjüngenden obeliskenförmigen und pylonenartigen Türmchen, die nicht nur die Eingangsfassade der Kirche flankieren, sondern auch an den Ecken des Querhauses der Kirche stehen. Die ingravierten weißen Steine an der Fassade in der Zahl von Zehn erinnern an das Gebot des Karmelterinnenordens: Bete täglich den Rosenkranz und sind zugleich ein Vanitativmotiv. 2. Die Klosterkirche der unbeschuhten

  12. Guy von Dardel 1919-2009

    CERN Multimedia

    2009-01-01

    Guy von Dardel, a well-known figure at CERN and in the international particle physics community, passed away on 28 August. Guy von Dardel came to CERN when it was founded in 1954 and was a full-time staff member until 1964, performing several experiments and working on technical developments. These included the first measurement of the neutral pion’s life-time. Called to Lund University in 1964, he became professor there in 1965 and director of the 1.2 GeV electron accelerator. In the late 1960s, he performed an experiment at CERN’s PS that measured the decays of the Λ. Then, in the early 1970s, he involved the Lund group in a series of experiments at the Intersecting Storage Rings (ISR), where he measured the production of various types of particles. In particular, he participated in a series of experiments that observed the production of a high abundance of particles with large transverse momenta. This required an explanation...

  13. Translational Medicine Advances in von Willebrand Disease

    Science.gov (United States)

    Lillicrap, David

    2014-01-01

    Following the recognition of von Willebrand disease (VWD) in 1926 and the cloning of the gene for von Willebrand factor (VWF) in 1985, significant advances have been made in our fundamental knowledge of both the disease and the protein. Some of this new knowledge has also begun to impact the clinical management of VWD. First, the progressive increase in our understanding of the molecular genetic basis of VWD has resulted in rational applications of molecular testing to complement the current range of phenotypic tests for VWD. These molecular genetic strategies are most effectively directed at the prenatal diagnosis of type 3 VWD and confirmatory testing for types 2B and 2N disease. In contrast, the use of molecular testing to clarify the diagnosis of type 1 VWD is of marginal benefit, at best. In terms of VWD therapies, a new recombinant VWF concentrate has recently completed successful clinical trials and is now awaiting more widespread application. There have even been some pre-clinical successes with VWF gene transfer although the clinical rationale for this therapeutic strategy needs careful consideration. Much more remains to be learnt about the biology of VWF and further translational advances for the enhancement of VWD care will inevitably be realized. PMID:23809112

  14. Suitability of tracers; Eignung von Tracern

    Energy Technology Data Exchange (ETDEWEB)

    Klotz, D. [GSF - Forschungszentrum fuer Umwelt und Gesundheit GmbH, Neuherberg (Germany). Inst. fuer Hydrologie

    1999-02-01

    Hydrological tracer techniques are a means of making statements on the direction and speed of underground water. One of the simpler tasks is to find out whether there is hydrological communication between two given points. This requires a determination of the direction of flow, which places less exacting demands on the properties of the tracer than does the task of determining the flow velocity of underground water. Tracer methods can serve to infer from flow velocity the distance (flow) velocity, which is defined as the ratio between the distance between two points located in flow direction and the actual time it takes water to flow from one to the other. [Deutsch] Mit Hilfe der hydrologischen Markierungstechniken koennen Aussagen ueber die Richtung und die Geschwindigkeit von Bewegungen des unterirdischen Wassers gemacht werden. Der einfachere Fall liegt vor, wenn festgestellt werden soll, ob zwischen zwei Punkten eine hydrologische Verbindung besteht. Bei dieser Fliessrichtungsbestimmung sind die Forderungen an die Eigenschaften der einzusetzenden Tracer geringer als bei der Bestimmung der Geschwindigkeit des unterirdischen Wassers. Von den Geschwindigkeiten des unterirdischen Wassers ist die Abstands-(Fliess)geschwindigkeit, die definiert ist durch das Verhaeltnis aus dem Abstand und der wahren Fliesszeit zwischen zwei in Bewegungsrichtung gelegenen Punkten, durch Tracermethoden zu bestimmen. (orig.)

  15. Approximate von Neumann entropy for directed graphs.

    Science.gov (United States)

    Ye, Cheng; Wilson, Richard C; Comin, César H; Costa, Luciano da F; Hancock, Edwin R

    2014-05-01

    In this paper, we develop an entropy measure for assessing the structural complexity of directed graphs. Although there are many existing alternative measures for quantifying the structural properties of undirected graphs, there are relatively few corresponding measures for directed graphs. To fill this gap in the literature, we explore an alternative technique that is applicable to directed graphs. We commence by using Chung's generalization of the Laplacian of a directed graph to extend the computation of von Neumann entropy from undirected to directed graphs. We provide a simplified form of the entropy which can be expressed in terms of simple node in-degree and out-degree statistics. Moreover, we find approximate forms of the von Neumann entropy that apply to both weakly and strongly directed graphs, and that can be used to characterize network structure. We illustrate the usefulness of these simplified entropy forms defined in this paper on both artificial and real-world data sets, including structures from protein databases and high energy physics theory citation networks.

  16. Coarse Graining Shannon and von Neumann Entropies

    Directory of Open Access Journals (Sweden)

    Ana Alonso-Serrano

    2017-05-01

    Full Text Available The nature of coarse graining is intuitively “obvious”, but it is rather difficult to find explicit and calculable models of the coarse graining process (and the resulting entropy flow discussed in the literature. What we would like to have at hand is some explicit and calculable process that takes an arbitrary system, with specified initial entropy S, and that monotonically and controllably drives the entropy to its maximum value. This does not have to be a physical process, in fact for some purposes it is better to deal with a gedanken-process, since then it is more obvious how the “hidden information” is hiding in the fine-grain correlations that one is simply agreeing not to look at. We shall present several simple mathematically well-defined and easy to work with conceptual models for coarse graining. We shall consider both the classical Shannon and quantum von Neumann entropies, including models based on quantum decoherence, and analyse the entropy flow in some detail. When coarse graining the quantum von Neumann entropy, we find it extremely useful to introduce an adaptation of Hawking’s super-scattering matrix. These explicit models that we shall construct allow us to quantify and keep clear track of the entropy that appears when coarse graining the system and the information that can be hidden in unobserved correlations (while not the focus of the current article, in the long run, these considerations are of interest when addressing the black hole information puzzle.

  17. [Heinz von zur Mühlen. Das Bürgertum Fordert Blut. Ein Bolschewistiches Flugblatt von 1918] / Paul Kaegbein

    Index Scriptorium Estoniae

    Kaegbein, Paul

    2007-01-01

    Arvustus: Heinz von zur Mühlen. Das Bürgertum Fordert Blut. Ein Bolschewistiches Flugblatt von 1918. In : Ostseeprovinzen, baltische Staaten und das Nationale. Münster : LIT, 2005, lk. 403-414. 1918. aastast pärit lendlehest, mille käekirja järgi otsustades on kirjutanud Viktor Kingissepp

  18. PROSTATIC CANCER AFTER PROSTATECTOMY FOR BENIGN ...

    African Journals Online (AJOL)

    hi-tech

    2000-12-01

    Dec 1, 2000 ... peripheral zone, the central zone, the transition zone and the periurethral gland zone(1,2). There is a ... prostatic transition zone have also been described(7). The epidemiology of prostate cancer is ..... Brawn P.N., Ayala A.G., Von Eschenbach A.C., Hussey D.H. and. Johnson D.E. Histologic grading study ...

  19. Drei Dimensionen von filmischem Archivmaterial. Die Untersuchung von Archivfilmen aus der Zeit des Holocaust

    Directory of Open Access Journals (Sweden)

    Tobias Ebbrecht-Hartmann

    2017-04-01

    Full Text Available Filmisches Archivmaterial aus der Zeit des Holocaust ist eine ambivalente Quelle. Daher sind spezifische Ansätze notwendig, um dieses Material zu ‘lesen’. Es geht darum, den besonderen Inhalt der Bilder zu analysieren, den Kontext ihrer Entstehung zu bestimmen, aber auch, ihre spätere Verwendung und Zirkulation in der visuellen Kultur und damit auch ihren wechselnden Status mit einzubeziehen. Am Beispiel ausgewählter Filmfragmente aus dem Warschauer Ghetto und dem Ghetto Theresienstadt skizziert der Artikel einen Ansatz, wie man diese drei Dimensionen von filmischem Archivmaterial analysieren kann und schlägt damit eine entsprechende Historiographie von Archivfilmen aus der Zeit des Holocaust vor.

  20. [Determination of von Willebrand factor multimers in Mexican population].

    Science.gov (United States)

    Hernández-Zamora, Edgar; Zavala-Hernández, Cesar; Viveros-Sandoval, Martha Eva; Ochoa-Rico, Angeles; Martínez-Murillo, Carlos; Reyes-Maldonado, Elba

    2014-01-01

    Von Willebrand disease is an inherited disease in which the structure, function, and concentration of von Willebrand factor are altered, as well as the platelet von Willebrand factor endothelium interaction. In Mexico there are no epidemiological records of the disease. Only a few isolated studies have been reported from the clinical and hematological standpoint. We studied 155 Mexican Mestizos: 75 with presumptive diagnosis of von Willebrand disease, 15 with suspected diagnosis ofhemophilia A and 65 healthy donors (controls). Basic coagulation tests, special tests and classification test (analysis of multimeric composition) were carried out. There were 15 patients with clinical diagnosis of hemophilia A, 75 patients with suspected von Willebrand disease of which 50 were diagnosed as the following types and subtypes: Type 1 (62%), Type 2 (22%) [subtypes: 2A (14%), 2B (2%), and 2N (6%)] and Type 3 (16%). It has been reported that analysis of von Willebrand factor is a method that meets the characteristics for the diagnosis of von Willebrand disease. It is necessary to implement this methodology to study and improve the specific diagnoses.

  1. Die Rolle von RANK-Ligand und Osteoprotegerin bei Osteoporose

    Directory of Open Access Journals (Sweden)

    Hofbauer LC

    2004-01-01

    Full Text Available Receptor activator of nuclear factor (NF- κB ligand (RANKL, sein zellulärer Rezeptor RANK und der Decoy-Rezeptor Osteoprotegerin (OPG stellen ein essentielles Zytokinsystem für die Zellbiologie von Osteoklasten dar. Verschiedene Untersuchungen belegen die Bedeutung von Störungen des OPG/RANKL/RANK-Systems bei der Pathogenese metabolischer Knochenerkrankungen. In dieser Arbeit werden die wichtigsten Störungen des OPG/RANKL/RANK-Systems bei verschiedenen Osteoporoseformen dargestellt. Östrogenrezeptor- (ER- Agonisten wie 17 β-Östradiol, Raloxifen und Genistein stimulieren die osteoblastäre Produktion von OPG durch Aktivierung von ER- α in vitro, während Lymphozyten von Patientinnen mit Östrogenmangel RANKL überexprimieren. Die parenterale Gabe von OPG vermag den mit Östrogenmangel assoziierten Knochenverlust im Tiermodell und in einer kleineren klinischen Studie zu verhindern. Glukokortikoide und Immunsuppressiva steigern gleichzeitig die RANKL-Expression und hemmen die OPG-Produktion in osteoblastären Zellen in vitro. Glukokortikoide sind auch in vivo imstande, die OPG-Serumspiegel deutlich zu reduzieren. Dagegen hemmen biomechanische Reize in vitro die RANKL-Produktion und steigern die OPG-Produktion. Ein Fehlen dieser biomechanischen Reize bei längerer Immobilisierung kann daher den RANKL/OPG-Quotienten steigern, während die tierexperimentelle Immobilisierungs-Osteoporose durch die parenterale Gabe von OPG gemildert werden kann.

  2. Strukturbasierte Entwicklung von Assaysystemen und Charakterisierung von orthosterischen und allosterischen Kinaseinhibitoren

    OpenAIRE

    Klüter, Sabine

    2010-01-01

    Die Proteinkinasen stellen eine wichtige Enzymklasse für die Regulation der Signaltransduktion dar. Sie steuern diese diffizil regulierten, intrazellulären Signalkaskaden durch Übertragung der ?-Phosphatgruppe von ATP auf andere Proteine. Fehlregulationen dieser komplexen Stoffwechselwege können Krankheiten wie Krebs, Diabetes oder Autoimunkrankheiten verursachen. Somit gehören die Kinasen in den letzten Jahren zu den wichtigsten Zielproteinen der Pharmaindustrie. Die klassi...

  3. Der Effekt von Akupunktur in der Prävention von Prüfungsangst

    OpenAIRE

    Krüger, Peter

    2017-01-01

    Prüfungsangst ist ein weit verbreitetes gesellschaftliches Phänomen, das bisher in nur wenigen wissenschaftlichen Ansätzen untersucht wurde. Die Zahl der Studenten, die Gehirn - Doping zur Leistungssteigerung und zur Minimierung von Prüfungsangst nutzen, steigt stetig an. In bisherigen Studien wurde Akupunktur an Herz 7 als vielversprechende Behandlungsalternative dargestellt. Basierend auf diesen Ergebnissen, wurde in dieser Arbeit untersucht, ob eine Einzelpunktakupunktur an Herz 7 die ...

  4. Modernisation of ventilation systems; Modernisierung von Lueftungsanlagen

    Energy Technology Data Exchange (ETDEWEB)

    Richter, W. [Technische Univ. Dresden (Germany). Inst. fuer Thermodynamik und Technische Gebaeudeausruestung

    1997-12-31

    When redeveloping buildings it is common to use window constructions with air-tight rabbets which obviate the inflow of fresh air almost entirely. This leads to the well-known structural-physics and hygienic consequences. As an added effect, the distinctly enhanced thermal insulation results in changes in dynamic heat loss. The paper focuses on the issues of how to safeguard the inflow of fresh air, and the heating capacity of radiators. (MSK) [Deutsch] Da die bei Gebaeudesanierungen eingesetzten fugendichten Fensterkonstruktionen die Nachstroemmoeglichkeiten fuer die Zuluft fast ganz unterbinden, fuehrt das zu den bekannten bauphysikalischen und hygienischen Konsequenzen. Dazu kommen veraenderte dynamische Waermverlustverhaeltnisse aufgrund der deutlich verbesserten Waermedaemmung. Im Folgenden wird schwerpunktmaessig auf die Probleme Zuluftsicherung und Waermeleistung von Heizkoerpern eingegangen.

  5. Alexander von Humboldt and the concept of animal electricity.

    Science.gov (United States)

    Kettenmann, H

    1997-06-01

    More than two hundred years ago, Alexander von Humboldt helped to establish Galvani's view that muscle and nerve tissue are electrically excitable. His 1797 publication was a landmark for establishing the concept of animal electricity. Almost half a century later, von Humboldt became the mentor of the young du Bois-Reymond. With the help of von Humboldt's promotion, du Bois-Reymond demonstrated convincingly that animal tissue has the intrinsic capacity to generate electrical activity, and thus laid the ground for modern electrophysiology.

  6. The brain and the biology of belief: An interview with Andrew Newberg, MD. Interview by Nancy Nachman-Hunt.

    Science.gov (United States)

    Newberg, Andrew

    2009-01-01

    Andrew Newberg, MD, is an associate professor in the Department of Radiology, Division of Nuclear Medicine, at the Hospital of the University of Pennsylvania, Philadelphia, with secondary appointments in the Departments of Psychiatry and Religious Studies. He is actively involved in neuroimaging research projects, including the study of the neurophysiological correlates of meditation and other types of complementary therapies. Dr Newberg's research now largely focuses on how brain function is associated with various mental states, in particular, the relationship between brain function and mystical or religious experiences. He has authored several books, including Why God Won't Go Away: Brain Science and the Biology of Belief (Ballantine/Random House, 2001) and coauthor with Eugene G. d'Aquili, MD, of The Mystical Mind: Probing the Biology of Religious Experience (Fortress Press, 1999). His most recent book is How God Changes Your Brain, with coauthor Mark Waldman (Ballantine Books, 2009).

  7. Enhancing breast projection in autologous reconstruction using the St Andrew's coning technique and 3D volumetric analysis.

    Science.gov (United States)

    Chae, Michael P; Rozen, Warren Matthew; Patel, Nakul Gamanlal; Hunter-Smith, David J; Ramakrishnan, Venkat

    2017-12-01

    An increasing number of women undergo mastectomy for breast cancer and post-mastectomy autologous breast reconstruction has been shown to significantly improve the psychosexual wellbeing of the patients. A goal of treatment is to achieve symmetry and projection to match the native breast, and/or the contralateral breast in the case of a unilateral reconstruction. Autologous reconstruction, particularly with the deep inferior epigastric artery perforator (DIEP) flap, is particularly advantageous as it can be manipulated to mimic the shape and turgor of the native breast. However, very few techniques of shaping the breast conus when insetting the DIEP flap to enhance aesthetic outcome have been reported to date. With the aide of three-dimension (3D) photography and 3D-printed mirrored image of the contralateral breast as a guide intraoperatively, we describe our St Andrew's coning technique to create a personalized flap projection. We report a prospective case series of 3 delayed unilateral breast reconstructions where symmetrization procedure to the contralateral breast was not indicated. Using a commercial 3D scanner (VECTRA XR, Canfield Scientific), the breast region was imaged. The mirrored image was 3D-printed in-house using a desktop 3D printer. In all cases, projection of the breast mound was able to be safely achieved, with a demonstrated central volume (or 'cone') able to be highlighted on imaging and a 3D printed breast. A 3D print of the contralateral breast was able to be used intraoperatively to guide the operative approach. The St Andrew's coning technique is a useful aesthetic maneuver for achieving breast projection during DIEP flap breast reconstruction, with 3D imaging techniques able to assist in perioperative assessment of breast volume.

  8. 78 FR 76812 - In the Matter of: Andrew Vincent O'Donnell, Inmate Number-62355-019, USP Atlanta, U.S...

    Science.gov (United States)

    2013-12-19

    ... DEPARTMENT OF COMMERCE Bureau of Industry and Security In the Matter of: Andrew Vincent O'Donnell... the Internal Security Act of 1950 (50 U.S.C. 783(b)), or section 38 of the Arms Export Control Act (22... 750.8 of the Regulations states that the Bureau of Industry and Security's Office of Exporter Services...

  9. Invertebrates of The H.J. Andrews Experimental Forest, western Cascade Range, Oregon. V: An annotated list of insects and other arthropods.

    Science.gov (United States)

    Gary L. Parson; Gerasimos Cassis; Andrew R. Moldenke; John D. Lattin; Norman H. Anderson; Jeffrey C Miller; Paul Hammond; Timothy D. Schowalter

    1991-01-01

    An annotated list of species of insects and other arthropods that have been collected and studies on the H.J. Andrews Experimental forest, western Cascade Range, Oregon. The list includes 459 families, 2,096 genera, and 3,402 species. All species have been authoritatively identified by more than 100 specialists. Information is included on habitat type, functional group...

  10. Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia

    OpenAIRE

    Chung Ming CHIN; Punggol Secondary School

    2014-01-01

    Book Review of the edited compilation: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia, Washington DC: The World Bank, ISBN: 978-0-8213-8626-2, 264 pages

  11. Messen und Bewerten von Webapplikationen mit der Goal/Question/Metric Methode. Handbuch

    OpenAIRE

    Assmann, D.; Kalmar, R.; Punter, T.

    2002-01-01

    Inhalt: Einleitung: App2Web, Motivation für das ,,Messen und Bewerten von WebApplikationen", Was ist messen? Worauf es beim Messen ankommt, Zweck dieses Handbuchs, Struktur dieses Handbuchs GQM als Methode zum Messen und Bewerten: Einleitung, Der Rahmen eines Messprogramms Messplanung: Definition von Geschäfts- und Verbesserungszielen, Definition von Messzielen, Definition von Fragen, Definition von Metriken Ein Beispiel für eine Frage Messinstrumentierung: Entwicklung des Messplans, Vorberei...

  12. Segmentation and Accretionary Processes Near the Andrew Bain Mega-Transform Fault: The Southwest Indian Ridge 25°-35°E

    Science.gov (United States)

    Takeuchi, C. S.; Sclater, J. G.; Grindlay, N. R.; Madsen, J. A.; Rommevaux-Jestin, C.

    2008-12-01

    The ultra-slow spreading Southwest Indian Ridge (SWIR) separates the Antarctic and African plates. We present results from two surveys covering the SWIR between 26° and 27°30'E and between 32° and 35°E, lying on either side of the long-offset Andrew Bain transform fault. The objectives of the surveys were to characterize the segmentation of an ultra-slow spreading ridge on either side of a long-offset transform fault and to examine the structure of the individual segments. Four transform faults, the Du Toit, Andrew Bain, Marion, and Prince Edward, and one non-transform discontinuity bound four accretionary segments in the survey areas. Two segments lie northeast of the Andrew Bain (32°-35°E). Large central axial volcanoes, deep, broad mantle Bouguer anomaly (MBA) lows, and high magnetization intensities centered on the spreading axis result from high magmatic activity. Increased magmatism on the ridge axis is likely caused by high mantle temperatures produced by the close proximity of the Marion Plume, which abuts the northern end of the Andrew Bain. Two segments lie southwest of the Andrew Bain (26°-27°30'E). Discrepancies in the locations of the axial rift valley, central magnetization high, and an irregularly-shaped MBA low suggest complex accretionary processes at the western segment (~26°-27° E). The eastern segment (~27°-27°30'E), which abuts the southwest end of the Andrew Bain, shows a deep axial valley, MBA values which increase to the east, and nearly nonexistent magnetization intensity. These features are probably the result of amagmatic accretion caused by the transform edge effect of the Andrew Bain. A transition in the character of topography at 26°45'E suggests that the current segment configuration may not be temporally stable. High-relief (~1 km) ridge-trough structures south of the spreading axis may be the result of an episodic interplay between accretion, both magmatic and amagmatic, and tectonic extension.

  13. Tierärztliche Betreuung von Greifvögeln: Entwicklungen im Zeitraum von 1985 bis 2015

    OpenAIRE

    Hatt, Jean-Michel; Clauss, Marcus

    2016-01-01

    Im Rahmen einer retrospektiven Studie wurden die Patientenakten der an die Klinik für Zoo-, Heim- und Wildtiere der Universität Zürich im Zeitraum von 2009 bis 2015 eingelieferten Greifvögel analysiert und mit den Daten aus einer Studie über den Zeitraum von 1985 bis 1994 verglichen. Im gesamten Zeitraum haben sich die durchschnittlichen Fallzahlen von 55 auf 109 Patienten pro Jahr erhöht. Am meisten Vögel werden in den Monaten Februar sowie Juni/Juli vorgestellt. Chirurgische Probleme war...

  14. Funktionelle Analyse von bakteriellen W-xxx-E Rho GTPasen GEF Mimetika mittels Typ 3 Sekretionssystems von Yersinia enterocolitica

    OpenAIRE

    Wölke, Stefan

    2011-01-01

    Die zellulären Rho GTPasen kontrollieren und regulieren zentrale elementare Zellvorgänge wie Phagozytose, Migration und epitheliale Integrität. Aufgrund ihrer zentralen Stellung, interagiert eine Vielzahl von bakteriellen Cytotoxinen und Modulinen mit den Rho GTPasen und wirken so als Pathogenitätsfaktoren. Die zur W-xxx-E Familie gehörenden Effektoren IpgB1 und IpgB2 von Shigella und Map von E. coli (Pathotypen EHEC und EPEC) werden über ein Typ 3 Sekretionssystem (T3SS) in Wirtszellen injiz...

  15. Alexander von Humboldt and the Origins of Landscape Archaeology.

    Science.gov (United States)

    Mathewson, Kent

    1986-01-01

    Reviews the life, theories, and influence of Alexander von Humboldt, the early nineteenth century founder of modern geography. Maintains that Humboldt's novel approaches to the study of landscape antiquities have value for contemporary students in cultural and historical geography. (JDH)

  16. Von Krahli Teatri lavastus pääses tippfestivalile

    Index Scriptorium Estoniae

    1999-01-01

    Von Krahli Teatri uuendatud lavastus "Eesti mängud. Pulm" esietendub festivalil Theater Der Welt Berliinis. Peeter Jalaka multimeediaetendus Eesti ajaloost ja traditsioonidest osaleb ka suveteatrite festivalil Hamburgis, seejärel antakse kuus etendust Amsterdamis

  17. Pure Jauch-Piron states on von Neumann algebras

    International Nuclear Information System (INIS)

    Hamhalter, J.

    1993-01-01

    We study Jauch-Piron states and two-valued measures on von Neumann algebra. We prove as the main result that, under some set-theoretical assumption, a pure state of a von Neumann algebra A not containing a central abelian portion is Jauch-Piron if and only if it is σ-additive. Moreover, we show that this result holds for type I factor indenpendently on the set-theoretical axiomatics. As a consequence we obtain a lucid characterization of pure Jauch-Piron states on von Neumann algebras acting on a Hilbert space with real-nonmeasurable dimension (this can be viewed as a generalization of the paper). We also characterize the von Neumann algebras whose logic of projections is Jauch-Piron. Finally, we prove that every two-valued measure on the projection logic of A, where A contains no type I 2 central portion, has to be concentrated at an abelian direct summand of A. (orig.)

  18. Von Krahli Teater viis Helsingisse kaks menulavastust / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2003-01-01

    Von Krahli Teater esineb 29. nov. Helsingis "Baltic Circle" festivalil lavastustega "Luikede järv" ja "Taksojuhid". Tutvustatakse lühidalt ka paari olulisemat soome lavastust ("Puksiirabi" ja "Hamlet"), mis tulevad festivalil esitamisele

  19. Lexikon lesbischer Frauen im Film von Daniela Sobek

    Directory of Open Access Journals (Sweden)

    Karin Windt

    2002-03-01

    Full Text Available Das Lexikon stellt ein neues Basiswerk über lesbische Figuren im Film dar. Neben zahlreichen Artikeln von Anbeginn der Filmgeschichte bis heute gibt es Features über bekannte Schauspielerinnen und lesbische role models.

  20. Magnus Georg von Paucker (1787-1855) / Eckhard Spring

    Index Scriptorium Estoniae

    Spring, Eckhard

    2013-01-01

    Eestis sündinud ja Tartu Ülikoolis õppinud silmapaistvast baltisaksa teadlasest ja tema lapselapsest Alexandrine Pauckerist. 23. novembril 2012 Jelgavas/Mitaus toimunud Magnus Georg von Pauckerile pühendatud teaduskonverentsist

  1. Bereitstellung von schneller Regelleistung und Momentanreserve durch Batteriespeicher

    OpenAIRE

    Alács, Christian

    2017-01-01

    von Christian Alács Arbeit an der Bibliothek noch nicht eingelangt - Daten nicht geprueft Abweichender Titel nach Übersetzung der Verfasserin/des Verfassers Technische Universität Wien, Univ., Diplomarbeit, 2017

  2. Von Trier ootab maailma lõppu / Kaarel Kressa

    Index Scriptorium Estoniae

    Kressa, Kaarel, 1983-

    2011-01-01

    Taani režissööri Lars von Trieri filmist "Melanhoolia" ("Melancholia", Taani - Rootsi - Prantsusmaa - Saksamaa, 2011), 8.-13. augustini Tartus toimuva 6. armastusfilmide festivali tARTuFF avafilmist. Festivali kavast

  3. Reappraisal of the brachiopod Acrotreta socialis von Seebach, 1865

    DEFF Research Database (Denmark)

    Topper, Timothy Paul; Harper, David A. T.; Ahlberg, Per

    2013-01-01

    The acrotretide Acrotreta socialis von Seebach, 1865 has suffered a long and tumultuous history since its original description from the middle Cambrian (Guzhangian Stage) Andrarum Limestone of Bornholm, Denmark. Uncertainties regarding key morphological characters have resulted in numerous revisi...

  4. Warum das Controlling den systematischen Einsatz von Simulationen vorantreiben sollte

    DEFF Research Database (Denmark)

    Spitzner, Jan; Schneider, Melanie L.

    2017-01-01

    Simulationen werden in der Unternehmenssteuerung heutzutage noch nicht systematisch eingesetzt. Dass sich jedoch die existierenden Hemmnisse durchaus überwinden lassen, legen die Antworten von Studienteilnehmern nahe, die Simulationen häufig einsetzen. Dabei kann Controlling eine Vorreiterrolle e...

  5. Frobenius theory for positive maps of von Neumann algebras

    International Nuclear Information System (INIS)

    Albeverio, S.; Hoegh-Krohn, R.

    1978-01-01

    Frobenius theory about the cyclic structure of eigenvalues of irreducible non negative matrices is extended to the case of positive linear maps of von Neumann algebras. Semigroups of such maps and ergodic properties are also considered. (orig.) [de

  6. Modulares Leistungsberechnungsverfahren zur automatisierten modellbasierten Leistungsanalyse von Gasturbinen

    OpenAIRE

    Bauer, Michael

    2005-01-01

    Die Entwicklung moderner Gasturbinen wird durch ein umfangreiches Versuchsprogramm mit Prototypen begleitet. Zur Bewertung des Leistungs- und Betriebsverhaltens werden diese mit einer Vielzahl von Messwertaufnehmern bestückt, mit denen Drücke, Temperaturen, Drehzahlen usw. gemessen werden. Die Auswertung der Meßdaten erfolgt mit Hilfe von Analyseverfahren, die nicht gemessene Größen, wie z. B. Wirkungsgrade der Gasturbinenkomponenten und Turbinentemperaturen, unter Verwendung bekannter Zusamm...

  7. Nash y von Neumann: mundos posibles y juegos de lenguaje

    Directory of Open Access Journals (Sweden)

    Salazar , Boris

    2004-06-01

    Full Text Available Este ensayo emplea las nociones de juego de lenguaje y de equivalencia entre juegos para examinar la decisión de John Nash de no jugar el juego coalicional que propuso John von Neumann. El argumento central es que Nash concibió una clase de mundos posibles incompatible con la de von Neumann, y que en el origen de esa divergencia estarían sus distintas nociones de racionalidad.

  8. Kommunale Versorgung, Verortung und Steuerung von Risiken psychischer Gesundheit

    OpenAIRE

    Warner, Joanne

    2006-01-01

    Das Risikokonzept ist heute zentral für alle Bereiche von gesundheitlicher und sozialer Wohlfahrt in Großbritannien. Im Bereich psychischer Gesundheit und insbesondere seit den Maßnahmen zur kommunalen Versorgung in den 1990er Jahren kommt dem Konzept jedoch besondere Aufmerksamkeit zu. Dabei kamen bisher vor allem die Risiken in den Blick, die von Personen mit psychischen Erkrankungen oder in psychischer Not ausgehen, aber nicht die Risiken, mit denen diese selbst konfrontiert sind. Der vorl...

  9. Bioverfügbarkeit und Metabolismus von Flavonoiden

    OpenAIRE

    Wittig, Jörg

    2002-01-01

    Ziel der vorliegenden Arbeit war die Entwicklung, Optimierung und Validierung von phyto- und bioanalytischen Analysemethoden. Dabei wurden exemplarische Fragestellungen aus dem Themenkreis Phytotherapie bzw. Bioverfügbarkeit und Metabolismus von einfachen und Polyphenolen bearbeitet. Quercetin und seine Derivate: Zur qualitativen Analyse der Flavonoide und -derivate in einem Trockenextraktgemisch aus Birkenblättern, Goldrutenkraut und Orthosiphonblättern wurde eine HPLC- UV/VIS Methode entwic...

  10. Räumliche Aspekte von Transformationsproblemen aus systemtheoretischer Perspektive

    OpenAIRE

    Klüter, Helmut

    2000-01-01

    Der mit dem Topos "Transformation von Wirtschafts- und Gesellschaftssystemen" axiomatisch angenommene Unvereinbarkeit sozialistischer und marktwirtschaftlicher Strukturen ist aus raumwissenschaftlicher Sicht nicht nachvollziehbar. Zum einen gibt es in Wirtschaftsgeographie und Infrastrukturtheorie eine ganze Reihe von Gemeinsamkeiten und Berührungspunkten, die man für den konstruktiven Systemumbau nutzen kann. Zum andern benötigt der Umbau selbst eine räumliche Infrastruktur. Und zum dritten ...

  11. Identifikation von uniparentaler Disomie bei mikrosatellitenstabilen und mikrosatelliteninstabilen kolorektalen Karzinomen

    OpenAIRE

    Zopf, Waltraud

    2012-01-01

    Im Rahmen dieser Arbeit wurden Gewebe von jeweils 15 kolorektalen MSI- und CSIPrimärtumoren, sowie 3 MSI- und 2 CSI-Tumorzelllinien mittels SNP-Arrayanalyse molekulargenetisch auf uniparentale Disomie (UPD) untersucht. Es konnte bestätigt werden, dass die uniparentale Disomie ein wichtiger Mechanismus zur Inaktivierung von Tumorsuppressorgenen zu sein scheint. Die Ergebnisse zeigen, dass nicht nur in MSI-Tumoren, sondern auch in CSI-Tumoren UPD nachgewiesen werden konnte, wobei der UPD-Anteil...

  12. Von Neumann's impossibility proof: Mathematics in the service of rhetorics

    Science.gov (United States)

    Dieks, Dennis

    2017-11-01

    According to what has become a standard history of quantum mechanics, in 1932 von Neumann persuaded the physics community that hidden variables are impossible as a matter of principle, after which leading proponents of the Copenhagen interpretation put the situation to good use by arguing that the completeness of quantum mechanics was undeniable. This state of affairs lasted, so the story continues, until Bell in 1966 exposed von Neumann's proof as obviously wrong. The realization that von Neumann's proof was fallacious then rehabilitated hidden variables and made serious foundational research possible again. It is often added in recent accounts that von Neumann's error had been spotted almost immediately by Grete Hermann, but that her discovery was of no effect due to the dominant Copenhagen Zeitgeist. We shall attempt to tell a story that is more historically accurate and less ideologically charged. Most importantly, von Neumann never claimed to have shown the impossibility of hidden variables tout court, but argued that hidden-variable theories must possess a structure that deviates fundamentally from that of quantum mechanics. Both Hermann and Bell appear to have missed this point; moreover, both raised unjustified technical objections to the proof. Von Neumann's argument was basically that hidden-variables schemes must violate the ;quantum principle; that physical quantities are to be represented by operators in a Hilbert space. As a consequence, hidden-variables schemes, though possible in principle, necessarily exhibit a certain kind of contextuality. As we shall illustrate, early reactions to Bohm's theory are in agreement with this account. Leading physicists pointed out that Bohm's theory has the strange feature that pre-existing particle properties do not generally reveal themselves in measurements, in accordance with von Neumann's result. They did not conclude that the ;impossible was done; and that von Neumann had been shown wrong.

  13. Politische Bildung im Kontext von Regierung, Unterricht und Zucht

    Directory of Open Access Journals (Sweden)

    Thomas Rucker

    2014-02-01

    Full Text Available Johann Friedrich Herbart (1776-1841 gilt als der Begründer der wissenschaftlichen Pädagogik. In diesem Beitrag wird zu zeigen versucht, dass Herbart die Unterstützung politischer Bildung als eine Aufgabe von Regierung, Unterricht und Zucht bestimmt und in seinem Werk wichtige „Bausteine“ für eine Theorie der politischen Bildung unter den Bedingungen von Erziehung vorlegt hat. Nach Herbart ist das politische Selbst- und Weltverhältnis auf Sachverhalte bezogen, die nicht nur die Lebensführung einzelner Menschen, sondern die Lebensführung einer Mehrzahl von Menschen betreffen. Nicht das Zusammenleben von Menschen generell ist jedoch Orientierungsgesichtspunkt des politischen Selbst- und Weltverhältnisses, sondern nur das problematisch gewordene Zusammenleben. Politik ergibt sich nach Herbart aus einem Konflikt hinsichtlich der Frage, wie das Zusammenleben von Menschen geregelt sein sollte. Während die Regierung lediglich mittelbar einen Beitrag zur politischen Bildung leistet, indem sie die Voraussetzungen für Unterricht und Zucht bereitstellt, fungieren die beiden zuletzt genannten Formen von Erziehung als die eigentlichen Medien, in denen die politische Bildung im Sinne Herbarts ihren Ort hat.

  14. Electronic Resource Management System. Vernetzung von Lizenzinformationen

    Directory of Open Access Journals (Sweden)

    Michaela Selbach

    2014-12-01

    Full Text Available In den letzten zehn Jahren spielen elektronische Ressourcen im Bereich der Erwerbung eine zunehmend wichtige Rolle: Eindeutig lässt sich hier ein Wandel in den Bibliotheken (fort vom reinen Printbestand zu immer größeren E-Only-Beständen feststellen. Die stetig wachsende Menge an E-Ressourcen und deren Heterogenität stellt Bibliotheken vor die Herausforderung, die E-Ressourcen effizient zu verwalten. Nicht nur Bibliotheken, sondern auch verhandlungsführende Institutionen von Konsortial- und Allianzlizenzen benötigen ein geeignetes Instrument zur Verwaltung von Lizenzinformationen, welches den komplexen Anforderungen moderner E-Ressourcen gerecht wird. Die Deutsche Forschungsgemeinschaft (DFG unterstützt ein Projekt des Hochschulbibliothekszentrums des Landes Nordrhein-Westfalen (hbz, der Universitätsbibliothek Freiburg, der Verbundzentrale des Gemeinsamen Bibliotheksverbundes (GBV und der Universitätsbibliothek Frankfurt, in dem ein bundesweit verfügbares Electronic Ressource Managementsystem (ERMS aufgebaut werden soll. Ein solches ERMS soll auf Basis einer zentralen Knowledge Base eine einheitliche Nutzung von Daten zur Lizenzverwaltung elektronischer Ressourcen auf lokaler, regionaler und nationaler Ebene ermöglichen. Statistische Auswertungen, Rechteverwaltung für alle angeschlossenen Bibliotheken, kooperative Datenpflege sowie ein über standardisierte Schnittstellen geführter Datenaustausch stehen bei der Erarbeitung der Anforderungen ebenso im Fokus wie die Entwicklung eines Daten- und Funktionsmodells. In the last few years the importance of electronic resources in library acquisitions has increased significantly. There has been a shift from mere print holdings to both e- and print combinations and even e-only subscriptions. This shift poses a double challenge for libraries: On the one hand they have to provide their e-resource collections to library users in an appealing way, on the other hand they have to manage these

  15. Prophylaxis escalation in severe von Willebrand disease: A prospective study from the von Willebrand Disease Prophylaxis Network

    NARCIS (Netherlands)

    T.C. Abshire (Thomas Calvin); J. Cox-Gill; C.L. Kempton; F.W.G. Leebeek (Frank); M. Carcao (M.); P. Kouides (P.); S. Donfield (S.); E. Berntorp

    2015-01-01

    textabstractBackground: Treatment of mucosal bleeding (epistaxis, gastrointestinal bleeding, and menorrhagia) and joint bleeding remains problematic in clinically severe von Willebrand disease (VWD). Patients are often unresponsive to treatment (e.g. desmopressin or antifibrinolytic therapy) and may

  16. Von Roll RCP method - first experiences; Von Roll RCP - Verfahren. Erste Erfahrungen

    Energy Technology Data Exchange (ETDEWEB)

    Capitaine, P.; Engweiler, J. [Roll Umwelttechnik AG, Zuerich (Switzerland)

    1998-09-01

    The RCP method was designed as a residue-optimised alternative to the thermally optimised grate firing of residual wastes. Its technical realisation and development to market maturity took no more than 5 years. In the first process stage the waste is converted to high-carbon pyrolysis charcoal and high-rank gas in the absence of oxygen. In the second stage these substances are oxidised by addition of oxygen. The resulting temperature causes the non-combustible constituents of the slag to melt. In a third, optional, stage this molten slag can be liberated of (heavy) metals to such an extent that it can subsequently be used directly as additive for grinding. Further exhaust gas treatment is facilitated by the use of a circulatory fluidised-bed secondary combustion chamber. Despite the reduced flue gas volume and resultant higher pollutant concentrations in the crude gas, overall emissions are lower than in conventional plants. [Deutsch] Das reststoffoptimierte RCP Verfahren ist als Alternative zur thermisch optimierten Rostverbrennung von Restabfaellen konzipiert. In nur fuenf Jahren wurde das Verfahren technisch umgesetzt und zur Marktreife entwickelt. In einer ersten Stufe des Verfahrens wird der Abfall unter Luftabschluss in einen kohlenstoffreichen Pyrolysekoks und eine heizwertreiches Gas umgesetzt. Im zweiten Schritt werden diese Stoffe unter Zugabe von Sauerstoff oxidiert. Dabei treten Temperaturen auf, bei denen die nichtbrennbaren Bestandteile der Schlacke schmelzen. Optional wird diese Schmelzschlacke in einem dritten Schritt derart von (Schwer-) Metallen befreit, dass sie anschliessend direkt als Zement-Zumahlstoff eingesetzt werden kann. Die Nutzung der zirkulierenden Wirbelschicht - Nachbrennkammer zur Abgasbehandlung vereinfacht die weitergehende Abgasbehandlung. Trotz verringertem Rauchgasvolumen und damit hoeheren Schadstoffkonzentrationen im Rohgas werden die Gesamtemissionen gegenueber konventionellen Anlagen verringert. (orig./SR)

  17. GFRP life in wind rotor blades; Lebensdauer von GFK im Holmgurt und im Schubsteg von Rotorblaettern

    Energy Technology Data Exchange (ETDEWEB)

    Kensche, C.W. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Stuttgart (Germany). Inst. fuer Bauweisen- und Konstruktionsforschung

    1999-07-01

    Lives of GFRP rotor blade components were calculated on the basis of Woehler curves and the wind power specific standard WISPERX using the linear Palmgren-Miner rule. The Calculations were based on experiments with belts made of the L20/SL epoxy resin system at pressure ratios R=0.1, and -1 and with torsionally stressed GFRP tubes of linen tissue with the epoxy resing GE162/C260 at R=0.1 and -1. The results were incorporated into Haigh diagrams, from which the damage from the collective load was calculated by linear interpolation of the averaged stresses and amplitudes resp. the lines of constant life. The life curves calculated for different maximum stress horizons are in good agreement with experimental collective loads. A comparison of life curves showed that the linen tissue material was more fatigue-sensitive than the belt material. [German] Fuer GFK-Gurte und Schubstege von Rotorblaettern wurden Lebensdauerberechnungen auf der Basis von Woehlerkurven und dem windenergiespezifischen Standard WISPERX unter Anwendung der linearen Palmgren-Miner Regel durchgefuehrt. Bei der Betrachtung der Gurte wurde auf Versuche an UD-Proben mit dem Epoxidharzsystem L20/SL zurueckgegriffen, die bei Spannungsverhaeltnissen von R=0.1, -1 und 10 durchgefuehrt worden waren. Grundlage fuer die Lebensdauerbestimmung der Schubstege waren Ermuedungsversuche an torsionsbelasteten GFK-Rohren aus Leinengewebe mit dem Epoxidharz GE162/C260 bei R=0.1 und -1. In den daraus konstruierten Haighdiagrammen wurden die Schaedigungen durch das Lastkollektiv mittels linearer Interpolation der Mittelspannungen und Amplituden bzw. der Linien konstanter Lebensdauer ermittelt. Die Lebensdauerkurven, die fuer verschiedene Maximalspannungshorizonte ermittelt wurden, stimmen gut mit experimentellen Lastkollektivergebnissen ueberein. Beim Vergleich der Lebensdauerkurven zeigt sich, dass ein Leinengewebesteg erheblich ermuedungsgefaehrdeter ist als ein Gurt. (orig.)

  18. Entwicklung von Extraktions- und Absorptionssystemen auf Basis ionischer Flüssigkeiten für die Entschwefelung von Kohlenwasserstoffen

    OpenAIRE

    Kuhlmann, Esther

    2008-01-01

    Da die Anforderungen an den Schwefelgehalt der fossilen Brennstoffe - nicht zuletzt durch gesetzliche Richtlinien bezüglich der Schadstoffemissionen - im Laufe der Zeit ständig gestiegen sind, sind effektive Entschwefelungsverfahren für fossile Brennstoffe von hohem Interesse. Die derzeitige Entschwefelungstechnologie basiert auf dem HDS-Verfahren, alternative Verfahren sind aber wünschenswert, insbesondere wenn Anwendungen einen Schwefelgehalt von weit unter 10 ppm erforderlich machen. Daher...

  19. "Die Toten reiten schnelle." Literarische Zitate in Briefen von und an Alexander von Humboldt

    Directory of Open Access Journals (Sweden)

    Ingo Schwarz

    2007-04-01

    Full Text Available Article in GermanAbstract in English and GermanAlexander von Humboldt and his correspondents liked to enrich or embellish their letters with quotations from classic works of ancient literature as well as from recent poems, plays, or novels. This paper tries to show that references to literature were very often used in order to express thoughts and feelings more clearly not so much for impressing the recipients of letters with high education. In educated circles a good knowledge of ancient and modern works of literature was a standard requirement, which often allowed the letter writers to use quotations in a playful manner.

  20. Hypercontractivity in group Von Neumann algebras

    CERN Document Server

    Junge, Marius; Parcet, Javier

    2017-01-01

    In this paper, the authors provide a combinatorial/numerical method to establish new hypercontractivity estimates in group von Neumann algebras. They illustrate their method with free groups, triangular groups and finite cyclic groups, for which they obtain optimal time hypercontractive L_2 \\to L_q inequalities with respect to the Markov process given by the word length and with q an even integer. Interpolation and differentiation also yield general L_p \\to L_q hypercontrativity for 1 < p \\le q < \\infty via logarithmic Sobolev inequalities. The authors' method admits further applications to other discrete groups without small loops as far as the numerical part-which varies from one group to another-is implemented and tested on a computer. The authors also develop another combinatorial method which does not rely on computational estimates and provides (non-optimal) L_p \\to L_q hypercontractive inequalities for a larger class of groups/lengths, including any finitely generated group equipped with a condit...

  1. Richard von Volkmann: surgeon and Renaissance man.

    Science.gov (United States)

    Willy, Christian; Schneider, Peter; Engelhardt, Michael; Hargens, Alan R; Mubarak, Scott J

    2008-02-01

    Richard von Volkmann (1830-1889), one of the most important surgeons of the 19(th) century, is regarded as one of the fathers of orthopaedic surgery. He was a contemporary of Langenbeck, Esmarch, Lister, Billroth, Kocher, and Trendelenburg. He was head of the Department of Surgery at the University of Halle, Germany (1867-1889). His popularity attracted doctors and patients from all over the world. He was the lead physician for the German military during two wars. From this experience, he compared the mortality of civilian and war injuries and investigated the general poor hygienic conditions in civilian hospitals. This led him to introduce the "antiseptic technique" to Germany that was developed by Lister. His powers of observation and creativity led him to findings and achievements that to this day bear his name: Volkmann's contracture and the Hueter-Volkmann law. Additionally, he was a gifted writer; he published not only scientific literature but also books of children's fairy tales and poems under the pen name of Richard Leander, assuring him a permanent place in the world of literature as well as orthopaedics.

  2. Geschichte der Natur bei Alexander von Humboldt

    Directory of Open Access Journals (Sweden)

    Christian Helmreich

    2009-05-01

    Full Text Available Article in German, Abstracts in English, German and French.This article analyses the importance of an historical view of nature in the works of Alexander von Humboldt. In several of his first writings, Humboldt seems to outline the importance of what one may call history of nature. But even before his famous American travel, his position changed and he became reluctant to accept the seriousness of historical enquiry in the area of natural sciences: if we want to reconstruct the past state of nature, we cannot rely on empirical proofs; and history of nature is therefore necessarily based on uncertain hypotheses. Humboldt kept his sceptical attitude in the first decades of the 19th century, despite the positive results of the palaeontological researches of his scientific colleagues. However, he gradually convinced himself of the scientific interest of historical investigations in the natural sciences. The Cosmos paradoxally displays two apparently conflicting points of view: in his methodological remarks, Humboldt maintains that precise accounts of the past state of nature are out of reach of human knowledge, yet elsewhere in the same Cosmos he gives broad and rather vivid descriptions of the eventful history of nature.

  3. Hypercontractivity in group von neumann algebras

    CERN Document Server

    Junge, Marius; Parcet, Javier

    2017-01-01

    In this paper, the authors provide a combinatorial/numerical method to establish new hypercontractivity estimates in group von Neumann algebras. They illustrate their method with free groups, triangular groups and finite cyclic groups, for which they obtain optimal time hypercontractive L_2 \\to L_q inequalities with respect to the Markov process given by the word length and with q an even integer. Interpolation and differentiation also yield general L_p \\to L_q hypercontrativity for 1 < p \\le q < \\infty via logarithmic Sobolev inequalities. The authors' method admits further applications to other discrete groups without small loops as far as the numerical part-which varies from one group to another-is implemented and tested on a computer. The authors also develop another combinatorial method which does not rely on computational estimates and provides (non-optimal) L_p \\to L_q hypercontractive inequalities for a larger class of groups/lengths, including any finitely generated group equipped with a condit...

  4. Transparenz von Subskriptionskosten in der Schweiz

    Directory of Open Access Journals (Sweden)

    Christian Gutknecht

    2016-04-01

    Full Text Available Dieser Beitrag handelt von dem Versuch, die Subskriptionszahlungen aller Schweizer Hochschulbibliotheken an Elsevier, Springer und Wiley in Erfahrung zu bringen. Zeitschriftenlizenzen beanspruchen bei den meisten wissenschaftlichen Bibliotheken den grössten Teil des Erwerbungsbudget. Trotzdem gibt es wenig öffentliche Daten zu den detaillierten Ausgaben. Bibliotheken vereinbaren mit den Verlagen für gewöhnlich Vertraulichkeit über den Preis und die Vertragsbedinungen. Diese Vertraulichkeit ist unnötig und verhindert eine datenbasierte Diskussion über Open Access. Zudem verträgt sie sich nicht mit dem in der Schweiz auf Bundesebene und in vielen Kantonen gesetzlich verankerten Öffentlichkeitsprinzip. This article is about the attempt to disclose the subscription costs to Elsevier, Springer and Wiley from all Swiss academic libraries. The costs for journal subscriptions usually make the largest share of the acquisition budget of an academic library. Yet there is little public data about the specific costs. Usually libraries sign non disclosure agreements about the price and content of the contract with the publishers. This confidentiality is actually not necessary and does hinder the discussion about Open Access based on data. Additionally it is not compatible with Swiss law, where on federal level and in most cantons public access to documents is guaranteed to citizens.

  5. Zur Struktur und Funktion von Synonymen

    Directory of Open Access Journals (Sweden)

    Marina Zorman

    1998-12-01

    Full Text Available Der Artikel behandelt die Synonyme im Licht der funktionell-strukturellen Sprachtheorie Coserius. 1 Die Wahl der theoretischen Grundsätze wurde durch die Festellung diktiert, daß die bisherigen Erkenntnisse über die Synonymie widersprüchlich sind und daß auch schon über alle Feststellungen berechtigte Einsprüche erhoben wurden. Deshalb wird in dieser Arbeit auf der genannten theoretischen Grundlage, die verschiedene Gesichtspunkte des Problems verbindet, anstatt sie zu trennen (s. Punkt 2, ein Modell für die Analyse von Synonymen vorgestellt (3, das die klassischen Schwächen der Semantikforschung (zu geringe Menge tatsächlicher Daten, Subjektivität und Introspektion durch eine empirische Untersuchung in einem Textkorpus zu ersetzen versucht. In die Analyse sind drei Inhaltsebenen einbezogen (Bezeichnung, Bedeutung und Sinn und ihnen sind jeweils entsprechende Untersuchungsmethoden zugeordnet. Im Sinne des Modells wurden in der Arbeit Zorman 1997 zwei slowenische Synonympaare (kuverta - ovojnica und borba - boj analysiert, die als Beispiele reiner (und totaler Synonymie gelten können. Die Analyse wird aus Platzgründen an dieser Stelle nicht detailliert dargestellt,2 veranschaulicht werden nur ihre Tragweite und die Ergebnisse (4. Im letzten Teil (5 werden die Leistungen der vorgeschlagenen Methode bewertet und einige Annahmen dargestellt, die der weiteren Erforschung der Synonyme dienen könnten. Die objektive Behandlung der Synonymie unter unterschiedlichen Gesichtspunkten scheint einige Dogmen über Synonyme in Frage zu  stellen.

  6. Inhibition of the gastric H+,K+ -ATPase by plectrinone A, a diterpenoid isolated from Plectranthus barbatus Andrews.

    Science.gov (United States)

    Schultz, Carla; Bossolani, Myllene P; Torres, Luce M B; Lima-Landman, Maria Teresa R; Lapa, Antonio J; Souccar, Caden

    2007-04-20

    This work assessed the mechanism underlying the antisecretory gastric acid effect of Plectranthus barbatus Andrews (Lamiaceae) and active constituents. Popularly known as "false-boldo", this plant is used in Brazilian folk medicine to treat gastrointestinal and hepatic ailments. The plant aqueous extract (AE) and isolated compounds were assayed in vivo in pylorus-ligated mice, and in vitro on acid secretion measured as [(14)C]-aminopyrine ([(14)C]-AP) accumulation in rabbit gastric glands and gastric H(+),K(+)-ATPase preparations. Injected into the duodenal lumen, the AE of the plant leaves (0.5 and 1.0 g/kg) decreased the volume (62 and 76%) and total acidity (23 and 50%) of gastric acid secretion in pylorus-ligated mice. Bioguided purification of the AE yielded an active fraction (IC(50)=24 microg/ml) that inhibited acid secretion in rabbit gastric glands with a potency 10 to 18 times greater than that of the originating extract, on both the basal and stimulated acid secretion by histamine (His) (1 microM) or bethanechol (100 microM). At the same concentrations the gastric H(+),K(+)-ATPase activity was also inhibited. The active constituent was chemically identified as the abietanoid dienedione plectrinone A which reduced the H(+),K(+)-ATPase activity with IC(50)=171 microM. The results indicate that inhibition of the gastric proton pump by this diterpenoid may account for the antisecretory acid effect and reputed anti ulcer activity of Plectranthus barbatus.

  7. Genetic fidelity of long-term micropropagated shoot cultures of vanilla (Vanilla planifolia Andrews) as assessed by molecular markers.

    Science.gov (United States)

    Sreedhar, Reddampalli V; Venkatachalam, Lakshmanan; Bhagyalakshmi, Neelwarne

    2007-08-01

    Occurrence of genetic variants during micropropagation is occasionally encountered when the cultures are maintained in vitro for long period. Therefore, the micropropagated multiple shoots of Vanilla planifolia Andrews developed from axillary bud explants established 10 years ago were used to determine somaclonal variation using random amplified polymorphic DNA (RAPD) and intersimple sequence repeats markers (ISSR). One thousand micro-plants were established in soil of which 95 plantlets (consisting of four phenotypes) along with the mother plant were subjected to genetic analyses using RAPD and ISSR markers. Out of the 45 RAPD and 20 ISSR primers screened, 30 RAPD and 7 ISSR primers showed 317 clear, distinct and reproducible band classes resulting in a total of 30 115 bands. However, no difference was observed in banding patterns of any of the samples for a particular primer, indicating the absence of variation among the micropropagated plants. Our results allow us to conclude that the micropropagation protocol that we have used for in vitro proliferation of vanilla plantlets for the last 10 years might be applicable for the production of clonal plants over a considerable period of time.

  8. Lessons learned from Hurricane Andrew: recommendations for care of the elderly in long-term care facilities.

    Science.gov (United States)

    Silverman, M A; Weston, M; Llorente, M; Beber, C; Tam, R

    1995-06-01

    We report on the experience of a 500-bed, long-term care facility in Miami, Fla, which provides housing and nursing care units for patients--ranging from those who are independently ambulatory to those who are acutely ill and feeble--in preparing for, during, and in the immediate aftermath of Hurricane Andrew, which struck on August 24, 1992. The problems encountered included a massive influx of evacuated elderly to the facility, facility isolation, loss of electrical power, loss of running water, special dietary needs, and limited professional staffing due to personal property losses or loss of transportation. Overwhelmed county emergency medical services, limited access to hospitals and patient care, and difficulty in procuring supplies exacerbated the already complicated situation resulting from the storm. As a result of these catastrophic conditions, a number of challenges specific to the care of the elderly were identified. In conjunction with the Florida Department of Elder Affairs, we drafted a comprehensive blueprint that could serve as a disaster plan for other long-term care facilities facing a similar threat during the hurricane season.

  9. Apocalyptic Kingship, Harmony and Political Expediency: the Challenges and Paradoxes of Andrew Marvell’s “First Anniversary”

    Directory of Open Access Journals (Sweden)

    Jajtner Tomáš

    2015-07-01

    Full Text Available The following paper deals with the interpretation of one of the major “Cromwellian” poems of Andrew Marvell (1621-1678, “The First Anniversary of the Government under His Highness the Lord Protector”, 1655. The poem is first set in the context of Marvell’s poetry and his public career in the period between 1637 and 1660. The article then identifies and analyses three main themes of “The First Anniversary”: the notion of a new aeon starting with Cromwell’s rule and the apocalyptical imagery related to his Protectorate, the concept of his power and authority between liberty and tyranny, and the relation between the harmony established by Cromwell and classical Pythagorean harmonious lore. The author argues that the imagery Marvell uses to describe the nature of the regime (especially the concept of Cromwell’s “no-kingship” shows a deeply paradoxical structure, which uncovers the frailty and insecurity of Cromwell’s dictatorship as well as the circular logic of its justification. In that sense, the poem can be read as a vivid manifestation of the dilemmas and tensions of this period.

  10. The Impact of Structural Break(s on the Validity of Purchasing Power Parity in Turkey: Evidence from Zivot-Andrews and Lagrange Multiplier Unit Root Tests

    Directory of Open Access Journals (Sweden)

    Hakan Kum

    2012-01-01

    Full Text Available This study examines the validity of the purchasing power parity (PPP in Turkey for annual data from 1953 to 2009. While results from both the ADF unit root and the DF-GLS unit root test indicate mixed results, PPP holds for Turkey with the presence of structural breaks which are obtained by Zivot and Andrews and Lagrange Multiplier unit root tests.

  11. Familienpolitik, Bildung und Berufskarrieren von Müttern in Deutschland, USA und Schweden

    NARCIS (Netherlands)

    Grunow, D.; Aisenbrey, S.; Evertsson, M.

    2011-01-01

    Dieser Beitrag widmet sich der beruflichen Entwicklung von Müttern mit ungleichen Bildungsressourcen in international vergleichender Perspektive. Wir untersuchen die Strategien zur Vereinbarkeit von Berufskarrieren und Elternschaft in Deutschland, USA und Schweden für Frauen mit unterschiedlichem

  12. Applikation von fermentierter Soja bei Krebspatienten zur Verminderung von Kachexie und Erhöhung der Apoptose - eine prospektive Pilotstudie

    Directory of Open Access Journals (Sweden)

    Jacob U

    2009-01-01

    Full Text Available Kachexie ist eine Begleiterkrankung von Krebs, Aids oder rheumatoider Arthritis. Andere Symptome dieser Erkrankungen sind Depression sowie chronische Erschöpfung. Für alle diese Begleiterkrankungen, die die Lebensqualität der schwererkrankten Patienten negativ beeinflussen, wird eine Erhöhung von Entzündungsmediatoren (z.B. IL-6 und TNF-α verantwortlich gemacht. Für Krebs wird eine Erniedrigung der Apoptose, ausgelöst durch eine Erhöhung von NFκB verantwortlich gemacht. Eine Gabe eines fermentierten Soja-Produktes, das in den USA seit 10 Jahren zur Verbesserung der Lebensqualität von Krebspatienten eingesetzt wird, wurde in einer prospektiven Studie untersucht: Für je 5 Patienten, die unter Prostata-, Ovar- oder Brustkrebs litten, konnte eine signifikante Verminderung von Kachexie, Stress und Depression festgestellt werden. Gleichzeitig konnte man für Prostata- und Ovarkrebs-Patienten eine Erhöhung der Genexpression apoptotischer Marker disseminierter Tumorzellen feststellen. Zusätzlich wurde eine starke Erhöhung der Genexpression des Tumorsuppressorgens p21 festgestellt. Auch wenn die prospektive Studie präliminär ist und die Anzahl der untersuchten Patienten zu klein, so widerspricht sie nicht unserer Annahme, dass es einen direkten Zusammenhang zwischen Krebs und Begleiterkrankungen, besonders der Kachexie, gibt.

  13. Proof of pipeline strength based on measurements of inspection pigs; Festigkeitsnachweis von Pipelines aufgrund der Messergebnisse von Pruefmolchen

    Energy Technology Data Exchange (ETDEWEB)

    De la Camp, H.J.; Feser, G.; Hofmann, A.; Wolf, B.; Schmidt, H. [TUeV Sueddeutschland Bau und Betrieb GmbH, Muenchen (Germany); Herforth, H.E.; Juengling, K.H.; Schmidt, W. [TUeV Anlagentechnik GmbH, Berlin-Schoeneberg (Germany). Unternehmensgruppe TUeV Rheinland/Berlin-Brandenburg

    2002-01-01

    The report is aimed at collecting and documenting the state of the art and the extensive know how of experts and pipeline operators with regard to judging the structural integrity of pipelines. In order to assess the actual mechanical strength of pipelines based on measurement results obtained by inspection pigs, guidance is given for future processing, which eventually can be used as a basis for an industry standard. A literature study of the commercially available types of inspection pigs describes and synoptically lists the respective pros and cons. In essence the report comprises besides check lists of operating data for the pipeline and the pig runs mainly the evaluation of defects and respective calculating procedures. Included are recommendations regarding maintenance planning, verification of defects as well as repetition of pig runs. (orig.) [German] Ziel des Berichtes ist die Erfassung und Dokumentation zum derzeitigen Stand der Technik und des vorhandenen umfangreichen Know-how von Sachverstaendigen und Pipelinebetreibern auf dem Gebiet der sicherheitstechnischen Beurteilung von Pipelines. Fuer den Festigkeitsnachweis von Pipelines aufgrund der Messergebnisse von Pruefmolchen wurde ein Leitfaden als Basis fuer die zukuenftige Vorgehensweise erstellt, der eventuell die Grundlage eines normativen Regelwerkes bilden kann. In einer Literaturstudie wurden die auf dem Markt befindlichen Pruefmolchtypen zusammenfassend beschrieben und ihre Vor- und Nachteile tabellarisch gegenuebergestellt und bewertet. Neben der Erstellung von Checklisten fuer notwendige Daten zum Betrieb der Pipeline und der Molchlaeufe bildet die Fehlerbewertung mit entsprechenden Berechnungsverfahren den Hauptteil dieses Berichtes. Hinweise zur Instandhaltungsplanung (Fehlerverifikation und Molchlaufwiederholung) werden gegeben. (orig.)

  14. The ultrastructural localization of von Willebrand factor in endothelial cells.

    Science.gov (United States)

    Warhol, M J; Sweet, J M

    1984-11-01

    Factor VIII-related antigen was localized ultrastructurally in a variety of human tissues (smooth muscle, skeletal muscle, breast, capillary hemangioma) with the use of a low-temperature embedding protein A-gold technique with both polyclonal and monoclonal antisera directed against von Willebrand factor. All endothelial cells examined localized the anti-von Willebrand factor to Weibel-Palade bodies. Cisternae of the endoplasmic reticulum, and cytoplasmic vacuoles were also labeled. These results establish the distribution of factor VIII-related antigen at the subcellular level. The observed distribution suggests that the endothelial cells synthesize von Willebrand factor, store it in Weibel-Palade bodies, and release it by exocytosis. These observations provide in vivo confirmation for previous biochemical and immunocytochemical data obtained from studies on cultured endothelial cells.

  15. Snobismus und neue deutsche Popliteratur am Beispiel von Benjamin von Stuckrad-Barre

    OpenAIRE

    Strasser, Alfred

    2012-01-01

    Soloalbum, roman de Benjamin von Stuckrad-Barre, décrit la façon de vivre des jeunes adultes dans les années quatre-vingt-dix du xxe siècle en Allemagne. Cette génération apolitique vit repliée sur elle-même. Le narrateur est le personnage principal du roman. Il n’a pas de nom. Il décrit dans une langue marquée par une « rhétorique d’exclusion » la vie qu’il mène après avoir été quitté par son amie Katharina. Toutes ses tentatives pour accepter son départ et la remplacer échouent à cause de s...

  16. Genexpression der überaktiven Blase am Beispiel von Smoothelin

    Directory of Open Access Journals (Sweden)

    Maake C

    2007-01-01

    Full Text Available Einleitung: Faktoren, welche zur Pathoätiologie der überaktiven Blase beitragen, sind bisher nur unzureichend bekannt. Die vorliegende Studie befaßt sich mit dem Kompartiment der glatten Muskulatur und möglichen Änderungen von Smoothelin, einem Markerprotein für glatte Muskelzellen des kontraktilen Phänotyps. Patienten und Methoden: Detrusorbiopsien wurden von überaktiven (n = 13 und von normokontraktilen, nichtobstruktiven Blasen (n = 8 gesammelt. Es wurde eine Urodynamik durchgeführt und bei Patienten mit Blasenüberaktivität eine Unterteilung in überaktive instabile Blasen (n = 7 und überaktive stabile Blasen (n = 6 vorgenommen. Gefrorene Biopsien wurden mit den Methoden der Immunfluoreszenz und der Reverse Transcriptase (RT Polymerase Chain Reaction (PCR analysiert. Außerdem wurden aus Gefrierschnitten mittels Laser Capture Microdissection Areale von Detrusormuskulatur isoliert und mit real-time PCR unter Verwendung von Primer/Probes für Smoothelin Varianten untersucht. Ergebnisse: Immunhistochemische und RT-PCR-Analysen zeigten, daß im menschlichen Detrusor Smoothelin exprimiert wird. Von den drei Varianten waren allerdings nur Varianten 1 und 2 detektierbar. Im Vergleich zu den Kontrollen war in Patienten mit überaktiver Blase im Detrusor signifikant mehr Smoothelin der Variante 1 vorhanden. Dieses Ergebnis war in Patienten mit überaktiver instabiler Blase noch deutlicher ausgeprägt als in Patienten mit überaktiver stabiler Blase. Die Differenz zwischen beiden Patientengruppen war aber statistisch nicht signifikant. Schlußfolgerungen: Unsere Ergebnisse weisen darauf hin, daß das Syndrom der überaktiven Blase mit Veränderungen myogener Parameter, wie eine erhöhte Smoothelinexpression, einhergehen. Unsere Studie untermauert außerdem die neue Definition des "overactive bladder syndrome" der International Continence Society, nach welcher "sensory urge" und "detrusor instability" eine gemeinsame klinische Entit

  17. Eine grüne Route der selektiven Hydrierung von Benzol zu Cyclohexen

    OpenAIRE

    Schwab, Frederick

    2014-01-01

    In der vorliegenden Arbeit wurde die Hydrierung von Benzol mit dem Ziel der selektiven Bildung von Cyclohexen untersucht. Die selektive Umsetzung von Benzol zu Cyclohexen könnte die Produktion der Monomere von Polyamiden vereinfachen, da Cyclohexen hydratisiert und anschließend wieder in den bestehenden Prozess eingespeist werden könnte. Hierfür wurden geträgerte Rutheniumkatalysatoren verwendet. Die Katalysatorsysteme sind im Einklang mit den Prinzipien der grünen Chemie, da die notwendigen...

  18. Virtuelle Nothilfe - Ein Experiment zum Effekt von virtueller Hilfe, Gewalt und Nothilfe auf Hilfe- und Gewaltverhalten

    OpenAIRE

    Mohseni, M. Rohangis

    2013-01-01

    Eine aktuelle Meta-Analyse von Anderson et al. (2010) zeigt, dass Gewaltverhalten in Computerspielen das Gewaltverhalten im realen Leben erhöht, während es prosoziales Verhalten verringert. Daneben führen einige Studien von Greitemeyer und Osswald (2010) sowie von Gentile et al. (2009) zu der Schlussfolgerung, dass das Hilfeverhalten in Computerspielen das Hilfeverhalten im realen Leben erhöht. Bisher gibt es aber keine Studien, die die kombinierte Wirkung von Gewalt und Hilfe in Computerspie...

  19. Wirksamkeit von Bitumenemulsionen bei der Wiederverwertung pechhaltiger Materialien im Straßenbau

    OpenAIRE

    Metz, Georg

    2009-01-01

    Die Wirksamkeit von Bitumenemulsionen bei der Wiederverwertung pechhaltiger Straßenausbaustoffe hängt von ihrer Fähigkeit zur Immobilisierung der im Pech enthaltenen PAK und Phenole sowie von ihrer bautechnischen Eignung bei der Verarbeitung eines konkreten Straßenausbaustoffes ab. Die Arbeit befasst sich mit der Untersuchung und modellhaften Beschreibung des Brechverhaltens handelsüblicher Bitumenemulsionen sowie anhand von pechhaltigem Modellmischgut mit deren Fähigkeiten bei der Einkapselu...

  20. Batteriespeicher in Haushalten unter Berücksichtigung von Photovoltaik, Elektrofahrzeugen und Nachfragesteuerung

    OpenAIRE

    Kaschub, Thomas

    2017-01-01

    In dieser Dissertation wird die Wirtschaftlichkeit von stationären Batteriespeicher-Systemen (SBS) in Kombination mit einer Photovoltaik-Anlage (PVA) und unter Berücksichtigung von Elektro-Pkw in Haushalten untersucht. Dabei wird auch das Potenzial für Lastverlagerung von E-Pkw und SBS betrachtet sowie die Auswirkungen von verschiedenen Stromtarifen oder Rahmenbedingungen evaluiert. Hierfür wurde ein Optimierungsmodell als gemischt-ganzzahliges lineares Programm entwickelt, welches mo...

  1. Batteriespeicher in Haushalten unter Berücksichtigung von Photovoltaik, Elektrofahrzeugen und Nachfragesteuerung

    OpenAIRE

    Kaschub, Thomas

    2017-01-01

    In dieser Arbeit wird die Wirtschaftlichkeit von stationären Batteriespeicher-Systemen (SBS) in Kombination mit einer Photovoltaik-Anlage (PVA) und unter Berücksichtigung von E-Pkw in Haushalten untersucht. Die Anlagengrößen von PVA und SBS werden dabei im Optimierungsmodell modellendogen bestimmt sowie deren Kapitalwert maximiert. Der Kapitalwert wird stark beeinflusst durch Lastverlagerungspotenziale von E-Pkw und SBS, Stromtarifdesign und weiteren Rahmenbedingungen.

  2. KK -theory and spectral flow in von Neumann algebras

    DEFF Research Database (Denmark)

    Kaad, Jens; Nest, Ryszard; Rennie, Adam

    2012-01-01

    We present a definition of spectral flow for any norm closed ideal J in any von Neumann algebra N. Given a path of selfadjoint operators in N which are invertible in N/J, the spectral flow produces a class in Ko (J). Given a semifinite spectral triple (A, H, D) relative to (N, t) with A separable......, we construct a class [D] ¿ KK1 (A, K(N)). For a unitary u ¿ A, the von Neumann spectral flow between D and u*Du is equal to the Kasparov product [u] A[D], and is simply related to the numerical spectral flow, and a refined C* -spectral flow....

  3. Die Bundesstatistik als Anbieter und Nutzer von raumbezogenen Daten

    Directory of Open Access Journals (Sweden)

    R. Humbel

    Einige konkrete und potentielle Anwendungen der vorhandenen Daten sollen das Potential und die Breite der Fragestellungen, die damit angegangen werden können, illustrieren. Eine besondere Stellung dürfte in Zukunft aber auch die Satellitenfernerkundung erhalten, deren Daten und Auswertungen eine willkommene Ergänzung für die eher traditionellen GIS-Datensätze bilden werden. Ein erster Pilotversuch wurde vor wenigen Monaten im BFS gestartet, der zum Ziel hat, die Machbarkeit einer gesamtschweizerischen Unterscheidung von Laub-, Nadel- und Mischwald als Ergänzung der auf der Grundlage von konventionellen Luftbildern erhobenen Arealstatistik nachzuweisen.

  4. The smooth entropy formalism for von Neumann algebras

    International Nuclear Information System (INIS)

    Berta, Mario; Furrer, Fabian; Scholz, Volkher B.

    2016-01-01

    We discuss information-theoretic concepts on infinite-dimensional quantum systems. In particular, we lift the smooth entropy formalism as introduced by Renner and collaborators for finite-dimensional systems to von Neumann algebras. For the smooth conditional min- and max-entropy, we recover similar characterizing properties and information-theoretic operational interpretations as in the finite-dimensional case. We generalize the entropic uncertainty relation with quantum side information of Tomamichel and Renner and discuss applications to quantum cryptography. In particular, we prove the possibility to perform privacy amplification and classical data compression with quantum side information modeled by a von Neumann algebra

  5. Design of inside cut von koch fractal UWB MIMO antenna

    Science.gov (United States)

    Tharani, V.; Shanmuga Priya, N.; Rajesh, A.

    2017-11-01

    An Inside Cut Hexagonal Von Koch fractal MIMO antenna is designed for UWB applications and its characteristics behaviour are studied. Self-comparative and space filling properties of Koch fractal structure are utilized in the antenna design which leads to the desired miniaturization and wideband characteristics. The hexagonal shaped Von Koch Fractal antenna with Defected Ground Structure (DGS) is designed on FR4 substrate with a compact size of 30mm x 20mm x 1.6mm. The antenna achieves a maximum of -44dB and -51dB at 7.1GHz for 1-element and 2-element case respectively.

  6. The smooth entropy formalism for von Neumann algebras

    Energy Technology Data Exchange (ETDEWEB)

    Berta, Mario, E-mail: berta@caltech.edu [Institute for Quantum Information and Matter, California Institute of Technology, Pasadena, California 91125 (United States); Furrer, Fabian, E-mail: furrer@eve.phys.s.u-tokyo.ac.jp [Department of Physics, Graduate School of Science, University of Tokyo, Tokyo, Japan and Institute for Theoretical Physics, Leibniz University Hanover, Hanover (Germany); Scholz, Volkher B., E-mail: scholz@phys.ethz.ch [Institute for Theoretical Physics, ETH Zurich, Zurich (Switzerland)

    2016-01-15

    We discuss information-theoretic concepts on infinite-dimensional quantum systems. In particular, we lift the smooth entropy formalism as introduced by Renner and collaborators for finite-dimensional systems to von Neumann algebras. For the smooth conditional min- and max-entropy, we recover similar characterizing properties and information-theoretic operational interpretations as in the finite-dimensional case. We generalize the entropic uncertainty relation with quantum side information of Tomamichel and Renner and discuss applications to quantum cryptography. In particular, we prove the possibility to perform privacy amplification and classical data compression with quantum side information modeled by a von Neumann algebra.

  7. Vergleich verschiedener Methoden zur Haftkraftmessung von Dentinadhäsiven

    OpenAIRE

    Schwertner, Katharina

    2010-01-01

    Zur Bestimmung der Haftkraft von Adhäsiven stehen verschiedene Methoden zur Verfügung. Ziel dieser Studie war es, vier gebräuchliche in vitro Haftkraftmessmethoden (Tensile Bond Strength Test, Shear Bond Strength Test, Microtensile Bond Strength Test, Push-out Bond Strength Test) an drei unterschiedlichen Adhäsivsystemen (Syntac, Clearfil SE Bond, Adper Scotchbond Multi Purpose) zu testen und die Ergebnisse zu vergleichen. Die Haftkräfte sind abhängig von der verwendeten Messmethode. Viele Pa...

  8. Dr. Space the life of Wernher von Braun

    CERN Document Server

    Ward, Bob

    2013-01-01

    Written by veteran aerospace journalist Bob Ward, who spent years investigating his subject, this biography presents a revealing but even-handed portrait of the father of modern rocketry. As he chronicles Wernher von Braun's life, Ward explodes many myths and misconceptions about the controversial genius who was a hero to some, a villain to others. The picture of von Braun that emerges is of a brilliant scientist with limitless curiosity and a drive to achieve his goals at almost any price from, developing the world's first ballistic missile used against the Allies in World War II to help

  9. RTLOpen Plattform Handbuch. Teil 3 - Softwareentwicklung von Echtzeitsystemen

    OpenAIRE

    Elberzhager, Frank; Kalmar, Ralf; Keuler, Thorsten; Meininger, Stefan

    2007-01-01

    In diesem Dokument wird der Gesamtprozess zur Entwicklung von Software für Echtzeitsysteme beschrieben. Dabei ist der Prozess der Vorgehensweise an das Prinzip des V-Modells angelehnt. Das 3-Ebenen-Vorgehensmodell aus dem EQUAL-Projekt [Ben+05] unterstützt dabei die qualitätsorientierte multidisziplinäre Entwicklung von mechatronischen Echtzeitsystemen. Die ProMiS Methode ("Projektmanagement für interdisziplinäre Systeme") kann dabei als Projektmanagementmethode herangezogen werden. Zusätzlic...

  10. Das Surfgramm als grafische Darstellung von Surfwegen im Internet

    Directory of Open Access Journals (Sweden)

    Martina Schuegraf

    2007-12-01

    Full Text Available Das folgend vorgestellte Instrument zur Analyse und Darstellung von Surfwegen im Internet, die durch ihre Nutzerinnen und Nutzer vollzogen werden, kann und soll nicht als ein technisch komplexes und «objektive» Daten lieferndes Methodeninstrumentarium betrachtet werden. Es ist vielmehr eine Methode, um im Bereich der qualitativen (Internet-Forschung in einer strukturierenden und fassbaren Weise Handlungsformen im Internet sichtbar und auf diese Weise auswertbar zu machen. Diese Form der Auswertung geht über die reine Interpretation der Transkripttexte von Interviews hinaus, sollte aber damit trianguliert werden.

  11. Computer-pictures of blowing-ups. (Computerbilder von Aufblasungen.)

    OpenAIRE

    Brodmann, M

    1995-01-01

    In dieser Arbeit stellen wir einige Computerbilder von Aufblasungen vor und beschreiben die Methode, mit der diese Bilder hergestellt wurden. Zugleich erläutern wir das für die algebraische Geometrie sehr wichtige Konzept der Aufblasung. Bei unseren Bildern beschränken wir uns auf Aufblasungen einer Kreisscheibe bezüglich zweier Polynome. Schon in diesem einfachen Fall erhält man eine erstaunliche Vielfalt von ästetisch sehr ansprechenden Flächen. In augenfälliger Weise zeigt sich so etwas vo...

  12. Von-Neumann and Beyond: Memristor Architectures

    KAUST Repository

    Naous, Rawan

    2017-05-01

    An extensive reliance on technology, an abundance of data, and increasing processing requirements have imposed severe challenges on computing and data processing. Moreover, the roadmap for scaling electronic components faces physical and reliability limits that hinder the utilization of the transistors in conventional systems and promotes the need for faster, energy-efficient, and compact nano-devices. This work thus capitalizes on emerging non-volatile memory technologies, particularly the memristor for steering novel design directives. Moreover, aside from the conventional deterministic operation, a temporal variability is encountered in the devices functioning. This inherent stochasticity is addressed as an enabler for endorsing the stochastic electronics field of study. We tackle this approach of design by proposing and verifying a statistical approach to modelling the stochastic memristors behaviour. This mode of operation allows for innovative computing designs within the approximate computing and beyond Von-Neumann domains. In the context of approximate computing, sacrificing functional accuracy for the sake of energy savings is proposed based on inherently stochastic electronic components. We introduce mathematical formulation and probabilistic analysis for Boolean logic operators and correspondingly incorporate them into arithmetic blocks. Gate- and system-level accuracy of operation is presented to convey configurability and the different effects that the unreliability of the underlying memristive components has on the intermediary and overall output. An image compression application is presented to reflect the efficiency attained along with the impact on the output caused by the relative precision quantification. In contrast, in neuromorphic structures the memristors variability is mapped onto abstract models of the noisy and unreliable brain components. In one approach, we propose using the stochastic memristor as an inherent source of variability in

  13. Muuga / Mary von Grünewaldt ; tõlk. Mati Sirkel

    Index Scriptorium Estoniae

    Grünewaldt, Mary von

    2004-01-01

    Leo Zoegelt ostetud Muuga mõisahoone korrastamisest ja uue hoone ehitamisest C. T. von Neffi kunstikogu paigutamise tarbeks. Tütre mälestused. Tõlgitud raamatust: Skizzen und Bilder aus dem Leben Carl Timoleon von Neff / Mary von Grünewaldt. Darmstadt, 1887

  14. Die grossen Physiker und ihre Entdeckungen von den fallenden Körpern zu den Quarks

    CERN Document Server

    Segrè, Emilio

    1998-01-01

    Von Galileo Galilei bis zu Richard Feynman und Murray Gell-Mann - von den fallenden Körpern zu den Quarks: Der Physiknobelpreisträger Emilio Segre hat seine ganz persönliche Geschichte der Physik geschrieben. Er erzählt von den großen Gestalten und deren wichtigen Entdeckungen mit großer Anschaulichkeit und Lebendigkeit.

  15. Analyse der pharmazeutischen Versorgungssituation von Patienten mit Psoriasis-Arthritis auf Basis von Routinedaten der Gesetzlichen Krankenversicherung.

    Science.gov (United States)

    Sondermann, Wiebke; Ventzke, Julia; Matusiewicz, David; Körber, Andreas

    2018-03-01

    Die Psoriasis-Arthritis (PsA) gehört zu den chronisch entzündlichen Gelenkerkrankungen. Trotz zahlreicher versorgungswissenschaftlicher Studien in Deutschland liegen zur pharmazeutischen Versorgungssituation von PsA-Patienten bisher kaum aktuelle Ergebnisse vor. Mit Hilfe einer systematischen Literaturrecherche sowie anhand von Routinedaten der Allgemeinen Ortskrankenkasse (AOK) Rheinland/Hamburg wird ein aktueller Überblick über die pharmazeutische Versorgung von PsA-Patienten in Deutschland gegeben. Selektiert wurden Versicherte aus dem ambulanten und stationären Bereich, die im 1. und 2. Quartal des Jahres 2014 die gesicherte Abrechnungsdiagnose Psoriasis-Arthritis L40.5+ aufwiesen. Anschließend wurden auf Basis dieser "vorab definierten" Kohorte die Arzneimitteldaten für 5 Jahre (01.01.2010-31.12.2014) abgerufen. Es konnten insgesamt n  =  3205 Versicherte (45 % männlich, 55 % weiblich) der AOK Rheinland/Hamburg mit einer gesicherten PsA-Diagnose selektiert werden. Das Durchschnittsalter betrug 58,9 Jahre. 53,7 % der PsA-Patienten wurden mit systemischen PsA-relevanten Arzneimitteln versorgt. Nichtsteroidale Antirheumatika (NSAR) wurden am häufigsten verordnet, gefolgt von systemischen Glucocorticoiden. Von den selektierten PsA-Patienten, die eine Systemtherapie erhielten, wurden 72,1 % mittels einer Disease-modifying-antirheumatic-Drug (DMARD)-Monotherapie behandelt, gefolgt von der Kombinationstherapie aus DMARDs und Biologika (20,9 %). Die pharmakologische Therapie der PsA muss eine Gewährleistung zwischen adäquater Versorgung der PsA mit Verhinderung der Krankheitsprogression und ökonomischer Verantwortung darstellen. © 2018 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

  16. Hurricane Andrew causes major oil spill at Florida Power ampersand Light Company's Turkey Point Power Plant, Homestead, Florida

    International Nuclear Information System (INIS)

    Jones, M.A.; Butts, R.L.; Lindsay, J.R.; McCully, B.S.; Pickering, T.H.

    1993-01-01

    On August 24, 1992, Hurricane Andrew slammed into South Florida with wind gusts in excess of 160 mph. At 4:00 a.m. that day, the eye of this category four storm passed over Florida Power ampersand Light Company's Turkey Point power plant, south of Miami. Although the plant's two nuclear units escaped any significant damage, the storm caused extensive destruction to buildings and transmission facilities, and damaged two 400 foot tall emission stacks associated with the site's two fossil fuel generating units. In addition, a 90,000 to 110,000 gallon spill of No. 6 fuel oil resulted when a piece of wind-blown debris punctured the steel of the unit One 12,000 barrel fuel oil metering tank approximately 30 feet up from the tank bottom. Despite the presence of a secondary containment structure around the tank, the intense wind blew oil throughout the plant site. The damage to the metering tank apparently occurred during the first half hour of the hurricane. As the tank's oil level fell due to the puncture, transfer pumps from the bulk oil storage tanks received a low level alarm which automatically began transferring oil to the damaged metering tank. To prevent the further discharge of oil, plant personnel entered the power block and secured the pumps during the passage of the hurricane eye. Immediately following the storm, facility personnel deployed booms across the barge canal and the Units 1 and 2 intake canal to contain the oil which had entered the water. The response strategy and implementation is described in detail. The remediation costs were approximately $14/gallon spilled, including 54,000 gallons recovered for electricity generation

  17. Der Zusammenhang von Partnermarktopportunitäten aus dem Freundeskreis und der Stabilität von Paarbeziehungen : Eine Analyse mit den Daten des Partnermarktsurvey

    OpenAIRE

    Häring, Armando

    2014-01-01

    "Der Beitrag analysiert den Zusammenhang zwischen Partnermarktoportunitäten aus dem Freundeskreis und der Stabilität von Paarbeziehungen. Unter Verwendung des theoretischen Konzepts der Theorie der Interaktionsgelegenheiten sowie von Annahmen der Austauschtheorie und der Familienökonomie, werden mögliche Zusammenhänge zwischen gemeinsamen Freundeskreisen mit dem Partner, Partnermarktgelegenheiten aus dem Freundeskreis (sex ratio) und der Stabilität von Paarbeziehungen diskutiert. Der Beitrag ...

  18. ERWERB VON EIGENTUMSRECHTEN DURCH ERSITZUNG VON IMMOBILIEN IN SOZIALEM EIGENTUM IM KONTEXT DER NEUEN PRAXIS DES EUROPÄISCHEN GERICHTSHOFS FÜR MENSCHENRECHTE

    Directory of Open Access Journals (Sweden)

    Damir Kontrec

    2017-01-01

    Full Text Available Dieser Artikel befasst sich mit der Ersitzung von Immobilien als einer Art des Erwerbs des Eigentumsrecht im gesellschaftlichen Eigentum. Er weist auf drei wichtige Entscheidungen des Europäischen Gerichtshofs für Menschenrechte gegen die Republik Kroatien hin, die einen direkten Einfl uss auf das Rechtsdenken der ordentlichen Gerichte in der Republik Kroatien in Bezug auf den Erwerb von Eigentumsrecht durch Ersitzung von Immobilien in sozialem Eigentum haben.

  19. Einflüsse von Trennung und neuer Partnerschaft der Eltern. Ein Vergleich von Jungen und Mädchen in Ost- und Westdeutschland

    OpenAIRE

    Walper, Sabine

    2002-01-01

    Die vorliegende Studie vergleicht die Befindlichkeit, Sozial- und Kompetenzentwicklung von Kindern und Jugendlichen aus Kern-, Mutter- und Stieffamilien. Hierbei wird zunächst nach differentiellen Effekten des Familientyps in West- und Ostdeutschland sowie in Abhängigkeit von Alter und Geschlecht gefragt. Danach wird geprüft, inwieweit verschiedene familiäre Belastungsfaktoren mögliche Effekte des Familientyps erklären. Die Daten stammen aus standardisierten Befragungen von 654 Kindern und Ju...

  20. Lars von Triers fornyelse af filmen 1984-2014

    DEFF Research Database (Denmark)

    Thomsen, Bodil Marie Stavning

    Bogen undersøger Lars von Triers affektskabende og etisk involverende stil med udgangspunkt i hans værker over en 30-årig periode (1984-2014). Centralt i bogens læsninger står væsentlige analytiske begreber som det haptiske, det affektive, det diagrammatiske og det signaletiske materiale, der med...

  1. Enfermedad de Von Gierke: Reporte de tres casos

    Directory of Open Access Journals (Sweden)

    E. Espinosa

    2001-07-01

    Full Text Available La enfermedad de Von Gierke es un defecto en la glucosa 6 fosfatasa, degrada el glucógeno en el hígado, riñón e intestino. Asociada con hipoglicemia, acidosis láctica e hiperuricemia.

  2. Spin–momenta entanglement in moving frames: Properties of von ...

    Indian Academy of Sciences (India)

    disentangled) as seen by moving observers, is used to investigate the properties of von Neumann entropy, as a measure of spin–momentum entanglement. To do so, we partition the total Hilbert space into momentum and spin subspaces so that the ...

  3. Sakslased tulevad! Ärevad ajad Tallinnas Von Krahli Teatris

    Index Scriptorium Estoniae

    2001-01-01

    Von Krahli Teater ja Showcase Beat Le Mot valmistuvad oma esimeseks koostööprojektiks - lavastuseks "Pirates", kus osalevad mõlema teatri näitlejad ja tehnikud. Ühisprojekti toetavad Goethe Instituut, Hamburgi Linnavalitsus ja Eesti Kultuurkapital

  4. Eritrea : Von der Befreiung zur Unterdrückung

    NARCIS (Netherlands)

    van Reisen, Mirjam; Buck, K.D.

    2015-01-01

    Über das heutige Eritrea ist nur wenig bekannt. Als das kleine Land am Horn von Afrika 1993 die Unabhängigkeit erlangte, waren nicht nur im Land selbst die Hoffnungen groß, dass nach dem dreißig Jahre dauernden Befreiungskampf gegen Äthiopien eine bessere und friedliche Zukunft für alle beginnen

  5. C. J. Ebhardi ja Balthasar von Campenhauseni projektid / Toivo Meikar

    Index Scriptorium Estoniae

    Meikar, Toivo, 1947-

    2005-01-01

    Lisatud: C. J. Ebhardi Eesti- ja Liivimaa metsa- ja jahiseaduse projekt (valmis hiljemalt aastaks 1770), lk. 199-222 ; Härra maanõuniku parun von Campenhauseni ettepanekud kõikide metsade nõuetekohaseks korralduseks (4. juuli 1778), lk. 223-233

  6. Minimum Moduli in Von Neumann Algebras | Gopalraj | Quaestiones ...

    African Journals Online (AJOL)

    In this paper we answer a question raised in [12] in the affirmative, namely that the essential minimum modulus of an element in a von. Neumann algebra, relative to any norm closed two-sided ideal, is equal to the minimum modulus of the element perturbed by an element from the ideal. As a corollary of this result, we ...

  7. A von Neumann type inequality for certain domains in Cn

    Czech Academy of Sciences Publication Activity Database

    Ambrozie, Calin-Grigore; Timotin, D.

    2002-01-01

    Roč. 131, č. 3 (2002), s. 859-869 ISSN 0002-9939 R&D Projects: GA ČR GA201/03/0041 Institutional research plan: CEZ:AV0Z1019905 Keywords : von Neumann inequality * multioperators * Nevanlinna-Pick problem Subject RIV: BA - General Mathematics Impact factor: 0.334, year: 2002

  8. Characterizing ξ-Lie Multiplicative Isomorphisms on Von Neumann Algebras

    Directory of Open Access Journals (Sweden)

    Yamin Song

    2014-01-01

    Full Text Available Let ℳ and be von Neumann algebras without central summands of type I1. Assume that ξ∈ℂ with ξ≠1. In this paper, all maps Φ:ℳ→ satisfying ΦAB-ξBA=ΦAΦB-ξΦBΦ(A are characterized.

  9. A bicategorical approach to Morita equivalence for Von Neumann algebras

    NARCIS (Netherlands)

    R.M. Brouwer (Rachel)

    2003-01-01

    textabstractWe relate Morita equivalence for von Neumann algebras to the ``Connes fusion'' tensor product between correspondences. In the purely algebraic setting, it is well known that rings are Morita equivalent if and only if they are equivalent objects in a bicategory whose 1-cells are

  10. A paradox of rationality à la von Neumann-Morgenstern

    NARCIS (Netherlands)

    Ismail, M.S.

    2015-01-01

    We show that there are games and decision situations in which it is not possible for the decision maker to be rational a la von Neumann-Morgenstern in both situations simultaneously, which is the source of the paradox presented in this note. We provide an assumption which is the necessary and

  11. Spin–momenta entanglement in moving frames: Properties of von ...

    Indian Academy of Sciences (India)

    Keywords. Relativistic entanglement; reduced von Neumann entropy; Gaussian distributions. PACS Nos 03.67.Mn; 03.65.Yz; 03.67.Bg. 1. Introduction. It is well known that any information processing scheme involves a part emitting the information and a part measuring the received information. The emitted information, as.

  12. Alexander von Humboldt's invention of the natural landscape

    NARCIS (Netherlands)

    Kwa, C.

    2005-01-01

    Landscape took on a new meaning through the new science of plant geography of Alexander von Humboldt (1769-1857). In the seventeenth and eighteenth centuries, "landscape" was foremost a painterly genre. Slowly, painted landscapes came to bear on natural surroundings, but by 1800 it was still not

  13. Wilhelm von Humboldt's Idea of "Bildung" and Education.

    Science.gov (United States)

    Stubbs, Elsina

    The importance of Wilhelm von Humboldt's work in educational philosophy is little known outside of Germany and even there he is more often criticized than praised. This is unfortunate because his contributions to education and other areas had an important impact on other philosophers of his period and are well worth considering today. In his main…

  14. Von Willebrand Factor Gene Variants Associate with Herpes simplex Encephalitis

    Czech Academy of Sciences Publication Activity Database

    Abdelmagid, N.; Bereczky-Veress, B.; Atanur, S.; Musilová, Alena; Zídek, Václav; Saba, L.; Warnecke, A.; Khademi, M.; Studahl, M.; Aurelius, E.; Hjalmarsson, A.; Garcia-Dias, A.; Denis, C. V.; Bergström, T.; Sköldenberg, B.; Kockum, I.; Aitman, T.; Hübner, N.; Olsson, T.; Pravenec, Michal; Diez, M.

    2016-01-01

    Roč. 11, č. 5 (2016), e0155832 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) 7E10067; GA MŠk(CZ) LL1204 Institutional support: RVO:67985823 Keywords : Von Willebrand Factor gene * Herpes simplex encephalitis * rat * humans Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.806, year: 2016

  15. Rezension: Kafka von David Zane Mairowitz u. Robert Crumb

    Directory of Open Access Journals (Sweden)

    Johanna Lenhart

    2015-12-01

    Full Text Available Die inzwischen schon fast als Klassiker gehandelte Comicadaption von Franz Kafkas Leben und Werk wird zwanzig Jahre nach Erscheinen neu aufgelegt. Johanna Lenhart rezensierte für die MEDIENIMPULSE die visuelle Einführung des Autorenduos Crumb/Mairowitz in Kafkas Welt.

  16. Computed tomography of von Meyenburg complex simulating micro-abscesses

    International Nuclear Information System (INIS)

    Sada, P.N.; Ramakrishna, B.

    1994-01-01

    A case is presented of a bile duct hamartoma in a 44 year old man being evaluated for abdominal pain. The computed tomography (CT) findings suggested micro-abscesses in the liver and a CT guided tru-cut biopsy showed von Meyenburg complex. 9 refs., 3 figs

  17. Dr. von Braun With a Model of a Launch Vehicle

    Science.gov (United States)

    1950-01-01

    Dr. von Braun stands beside a model of the upper stage (Earth-returnable stage) of the three-stage launch vehicle built for the series of the motion picture productions of space flight produced by Walt Disney in the mid-1950's.

  18. Molecular characterization of exon 28 of von Willebrand's factor ...

    African Journals Online (AJOL)

    Background: Polymorphisms in von Willebrand factor (VWF) gene are an important contributor to the expression of VWF gene and differences in ethnic distribution of these single nucleotide polymorphisms (SNPs) exists. Aims: Our objective was to molecularly characterize the exon 28 of the VWF gene in the three major ...

  19. Seminario para el estudio de Carl Von Clausewitz

    OpenAIRE

    Darío Mesa

    2008-01-01

    Este es el programa del seminario que a propuesta y bajo la dirección del profesor Darío Mesa se realizó en el Departamento de Sociología, entre marzo y septiembre de 1981 sobre el libro de La Guerra del Militar y Teórico Prusiano Cari Von Clausewitz (178

  20. Seminario para el estudio de Carl Von Clausewitz

    Directory of Open Access Journals (Sweden)

    Darío Mesa

    2000-01-01

    Full Text Available Este es el programa del seminario que a propuesta y bajo la dirección del profesor Darío Mesa se realizó en el Departamento de Sociología, entre marzo y septiembre de 1981 sobre el libro de La Guerra del Militar y Teórico Prusiano Cari Von Clausewitz (178

  1. Playing the Waves : Lars von Trier's Game Cinema

    NARCIS (Netherlands)

    Simons, Jan

    2007-01-01

    Dogma95 werd toegejuicht als een Europees alternatief voor de Hollywoodblockbuster. Voor veel critici en filmliefhebbers is Dogma95 gaan staan voor de begrippen waarmee de kunstzinnige film gebruikelijk in verband wordt gebracht: low budget en realisme. Von Triers benadering van filmen voert film

  2. Ernst von Glasersfeld's Radical Constructivism and Truth as Disclosure

    Science.gov (United States)

    Joldersma, Clarence W.

    2011-01-01

    In this essay Clarence Joldersma explores radical constructivism through the work of its most well-known advocate, Ernst von Glasersfeld, who combines a sophisticated philosophical discussion of knowledge and truth with educational practices. Joldersma uses Joseph Rouse's work in philosophy of science to criticize the antirealism inherent in…

  3. The education of Ehrenfried Walther von Tschirnhaus (1651-1708).

    Science.gov (United States)

    Adler, Jacob

    2015-02-01

    Ehrenfried Walther von Tschirnhaus, mathematician, inventor, and correspondent of Spinoza, is often thought to have studied medicine at Leiden, though documentation of this fact has been lacking. Tschirnhaus' medical education is here documented, along with the nature of his medical practice. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  4. lessons from Auzoux's and von Hagens's anatomical models

    Indian Academy of Sciences (India)

    2009-12-09

    Dec 9, 2009 ... A variety of materials, such as wax, wood, papier-mâché, or glass, have long been used to construct animal and plant models. In the case of the human body, the most innovative, yet controversial, method of preservation has been plastination, invented by the German physician Gunther von Hagens, ...

  5. Lars von Trier ja kombekuse riismed / Kadri Kõusaar

    Index Scriptorium Estoniae

    Kõusaar, Kadri, 1980-

    2011-01-01

    Taani filmilavastaja Lars von Trieri Cannes'is persona non grata'ks kuulutamisest tema filmi "Melanhoolia" esilinastusele järgnenud pressikonverentsil öeldu pärast. Autor ja tema teos tuleb hoida lahus. Trieri filmid jäävad sama raputavateks meistriteosteks, kui nad olid enne

  6. Primary carcinoma of the lung in von Recklinghausen neurofibromatosis

    Directory of Open Access Journals (Sweden)

    Gupta K

    2009-01-01

    Full Text Available von Recklinghausen neurofibromatosis (NF-1 is the most common inherited syndrome predisposing to neoplasia, particularly neural crest-derived tumors. However, lung malignancies reported in association with neurofibromatosis are sparse. We present a case of a 48-year-old man with NF-1 that manifested as carcinoma of lung, in order to discuss the linkage between these two entities.

  7. Mollusken aus posttertiären Schichten von Celebes

    NARCIS (Netherlands)

    Schepman, M.M.

    1912-01-01

    Die im Folgenden behandelten Mollusken stammen aus der Nähe von Kajoe ragi auf Celebes, woselbst sie durch R. FENNEMA aus denselben Schichten ausgelesen wurden, aus denen früher durch J. G. DE MAN einige brachyure Krebse beschrieben sind. Es darf deswegen betreffs näherer Angaben über die Herkunft

  8. Semiparametric Bernstein-von Mises for the error standard deviation

    NARCIS (Netherlands)

    de Jonge, R.; van Zanten, H.

    2013-01-01

    We study Bayes procedures for nonparametric regression problems with Gaussian errors, giving conditions under which a Bernstein-von Mises result holds for the marginal posterior distribution of the error standard deviation. We apply our general results to show that a single Bayes procedure using a

  9. Von Kármán between Aachen and Pasadena

    Science.gov (United States)

    Krause, Egon; Kalkmann, Ulrich

    2013-05-01

    In the Introduction the reader is referred back to the academic ceremonials held after Theodore von Kármán's death in Aachen in May 1963. His work as the first director of the Aerodynamisches Institut (Institute of Aerodynamics) of the RWTH Aachen University of Technology from 1913 on and his initiative to re-establish international cooperation after World War I, resulting in the International Union of Theoretical and Applied Mechanics (IUTAM), are commented on. The following chapter describes von Kármán's relation to his former teacher Ludwig Prandtl. Some of von Kármán's scientific contributions during his time in Aachen are briefly reviewed. Thereafter, his first contacts to the California Institute of Technology are covered. Finally, the scientific and political circumstances, which led to von Kármán's decision to leave Germany in the early thirties, are elucidated in some detail. The English translation of the titles of the Aachen papers is given in Appendix I.

  10. Über die Gyriniden (Col.) von Guiana

    NARCIS (Netherlands)

    Ochs, Georg

    1962-01-01

    Von 14 Taumelkäfer-Arten, die bislang für Guiana nachgewiesen waren, kannte man aus Suriname lediglich 2. Dank der Sammeltätigkeit der Naturwissenschaftlichen Suriname Expedition 1949 in den Nassau Gebergte erhöhen sich diese Zahlen um 3 neue Arten und 2 Unterarten, die hierunter beschrieben werden,

  11. De identiteit van Portulaca advena Reichg. & Von Poellnitz

    NARCIS (Netherlands)

    Geesink, R.

    1969-01-01

    Portulaca advena Reichg. & Von Poellnitz (1939), based on adventive specimens collected near Erp, prov. N.-Brabant, Netherlands, and afterwards cultivated in a garden at Nijmegen, appears to be identical with the South American P. papulosa Schldl. (1853). The adventive species of Portulaca found in

  12. Die Rolle von Osteoklasten bei der arthritischen Knochenerosion

    Directory of Open Access Journals (Sweden)

    Schett G

    2003-01-01

    Full Text Available Knöcherne Erosionen stellen eine wesentliche Ursache für die funktionelle Einschränkung von Patienten mit rheumatoider Arthritis dar. Bis vor kurzem war über den Pathomechanismus dieser Veränderungen nur wenig bekannt. Dieser Review faßt die letzten Erkenntnisse über die Ausbildung einer Knochenschädigung bei entzündlichen Gelenkerkrankungen zusammen und fokussiert insbesondere die Rolle von Osteoklasten. Es wird ein Überblickzu den Hinweisen für eine Präsenz von Osteoklasten im entzündlich veränderten Gelenk gegeben. Weiters werden die Faktoren diskutiert, die die Osteoklastogenese im Rahmen einer Gelenkentzündung aktivieren können. Hier wird im besonderen auf die Rolle von Receptor-Activator of Nuclear Factor Kappa B Ligand (RANKL eingegangen. Im weiteren werden die Auswirkungen einer Osteoklastenhemmung in den verschiedenen Arthritismodellen zusammengefaßt und Möglichkeiten einer therapeutischen Nutzung bei rheumatoider Arthritis diskutiert.

  13. Der gespielte Ernst des Lebens: Bestandsaufnahme und Potenziale von Serious Games (for Health

    Directory of Open Access Journals (Sweden)

    Claudia Lampert

    2009-03-01

    Full Text Available Serious Games werden aktuell im Zusammenhang mit den positiven Potenzialen von Computerspielen in verschiedenen Kontexten diskutiert. Im vorliegenden Beitrag werden die Entwicklung und der Forschungsstand des relativ neuen Konzeptes skizziert und gegenüber anderen Lernkonzepten wie Edutainment, Digital Game-Based Learning und E-learning abgegrenzt. Das Spektrum von Serious Games wird am Beispiel von zwei Spielen aus dem Gesundheitsbereich (Re-Mission und Fatworld dargestellt und die Potenziale und Grenzen von Serious Games (for Health erörtert. Da bislang nur wenige empirische Befunde zur Wirkung von Serious Games vorliegen, plädieren die Autoren für eine umfassende Grundlagen- und Wirkungsforschung.

  14. Die filmstilistische Darstellung von Klaras Gehbehinderung im Kinderfilm "Heidi"

    Directory of Open Access Journals (Sweden)

    Maria Ohrfandl

    2016-09-01

    Full Text Available Dieser Beitrag soll die Forschungslücke zur Darstellung von Behinderungen speziell im Kinderfilm im deutschsprachigen Raum füllen. Auf Basis einer neoformalistisch orientierten Filmanalyse nach Bordwell und Thompson (2008, wird anhand von drei Filmsequenzen eine mögliche Lesart des Kinderfilms "Heidi" (Marcus 2005 entwickelt, um die filmstilistische Darstellung der Gehbehinderung des Mädchens Klara zu untersuchen. Die Ergebnisse werden mit theoretischen Überlegungen zur Problematik der Begriffsbestimmung von Körperbehinderung sowie zur Mobilität und Selbstbestimmung von Menschen mit Körperbehinderungen in Bezug gesetzt. Dabei zeigt sich im Wesentlichen, dass im Kinderfilm "Heidi" (Marcus 2005 Klaras Gehbehinderung als 'heilbare Krankheit' und der Rollstuhl als Einschränkung von Mobilität begriffen wird. Außerdem unterliegt Klara aufgrund ihrer Körperbehinderung überwiegend der Fremdbestimmung von Erwachsenen. Zur Klärung wahrscheinlicher filmischer Bildungspotenziale werden die Ergebnisse schließlich anhand der von Jörissen und Marotzki (2009 entwickelten Orientierungsdimensionen "Wissens-, Handlungs-, Grenz- und Biographiebezug" diskutiert. This article aims to bridge a knowledge gap by showing ways of representing disabilities in the German children film genre. Using Bordwell and Thomson's (2008 neoformalistically orientated film analysis approach, the movie "Heidi" (Marcus 2005 is analysed. Bordwell and Thompson's (2008 method is applied to three sequences of "Heidi" in order to present an interpretation and to discuss the representation of Clara's walking impediment. The results are then associated with theoretical considerations regarding the mobility and self-determination of people with disabilities and problematic definitions of the term 'physical disability'. It is shown that characters in the children's film "Heidi" (Marcus 2005 regard Clara's walking impediment as a 'curable disease' and the wheelchair as a limitation

  15. Einfluss von Ernährungsfaktoren im ersten Lebensjahr auf die Entwicklung von Diabetes- und Zöliakie-assoziierter Autoimmunität

    OpenAIRE

    Huber, Doris

    2005-01-01

    Eine Modulation von Ernährungsfaktoren wurde als möglicher Einflussfaktor auf das Risiko für Typ 1 Diabetes-assoziierte Autoimmunität vermutet. Ziel der Arbeit war es, festzustellen, ob die Stilldauer, die Einführung von industriell hergestellter Säuglingsmilchnahrung, das Zufüttern von Beikost oder der Zeitpunkt der erstmaligen Gabe glutenhaltiger Nahrungsmittel Einfluss auf die Entwicklung von Diabetes- oder Zöliakie-assoziierten Autoantikörper haben. Als Studienkollektiv dienten 1610 Kinde...

  16. Eine selbstkonsistente Carleman Linearisierung zur Analyse von Oszillatoren

    Directory of Open Access Journals (Sweden)

    H. Weber

    2017-09-01

    Full Text Available Die Analyse nichtlinearer dynamischer Schaltungen ist bis heute eine herausfordernde Aufgabe, da nur selten analytische Lösungen angegeben werden können. Daher wurden eine Vielzahl von Methoden entwickelt, um eine qualitative oder quantitative Näherung für die Lösungen der Netzwerkgleichung zu erhalten. Oftmals wird beispielsweise eine Kleinsignalanalyse mit Hilfe einer Taylorreihe in einem Arbeitspunkt durchgeführt, die nach den Gliedern erster Ordnung abgebrochen wird. Allerdings ist diese Linearisierung nur in der Nähe des stabilen Arbeitspunktes für hyperbolische Systeme gültig. Besonders für die Analyse des dynamischen Verhaltens von Oszillatoren treten jedoch nicht-hyperbolische Systeme auf, sodass diese Methode nicht angewendet werden kann Mathis(2000. Carleman hat gezeigt, dass nichtlineare Differentialgleichungen mit polynomiellen Nichtlinearitäten in ein unendliches System von linearen Differentialgleichungen transformiert werden können Carleman(1932. Wird das unendlichdimensionale Gleichungssystem für numerische Zwecke abgebrochen, kann bei Oszillatoren der Übergang in eine stationäre Schwingung (Grenzzyklus nicht wiedergegeben werden.In diesem Beitrag wird eine selbstkonsistente Carleman Linearisierung zur Untersuchung von Oszillatoren vorgestellt, die auch dann anwendbar ist, wenn die Nichtlinearitäten keinen Polynomen entsprechen. Anstelle einer linearen Näherung um einen Arbeitspunkt, erfolgt mit Hilfe der Carleman Linearisierung eine Approximation auf einem vorgegebenen Gebiet. Da es jedoch mit der selbstkonsistenten Technik nicht möglich ist, das stationäre Verhalten von Oszillatoren zu beschreiben, wird die Berechnung einer Poincaré-Abbildung durchgeführt. Mit dieser ist eine anschließende Analyse des Oszillators möglich.

  17. Optimierung der Gesichtsklassifikation bei der Erkennung von Akromegalie

    Directory of Open Access Journals (Sweden)

    Frohner R

    2013-01-01

    Full Text Available In vorausgegangenen Studien konnte gezeigt werden, dass eine Gesichtsklassifikation mittels Gesichtsphotographien zur Diagnostik von Akromegalie mit guten Ergebnissen eingesetzt werden kann. In diesem Artikel werden die grundlegende Vorgehensweise der Klassifikation mittels der Software FIDA erläutert sowie Optimierungsansätze mit dem Ziel diskutiert, diese Methode näher an den klinischen Einsatz zu bringen. Die Gesichtsklassifikation basiert auf „Knotenpunkten“, die verteilt über die jeweilige Frontal- und/oder Seitenansicht des Gesichts platziert werden und den so genannten „Graphen“ bilden. Mittels mathematischer Verfahren erfolgt eine Analyse der zugrunde liegenden Textur des Bildes sowie die Auswertung geometrischer Informationen. Untersucht wird, wie sich die Reduktion von als irrelevant eingestuften Knoten auf das Klassifikationsergebnis auswirkt. Ebenso wird untersucht, wie sich neu definierte Knoten, die die typischen morphologischen Veränderungen der akromegalen Erkrankung im Gesicht berücksichtigen, auf die Klassifizierungsergebnisse auswirken. Die interne Validierung erfolgt an einem Datenset bestehend aus 57 an Akromegalie erkrankten Probanden (29 weiblich, 28 männlich sowie 59 Kontrollen (29 weiblich, 30 männlich. Die externe Validierung wird an einer weiteren Stichprobe gemessen, die zum Zeitpunkt der Präsentation auf der Tagung der European Neuroendocrine Association 2012 in Wien 13 akromegale Patienten (7 weiblich, 6 männlich sowie 45 Kontrollen (25 weiblich, 20 männlich umfasste. Die Datenbank wird ständig durch neue Probanden aus verschiedenen Quellen erweitert. Erste Ergebnisse zeigen, dass die Verwendung von Graphen mit reduzierten Knoten und von neuen Sets von Knoten unter Einbeziehung typischer morphologischer Veränderungen des Gesichts die Klassifizierung weiter verbessert. Diese Ergebnisse ermutigen zu weiteren Untersuchungen an einer erweiterten Datenbank.

  18. Eine selbstkonsistente Carleman Linearisierung zur Analyse von Oszillatoren

    Science.gov (United States)

    Weber, Harry; Mathis, Wolfgang

    2017-09-01

    Die Analyse nichtlinearer dynamischer Schaltungen ist bis heute eine herausfordernde Aufgabe, da nur selten analytische Lösungen angegeben werden können. Daher wurden eine Vielzahl von Methoden entwickelt, um eine qualitative oder quantitative Näherung für die Lösungen der Netzwerkgleichung zu erhalten. Oftmals wird beispielsweise eine Kleinsignalanalyse mit Hilfe einer Taylorreihe in einem Arbeitspunkt durchgeführt, die nach den Gliedern erster Ordnung abgebrochen wird. Allerdings ist diese Linearisierung nur in der Nähe des stabilen Arbeitspunktes für hyperbolische Systeme gültig. Besonders für die Analyse des dynamischen Verhaltens von Oszillatoren treten jedoch nicht-hyperbolische Systeme auf, sodass diese Methode nicht angewendet werden kann Mathis (2000). Carleman hat gezeigt, dass nichtlineare Differentialgleichungen mit polynomiellen Nichtlinearitäten in ein unendliches System von linearen Differentialgleichungen transformiert werden können Carleman (1932). Wird das unendlichdimensionale Gleichungssystem für numerische Zwecke abgebrochen, kann bei Oszillatoren der Übergang in eine stationäre Schwingung (Grenzzyklus) nicht wiedergegeben werden. In diesem Beitrag wird eine selbstkonsistente Carleman Linearisierung zur Untersuchung von Oszillatoren vorgestellt, die auch dann anwendbar ist, wenn die Nichtlinearitäten keinen Polynomen entsprechen. Anstelle einer linearen Näherung um einen Arbeitspunkt, erfolgt mit Hilfe der Carleman Linearisierung eine Approximation auf einem vorgegebenen Gebiet. Da es jedoch mit der selbstkonsistenten Technik nicht möglich ist, das stationäre Verhalten von Oszillatoren zu beschreiben, wird die Berechnung einer Poincaré-Abbildung durchgeführt. Mit dieser ist eine anschließende Analyse des Oszillators möglich.

  19. No evidence for a direct effect of von Willebrand factor's ABH blood group antigens on von Willebrand factor clearance

    NARCIS (Netherlands)

    Groeneveld, D J; van Bekkum, T; Cheung, K L; Dirven, R J; Castaman, G; Reitsma, P H; van Vlijmen, B; Eikenboom, J

    BACKGROUND: One of the major determinants of von Willebrand factor (VWF) plasma levels is ABO blood group status, and individuals with blood group O have ~ 25% lower plasma levels. The exact mechanism behind this relationship remains unknown, although effects on clearance have been postulated.

  20. Charakterisierung von dotierten Zinnoxidschichten für die Detektion von Gasen durch ellipsometrische Messung der Oberflächenplasmonenresonanz

    OpenAIRE

    Fischer, Daniel

    2017-01-01

    In der vorliegenden Dissertation wird die Verbesserung von Gassensoren durch Beschichtung mit dotierten Zinnoxidschichten untersucht, wobei zur Messung der Gase die Methode der oberflächenplasmonenresonanzverstärkten Ellipsometrie (SPREE) angewendet wurde. Die vorgestellten Ergebnisse unterteilen sich dabei in drei Schritte: Herstellung der Schichtsysteme, Analyse der chemischen, strukturellen und optischen Eigenschaften, sowie die Anwendung in der SPREE Gasmessung. Die dotierten Zinnoxid...

  1. Zum 215. Gebutstag von Admiral Ferdinand Baron von Wrangell : (29. Dezember 1797 - 25. 25. Mai 1870) / Peter Krienitz

    Index Scriptorium Estoniae

    Krienitz, Peter

    2012-01-01

    Admiral Ferdinand Baron von Wrangellist tema 215. sünniaastapäeva puhul. Silmapaistavast Kirde-Siberi uurijast. Tema poliitilisest tegevusest ja elust Roela mõisas. Ferdinand Baroni poolt seatud viisil tähistati jõulusid Roelas kuni 1944. aasta lõpuni.

  2. Otto von Habsburg : III maailmasõda on läbi / Otto von Habsburg ; interv. Marianne Mikko

    Index Scriptorium Estoniae

    Habsburg, Otto von, 1912-2011

    2002-01-01

    Otto von Habsburg vastab küsimustele, mis puudutavad Euroopa konvendi presidendi teadet, et Türgi koht ei ole EL-is, Iraagi võimalikku ründamist, Hiina ja Venemaa suhteid, Tšetšeeniat, tshetsheene ja terrorismi, Venemaa, EL-i ja USA suhteid, III maailmasõda, Eesti Vabariigi tulevikku

  3. Modellierung von Quanteneffekten in einem ladungsbasierten MOS-Transistor-Modell zur Simulation von nanoskalierten CMOS-Analogschaltungen

    Directory of Open Access Journals (Sweden)

    S. Stegemann

    2009-05-01

    Full Text Available Aufgrund der fortschreitenden Miniaturisierung der Bauelemente in CMOS-Schaltungen und den dadurch erreichten Strukturgrößen nehmen quantenmechanische Effekte zunehmenden Einfluss auf die Funktion von Transistoren und damit auf die gesamte Schaltung. Unter Einbeziehung der Energiequantisierung an der Si/SiO2-Grenzfläche wird untersucht, wie sich durch eine Modifikation der Beschreibung des Oberflächenpotenzials die Inversionsladung quantenmechanisch formulieren lässt. Im Hinblick auf den Entwurf und die Simulation von CMOS-Analogschaltungen wird dazu ein ladungsbasiertes MOS-Transistor-Modell zugrunde gelegt. Die sich daraus ergebenden Veränderungen für die Kapazitäten und die Inversionsladung werden dabei für die Modellierung des quasiballistischen Drain-Source-Stromes verwendet. Dazu wird innerhalb dieses Modells ein Streufaktor berechnet, mit dem nanoskalierte MOS-Transistoren mit einer Kanallänge von unter 20 nm simuliert werden können. Ausgehend von Parametern eines CMOS-Prozesses werden mit MATLAB die Einflüsse der quantenmechanischen Effekte bei der Skalierung des Transistors analysiert.

  4. Methanation of abattoir by-products and wastes from catering services; Methanisierung von Schlachtnebenprodukten und von Grosskuechenabfaellen

    Energy Technology Data Exchange (ETDEWEB)

    Membrez [EREP S.A., Aclens (Switzerland); Schwitzguebel [Swiss Federal Inst. of Technology, Lausanne (Switzerland); Dubois; Descloux; Wellinger [Nova Energie GmbH, Ettenhausen (Switzerland); Disetti

    2000-07-01

    The purpose of this research project, which was promoted by the Swiss Energy Economy Agency, was to develop and test a specific concept for processing abattoir by-products and wastes from catering services. The system under study involves the separation of fluid and solid fractions following sterilisation. The liquid phase, which contains a large proportion of suspended organic matter, is treated by fermentation in hybrid reactors, while the solid residues are processed and then fed to pigs. The results obtained after a nine-month laboratory phase and a pilot-scale 5-month trial phase have shown to be very promising. The present technical and economic assessment of the concept has made it possible to dimension an industrial-scale plant and to determine the strong points of the concept. [German] Das Ziel dieses seitens des Eidgenoessischen Amtes fuer Energiewirtschaft unterstuetzten Forschungsprojekts bestand darin, ein spezifisches Konzept zur Aufbereitung von Schlachtnebenprodukten und von Abfaellen aus den Grosskuechen zu entwickeln und zu testen. Das vorgeschlagene System besteht darin, die Fluessig- und Feststofffraktionen der vorher sterilisierten Abfaelle zu trennen. Die sich durch ein hohes Mass an schwebenden organischen Stoffen auszeichnende Fluessigphase wird mittels Vergaerung in Hybridreaktoren verarbeitet, waehrend die festen Rueckstaende, nach Aufbereitung, fuer die Schweinefuetterung verwendet werden. Die Ergebnisse, die im Laufe von 9 Monaten Labortests und 5 Monaten Testzeit in einem Pilotmassstab erzielt wurden, haben sich als besonders vielversprechend erwiesen. Die technisch-oekonomische Bewertung dieses Konzepts hat es ermoeglicht, eine Anlage von industrieller Groesse zu dimensionieren und die Vorteile des Konzepts hervorzuheben. (orig.)

  5. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    et al 2000). CMV is a multicomponent virus with a single stranded positive sense RNA. .... sense primer 5′ ATGGACAAATCTGAATCAAC 3′ was derived from the beginning of the first 20 bases of the ..... Pappu S S, Brand R, Pappu H R, Rybicki E, Gough K H, Frenkel. M J and Niblett C L 1993 A polymerase chain reaction.

  6. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    species including cereals, fruits, vegetables and ornamentals. (Roossinck 1999). CMV is readily transmitted in a non-per- sistent manner by more than 75 species of aphids (Palukaitis et al 1992). Weed hosts function as a reservoir for the virus and serve as sources of inoculum for the development of disease epidemics.

  7. DIE SPRACHE VON "BAŠĆANSKA PLOČA" (DIE STEINTAFEL VON BAŠKA

    Directory of Open Access Journals (Sweden)

    Stjepan Damjanović

    1990-01-01

    Full Text Available In einer Mehrzahl von Abhandlungen über Bašćanska ploča berücksichtigen die Verfasser auch die Sprache, in der Regel kurz, nur in einem oder zwei Sätzen. Die größten Bemühungen sind auf die Rekonstruirung der unlesbaren Teilen gerichtet, dagegen nicht weinger interessanter lesbarer Teil regte eine Sprachanalyse selten an. Gewöhnlich wird festgestellt, daß die Tafel in der kroatischen Sprache geschrieben ist, während die philologisch gut unterrichtete Forscher vermeiden diesartige Nenunngen, indem sie das Vorhandensein der altslawischen und altkroatischen Sprachelemente entdeckten. Man versuchte noch nicht in einer Analyse sprachliche Grundschichte und darauf geschichtete Sprachelemente zu bestimmen. Nach dem ersten Eindruck wurde bestimmt, ob es sich um "die kroatische Srpache mit den Elementen der alten slawischen liturgischen Sprache" handelt oder um "die altslawische in der manche kroatische Spracheigenschaften hereingekommen sind". Die Analyse mancher Spracheinzelheiten (Halblaute und "Jat" weist auf altslawische Grundschicht hin. Der Verfasser hat sich trotzdem nicht entschieden den Fachausdruck "kroatische Redaktion des altslawischen" zu verwenden, weil er neue Analyse und neue Begriffsbestimmungen als nötig hält, wie z.B. "Redaktion", "Rezension" usw, um mit Sicherkeit sagen zu können, ob es um kroatische Redaktion des altslawischen oder um andere Formen der altslawischen - alt kroatischen Interferenz geht.

  8. Digitale Rekonstruktion von historischem Bibliotheksgut. Projektvorstellung Leibniz-Fragmente und Massendigitalisierung von Flachware

    Directory of Open Access Journals (Sweden)

    Matthias Wehry

    2017-12-01

    Full Text Available Der Universalgelehrte Gottfried Wilhelm Leibniz verwendete eine besondere Form der Wissensordnung: Teile seiner Manuskripte und Arbeitspapiere, z.B. Abschriften und Exzerpte, wurden von ihm zerschnitten und in einem so genannten „Zettel-Schrancken“, einem großen Zettelkasten, geordnet. Im vorgestellten Projekt wurde ein automatisiertes virtuelles Assistenzsystem erarbeitet, um die ursprünglichen Zusammenhänge der Notata im Augenblick ihrer Entstehung wiederherzustellen. Das Ergebnis des Projektes ist ein innovatives Massenverfahren zum Puzzeln und Scannen historischer handschriftlicher Dokumente. The polymath Gottfried Wilhelm Leibniz used a specific technique for knowledge organisation: He cut parts of his manuscripts and working papers, e.g., copies and excerpts, in pieces and filed them systematically in a so called “Zettel-Schrancken”, a hugh slipbox. In the project presented in this paper, an automated virtual reconstruction of the notes’ initial context at the moment of origin was developed. The result of the project is an innovative mass processing method for puzzling and scanning historical handwritten documents

  9. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews

    Directory of Open Access Journals (Sweden)

    Haryuni Haryuni

    2016-09-01

    Full Text Available Vanilla (Vanilla planifolia Andrews is one of the important exported commodities in Indonesia. Indonesia is one of top five major vanilla exporters in the world, that produce the high quality of Indonesian vanilla with high vanillin content (2.75%. The aims of this research were to determine the effects of dose binukleat Rhizoctonia (BNR and phosphorus as well as the interaction of the nitrate reductase activity (NRA and chlorophyll of the vanilla seedling (Vanilla planifolia Andrew. Method in this research used completely randomized factorial design, by involving two factors (dose of BNR inoculation and Phosphor. The first factor is without inoculation and inoculation BNR (M0, M1, M2, M3 wich consists of (0,5, 10, 15 g/polybag, the second factor is the dose of phosphorus fertilizer (P0, P1, P2, P3 which consists of (0, 3, 6, 9 g/polibag. The results showed that the inoculation dose of BNR and doses of phosphorus not significant and lower levels of NRA and chlorophyll while the interaction dose of BNR and phosphorus significantly and increase levels of NRA and chlorophyll of vanilla seedling. Nitrate Reductase Activity and chlorophyll has important role in metabolism process as a plant growth indicator.How to CiteHaryuni, H., & Dewi, T. S. K. (2016. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews. Biosaintifika: Journal of Biology & Biology Education, 8(2, 141-147.

  10. Maaleht soovitab : Anu Tali dirigeerib Vanemuises "Toscat". Vivaldi, Casanova ja Veneetsia. "Uinuv kaunitar" Vanemuises. Andrew Lloyd Webberi juubelikontserdid. Pärimusmuusika lõiluspidu

    Index Scriptorium Estoniae

    2008-01-01

    27. sept. juhatab Anu Tali Vanemuise teatris Mikk Mikiveri lavastatud ja Ervin Õunapuu taastatud Puccini ooperilavastust "Tosca". Barokkansambel Corelli Consort ja Raivo Järvi esitavad kava "Vivaldi, Casanova ja Veneetsia" 15. okt. Maardu mõisa muusikasalongis, 18. okt. Pärnus sarjas "Café Grand muusikasalong" ja 19. okt. Eesti Teaduste Akadeemia majas sarjas "Toompea muusikasalong". Vanemuisees esietendub 4. okt. Pjotr Tshaikovski ballett "Uinuv kaunitar". Tallinnas Saku Suurhallis toimuvad 18. okt. briti muusikalihelilooja Andrew Lloyd Webberi 60. sünnipäevale pühendatud juubelikontserdid. Viljandi Pärimusmuusika Aidas peetakse 10.-11. okt. "Pärimusmuusika lõikuspidu"

  11. DEEP VEIN THROMBOSIS IN PATIENT WITH VON WILLEBRAND DISEASE

    Directory of Open Access Journals (Sweden)

    V. A. Elykomov

    2016-01-01

    Full Text Available Objective: to identify the possible factors of thrombogenic risk and ways of its prevention in patients with von Willebrand disease.Case description. Patient X., 42 years old, who suffers from von Willebrand disease type 3 with 5-years of age. Asked on reception to the traumatologist in the polyclinic of the Regional Hospital with pain in the left hip joint. Recommended planned operative treatment in the Altai Regional Clinical Hospital. Preoperative preparation included the infusion of concentrate of von Willebrand factor and coagulation factor VIII. Operation – cement total arthroplasty of the left hip joint. In the postoperative period analgesic treatment, elastic compression of the lower extremities, iron supplements, also conducted infusion of concentrate of von Willebrand factor and coagulation factor VIII for 20 days and thromboprophylactic with dabigatran. On the 3rd day after the operation the patient revealed deep vein thrombosis of the femoral segment (floating clot.Results. The patient was operated for emergency indications in the Department of endovascular surgery – installation of venous cava filter “Volan”. Dabigatran is cancelled, appointed clexane for 3 months. In our clinical example the patient lacked risk factors of pulmonary embolism as obesity, age, smoking, prolonged immobilization, estrogen therapy. Overdose of factor VIII were not observed – the level of factor did not exceed 135 % on transfusions. At the same time, the patient was found polymorphisms in the genes ITGA2, FGB, MTHFR, MTR – heterozygote, MTRR – mutant homozygote, which may indicate the genetic factors of thrombogenic risk. Also a significant risk factor was massive surgical intervention (total hip replacement. Despite preventive measures (elastic compression, thromboprophylactic dabigatran, early activation we cannot to avoid thrombotic complications.Conclusion. This article presents a case demonstrating a thrombotic complication in patients

  12. [Die baltischen Kapitulationen von 1710. Kontext - Wirkungen - Interpretationen. Hrsg. von Karsten Brüggemann, Mati Laur und Pärtel Piirimäe] / Maretn Seppel

    Index Scriptorium Estoniae

    Seppel, Marten, 1979-

    2015-01-01

    Arvustus: Die baltischen Kapitulationen von 1710. Kontext - Wirkungen - Interpretationen. Hrsg. von Karsten Brüggemann, Mati Laur und Pärtel Piirimäe. (Quellen und Studien zur baltischen Geschichte. Bd. 23). Köln [etc.] : Böhlau, 2014

  13. Jakob von Uexküll : tuleb hakata taas koos oma planeediga elama / Jakob von Uexküll ; interv. Andris Feldmanis

    Index Scriptorium Estoniae

    Uexküll, Jakob von

    2007-01-01

    Jakob von Uexküll vastab küsimustele, mis puudutavad postkapitalismi, kapitalismi vajakajäämisi, praegust kapitalismi, postkapitalismi n.-ö. filosoofilist süsteemi, samuti kohtumist president Toomas Hendrik Ilvesega. J. von Uexküll esitles Eesti presidendile Maailma Tuleviku Nõukogu (World Future Council) projekti

  14. Entwicklung von in situ Nachweisverfahren für die humanpathogenen Lebensmittelkontaminanten Listeria, Salmonella und Campylobacter, sowie phylogenetische Analysen der Gattung Listeria und Feindifferenzierung von L. monocytogenes

    OpenAIRE

    Schmid, Michael Wilhelm

    2007-01-01

    In dieser Arbeit wurden rRNS-gerichtete Gensonden zur spezifischen in situ Detektion der pathogenen Mikroorganismen Salmonella, Campylobacter und Listeria konstruiert. Durch vergleichende Sequenzanalyse verschiedener Gene konnte die Evolution der Virulenz der Gattung Listeria aufgeklärt werden. Zudem gelang es, anhand phylogenetischer Analysen von Virulenzgenen innerhalb der Art L. monocytogenes drei Entwicklungslinien zu ermitteln. Zur Feindifferenzierung von L. monocytogenes wurden weiterhi...

  15. Von Willebrand's disease in the German shepherd dog : clinical communication

    Directory of Open Access Journals (Sweden)

    R.G. Lobetti

    2000-07-01

    Full Text Available Two litters of Germanshepherd dogs were evaluated for a haemorrhagic tendency that was characterised by excessive bleeding from the umbilicus at birth, haemorrhage and haematoma formation at vaccination, excessive bruising, and lameness due to haemarthrosis. Platelet counts, clotting times and Von Willebrand's factor (VWF assays were assessed in all dogs. Factor VIII determination was performed in 1 puppy and its parents. Based on the clotting times and VWF assay, 6 puppies (4 male and 2 female showed type I Von Willebrand's disease (VWD, 5 (4 male and 1 female possible type II VWD, and 4 were unaffected. One puppy with possible type II VWD had very low factor VIII activity; its sire had a normal factor activity, whereas the dam was in the low-normal range. This article reports type I and possible type II VWD in 2 related litters of German shepherd dogs, the latter being rare in German shepherd dogs.

  16. Doença de von Willebrand e anestesia

    OpenAIRE

    Barbosa, Fabiano Timbó; Cunha, Rafael Martins da; Barbosa, Luciano Timbó

    2007-01-01

    JUSTIFICATIVA E OBJETIVOS: A doença de von Willebrand ocorre devido à mutação no cromossomo 12 e é caracterizada por deficiência qualitativa ou quantitativa do fator de von Willebrand. A diversidade de mutações leva ao aparecimento das mais variadas manifestações clínicas possibilitando a divisão dos pacientes em vários tipos e subtipos clínicos. A coagulopatia se manifesta basicamente através da disfunção plaquetária associada à diminuição dos níveis séricos do fator VIII coagulante. O objet...

  17. Von eingebetteten Systemen zu Cyber-Physical Systems

    Science.gov (United States)

    Wedde, Rorst F.; Lehnhoff, Sebastian; Rehtanz, Christian; Krause, Olav

    Das Hauptanliegen des Papiers ist, ein Paradigma für Probleme mit neuartigen Integrationsanforderungen für Forschung und Entwicklung in verteilten eingebetteten Echtzeitsystemen zu motivieren und vorzustellen, nämlich den Begriff Cyber-Physical Systems. Bei einer in letzter Zeit stark zunehmenden Anzahl von Realzeitanwendungen können ohne die Berücksichtigung solcher Forderungen keine praktisch brauchbaren Lösungen erwartet werden. Einige Anwendungsfelder werden angesprochen. Im Einzelnen werden dann für Elektroautos, die mit erneuerbaren Energien betrieben werden sollen, einerseits die Management-, verteilte Verhandlungs- und Verteilungsprobleme der benötigten Energie in einem bottom-up Ansatz gelöst. Andererseits wird als Teil unserer Projektarbeit die Bereitstellung von Reserveenergie für den allgemeinen Bedarf durch Autobatterien vorgestellt. Es zeigt sich, dass dies effizienter und wesentlich kurzfristiger in unserem verteilten Vorgehen geschehen kann als in traditionellen Verfahren.

  18. Up-to-date der Betreuung von Chorionkarzinompatientinnen - ein Fallbeispiel

    Directory of Open Access Journals (Sweden)

    Söhnchen N

    2010-01-01

    Full Text Available Das Chorionkarzinom tritt in Europa bei einer von 30.000 Schwangerschaften auf. Betroffen sind vor allem junge und ältere Mütter sowie Patientinnen mit einer positiven Anamnese für Trophoblasterkrankungen. Kardinalsymptome sind persistierende vaginale Blutungen nach der Geburt. Bei Diagnosestellung liegen häufig bereits pulmonale Metastasen vor. In der Behandlung spielt die Chirurgie nur eine untergeordnete Rolle. Der rasche und ununterbrochene Beginn einer Chemotherapie ist hingegen entscheidend. Oft reicht eine Monochemotherapie aus. Hochrisikopatienten werden hingegen mit einer Kombinationschemotherapie (EMA/CO behandelt. Das Ansprechen auf diese Therapie ist ausgesprochen gut. Wichtig sind die weiteren Kontrollen der Patientinnen mithilfe von biochemischen Markern und radiologischer Diagnostik. Kinder betroffener Frauen sollten ebenfalls kontrolliert werden, da es auch bei ihnen zu einer intrauterinen Metastasierung gekommen sein kann. Wir stellen das diagnostische und therapeutische Vorgehen anhand eines aktuellen Fallbeispiels aus unserer Klinik dar.

  19. Diurnal variation of von Willebrand factor in plasma

    DEFF Research Database (Denmark)

    Timm, Annette; Fahrenkrug, Jan; Jørgensen, Henrik L

    2014-01-01

    thoroughly tested. OBJECTIVES: We examined whether VWF antigen and VWF activity in plasma display a diurnal profile in healthy young males, and whether such variation is related to changes in release or elimination. METHODS: Plasma from 20 healthy young males was collected at 9 time-points over 24 h (15 h......BACKGROUND: Quantitation of von Willebrand factor (VWF) in plasma is a central element in assessing von Willebrand disease (VWD). VWF activity is known to vary, which has partly been ascribed to biological and preanalytical variation. However, a possible diurnal expression of VWF has not been...... of light and 9 h of darkness); the plasma concentration of melatonin was used as an internal control to confirm the normal 24-h rhythms of the individual participants. RESULTS: The data, analyzed by rhythmometric statistics, revealed a significant variation (P = 0.02) and total amplitude of 22.6% in VWF...

  20. Rezension von: Gabriele Dietze: Weiße Frauen in Bewegung. Genealogien und Konkurrenzen von Race- und Genderpolitiken. Bielefeld: transcript Verlag 2013.

    Directory of Open Access Journals (Sweden)

    Philipp Dorestal

    2014-03-01

    Full Text Available Gabriele Dietze zeichnet das Verhältnis der Kategorien Race und Gender innerhalb der US-amerikanischen Geschichte von der Mitte des 19. Jahrhunderts bis zur Präsidentschaftswahl von Barack Obama nach. Dabei demonstriert sie anhand von zentralen Figuren der weißen Frauenbewegung deren ambivalente Positionen, die oftmals für progressive Inhalte wie das Eintreten für Frauenrechte stehen, gleichzeitig aber dann Anliegen von African Americans nicht artikulieren oder gar zum Schweigen bringen. Ebenso zeigt Dietze mithilfe von Texten einiger schwarzer Autor_innen sowie anhand berühmter Gerichtsprozesse, dass schwarze Emanzipation nicht notwendigerweise mit feministischen Positionen einhergehen musste, sondern sich vielmehr eine Konkurrenzsituation zwischen Race und Gender entspann.

  1. Oberflächenmodifizierung von Wirkstoffen zur Inhalation

    OpenAIRE

    Stank, Katharina

    2014-01-01

    In der vorliegenden Arbeit wird die Anwendung des „dry particle coating“ für die Oberflächenmodifizierung von mikronisiertem Salbutamolsulfat zur Inhalation beschrieben. Bei diesem Verfahren wird der Wirkstoff durch einen mechanischen Energieeintrag mit einem Hilfsstoff verbunden, um dadurch Veränderungen der Oberflächeneigenschaften zu erzielen. Der Einfluss der Oberflächenmodifizierung wurde sowohl für trägerfreie Pulverformulierungen als auch für suspensionsbasierte Dosieraerosole untersuc...

  2. Von Krahl klaarib piraadina asju euroliidus / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2006-01-01

    Von Krahli Teatri selle hooaja eelviimane esietendus "Europiraadid" on 17. mail Düsseldorfis, koostöös Saksamaa teatrirühmaga Showcase Beat Le Mot. (Varem on tehtud sama teatrirühmaga koostöös "Piraadid", mida mängiti nii Eestis kui Saksamaal). Eesti poole pealt teevad kaasa Juhan Ulfsak, Taavi Eelmaa, Maarja Jakobson ja Rain Tolk. Sakslaste poole pealt on tegijad Nikola Duric, Thorsten Eibler, Dariusz Kostyra ja Veit Spengler

  3. Modellbildung und Realisierung von holografischen Aufprojektionsflächen

    OpenAIRE

    Schmiedchen, Marc

    2006-01-01

    Konventionelle Projektionssysteme sind systembedingt auf gute Streueigenschaften des Materials angewiesen, auf das projiziert wird. Dies bewirkt bei Vorhandensein von Umgebungslicht eine dramatische Reduktion der erreichbaren Kontrastverhältnisse und der Farbsättigung; typische Lichtverhältnisse in einem abgedunkelten Konferenzraum sind bereits ausreichend, um das verbleibende Kontrastverhältnis auf Werte unter 20:1 zu drücken. In dieser Arbeit wird ein Ansatz präsentiert, diese Einschränkung...

  4. Johann Baptist von Schweitzer: the queer Marx loved to hate.

    Science.gov (United States)

    Kennedy, H

    1995-01-01

    Despite his conviction on a morals charge involving a boy, the early German Social Democrat Johann Baptist von Schweitzer went on to have a successful political career. His life furnishes the context to present remarks by his political opponents Marx and Engels, which reveal their deep-seated homophobia. It is pointed out that this has been glossed over by the translations of the recently published Marx/Engels Collected Works. Some remarks on boy-love and anarchism are appended.

  5. Gender-Dynamiken in der Rekonstruktion von Bildungsprozessen in Medienprojekten

    Directory of Open Access Journals (Sweden)

    Barbara Stauber

    2007-11-01

    Full Text Available Dieser Beitrag basiert auf Erfahrungen aus einem aktuellen Praxisforschungsprojekt des tifs (Tübinger Institut für frauenpolitische Sozialforschung. Es wurde in Auftrag gegeben von der Landesstiftung Baden-Württemberg zur Evaluation ihres Programms «Jugend und verantwortungsvolle Mediennutzung», mit dem sie medienpädagogische Projekte in unterschiedlichen Jugendhilfe-Kontexten (Projekte der offenen und der verbandlichen Jugendarbeit, der Hilfen zur Erziehung, der Jugendberatung etc. förderte.

  6. Von Neuman representations on self-dual Hilbert W* moduli

    International Nuclear Information System (INIS)

    Frank, M.

    1987-01-01

    Von Neumann algebras M of bounded operators on self-dual Hilbert W* moduli H possessing a cyclic-separating element x-bar in H are considered. The close relation of them to certain real subspaces of H is established. Under the supposition that the underlying W*-algebra is commutative, a Tomita-Takesaki type theorem is stated. The natural cone in H arising from the pair (M, x-bar) is investigated and its properties are obtained

  7. Osteoporose bei Spondylitis ankylosans - Einfluß von Lebensgewohnheiten

    Directory of Open Access Journals (Sweden)

    Aglas F

    2004-01-01

    Full Text Available Krankheitsbedingte Artefakte können bei der SpA (Spondylitis ankylosans; Mb. Bechterew die Sensitivität einer Knochendichtemessung im Lumbalbereich beeinträchtigen. Das bei dieser rheumatischen Erkrankung bekannte Osteoporoserisiko ist neben genetischen Faktoren und Entzündungsmechanismen auch von verschiedenen exogenen Einflüssen abhängig. An 47 SpA-Patienten wurde mittels DEXA eine vergleichende Knochendichtemessung (BMD an der Hüfte (Schenkelhals und Ward'sches Dreieck sowie im Bereich der Wirbelsäule (L1-L4 vorgenommen. Zusätzlich erfolgte eine Erhebung der Lebens-Ernährungsgewohnheiten der SpA-Patienten in bezug auf die BMD, um exogene Einflüsse erfassen zu können. Die Knochendichtemessungen ergaben an der LWS wesentlich häufiger eine BMD im Normbereich als am proximalen Femur. Besonders deutliche Unterschiede traten im höheren Lebensalter auf, bei dem aufgrund von Kalzifizierungsvorgängen und Syndesmophyten an der LWS fälschlicherweise eine Dichtezunahme vorgetäuscht wird. Es kann daher bei SpA empfohlen werden, die wesentlich sensitivere Dichtemessung am Schenkelhals durchzuführen. Die über einen Zeitraum von 3 Jahren beobachteten, signifikant erhöhten, medianen CRP-Spiegel zeigen, daß eine permanente Aktivierung von Entzündungsprozessen bei SpA auch einen negativen Faktor betreffend des Knochenmasseverlustes darstellt. Die Analyse der Lebensgewohnheiten ergab, daß SpA-Patienten mit normaler BMD ausnahmslos regelmäßig kalziumreiche Nahrungsmittel zu sich nehmen; bei verminderter BMD wurde in der Mehrheit ein fehlender Konsum an Milchprodukten beobachtet. Leider war auch mit abnehmender BMD eine Verminderung der bei SpA empfohlenen Bewegungsübungen festzustellen. Aufgrund der Resultate ergibt sich eine generelle Empfehlung zu regelmäßigen Bewegungsübungen plus Osteoporosediät bei allen Bechterew-Patienten.

  8. Optimierung der Osteoporosetherapie - Kombination von Alfacalcidol und Alendronat

    Directory of Open Access Journals (Sweden)

    Dambacher MA

    2003-01-01

    Full Text Available Die Osteoporose mit dem primären "Outcome"-Problem der Frakturen ist eine multifaktorielle Erkrankung, charakterisiert durch eine niedere Knochendichte (BMD, eine verminderte Knochenqualität sowie durch neuromuskuläre Defizite und ein dadurch erhöhtes Sturzrisiko. In unseren wachsenden Bestrebungen, die BMD zu erhöhen und die Wirkung mit kontinuierlich verbesserten Techniken zu messen, wurden von den behandelnden Ärzten andere wichtige pathologische Faktoren, wie z. B. die Knochenqualität, oftmals unterbewertet. Die besonders relevanten Faktoren bei älteren Patienten, nämlich die reduzierte Muskelleistung sowie Gleichgewichtsstörungen und das daraus resultierende erhöhte Sturzrisiko, wurde nahezu vollständig vernachlässigt. Die Korrelationen zwischen den Organen Muskel und Knochen, welche eine Einheit bilden, sind erst jetzt wieder im Fokus der modernen Forschung. Die Basis einer zukünftigen, optimalen Therapie zur Prävention der klinisch besonders relevanten, nicht-vertebralen Frakturen ist sowohl die Verbesserung der Knochenfestigkeit als auch die Reduktion von Stürzen. Die Kombination von Alfacalcidol und Alendronat garantiert eine optimale Wirkung auf die Knochenfestigkeit basierend auf den beiden komplett unterschiedlichen und sich ergänzenden Wirkungsmechanismen auf den Knochen. Der Hauptsynergismus liegt in der Tatsache begründet, daß die duale Wirkung von Alfacalcidol auf Knochen und Muskeln die Muskelleistung und die neuromuskuläre Koordination bei älteren osteoporotischen Patienten verbessert, so daß dadurch Stürze und nicht-vertebrale Frakturen vermehrt reduziert werden können.

  9. Zum Verhältnis von Nachhaltigkeit, Gerechtigkeit und Bildung

    OpenAIRE

    Jürgen Deuschle; Marco Sonnberger

    2009-01-01

    Gerechtigkeit ist eine der Voraussetzungen für Nachhaltigkeit. Eine der wichtigsten Aufgaben der Bildung ist deshalb die Vermittlung von Gerechtigkeitsstandards. Was aber ist Gerechtigkeit? Unter Bezugnahme auf philosophische Betrachtungen sowie auf Forschungsergebnisse aus Soziologie, Sozialpsychologie und Neurobiologie kommt die vorliegende Untersuchung zu dem Ergebnis, das Gerechtigkeit eine Synthese aus Verstand, Vernunft und Gefühl ist, die sich auf die Freiheitsbeschränkung individuelle...

  10. Untersuchung zur Fixierung von Knorpelgewebe mittels laserinduzierter Koagulation

    OpenAIRE

    Hoffmann, Philipp

    2012-01-01

    Philipp Hoffmann Untersuchung zur Fixierung von Knorpelgewebe mittels laserinduzierter Koagulation Aus der Chirurgischen Tierklinik der Veterinärmedizinische Fakultät der Universität Leipzig, angefertigt im Forschungszentrum für Medizintechnik und Biotechnologie GmbH, Bad Langensalza Eingereicht im Januar 2012 97 Seiten, 59 Abbildungen, 9 Tabellen, 318 Literaturangaben 10 Seiten Anhang Schlüsselwörter: Laser, Löten, Knorpelgewebe, Zugfestigkeit, thermische Schäden Gelenkerk...

  11. Expression und Funktion Apoptose modulierender Gene von Orthopockenviren

    OpenAIRE

    Witkowski, Peter

    2010-01-01

    Dipl.-Ing. Peter Witkowski Abstract zur Dissertation „Expression und Funktion Apoptose regulierender Gene von Orthopockenviren“ Nach der Eradikation des humanpathogenen Variolavirus durch das WHO-Impfprogramm im 20. Jahrhundert treten andere Orthopockenviren (OPV) gehäuft als Erreger humaner Infektionen in Erscheinung. Weniger gefährlich als die humanen Pocken, können Kuhpocken- oder Vacciniaviren dennoch Menschen infizieren und zu schweren Komplikationen führen. OPV besitzen Erbinformationen...

  12. A von Neumann algebra approach to quantum metrics

    OpenAIRE

    Kuperberg, Greg; Weaver, Nik

    2010-01-01

    We propose a new definition of quantum metric spaces, or W*-metric spaces, in the setting of von Neumann algebras. Our definition effectively reduces to the classical notion in the atomic abelian case, has both concrete and intrinsic characterizations, and admits a wide variety of tractable examples. A natural application and motivation of our theory is a mutual generalization of the standard models of classical and quantum error correction.

  13. Bible and Philology: Gerhard von Rad regarding the Wisdom Books

    OpenAIRE

    Lase, Norma Haydeé

    2015-01-01

    Theology, through its history, has always been related to Philology, because its source is the Holy Scriptures. This reason has stimulated my further consideration of the exegeta Gerhard von Rad “Wisdom in Israel” a “symbol” of modern interest for the Wisdom books. Inserted in the philologic German trend of the history of tradition and history of editing and forms, it is opposed to positivists interpretation and installs a new comprehension of the OT traditions. Its hermeneutica, without dete...

  14. La esclavitud norteamericana vista por Lars von Trier

    Directory of Open Access Journals (Sweden)

    Alberto PRIETO ARCINIEGA

    2009-03-01

    Full Text Available El eje de la comunicación corresponderá a la película Manderley, pero se tendrá en cuenta, como precedente, la película Dogville y el texto de Jean Paulhan, La bonheur dans l´esclavage, que inspiró a Lars von Trier para la elaboración de su propio y peculiar guión.

  15. Fibrolipoma en un paciente con la enfermedad de Von Recklinghausen

    Directory of Open Access Journals (Sweden)

    Orlando L Rodríguez Calzadilla

    2000-08-01

    Full Text Available Se presenta el caso de un paciente, con antecedente de padecer de la enfermedad de Von Recklinghausen, el cual fue valorado y su conducta terapéutica fue diferida, por sospechar la presencia de un tumor neurofibromatoso. El paciente se remitió a la consulta externa de nuestro servicio y una vez concluido sus estudios, se realizó su tratamiento quirúrgco. El paciente no presentó complicaciones transoperatorias y posoperatorias; su estadía fue de 3 días. Anatomía patológica informó la presencia de un fibrolipoma (neoplasia mesodérmica. El control a los 3 años de operado mostró un paciente asintomático y sin recidiva local. En la literatura médica revisada no se informaron otros casos similares de pacientes con la presencia de un fibrolipoma en la enfermedad de Von Recklinghausen.The case of a patient who suffers from Von Recklinghausen´s disease is reported. The patient was evaluated and his therapeutic conduct was deferred because the presence of a neurofibromatous tumor was suspected. The patient was referred to the outpatient department of our service and once the studies were concluded, he underwent surgical treatment. The patient had no transoperative or postoperative complications. He stayed in hospital only 3 days. The Department of Pathological Anatomy reported the presence of a fibrolipoma (mesodermic neoplasia. 3 years later the patient proved to be asymptomatic and without local relapse. Similar cases of patients with a fibrolipoma in Von Recklinghausen´s disease are not reported in the reviewed medical literature.

  16. Neue Konzepte zur Reinigung von Siliciumoberflächen

    OpenAIRE

    Leopold, Alexander

    2007-01-01

    In dieser Arbeit wurde eine modifizierte einstufige RCA-Reinigung entwickelt. Die Untersuchungen mit den besonders kritischen Metallen bei der Wafer- und Halbleiterbauelementherstellung Al, Ca, Fe, Ni und Zn zeigten deutliche Vorteile bei der Reinigung gegenüber herkömmlichen Methoden. Durch die Verwendung von Komplexbildnern konnte eine Abscheidung der Metalle auf die Siliciumoberfläche verhindert bzw. stark reduziert werden. Während bei den bekannten Reinigungsverfahren mehrere Schritte für...

  17. Semiparametric Bernstein–von Mises for the error standard deviation

    OpenAIRE

    de Jonge, René; van Zanten, Harry

    2013-01-01

    We study Bayes procedures for nonparametric regression problems with Gaussian errors, giving conditions under which a Bernstein–von Mises result holds for the marginal posterior distribution of the error standard deviation. We apply our general results to show that a single Bayes procedure using a hierarchical spline-based prior on the regression function and an independent prior on the error variance, can simultaneously achieve adaptive, rate-optimal estimation of a smooth, multivariate regr...

  18. Põlvkondade triloogia Von Krahli teatris / Hedi-Liis Toome

    Index Scriptorium Estoniae

    Toome, Hedi-Liis

    2010-01-01

    Von Krahli teatri lavastustest: William Shakespeare "Kuningas Lear", mängib Viljandi Kultuuriakadeemia 8. lend, lavastaja Peeter Jalakas (esietendus 30. jaan. 2010); "The End" - autorid, lavastajad ja näitlejad: Mari Abel, Tiina Tauraite, Riina Maidre, Erki Laur, Taavi Eelmaa, Juhan Ulfsak (esietendus 19. märts 2010); "Mehed lumes" Peter Freucheni jutustuse "Olavi lugu" ainetel lavastanud Mart Koldits ja Kristjan Sarv, kes ka ise mängivad (17. aprill 2010)

  19. Weiterverarbeitung von WPC für technische Anwendungen

    OpenAIRE

    Clauß, Brit; Gehde, Michael; Nendel, Klaus; Eichhorn, Sven

    2010-01-01

    Die im Folgenden vorgestellten Arbeiten sollen zur Erweiterung der Einsatzmöglichkeiten von WPC-Bauteilen beitragen, wobei die Untersuchung möglicher Fügetechnologien und ein praxisnahes Anwendungsbeispiel die Schwerpunkte bilden. Mittels Heizelement- und Vibrationsschweißens ist es gelungen, WPC-Bauteile sowohl mit gleichen Materialien als auch mit dem jeweiligen reinen Matrixmaterialien in Mischbauweisen zu verbinden. Deutlich werden hierbei verfahrensbedingte Einflüsse der Temperaturen...

  20. Baron von Zach's business relations with the Munich entrepreneur Joseph von Utzschneider (German Title: Geschäftsbeziehungen des Barons von Zach zu dem Münchner Unternehmer Joseph von Utzschneider)

    Science.gov (United States)

    Schneider, Ivo

    The relationship between the astronomer von Zach on the one side and the entrepreneur Joseph von Utzschneider and his partner Georg von Reichenbach on the other dates presumably from the year 1807 when Zach spent two months in Munich. Already in the same year Zach had ordered an instrument for himself and began to solicit business for the institute of Reichenbach, Utzschneider, and Liebherr, which was founded in 1804. One of the clients canvassed by Zach was the director of the observatory in Naples Zuccari. Zuccari had ordered the whole equipment for the new observatory from this institute in 1813. The instruments for Naples, which were completed in 1814, were sent accompanied by Reichenbach by land and sea to their destination where Reichenbach supervised their setup. At that time Reichenbach had separated from Utzschneider who kept the optical institute in Benediktbeuern with his new partner Joseph von Fraunhofer whereas Reichenbach became owner of the mathematical-mechanical institute in Munich. For personal and economical reasons Utzschneider began soon after to produce not only optical glass but also optical devices similar to those offered by Reichenbach. As soon as two institutes in Munich competed against each other on the market for sophisticated geodetical and astronomical instruments Zach sided with Utzschneider. Zach's main professional argument for this decision was that both competitors got the optical glass for their instruments from Utzschneider's optical institute in Benediktbeuern. This meant that Utzschneider had first choice and so the optical part of his instruments could be considered as better than that of Reichenbach`s instruments. Zach's role as an agent in Italy and France for the sale of products coming from Utzschneider's manufactories is highlighted by three of Zach's letters to Utzschneider from 1817 and 1818, two of which are reproduced here for the first time.

  1. Utilizing NASA Earth Observations to Assess Impacts of Hurricanes Andrew and Irma on Mangrove Forests in Biscayne Bay National Park, FL

    Science.gov (United States)

    Kumar, A.; Weber, S.; Remillard, C.; Escobar Pardo, M. L.; Hashemi Tonekaboni, N.; Cameron, C.; Linton, S.; Rickless, D.; Rivero, R.; Madden, M.

    2017-12-01

    Extreme weather events, such as hurricanes, pose major threats to coastal communities around the globe. However, mangrove forests along coastlines act as barriers and subdue the impacts associated with these catastrophic events. The Biscayne Bay National Park mangrove forest located near the city of Miami Beach was recently affected by the category four hurricane Irma in September of 2017. This study analyzed the impact of Hurricane Irma on Biscayne Bay National Park mangroves. Several remote sensing datasets including Landsat 8 Operational Land Imager (OLI), Sentinel 2-Multi Spectral Imager (MSI), PlanetScope, and aerial imagery were utilized to assess pre-and post-hurricane conditions. The high-resolution aerial imagery and PlanetScope data were used to map damaged areas within the national park. Additionally, Landsat 8 OLI and Sentinel-2 MSI data were utilized to estimate changes in biophysical parameters, including gross primary productivity (GPP), before and after Hurricane Irma. This project also examined damages associated with Hurricane Andrew (1992) using historical Landsat 5 Thematic Mapper (TM) data. These results were compared to GPP estimates following Hurricane Irma and suggested that Hurricane Andrew's impact was greater than that of Irma in Biscayne Bay National Park. The results of this study will help to enhance the mangrove health monitoring and shoreline management programs led by officials at the City of Miami Beach Public Works Department.

  2. Ueber die bildung von lymphzellen bei rhinocricus padbergii (Diplopoda

    Directory of Open Access Journals (Sweden)

    Rudolf Barth

    1968-01-01

    Full Text Available In den aktiven Amoebozyten der Haemolymphe des Diplopoden Rhinocricus padbergii finden sich keine Mitosen oder andere Anzeichen von Zellvermehrung. In Haeutungsstadien findet sich im hinteren Winkel der Doppelsegmente eine Hypodermiszone, von deren Zellen einige amitotisch junge Amoebozyten hervorbringen. Nach der amitotischen Teilung bildet der distale Tochterkern den zukuenftigen Hypodermiszellkern; der proximale teilt sich nochmals amitotisch beide produkte dieses Vorganges umgeben sich mit einem Teil des Protoplasmakoerpers und verlassen, die Basalmembran durchbrechend, das Epithel. Sie bilden neue Amoebozyten. Waehrend alle Organe durch eine Bindegewebsmembran gegen die Haemolymphe abgegrenzt sind, findet sich in dem Raum hinter der Intersegmentalmembran der Segmente keine solche Membran. Diese fasert sich unmittelbar hinter der Intersegmentalmembran schichtenweise auf und bildet eine gitterfoermige Sperre, so dass keine aelteren phagozytierenden Amoebozyten in den hinteren Raum der Segmente gelangen. Durch Muskelkontraktion kann der Raum verkleinert werden, wodurch die jungen Amoebozyten in die Hauptleibeshoehle transportiert werden. Es wird vermutet, dass die Bindegewebsmembran im Sinne von Hoyle (1952 und Twarog und Roeder (1956 die Organe vor ploetzlichen Veraenderungen der Jonenkonzentration und des osmotischen Wertes der Haemolymphe schuetzt; die amoebozytogene Hypodermis ist aus diesem System ausgeschlossen, so dass die jungen Amoebozyten die erwaehnten Schwankungen in der Zusammensetzung der Haemolymphe begleiten koennen.

  3. Plasma product treatment in various types of von Willebrand's disease.

    Science.gov (United States)

    Berntorp, E

    1994-01-01

    Four different virus-inactivated factor VIII concentrates (Haemate P, Behring; Profilate, Alpha, FVIII-VHP-vWF, CRTS), near-pure von Willebrand factor (Facteur Willebrand, CRTS) or one recombinant FVIII preparation (Recombinate, Baxter) were given to one or more patients with different forms of von Willebrand's disease. Duke bleeding time, VIII:C, vWF:Ag, RC of activity, and the multimeric pattern of plasma vWF were monitored. Both Duke bleeding time and the multimeric pattern were normalized after treatment with Haemate P, FVIII-VHP-vWF, or Facteur Willebrand, and to a lesser extent after Profilate. Except in one case, the reduction in bleeding time lasted longer after Haemate P than after the other concentrates. Recombinate had no effect on primary hemostasis, and the half-life of VIII:C was very short. If prompt hemostasis is required, and when pharmacological correction of the defect is impossible, we recommend a concentrate containing both FVIII and the full complement of vWF multimers, but for prophylactic treatment pure von Willebrand factor may be used.

  4. Die Problematik der Inklusion von Religion in das Schulsystem

    Directory of Open Access Journals (Sweden)

    Doris Lindner

    2016-12-01

    Full Text Available ENGLISH: This paper wants to point out, what it might mean to include religion in educational systems. The diversity of religion is a fact insociety and schools today. However, the issue of the proper role of religion in public schools continues to be a subject of greatcontroversy. So it is with inclusion in education, which has taken firm root in many school systems so far. Though, the relationshipof religion to inclusion in the public school is little well known, because schools have failed to recognize the problem ofreligious inclusion, while focusing on other forms of racial, gendered and socio-economic forms of exclusion and inclusion. DEUTSCH: Unter den Fragen, die Schule heute im Besonderen herausfordern, nimmt diejenige nach der Inklusion von Religion zweifelsohneeine Sonderstellung ein. Geht es um die Verhandlung von Differenz in der Migrationsgesellschaft, werden sowohl der Inklusionsbegriffals auch Religion in ihrer Vielfalt in unterschiedlichen Diskursen prominent erörtert. Dabei bleibt zu klären, welche Rolleder Religion vor dem Hintergrund pluraler Gesellschaften in inklusiven Schulen zukommen soll. In diesem Beitrag werden daherunterschiedliche Aspekte und Ansätze von Inklusion mit Blick auf Religion diskutiert und Überlegungen für den schulischenUmgang mit religiöser Heterogenität resümiert.

  5. Acquired Von Willebrand’s Syndrome in Systemic Lupus Erythematosus

    Directory of Open Access Journals (Sweden)

    Sara Taveras Alam

    2014-01-01

    Full Text Available Acquired von Willebrand syndrome (AVWS is an uncommon, underdiagnosed, and heterogeneous disease which is increasingly recognized as a cause of bleeding diatheses. Systemic lupus erythematosus (SLE is an infrequent cause of AVWS. Herein, we report a case of AVWS diagnosed during the initial presentation of SLE in a previously healthy young man with no family history of bleeding diathesis who presented with worsening epistaxis, gastrointestinal bleeding, and anasarca. He was found to have severe anemia and prolonged activated partial thromboplastin time (aPTT with severely decreased levels of von Willebrand factor (VWF measurements in addition to markedly decreased factor VIII levels. Further evaluation revealed nephrotic syndrome and interstitial lung disease due to SLE. He initially received combination therapy with intravenous immunoglobulin (IVIG and von Willebrand factor/factor VIII concentrates without significant improvement. Treatment with steroids, cyclophosphamide, and rituximab was followed by clinical improvement evidenced by cessation of bleeding. The short follow-up did not allow us to definitely prove the therapeutic effect of immunosuppressive treatment on AVWS in SLE patients. This case adds to the literature supporting the relationship between AVWS and SLE and highlights the importance of combination therapy in the treatment of severe AVWS as well as the role of IVIG, cyclophosphamide, and rituximab in AVWS associated with SLE.

  6. Compliance with periodic surveillance for Von-Hippel-Lindau disease.

    Science.gov (United States)

    Lammens, Chantal R M; Aaronson, Neil K; Hes, Frederik J; Links, Thera P; Zonnenberg, Bernard A; Lenders, Jacques W M; Majoor-Krakauer, Danielle; Van Os, Theo A M; Gomez-Garcia, Encarna B; de Herder, Wouter; van der Luijt, Rob B; van den Ouweland, Ans M W; Van Hest, Liselot P; Verhoef, Senno; Bleiker, Eveline M A

    2011-06-01

    To assess compliance with a periodic surveillance regimen for Von Hippel-Lindau disease. In this nationwide study, Von Hippel-Lindau disease mutation carriers and those at 50% risk were invited to complete a questionnaire assessing (compliance with) advice given for periodic surveillance. Medical record data on compliance with recommended radiologic surveillance examinations were also collected. Of the 84 (77%) participants, 78 indicated having received advice to undergo periodic surveillance. Of these, 71 reported being fully compliant with that advice. In 64% of the cases, this advice was only partially consistent with published guidelines. Based on medical record data, between one quarter and one third of individuals did not undergo surveillance as recommended in the guidelines for central nervous system lesions and one half for visceral lesions. Screening delay for central nervous system lesions was significantly higher in one hospital and in those cases where "the advice given" deviated from the guidelines. The majority of those with or at risk of Von Hippel-Lindau disease reported having received and being fully compliant with screening advice. However, in many cases, the advice given was only partially consistent with published guidelines, and screening delays were observed. Efforts should be undertaken to stimulate guideline-based surveillance advice and to minimize screening delay.

  7. Christian Enichlmayr, Leiter der Oberösterreichischen Landesbibliothek von 1999 bis 2015, beantwortet 10 Fragen von Bruno Bauer

    Directory of Open Access Journals (Sweden)

    Christian Enichlmayr

    2016-05-01

    Full Text Available Christian Enichlmayr beantwortet Fragen über seinen Start ins Berufsleben in der Verlagsbranche, seine Zeit an der Universitätsbibliothek Linz und seinen Wechsel an die Oberösterreichische Landesbibliothek. 1999 bis 2015 war er als deren Leiter auch in führender Position für die Transformation der Bundesstaatlichen Studienbibliothek zur Landesbibliothek sowie die Sanierung und Erweiterung des Bibliotheksgebäudes verantwortlich. Weitere Themen, die in den vergangenen 17 Jahren an der Landesbibliothek stark forciert wurden, erstrecken sich von der NS-Provenienzforschung über die Entwicklung der digitalen Landesbibliothek bis zur Stärkung der Rolle der Landesbibliothek im oberösterreichischen Kulturleben. Zuletzt spricht Enichlmayr über die Bedeutung von Kooperationen im Bibliothekswesen, die Ausrichtung des Bibliothekartages der Vereinigung Österreichischer Bibliothekarinnen und Bibliothekare 2004 in Linz sowie die Perspektive für Bibliotheken.

  8. Berechnung von Gleichgewichtskonstanten mit Hilfe der Quantenchemie und Vergleich mit experimentellen Daten bei der Bildung von Halbacetalen

    OpenAIRE

    Jaubert, Silke

    2012-01-01

    Mischungen aus Aldehyden und Alkoholen sind für zahlreiche technische Prozesse von Bedeutung. Bei der Auslegung solcher Prozesse muss berücksichtigt werden, dass Aldehyde mit Alkoholen in einer Additions-Eliminierungsreaktion zu Halbacetalen reagieren. Zurzeit erhält man genaue Angaben zum Reaktionsgleichgewicht, die für technische Anwendungen ausreichend sind, fast ausschließlich aus experimentellen Untersuchungen. Eine Vorhersage solcher Gleichgewichtskonstanten (für Reaktionen in der Ga...

  9. Isolation, Charakterisierung und Einsatzmöglichkeiten von hitzeadaptierten Protozoen in der thermalen Abwasseraufbereitung von Prozesswasser-Kreislaufsystemen

    OpenAIRE

    Feuersänger, Grischa Peter

    2009-01-01

    Protozoen werden bereits seit vielen Jahren in Belebungsanlagen städtischer Klärwerke zur biologischen Aufbereitung von sanitären Abwässern als Bakterienkonsumenten eingesetzt. Bei den hier vorgestellten Arbeiten wurden die Einsatzmöglichkeiten ausgewählter Protozoenarten in einer erweiterten biologischen Reinigungsstufe im Anschluss an eine kombinierte anaerobe/aerobe Prozesswasseraufbereitung am Beispiel der Altpapier verarbeitenden Industrie untersucht. Prägend für die Umweltbedingungen in...

  10. BELASTUNGEN VON ANGEHÖRIGEN IM KONTEXT PSYCHISCHER TRAUMATISIERUNGEN

    Directory of Open Access Journals (Sweden)

    Carolyn Rose

    2015-03-01

    Full Text Available Psychische Erkrankungen haben in der bundesdeutschen Bevölkerung einen hohen Stellenwert und erreichen eine 12-Monatsprävalenz von ca. 30%. Dazu gehören auch posttraumatische Störungsbilder, die durch Einwirkung von Extrembelastungen aus dem beruflichen (wie beispielsweise bei Einsatzkräften oder privaten Kontext (Raubüberfälle, Vergewaltigung etc. entstehen können (Wittchen & Jacobi, 2012. In der Bundeswehr ergab eine kürzlich zum Abschluss gebrachte epidemiologische Studie eine 12-Monatsprävalenz psychischer Erkrankungen für Einsatzsoldaten von 21,4% und für Nicht-Einsatzkräfte von 22,5%. Die Posttraumatische Belastungsstörung war mit 2,9% vertreten, Angststörungen mit 10,8%, ebenso wie affektive Störungen, von einer Alkoholerkrankung waren 3,4% betroffen (Wittchen u.a., 2012. Die zunächst überraschend höhere Prävalenzrate in der Gruppe ohne Einsatz ist dabei durch Gesundheitsuntersuchungen der Bundeswehr vor dem Einsatz erklärbar, wodurch in einigen Fällen ein Einsatz zumindest vorübergehend unterbleiben muss, beispielsweise bei laufender Psychotherapie (Wittchen u.a. ,2012. „Das Leben mit einem psychisch erkrankten Menschen kann für die Angehörigen eine starke emotionale Belastung hervorrufen (Manguno-Mire u.a., 2007. Jede psychische Erkrankung greift nicht nur in die gewohnten Abläufe sondern auch in die ungeschriebenen Gesetze einer Partnerschaft ein und löst häufig ein Schwanken zwischen Hoffnung und Enttäuschung, Zuversicht und Resignation aus (Bischkopf, 2010. Auf der anderen Seite scheint familiäre Unterstützung ein protektiver Faktor gegen Langzeitstress zu sein (Stevens u.a. 2013 und den Verlauf posttraumatischer psychischer Erkrankungen positiv zu beeinflussen (Price u.a. 2013“ ( Wesemann u.a.,2015, S. 3 Die supportive therapeutische Arbeit mit Angehörigen lässt daher positive Effekte sowohl für diese selbst als auch für die originär Erkrankten erwarten.

  11. Zur Diagnose von isolierten und kombinierten Leseproblemen: Definitionen, Operationalisierungen und Vorkommenshäufigkeiten

    OpenAIRE

    Valtin, Renate; Voss, Andreas; Bos, Wilfried

    2015-01-01

    Aufgrund einer Vielzahl von Definitionen und Operationalisierungen gibt es keine verlässlichen Zahlen über die Vorkommenshäufigkeiten isolierter oder kombinierter Leseprobleme, auch bedingt durch das Fehlen repräsentativer Studien. Anhand des für Deutschland repräsentativen Datensatzes von IGLU und TIMSS 2011 wurde die Vorkommenshäufigkeit von isolierten und kombinierten Leseproblemen in kompetenzorientierten Tests bestimmt. Insgesamt weisen die Ergebnisse darauf hin, dass Leseprobleme selten...

  12. Der Beitrag von Erfahrungen an den Entwicklungsprozessen zur Selbständigkeit

    OpenAIRE

    Panick, Veronika

    1999-01-01

    Mit der Arbeit wird der Versuch unternommen, den Zusammenhängen von Biographie- und individuellen Lernprozessen nachzugehen. Dies erfolgt am Beispiel von acht ostdeutschen ExistenzgründerInnen, die sich nach der Wende in den neuen Bundesländern im Lebensmitteleinzelhandel selbständig gemacht haben. Hierbei interessiert die Frage, inwieweit Erfahrungen den Lernprozeß behindert oder gefördert haben. Die Ergebnisse der Arbeit bestätigen die hohe Relevanz von Erfahrungen, Handlungsmustern und V...

  13. Darstellung hochmolekularer und verzweigter Polyisobutene durch Einsatz von Makroinitiatoren, cyclischen Dienen und Initiatormonomeren

    OpenAIRE

    Schäfer, Marcus

    2007-01-01

    Die Synthese und Charakterisierung von hochmolekularen und verzweigten Polyisobutenen durch Einsatz von neuartigen Makroinitiatoren, cyclischen Dienen und Initiatormonomeren stand im Mittelpunkt dieser Arbeit. Es wurden Lösungsansätze zu aktuellen wissenschaftlichen und technischen Problemen aufgezeigt und miteinander verglichen. Die Kombination von DPE-Technik und kationischer Polymerisation führte zu neuartigen Graftcopolymeren mit variablem Rückgrat und Polyisobutenseitenästen. Die Kombina...

  14. Über den Nachrichtenwert von Friedensjournalismus - Ergebnisse einer experimentellen Studie

    OpenAIRE

    Monika Spohrs

    2006-01-01

    Laut Nachrichtenwertforschung hängt die Publikations- und Lesenswürdigkeit von Nachrichtentexten von den Nachrichtenfaktoren der zu publizierenden Ereignisse ab. Als anerkannte Nachrichtenfaktoren gelten beispielsweise Negativität, Vereinfachung und Personifizierung. Friedensjournalistische Arbeiten weichen von diesen Kriterien oft ab, indem sie versuchen, die berichteten Ereignisse in ihrer Komplexität darzustellen, den Fokus nicht auf negative Ereignisse zu legen und auch strukturellen Them...

  15. Entwicklung von flexiblen Zelllinien für die Produktion rekombinanter Proteine und Retroviren

    OpenAIRE

    Schucht, Roland

    2006-01-01

    Die vorhersagbare und stabile Expression rekombinanter Proteine in Säugerzellen ist von großem Interesse für viele Anwendungen in der Biotechnologie. Konventionelle Methoden zur Etablierung von Klonen mit guten Produktionseigenschaften sind mit hohem Screeningaufwand verbunden. Das Ziel dieser Arbeit war die Entwicklung einer Austauschstrategie, welche die Etablierung von Masterzelllinien mit einer austauschbaren Expressionskassette beinhaltet. Dazu wurden chromosomale Loci in HEK293, CHO-K1 ...

  16. Biologische Ansätze zum Verhältnis von Literatur und Emotionen

    OpenAIRE

    Mellmann, Katja

    2010-01-01

    Als eine Möglichkeit, emotionale Wirkungen von Literatur zu beschreiben, wird eine evolutionspsychologische Heuristik vorgeschlagen. Während der rein textwissenschaftliche Ansatz nur die Darstellung von Emotionen in Texten untersuchen kann, ermöglicht der literaturpsychologische Ansatz ein Inbeziehungsetzen von Werkstruktur und Leserpsyche und damit hypothetische Aussagen über emotionale Wirkungsphänomene. Die Evolutionspsychologie eröffnet einen Zugang insbesondere zu einigen sehr basalen Wi...

  17. Repertory Grids als Methode zur Untersuchung von Schülervorstellungen im Bereich Computer und Internet

    OpenAIRE

    Pancratz, Nils

    2016-01-01

    In dieser Arbeit wird untersucht, inwieweit sich die Repertory Grid Methode zur Erhebung (bzw. zur Bestätigung bisheriger Ergebnisse von Untersuchungen) von Schülervorstellungen im Bereich Computer und Internet eignet. Dazu wird eine konkrete Repertory Grid Methode entwickelt und diese an einigen Schülerinnen und Schülern angewandt. Die Untersuchungen werden ausgewertet und mit bisherigen Ergebnissen verglichen. Abschließend wird die Eignung der Methode zur Untersuchung von Schülervorstellung...

  18. Interpretation of ultrasonic images; Interpretation von Ultraschall-Abbildungen

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, W.; Schmitz, V.; Kroening, M. [Fraunhofer-Institut fuer Zerstoerungsfreie Pruefverfahren, Saarbruecken (Germany)

    1998-11-01

    During the evaluation of ultrasonic images, e.g. SAFT-reconstructed B-scan images (SAFT=Synthetic Aperture Focusing Technique) it is often difficult to decide, what is the origin of reconstructed image points: were they caused by defects, specimens geometry or mode-conversions. To facilitate this evaluation a tool based on the comparison of data was developed. Different kinds of data comparison are possible: identification of that RF-signals, which caused the reconstructed image point. This is the comparison of a reconstructed image with the corresponding RF-data. Comparison of two reconstructed images performing a superposition using logical operators. In this case e.g. the reconstruction of an unknown reflector is compared with that of a known one. Comparison of raw-RF-data by simultaneous scanning through two data sets. Here the echoes of an unknown reflector are compared with the echoes of a known one. The necessary datasets of known reflectors may be generated experimentally on reference reflectors or modelled. The aim is the identification of the reflector type, e.g. cracklike or not, the determination of position, size and orientation as well as the identification of accompanying satellite echoes. The interpretation of the SAFT-reconstructed B-scan image is carried out by a complete description of the reflector. In addition to the aim of interpretation the tool described is well suited to educate and train ultrasonic testers. (orig./MM) [Deutsch] Bei der Auswertung von Ultraschall-Abbildungen, z.B. SAFT-rekonstruierten B-Bildern (SAFT=Synthetische Apertur Fokus Technik), ist es oft schwierig zu entscheiden, wo rekonstruierte Bildpunkte herruehren: wurden sie durch Materialfehler, Bauteilgeometrie oder durch Wellenumwandlungen versursacht. Um diese Auswertung zu erleichtern, wurde ein Werkzeug entwickelt, welches auf dem Vergleich von Datensaetzen basiert. Es koennen verschiedene Arten des Datenvergleichs durchgefuehrt werden: Identifikation der HF

  19. August von Kotzebue estofiilina / Otto-Heinrich Elias ; saksa keelest tõlkinud Reet Bender

    Index Scriptorium Estoniae

    Elias, Otto-Heinrich, 1932-

    2011-01-01

    Tutvustatakse August von Kotzebue kirjanduslikku - ja draamaloomingut, tema rolli seadusreformide mõjutamisel ning eestlastest positiivse kujundi loomisel. Peatutakse ka tema reisil revolutsioonilisel Prantsusmaal

  20. Biotechnological use of carbon dioxide as raw material using microalgae; Biotechnologische Nutzung von Kohlendioxid als Rohstoff mit Hilfe von Mikroalgen

    Energy Technology Data Exchange (ETDEWEB)

    Menz, K. [Preussag AG, Hannover (Germany)

    1998-12-31

    Because of its slow chemical reactivity, carbon dioxide has in the past been regarded as only the final product of combustion processes and as such as of no value. Carbon dioxide should however be seen as an important industrial raw material, which with the help of biological processing technologies can be used in the preparation of chemical-pharmaceutical substances. In a Preussag AG project, working in collaboration with the IGV Institute for Getreideverarbeitung, the Salzgitter Anlagenbau GmbH and the FELS-Werke GmbH, a pilot reactor has been erected in Elbingerode/Harz which uses CO{sub 2} as a raw material in biotechnology. The organisms at work in the special bioreactors are microalgae. These single cell plants are particularly efficient at photosynthesis and are able to fix high CO{sub 2} concentrations from industrial exhaust gases. In a pilot test, productivity rates of up to 6 kg biomass per day have been achieved. Use of microalgae produced in the Elbingerode plant as a feed additive has significantly raised the performance of egg-laying hens. Similarly, the biomass has also proven to be useful in the production of bio-tensides and bio-diesel oil. The level of useable product also promises many additional areas of application. (orig.) [Deutsch] Aufgrund seiner chemischen Reaktionstraegheit wurde Kohlendioxid bislang lediglich als wertloses Endprodukt von Verbrennungsprozessen betrachtet. CO{sub 2} ist jedoch als ein wichtiger Industrierohstoff zu verstehen, der mit Hilfe der Bioverfahrenstechnik gezielt zur Bereitstellung von chemisch/pharmazeutischen Wertstoffen genutzt werden kann. In einem Projekt der Preussag AG wurde in Zusammenarbeit mit dem IGV Institut fuer Getreideverarbeitung GmbH, der Salzgitter Anlagenbau GmbH und der FELS-Werke GmbH ein Pilotreaktor zur Nutzung von CO{sub 2} als Rohstoff fuer die Biotechnologie in Elbingerode/Harz errichtet. Die Organismen, die in speziellen Bioreaktoren zum Einsatz kommen, sind Mikroalgen. Diese einzelligen

  1. Auftreten von Falschem Mehltau bei Gartenkresse (Lepidium sativum L. in der Saatgutvermehrung – Evaluierung von Saatgutbehandlung und Wachstumsbedingungen in einem Gefäßversuch

    Directory of Open Access Journals (Sweden)

    Zeller, Stefanie

    2014-09-01

    Full Text Available Die zur Familie der Brassicaceae gehörende Gartenkresse wird in Deutschland überwiegend im biologischen Anbau vermehrt. Seit einigen Jahren werden diese Gartenkressebestände von Erregern des Falschen Mehltaus (Hyaloperonospora parasitica, Perofascia lepidii befallen, was zu einem Totalausfall des Pflanzenbestandes führen kann. Daher ist die biologische Saatgutproduktion von Gartenkresse gefährdet, was eine Beeinträchtigung der Saatgutversorgung für die Keimsprossenerzeugung zur Folge hat. In den laufenden Untersuchungen wird der Einfluss von nicht chemischen Saatgutbehandlungsmaßnahmen (Wasserdampf, Elektronen, sowie Wachstumsbedingungen (Feuchte, Boden auf die Infektion mit Falschem Mehltau untersucht.

  2. Einfluss von Bodenamöben (Acanthamoeba castellanii Neff) auf das Wachstum von Pflanzen und die bakterielle Rhizosphärengemeinschaft

    OpenAIRE

    Kreuzer, Knut

    2004-01-01

    Die Rhizosphäre ist der eng begrenzte Raum um die Wurzel von Pflanzen, welcher von der lebenden Wurzel durch die Rhizodeposition, die Abgabe von leicht abbaubaren organischen Verbindungen, beeinflusst wird. Damit wird die mikrobielle Aktivität in diesem für die Pflanze hochsensiblen Bereich der Wasser- und Nährstoffaufnahme deutlich erhöht. Protozoen beweiden die Bakterien in der Rhizosphäre und fördern damit indirekt das Pflanzenwachstum, vor allem das der Wurzeln. In dieser Arbeit wurde der...

  3. Messung der Vorwärts-Rückwärts-Ladungsassymetrie von b-Quarks bei Energien nahe der Z0-Resonanz. Untersuchung von Ereignissen mit initialem b-Quark unter Verwendung der Jetladungstechnik mit dem DELPHI Detektor

    CERN Document Server

    Schwering, Britta

    Messung der Vorwärts-Rückwärts-Ladungsassymetrie von b-Quarks bei Energien nahe der Z0-Resonanz. Untersuchung von Ereignissen mit initialem b-Quark unter Verwendung der Jetladungstechnik mit dem DELPHI Detektor

  4. Konstruktion, Aufbau und Erprobung einer Einzelionen-Bestrahlungsapparatur und Untersuchung der Inaktivierung von Sporen von bacillus subtilis durch einzelne sehr schwere Ionen (Z $>$ 27) in Abhängigkeit vom Stossparameter

    CERN Document Server

    Weisbrod, U

    1988-01-01

    Konstruktion, Aufbau und Erprobung einer Einzelionen-Bestrahlungsapparatur und Untersuchung der Inaktivierung von Sporen von bacillus subtilis durch einzelne sehr schwere Ionen (Z $>$ 27) in Abhängigkeit vom Stossparameter

  5. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-β -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae

    Directory of Open Access Journals (Sweden)

    Roberta T. dos Santos

    2012-01-01

    Full Text Available MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae, showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG, after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC50 value of 67 µM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature.

  6. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    International Nuclear Information System (INIS)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia

    2012-01-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC 50 value of 67 μM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  7. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia [Universidade Federal de Sao Paulo (UNIFESP), Diadema, SP (Brazil). Inst. de Ciencias Ambientais, Quimicas e Farmaceuticas; Tempone, Andre G.; Pinto, Erika G. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil). Dept. de Parasitologia; Lorenzi, Harri, E-mail: psartorelli@unifesp.br [Instituto Plantarum de Estudos da Flora, Nova Odessa, SP (Brazil)

    2012-07-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-{beta}-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC{sub 50} value of 67 {mu}M, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  8. Public health assessment for Wheeling Disposal Service Company Landfill, Amazonia, Andrew County, Missouri, Region 7, CERCLIS number MOD000830554. Final report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-08-25

    The Wheeling Disposal Service Company, Inc., (Wheeling Disposal) site is a closed municipal and industrial waste landfill, approximately 1 mile southeast of Amazonia, Andrew County, Missouri. On-site shallow groundwater is contaminated with Volatile Organic Compounds (VOCs) (methylene chloride, carbon tetrachloride, trichloroethylene) and metals; however, no one is using that water for potable purposes at present. Isolated farm houses are situated in the vicinity of the site, but the houses that would most likely be affected are connected to the public water system. From the information reviewed, DOH concludes that the Wheeling Disposal site currently poses no apparent public health hazard. No exposures are known to be occurring at this time. Potential exposure pathways have been identified, but remedial actions eliminated them.

  9. The impact of Hurricane Andrew on deviant behavior among a multi-racial/ethnic sample of adolescents in Dade County, Florida: a longitudinal analysis.

    Science.gov (United States)

    Khoury, E L; Warheit, G J; Hargrove, M C; Zimmerman, R S; Vega, W A; Gil, A G

    1997-01-01

    Findings from a longitudinal study are presented on the relationships between the problems and stresses resulting from Hurricane Andrew and posthurricane minor deviant behavior. The sample (N = 4,978) included Hispanic, African-American, and White non-Hispanic middle school students enrolled in Dade County, Florida public schools. Two waves of data were collected prior to the hurricane; a third was obtained approximately 6 months following the storm. Results indicated that females were likely to report higher levels of hurricane-related stress symptoms than males. After controlling for prehurricane levels of minor deviance, family support, and race/ethnicity, hurricane stress symptom level remained a significant predictor of posthurricane minor deviant behavior. The findings lend support to stress theories of social deviance.

  10. Die erediens as fees of die fees as erediens?: �n Andrew Murray pryswenner �n kwarteeu later herlees

    Directory of Open Access Journals (Sweden)

    Cas Wepener

    2014-08-01

    Full Text Available Worship as feast or feast as worship? Re-reading an Andrew Murray prizewinner one quarter of a century later. The aim of this contribution is to bring the book Die erediens as fees into discussion with the surrounding culture almost one quarter of a century after its publication. The surrounding culture, we shall call, following Martin Stringer and his so-called discourse of globalisation and consumerism, �the feast as worship service�. Based on this discussion, our research question pertains to the value of Die erediens as fees for the field of Liturgical Studies today. An answer is attempted by, firstly, sketching the liturgical landscape as well as national and international liturgical-scientific developments in our day and, secondly, providing a liturgical-aesthetical exploration and positioning Die erediens as fees within these developments and exploration.

  11. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    Energy Technology Data Exchange (ETDEWEB)

    Moniz, Ernest [U.S. Energy Secretary

    2014-02-03

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  12. Nachweis von Verticillium dahliae an Pfefferminze (Mentha x piperita L.

    Directory of Open Access Journals (Sweden)

    Gärber, Ute

    2014-09-01

    Full Text Available In Beständen von Pfefferminze wurden Krankheitssymptome beobachtet, die sich in Wuchshemmungen, Stängelverbräunungen, Blattchlorosen und Welke zeigten. Teilweise starben die Pflanzen bzw. einzelne Triebe ab. Als Ursache konnte Verticillium dahliae nachgewiesen werden. In einem Infektionsversuch im Gewächshaus wurden sieben Wochen alte Pfefferminzpflanzen der Sorte Multimentha durch Angießen mit einer Konidiensuspension (106 Konidien/ml Suspension inokuliert. Erste Krankheitssymptome erschienen acht Wochen nach Inokulation. Innerhalb kurzer Zeit nahm der Befall stark zu. Aus den kranken Pflanzenteilen wie Stängel und Blatt konnte der Erreger reisoliert werden.

  13. Modelluntersuchungen zur Mehrfachverkapselung von bioaktiven Wirkstoffen und ihrer Freisetzung

    OpenAIRE

    Albrecht, Anja Karin

    2009-01-01

    Während sich die Verkapselung von Inhaltstoffen in der Pharmazie seit längerem fest etabliert hat, spielten verkapselte Inhaltsstoffe in Lebensmitteln bislang noch eine untergeordnete Rolle. Jedoch gewinnt sie auch im Lebensmittelbereich zunehmend an Bedeutung. Hauptziel für die Verkapselung ist im Allgemeinen der Schutz des Kernmaterials vor schädlichen Einflüssen wie Licht, Sauerstoff und Feuchtigkeit, die zu schnellem Verderb des Endprodukts führen können. Sie dient aber auch der Verbesser...

  14. Bernstein - Von Mises theorem and its application in survival analysis

    Czech Academy of Sciences Publication Activity Database

    Timková, Jana

    2010-01-01

    Roč. 22, č. 3 (2010), s. 115-122 ISSN 1210-8022. [16. letní škola JČMF Robust 2010. Králíky, 30.01.2010-05.02.2010] R&D Projects: GA AV ČR(CZ) IAA101120604 Institutional research plan: CEZ:AV0Z10750506 Keywords : Cox model * bayesian asymptotics * survival function Subject RIV: BB - Applied Statistics, Operational Research http://library.utia.cas.cz/separaty/2010/SI/timkova-bernstein - von mises theorem and its application in survival analysis.pdf

  15. An ELISA for the quantitation of von Willebrand Factor

    DEFF Research Database (Denmark)

    Vinholt, Pernille Just; Overgaard, Martin; Diederichsen, Axel Cosmus Pyndt

    2013-01-01

    for measurement of von Willebrand factor-osteoprotegerin complex (VWF:OPG) in human plasma. Furthermore, the significance of VWF:OPG complex as a marker of cardiovascular disease (CVD) was evaluated. PATIENTS/METHODS: A sandwich ELISA for quantification of VWF:OPG was developed using a polyclonal rabbit anti...... with and without documented coronary calcification (total n=118). RESULTS AND CONCLUSIONS: The assay detected VWF:OPG complexes in human plasma, while no significant signal was observed when testing solutions containing VWF or recombinant OPG alone. Importantly, the ELISA assay was able to detect in vitro formed...

  16. Contiguity and Entire Separability of States on von Neumann Algebras

    Science.gov (United States)

    Haliullin, Samigulla

    2017-12-01

    We introduce the notions of the contiguity and entirely separability for two sequences of states on von Neumann algebras. The ultraproducts technique allows us to reduce the study of the contiguity to investigation of the equivalence for two states. Here we apply the Ocneanu ultraproduct and the Groh-Raynaud ultraproduct (see Ocneanu (1985), Groh (J. Operator Theory, 11, 2, 395-404 1984), Raynaud (J. Operator Theory, 48, 1, 41-68, 2002), Ando and Haagerup (J. Funct. Anal., 266, 12, 6842-6913, 2014)), as well as the technique developed in Mushtari and Haliullin (Lobachevskii J. Math., 35, 2, 138-146, 2014).

  17. Lernen von las Cuencas / Aprendiendo de las Cuencas

    DEFF Research Database (Denmark)

    Allen, Nacho Ruiz; López Arraiza, Sara

    2015-01-01

    -existence of natural, rural, industrial and urban landscapes came about in a totally uncontrolled and unplanned fashion. The fuzzy limits between the different landscapes foreclose the possibility of identifying their areas of influence. The Cuencas are perceived as a mesh of opposing yet interconnected identities......Lernen von las Cuencas / Aprendiendo de las Cuencas (Learning from las Cuencas) research project, awarded with the EU Prize for Cultural Heritage / Europa Nostra Awards 2015, provides a new perspective of industrial cultural landscapes. Despite being focused on a local environment, the coal mining...

  18. Lernen von las Cuencas / Aprendiendo de las Cuencas

    DEFF Research Database (Denmark)

    2016-01-01

    -existence of natural, rural, industrial and urban landscapes came about in a totally uncontrolled and unplanned fashion. The fuzzy limits between the different landscapes foreclose the possibility of identifying their areas of influence. The Cuencas are perceived as a mesh of opposing yet interconnected identities......Lernen von las Cuencas / Aprendiendo de las Cuencas (Learning from las Cuencas) research project, awarded with the EU Prize for Cultural Heritage / Europa Nostra Awards 2015, provides a new perspective of industrial cultural landscapes. Despite being focused on a local environment, the coal mining...

  19. Content Management von Leittexten mit XML Topic Maps

    Directory of Open Access Journals (Sweden)

    Johannes Busse

    2003-07-01

    Full Text Available Die Autoren definieren den Umgang mit internet- basierten Informations- und Kommunikationstechnologien als Schlüsselqualifikation für Studierende aller Fachrichtungen. Im vorliegenden Aufsatz beschreiben sie ein Projekt, das der Fachbereich Erziehungswissenschaften der Universität Heidelberg seit 2001 durchführt. Hier werden Studierende der Geistes- und Sozialwissenschaften zu "Lernberatern" ausgebildet, die als Multiplikatoren die notwendigen Kenntnisse erwerben. Die Teilnehmenden erarbeiten nach der "Leittextmethode" selbstgesteuert xml-basierte Contents. Dies setzt den Erwerb von informationstechnischen Kenntnissen voraus, der neben dem Aufbau eines (sowohl technischen als auch sozialen Netzwerks einen Schwerpunkt bildet.

  20. Inadequacy of von Neumann entropy for characterizing extractable work

    International Nuclear Information System (INIS)

    Dahlsten, Oscar C O; Renner, Renato; Rieper, Elisabeth; Vedral, Vlatko

    2011-01-01

    The lack of knowledge that an observer has about a system limits the amount of work it can extract. This lack of knowledge is normally quantified using the Gibbs/von Neumann entropy. We show that this standard approach is, surprisingly, only correct in very specific circumstances. In general, one should use the recently developed smooth entropy approach. For many common physical situations, including large but internally correlated systems, the resulting values for the extractable work can deviate arbitrarily from those suggested by the standard approach.