WorldWideScience

Sample records for andrew grant md

  1. The brain and the biology of belief: An interview with Andrew Newberg, MD. Interview by Nancy Nachman-Hunt.

    Science.gov (United States)

    Newberg, Andrew

    2009-01-01

    Andrew Newberg, MD, is an associate professor in the Department of Radiology, Division of Nuclear Medicine, at the Hospital of the University of Pennsylvania, Philadelphia, with secondary appointments in the Departments of Psychiatry and Religious Studies. He is actively involved in neuroimaging research projects, including the study of the neurophysiological correlates of meditation and other types of complementary therapies. Dr Newberg's research now largely focuses on how brain function is associated with various mental states, in particular, the relationship between brain function and mystical or religious experiences. He has authored several books, including Why God Won't Go Away: Brain Science and the Biology of Belief (Ballantine/Random House, 2001) and coauthor with Eugene G. d'Aquili, MD, of The Mystical Mind: Probing the Biology of Religious Experience (Fortress Press, 1999). His most recent book is How God Changes Your Brain, with coauthor Mark Waldman (Ballantine Books, 2009).

  2. George Andrew Olah

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 12. George Andrew ... Hungarian born American chemist, George Andrew Olah wasa prolific researcher. The central theme ... He leavesbehind a large body of work comprising almost 1500 papersand twenty books for the scientific community.

  3. Psychiatric morbidity following Hurricane Andrew.

    Science.gov (United States)

    David, D; Mellman, T A; Mendoza, L M; Kulick-Bell, R; Ironson, G; Schneiderman, N

    1996-07-01

    The nature of psychiatric morbidity in previously non-ill subjects from the area most affected by Hurricane Andrew was investigated at 6-12 months posthurricane. Preliminary associations of morbidity with personal and event-related risk factors were also determined. Fifty one percent (31/61) met criteria for a new-onset disorder, including posttraumatic stress disorder (PTSD) in 36%, major depression (MD) in 30%, and other anxiety disorders in 20%. Thirty four subjects (56%) had significant symptoms persisting beyond 6 months. Having sustained "severe damage" was the risk factor most strongly associated with outcome. Our data underscore the range of psychiatric morbidity related to a natural disaster, and suggest a relationship to chronic stressors.

  4. George Andrews' Game

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 2. George Andrews' Game. Jerold Mathews. General Article Volume 14 Issue 2 February 2009 pp 172-178. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/014/02/0172-0178. Keywords. Fibonacci ...

  5. Millikan, Prof. Robert Andrews

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1935 Honorary. Millikan, Prof. Robert Andrews Nobel Laureate (Physics) - 1923. Date of birth: 22 March 1868. Date of death: 19 December 1953. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the ...

  6. George Andrews' Game

    Indian Academy of Sciences (India)

    Admin

    helping international students learn English. Keywords. Fibonacci numbers, Zecken- dorf's theorem, Andrew's game, greedy algorithm. T his is an expository article show ing how Zeck- endorf's T heorem (every positive integer can be represented in one and only one w ay as the sum of non-consecutive Fibonacci num bers) ...

  7. Interview with Andrew Dalby

    OpenAIRE

    Mac Con Iomaire, Máirtín

    2016-01-01

    Andrew Dalby (born 1947 in Liverpool) is an English linguist, translator and historian and author of numerous articles and several books on a wide range of topics including food history, language, and Classical texts. Dalby studied Latin, French and Greek at the Bristol Grammar School and University of Cambridge. Here he also studied Romance languages and linguistics, earning a bachelor's degree in 1970. Dalby worked for fifteen years at Cambridge University Library, eventually specialising i...

  8. Md Naimuddin

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics. Md Naimuddin. Articles written in Pramana – Journal of Physics. Volume 79 Issue 5 November 2012 pp 1255-1258 Poster Presentations. Model unspecific search for new physics in collision at s = 7 TeV · Shivali Malhotra Md Naimuddin Thomas Hebbeker Arnd Meyer ...

  9. Mortality from Hurricane Andrew.

    Science.gov (United States)

    Lew, E O; Wetli, C V

    1996-05-01

    Hurricane Andrew, a category 4 storm, made landfall in South Florida on August 24, 1992, and caused extensive structural and environmental damage. The Dade County Medical Examiner Department investigated 15 deaths directly related to the storm and another 15 natural deaths indirectly related to the storm. The aftermath of the hurricane continued to create circumstances that lead to 32 accidental deaths, five suicides, and four homicides over the next six months. Traffic fatalities due to uncontrolled intersections accounted for one-third of the post-storm accidental deaths. Dyadic deaths (homicide-suicide) doubled in rate for the six months following the storm. The limited number of direct hurricane deaths is attributed to advance storm warnings, its occurrence on a weekend, the storm's passage through less populated areas of the county, and the relatively modest amount of accompanying rainfall.

  10. Andrew spares Florida Coast

    Science.gov (United States)

    Bush, Susan

    When geologists heard of the intensity of Hurricane Andrew, which struck the Florida coast on August 25 and then moved on to southern Louisiana, they were expecting the same kinds of coastal damage that Hurricane Hugo brought to the Caribbean and Carolina shores in 1989. Both storms were category 4 hurricanes, having winds of 131-155 mph and surges of 13-18 feet. However, the coastal damage never materialized, leaving geologists to analyze the factors that lessened the impact of the storm. “For minimum coastal damage, you couldn't have designed a better storm,” said Orrin Pilkey, director of the Program for the Study of Developed Shorelines (PSDS) in Durham, N.C. This was due in part to the nature of the storm itself and where it hit land, and in part to the regional geology, said Rob Thieler of PSDS. Despite the huge amounts of damage to buildings, there was virtually no evidence of coastal process destruction, he said.

  11. In Memoriam: George Andrew Olah

    Indian Academy of Sciences (India)

    A Nobel Laureate in chemistry, George Andrew Olah, was a giant who transformed many ideas of fundamental organic chemistry. A kind and generous gentleman, ... cluded investigations into superacids and ways to generate and study long-lived carbocations. These investigations led him to distinguish between classical ...

  12. Andrew A. Benson: personal recollections.

    Science.gov (United States)

    Nonomura, Arthur; Lorimer, George; Holtz, Barry; Vacquier, Victor; Biel, Karl Y; Govindjee

    2016-03-01

    Andrew A. Benson, one of the greatest and much loved scientists of our century, passed away on January 16, 2015; he was born on September 24, 1917. A grand celebration of his life was held on February 6, 2015, in California. Here, we present one of his photographs and key excerpts from what was said then, and soon thereafter.

  13. The Americas and Hurricane Andrew

    Science.gov (United States)

    1992-01-01

    Image taken on August 25, 1992 by NOAA GOES-7 of the Americas and Hurricane Andrew.Photo Credit: Image produced by F. Hasler, M. Jentoft-Nilsen, H. Pierce, K. Palaniappan, and M. Manyin. NASA Goddard Lab for Atmospheres - Data from National Oceanic and Atmospheric Administration (NOAA).

  14. Ulysses S. Grant and Reconstruction.

    Science.gov (United States)

    Wilson, David L.

    1989-01-01

    Discusses the role played by Ulysses S. Grant during the four years of Reconstruction before he became President of the United States. Describes the dynamics of the relationship between Grant and Andrew Johnson. Points out that Grant's attitude of service to the laws created by Congress submerged his desire to create a new South. (KO)

  15. Safety and design impact of hurricane Andrew

    International Nuclear Information System (INIS)

    Guey, Ching N.

    2004-01-01

    Turkey Point completed the IPE in June of 1991. Hurricane Andrew landed at Turkey Point on August 24, 1992. Although the safety related systems, components and structures were not damaged by the Hurricane Andrew, certain nonsafety related components and the neighboring fossil plant sustained noticeable damage. Among the major components that were nonsafety related but would affect the PRA of the plant included the service water pumps and the high tower. This paper discusses the safety and design impact of Hurricane Andrew on Turkey Point Nuclear Power Plant. The risk of hurricanes on the interim and evolving plant configurations are briefly described. The risk of the plant from internal events as a result of damage incurred during Hurricane Andrew are discussed. The design change as the result of Hurricane Andrew and its impact on the PRA are presented. (author)

  16. Harold E. Varmus, MD.

    Science.gov (United States)

    Varmus, H E

    1995-06-01

    On November 19, 1993, the Senate approved the nomination of Harold E. Varmus, MD, as Director of the National Institutes of Health (NIH). Varmus, who received the 1989 Nobel Prize in Medicine, brought unquestioned credentials as a scientist to the NIH. Despite his limited background as an administrator, Varmus has received high marks from most observers for improving the morale of NIH staffers and implementing streamlined procedures in the grant review process. His tenure has not been free of controversy, however. Many clinical researchers have long felt there is a bias in NIH study sections against patient-oriented research. A recent study sponsored by the Division of Research Grants confirmed the lower success rate of patient-oriented research proposals, but the outcome of these findings remains unclear. Faced with mounting political pressure for a balanced budget, and the resultant reduction of funding to many branches of government, Varmus has been a strong voice for non-targeted investigator initiated research. Interviewed in his office in Building One on the NIH campus in Bethesda, Maryland, Varmus discussed the state of patient oriented research, the evolving role of the NIH in supporting science, and just where the money to pay for it should be found.

  17. Obituary: Andrew Stephen Wilson, 1947-2008

    Science.gov (United States)

    Veilleux, Sylvain

    2009-01-01

    On 24 May 2008, Andrew Stephen Wilson passed away at the age of 61, in his home in Silver Spring, Maryland, from complications resulting from a painful spinal illness. Andrew was arguably one of the first truly multi-wavelength astronomers of his generation. His scientific work on active galactic nuclei [AGN] spanned the entire electromagnetic spectrum from the radio to the X-rays. Andrew was born in Doncaster, Yorkshire, England, on 26 March 1947. He was the younger of two brothers whose births were separated by the Second World War. His father, Norman, came from a relatively affluent family who were coal merchants. His mother, Mary, came from a less comfortable background, one of seven children, daughter of a skilled cabinet maker/French polisher, who went through a very hard time during the depression. As a teacher, she placed enormous value on hard work and education as a way of gaining advancement in life. When Andrew was four, the family moved to Skipton, a nice market town in the Yorkshire dales. Andrew went to a small village school until age eleven when he entered Ermysted's Grammar School. He was an enthusiastic soccer and cricket player. He never lost his enthusiasm for soccer and supported the local soccer team, Leeds United, for all his life. Andrew also followed the Yorkshire county cricket team. Andrew's interest in astronomy stemmed from the fact that at Ermysted's Grammar School someone donated a four-inch refracting telescope, so he and his friends used to go back in the evenings to investigate the rings of Saturn, the moons of Jupiter, and various nebulae. While an undergraduate at Cambridge, Andrew joined the astronomy club and ground an 8-inch mirror by hand as a part of a telescope that he set up in the backyard of his parents' house. Andrew spent hours observing with this telescope, and it was the wonder of the family. At Cambridge, Andrew obtained his bachelor's degree with first-class honors in 1969. During a short visit in London with his

  18. Muscular Dystrophy (MD)

    Science.gov (United States)

    ... boys. It is caused by the absence of dystrophin, a protein involved in maintaining the integrity of ... than Duchenne MD) have faulty or not enough dystrophin. Facioscapulohumeral MD usually begins in the teenage years. ...

  19. Cryptanalysis of MD2

    DEFF Research Database (Denmark)

    Knudsen, Lars Ramkilde; Mathiassen, John Erik; Muller, Frédéric

    2010-01-01

    This paper considers the hash function MD2 which was developed by Ron Rivest in 1989. Despite its age, MD2 has withstood cryptanalytic attacks until recently. This paper contains the state-of-the-art cryptanalytic results on MD2, in particular collision and preimage attacks on the full hash...

  20. A Reanalysis of Hurricane Andrew's Intensity.

    Science.gov (United States)

    Landsea, Christopher W.; Franklin, James L.; McAdie, Colin J.; Beven, John L., II; Gross, James M.; Jarvinen, Brian R.; Pasch, Richard J.; Rappaport, Edward N.; Dunion, Jason P.; Dodge, Peter P.

    2004-11-01

    Hurricane Andrew of 1992 caused unprecedented economic devastation along its path through the Bahamas, southeastern Florida, and Louisiana. Damage in the United States was estimated to be $26 billion (in 1992 dollars), making Andrew one of the most expensive natural disasters in U.S. history. This hurricane struck southeastern Florida with maximum 1-min surface winds estimated in a 1992 poststorm analysis at 125 kt (64 m s-1). This original assessment was primarily based on an adjustment of aircraft reconnaissance flight-level winds to the surface.Based on recent advancements in the understanding of the eyewall wind structure of major hurricanes, the official intensity of Andrew was adjusted upward for five days during its track across the Atlantic Ocean and Gulf of Mexico by the National Hurricane Center Best Track Change Committee. In particular, Andrew is now assessed by the National Hurricane Center to be a Saffir Simpson Hurricane Scale category-5 hurricane (the highest intensity category possible) at its landfall in southeastern Florida, with maximum 1-min winds of 145 kt (75 m s-1). This makes Andrew only the third category-5 hurricane to strike the United States since at least 1900. Implications for how this change impacts society's planning for such extreme events are discussed.

  1. Injector MD Days 2017

    CERN Document Server

    Rumolo, G

    2017-01-01

    The Injector Machine Development (MD) days 2017 were held on 23-24 March, 2017, at CERN with thefollowing main goals:Give a chance to the MD users to present their results and show the relevant progress made in 2016 onseveral fronts.Provide the MD users and the Operation (OP) crews with a general overview on the outcome and theimpact of all ongoing MD activities.Identify the open questions and consequently define - with priorities - a list of machine studies in theinjectors for 2017 (covering the operational beams, LHC Injectors Upgrade, High Luminosity LHC,Physics Beyond Colliders, other projects).Create the opportunity to collect and document the highlights of the 2016 MDs and define the perspectivesfor 2017.Discuss how to make best use of the MD time, in particular let the main MD user express their wishesand see whether/how OP teams can contribute to their fulfilment.

  2. Andrew A. Benson, 1917-2015.

    Science.gov (United States)

    Lichtenthaler, Hartmut K; Buchanan, Bob B; Douce, Roland; Govindjee

    2015-05-01

    On January 16, 2015, Professor Andrew Alm Benson, one of the leading plant biochemists of the twentieth century, died in La Jolla, California, at the age of 97; he was born on September 24, 1917. Benson was known especially for his pioneering studies on photosynthesis (CO2 assimilation, carbon reduction cycle) and plant lipids (phospholipid phosphatidyl glycerol; and the sulfolipid, sulfoquinovosyl diglyceride). A photograph of Benson is shown in Fig. 1. Fig. 1 Photograph of Andrew A. Benson. Annual Review of Plant Biology, Vol. 53, 2002, published with permission.

  3. Md Maidul Islam

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Md Maidul Islam. Articles written in Journal of Chemical Sciences. Volume 122 Issue 2 March 2010 pp 247-257 Full Papers. DNA minor groove binding of small molecules: Experimental and computational evidence · Prateek Pandya Md Maidul Islam G Suresh Kumar B ...

  4. Dr. Andrew Foster: A Literature Review

    Science.gov (United States)

    Runnels, Joel

    2017-01-01

    Often compared to Laurent Clerc, Thomas Gallaudet, and Alexander Graham Bell, Dr. Andrew Foster was a deaf African American who founded 32 schools for the deaf in 13 African nations. The 60th anniversary of his arrival in Liberia and Ghana and the 30th anniversary of his tragic death in a Rwanda airplane accident both occur in 2017. Renewed…

  5. George Andrew Olah: Across Conventional Lines

    Indian Academy of Sciences (India)

    Permanent link: https://www.ias.ac.in/article/fulltext/reso/022/12/1111-1153. Keywords. Electron-deficient intermediates, Friedel–Crafts chemistry, carbocations, carbanions, methanol economy, anthropogenic chemical carbon cycle. Abstract. Hungarian born American chemist, George Andrew Olah wasa prolific researcher.

  6. Identification of 253Md

    International Nuclear Information System (INIS)

    Kadkhodayan, B.; Czerwinski, K.R.; Kreek, S.A.; Hannink, N.J.; Gregorich, K.E.; Lee, D.M.; Nurmia, M.J.; Hoffman, D.C.; Hall, H.L.

    1992-01-01

    We have measured the half-life and production cross section of the new isotope 253 Md, produced via the 243 Am( 13 C,3n) reaction. Isolation of Md from other activities was accomplished using elution with ammonium α-hydroxyisobutyrate from a cation exchange resin column. Experiments were performed with different irradiation time intervals, but the chemical separation always began and ended at exactly the same length of time after the end of irradiation. All separations with the same irradation lengths were combined and analyzed for growth and decay of the 3.0-d 253 Fm daughter and 20.47-d 253 Es, granddaugther of 253 Md. The amount of 253 Es in each fraction depends on the length of each irradiation and the 253 Md half-life. An increase in the length of irradiation will cause a corresponding increase in the amount of the new isotope 253 Md and hence, in the amount of 253 Es produced, provided the length of irradiations are not very long compared to the half-life of 253 Md. In this way, the Md half-life was estimated to be about 6 minutes with a production cross section of the order of 50 nb. (orig.)

  7. Final Environmental Assessment for FY07-11 BRAC Construction Requirements at Andrews Air Force Base, Maryland

    Science.gov (United States)

    2007-09-01

    Branch Library of the Prince George’s County Memorial Library System at 14730 Main St. Upper Marlboro, MD 20772 and at the Andrews AFB Library at 1642...latifolia), highbush blueberry (Vaccinium corymbosum), and Christmas fern (Polystichium acrostichoides) (USAF 2001). Approximately 720 acres of...parks; national parks that exceeded 6,000 acres; and national wilderness areas and memorial parks that exceeded 5,000 acres if these areas were in

  8. Obituary: Andrew Lange (1957-2010)

    Science.gov (United States)

    Kamionkowski, Marc

    2011-12-01

    The worlds of physics and astrophysics were stunned to learn on 22 January 2010 that Andrew Lange, the Marvin L. Goldberger Professor of Physics at Caltech, had taken his own life the night before. He had succumbed to the severe depression that he had suffered from for many years, unbeknownst to even his closest colleagues. Lange will perhaps be best remembered as the co-leader of Boomerang, the balloon-borne experiment that provided the first high-angular-resolution map of the cosmic microwave background (CMB). And while this was certainly his most notable achievement, Andrew amassed a record of accomplishment as an instrumentalist, leader, mentor, and communicator that extended much further. Andrew was born in Urbana, Illinois on July 23, 1957, the son of an architect and a librarian, and raised primarily in Connecticut. His family and early friends remember him as a serious and extremely intelligent child and young man. Andrew Lange's lifelong interest in the CMB was nurtured as an undergraduate at Princeton University by David Wilkinson, and he recalled fondly a summer spent working with John Mather at Goddard Space Flight Center. Andrew Lange went to graduate school in physics at Berkeley where he worked in Paul Richards' group. Although his thesis project, the Berkeley-Nagoya rocket experiment, showed an anomalous sub-millimeter excess in the CMB spectrum that was shortly thereafter shown by a later flight of the same rocket and COBE-FIRAS to be incorrect, Lange's talents were recognized by the physics department at Berkeley who appointed him shortly after his PhD (1987) to their faculty. While on the Berkeley faculty, Andrew obtained early detections of the Sunyaev-Zeldovich effect, upper limits to small-angle CMB fluctuations, and important infrared constraints to the interstellar medium. He also led a pioneering instrument operating 300 mK detectors for a small infrared satellite experiment. This early work showed high ambition and daring, and it pioneered

  9. MD plans in 2012

    OpenAIRE

    Assmann, R

    2012-01-01

    Machine development sessions were performed in 2011 during dedicated slots of beam time. These MD studies were scheduled and planned in detail well before, reflecting the agreed priorities: further optimizing machine performance, exploring beam parameters beyond design targets, assessing machine limitations, testing new concepts and machine settings. The MD's in 2012 will build on the successful 2011 experience. The proposed priorities are discussed. A particular emphasis is put on how to bes...

  10. A History of the Andrew File System

    CERN Multimedia

    CERN. Geneva; Altman, Jeffrey

    2011-01-01

    Derrick Brashear and Jeffrey Altman will present a technical history of the evolution of Andrew File System starting with the early days of the Andrew Project at Carnegie Mellon through the commercialization by Transarc Corporation and IBM and a decade of OpenAFS. The talk will be technical with a focus on the various decisions and implementation trade-offs that were made over the course of AFS versions 1 through 4, the development of the Distributed Computing Environment Distributed File System (DCE DFS), and the course of the OpenAFS development community. The speakers will also discuss the various AFS branches developed at the University of Michigan, Massachusetts Institute of Technology and Carnegie Mellon University.

  11. Andrew shortens lifetime of Louisiana Barrier Islands

    Science.gov (United States)

    Bush, Susan

    Because the Isles Dernieres, a series of four barrier islands off the coast of Louisiana, have one of the most rapidly eroding shorelines in the world, geologists at the U.S. Geological Survey and the Louisiana Geological Survey have been monitoring erosion activity over the last several years, said Jeff Williams of the USGS in Reston, Va. Hurricane Andrew, which struck the state on August 26, caused severe erosional damage to these islands that has shortened their lifetimes.Before Andrew struck, geologists projected that Raccoon Island would disappear below sea level by the year 2001 and that Whiskey Island would disappear by 2016. Now, due to the severe erosion from Hurricane Andrew, the scientists claim that the islands may disappear before the turn of the century, and the other islands in the Dernieres chain are expected to follow suit within 2 decades. Raccoon, Whiskey, Trinity, and East islands make up the Isles Dernieres, which existed as one island, known as the Isle Derniere, before an 1856 hurricane and subsequent erosion.

  12. md. saimul islam

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. MD. SAIMUL ISLAM. Articles written in Journal of Genetics. Volume 95 Issue 3 September 2016 pp 551-563 RESEARCH ARTICLE. Frequent alterations of SLIT2–ROBO1–CDC42 signalling pathway in breast cancer: clinicopathological correlation · RITTWIKA BHATTACHARYA NUPUR ...

  13. Children describe life after Hurricane Andrew.

    Science.gov (United States)

    Coffman, S

    1994-01-01

    Hurricane Andrew, which devastated the south Florida coast in August 1992, left over 250,000 people homeless with multiple health and social problems. This nursing study explored the experiences of 17 children, ages 5 through 12, who lived in the geographic area of storm damage. Common experiences described by the children included remembering the storm, dealing with after-effects, and reestablishing a new life. In general, children described a sense of strangeness, articulated as "life is weird" after the hurricane. In addition to stressful responses, many positive reactions were described by children in the study, revealing that the disaster also had a maturing effect.

  14. Shallow water currents during Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Glenn, Scott M.

    1999-10-01

    Oceanographic measurements are used in combination with a numerical model to examine the influence of stratification on shallow water currents during the directly forced stage of a tropical cyclone (Hurricane Andrew) on the continental shelf. The following stratification-dependent coastal processes are examined: (1) turbulent mixing, (2) coastally trapped waves, (3) near-inertial oscillations, and (4) upwelling and downwelling. Turbulent mixing was strong within 1 Rw (radius of maximum winds) of the storm track, and stratification was nearly destroyed. Turbulent mixing was weak at distances greater than 2 Rw. The dominant coastal wave was a barotropic Kelvin wave generated as the storm surge relaxed after landfall. Baroclinic near-inertial oscillations were dominant at the shelf break and occurred along with a barotropic response on the middle shelf. Downwelling-favorable flow developed east of the track prior to the storm peak, and upwelling-favorable flow evolved west of the track as the eye crossed the shelf. The idealized storm flow was modified by local barotropic and baroclinic pressure gradients on the shelf. Ocean circulation during Hurricane Andrew was hindcast using both stratified and unstratified three-dimensional numerical models. For areas within 1 Rw of the storm track, the unstratified model matched the observed currents better than the stratified model, partly because of errors in the initial stratification. At distances greater than 2 Rw the influence of stratification increases, and the unstratified model does not reproduce the observed upwelling-favorable flow.

  15. Remote sensing for hurricane Andrew impact assessment

    Science.gov (United States)

    Davis, Bruce A.; Schmidt, Nicholas

    1994-01-01

    Stennis Space Center personnel flew a Learjet equipped with instrumentation designed to acquire imagery in many spectral bands into areas most damaged by Hurricane Andrew. The calibrated airborne multispectral scanner (CAMS), a NASA-developed sensor, and a Zeiss camera acquired images of these areas. The information derived from the imagery was used to assist Florida officials in assessing the devastation caused by the hurricane. The imagery provided the relief teams with an assessment of the debris covering roads and highways so cleanup plans could be prioritized. The imagery also mapped the level of damage in residential and commercial areas of southern Florida and provided maps of beaches and land cover for determination of beach loss and vegetation damage, particularly the mangrove population. Stennis Space Center personnel demonstrated the ability to respond quickly and the value of such response in an emergency situation. The digital imagery from the CAMS can be processed, analyzed, and developed into products for field crews faster than conventional photography. The resulting information is versatile and allows for rapid updating and editing. Stennis Space Center and state officials worked diligently to compile information to complete analyses of the hurricane's impact.

  16. Hurricane Andrew and a pediatric emergency department.

    Science.gov (United States)

    Quinn, B; Baker, R; Pratt, J

    1994-04-01

    To determine the effect of Hurricane Andrew on a pediatric emergency department. A retrospective analysis of ED visits through the use of computerized records and chart review. A children's hospital in South Florida. All patients presenting to the ED during the control week and the two study weeks after the hurricane. Census, diagnoses, admission rate, and patient geographic origin and age. During week 1, there was an average daily increase of 40.7% in patient volume (P < .01) and a 3.3% decrease in the admission rate (P < .01). The increased census was due mainly to local patients, rather than those from the most devastated areas. More patients were seen with open wounds, gastroenteritis, and impetigo (all, P < .05); more were more than 18 years old (P < .05). By the second week, both census and admission rate returned to normal; cases of cellulitis (P < .05) and open wounds (P < .001) were increased. Although not statistically significant, a higher percentage of hydrocarbon and/or bleach ingestions was seen for both weeks. Following a hurricane, personnel in a pediatric ED can expect to see an increased census, with more diagnoses of open wounds, gastroenteritis, and skin infections. They may also see hydrocarbon and bleach ingestions. Alerting parents to the potential for injury and accidental poisoning in their children after a hurricane may help prevent the reported morbidity.

  17. Andrew Smith: peame leidma tee majanduskasvuni, mis põhineb säästmisel, investeeringutel ja ekspordil / Andrew Smith

    Index Scriptorium Estoniae

    Smith, Andrew

    2010-01-01

    KPMG (UK) peaökonomist Andrew Smith vastab küsimustele, mis puudutavad majanduskriisi tekkimist, olukorra paranemist, majandusolukorda Suurbritannias, erinevusi Euroopa ja muude maailma piirkondade vahel, sarnasusi Eesti ja Suurbritannia majandusolukorra vahel ning prognoose edaspidiste arengute osas

  18. ADT fast losses MD

    CERN Document Server

    Priebe, A; Dehning, B; Redaelli, S; Salvachua Ferrando, BM; Sapinski, M; Solfaroli Camillocci, M; Valuch, D

    2013-01-01

    The fast beam losses in the order of 1 ms are expected to be a potential major luminosity limitation for higher beam energies after the LHC long shutdown (LS1). Therefore a Quench Test is planned in the winter 2013 to estimate the quench limit in this timescale and revise the current models. This experiment was devoted to determination the LHC Transverse Damper (ADT) as a system for fast losses induction. A non-standard operation of the ADT was used to develop the beam oscillation instead of suppressing them. The sign flip method had allowed us to create the fast losses within several LHC turns at 450 GeV during the previous test (26th March 2012). Thus, the ADT could be potentially used for the studies of the UFO ("Unidentied Falling Object") impact on the cold magnets. Verification of the system capability and investigations of the disturbed beam properties were the main objectives of this MD. During the experiment, the pilot bunches of proton beam were excited independently in the horizontal and vertical ...

  19. Grants Solutions -

    Data.gov (United States)

    Department of Transportation — The Grants Center of Excellence The Grants Center of Excellence (COE) delivers end-to-end grants management products and support to over 17 Federal partner agencies....

  20. The Future of the Andrew File System

    CERN Multimedia

    CERN. Geneva; Altman, Jeffrey

    2011-01-01

    The talk will discuss the ten operational capabilities that have made AFS unique in the distributed file system space and how these capabilities are being expanded upon to meet the needs of the 21st century. Derrick Brashear and Jeffrey Altman will present a technical road map of new features and technical innovations that are under development by the OpenAFS community and Your File System, Inc. funded by a U.S. Department of Energy Small Business Innovative Research grant. The talk will end with a comparison of AFS to its modern days competitors.

  1. Tilting at wave beams: a new perspective on the St Andrew's Cross

    Science.gov (United States)

    Akylas, T. R.; Kataoka, T.; Ghaemsaidi, S. J.; Holzenberger, N.; Peacock, T.

    2017-11-01

    The generation of internal gravity waves by a vertically oscillating cylinder that is tilted to the horizontal in a stratified fluid of constant buoyancy frequency, is investigated theoretically and experimentally. This forcing arrangement leads to a variant of the classical St Andrew's Cross that has certain unique features: (i) radiation of wave beams is limited due to a lower cut-off frequency set by the cylinder tilt angle to the horizontal; (ii) the response is essentially three-dimensional, as end effects eventually come into play when the cut-off frequency is approached, however long a cylinder might be. These results follow from kinematic considerations and are also confirmed by laboratory experiments. The kinematic analysis, moreover, suggests a resonance phenomenon near the cut-off frequency, where viscous and nonlinear effects are likely to play an important part. This scenario is examined by an asymptotic model as well as experimentally. Supported in part by NSF Grant DMS-1512925.

  2. Appreciating Unity in Diversity: An Interview with Andrew Solomon

    Science.gov (United States)

    Peters, Dane L.

    2014-01-01

    The theme of the AMS 2014 Annual Conference is "Unity in Diversity," a concept that also describes the work of conference keynote speaker Andrew Solomon. Solomon is a writer and lecturer on psychology and politics; winner of the National Book Award; and an activist for LGBT [lesbian, gay, bisexual, and transgender] rights, mental health,…

  3. Hurricane Andrew in Florida: Dynamics of a Disaster.

    Science.gov (United States)

    Willoughby, H. E.; Black, P. G.

    1996-03-01

    Four meteorological factors aggravated the devastation when Hurricane Andrew struck South Florida: completed replacement of the original eyewall by an outer, concentric eyewall while Andrew was still at sea; storm translation so fast that the eye crossed the populated coastline before the influence of land could weaken it appreciably, extreme wind speed, 82 m s1 winds measured by aircraft flying at 2.5 km; and formation of an intense, but nontornadic, convective vortex in the eyewall at the time of landfall. Although Andrew weakened for 12 h during the eyewall replacement, it contained vigorous convection and was reintensifying rapidly as it passed onshore. The Gulf Stream just offshore was warm enough to support a sea level pressure 20-30 hPa lower than the 922 hPa attained, but Andrew bit land before it could reach this potential. The difficult-to-predict mesoscale and vortex-scale phenomena determined the course of events on that windy morning, not a long-term trend toward worse hurricanes.

  4. Hurricane Andrew: Parent Conflict As a Moderator of Children's Adjustment.

    Science.gov (United States)

    Wasserstein, Shari B.; La Greca, Annette M.

    1998-01-01

    Three months after Hurricane Andrew, 89 children in grades four to six who lived in two-parent families and had experienced the hurricane were tested. Children's symptoms of posttraumatic stress disorder were related to their perceptions of parental conflict; this relationship was stronger for Hispanic children than for other ethnic groups.…

  5. The Mental Health Counselor's Role in Hurricane Andrew.

    Science.gov (United States)

    Dingman, Robert L.

    1995-01-01

    Discusses the effects of Hurricane Andrew on disaster workers, followed by some reported experiences of workers as well as victims. Background on natural disasters in general is given, along with information about crisis intervention. Discusses mental health interventions and various skills needed by disaster mental health counselors. (Author/KW)

  6. Andrew Tracey: Performer, Scholar, Teacher, Mentor | Thram | South ...

    African Journals Online (AJOL)

    A Legacy to Uphold Born to follow in his father Hugh Tracey's footsteps, Andrew Tracey has inspired countless people with his knowledge of African music. This he has done through his publications and films and his teaching and performing from the early days of his career in the 1960s through his Directorship of the ...

  7. Interview with Abel Laureate Sir Andrew J. Wiles

    DEFF Research Database (Denmark)

    Raussen, Martin Hubert; Skau, Christian

    2017-01-01

    Andrew J. Wiles is the recipient of the 2016 Abel Prize of the Norwegian Academy of Science and Letters. The interview was conducted by Martin Raussen And Christian Skau in Oslo on May 23, 2016, in conjunction with the Abel Prize celebration....

  8. Final Environmental Assessment Airfield Storm Drainage System Repair Joint Base Andrews-Naval Air Facility Washington, MD

    Science.gov (United States)

    2015-06-01

    conducted at JBA require the use and storage of hazardous materials, including flammable and combustible liquids, acids, aerosols, batteries, and petroleum...materials of any kind, including the driving of piles and placing of obstructions; changing existing drainage characteristics, sedimentation patterns

  9. Impact of Hurricane Andrew on FPL generation facilities

    International Nuclear Information System (INIS)

    Brannen, W.F.; Adams, R.L.

    1993-01-01

    In the pre-dawn hours of August 25, 1992, Hurricane Andrew made landfall in southern Dade County, Florida. The storm approached directly from the east and moved rapidly across the State and into the Gulf of Mexico. Andrew's intense winds caused unprecedented devastation to structures and facilities in its path. Not surprisingly, Florida Power and Light's (FPL) generation, transmission and distribution facilities in south Florida also suffered extensive damage. Two of FPL's electrical generating sites were located in the direct path of the storm and received its full brunt. This paper presents a review of the damage sustained by those plants, an overview of the unique recovery challenges encountered and a summary of the lessons learned from this experience

  10. Injuries and illnesses related to Hurricane Andrew--Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    On August 26, 1992, Hurricane Andrew struck Louisiana. On August 24, in anticipation of hurricane-related injuries and illnesses, the Office of Public Health (OPH), Louisiana Department of Health and Hospitals, in cooperation with hospital emergency room (ER) and public utility personnel and coroners, established an active emergency surveillance system in 19 parishes to monitor these events. This report summarizes the findings from this emergency surveillance system.

  11. Interview with 2018 Hooke medal winner Andrew McAinsh.

    Science.gov (United States)

    2018-03-14

    Andrew McAinsh received his PhD from the University of Cambridge, UK, working in the laboratory of Steve Jackson on DNA damage and repair mechanisms in yeast. He then joined the laboratory of Peter Sorger as a Jane Coffin Childs Fellow to work as a post-doc on kinetochore biology at the Massachusetts Institute of Technology, Boston, USA. In 2005, he returned to the UK to establish his independent laboratory at the Marie Curie Research Institute, Surrey, before moving to the University of Warwick in 2009 to co-found the Centre for Mechanochemical Cell Biology (CMCB). Subsequently, Andrew was appointed Professor of Cell Biology and became a Wellcome Senior Investigator, and was awarded a Royal Society Wolfson Research Merit Award. He co-directs the MRC Doctoral Training Partnership in Interdisciplinary Biomedical Research, and in 2017 became Head of Division of Biomedical Sciences at Warwick Medical School. Andrew is interested in understanding how the chromosomal multi-protein complex, the kinetochore, ensures error-free chromosome segregation. He is the recipient of the 2018 Hooke medal, established to recognize an emerging leader in cell biology. The Hooke medal is awarded at the annual spring meeting of the British Society for Cell Biology (BSCB). © 2018. Published by The Company of Biologists Ltd.

  12. A pioneer of tropical medicine worldwide: Andrew Balfour, of Khartoum.

    Science.gov (United States)

    Adeel, Ahmed A A

    2013-01-01

    This is an archival account of the career of Sir Andrew Balfour in Khartoum, Sudan during the period 1902 to 1913. As the first director of the Wellcome Tropical Research Laboratories in Khartoum during the period, Andrew Balfour was tasked with establishing the laboratories and at the same time he was engaged in founding the health services in Khartoum. Balfour worked in close collaboration and support from Henry Wellcome and Reginald Wingate, the Governor General of the Sudan. The energetic and meticulous sanitary work of Balfour had a remarkable impact, with Khartoum declared mosquito-free by 1910. Establishing a research base in the laboratories was met with many challenges but eventually Balfour managed to recruit a team of dedicated researchers and to produce well-circulated publications in tropical medicine. Balfour's work in Khartoum later lead him to a distinguished career in tropical medicine. In 1923 he was appointed the first Director of London School of Hygiene and Tropical Medicine. He was also elected President of the Royal Society of Tropical Medicine and Hygiene (1925-27). Sir Andrew Balfour, KCMG, CB, LL D (1873 -1931).

  13. USEPA Grants

    Data.gov (United States)

    U.S. Environmental Protection Agency — This is a provisional dataset that contains point locations for all grants given out by the USEPA going back to the 1960s through today. There are many limitations...

  14. The MacAndrew Scale as a measure of substance of abuse and delinquency among adolescents.

    Science.gov (United States)

    Rathus, S A; Fox, J A; Ortins, J B

    1980-04-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 suburban high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse, but was also shown to be related to crimes against property and persons and to marijuana usage. It was concluded that the MacAndrew Alcoholism Scale may not be uniquely sensitive to alcohol abuse among the population sampled.

  15. The Center for Adventist Research at Andrews University

    Directory of Open Access Journals (Sweden)

    Terry Dwain Robertson

    2015-01-01

    Full Text Available The Center for Adventist Research (CAR, an Andrews University and General Conference of Seventh-day Adventist organization, seeks to promote an understanding and appreciation of the heritage and mission of the Seventh-day Adventist Church (SDA. It combines the resources of the James White Library’s Adventist Heritage Center and the Ellen G. White Estate Branch Office to provide the most extensive collection of Adventist related resources in the world, both physically and digitally. An introduction to the background, collections, and activities of CAR is presented. Of particular interest are the digitization projects.

  16. Micropropagation and in vitro conservation of vanilla (Vanilla planifolia Andrews).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal

    2009-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a source of natural vanillin, plays a major positive role in the economy of several countries. A native to the Central America, its primary gene pool is threatened by deforestation and over collection that has resulted in disappearance of natural habitats and wild species. Therefore, multiplication and conservation of vanilla diversity is of paramount importance because of its narrow genetic base. It plays an important role in the production of disease free planting material for commercial cultivation. Simple protocols for micropropagation, in vitro conservation and synthetic seed production are described in this chapter which could further be applied to other related vanilla species as well.

  17. Prediction of posttraumatic stress symptoms in children after hurricane Andrew.

    Science.gov (United States)

    Vernberg, E M; Silverman, W K; La Greca, A M; Prinstein, M J

    1996-05-01

    The authors used an integrative conceptual model to examine the emergence of posttraumatic stress disorder (PTSD) symptoms in 568 elementary school-age children 3 months after Hurricane Andrew. The model included 4 primary factors: Exposure to Traumatic Events, Child Characteristics, Access to Social Support, and Children's Coping. Overall, 62% of the variance in children's self-reported PTSD symptoms was accounted for by the 4 primary factors, and each factor improved overall prediction of symptoms when entered in the analyses in the order specified by the conceptual model. The findings suggest that the conceptual model may be helpful to organize research and intervention efforts in the wake of natural disasters.

  18. Pharmaceutical services at a medical site after Hurricane Andrew.

    Science.gov (United States)

    Nestor, A; Aviles, A I; Kummerle, D R; Barclay, L P; Rey, J A

    1993-09-01

    The experiences of a group of volunteer clinical pharmacists who provided pharmacy services as part of a disaster relief effort following a hurricane are reported. Hurricane Andrew left many people in southern Florida without shelter and other basic necessities, including health care services. A group of seven pharmacists volunteered to provide services at a temporary medical site set up in a community center. The pharmacy stock consisted of donated drugs. The pharmacists dispensed medications directly to patients and worked closely with other volunteer medical personnel to make sure proper medications were used. Because the pharmacy stock was limited, physicians relied upon the pharmacists for information about therapeutic interchanges, dosage conversions, and new medications. Prescriptions were often ordered and dispensed with only oral instructions. The pharmacists also provided patient counseling, although problems caused by inexperience with certain types of patients, a language barrier, and substandard living conditions after the hurricane made counseling more difficult. The contributions of seven pharmacists who provided services at an emergency medical site after Hurricane Andrew were well received by other health care personnel and by the community.

  19. Posttraumatic stress disorder in adolescents after Hurricane Andrew.

    Science.gov (United States)

    Garrison, C Z; Bryant, E S; Addy, C L; Spurrier, P G; Freedy, J R; Kilpatrick, D G

    1995-09-01

    To examine rates and correlates of posttraumatic stress disorder (PTSD) in adolescents after Hurricane Andrew. A random-digit dialing sample of 158 Hispanic, 116 black, and 104 white adolescent-parent pairs were surveyed in high- and low-impact areas within Dade County, Florida, 6 months after Hurricane Andrew. Subjects completed a structured telephone interview focused on within-disaster experiences and emotional reaction, disaster-related losses, lifetime exposure to violent or traumatic events, recent stressful experiences, and psychiatric symptomatology. Approximately 3% of males (95% confidence interval 0.4 to 5.3) and 9% of females (95% confidence interval 4.6 to 13.7) met the criteria for PTSD. Rates were highest among blacks (8.3%, 95% confidence interval 2.3 to 14.2) and Hispanics (6.1%, 95% confidence interval 2.2 to 9.9) and increased with age (odds ratio of 1.34, 95% confidence interval 1.04 to 1.72) and the number of undesirable events reported (odds ratio of 1.38, 95% confidence interval 1.21 to 1.57). While only a relatively small percentage of adolescents reported symptoms consistent with a diagnosis of PTSD, most reported some posttraumatic symptoms. Postdisaster planning should recognize that common stressful events occurring after disasters may be more strongly associated with PTSD than magnitude of contact with the actual disaster.

  20. Hurricane Andrew-related injuries and illnesses, Louisiana, 1992.

    Science.gov (United States)

    McNabb, S J; Kelso, K Y; Wilson, S A; McFarland, L; Farley, T A

    1995-06-01

    To determine the extent and types of injuries and illnesses in Louisiana associated with or related to Hurricane Andrew, we gathered data from hospital emergency departments and coroner's offices on demographic variables, institution, nature and cause of the injury or illness, body part affected, location, and date and time of the event. A hurricane-related injury or illness was defined as one that occurred from noon on August 24, 1992, through midnight on September 21, 1992, as a direct or indirect result of the preparation for (preimpact), the impact of, or the clean-up after the hurricane (postimpact). Nineteen parishes in south-central Louisiana that were most affected by Hurricane Andrew provided data from patients seen in emergency departments and reports from coroner's offices. Active, advance surveillance of this type promotes and facilitates the reporting of disaster-related health outcomes. Future planning for hurricanes should take into account the high rate of cuts, lacerations, and puncture wounds, particularly during the postimpact phase.

  1. Vroeë Oos-Kaapse tekste: Andrew Geddes Bain (1797-1864) | van ...

    African Journals Online (AJOL)

    Early Eastern Cape Texts: Andrew Geddes Bain (1797-1864) [Afrikaans] Andrew Geddes Bain: fervent letter writer of satirical sketches of contemporary life, transport entrepeneur, military man, farmer, builder of bridges in the dry stone walling technique, autodidact, discoverer of the "Blinkwater Monster" fossil, as well as ...

  2. The Implementation of IAS 16 and IAS 41 at Andrew Peller Limited

    Science.gov (United States)

    Lapointe-Antunes, Pascale; Moore, James

    2013-01-01

    This case asks students to play the role of Doug Grodeckie, Manager of Financial Reporting at Andrew Peller Limited (APL). Doug was asked to prepare a report analyzing Andrew Peller Limited's current tangible long-lived assets disclosures and making recommendations on how best to comply with International Accounting Standard (IAS) 16 Property,…

  3. The MacAndrew Scale as a Measure of Substance Abuse and Delinquency among Adolescents.

    Science.gov (United States)

    Rathus, Spencer A.; And Others

    1980-01-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse but was also related to crimes against property and persons and to marijuana usage. (Author)

  4. Pamela Ngesa A Review of George Gonaís Andrew Mtagwaba ...

    African Journals Online (AJOL)

    Jimmy Gitonga

    Review of George Gona's Andrew Mtagwaba Kailembo: The Life and Times of an African Trade Unionist 173. Review of ... renowned Tanzanian labour movement leader, Andrew Mtagwaba Kailembo has received little .... hanging rather loosely, without clearly showing their role on the road to Pan-African trade union unity.

  5. The paths of Andrew A. Benson: a radio-autobiography.

    Science.gov (United States)

    Nonomura, Arthur M; Holtz, Barry; Biel, Karl Y; Cooney, Robert; Lorimer, George; Govindjee

    2017-10-01

    Andrew A. Benson, one of the greatest biochemists of our time, is celebrated on his centennial by the authors with whom he interacted performing experiments or contemplating metabolic pathways in a wide range of biological kingdoms. He charted the chemical flow of energy in cells, tissues, organs, plants, animals, and ecosystems. Benson collaborated with hundreds of colleagues to examine the natural history of autotrophy, mixotrophy, and heterotrophy while elucidating metabolic pathways. We present here a biological perspective of his body of studies. Benson lived from September 24, 1917, to January 16, 2015. Out of over 1000 autoradiograms he produced in his life, he left a legacy of 50 labeled autoradiograms to the authors who tell the story of his life's work that resulted in Benson's Protocol (Nonomura et al., Photosynth Res 127:369-378, 2016) that has been applied, over the years, for the elucidation of major metabolic pathways by many scientists.

  6. Measurement of perceived disruption during rebuilding following Hurricane Andrew.

    Science.gov (United States)

    Burnett, K; Ironson, G; Benight, C; Wynings, C; Greenwood, D; Carver, C S; Cruess, D; Baum, A; Schneiderman, N

    1997-10-01

    The purpose of this study was to develop and evaluate a measure of perceived disruption during rebuilding following a disaster. Two eight-item scales, which measured intensity of disruption during the entire repair phase (Intensity-RP) and intensity of disruption during the past month (Intensity-PM) were developed and administered to 135 survivors of Hurricane Andrew. At 9 to 12 months postdisaster, Intensity-RP and Intensity-PM were both significantly associated with scores on the Global Severity Index of the SCL-90-R, and with scores on the Impact of Event-Intrusion Scale; Intensity-PM alone was significantly associated with PTSD scores. Regression analyses indicated that each scale contributed significant unique variance in predicting mental health symptoms, even after controlling for relevant demographic and initial disaster exposure variables.

  7. Food-related coping strategies after Hurricane Andrew.

    Science.gov (United States)

    Magnus, M H

    1994-06-01

    This telephone survey examined food-related coping strategies in Floridian households after Hurricane Andrew. Approximately 137 households of university faculty and staff who lived in hurricane-damaged areas were interviewed. The average respondent was a college-educated woman between 41 and 60 years old. Prevailing food-purchasing problems included food stores that were either closed, without perishable food, distant, or crowded. In the absence of electricity and water, changes in food preparation included preparation of meals without a stove, more frequent use of grills and canned food, simpler meals, and less cooking. Changes in kitchen cleanup included using more disposables, cleaning more often, washing dishes by hand, and cleaning up less often because of damage in the kitchen. Respondents indicated that the hurricane experience taught them that they should have acquired more general supplies (eg, coolers, thermoses, propane stoves, and gas burners), more water and ice, and more nonperishable foods before the hurricane.

  8. Philip Andrew Traynor, DDS, FACD, (1874-1962).

    Science.gov (United States)

    Reed, R V

    1996-11-01

    Philip Andrew Traynor was arguably Delaware's most peerless dentist during his lifetime and even until today. He touched many lives, advanced the prestige of the dental profession, and served his state and country unselfishly as a national legislator. Forceful, no nonsense, take charge, persuasive, athlete, soldier, politico, legislator, canine judge, vocalist, dentist--all words that have been used to identify and describe this remarkable, unwonted, and extraordinary man--truly a dental diamond from the Diamond State. Historically it is important to view Traynor's wide ranging accomplishments in perspective. An Irish Catholic and son of the nation's second smallest state, Dr. Traynor affected the lives of thousands of people the length and breadth of his state and even his nation. Whether at the dental chair or congressional lecturn, Philip A. Traynor, a dual savant, imprinted his hallmark. This paper details the unselfish life of a perspicacious man and exceptional dentist, Philip A. Traynor, DDS.

  9. Deaths related to Hurricane Andrew in Florida and Louisiana, 1992.

    Science.gov (United States)

    Combs, D L; Parrish, R G; McNabb, S J; Davis, J H

    1996-06-01

    Information about circumstances leading to disaster-related deaths helps emergency response coordinators and other public health officials respond to the needs of disaster victims and develop policies for reducing the mortality and morbidity of future disasters. In this paper, we describe the decedent population, circumstances of death, and population-based mortality rates related to Hurricane Andrew, and propose recommendations for evaluating and reducing the public health impact of natural disasters. To ascertain the number and circumstances of deaths attributed to Hurricane Andrew in Florida and Louisiana, we contacted medical examiners in 11 Florida counties and coroners in 36 Louisiana parishes. In Florida medical examiners attributed 44 deaths to the hurricane. The mortality rate for directly-related deaths was 4.4 per 1 000 000 population and that for indirectly-related deaths was 8.5 per 1 000 000 population. In Louisiana, coroners attributed 11 resident deaths to the hurricane. Mortality rates were 0.6 per 1000 000 population for deaths directly related to the storm and 2.8 for deaths indirectly related to the storm. Six additional deaths occurred among non-residents who drowned in international waters in the Gulf of Mexico. In both Florida and Louisiana, mortality rates generally increased with age and were higher among whites and males. In addition to encouraging people to follow existing recommendations, we recommend emphasizing safe driving practices during evacuation and clean-up, equipping shelters with basic medical needs for the population served, and modifying zoning and housing legislation. We also recommend developing and using a standard definition for disaster-related deaths, and using population-based statistics to describe the public health effectiveness of policies intended to reduce disaster-related mortality.

  10. The discovery of 260Md and the decay properties of 258Fm, 258m,gMd and 259Md

    International Nuclear Information System (INIS)

    Lougheed, R.W.; Hulet, E.K.; Dougan, R.J.; Wild, J.F.; Dupzyk, R.J.; Henderson, C.M.; Moody, K.J.; Hahn, R.L.; Suemmerer, K.; Bethune, G.

    1986-01-01

    We have discovered a new neutron-rich isotope, 260 Md, from 18 O and 22 Ne bombardments of 254 Es. We observed a spontaneous-fission (SF) activity with a half-life of 32 days in electromagnetically separated fractions with mass number 260 from these bombardments and we measured the mass and kinetic energy distributions of this SF activity. The mass distribution was symmetric with the principal energy peak at a total kinetic energy (TKE) of 234 MeV, similar to previous observations for heavy fermium isotopes. Surprisingly, we also observed a smaller symmetric component with a TKE of 195 MeV. We interpret these two peaks in the TKE distribution as arising from two types of fission in the same nucleus, or bimodal fission. The observed fission activity may be either from the SF decay of 260 Md or from 260 Fm which would arise from electron-capture (EC) decay of 260 Md. We have eliminated the possible β - decay of 260 Md by measuring β - -SF time correlations for the decay of 260 Md and we plan to determine whether 260 Md decays by EC by measuring time correlations between fermium X-rays and SF events. We also measured various properties of the heavy fermium and mendelevium isotopes and obtained 1. more accurate cross-sections for the neutron-rich mendelevium isotopes which we use to predict the production rates of yet undiscovered nuclides, 2. improved half-life measurements for 258m,g Md and 259 Md, 3. confirmation of the EC decay of 258m Md by measurement of the fermium X-rays preceding the SF decay of 258 Fm and 4. very substantially improved mass and TKE distributions for the SF decay of 258 Fm and 259 Md. (orig.)

  11. First thoughts on MD priorities for 2012

    CERN Document Server

    Zimmermann, F; Assmann, R

    2012-01-01

    In 2012, 22 days of beam time will be allocated for LHC MDs. In this paper, after recalling the 2011 LHC MD experience, the MD rrequests for 2012 are reviewed. Three primary MD themes for 2012 can be identified: 1)pushing performance in 2012, 2)preparing for 2014/15, and 3)towards maximum luminosity. Example topics include emittance growth in collision or enhanced satellites for theme 1), 25 ns operation for 2), and ATS optics for 3). Structures lists of MD requests and topics for each theme as well as some initial thoughts on the MD priorities are presented. For certain topics, "start-of-fill MDs" are proposed in order to most efficiently use of the available beam time.

  12. Third-order gas-liquid phase transition and the nature of Andrews critical point

    Directory of Open Access Journals (Sweden)

    Tian Ma

    2011-12-01

    Full Text Available The main objective of this article is to study the nature of the Andrews critical point in the gas-liquid transition in a physical-vapor transport (PVT system. A dynamical model, consistent with the van der Waals equation near the Andrews critical point, is derived. With this model, we deduce two physical parameters, which interact exactly at the Andrews critical point, and which dictate the dynamic transition behavior near the Andrews critical point. In particular, it is shown that 1 the gas-liquid co-existence curve can be extended beyond the Andrews critical point, and 2 the transition is first order before the critical point, second-order at the critical point, and third order beyond the Andrews critical point. This clearly explains why it is hard to observe the gas-liquid phase transition beyond the Andrews critical point. Furthermore, the analysis leads naturally the introduction of a general asymmetry principle of fluctuations and the preferred transition mechanism for a thermodynamic system. The theoretical results derived in this article are in agreement with the experimental results obtained in (K. Nishikawa and T. Morita, Fluid behavior at supercritical states studied by small-angle X-ray scattering, Journal of Supercritical Fluid, 13 (1998, pp. 143-148. Also, the derived second-order transition at the critical point is consistent with the result obtained in (M. Fisher, Specific heat of a gas near the critical point, Physical Review, 136:6A (1964, pp. A1599-A1604.

  13. A transnational conference romance: Elsie Andrews, Hildegarde Kneeland, and the Pan-Pacific Women's Association.

    Science.gov (United States)

    Laurie, Alison J

    2009-01-01

    Elsie Andrews, a feminist activist from New Zealand, met Dr. Hildegarde Kneeland, a progressive economist from the United States, at the 1934 Pan-Pacific Women's Association conference in Honolulu. Andrews wrote diaries of her attendance at conferences, and in these writes openly of her attraction and romantic feelings for Kneeland, despite her own long-term domestic partnership back in New Plymouth with Muriel Kirton. This article considers the role conference romances may have played for Andrews and others in encouraging their interest in women's organizations, in the context of literature on romantic friendships and lesbianism.

  14. Cloud-to-ground lightning in Hurricane Andrew

    Science.gov (United States)

    Molinari, John; Moore, Paul K.; Idone, Vincent P.; Henderson, Ronald W.; Saljoughy, Arsalan B.

    1994-08-01

    The spatial and temporal distribution of cloud-to-ground lightning was examined in Hurricane Andrew of 1992. Lightning locations available from the National Lightning Detection Network were superimposed on infrared satellite images to relate lightning activity to hurricane cloud structure. A distinct radial variation occurred in time-averaged flash density, with a weak maximum in the eye wall, a region of near-zero flash density 40 to 100 km from the center, and a steady increase to a large maximum in the outer rainbands 190 km from the center. This radial distribution is consistent with the convective structure of mature hurricanes. Eye wall lightning tended to be episodic, occurring almost exclusively prior to and during periods of intensification of the storm. During these periods, negative flashes occurred several kilometers inward from the highest eye wall cloud tops, in the region of the largest radar reflectivity. Positive eye wall flashes, while small in number, tended to occur directly under the highest cloud tops. The results are suggestive of a normal dipole in sign but outwardly tilted along the sloping eye wall. In general, hurricane flash characteristics resembled those for a background data set of nonhurricane flashes from the same area. The exception occurred for negative flashes in the eye wall, which had a much smaller mean peak current than the background (25.3 kA versus 44.9 kA).

  15. Psychological effects of Hurricane Andrew on an elementary school population.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Tanner, S; Perez, D; Rothe, E; Campo-Bowen, A E; Lahey, B L

    1995-09-01

    To explore the prevalence and progression of posttraumatic symptomatology (PTS), using emotional and behavioral indices of psychopathology in school-age children in the pathway of Hurricane Andrew (HI-IMPACT) and in a comparison group north of Miami (LO-IMPACT). Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form (TRF) were administered 8 weeks and 32 weeks after the hurricane. In addition, 21 measures of disruptive behavior cataloged by Dade County Public Schools were aggregated and compared by grading period between pre- and posthurricane school years. There were no statistically significant differences between the two schools in PTS at 8 weeks after the hurricane, although the children in the HI-IMPACT school were more likely to have severe PTS. TRF findings at 8 weeks revealed that children in the HI-IMPACT school evidenced lower means on the eight TRF scales and on the broader Internalizing and Externalizing measures. Analysis of the disruptive behavior revealed a drop in the marking period immediately after the hurricane in the HI-IMPACT area, but an opposite effect was observed in the LO-IMPACT area. After the hurricane there was an initial increase in PTS and a concomitant decrease in other measures of behavior and psychopathology. PTS remained relatively high throughout the school year, but there was a rebound and subsequent normalization of the measures of disruptive behavior.

  16. Andrew Liehr and the structure of Jahn-Teller surfaces

    Science.gov (United States)

    Chibotaru, Liviu F.; Iwahara, Naoya

    2017-05-01

    The present article is an attempt to draw attention to a seminal work by Andrew Liehr “Topological aspects of conformational stability problem” [1, 2] issued more than half century ago. The importance of this work stems from two aspects of static Jahn-Teller and pseudo-Jahn-Teller problems fully developed by the author. First, the work of Liehr offers an almost complete overview of adiabatic potential energy surfaces for most known Jahn-Teller problems including linear, quadratic and higher-order vibronic couplings. Second, and most importantly, it identifies the factors defining the structure of Jahn-Teller surfaces. Among them, one should specially mention the minimax principle stating that the distorted Jahn-Teller systems tend to preserve the highest symmetry consistent with the loss of their orbital degeneracy. We believe that the present short reminiscence not only will introduce a key Jahn-Teller scientist to the young members of the community but also will serve as a vivid example of how a complete understanding of a complex problem, which the Jahn-Teller effect certainly was in the beginning of 1960s, can be achieved.

  17. Does Andrews facial analysis predict esthetic sagittal maxillary position?

    Science.gov (United States)

    Resnick, Cory M; Daniels, Kimberly M; Vlahos, Maryann

    2018-04-01

    Cephalometric analyses have limited utility in planning maxillary sagittal position for orthognathic surgery. In Six Elements of Orofacial Harmony, Andrews quantified maxillary position relative to forehead projection and angulation and proposed an ideal relationship. The purpose of this study was to investigate the ability of this technique to predict esthetic sagittal maxillary position. Survey study including a male and female with straight facial profiles, normal maxillary incisor angulations, and Angle's Class I. Maxillary position was modified on lateral photographs to create 5 images for each participant with incisor-goal anterior limit line (GALL) distances of -4, -2, 0, +2, and +4 mm. A series of health care professionals and laypeople were asked to rate each photo in order of attractiveness. A total of 100 complete responses were received. Incisor-GALL distances of +4 mm (41%) and +2 mm (40%) were most commonly considered "most esthetic" for the female volunteer (P < .001). For the male volunteer, there were 2 peak "most esthetic" responses: incisor-GALL distances of 0 mm (37%) and -4 mm (32%) (P < .001). Respondents considered maxillary incisor position 2 to 4 mm anterior to GALL most attractive in a woman and 0 to 4 mm posterior to GALL most esthetic in a man. Using these modified target distances, this analysis may be useful for orthognathic surgery planning. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Multi-Dimensional Games (MD-Games)

    OpenAIRE

    Ruiz Estrada, M.A.

    2009-01-01

    This paper introduces the concept of Multi-Dimensional games (MD-games) based on the application of an alternative mathematical and graphical modeling approach to study the game theory from a multi-dimensional perspective. In fact, the MD-Games request the application of the mega-space coordinate system to visualize a large number of games, players, strategies and pay-offs functions into the same graphical space.

  19. Mida mõtleb professor Andrew Mayo? / Anne-Mari Ernesaks

    Index Scriptorium Estoniae

    Ernesaks, Anne-Mari

    2005-01-01

    PARE koordinaator tutvustab tuntud inimkapitali ideoloogi Andrew Mayo raamatut "Ettevõtte inimväärtus". Raamatu autori hinnangul on tänapäeva organisatsioonides juhtimise olulisim ülesanne inimese juhtimine varana. Lisa: Konverents

  20. Active morbidity surveillance after Hurricane Andrew--Florida, 1992.

    Science.gov (United States)

    Lee, L E; Fonseca, V; Brett, K M; Sanchez, J; Mullen, R C; Quenemoen, L E; Groseclose, S L; Hopkins, R S

    1993-08-04

    To describe the health status of and to detect disease outbreaks in the population affected by Hurricane Andrew in south Dade County, Florida. The Florida Department of Health and Rehabilitative Services and the US Army conducted active surveillance for gastrointestinal illness, respiratory illness, injury, and other index conditions by monitoring civilian and service member visits to care sites (civilian and military free care sites and hospital emergency departments) from August 30 (1 week after the hurricane's landfall) through September 30, 1992. South Dade County, Florida. Proportional morbidity: the number of daily visits for each index condition divided by the total number of visits, expressed as a percentage. Morbidity rate: the total number of daily visits by service members divided by the total number of service members, expressed as a percentage. Six index conditions accounted for 41.3% of visits to civilian free care sites: diarrhea (4.7%), cough (4.7%), other infection (9.6%), rash (5.4%), animal bite (1.2%), and injury (15.7%). At military free care sites, five index conditions accounted for 75.7% of civilian visits: injury (23.7%), dermatologic illness (12.4%), respiratory illness (9.9%), gastrointestinal illness (5.3%), and other medical conditions (24.4%). Two index conditions accounted for 54.1% of service member visits: injury (36.2%) and dermatologic illness (17.9%). During the 5 weeks after the hurricane, proportional morbidity from injury decreased; proportional morbidity from respiratory illness increased; and proportional morbidity from diarrhea was stable. No infectious disease outbreaks occurred. Injuries were an important source of morbidity throughout the surveillance period, especially among service members. Enteric and respiratory agents did not cause disease outbreaks, despite alarming rumors to the contrary.

  1. Wetland Program Pilot Grants

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Wetland Grant Database (WGD) houses grant data for Wetland Program Development Grants (created by EPA in 1990 under the Clean Water Act Section 104(b)(3)...

  2. MD2190: Q" Stabilization during injection

    CERN Document Server

    Schenk, Michael; Li, Kevin Shing Bruce; Malina, Lukas; Metral, Elias; Tomas Garcia, Rogelio; CERN. Geneva. ATS Department

    2018-01-01

    This MD is a follow-up study of MD1831, where single bunches were stabilized against impedance-driven instabilities at 6.5 TeV in the LHC with Q''. The goals are (i) to explore whether an amplitude detuning free Q'' knob can be implemented at injection energy, and (ii) whether Q'' can provide beam stability at injection, where the beams suffer mostly from electron cloud effects. Ideally, this would relax the use of the Landau octupoles and may help in preserving the beam quality by reducing dynamic aperture limitations originating from the octupoles. The MD has been split into two parts: First, optics corrections were put in place to minimize beta-beating and linear coupling introduced by the knobs. The corrections were achieved by means of orbit bumps and skew quadrupole knobs. Machine safety was then validated with loss maps. While the betatron loss maps were approved, the off-momentum maps showed a priori unexpected losses in several arcs and the MD was stopped at this point for reasons of machine protecti...

  3. MD2725: 16L2 aperture measurement

    CERN Document Server

    Mirarchi, Daniele; Rossi, Roberto; CERN. Geneva. ATS Department

    2018-01-01

    Dumps induced by sudden increase of losses in the half-cell 16L2 have been a serious machine limitation during the 2017 run. The aim of this MD was to perform local aperture measurements in order to assess differences after the beam screen regeneration, compared to first measurements in 2017.

  4. The Multidimensional Curriculum Model (MdCM)

    Science.gov (United States)

    Vidergor, Hava E.

    2010-01-01

    The multidimensional Curriculum Model (MdCM) helps teachers to better prepare gifted and able students for our changing world, acquiring much needed skills. It is influenced by general learning theory of constructivism, notions of preparing students for 21st century, Teaching the Future Model, and current comprehensive curriculum models for…

  5. MD-11 PCA - Research flight team photo

    Science.gov (United States)

    1995-01-01

    On Aug. 30, 1995, a the McDonnell Douglas MD-11 transport aircraft landed equipped with a computer-assisted engine control system that has the potential to increase flight safety. In landings at NASA Dryden Flight Research Center, Edwards, California, on August 29 and 30, the aircraft demonstrated software used in the aircraft's flight control computer that essentially landed the MD-11 without a need for the pilot to manipulate the flight controls significantly. In partnership with McDonnell Douglas Aerospace (MDA), with Pratt & Whitney and Honeywell helping to design the software, NASA developed this propulsion-controlled aircraft (PCA) system following a series of incidents in which hydraulic failures resulted in the loss of flight controls. This new system enables a pilot to operate and land the aircraft safely when its normal, hydraulically-activated control surfaces are disabled. This August 29, 1995, photo shows the MD-11 team. Back row, left to right: Tim Dingen, MDA pilot; John Miller, MD-11 Chief pilot (MDA); Wayne Anselmo, MD-11 Flight Test Engineer (MDA); Gordon Fullerton, PCA Project pilot; Bill Burcham, PCA Chief Engineer; Rudey Duran, PCA Controls Engineer (MDA); John Feather, PCA Controls Engineer (MDA); Daryl Townsend, Crew Chief; Henry Hernandez, aircraft mechanic; Bob Baron, PCA Project Manager; Don Hermann, aircraft mechanic; Jerry Cousins, aircraft mechanic; Eric Petersen, PCA Manager (Honeywell); Trindel Maine, PCA Data Engineer; Jeff Kahler, PCA Software Engineer (Honeywell); Steve Goldthorpe, PCA Controls Engineer (MDA). Front row, left to right: Teresa Hass, Senior Project Management Analyst; Hollie Allingham (Aguilera), Senior Project Management Analyst; Taher Zeglum, PCA Data Engineer (MDA); Drew Pappas, PCA Project Manager (MDA); John Burken, PCA Control Engineer.

  6. Preliminary report: medical examiner reports of deaths associated with Hurricane Andrew--Florida, August 1992.

    Science.gov (United States)

    1992-09-04

    On August 24, 1992, at 1:40 a.m. eastern daylight time (EDT), rain bands associated with Hurricane Andrew reached the eastern coast of Florida. At 4:45 a.m. EDT, Hurricane Andrew made landfall 35 miles southeast of Miami at Homestead, with sustained winds of 145 miles per hour (mph) and gusts of 164 mph. These winds extended 45 miles outward of the storm center. The storm moved across the state at 18 mph toward the Gulf of Mexico (Figure 1). The tidal surge on the eastern coast was estimated at 7-19 feet. During the storm, approximately 2.5 million Florida residents were left without electrical power, and approximately 56,000 family dwelling units were destroyed or severely damaged. This report presents preliminary data from Florida medical examiner (ME) offices about deaths attributed to Hurricane Andrew.

  7. Analyzing after-action reports from Hurricanes Andrew and Katrina: repeated, modified, and newly created recommendations.

    Science.gov (United States)

    Knox, Claire Connolly

    2013-01-01

    Thirteen years after Hurricane Andrew struck Homestead, FL, Hurricane Katrina devastated the Gulf Coast of Mississippi, Alabama, and southeastern Louisiana. Along with all its destruction, the term "catastrophic" was redefined. This article extends the literature on these hurricanes by providing a macrolevel analysis of The Governor's Disaster Planning and Response Review Committee Final Report from Hurricane Andrew and three federal after-action reports from Hurricane Katrina, as well as a cursory review of relevant literature. Results provide evidence that previous lessons have not been learned or institutionalized with many recommendations being repeated or modified. This article concludes with a discussion of these lessons, as well as new issues arising during Hurricane Katrina.

  8. Capacities of template-type platforms in the Gulf of Mexico during hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Bea, R.G.; Loch, K.J.; Young, P.L. [Univ. of California, Berkeley, CA (United States)

    1997-02-01

    This paper details results from nonlinear analyses of the ultimate limit state performance characteristics of four Gulf of Mexico (GOM) platforms subjected to intense loadings from hurricane Andrew. These four platforms were located to the east of the track of hurricane Andrew, and were thus in the most intense portion of the storm (Smith, 1993). The nonlinear analyses are able to replicate details of the observed behavior of the four structures. This replication is very dependent on realistic characterization of the performance characteristics of the pile foundations and on accurate information on the as is condition of the platforms before the storm.

  9. 76 FR 58292 - Announcement of Funding Awards for Fiscal Year 2011; Doctoral Dissertation Research Grant Program

    Science.gov (United States)

    2011-09-20

    .... The Board of Trustees of the University of Illinois, Mr. David Perry, The Board of Trustees of the.... Grant: $24,964 to Hye- Sung Han. 10. University of Maryland Baltimore, Ms. Julianne Oktay, University of Maryland Baltimore, 620 West Lexington Street, 4th Floor, Baltimore, MD 21201. Grant: $20,386 to Kathleen...

  10. The Role of the U.S. Army Medical Department in Domestic Disaster Assistance Operations. Lessons Learned from Hurricane Andrew.

    Science.gov (United States)

    1996-04-15

    Hurricane Andrew , which struck South Dade County, Florida on the morning of 24 August 1992, was the ’worst natural disaster ever to hit the United...and Medical). The study also addresses the Army Medical Department’s role in the Hurricane Andrew operations and closes with a review of the medically

  11. MD on UFOs at MKIs and MKQs

    CERN Document Server

    Baer, T; Bartmann, W; Bracco, C; Carlier, E; Dehning, B; Garrel, N; Goddard, B; Jackson, S; Jimenez, M; Kain, V; Mertens, V; Misiowiec, M; Nordt, A; Papotti, G; Uythoven, J; Wenninger, J; Zerlauth, M; Zamantzas, C; Zimmermann, F

    2012-01-01

    UFOs ("Unidentified Falling Objects") are expected to be one of the major known performance limitation of the LHC. In this MD, the production mechanism and the dynamics of UFOs at the injection kicker magnets (MKIs) and the tune kicker magnets (MKQs) were studied. This was done by pulsing the MKIs and MKQs on a gap in the partly filled machine. During the MD, in total 58 UFO-type beam loss patterns were observed directly after pulsing the MKIs. None were observed after pulsing the MKQs, which provides important input for possible mitigation strategies. The temporal and spatial distribution of the UFO events could be determined by using a dedicated BLM Study Buffer, the implications for the UFO dynamics are discussed.

  12. On the Record: with Olly Owen and Andrew Faull | Owen | South ...

    African Journals Online (AJOL)

    ... of International Development at the University of Oxford. In 2012 he completed his doctorate in Social and Cultural Anthropology at Oxford. This involved an ethnographic study of, and fieldwork with, the Nigerian Police Force. Andrew Faull is a doctoral research student at the Centre for Criminology, University of Oxford.

  13. Joshua Rodda: Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History

    Directory of Open Access Journals (Sweden)

    Joachim Schwend

    2015-01-01

    Full Text Available This contribution offers a review of Joshua Rodda's Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History. Farnham, Surrey: Ashgate, 2014. 252 pages, regular price £ 70, 234 x 156 mm, ISBN 978–1–4724–1555–4.

  14. Commentary on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence"

    Science.gov (United States)

    Wolfram, Gary; Coulson, Andrew J.

    2009-01-01

    In this article, the authors comment on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence." The authors believe that Coulson's paper is a very interesting review of the literature on the ability of market-produced education to outperform government-produced education. Coulson's response on this commentary…

  15. Crisis Intervention with Survivors of Natural Disaster: Lessons from Hurricane Andrew.

    Science.gov (United States)

    Shelby, Janine S.; Tredinnick, Michael G.

    1995-01-01

    Crisis intervention has typically been conceptualized as seeking a return of clients to a state of equilibrium. Personal work experience with Hurricane Andrew survivors has led to an appreciation of the importance of several considerations. Develops a proactive approach, attempting to recognize and extend clients' preexisting strengths. Offers…

  16. News of Hurricane Andrew: The Agenda of Sources and the Sources' Agendas.

    Science.gov (United States)

    Salwen, Michael B.

    1995-01-01

    Studies quotations in newspaper coverage of Hurricane Andrew, showing that individuals who were not affiliated with government or business were quoted most often. Shows that most sources were quoted as experts, with individuals represented as suffering victims, providing the news media with human interest quotations. Notes that most sources…

  17. Posttraumatic Stress, Depression, and Social Support among College Students after Hurricane Andrew.

    Science.gov (United States)

    Pickens, Jeffrey; And Others

    1995-01-01

    One month after Hurricane Andrew, surveyed students who reported experiencing the most severe impact damage from the storm also reported experiencing the most stress, anxiety, and depressive symptoms. Regression analyses revealed that material and emotional social support were significant predictors of anxiety and depression scores after the…

  18. Stressing Memory: Long-Term Relations among Children's Stress, Recall and Psychological Outcome following Hurricane Andrew

    Science.gov (United States)

    Sales, Jessica McDermott; Fivush, Robyn; Parker, Janat; Bahrick, Lorraine

    2005-01-01

    We examined relations among stress, children's recall, and psychological functioning following Hurricane Andrew. Thirty-five children from mixed socioeconomic backgrounds were divided into low-, moderate-, and high-stress groups and were interviewed about the hurricane immediately after the storm and 6 years later. Our primary interest, stemming…

  19. Airborne Videography and GPS for Assessment of Forest Damage in Southern Louisiana from Hurricane Andrew

    Science.gov (United States)

    D.M. Jacobs; Susan Eggen-McIntosh

    1993-01-01

    Abstract: One week after Hurricane Andrew made landfall in Louisiana in August 1992, an airborne videography system, with a global positioning system (GPS) receiver, was used to assess timberland damage across a 1.7 million-ha (4.2 million-acre) study area. Ground observations were made to identify different intensities of timber damage and then...

  20. Visions and Vanities: John Andrew Rice of Black Mountain College. Southern Biography Series.

    Science.gov (United States)

    Reynolds, Katherine Chaddock

    This biography presents the life of John Andrew Rice, who founded Black Mountain College (North Carolina) in 1933 to implement his philosophy of education, including the centrality of artistic experience and emotional development to learning in all disciplines and the need for democratic governance shared between faculty and students. Born in…

  1. Building a "cyber forest" in complex terrain at the Andrews Experimental Forest

    Science.gov (United States)

    Donald L. Henshaw; Fred Bierlmaier; Barbara J. Bond; Kari B. O' Connell

    2008-01-01

    Our vision for a future "cyber forest" at the Andrews Experimental Forest foresees high performance wireless communications enhancing connectivity among remote field research locations, station headquarters, and beyond to the university and outside world. New sensor technologies and collaboration tools foretell exponential increases in data and information...

  2. 77 FR 73967 - Drawbridge Operation Regulation; Bear Creek, Dundalk, MD

    Science.gov (United States)

    2012-12-12

    ...-AA09 Drawbridge Operation Regulation; Bear Creek, Dundalk, MD AGENCY: Coast Guard, DHS. ACTION... Avenue across Bear Creek, mile 3.4, between Dundalk and Sparrows Point, MD. The proposed change would... Notice of Proposed Rulemaking entitled ``Drawbridge Operation Regulation; Bear Creek, Dundalk, MD'' in...

  3. mdFoam+: Advanced molecular dynamics in OpenFOAM

    Science.gov (United States)

    Longshaw, S. M.; Borg, M. K.; Ramisetti, S. B.; Zhang, J.; Lockerby, D. A.; Emerson, D. R.; Reese, J. M.

    2018-03-01

    This paper introduces mdFoam+, which is an MPI parallelised molecular dynamics (MD) solver implemented entirely within the OpenFOAM software framework. It is open-source and released under the same GNU General Public License (GPL) as OpenFOAM. The source code is released as a publicly open software repository that includes detailed documentation and tutorial cases. Since mdFoam+ is designed entirely within the OpenFOAM C++ object-oriented framework, it inherits a number of key features. The code is designed for extensibility and flexibility, so it is aimed first and foremost as an MD research tool, in which new models and test cases can be developed and tested rapidly. Implementing mdFoam+ in OpenFOAM also enables easier development of hybrid methods that couple MD with continuum-based solvers. Setting up MD cases follows the standard OpenFOAM format, as mdFoam+ also relies upon the OpenFOAM dictionary-based directory structure. This ensures that useful pre- and post-processing capabilities provided by OpenFOAM remain available even though the fully Lagrangian nature of an MD simulation is not typical of most OpenFOAM applications. Results show that mdFoam+ compares well to another well-known MD code (e.g. LAMMPS) in terms of benchmark problems, although it also has additional functionality that does not exist in other open-source MD codes.

  4. Superfund Technical Assistance Grants

    Data.gov (United States)

    U.S. Environmental Protection Agency — This asset includes data related to the Superfund Technical Assistance Grant program, including grant number, award amounts, award dates, period of performance,...

  5. SRA Grant Writing Tutorial

    Science.gov (United States)

    This tutorial will help give your organization a broad but succinct analysis of what the SRA grant program is about. This self-paced tutorial is organized under two segments: Overview of Grant Program and Program Details.

  6. IGMS Construction Grants Overview

    Science.gov (United States)

    The Integrated Grants Management System (IGMS) is a web-based system that contains information on the recipient of the grant, fellowship, cooperative agreement and interagency agreement, including the name of the entity accepting the award.

  7. Gordon Fullerton in PCA (MD-11) Simulator

    Science.gov (United States)

    1998-01-01

    NASA research pilot Gordon Fullerton 'flying' in the MD-11 simulator during the Propulsion Controlled Aircraft (PCA) project. This investigation grew out of the crash of a DC-10 airliner on July 19, 1989, following an explosion in the rear engine which caused the loss of all manual flight controls. The flight crew attempted to control the airliner using only the thrust from the two remaining engines. Although the DC-10 crashed during the landing attempt, 184 of the 296 passengers and crew aboard survived. The PCA effort at the Dryden Flight Research Center grew out of the crash, and attempted to develop a means to successfully land an aircraft using only engine thrust. After more than five years of work, on August 29, 1995, Gordon Fullerton made the first PCA touchdown aboard an MD-11 airliner (a later version of the DC-10). The concept was further refined over the years that followed this first landing. Simulators were essential ingredients of the PCA development process. The feasibility of the concept was first tested with an F-15 simulator, then the results of actual flight tests in an F-15 were incorporated back into the simulator. Additional simulations were run on the Boeing 720 airliner simulator used in the Controlled Impact Demonstration project. After the MD-11 test landings, Boeing 747 and 757 simulators tested a wide range of possible situations. Simulations even helped develop a method of landing an airliner if it lost its complete hydraulic system as well as a wing engine, by transferring fuel to shift the center of gravity toward the working engine. The most extreme procedure was undertaken in a 747 simulator. The aircraft simulated the loss of the hydraulic system at 35,000 feet and rolled upside down. Then, the PCA mode was engaged, the airliner righted itself, leveled its wings, and made an approach nearly identical to that of a normal auto landing.

  8. LHC MD 2042: Persistent Injection Oscillations

    CERN Document Server

    Karpov, Ivan; Argyropoulos, Theodoros; Baudrenghien, Philippe; Chapochnikova, Elena; Timko, Helga; CERN. Geneva. ATS Department

    2018-01-01

    This MD note summarizes the measurements performed to study persistent longitudinal oscillations after injection into the LHC. It was found that they build up due to mismatch, and can lead to particle losses and uncontrolled bunch lengthening. For the first time, profile measurements and ObsBox data acquisitions were triggered at injection to obtain first-turn data. The measurements took place on 16th September 2017 between 14:30 and 19:30, and between 27th November 2017 20:00 and 28th November 2017 04:00.

  9. 76 FR 2607 - Airworthiness Directives; MD Helicopters, Inc. (MDHI) Model MD900 Helicopters

    Science.gov (United States)

    2011-01-14

    ... MDHI Model MD900 helicopters. That AD currently requires turning on both Vertical Stabilizer Control... Stability Augmentation System (YSAS) for the Model 500N and 600N helicopters and to the VSCS for the Model... also requires turning ON both VSCS switches to reduce pilot workload and to help control the helicopter...

  10. Combining Rosetta with molecular dynamics (MD): A benchmark of the MD-based ensemble protein design.

    Science.gov (United States)

    Ludwiczak, Jan; Jarmula, Adam; Dunin-Horkawicz, Stanislaw

    2018-02-14

    Computational protein design is a set of procedures for computing amino acid sequences that will fold into a specified structure. Rosetta Design, a commonly used software for protein design, allows for the effective identification of sequences compatible with a given backbone structure, while molecular dynamics (MD) simulations can thoroughly sample near-native conformations. We benchmarked a procedure in which Rosetta design is started on MD-derived structural ensembles and showed that such a combined approach generates 20-30% more diverse sequences than currently available methods with only a slight increase in computation time. Importantly, the increase in diversity is achieved without a loss in the quality of the designed sequences assessed by their resemblance to natural sequences. We demonstrate that the MD-based procedure is also applicable to de novo design tasks started from backbone structures without any sequence information. In addition, we implemented a protocol that can be used to assess the stability of designed models and to select the best candidates for experimental validation. In sum our results demonstrate that the MD ensemble-based flexible backbone design can be a viable method for protein design, especially for tasks that require a large pool of diverse sequences. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Impact of an extreme event on the sediment budget: Hurricane Andrew in the Louisiana barrier islands

    Science.gov (United States)

    List, Jeffrey H.; Hansen, Mark E.; Sallenger,, Asbury H.; Jaffe, Bruce E.; Edge, B.L

    1997-01-01

    This paper examines the influence of Hurricane Andrew on the sediment budget of an 80-kilometer section of the Louisiana barrier islands west of the modern Mississippi delta. Because long-term bathymetric change has been extensively studied in this area, excellent baseline data are available for evaluating the impact of Hurricane Andrew. Results show that despite the high intensity of the storm and a storm track optimally positioned to impact the study area, the storm did not have an overwhelming influence on the sediment budget when compared to the changes occurring over the previous 50 years. For the Louisiana barrier islands, a 50-year record appears to be adequate for averaging the long-term contributions of both major and minor storm events to the sediment budget.

  12. Geologic impact of Hurricane Andrew on Everglades coast of southwest Florida

    Science.gov (United States)

    Davis, R. A.

    1995-04-01

    Hurricane Andrew, one of the strongest storms of the century, crossed the southern part of the Florida peninsula on 24 August 1992. Its path crossed the Florida Everglades and exited in the national park across a mangrove-dominated coast onto the shallow, low-energy, inner shelf. The storm caused extensive breakage and defoliation in the mangrove community; full recovery will take decades. It produced no extensive sedimentation unit; only local and ephemeral ebb-surge deposits. The discontinuous shelly storm beach ridge was breached at multiple locations, and it moved landward a few meters. After seven months, there was little geologic indication that the storm had passed. It is likely that the stratigraphic record in this area will not contain any recognizable features of the passage of Hurricane Andrew.

  13. Rapid health needs assessment following hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1992-09-18

    Following the impact phase of Hurricane Andrew in Florida (August 24) and Louisiana (August 26) (Figure 1), the primary objectives of the public health response have been to address the health and medical needs of residents in the storm-damaged areas and to provide data for relief interventions and decision-making. This report presents the combined findings from rapid health needs assessment surveys conducted by state health departments with CDC assistance 3-10 days postimpact.

  14. MD-11 PCA - First Landing at Edwards

    Science.gov (United States)

    1995-01-01

    This McDonnell Douglas MD-11 approaches the first landing ever of a transport aircraft under engine power only on Aug. 29, 1995, at NASA's Dryden Flight Research Center, Edwards, California. The milestone flight, flown by NASA research pilot and former astronaut Gordon Fullerton, was part of a NASA project to develop a computer-assisted engine control system that enables a pilot to land a plane safely when it normal control surfaces are disabled. The Propulsion-Controlled Aircraft (PCA) system uses standard autopilot controls already present in the cockpit, together with the new programming in the aircraft's flight control computers. The PCA concept is simple--for pitch control, the program increases thrust to climb and reduces thrust to descend. To turn right, the autopilot increases the left engine thrust while decreasing the right engine thrust. The initial Propulsion-Controlled Aircraft studies by NASA were carried out at Dryden with a modified twin-engine F-15 research aircraft.

  15. MD-11 PCA - Research flight team egress

    Science.gov (United States)

    1995-01-01

    This McDonnell Douglas MD-11 has parked on the flightline at NASA's Dryden Flight Research Center, Edwards, California, following its completion of the first and second landings ever performed by a transport aircraft under engine power only (on Aug. 29, 1995). The milestone flight, with NASA research pilot and former astronaut Gordon Fullerton at the controls, was part of a NASA project to develop a computer-assisted engine control system that enables a pilot to land a plane safely when its normal control surfaces are disabled. Coming down the steps from the aircraft are Gordon Fullerton (in front), followed by Bill Burcham, Propulsion Controlled Aircraft (PCA) project engineer at Dryden; NASA Dryden controls engineer John Burken; John Feather of McDonnell Douglas; and Drew Pappas, McDonnell Douglas' project manager for PCA.

  16. Andrew Wyeth and N.C. Wyeth: a psychodynamic perspective on father and son.

    Science.gov (United States)

    Shaw, Jon A

    2013-01-01

    This paper examines the relationship between two extraordinary artists, father and son--N.C. Wyeth (1882-1945) and Andrew Wyeth (1917-2009)--and their art. N.C. Wyeth, the father, the most famous illustrator of his day, painted scenes full of drama and action, often of men engaged in violent life and death struggles. N.C. was unable to separate from his powerful mother and yearned for his iconic father. He thought himself an artistic failure and dedicated himself to raising his children to be geniuses. The youngest son, Andrew Wyeth, who lived a "secret life," painted scenes often characterized by pathos: bleak and barren landscapes, leaden skies, tire tracks, gray framed houses, desiccated fields, and circling buzzards. In the father-son relationship, we often seen three themes perpetuated developmentally: (1) the son's identification with the innermost conflicts of his father; (2) the yearning for the iconic father of his youth; and (3) a continuation and disavowal of his father's life. These themes are played out in the relationship between Andrew Wyeth and his father.

  17. 78 FR 9309 - Airworthiness Directives; MD Helicopters, Inc., Helicopters

    Science.gov (United States)

    2013-02-08

    ... 600N helicopters with a NOTAR fan blade T-T strap part number (P/N) 500N5311-5 and MDHI Model MD900... fan blade tension-torsion strap (T-T strap), part number (P/N) 500N5311-5; and MDHI Model MD900.... (MDHI) Model 500N, 600N and MD900 helicopters to require determining the cure date for each NOTAR fan...

  18. MD1228: Validation of Single Bunch Stability Threshold & MD1751: Instability Studies with a Single Beam

    CERN Document Server

    Carver, Lee Robert; Biancacci, Nicolo; Buffat, Xavier; Iadarola, Giovanni; Lasocha, Kacper; Li, Kevin Shing Bruce; Levens, Tom; Metral, Elias; Salvant, Benoit; Tambasco, Claudia; CERN. Geneva. ATS Department

    2017-01-01

    Instabilities were being routinely observed in B1V during ADJUST. The timing of the instabilities has been localised to shortly after the TOTEM bump has been implemented. The result is emittance blowup which can negatively effect the luminosity output of the fill. This MD aimed to rule out possible sources of the instability (i.e. beam-beam effects or electron cloud) by only taking one single beam to 6.5TeV and going through the full machine cycle. After the implementation of the TOTEM bump, a reduction of the octupole current was performed in order to determine if there was a discrepancy in the threshold between simulations and measurement. As a precursor, the results of the End of Fill MD: Validation of Single Bunch Stability Threshold will also be described.

  19. MD Data for Patterns in protein flexibility: a comparison of NMR "ensembles", MD trajectories and crystallographic B-factors

    OpenAIRE

    Snyder, David A.; Riga, Anthony; Rivera, Jasmin

    2017-01-01

    This data set comprises three zipped directories that contain the scripts and intermediate molecular dynamics (MD) results used in (as of April 24, 2017) a soon to be submitted paper, "Patterns in protein flexibility: a comparison of NMR 'ensembles', MD trajectories and crystallographic B-factors" written by the authors of this entry. This paper explores patterns in coordinate variance and coordinate uncertainty in MD trajectories and in protein structures derived from NMR and compares co...

  20. Making Block Grants Accountable.

    Science.gov (United States)

    Chelimsky, Eleanor

    Methods of accountability are presented in considering the Reagan administration plan to consolidate 84 federal health, education and social service grants into six block grant areas and to cut overall funding. After matching aspects of public criticism with proposal objectives, a rationale is developed for building elements of accountability into…

  1. Preparing MD-PhD Students for Clinical Rotations: Navigating the Interface Between PhD and MD Training

    OpenAIRE

    Goldberg, Charles; Insel, Paul A.

    2013-01-01

    Many aspects of MD-PhD training are not optimally designed to prepare students for their future roles as translational clinician-scientists. The transition between PhD research efforts and clinical rotations is one hurdle that must be overcome. MD-PhD students have deficits in clinical skills compared with those of their MD-only colleagues at the time of this transition. Reimmersion programs (RPs) targeted to MD-PhD students have the potential to help them navigate this transition. The author...

  2. Orbit Feedback Operation with RCBX (MD 1209)

    CERN Document Server

    Wenninger, Jorg; Nisbet, David; Ponce, Laurette; Louro Alves, Diogo Miguel; CERN. Geneva. ATS Department

    2017-01-01

    The LHC Orbit Feedback (OFB) is able to drive any orbit corrector circuit (COD) to steer the LHC orbit. But during the first feedback tests in 2010, all attempts to use the common triplet orbit correctors (MCBX) failed because the QPS system installed to protect those magnets triggered power aborts as soon as the OFB steered the beam with those CODs. The reason was most likely the violation of the RCBX circuit acceleration limits. For this reason the MCBX orbit correctors were never driven by the OFB in regular operation. Although the performance of the OFB is generally excellent, the quality of the beam steering around IRs could be improved if the OFB could correct the orbit with the MCBX to counteract locally triplet quadrupole movements. The aim of this MD was to make a new attempt to use the MCBX in the OFB. The test was successful at injection (no circuit trip) and failed during the ramp (QPS power abort). The PC voltages and QPS Ures signals revealed the presence of voltage spikes with a period of 10~s...

  3. LHC MD 1279: Bunch Flattening in Physics

    CERN Document Server

    AUTHOR|(CDS)2073675; Baudrenghien, Philippe; Esteban Muller, Juan; Shaposhnikova, Elena; CERN. Geneva. ATS Department

    2017-01-01

    Vertex reconstruction is not accurate enough for LHCb when the bunch length in physics shrinks below about 0.9 ns. The end-of-fill MD studies presented here proved that bunch flattening using sinusoidal RF modulation is a loss-free method to increase the r.m.s. bunch length and flatten the bunch profile. Furthermore, the optimum modulation parameters to be used in physics have been identified. Subsequently, bunch flattening in physics was used operationally with a modulation frequency of 98.75 % of the central synchrotron frequency and 0.6 modulation amplitude, resulting in a 150-200 ps increase in the BQM-measured bunch length. A ‘mid-of-fill’ test at arrival to flat top revealed that also the bunch distribution created by the controlled emittance blow-up during the ramp is affected when bunch flattening is applied. The measurements took place on 17th June and the 4th, 7th and 22nd July 2016. Operational cases are shown as well.

  4. Matching Grant Versus Block Grants with Imperfect Information

    OpenAIRE

    Singh, Nirvikar; Thomas, Ravi

    1989-01-01

    A matching grant for an input in public good production is compared with a block grant, where nonobservability of public good outputs and some inputs prevents the use of the optimal grant system. The welfare comparison is shown to depend on the technology of production. The second-best grant is also compared with the optimal grant.

  5. 77 FR 5201 - Drawbridge Operation Regulation; Bear Creek, Dundalk, MD

    Science.gov (United States)

    2012-02-02

    ...-AA09 Drawbridge Operation Regulation; Bear Creek, Dundalk, MD AGENCY: Coast Guard, DHS. ACTION: Notice... operation of the Baltimore County highway bridge at Wise Avenue across Bear Creek, mile 3.4, between Dundalk... Avenue across Bear Creek, mile 3.4 between Dundalk and Sparrows Point, MD. This change would require the...

  6. Waiting time distribution in M/D/1 queueing systems

    DEFF Research Database (Denmark)

    Iversen, Villy Bæk; Staalhagen, Lars

    1999-01-01

    The well-known formula for the waiting time distribution of M/D/1 queueing systems is numerically unsuitable when the load is close to 1.0 and/or the results for a large waiting time are required. An algorithm for any load and waiting time is presented, based on the state probabilities of M/D/1...

  7. Raymond Andrews as Griot: Privileging Southern Black Communities through Oral Storytelling and Cultural History

    Directory of Open Access Journals (Sweden)

    Brennan Collins

    2012-01-01

    Full Text Available Raymond Andrews’ novels celebrate rural Black life by focusing on the customs and traditions of Southern African American communities. Critical to this celebration are the rhetorical strategies Andrews uses that privilege oral over literary storytelling. Using Geneva Smitherman’s discussion of the griot and Henry Louis Gates, Jr.’s concept of the speakerly text in the context of John Miles Foley’s work on comparative oral traditions, this essay explores the possibility and implications of describing Andrews’ written work as a form of oral storytelling.

  8. Emergency mosquito control associated with Hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    Hurricane Andrew crossed south Florida on August 24, 1992 entered the Gulf of Mexico, and struck the Louisiana coast on August 26. In Florida, an estimated 25,000 housing units were destroyed and 37,000 severely damaged in a 200,000-acre area in the southern portion of Dade County; in Louisiana, an estimated 25,000 housing units were destroyed or severely damaged by the storm, primarily in the coastal sections of the 36-parish disaster area. Initial assessment of the disaster areas indicated a need for vector surveillance and control (1). This report summarizes actions to assess and alleviate mosquito-related problems in Florida and Louisiana.

  9. Cognition About the Creative Process – Interview With Dr Andrew P. Allen

    Directory of Open Access Journals (Sweden)

    Andrew P. Allen

    2016-11-01

    Full Text Available What is the relationship between the creative process and cognition and perception? Lynda Loughnane, a master’s student in Art and Process in Crawford College of Art and Design, Cork, Ireland interviewed Dr Andrew P. Allen about the subject. Areas covered include mindfulness, Type 1 and Type 2 thinking, stage theories of creativity, engagement with the art process and the artwork, phenomenology and consciousness with and without self report. The interview was constructed to cover a wide range of subject matter, so as to gather as much information as possible in layman's language about the cognitive process in relation to creativity and interaction with art.

  10. Brownfields Grants Information

    Data.gov (United States)

    U.S. Environmental Protection Agency — This asset includes all types of information regarding Brownfields grant programs that subsidize/support Brownfield cleanup. This includes EPA's Brownfields Program...

  11. US EPA EJ Grants

    Data.gov (United States)

    U.S. Environmental Protection Agency — This is a provisional dataset that contains point locations for all Environmental Justice (EJ) grants given out by the US EPA. There are many limitations to the data...

  12. Clean Diesel National Grants

    Science.gov (United States)

    National Funding Assistance Program administers competitive grants for clean diesel projects. The Diesel Emissions Reduction Act (DERA) appropriates funds for these projects. Publication numbers: EPA-420-B-13-025 and EPA-420-P-11-001.

  13. Clean Diesel Tribal Grants

    Science.gov (United States)

    The DERA Tribal Program awards clean diesel grants specifically for tribal nations. The Diesel Emissions Reduction Act (DERA) appropriates funds for these projects. Publication Numbers: EPA-420-B-13-025 and EPA-420-P-11-001.

  14. Zambia - Innovation Grants

    Data.gov (United States)

    Millennium Challenge Corporation — The performance evaluation of the IGP is structured according to five phases of IGP implementation that we have identified for each grant cycle: start-up, selection,...

  15. US EPA CARE Grants

    Data.gov (United States)

    U.S. Environmental Protection Agency — This is a provisional dataset that contains point locations for the subset of Community Action for a Renewed Environment (CARE) grants given out by the US EPA. CARE...

  16. VT Historic Preservation Grant

    Data.gov (United States)

    Vermont Center for Geographic Information — The State-funded Historic Preservation Grant Program helps municipalities and non-profit organizations rehabilitate the historic buildings that are a vital part of...

  17. Managing clinical grant costs.

    Science.gov (United States)

    Glass, Harold E; Hollander, Karen

    2009-05-01

    The rapidly increasing cost of pharmaceutical R&D presents a major challenge for the industry. This paper examines one aspect of that spending, clinical grants, and presents ways that pharmaceutical companies can best manage those expenditures. The first part of the paper examines the role of clinical grant payments as a motivation for clinical trial participation. The second part outlines a number of current management practices for controlling clinical grant costs. Financial compensation is an important matter for many physicians conducting clinical trials, especially those in office-based practices and those conducting phase 4 clinical trials. Since financial considerations are important to most types of investigators, and there is no compelling evidence that paying at high rates insures timely performance or quality data, companies engaging clinical investigators must manage their clinical grant funds as effectively as possible. Sound financial management requires that clinical development professionals appreciate the complex relationship between the pharmaceutical company and the physicians who serve as clinical investigators on that company's clinical trials. Sensible financial management of clinical grants also demands that sponsor companies get the most value for their clinical grant spending. Ultimately, good clinical grant management requires an attitude that combines good business sense with an understanding that pharmaceutical R&D strives to bring to market new drugs that can help patient populations around the world. Investigators are medical contractors in clinical trials, and while they are engaged in their vital research, they are a part of the research process that must be carefully budgeted and managed. Society, pharmaceutical companies, clinical investigators, and patients will reap the benefits of adequately budgeted, and well managed clinical grants.

  18. Wetland Program Development Grants (WPDGs)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Wetland Grant Database (WGD) houses grant data for Wetland Program Development Grants (created by EPA in 1990 under the Clean Water Act Section 104(b)(3)...

  19. Sleep disturbance and its relationship to psychiatric morbidity after Hurricane Andrew.

    Science.gov (United States)

    Mellman, T A; David, D; Kulick-Bell, R; Hebding, J; Nolan, B

    1995-11-01

    Sleep disturbance is an important dimension of posttraumatic stress disorder (PTSD), but most of the limited available data were obtained years after the original traumatic event. This study provides information on sleep disturbance and its relationship to posttraumatic morbidity from evaluations done within a year after the trauma. Sleep and psychiatric symptoms of 54 victims (12 men and 42 women) of Hurricane Andrew who had no psychiatric illness in the 6 months before the hurricane were evaluated. A subset of hurricane victims with active psychiatric morbidity (N = 10) and nine comparison subjects who were unaffected by the hurricane were examined in a sleep laboratory. A broad range of sleep-related complaints were rated as being greater after the hurricane, and psychiatric morbidity (which was most commonly PTSD, followed by depression) had a significant effect on most of the subjective sleep measures. In addition, subjects with active morbidity endorsed greater frequencies of "bad dreams" and general sleep disturbances before the hurricane. Polysomnographic results for the hurricane victims revealed a greater number of arousals and entries into stage 1 sleep. REM density correlated positively with both the PTSD symptom of reexperiencing trauma and global distress. Subjects affected by Hurricane Andrew reported sleep disturbances, particularly those subjects with psychiatric morbidity. Tendencies to experience bad dreams and interrupted sleep before a trauma appear to mark vulnerability to posttraumatic morbidity. Results of sleep laboratory evaluations suggested brief shifts toward higher arousal levels during sleep for PTSD subjects and a relationship of REM phasic activity and symptom severity.

  20. Delayed tree mortality in the Atchafalaya Basin of Southern Louisiana following Hurricane Andrew

    Science.gov (United States)

    Keeland, B.D.; Gorham, L.E.

    2009-01-01

    Hurricanes can damage trees in forested wetlands, and the potential for mortality related to these storms exists due to the effects of tree damage over time. In August 1992, Hurricane Andrew passed through the forested wetlands of southern Louisiana with winds in excess of 225 kph. Although more than 78 of the basal area was destroyed in some areas, most trees greater than 2.5 cm dbh were alive and resprouting prolifically the following year (98.8). Survival of most tree species was similarly high two years after the hurricane, but mortality rates of some species increased dramatically. For example, Populus heterophylla (swamp cottonwood) mortality increased from 7.8 to 59.2 (n 76) and Salix interior (sandbar willow) mortality increased from 4.5 to 57.1 (n 21). Stem sprouts on many up-rooted hardwood trees of other species were still alive in 1998, 6 years after the hurricane. Due to the understory tree species composition, regeneration, and high levels of resprouting, there was little change in species composition or perhaps a slight shift toward more shade and flood tolerant species six years following the hurricane event. Triadica sebifera (Chinese tallow) was found on some of the sites heavily disturbed by Hurricane Andrew, and may proliferate at the expense of native tree species. ?? 2009 The Society of Wetland Scientists.

  1. Impacts of Hurricane Andrew on carbonate platform environments, northern Great Bahama Bank

    Science.gov (United States)

    Boss, Stephen K.; Neumann, A. Conrad

    1993-10-01

    The northern (most energetic) quadrant of Hurricane Andrew (August 1992) passed over leeward-margin sand waves, bank-top sand shoals, reefs, and low islands of Great Bahama Bank for which an extensive prestorm data base exists. A reconnaissance survey seven weeks after Hurricane Andrew evaluated storm impacts on these bank-top settings. Resurveyed seismic profiles showed that positions, dimensions, and orientations of platform sand bodies were unchanged relative to fixed bedrock features. Surveys of reef communities indicated only minor storm-related disturbance. Coral bleaching may be due to storm-induced environmental stress. In addition, storm-wave plucking of boulders from emergent rocky cays resulted in localized crushing of reef biota. On low islands, beach erosion and storm surge were insignificant, and storm damage to Casuarina forests was minor and substrate-specific. Observed minimal hurricane impacts on northern Great Bahama Bank environments lying 10-75 km from the hurricane eye are reconciled by analysis of meteorological data, which show significant weakening of the storm (expressed as a rise in central barometric pressure of ˜20 mbar) during passage across the bank-top. This study demonstrates the importance of specific dynamic aspects of hurricanes (e.g., varying intensity, strength, size, forward speed, duration) which influence their geologic potential, even over relatively short distances along the storm track of an individual hurricane.

  2. Demographic effects of natural disasters: a case study of Hurricane Andrew.

    Science.gov (United States)

    Smith, S K; McCarty, C

    1996-05-01

    Many studies have considered the economic, social, and psychological effects of hurricanes, earthquakes, floods, tornadoes, and other natural disasters, but few have considered their demographic effects. In this paper we describe and evaluate a method for measuring the effects of Hurricane Andrew on the housing stock and population distribution in Dade County, Florida. Using information collected through sample surveys and from other data sources, we investigate the extent of housing damages, the number of people forced out of their homes, where they went, how long they stayed, and whether they returned to their prehurricane residences. We conclude that more than half the housing units in Dade County were damaged by Hurricane Andrew; that more than 353,000 people were forced to leave their homes, at least temporarily; and that almost 40,000 people left the county permanently as a direct result of the hurricane. We believe that this study will provide methodological guidance to analysts studying the demographic effects of other large-scale natural disasters.

  3. Development of pile foundation bias factors using observed behavior of platforms during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Aggarwal, R.K.; Litton, R.W.; Cornell, C.A.; Tang, W.H.; Chen, J.H.; Murff, J.D.

    1996-12-31

    The performance of more than 3,000 offshore platforms in the Gulf of Mexico was observed during the passage of Hurricane Andrew in August 1992. This event provided an opportunity to test the procedures used for platform analysis and design. A global bias was inferred for overall platform capacity and loads in the Andrew Joint Industry Project (JIP) Phase 1. It was predicted that the pile foundations of several platforms should have failed, but did not. These results indicated that the biases specific to foundation failure modes may be higher than those of jacket failure modes. The biases in predictions of foundation failure modes were therefore investigated further in this study. The work included capacity analysis and calibration of predictions with the observed behavior for 3 jacket platforms and 3 caissons using Bayesian updating. Bias factors for two foundation failure modes, lateral shear and overturning, were determined for each structure. Foundation capacity estimates using conventional methods were found to be conservatively biased overall.

  4. Specific features of basalts from the western part of Andrew Bain Fault, Southwest Indian Ridge

    Science.gov (United States)

    Peyve, A. A.; Skolotnev, S. G.

    2017-12-01

    This paper reports original data on the composition of volcanic rocks in the western part of the Andrew Bain Fault of the South-West Indian Ridge obtained in the 23rd voyage of R/V Akademik Nikolai Strakhov. In accordance with high La/Th and low Nb/U ratios, the basalt compositions of stations S2317, S2318, and S2330 could result from melting of the DM-type source with HIMU traces. Meanwhile, the enriched samples of station S2326 correspond to a mantle source with a considerable contribution of recycled sediments (EM). Sample S2326/35, which is composed of a melt almost completely depleted in EM material, corresponds to the volcanic rocks of the Marion and Prince Edward islands. The obtained and available data on the SWIR segment from Bouvet Island to Andrew Bain Fault are indicative of small mantle heterogeneities in this region. Two possible variants of their origin are considered: either preservation of the enriched material fragments in the depleted mantle during the split of Gondwana or "contamination" of the mantle with plume material with the formation of vein irregularities before opening of the ocean in this region. In the latter case, the plume material could cover a huge area not constrained by the young plume magmatism regions on Bouvet, Marion, and Prince Edward islands.

  5. Ecological evaluation of proposed dredged material from St. Andrew Bay, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Mayhew, H.L.; Word, J.Q.; Kohn, N.P.; Pinza, M.R.; Karle, L.M.; Ward, J.A. [Battelle/Marine Sciences Lab., Sequim, WA (United States)

    1993-10-01

    The US Army Corps of Engineers (USACE), Mobile District, requested that the Battelle/Marine Sciences Laboratory (MSL) conduct field sampling and chemical and biological testing to determine the suitability of potential dredged material for open ocean disposal. Sediment from St. Andrew Bay was chemically characterized and evaluated for biological toxicity and bioaccumulation of contaminants. The Tier III guidance for ocean disposal testing requires tests of water column effects (following dredged material disposal), deposited sediment toxicity, and bioaccumulation of contaminants from deposited sediment (dredged material). To meet these requirements, the MSL conducted suspended-particulate-phase (SPP) toxicity tests, solid-phase toxicity tests, and bioaccumulation testing on sediment representing potential dredged material from Panama City Harbor. Physical and chemical characterization of sediment to support toxicity and bioaccumulation results was also conducted on both the test and reference sediments. The MSL collected sediment samples from five sites in St. Andrew Bay and one reference site near Lands End Peninsula. The five test sediments and the reference sediment were analyzed for physical and chemical sediment characteristics, SPP chemical contaminants, solid-phase toxicity, SPP toxicity, and bioaccumulation of contaminants.

  6. Discriminative validity of the MacAndrew Alcoholism Scale with Cluster B personality disorders.

    Science.gov (United States)

    Smith, S R; Hilsenroth, M J

    2001-06-01

    This study was designed to assess the ability of the Minnesota Multiphasic Personality Inventory (MMPI-2) MacAndrew Alcoholism Scale (MAC-R) to differentiate between outpatients with personality disorders with Substance-Related Disorders (SRDs) and without SRDs. MMPI-2 validity, clinical, and MAC-R scale scores were compared in an SRD Cluster B group (comprised of Narcissistic, Antisocial, Borderline, and Histrionic; n = 15), a non-SRD Cluster B group (n = 33), and a non-SRD group with personality disorders from Clusters A and C (n = 18). Results revealed that the substance-abusing Cluster B group scored significantly higher on the MAC-R ( p Personality Disorder (r =.60, p Personality Disorders were most related to MAC-R scores (R =.78, R(2) =.60). This indicates that the MAC-R may be more related to the presence of an SRD than has been suggested, and when used in outpatient settings as MacAndrew (1965) intended, the MAC-R may be useful as a screening device for assessing SRD among outpatients with Axis II psychopathology.

  7. MD 239 on Collide and Squeeze (part 2)

    CERN Document Server

    Gorzawski, Arkadiusz; Salvachua Ferrando, Belen Maria; Wenninger, Jorg; CERN. Geneva. ATS Department

    2016-01-01

    Colliding the beams during the squeeze to profit from Landau damping due to head--on beam-beam and beta--star leveling are two operational modes that may have to be used in a not so distant future at the LHC. This MD aimed at improving the orbit control during the squeeze with much improved handling of orbit feedback references and at evaluating instruments and techniques to maintain the beam in collisions with active feedback on luminosity or beam position. This MD also integrated for the first time synchronized collimator measurements. Comparison of the settings with the previous MD allowed a validation of the long term stability of collide and squeeze.

  8. beta* leveling with telescopic ATS squeeze (MD 2410)

    CERN Document Server

    Wenninger, Jorg; Hostettler, Michi; Pojer, Mirko; Ponce, Laurette; Tydecks, Tobias; CERN. Geneva. ATS Department

    2017-01-01

    Luminosity leveling by beta* is the baseline operational scenario of HL-LHC, and this leveling technique may be used in 2018 or during run~3 depending on the beam parameters and beta* range. During this MD beta*leveling was commissioned successfully for the first time with the telescopic squeeze over the beta* range of 40 cm to 30 cm. A novel beta* leveling controls technique based on a modification of the LSA trim was also tested during the MD.

  9. Md-miR156ab and Md-miR395 Target WRKY Transcription Factors to Influence Apple Resistance to Leaf Spot Disease.

    Science.gov (United States)

    Zhang, Qiulei; Li, Yang; Zhang, Yi; Wu, Chuanbao; Wang, Shengnan; Hao, Li; Wang, Shengyuan; Li, Tianzhong

    2017-01-01

    MicroRNAs (miRNAs) are key regulators of gene expression that post-transcriptionally regulate transcription factors involved in plant physiological activities. Little is known about the effects of miRNAs in disease resistance in apple ( Malus × domestica ). We globally profiled miRNAs in the apple cultivar Golden Delicious (GD) infected or not with the apple leaf spot fungus Alternaria alternaria f. sp. mali (ALT1), and identified 58 miRNAs that exhibited more than a 2-fold upregulation upon ALT1 infection. We identified a pair of miRNAs that target protein-coding genes involved in the defense response against fungal pathogens; Md-miR156ab targets a novel WRKY transcription factor, MdWRKYN1, which harbors a TIR and a WRKY domain. Md-miR395 targets another transcription factor, MdWRKY26, which contains two WRKY domains. Real-time PCR analysis showed that Md-miR156ab and Md-miR395 levels increased, while MdWRKYN1 and MdWRKY26 expression decreased in ALT1-inoculated GD leaves; furthermore, the overexpression of Md-miR156ab and Md-miR395 resulted in a significant reduction in MdWRKYN1 and MdWRKY26 expression. To investigate whether these miRNAs and their targets play a crucial role in plant defense, we overexpressed MdWRKYN1 or knocked down Md-miR156ab activity, which in both cases enhanced the disease resistance of the plants by upregulating the expression of the WRKY-regulated pathogenesis-related (PR) protein-encoding genes MdPR3-1, MdPR3-2, MdPR4, MdPR5, MdPR10-1 , and MdPR10-2 . In a similar analysis, we overexpressed MdWRKY26 or suppressed Md-miR395 activity, and found that many PR protein-encoding genes were also regulated by MdWRKY26 . In GD, ALT-induced Md-miR156ab and Md-miR395 suppress MdWRKYN1 and MdWRKY26 expression, thereby decreasing the expression of some PR genes, and resulting in susceptibility to ALT1.

  10. 33 CFR 334.680 - Gulf of Mexico, southeast of St. Andrew Bay East Entrance, small-arms firing range, Tyndall Air...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico, southeast of St... AND RESTRICTED AREA REGULATIONS § 334.680 Gulf of Mexico, southeast of St. Andrew Bay East Entrance... the Gulf of Mexico, southeast of St. Andrew Bay East Entrance within a rectangular area beginning at a...

  11. 33 CFR 334.770 - Gulf of Mexico and St. Andrew Sound, south of East Bay, Fla., Tyndall Drone Launch Corridor...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico and St. Andrew... ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.770 Gulf of Mexico and St....; restricted area. (a) The area. The waters of the Gulf of Mexico and St. Andrew Sound within an area described...

  12. Prediction of Osmotic Pressure of Ionic Liquids Inside a Nanoslit by MD Simulation and Continuum Approach

    Science.gov (United States)

    Moon, Gi Jong; Yang, Yu Dong; Oh, Jung Min; Kang, In Seok

    2017-11-01

    Osmotic pressure plays an important role in the processes of charging and discharging of lithium batteries. In this work, osmotic pressure of the ionic liquids confined inside a nanoslit is calculated by using both MD simulation and continuum approach. In the case of MD simulation, an ionic liquid is modeled as singly charged spheres with a short-ranged repulsive Lennard-Jones potential. The radii of the spheres are 0.5nm, reflecting the symmetry of ion sizes for simplicity. The simulation box size is 11nm×11nm×7.5nm with 1050 ion pairs. The concentration of ionic liquid is about 1.922mol/L, and the total charge on an individual wall varies from +/-60e(7.944 μm/cm2) to +/-600e(79.44 μm/cm2) . In the case of continuum approach, we classify the problems according to the correlation length and steric factor, and considered the four separate cases: 1) zero correlation length and zero steric factor, 2) zero correlation length and non-zero steric factor, 3) non-zero correlation length and zero steric factor, and 4) non-zero correlation and non-zero steric factor. Better understanding of the osmotic pressure of ionic liquids confined inside a nanoslit can be achieved by comparing the results of MD simulation and continuum approach. This research was supported by the National Research Foundation of Korea (NRF) Grant funded by the Korea government (MSIP: Ministry of Science, ICT & Future Planning) (No. 2017R1D1A1B05035211).

  13. Protocols for Biotechnological Interventions in Improvement of Vanilla (Vanilla planifolia Andrews.).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal; Peter, K V

    2016-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a native of Central America, is the primary source of natural vanillin and plays a major role in the global economy. The gene pool of vanilla is threatened by deforestation and overcollection that has resulted in disappearance of natural habitats and wild species. Continuous vegetative propagation and lack of natural seed set and sufficient variations in the gene pool hamper crop improvement programs. In vitro techniques, one of the key tools of plant biotechnology, can be employed for overcoming specific problems, viz. production of disease-free clones, inducing somaclonal variations, developing hybrids, gene pool conservation, incorporating desired traits by distant hybridization, genetic engineering, etc. However, realization of these objectives necessitates standardization of protocols. This chapter describes the various protocols optimized for crop improvement in Vanilla species.

  14. A conversation with Andrew Benson: reflections on the discovery of the Calvin-Benson cycle.

    Science.gov (United States)

    Benson, Andrew

    2013-03-01

    On June 26-27, 2012, one of us (BBB) made a video based on an interview conducted with Andrew A. Benson, Professor Emeritus, Scripps Institution of Oceanography, University of California, San Diego, CA, USA. The video was first shown in a seminar presented by BBB on July 27, 2012 at the Calvin Laboratory, University of California, Berkeley, to mark the departure of the Energy Biosciences Institute to a new building. Here we record the conversation taking place during the interview. The Brancraft Library on the Berkeley campus will house the video's transcript in its oral histories collection, and the video will be housed in its motion picture collection. The video and the transcript have also been posted on You Tube (http://youtu.be/GfQQJ2vR_xE).

  15. Prosthetic rehabilitation of severe Siebert′s Class III defect with modified Andrews bridge system

    Directory of Open Access Journals (Sweden)

    Manu Rathee

    2015-01-01

    Full Text Available Prosthetic dentistry involves the replacement of missing and contiguous tissues with artificial substitutes to restore and maintain the oral functions, appearance, and health of the patient. The treatment of edentulous areas with ridge defects poses a challenging task for the dentist. Management of such cases involves a wide range of treatment options comprising mainly of surgical interventions and non surgical techniques such as use of removable, fixed or fixed- removable partial dentures. But each treatment plan undertaken should be customized according to patient needs. A variety of factors such as quality and quantity of existing contiguous hard and soft tissues, systemic condition and economic status of the patient play an important role in treatment planning, clinical outcome and prognosis. This case report presents the restoration of a Seibert′s Class III ridge defect by an economical modification of Andrews Bridge in a 32 Year old patient.

  16. Symptoms of posttraumatic stress in children after Hurricane Andrew: a prospective study.

    Science.gov (United States)

    La Greca, A; Silverman, W K; Vernberg, E M; Prinstein, M J

    1996-08-01

    The authors examined symptoms of posttraumatic stress in 3rd-5th grade children during the school year after Hurricane Andrew. From a conceptual model of the effects of traumatic events, 442 children were evaluated 3, 7, and 10 months postdisaster with respect to (a) their exposure to traumatic events during and after the disaster, (b) their preexisting demographic characteristics, (c) the occurrence of major life stressors, (d) the availability of social support, and (e) the type of coping strategies used to cope with disaster-related distress. Although symptoms of posttraumatic stress disorder (PTSD) declined over time, a substantial level of symptomatology was observed up to 10 months after the disease. All 5 factors in the conceptual model were predictive of children's PTSD symptoms 7 and 10 months postdisaster. Findings are discussed in terms of the potential utility of the model for organizing thinking about factors that predict the emergence and persistence of PTSD symptoms in children.

  17. Comprehensive assessment of health needs 2 months after Hurricane Andrew--Dade County, Florida, 1992.

    Science.gov (United States)

    1993-06-11

    On August 24, 1992, Hurricane Andrew struck southern Florida. More than 28,000 houses, mobile homes, and apartment buildings were destroyed, and approximately 107,000 additional dwellings sustained major damage. An estimated 180,000 persons were left homeless; insured damages were estimated at $15.5 billion and total damages at more than $30 billion. During the recovery period, many private and public health-care facilities damaged or destroyed in the storm were not functional. During November 3-13, to help prioritize health needs and direct public health resources, the Dade County Public Health Unit of the Florida Department of Health and Rehabilitative Services conducted a survey to assess health needs and the availability of health-care services during the recovery phase with funds provided by the Federal Emergency Management Agency (FEMA). This report summarizes the results of the survey.

  18. Damage Survey of Hurricane Andrew and Its Relationship to the Eyewall.

    Science.gov (United States)

    Wakimoto, Roger M.; Black, Peter G.

    1994-02-01

    A damage map documenting Hurricane Andrew's destructive land fall over southern Florida is presented. Vectors that represent the direction of winds causing damage to trees and structures are shown along with an F-scale rating in order to assess the strength of the near-surface winds. It is hypothesized that increased surface roughness once the hurricane made landfall may have contributed to a surface wind enhancement resulting in the strongest winds ever estimated (F3) for a landfall hurricane. This intense damage occurred primarily during the "second" period of strong winds associated with the east side of the eyewall. For the first time, a well-defined circulation in the damage pattern by the second wind was documented. A superposition of radar data from Miami and Key West on top of the damage map provides the first detailed examination of the relationship between the eyewall and the surface flow field as estimated from the damage vectors.

  19. Children's predisaster functioning as a predictor of posttraumatic stress following Hurricane Andrew.

    Science.gov (United States)

    La Greca, A M; Silverman, W K; Wasserstein, S B

    1998-12-01

    This study examined (a) children's predisaster behavioral and academic functioning as a predictor of posttraumatic stress (PTS) following Hurricane Andrew and (b) whether children who were exposed to the disaster would display a worsening of prior functioning. Fifteen months before the disaster, 92 4th through 6th graders provided self-reports of anxiety; peers and teachers rated behavior problems (anxiety, inattention, and conduct) and academic skills. Measures were repeated 3 months postdisaster; children also reported PTS symptoms and hurricane-related experiences (i.e., exposure). PTS symptoms were again assessed 7 months postdisaster. At 3 months postdisaster, children's exposure to the disaster, as well as predisaster ratings of anxiety, inattention, and academic skills, predicted PTS symptoms. By 7 months, only exposure, African American ethnicity, and predisaster anxiety predicted PTS. Prior anxiety levels also worsened as a result of exposure to the disaster. The findings have implications for identifying and treating children at risk for stress reactions following a catastrophic disaster.

  20. Stability and change in stress, resources, and psychological distress following natural disaster: Findings from hurricane Andrew.

    Science.gov (United States)

    Norris, F H; Perilla, J L; Riad, J K; Kaniasty, K; Lavizzo, E A

    1999-01-01

    Abstract The stress, resource, and symptom levels of 241 residents of southern Dade County, Florida were assessed 6 and 30 months after Hurricane Andrew. Percentages meeting study criteria for depression and PTSD did not change over time. Whereas mean levels of intrusion and arousal decreased, depressive symptoms remained stable, and avoidance/numbing symptoms actually increased. Intrusion and arousal were associated more strongly with pre-disaster factors (gender, ethnicity) and within-disaster factors (injury, property loss) than with post-disaster factors (stress, resources), but the reverse was true for depression and avoidance. Changes over time in symptoms were largely explained by changes over time in stress and resources. The findings indicate that ongoing services are needed to supplement the crisis-oriented assistance typically offered to disaster victims.

  1. Memorial Camels and Design by Committee: St Andrews Black Saturday Memorials

    Directory of Open Access Journals (Sweden)

    SueAnne Ware

    2015-02-01

    Full Text Available This paper examines a work in progress, the St Andrews Bushfire Memorial, which commemorates victims of the 7 February 2009 bushfires in Victoria, Australia. The paper’s intent is threefold: to describe and reflect on a current and ongoing memorial design project; to frame this project within a larger series of design discourses; and to examine the processes by which this memorial, but also many other grassroots or ‘bottom-up’ memorials, come into being. By examining the design process, I aim to open up various memorialisation and consultation methods for review. More importantly, however, by framing this project in contemporary discussions regarding socially engaged design practices, I offer a critique of the dictator–democrat binaries mentioned above and offer another way forward.

  2. Grant Wood: "American Gothic."

    Science.gov (United States)

    Fitzgerald, Diane M.

    1988-01-01

    Presents a lesson plan which exposes students in grades 10-12 to the visual symbols and historical references contained in Grant Wood's "American Gothic." Includes background information on the artist and the painting, instructional strategies, a studio activity, and evaluation criteria. (GEA)

  3. SynGrant

    Indian Academy of Sciences (India)

    IAS Admin

    with any institution or formal registered body anywhere in the world, for the purpose of SynGrant) every year. There are no requirements of nationality, age, gender, education, income, language, or material/social accomplishments. SynTalk would consider the long term (100–200+ years) impact potential of the chosen ...

  4. Grants Mining District

    Science.gov (United States)

    The Grants Mineral Belt was the focus of uranium extraction and production activities from the 1950s until the late 1990s. EPA is working with state, local, and federal partners to assess and address health risks and environmental effects of the mines

  5. Physical symptoms of chronic fatigue syndrome are exacerbated by the stress of Hurricane Andrew.

    Science.gov (United States)

    Lutgendorf, S K; Antoni, M H; Ironson, G; Fletcher, M A; Penedo, F; Baum, A; Schneiderman, N; Klimas, N

    1995-01-01

    This study examined the effects of Hurricane Andrew on physical symptoms and functional impairments in a sample of chronic fatigue syndrome (CFS) patients residing in South Florida. In the months after Hurricane Andrew (September 15-December 31, 1992), 49 CFS patients were assessed for psychosocial and physical functioning with questionnaires, interviews, and physical examinations. This sample was made up of 25 CFS patients living in Dade county, a high impact area, and 24 patients in Broward and Palm Beach counties, areas less affected by the hurricane. Based on our model for stress-related effects on CFS, we tested the hypothesis that the patients who had the greatest exposure to this natural disaster would show the greatest exacerbation in CFS symptoms and related impairments in activities of daily living (illness burden). In support of this hypothesis, we found that the Dade county patients showed significant increases in physician-rated clinical relapses and exacerbations in frequency of several categories of self-reported CFS physical symptoms as compared to the Broward/Palm Beach county patients. Illness burden, as measured on the Sickness Impact Profile, also showed a significant increase in the Dade county patients. Although extent of disruption due to the storm was a significant factor in predicting relapse, the patient's posthurricane distress response was the single strongest predictor of the likelihood and severity of relapse and functional impairment. Additionally, optimism and social support were significantly associated with lower illness burden after the hurricane, above and beyond storm-related disruption and distress responses. These findings provide information on the impact of environmental stressors and psychosocial factors in the exacerbation of CFS symptoms.

  6. Posttraumatic stress symptoms, intrusive thoughts, loss, and immune function after Hurricane Andrew.

    Science.gov (United States)

    Ironson, G; Wynings, C; Schneiderman, N; Baum, A; Rodriguez, M; Greenwood, D; Benight, C; Antoni, M; LaPerriere, A; Huang, H S; Klimas, N; Fletcher, M A

    1997-01-01

    To examine the impact of and relationship between exposure to Hurricane Andrew, a severe stressor, posttraumatic stress symptoms and immune measures. Blood draws and questionnaires were taken from community volunteer subjects living in the damaged neighborhoods between 1 and 4 months after the Hurricane. The sample exhibited high levels of posttraumatic stress symptoms by questionnaire (33% overall; 76% with at least one symptom cluster), and 44% scored in the high impact range on the Impact of Events (IES) scale. A substantial proportion of variance in posttraumatic stress symptoms could be accounted for by four hurricane experience variables (damage, loss, life threat, and injury), with perceived loss being the highest correlate. Of the five immune measures studied Natural Killer Cell Cytotoxicity (NKCC) was the only measure that was meaningfully related (negatively) to both damage and psychological variables (loss, intrusive thoughts, and posttraumatic stress disorder (PTSD). White blood cell counts (WBCs) were significantly positively related with the degree of loss and PTSD experienced. Both NKCC (lower) and WBC were significantly related to retrospective self-reported increase of somatic symptoms after the hurricane. Overall, the community sample was significantly lower in NKCC, CD4 and CD8 number, and higher in NK cell number compared to laboratory controls. Finally, evidence was found for new onset of sleep problems as a mediator of the posttraumatic symptom-NKCC relationship. Several immune measures differed from controls after Hurricane Andrew. Negative (intrusive) thoughts and PTSD were related to lower NKCC. Loss was a key correlate of both posttraumatic symptoms and immune (NKCC, WBC) measures.

  7. Hurricane Andrew Damage in Relation to Wood Decay Fungi and Insects in Bottomland Hardwoods of the Atchafalaya Basin, Louisiana

    Science.gov (United States)

    Theodor D. Leininger; A. Dan Wilson; Donald G. Lester

    1997-01-01

    Hurricane Andrew caused damage to more than 780 sq.km of bottomland hardwood and cypress-tupelo forests in the Atchafalaya Basin of Louisiana in August 1992. Trees in bottomland hardwood sites were examined, in early May 1994, for signs and symptoms of wood decay fungi, and for insect damage, ostensibly present before the hurricane, which may have predisposed trees to...

  8. The Psychological Effects of Hurricane Andrew on Ethnic Minority and Caucasian Children and Adolescents: A Case Study.

    Science.gov (United States)

    Jones, Russell T.; Frary, Robert; Cunningham, Phillippe; Weddle, J. David; Kaiser, Lisa

    2001-01-01

    Several measures of children's reactions to disasters were employed with 212 elementary and middle school students 6 months after experiencing Hurricane Andrew. Higher levels of intrusive symptomatology were found for girls and for elementary school children. Discusses lack of findings concerning race and implications for future research.…

  9. The role of the U.S. Army Medical Department in domestic disaster assistance operations - lessons learned from hurricane Andrew.

    Science.gov (United States)

    1996-04-01

    Hurricane Andrew, which struck South Dade County, Florida on the morning of 24 August 1992, was the "worst natural disaster ever to hit the United States..." The capabilities of the local and state governments to respond to the disaster were quickly ...

  10. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly

    Science.gov (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.

    2016-01-01

    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  11. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: III. The Orthoptera (Grasshoppers and Crickets).

    Science.gov (United States)

    David C. Lightfoot

    1986-01-01

    An inventory of Orthoptera (grasshoppers and crickets) at the H.J. Andrews Experimental Forest, near Blue River, Oregon, was conducted to determine the species present and ecological relationships. A key for identification and an annotated list are presented. From qualitative assessments of successional habitat relationships, generalized species associations of forest...

  12. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascade Mountains, Oregon: IV. The Oribatid Mites (Acari: Cryptostigmata).

    Science.gov (United States)

    Andrew Moldenke; Becky. Fichter

    1988-01-01

    A fully illustrated key is presented for identifying genera of oribatid mites known from or suspected of occurring in the Pacific Northwest. The manual includes an introduction detailing sampling methodology; an illustrated glossary of all terminology used; two color plates of all taxa from the H. J. Andrews Experimental Forest; a diagrammatic key to the 16 major...

  13. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: I. An annotated checklist of fleas.

    Science.gov (United States)

    Robert E. Lewis; Chris. Maser

    1981-01-01

    During a trapping survey of small mammals (approximately 3,000 individuals), species of fleas (1,632 specimens) were collected in the H.J. Andrews Experimental Forest, Western Cascades, Oregon. Host mammals were represented by 15 species—6 insectivores and 9 rodents captured from June through September. The collections extend our knowledge of the fauna of Oregon.

  14. Invertebrates of the H.J. Andrews Experimental Forest, western Cascades, Oregon II. an annotated checklist of caddisflies (Trichoptera)

    Science.gov (United States)

    N.H. Anderson; G.M. Cooper; D.G Denning

    1982-01-01

    At least 99 species, representing 14 families of Trichoptera, are recorded from the H.J. Andrews Experimental Forest, near Blue River, Oregon. The collecting sites include a wide diversity of environmental conditions in a 6000-hectare watershed of the western Cascade Range (from 400 to 1 630 meters in altitude and from 1st- to 7th-order streams).

  15. 77 FR 15600 - Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL

    Science.gov (United States)

    2012-03-16

    ...-AA08 Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL... navigable waters during the Emerald Coast Super Boat Grand Prix high speed boat races. Entry into... needed to safeguard persons and vessels from safety hazards associated with the Emerald Coast Super Boat...

  16. Religious Literacy or Spiritual Awareness? Comparative Critique of Andrew Wright's and David Hay's Approaches to Spiritual Education

    Science.gov (United States)

    Filipsone, Anta

    2009-01-01

    On the basis of a comparison of the educational approaches of Andrew Wright and David Hay this paper illustrates the persisting problem of dichotomising cognitive and trans-cognitive aspects of spiritual development and education. Even though both Wright and Hay speak of the same topic--spirituality and spiritual education--they define these terms…

  17. Climatic summaries and documentation for the primary meteorological station, H.J. Andrews Experimental Forest, 1972 To 1984.

    Science.gov (United States)

    Frederick A. Bierlmaler; Arthur. McKee

    1989-01-01

    This report describes the primary meteorological station at the H.J. Andrews Experimental Forest (elev. 426 m, lat. 44°15' N., long. 122°10' W.) in the Willamette National Forest, the automatic digital data logger, sensors, and data-processing procedures used in measuring air temperature, dewpoint temperature, windspeed, precipitation, and solar radiation....

  18. 3MdB: the Mexican Million Models database

    Science.gov (United States)

    Morisset, C.; Delgado-Inglada, G.

    2014-10-01

    The 3MdB is an original effort to construct a large multipurpose database of photoionization models. This is a more modern version of a previous attempt based on Cloudy3D and IDL tools. It is accessed by MySQL requests. The models are obtained using the well known and widely used Cloudy photoionization code (Ferland et al, 2013). The database is aimed to host grids of models with different references to identify each project and to facilitate the extraction of the desired data. We present here a description of the way the database is managed and some of the projects that use 3MdB. Anybody can ask for a grid to be run and stored in 3MdB, to increase the visibility of the grid and the potential side applications of it.

  19. Magnetic properties of the stable fraction of remanence in large multidomain (MD) magnetite grains: Single-domain or MD?

    Science.gov (United States)

    McClelland, E.; Muxworthy, A. R.; Thomas, R. M.

    It has been recognized since the early work of Verhoogen (1959) that a considerable proportion of remanence in multidomain (MD) magnetite grains is resistant to low-field a.f. or low-temperature demagnetization. The source of this high stability is still a matter of debate. A number of workers have suggested that MD grains of all sizes contain a remanence fraction with truly single domain (SD) character. We suggest that the critical diagnostic features which should be investigated to determine whether the high stability fraction is SD or MD in character are whether blocking (Tb) and unblocking (Tub) temperatures are equivalent, and whether the intensity of remanence is affected by the thermal pre-history of the sample. We have carried out such experiments on samples containing crushed natural magnetites in 7 grain sizes from 5-10 µm, to 100-150 µm. We show that Tb and Tub are equivalent for pTRM40020 for grain sizes up to 15-20 µm, but that Tub extends up to the Curie temperature for larger grain sizes. We also show that the stable fraction of MD TRM and pTRM has the same dependence on pre-history as the total TRM. Our experiments demonstrate that the stable fraction has magnetic properties which are truly MD in character for magnetite grains larger than 20 µm.

  20. Swiss national MD-PhD-program: an outcome analysis.

    Science.gov (United States)

    Kuehnle, Katrin; Winkler, David T; Meier-Abt, Peter J

    2009-09-19

    This study aims at a first evaluation of the outcome of the Swiss national MD-PhD program during the last 16 years. One hundred and twenty six former and current students in the Swiss national MD-PhD program were surveyed via a Web-based questionnaire in September 2007. Twenty-four questions assessed information regarding participant demographics, information on the PhD thesis and publication activity, current positions and research activity, as well as participant's opinions, attitudes and career goals. Eighty questionnaires were received from 126 MD-PhD students and graduates (63.5% response rate). The responders consisted of present students (36%), former graduates (56%), and dropouts (8%). The percentage of women in the program was 23%, and the average duration of the program was 4.2 +/- 1.4 years. Research interests were predominantly in the fields of neuroscience, immunology, molecular biology and cancer research. A considerable portion of the MD-PhD graduates had an excellent publication record stemming from their PhD research work, and 89% were planning to continue a research-orientated career. Over 50% of those MD-PhD graduates completing their thesis before 2002 had already reached an assistant or full professor position at the time of the survey. Nearly all participants considered the MD-PhD training helpful to their career and high quality standards were assigned to the acquired practical and intellectual skills. However, criticism was expressed concerning the general mentoring and the career related mentoring. Moreover, general mentoring and career related mentoring were significantly less well perceived in research groups employing more than seven PhD students at the same time. The MD-PhD students and graduates surveyed were satisfied with their education and most of them continued a research-orientated career. Regarding the overall positive evaluation, this study supports the view that MD-PhD graduates are well qualified for a successful career in

  1. Restructuring the syllabus for MD Pharmacology: Retrospection of bioassay

    Directory of Open Access Journals (Sweden)

    Sarita Mulkalwar

    2014-01-01

    Full Text Available Introduction: Career prospects in Pharmacology are witnessing a sea change due to fast and unanticipated development in the field of clinical research. Numerous openings exist now in academia, pharmaceutical industry, Clinical Research Organizations (CRO or as regulatory consultants, experimental pharmacologists, etc. In short, there are various options to choose from, depending on one′s interest. It′s high time we ponder now over the training programme for post-graduate students in Pharmacology. It needs to be revised keeping in mind the job prospects & uniqueness of the MD Pharmacology degree. Aim: To take suggestions of experienced pharmacologists on the present syllabus for MD Pharmacology and their opinion on continuation of Bioassay experiment which is currently an important part of it . Materials and Methods: A structured questionnaire was given to 30 experienced pharmacologists to seek their opinion on MD Pharmacology syllabus & continuation of Bioassay as a part of MD practical. Results: Out of 30 participants, 29 (96.6% did not use their knowledge of Bioassay during their 10 years of post MD career, whether in pharmaceutical industry or in academics. Only 5 of them (16.6% feel that experiment on bioassay should be continued in the current state. 76.7% of them wish it to be modified to a Dose Response Curve ( DRC . 6.71% feel that it should be totally scrapped. All the participants feel the need of revising current MD Pharmacology syllabus. Current syllabus is inclined more towards preparing good academicians but it lacks the proper training for creating good clinical research professionals. Medical writing, writing necessary documents for clinical trials including regulatory documents, writing an article for medical journals, marketing communication, product monograph and patient information of a clinical trial could be incorporated. They should be aware of the regulatory requirements for conducting studies on investigational drugs

  2. David Kasner, MD, and the Road to Pars Plana Vitrectomy

    Directory of Open Access Journals (Sweden)

    Christopher F. Blodi

    2016-01-01

    Full Text Available David Kasner, MD (1927–2001, used his extensive dissections of eye bank eyes and experiences in teaching cataract surgery to resident physicians to realize that excision of vitreous when present in the anterior chamber of eyes undergoing cataract surgery was preferable to prior intraoperative procedures. Noting that eyes tolerated his maneuvers, he then performed planned subtotal open-sky vitrectomies; first on a traumatized eye in 1961, then on two eyes of patients with amyloidosis (1966–1967. The success of these operations was noted by others, most particularly Robert Machemer, MD. Kasner's work directly led to further surgical developments, including closed pars plana vitrectomy.

  3. BayesMD: flexible biological modeling for motif discovery

    DEFF Research Database (Denmark)

    Tang, Man-Hung Eric; Krogh, Anders; Winther, Ole

    2008-01-01

    We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained on trans......We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained...

  4. BI MD Studies on June 29th 2011

    CERN Document Server

    Belohrad, D; Bravin, E; Calvo, E; Dehning, B; Emery, J; Favier, M; Gras, JJ; Guerrero, A; Jeff, A; Lefevre, T; Rabiller, A; Roncarolo, F; Sapinski, M; Soby, L; Steinhagen, R

    2011-01-01

    This note contains the preliminary results of the LHC MD that took place on 29-June-2011 (from 10 p.m. to 07 a.m.), dedicated to study Beam Current Monitors (BCT), Wire Scaners (WS), Synchrotron Radiation (BSRT), Beam Position (BPM), Wall Current (WCM) and Beam Gas Ionization (BGI) monitors. The MD aimed at performing different studies on the individual monitors. At the same time, it was possible to perform calibration studies with the Abort Gap (AGM) and Longitudinal Density (LDM) monitors that share the extracted light with the BSRT. Additionally some observations about the beam stability and emittance dependence on the chromaticity were performed.

  5. MD 2179: Scraping of off-momentum halo after injection

    CERN Document Server

    Garcia Morales, Hector; Patecki, Marcin; Wretborn, Sven Joel; CERN. Geneva. ATS Department

    2018-01-01

    In this MD, a beam scraping was performed using the momentum primary collimator in IR3 where dispersion is high. A second scraping was performed using a TCSG in IR7 where dispersion is almost negligible. In such a way, we aim to disentangle the contribution of off-momentum particles to halo population. These scrapings will provide useful information to better understand the usual off-momentum losses we see at the start of the ramp. The MD results would also be used to benchmark simulations of off-momentum beam losses in order to gain confidence in simulation models.

  6. Chesapeake Bay Program Grant Guidance

    Science.gov (United States)

    Grant Guidance and appendices for the Chesapeake Bay Program that describes how the U.S. Environmental Protection Agency’s (EPA) Region 3’s Chesapeake Bay Program Office (CBPO) administers grant and cooperative agreement funds.

  7. General Plan Environmental Assessment for Joint Base Andrews-Naval Air Facility, Washington, Maryland

    Science.gov (United States)

    2011-04-01

    at the Upper Marlboro Branch Library of the Prince George’s County Memorial Library System at 14 730 Main St. Upper Marlboro, MD 20772 and on the...quality in all international parks; national parks that exceeded 6,000 acres; and national wilderness areas and memorial parks that exceeded 5,000 acres...plants found in wooded areas include mountain laurel (Kalmia latifolia), highbush blueberry (Vaccinium corymbosum), and Christmas fern (Polystichium

  8. Apple (Malus domestica) MdERF2 negatively affects ethylene biosynthesis during fruit ripening by suppressing MdACS1 transcription.

    Science.gov (United States)

    Li, Tong; Jiang, Zhongyu; Zhang, Lichao; Tan, Dongmei; Wei, Yun; Yuan, Hui; Li, Tianlai; Wang, Aide

    2016-12-01

    Ripening in climacteric fruit requires the gaseous phytohormone ethylene. Although ethylene signaling has been well studied, knowledge of the transcriptional regulation of ethylene biosynthesis is still limited. Here we show that an apple (Malus domestica) ethylene response factor, MdERF2, negatively affects ethylene biosynthesis and fruit ripening by suppressing the transcription of MdACS1, a gene that is critical for biosynthesis of ripening-related ethylene. Expression of MdERF2 was suppressed by ethylene during ripening of apple fruit, and we observed that MdERF2 bound to the promoter of MdACS1 and directly suppressed its transcription. Moreover, MdERF2 suppressed the activity of the promoter of MdERF3, a transcription factor that we found to bind to the MdACS1 promoter, thereby increasing MdACS1 transcription. We determined that the MdERF2 and MdERF3 proteins directly interact, and this interaction suppresses the binding of MdERF3 to the MdACS1 promoter. Moreover, apple fruit with transiently downregulated MdERF2 expression showed higher ethylene production and faster ripening. Our results indicate that MdERF2 negatively affects ethylene biosynthesis and fruit ripening in apple by suppressing the transcription of MdACS1 via multiple mechanisms, thereby acting as an antagonist of positive ripening regulators. Our findings offer a deep understanding of the transcriptional regulation of ethylene biosynthesis during climacteric fruit ripening. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  9. Book received: Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

    Directory of Open Access Journals (Sweden)

    Alois Riegl

    2010-12-01

    Full Text Available Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

  10. DOE Matching Grant Program

    International Nuclear Information System (INIS)

    Tsoukalas, L.

    2002-01-01

    Funding used to support a portion of the Nuclear Engineering Educational Activities. Upgrade of teaching labs, student support to attend professional conferences, salary support for graduate students. The US Department of Energy (DOE) has funded Purdue University School of Nuclear Engineering during the period of five academic years covered in this report starting in the academic year 1996-97 and ending in the academic year 2000-2001. The total amount of funding for the grant received from DOE is $416K. In the 1990's, Nuclear Engineering Education in the US experienced a significant slow down. Student enrollment, research support, number of degrees at all levels (BS, MS, and PhD), number of accredited programs, University Research and Training Reactors, all went through a decline to alarmingly low levels. Several departments closed down, while some were amalgamated with other academic units (Mechanical Engineering, Chemical Engineering, etc). The School of Nuclear Engineering at Purdue University faced a major challenge when in the mid 90's our total undergraduate enrollment for the Sophomore, Junior and Senior Years dropped in the low 30's. The DOE Matching Grant program greatly strengthened Purdue's commitment to the Nuclear Engineering discipline and has helped to dramatically improve our undergraduate and graduate enrollment, attract new faculty and raise the School of Nuclear Engineering status within the University and in the National scene (our undergraduate enrollment has actually tripled and stands at an all time high of over 90 students; total enrollment currently exceeds 110 students). In this final technical report we outline and summarize how the grant was expended at Purdue University

  11. Physical Properties of Near-Earth Asteroid 2011 MD

    NARCIS (Netherlands)

    Mommert, M.; Farnocchia, D.; Hora, J. L.; Chesley, S. R.; Trilling, D. E.; Chodas, P. W.; Mueller, M.; Harris, A. W.; Smith, H. A.; Fazio, G. G.

    2014-01-01

    We report on observations of near-Earth asteroid 2011 MD with the Spitzer Space Telescope. We have spent 19.9 h of observing time with channel 2 (4.5 {\\mu}m) of the Infrared Array Camera and detected the target within the 2{\\sigma} positional uncertainty ellipse. Using an asteroid thermophysical

  12. 76 FR 51887 - Safety Zone; Patuxent River, Patuxent River, MD

    Science.gov (United States)

    2011-08-19

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Patuxent River, Patuxent River, MD AGENCY... safety zone during the ``NAS Patuxent River Air Expo '11,'' which consists of aerial practices, performance demonstrations and air shows, to be held over certain waters of the Patuxent River adjacent to...

  13. 76 FR 36447 - Safety Zone; Patuxent River, Patuxent River, MD

    Science.gov (United States)

    2011-06-22

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Patuxent River, Patuxent River, MD AGENCY... a temporary safety zone during the ``NAS Patuxent River Air Expo '11'', which consists of aerial practices, performance demonstrations and air shows, to be held over certain waters of the Patuxent River...

  14. QM/MM-MD simulations of conjugated polyelectrolytes

    DEFF Research Database (Denmark)

    Sjöqvist, Jonas; Linares, Mathieu; Mikkelsen, Kurt Valentin

    2014-01-01

    description of the solvent in its electronic ground state as well as the chromophore in its electronic ground and excited states, (ii) a conformational sampling by means of classical molecular dynamics (MD) in the respective electronic states, and (iii) spectral response calculations by means of the quantum...

  15. Occurrence of Cucumber mosaic virus on vanilla (Vanilla planifolia Andrews) in India.

    Science.gov (United States)

    Madhubala, R; Bhadramurthy, V; Bhat, A I; Hareesh, P S; Retheesh, S T; Bhai, R S

    2005-06-01

    Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, Cucurbitaceae, Fabaceae and Solanaceae. Nicotiana benthamiana was found to be a suitable host for the propagation of CMV. The virus was purified from inoculated N. benthamiana plants and negatively stained purified preparations contained isometric particles of about 28 nm in diameter. The molecular weight of the viral coat protein subunits was found to be 25.0 kDa. Polyclonal antiserum was produced in New Zealand white rabbit, immunoglobulin G (IgG) was purified and conjugated with alkaline phosphatase enzyme. Double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) method was standardized for the detection of CMV infection in vanilla plants. CP gene of the virus was amplified using reverse transcriptase-polymerase chain reaction (RT-PCR), cloned and sequenced. Sequenced region contained a single open reading frame of 657 nucleotides potentially coding for 218 amino acids. Sequence analyses with other CMV isolates revealed the greatest identity with black pepper isolate of CMV (99%) and the phylogram clearly showed that CMV infecting vanilla belongs to subgroup IB. This is the first report of occurrence of CMV on V. planifolia from India.

  16. Wind damage effects of Hurricane Andrew on mangrove communities along the southwest coast of Florida, USA

    Science.gov (United States)

    Doyle, T.W.; Smith, T. J.; Robblee, M.B.

    1995-01-01

    On August 24, 1992, Hurricane Andrew downed and defoliated an extensive swath of mangrove trees across the lower Florida peninsula. Permanent field sites were established to assess the extent of forest damage and to monitor the rate and process of forest recovery. Canopy trees suffered the highest mortality particularly for sites within and immediately north of the storm's eyewall. The type and extent of site damage, windthrow, branch loss, and defoliation generally decreased exponentially with increasing distance from the storm track. Forest damage was greater for sites in the storm's right quadrant than in the left quadrant tor the same given distance from the storm center. Stand exposure, both horizontally and vertically, increased the susceptibility and probability of forest damage and accounted for much of the local variability. Slight species differences were found. Laguncularia racemosa exceeded Avicennia germinans and Rhizophora mangle in damage tendency under similar wind conditions. Azimuths of downed trees were strongly correlated with maximum wind speed and vector based on a hurricane simulation of the storm. Lateral branch loss and leaf defoliation on sites without windthrow damage indicated a degree of crown thinning and light penetration equivalent to treefall gaps under normally intact forest conditions. Mangrove species and forests are susceptible to catastrophic disturbance by hurricanes; the impacts of which are significant to changes in forest structure and function.

  17. William Horner Andrews (1887–1953 – First Professor of Physiology at Onderstepoort

    Directory of Open Access Journals (Sweden)

    D. W. Verwoerd

    2011-04-01

    Full Text Available WHAndrews qualified as a veterinarian in London in 1908 and was recruited soon after, in 1909, by Sir Arnold Theiler to join the staff of the newly established veterinary laboratory at Onderstepoort. After initial studies on the treatment of trypanosomosis and on snake venoms he was deployed by Theiler in 1911 to start research on lamsiekte (botulismat a field station on the farm Kaffraria near Christiana, where he met and married his wife Doris. After a stint as Captain in the SA Veterinary Corps during World War I he succeeded D T Mitchell as head of the Allerton Laboratory in 1918, where he excelled in research on toxic plants, inter alia identifying Matricaria nigellaefolia as the cause of staggers in cattle.Whenthe Faculty ofVeterinary Science was established in 1920 he was appointed as the first Professor of Physiology. After the graduation of the first class in 1924, and due to health problems, he returned to the UK, first to the Royal Veterinary College and then to the Weybridge Veterinary Laboratories of which he became Director in 1927.After his retirement in 1947 he returned to South Africa as a guest worker at Onderstepoort where he again became involved in teaching physiologywhenProf. Quin unexpectedly died in 1950. Andrews died in Pretoria in 1953 and was buried in the Rebecca Street Cemetery.

  18. Analysis of medical treatment at a field hospital following Hurricane Andrew, 1992.

    Science.gov (United States)

    Alson, R; Alexander, D; Leonard, R B; Stringer, L W

    1993-11-01

    To determine what medical care was required of a special operations response team by a community devastated by a major hurricane. Retrospective analysis of 1,544 patient encounter forms generated at a field hospital set up in Homestead, Florida, after Hurricane Andrew in August 1992 and staffed by the special operations response team from Forsyth County, North Carolina. All persons presenting for treatment. One thousand two hundred three adult patients and 336 pediatric patients were seen by the special operations response team. Only five of the injuries treated were due directly to the hurricane, whereas 285 of the treated injuries were sustained during clean-up activities. Most of the care provided was routine medical care denied the citizens due to the loss of their physicians' offices and clinics. Supplies of tetanus toxoid, antibiotics, and insulin were depleted in 24 hours. Resupplying these items and acquiring other medication to refill prescriptions constituted a pressing problem. The primary function of medical personnel responding to an area hit by a major hurricane will be to provide general medical care. Any trauma encountered will be primarily due to clean-up activities and not due to the hurricane itself. Responding medical personnel should plan on providing their own food and water for the first 72 hours and be well stocked with antibiotics, tetanus toxoid, and insulin.

  19. The generation of internal waves on the continental shelf by Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Allen, Susan E.

    2000-11-01

    Observed currents, temperature, and salinity from moored instruments on the Louisiana continental slope and shelf reveal multiple baroclinic oscillations during Hurricane Andrew in August 1992. These measurements are supplemented by numerical models in order to identify possible internal wave generation mechanisms. The Princeton Ocean Model is run with realistic topography, stratification, and wind forcing to extend the observations to Mississippi Canyon and other areas on the shelf. A two-layer isopycnal model is used with idealized topography and spatially uniform winds to isolate internal waves generated in and around the canyon. The combination of the observations and the results from the numerical models indicates several possible mechanisms for generating long internal waves: (1) near-inertial internal waves were generated across the slope and shelf by dislocation of the thermocline by the wind stress; (2) interaction of inertial flow with topography generated internal waves along the shelf break, which bifurcated into landward and seaward propagating phases; (3) downwelling along the coast depressed the thermocline; after downwelling relaxes, an internal wave front propagates as a Kelvin wave; and (4) Poincaré waves generated within Mississippi Canyon propagate seaward while being advected westward over the continental slope. These processes interact to produce a three-dimensional internal wave field, which was only partly captured by the observations.

  20. Weathering the storm: children's long-term recall of Hurricane Andrew.

    Science.gov (United States)

    Fivush, Robyn; Sales, Jessica McDermott; Goldberg, Amy; Bahrick, Lorraine; Parker, Janat

    2004-01-01

    Children who experienced a highly stressful natural disaster, Hurricane Andrew, were interviewed within a few months of the event, when they were 3-4 years old, and again 6 years later, when they were 9-10 years old. Children were grouped into low, moderate, or high stress groups depending on the severity of the experienced storm. All children were able to recall this event in vivid detail 6 years later. In fact, children reported over twice as many propositions at the second interview as at the first. At the initial interview, children in the high stress group reported less information than children in the moderate stress group, but 6 years later, children in all three stress groups reported similar amounts of information. However children in the high stress group needed more questions and prompts than children in the other stress groups. Yet children in the high stress group also reported more consistent information between the two interviews, especially about the storm, than children in the other stress groups. Implications for children's developing memory of stressful events are discussed.

  1. Storm-tide elevations produced by Hurricane Andrew along the southern Florida coasts, August 24, 1992

    Science.gov (United States)

    Murray, Mitchell H.

    1994-01-01

    On August 24, 1992, Hurricane Andrew crossed southern peninsular Florida. The combined effects of storm surge from the hurricane and astronomical tide, referred to as storm tide, caused flooding over a large part of southern Florida. Subsequent to the flooding, many high-water marks were identified, described, and surveyed along the south- eastern coast of Florida (Miami to Key Largo) and at selected areas along the southwestern coast of Florida (Flamingo to Goodland). Descriptions of these 336 high-water makrs are presented in tabular form in this report and their locations are plotted on nineteen 7.5-minute topographic quadrangle maps. For the southeastern coast, north-south profiles of the high-water makrs along the outher and inner barrier islands and the western shoreline of Biscayne Bay are presented. Average storm-tide elevations (relative to sea level) ranged from 4 to 6 feet in northern Biscayne Bay, were as much as 17 feet on the western shoreline near the center of the bay and ranged from 3 to 6 feet in southern Biscayne Bay and Barnes Sound. Storm-tide elevations along the southwestern coast ranged from 4 to 5 feet at Flamingo and 5 to 7 feet at Goodland in the Ten Thousand Islands area.

  2. Use of a modified cluster sampling method to perform rapid needs assessment after Hurricane Andrew.

    Science.gov (United States)

    Hlady, W G; Quenemoen, L E; Armenia-Cope, R R; Hurt, K J; Malilay, J; Noji, E K; Wurm, G

    1994-04-01

    To rapidly obtain population-based estimates of needs in the early aftermath of Hurricane Andrew in South Florida. We used a modified cluster-sampling method (the Expanded Programme on Immunization [EPI] method) for three surveys. We selected a systematic sample of 30 quarter-mile square clusters for each survey and, beginning from a random start, interviewed members of seven consecutive occupied households in each cluster. Two surveys were of the most affected area (1990 population, 32,672) at three and ten days after the hurricane struck; one survey was of a less affected area (1990 population, 15,576) seven days after the hurricane struck. Results were available within 24 hours of beginning each survey. Initial findings emphasized the need for restoring utilities and sanitation and helped to focus medical relief on primary care and preventive services. The second survey of the most affected area showed improvement in the availability of food, water, electricity, and sanitation (P < or = .05). There was no evidence of disease outbreaks. For the first time, the EPI method provided population-based information to guide and evaluate relief operations after a sudden-impact natural disaster. An improvement over previous approaches, the EPI method warrants further evaluation as a needs assessment tool in acute disasters.

  3. Business closure and relocation: a comparative analysis of the Loma Prieta earthquake and Hurricane Andrew.

    Science.gov (United States)

    Wasileski, Gabriela; Rodríguez, Havidán; Diaz, Walter

    2011-01-01

    The occurrence of a number of large-scale disasters or catastrophes in recent years, including the Indian Ocean tsunami (2004), the Kashmir earthquake (2005), Hurricane Katrina (2005) and Hurricane Ike (2008), have raised our awareness regarding the devastating effects of disasters on human populations and the importance of developing mitigation and preparedness strategies to limit the consequences of such events. However, there is still a dearth of social science research focusing on the socio-economic impact of disasters on businesses in the United States. This paper contributes to this research literature by focusing on the impact of disasters on business closure and relocation through the use of multivariate logistic regression models, specifically focusing on the Loma Prieta earthquake (1989) and Hurricane Andrew (1992). Using a multivariate model, we examine how physical damage to the infrastructure, lifeline disruption and business characteristics, among others, impact business closure and relocation following major disasters. © 2011 The Author(s). Disasters © Overseas Development Institute, 2011.

  4. Long-term effects of Hurricane Andrew: revisiting mental health indicators.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-09-01

    Two population-based surveys of South Dade County, Florida, were conducted after Hurricane Andrew to compare hurricane-related symptoms of mental distress and describe the impact of mental health outreach teams. Households were selected by three-stage cluster sampling and findings from the two surveys, 13 months apart, were compared. Response rates were 75 per cent and 84 per cent. The prevalence of symptoms of mental distress decreased over time. However, in the households contacted by the teams (25 per cent of sample), the prevalence of symptoms (50 per cent) did not differ from households not contacted (43 per cent). Households contacted by teams that reported symptoms were just as likely to have been referred for help by the teams (72 per cent) as those without symptoms (68 per cent). Households reporting symptoms were equally likely to get counselling regardless of whether the teams visited. Mental health teams had no significant impact on mental health symptoms or the use of mental health services. Alternative approaches to mental health outreach teams need to be explored.

  5. The post-disaster negative health legacy: pregnancy outcomes in Louisiana after Hurricane Andrew.

    Science.gov (United States)

    Antipova, Anzhelika; Curtis, Andrew

    2015-10-01

    Disasters and displacement increasingly affect and challenge urban settings. How do pregnant women fare in the aftermath of a major disaster? This paper investigates the effect of pregnancies in disaster situations. The study tests a hypothesis that pregnant women residing in hurricane-prone areas suffer higher health risks. The setting is Louisiana in the Gulf Coast, United States, a state that continually experiences hurricane impacts. The time period for the analysis is three years following the landfall of Hurricane Andrew in 1992. We analysed low birth weight and preterm deliveries before and after landfall, as a whole and by race. Findings support an association between hazards and health of a community and indicate that pregnant women in the affected area, irrespective of race, are more likely to experience preterm deliveries compared to pre-event births. Results suggest there is a negative health legacy impact in Louisiana as a result of hurricane landfall. © 2015 The Author(s). Disasters © Overseas Development Institute, 2015.

  6. Grants Process Overview

    Science.gov (United States)

    This infographic shows the steps in the National Institutes of Health and National Cancer Institute Grants Process. The graphic shows which steps are done by the Principle Investigator, Grantee Institution, and by NIH. The process is represented by a circular flow of steps. Starting from the top and reading clockwise: The Principle Investigator “Initiates Research Idea and Prepares Application” The Grantee Institution “Submits Application” NIH “NIH Center For Scientific Review, Assigns To NCI And To Study Section” NIH “Scientific Review Group (NCI OR CSR) Evaluates for Scientific Merit” NIH “National Cancer Advisory Board Recommends Action” NIH “NCI Evaluates Program Relevance And Need” NIH “NCI Makes Funding Selections And Issues Grant Awards” (NIH) NIH “NCI Monitors Programmatic and Business Management Performance of the Grant” The Grantee Institution “Manages Funds” The Principle Investigator “Conducts Research” Source: www.cancer.gov Icons made by Freepik from http://www.flaticon.com is licensed by CC BY3.0”

  7. Predicting the Path to Recovery from Hurricane Katrina through the Lens of Hurricane Andrew and the Rodney King Riots

    OpenAIRE

    Robert Baade; Robert Baumann; Victor Matheson

    2005-01-01

    Hurricane Katrina caused the greatest damage of any hurricane in American history. We look at the rebuilding effort in New Orleans through the lens of two other disasters that occurred in 1992: Hurricane Andrew in Miami and the Rodney King riots in Los Angeles. The rebuilding effort in New Orleans shares similarities with both events, combining the impact of a hurricane on infrastructure and private businesses, and the prospect of an uneven recovery biased against racial minorities and the ec...

  8. Commentary on "The Perception and Cognition of Time in Balinese Music" by Andrew Clay McGraw

    OpenAIRE

    Ian Cross; Satinder Gill; Sarah Knight; Chris Nash; Tal-Chen Rabinowitch; Lydia Slobodian; Neta Spiro; Ghofur Woodruff; Matthew Woolhouse

    2008-01-01

    We review the paper by Andrew Clay McGraw, noting that it represents an interesting and valuable contribution to the study of music in cognition in its informed exploration of non-western musical perceptions. We raise a number of concerns about the methods used, and make suggestions as to how the issues that were empirically addressed in the paper might have been tackled in ways that would have enhanced the interpretability of its findings.

  9. National Status and Trends: Bioeffects Program - Magnitude and Extent of Sediment Toxicity in Four Bays of the Florida Panhandle: Pensacola, Choctawhatchee, St. Andrew and Apalachicola

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The toxicity of sediments in Pensacola, Choctawhatchee, St. Andrew and Apalachicola Bays was determined as part of bioeffects assessments performed by NOAA's...

  10. Cinema and the Great War - Andrew Kelly, 1997. History by Hollywood. The use and abuse of the American past - Robert Brant Toplin, 1996

    NARCIS (Netherlands)

    Kester, Bernadette

    1998-01-01

    textabstractReview of: Cinema and the Great War. Andrew Kelly, Londen, New York (Routledge), 1997, 219 p.History by Hollywood. The use and abuse of the American past. Robert Brant Toplin, Chicago (Urbana), 1996, 267 p.

  11. Twenty-one-month follow-up study of school-age children exposed to Hurricane Andrew.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Schorr, C

    1996-03-01

    To explore the 21-month course of posttraumatic stress symptomatology (PTSS) and psychological morbidity in 30 school-age children (7 to 13 years) after exposure to Hurricane Andrew. Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form were administered at 8 and 21 months after Hurricane Andrew. At 21 months 70% of the children endorsed moderate-severe PTSS. The reduction in PTSS was greater for boys than girls. Psychopathology as measured by the Teacher's Report Form increased over the 19-month period. Boys demonstrated significant increases in internalizing symptoms and in Withdrawn, Anxious/Depressed, Social Problems, and Attention Problems scales, and girls showed a significant increase in the Anxious/Depressed scale. Twenty-one months after exposure to Hurricane Andrew, there were continuing high levels of PTSS and evidence of increasing emotional and behavioral problems. While girls sustained higher levels of PTSS, boys demonstrated higher indices of other psychopathology. The enduring effects of disaster associated with secondary stressors and "traumatic reminders" continue to be etiologically important for continuing psychological morbidity.

  12. 76 FR 67195 - Announcing the Award of a Single-Source Program Expansion Supplement Grant to the Johns Hopkins...

    Science.gov (United States)

    2011-10-31

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Administration for Children and Families Announcing the Award of a Single-Source Program Expansion Supplement Grant to the Johns Hopkins University, Bloomberg School of Public Health in Baltimore, MD, To Support the Development of a Human Services National...

  13. Fascia Research Congress evidence from the 100 year perspective of Andrew Taylor Still.

    Science.gov (United States)

    Findley, Thomas W; Shalwala, Mona

    2013-07-01

    More than 100 years ago A.T. Still MD founded osteopathic medicine, and specifically described fascia as a covering, with common origins of layers of the fascial system despite diverse names for individual parts. Fascia assists gliding and fluid flow and is highly innervated. Fascia is intimately involved with respiration and with nourishment of all cells of the body, including those of disease and cancer. This paper reviews information presented at the first three International Fascia Research Congresses in 2007, 2009 and 2012 from the perspective of Dr Still, that fascia is vital for organism's growth and support, and it is where disease is sown. Published by Elsevier Ltd.

  14. Postgraduate research training: the PhD and MD thesis.

    Science.gov (United States)

    Higginson, I; Corner, J

    1996-04-01

    Higher research degrees, such as the PhD, MPhil and MD, have existed within universities for 80 years or more, although the differences between the MD and PhD remain confused. A higher research degree training provides individuals with greater research knowledge and skills, and benefits the specialty. Concern exists about the levels of supervision sometimes provided, failure to complete degrees, and the variable levels of research knowledge and skills attained. We propose that higher research degrees in palliative care have four functions: extending personal scholarship, generating knowledge, training for the individual and contributing to the growth of the specialty. Such an approach may include: a formalised first year with taught components such as in research MSc programmes, formal supervision and progress assessment. In palliative care, clinical and academic approaches need greater integration. Multiprofessional learning is essential. To allow individuals to undertake higher research degree programmes, fellowships or specific funding are needed.

  15. MD 1856 - Landau Damping: Beam Transfer Functions and diffusion mechanisms

    CERN Document Server

    Tambasco, Claudia; Boccardi, Andrea; Buffat, Xavier; Gasior, Marek; Lefevre, Thibaut; Levens, Tom; Pojer, Mirko; Salvachua Ferrando, Belen Maria; Solfaroli Camillocci, Matteo; Pieloni, Tatiana; Crouch, Matthew Paul; CERN. Geneva. ATS Department

    2017-01-01

    In the 2012, 2015 and 2016 several instabilities were developing during the betatron squeeze where beam-beam interactions become stronger modifying the tune spread provided by the octupoles magnets. Studies of the stability area computed by evaluating the dispersion integral for different tune spread couldn’t explain the 2012 observed instabilities during the squeeze. The size of the stability area given by the computed dispersion integral depends on the transverse tune spread but its shape is defined by the particle distribution in the beams. Therefore any change of the particle distribution due to for instance a diffusion from excited resonances can lead to a deterioration of the Landau stability area. The Beam Transfer Functions (BTF) measurements are direct measurement of the Stability Diagrams (SD). They are sensitive to the particle distribution and contain information about the transverse tune spread in the beams. In this MD we wanted to verify the findings of MD 1407 and try to explain observed inst...

  16. Enhancing MD simulations of proteins using vague and combinatorics information

    Science.gov (United States)

    Dill, Ken

    We have developed MELD, a method that `melds' together replica-exchange molecular dynamics simulations with external information. Traditionally, accelerating MD simulations has only been possible by using information that is precise and correct. In contrast, MELD allows us to leverage information that is vague or corrupted. For example, we give generic instructives, such as `make a hydrophobic core', `make good secondary structures', or `search only compact structures'. Normally, such information implies a loss of ability to compute free energies and populations. But, MELD satisfies detailed balance. We show that it can fold small proteins much faster than brute-force MD can, that it gives reasonable populations, and that it can succeed in CASP, the blind protein-structure prediction event.

  17. MD210 Note: Creation of Hollow Bunches in the PSB

    CERN Document Server

    Oeftiger, Adrian; Findlay, Alan James; Hancock, Steven; Rumolo, Giovanni; CERN. Geneva. ATS Department

    2016-01-01

    MD210 aims for the creation of longitudinally hollow bunches in the CERN PS Booster. The first three sessions have been carried out using the radial loop feedback system in order to drive the beam on a dipolar parametric resonance (instead of the phase loop). It has been found that the damping by the phase loop inhibits the excitation of the resonance to a major extent. The hollow distributions generated under these circumstances fail to reach a satisfying bunching factor. Nonetheless, proving the principally successful application of this technique to the PS Booster promises good results once the phase loop system supports trim functions. The approach, actions and detailed results of the first three MD sessions are presented in this paper.

  18. MD 382: Beam Transfer Function and diffusion mechanisms

    CERN Document Server

    Tambasco, Claudia; Buffat, Xavier; Crouch, Matthew; Pieloni, Tatiana; Boccardi, Andrea; Fuchsberger, Kajetan; Gasior, Marek; Kotzian, Gerd; Lefevre, Thibaut; Pojer, Mirko; Salvachua Ferrando, Belen Maria; Solfaroli Camillocci, Matteo; Giachino, Rossano; CERN. Geneva. ATS Department

    2016-01-01

    The Beam Transfer Function (BTF) measurements have been previously tested in the LHC during MD block 1 and 2. Different machine configurations (i.e. energy, beam intensity, emittance etc...) have been tested to determine a safe set-up (excitation amplitude) of the system to be completely transparent to the beam (no emittance blow-up neither losses). The aim of this experiment in MD block 3 was to characterize the Stability Diagram (SD) in the presence of diffusion mechanisms induced by excited resonances due to beam-beam long range and Landau octupole interplay. During the experiment, BTF measurements have been acquired at flat top for different settings of Landau octupole current, different chromaticity values and transverse feedback gains. In this note the description of the experiment is presented together with some preliminary results.

  19. Damage to unburied flowlines in the Gulf of Mexico during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Collins, J.I.

    1995-12-31

    The US Minerals Management Service reported that 454 sub-sea pipelines were damaged during Hurricane Andrew. Previously, damage to pipelines and flowlines has been reported in a series of papers by Blumberg (1964). In the present paper a formulation of the hydrodynamic loads acting on a flowline which is lying on the seafloor in the presence of waves and currents is summarized. In general, the line dynamics can be represented by a fourth order differential equation with nonlinear forcing but a method is presented which assumes that the complete response can be broken down into distinct phases from ``early motion`` to ``taut line`` to ``yield and breaking``. The selection of appropriate force coefficients and boundary layer interactions is discussed. The initial stages of pipeline migration across the seafloor is shown to be followed by loading of the flowline once all of the ``slack`` is taken up. The loads are shown to be a function of the current orientation and the maximum tension is approximately proportional to the square of the distance between risers. Comparisons of predicted and observed damages confirm that ``effective`` boundary layer thicknesses at the seafloor and typical drag and lift coefficients which were selected based on available literature are consistent with observed flowline damage. The results of sidescan sonar mosaics of pipeline migrations and reported damage are consistent with the loads predicted by relatively simple hydrodynamic/structural models. The material presented in this paper permits the evaluation of the risk of damage to unburied flowlines using relatively simple tools. Guidelines to the assumptions of force coefficients and flowline responses are provided. 20 refs., 11 figs., 2 tabs.

  20. Low-Frequency Response Following the Passage of Hurricane Andrew on the Texas-Louisiana Shelf

    Science.gov (United States)

    Pearce, S. M.; Smith, D. C.; Dimarco, S. F.

    2009-12-01

    During August 24th through 27th in 1992, Hurricane Andrew passed through the Gulf Of Mexico almost directly over several moorings on the easternmost Louisiana shelf portion of the Texas-Louisiana Shelf (LATEX) coastal ocean monitoring program. Examination of the current meter time-series showed the existence of fast moving, long shelf waves over the entire Texas-Louisiana shelf west of the storm passage for up to 12 days after direct forcing ceased. The LATEX program featured 31 moorings each with 3 current meters over the 10, 20, 50, and 200 meter isobaths in 5 cross sectional lines with additional coverage on the 200 meter isobath from the Louisiana-Mississippi River delta, to Corpus Christi, Texas. Additionally, several pressure records from LATEX and several NOAA historical coastal tide gauge data from Sabine Pass to Port Isabella, Texas were incorporated. Raw, 3-hour low pass filtered, and 40-hour low pass filtered versions of the current data were analyzed. The pressure data used were detided using a least squares fit, and the tidal records were detided using the NOAA predicted tides for that location. All data were analyzed using a wavelet analysis to determine the spectra over time. The analyzed data shows that the shelf response was largely dominated in the internal Kelvin wave mode. The wave propagated towards the west on the shelf at approximately 400 km/day. These results are contrasted and compared with wave modes predicted for coastal trapped wave solutions. The output of a coastal ocean model simulation using a forced wind field similar to the storm are also contrasted and compared with the observed data.

  1. Tests of executive functioning predict scores on the MacAndrew Alcoholism Scale.

    Science.gov (United States)

    Deckel, A W

    1999-02-01

    1. Previous work reported that tests of executive functioning (EF) predict the risk of alcoholism in subject populations selected for a "high density" of a family history of alcoholism and/or the presence of sociopathic traits. The current experiment examined the ability of EF tests to predict the risk of alcoholism, as measured by the MacAndrew Alcoholism Scale (MAC), in outpatient subjects referred to a general neuropsychological testing service. 2. Sixty-eight male and female subjects referred for neuropsychological testing were assessed for their past drinking histories and administered the Wisconsin Card Sorting Test, the Wechsler Adult Intelligence Scale-Revised, the Trails (Part B) Test, and the MAC. Principal Components analysis (PCA) reduced the number of EF tests to two measures, including one that loaded on the WCST, and one that loaded on the Similarities, Picture Arrangement, and Trails tests. Multiple hierarchical regression first removed the variance from demographic variables, alcohol consumption, and verbal (i.e., Vocabulary) and non-verbal (i.e., Block Design) IQ, and then entered the executive functioning factors into the prediction of the MAC. 3. Seventy-six percent of the subjects were classified as either light, infrequent, or non-drinkers on the Quantity-Frequency-Variability scale. The factor derived from the WCST on PCA significantly added to the prediction of risk on the MAC (p = .0063), as did scores on Block Design (p = .033). Relatively more impaired scores on the WCST factor and Block Design were predictive of higher scores on the MAC. The other factors were not associated with MAC scores. 4. These results support the hypothesis that decrements in EF are associated with risk factors for alcoholism, even in populations where the density of alcoholic behaviors are not unusually high. When taken in conjunction with other findings, these results implicate EF test scores, and prefrontal brain functioning, in the neurobiology of the risk for

  2. Glass Cathedral: Gay Novel or Liberation Theology? An Interview with Andrew Koh

    Directory of Open Access Journals (Sweden)

    Angus Whitehead

    2013-05-01

    Full Text Available Singaporean Andrew Koh was a founding member of the groundbreaking Necessary Stage theatre company in 1987. In Singapore he is best remembered as the author of Glass Cathedral (1995, Singapore's second gay novel[la], which won the 1994 Singapore Literature Prize Commendation Award and was subsequently shortlisted for the 1996 Commonwealth Writers Prize for the Best First Novel Regional Awards. A collection of poetry, Hybrid from the East, was published in the UK in 1997. A second novel awaits publication. After initially leaving Singapore for London in the mid-1990s he now lives in Sydney as a healthcare worker and qualified Chinese medicine practitioner. Sixteen years after its initial publication, Glass Cathedral the novel is finally receiving attention and reappraisal in the wake of its Glass Cathedral's republication by Epigram Books as a Singapore Classic, alongside works such as Goh Poh Seng's The Immolation, Robert Yeo's The Adventures of Holden Heng and Lloyd Fernando's Scorpion Orchid. The interview took place on 8 November 2011 at a restaurant on the site of Koh's alma mater St Joseph's Institution, Bras Basah Road, Singapore, just days after Koh returned to the city-state and gave a spirited reading from and talk about Glass Cathedral at the Singapore Writers Festival. In this interview Koh discusses his Catholic upbringing, and his employment as a policeman during Singapore's policy of entrapment of homosexual men during the 1990s. Koh goes on to discuss how he came to write Glass Cathedral, his leaving Singapore in response to the nation-state's repressive climate and unsympathetic response to queer writing. In the second half of the interview Koh discusses homophobia in Singapore, the Catholic Church, and elsewhere and its roots in misogyny. Koh also draws attention to other issues explored in Glass Cathedral: the marginalisation of minorities in a supposedly multicultural nation state and the impact of Singapore's secret history

  3. MD 754: Instability Threshold for Train with 25ns Spacing

    CERN Document Server

    Carver, Lee Robert; Biancacci, Nicolo; Iadarola, Giovanni; Levens, Tom; Metral, Elias; Salvant, Benoit; Wang, Na; CERN. Geneva. ATS Department

    2016-01-01

    Measurements made since the beginning of run II at 6.5 TeV have shown that there is a large discrepancy in the instability thresholds between single bunches and trains of 72 bunches with 25ns spacing, whereas the same result is expect for pure impedance-induced instabilities. One possible explanation is that the presence of electron cloud is affecting the beam stability. This MD will attempt to determine if electron cloud is the dominant mechanism affecting beam stability.

  4. MD 1691: Active halo control using tune ripple at injection

    CERN Document Server

    Garcia Morales, Hector; Bruce, Roderik; Redaelli, Stefano; Fitterer, Miriam; Fiascaris, Maria; Nisbet, David; Thiesen, Hugues; Valentino, Gianluca; Xu, Chen; CERN. Geneva. ATS Department

    2017-01-01

    In this MD we performed halo excitation through tune ripple. This consists in an excitation that introduces new resonance sidebands around the existing resonance lines. In presence of sufficient detuning with amplitude, these sidebands can in principle affect only the dynamics of the halo particles at large amplitudes. Tune ripple was induced through a current modulation of the warm trim quadrupoles in IR7. This is the first time this method is experimentally tested at the LHC.

  5. MD 346: Summary of single bunch instability threshold measurements

    CERN Document Server

    Carver, Lee Robert; Metral, Elias; Salvant, Benoit; Levens, Tom; Buffat, Xavier; Pieloni, Tatiana; Tambasco, Claudia; Trad, Georges; CERN. Geneva. ATS Department

    2016-01-01

    The purpose of this MD is to measure the octupole current threshold to reach single-bunch stability in the LHC at flat top. Two bunches with dierent emittances are injected in the LHC in both B1 and B2 and the current in the Landau octupoles was progressively decreased until an instability developed. The measurements provide insight into the LHC impedance model by comparing them with the stabilizing octupole current predicted from DELPHI.

  6. 77 FR 42459 - Airworthiness Directives; MD Helicopters, Inc. (MDHI) Helicopters

    Science.gov (United States)

    2012-07-19

    ... 500N, 600N, and MD900 helicopters to require determining the cure date for each NOTAR fan blade tension..., DC 20590-0001. Hand Delivery: Deliver to the ``Mail'' address between 9 a.m. and 5 p.m., Monday... 900R3442009-103, and P/N 900R6442009-103, measured from the manufacturer's cure date or the date the package...

  7. MD 349: Impedance Localization with AC-dipole

    CERN Document Server

    Biancacci, Nicolo; Metral, Elias; Salvant, Benoit; Papotti, Giulia; Persson, Tobias Hakan Bjorn; Tomas Garcia, Rogelio; CERN. Geneva. ATS Department

    2016-01-01

    The purpose of this MD is to measure the distribution of the transverse impedance of the LHC by observing the phase advance variation with intensity between the machine BPMs. Four injected bunches with different intensities are excited with an AC dipole and the turn by turn data is acquired from the BPM system. Through post-processing analysis the phase variation along the machine is depicted and, from this information, first conclusions of the impedance distribution can be drawn.

  8. Space Technology Research Grants Program

    Data.gov (United States)

    National Aeronautics and Space Administration — The Space Technology Research Grants Program will accelerate the development of "push" technologies to support the future space science and exploration...

  9. MD Anderson's Population Health Approaches to Cancer Prevention.

    Science.gov (United States)

    Foxhall, Lewis; Moreno, Mark; Hawk, Ernest

    2018-02-01

    Texas's size and unique population demographics present challenges to addressing the state's cancer burden. The University of Texas MD Anderson Cancer Center is one of 69 National Cancer Institute-designated cancer centers across the United States. While these centers traditionally have focused on research, education and training, and providing research-driven patient care, they are in a unique position to collaboratively advance population health through cancer control. Unlike the traditional academic model of a three-legged stool representing research, education, and patient care, MD Anderson's mission includes a fourth leg that incorporates population health approaches. MD Anderson has leveraged state- and national-level data and freely available resources to develop population-health priorities and a set of evidence-based actions across policy, public and professional education, and community-based clinical service domains to address these priorities. Population health approaches complement dissemination and implementation research and treatment, and will be increasingly needed to address the growing cancer burden in Texas and the nation.

  10. MD2036: UFO Dynamics Studies and UFO Fast Detection

    CERN Document Server

    Belanger, Philippe; Valette, Matthieu; Lindstrom, Bjorn Hans Filip; Grob, Laura Katharina; Schmidt, Rudiger; Wollmann, Daniel

    2017-01-01

    UFOs are one of the remaining unknown related to LHC operation. Therefore, improving the understanding of UFO dynamics and validating the developed models against direct beam measurements is of fundamental importance in view of LHC operation at 7 TeV and with HL-LHC beam intensities. If not understood, UFOs could also be a showstopper for future machines such as FCC. This MD demonstrates new methods to study the dynamic behaviour of a calibrated UFO, simulated by the interaction of wire scanners with the beam. The events created during the MD were monitored using diamond BLMs in IR7, providing bunch-by-bunch resolution measurements. The analysis presented herein shows that blown-up bunches can be used to identify the plane of movement of UFOs, that bunch profiles and bunch sizes can be measured with dBLMs with good precision, that simulation of expected losses are in good agreement with measurements for oscillating bunches and that the space resolution of the acquisition system used during the MD is about 10 ...

  11. Cross-scale MD simulations of dynamic strength of tantalum

    Science.gov (United States)

    Bulatov, Vasily

    2017-06-01

    Dislocations are ubiquitous in metals where their motion presents the dominant and often the only mode of plastic response to straining. Over the last 25 years computational prediction of plastic response in metals has relied on Discrete Dislocation Dynamics (DDD) as the most fundamental method to account for collective dynamics of moving dislocations. Here we present first direct atomistic MD simulations of dislocation-mediated plasticity that are sufficiently large and long to compute plasticity response of single crystal tantalum while tracing the underlying dynamics of dislocations in all atomistic details. Where feasible, direct MD simulations sidestep DDD altogether thus reducing uncertainties of strength predictions to those of the interatomic potential. In the specific context of shock-induced material dynamics, the same MD models predict when, under what conditions and how dislocations interact and compete with other fundamental mechanisms of dynamic response, e.g. twinning, phase-transformations, fracture. In collaboration with: Luis Zepeda-Ruiz, Lawrence Livermore National Laboratory; Alexander Stukowski, Technische Universitat Darmstadt; Tomas Oppelstrup, Lawrence Livermore National Laboratory. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  12. Review of 40-year MD theses in Medical Oncology

    International Nuclear Information System (INIS)

    Zeeneldin, A.; Diyaa, A.; Elgammal, M.; Buhoush, W.; Manar Moneer, M.

    2014-01-01

    Background and objective: It is almost 40 years since the foundation of the Medical Oncology (MO) Department. We aimed to appraise the clinical research to fulfill the Medical Doctorate (MD) degree in MO at the National Cancer Institute, Cairo University (NCI, CU). Methods: This review included 62 MD theses containing 66 studies. They were reviewed regarding aims, type of study, clinical trial phase, design and methodology, statistical tests, results, limitations, consent and IRB approval. Theses were grouped into 3 periods: 1970-1989, 1990-1999 and 2000- 2008. Results: Almost 76% of the studies were interventional and 24% were observational. Informed consent and Institutional Review Board approval were mentioned in 18 and 2 studies, respectively. While all studies mentioned the aims, none, clearly mentioned the research question. Outcomes were mainly efficacy followed by safety. Study design was inadequately considered, especially in 70’s–80’s period (p = 0.038). Median sample size and study duration were almost stable through the three periods (p = 0.441, 0.354, respectively). Most of the studies used both descriptive and analytical statistical methods. In a descending order, researched cancers were lymphoma, breast, leukemia, liver, urinary bladder, lung and colorectal. The commonest stages researched were IV and III. The number of studies focused on assessing biomarkers, biomarkers plus drugs/procedures, drugs and procedures are 20, 20, 16 and 6, respectively. Conclusion: With time, research within MD theses in MO increased quantitatively and qualitatively. Improvements were noticeable in documentation of study design.

  13. 78 FR 28229 - Prospective Grant of Exclusive License: Device and System for Expression Microdissection (xMD)

    Science.gov (United States)

    2013-05-14

    ...-2003/1-US-02) filed February 25, 2010; Australian Patent No. 2003256803 (HHS Ref. No. E-113-2003/0-AU-04) issued January 21, 2010; Australian Patent Application S/N 2009250964 (HHS Ref. No. E-113-2003/0.... The patent rights in these inventions have been assigned to the Government of the United States of...

  14. Hawaii Space Grant Consortium

    Science.gov (United States)

    Flynn, Luke P.

    2005-01-01

    The Hawai'i Space Grant Consortium is composed of ten institutions of higher learning including the University of Hawai'i at Manoa, the University of Hawai'i at Hilo, the University of Guam, and seven Community Colleges spread over the 4 main Hawaiian islands. Geographic separation is not the only obstacle that we face as a Consortium. Hawai'i has been mired in an economic downturn due to a lack of tourism for almost all of the period (2001 - 2004) covered by this report, although hotel occupancy rates and real estate sales have sky-rocketed in the last year. Our challenges have been many including providing quality educational opportunities in the face of shrinking State and Federal budgets, encouraging science and technology course instruction at the K-12 level in a public school system that is becoming less focused on high technology and more focused on developing basic reading and math skills, and assembling community college programs with instructors who are expected to teach more classes for the same salary. Motivated people can overcome these problems. Fortunately, the Hawai'i Space Grant Consortium (HSGC) consists of a group of highly motivated and talented individuals who have not only overcome these obstacles, but have excelled with the Program. We fill a critical need within the State of Hawai'i to provide our children with opportunities to pursue their dreams of becoming the next generation of NASA astronauts, engineers, and explorers. Our strength lies not only in our diligent and creative HSGC advisory board, but also with Hawai'i's teachers, students, parents, and industry executives who are willing to invest their time, effort, and resources into Hawai'i's future. Our operational philosophy is to FACE the Future, meaning that we will facilitate, administer, catalyze, and educate in order to achieve our objective of creating a highly technically capable workforce both here in Hawai'i and for NASA. In addition to administering to programs and

  15. Rhodotorula taiwanensis MD1149 produces hypoacetylated PEFA compounds with increased surface activity compared to Rhodotorula babjevae MD1169

    Science.gov (United States)

    Rubinfeld, Bonnee; Leif, Roald; Mulcahy, Heather; Dugan, Lawrence; Souza, Brian

    2018-01-01

    Biosurfactants have several desirable characteristics in the industrial sector: detergency, antimicrobial effects, skin hydration, and emulsibility. Several yeast glycolipids are currently being utilized in these capacities: sophorolipids, ustilagic acid, and mannosylerythritol lipids (MELs). An emerging class of glycolipids, termed polyol esters of fatty acids (PEFA), have recently been reported for Rhodotorula babjevae, a basidiomycetous yeast species that secretes hyperacetylated congeners of PEFA (typically with 3–6 acetylation modifications). While screening Rhodotorula species for surfactant production, we identified a new environmental isolate identified as Rhodotorula taiwanensis MD1149 that dropped the surface tension of the liquid medium, indicating that it produced a potent biosurfactant. Acid depolymerization of the purified biosurfactants, followed by gas chromatography-mass spectrometry (GC-MS) analysis revealed that the biosurfactants were composed of PEFA compounds composed mainly of mannitol and arabitol esters of 3-hydroxy fatty acid, 3-methoxy fatty acid, and fatty acids with a single double bond; chain lengths were mainly C16 and C18. Liquid chromatography-mass spectrometry (LC-MS) confirmed the predicted accurate mass of these compounds. Interestingly, PEFA compounds produced by Rhodotorula taiwanensis MD1149 were more surface active due to their hypoacetylation profile (0–4 acetylation modifications) compared to Rhodotorula babjevae MD1169. These disparate surface active properties, based on acetylation, change the hydrophilic-lipophilic balance (HLB) of these compounds, and their potential utility within industrial applications. PMID:29293588

  16. Rhodotorula taiwanensis MD1149 produces hypoacetylated PEFA compounds with increased surface activity compared to Rhodotorula babjevae MD1169.

    Science.gov (United States)

    Lyman, Mathew; Rubinfeld, Bonnee; Leif, Roald; Mulcahy, Heather; Dugan, Lawrence; Souza, Brian

    2018-01-01

    Biosurfactants have several desirable characteristics in the industrial sector: detergency, antimicrobial effects, skin hydration, and emulsibility. Several yeast glycolipids are currently being utilized in these capacities: sophorolipids, ustilagic acid, and mannosylerythritol lipids (MELs). An emerging class of glycolipids, termed polyol esters of fatty acids (PEFA), have recently been reported for Rhodotorula babjevae, a basidiomycetous yeast species that secretes hyperacetylated congeners of PEFA (typically with 3-6 acetylation modifications). While screening Rhodotorula species for surfactant production, we identified a new environmental isolate identified as Rhodotorula taiwanensis MD1149 that dropped the surface tension of the liquid medium, indicating that it produced a potent biosurfactant. Acid depolymerization of the purified biosurfactants, followed by gas chromatography-mass spectrometry (GC-MS) analysis revealed that the biosurfactants were composed of PEFA compounds composed mainly of mannitol and arabitol esters of 3-hydroxy fatty acid, 3-methoxy fatty acid, and fatty acids with a single double bond; chain lengths were mainly C16 and C18. Liquid chromatography-mass spectrometry (LC-MS) confirmed the predicted accurate mass of these compounds. Interestingly, PEFA compounds produced by Rhodotorula taiwanensis MD1149 were more surface active due to their hypoacetylation profile (0-4 acetylation modifications) compared to Rhodotorula babjevae MD1169. These disparate surface active properties, based on acetylation, change the hydrophilic-lipophilic balance (HLB) of these compounds, and their potential utility within industrial applications.

  17. Taking Soft Skills for Granted?

    Science.gov (United States)

    Dutton, Gail

    2012-01-01

    The U.S. Department of Labor will award a total of $2 billion over the next four years through the Trade Adjustment Assistance Community College and Career Training Grant Program. Grants will support the development and improvement of postsecondary programs of two years or less that use evidence-based or innovative strategies to prepare students…

  18. MdMYB9 and MdMYB11 are involved in the regulation of the JA-induced biosynthesis of anthocyanin and proanthocyanidin in apples.

    Science.gov (United States)

    An, Xiu-Hong; Tian, Yi; Chen, Ke-Qin; Liu, Xiao-Juan; Liu, Dan-Dan; Xie, Xing-Bin; Cheng, Cun-Gang; Cong, Pei-Hua; Hao, Yu-Jin

    2015-04-01

    Anthocyanin and proanthocyanidin (PA) are important secondary metabolites and beneficial to human health. Their biosynthesis is induced by jasmonate (JA) treatment and regulated by MYB transcription factors (TFs). However, which and how MYB TFs regulate this process is largely unknown in apple. In this study, MdMYB9 and MdMYB11 which were induced by methyl jasmonate (MeJA) were functionally characterized. Overexpression of MdMYB9 or MdMYB11 promoted not only anthocyanin but also PA accumulation in apple calluses, and the accumulation was further enhanced by MeJA. Subsequently, yeast two-hybrid, pull-down and bimolecular fluorescence complementation assays showed that both MYB proteins interact with MdbHLH3. Moreover, Jasmonate ZIM-domain (MdJAZ) proteins interact with MdbHLH3. Furthermore, chromatin immunoprecipitation-quantitative PCR and yeast one-hybrid assays demonstrated that both MdMYB9 and MdMYB11 bind to the promoters of ANS, ANR and LAR, whereas MdbHLH3 is recruited to the promoters of MdMYB9 and MdMYB11 and regulates their transcription. In addition, transient expression assays indicated that overexpression of MdJAZ2 inhibits the recruitment of MdbHLH3 to the promoters of MdMYB9 and MdMYB11. Our findings provide new insight into the mechanism of how MeJA regulates anthocyanin and PA accumulation in apple. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. 75 FR 49991 - Beverley P. Edwards, M.D.; Revocation of Registration

    Science.gov (United States)

    2010-08-16

    ... Enforcement Administration Beverley P. Edwards, M.D.; Revocation of Registration On January 21, 2010, I, the... Suspension of Registration to Beverly P. Edwards, M.D. (Respondent), of Indianapolis, Indiana. The Show Cause... DEA Certificate of Registration, BE8619667, issued to Beverly P. Edwards, M.D., be, and it hereby is...

  20. 75 FR 52461 - Drawbridge Operation Regulation; Pocomoke River, Snow Hill, MD

    Science.gov (United States)

    2010-08-26

    ... Operation Regulation; Pocomoke River, Snow Hill, MD AGENCY: Coast Guard, DHS. ACTION: Notice of temporary... River, mile 29.9, at Snow Hill, MD. The deviation restricts the operation of the draw span to facilitate.... The S12 Bridge across Pocomoke River, mile 29.9 at Snow Hill MD, has a vertical clearance in the...

  1. 76 FR 16296 - Drawbridge Operation Regulation; Pocomoke River, Snow Hill, MD

    Science.gov (United States)

    2011-03-23

    ... Operation Regulation; Pocomoke River, Snow Hill, MD AGENCY: Coast Guard, DHS. ACTION: Notice of temporary..., at Snow Hill, MD. The deviation restricts the operation of the draw span to facilitate the cleaning... Pocomoke River, mile 29.9 at Snow Hill MD, has a vertical clearance in the closed position of two feet...

  2. 76 FR 20032 - Thomas E. Mitchell, M.D.; Dismissal of Proceeding

    Science.gov (United States)

    2011-04-11

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 10-7] Thomas E. Mitchell, M.D... Control, Drug Enforcement Administration, issued an Order to Show Cause to Thomas E. Mitchell, M.D....100(b) and 0.104, I hereby order that the Order to Show Cause issued to Thomas E. Mitchell, M.D., be...

  3. 76 FR 71375 - Scott D. Fedosky, M.D.; Denial of Application

    Science.gov (United States)

    2011-11-17

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Scott D. Fedosky, M.D.; Denial of... Enforcement Administration, issued an Order to Show Cause to Scott D. Fedosky, M.D. (Respondent), of... Scott David Fedosky, M.D. (Ark. Med. Bd. Feb. 17, 2004). On October 8, 2003, Respondent voluntarily...

  4. 77 FR 7182 - Scott W. Houghton, M.D.; Decision and Order

    Science.gov (United States)

    2012-02-10

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 12-09] Scott W. Houghton, M.D... CFR 0.100(b), I order that DEA Certificate of Registration BH8796077, issued to Scott W. Houghton, M.D., be, and it hereby is, revoked. I further order that any pending application of Scott W. Houghton, M.D...

  5. 22q11 deletion syndrome and urogenital manifestationsA clinicopathological case report and review of the literatureM.Vachette MD*, GE.Grant MD*, J.Bouquet de Joliniere MD.PhD*, M. Jotterand MD** N.Ben Ali MD*, A.Feki MD.PhD * and R.Brugger MD.*Department of gynecology and obstetrics, HFR, Fribourg, Switzerland.** Institute of pathology, CHUV, Lausanne, Switzerland.

    Directory of Open Access Journals (Sweden)

    Jean Bouquet De Jolinière

    2016-11-01

    Full Text Available Background: Deletion in the chromosomal region 22q11 results from the abnormal development of the third and fourth pharyngeal pouches during embryonic life and presents an expansive phenotype with more than 180 clinical features described that involve every organ and system. History and Signs: A 23-year-old African woman presented for the first trimester echography, which revealed an isolated anechoic structure suggesting a ureteral dilatation. The suspicion of a malposition of great arteries in the second trimester indicated an amniocentesis leading to a diagnosis of 22q11 deletion. Outcome: At 32 weeks, the patient was admitted for premature rupture of membranes and gave birth 2 weeks later to a male newborn that presented a respiratory distress syndrome and probably died secondary to a tracheal stenosis. Necropsy revealed typical clinical features of 22q11 deletion associated with left renal agenesis, hypospadias and penile hypoplasia. Conclusions: We report a case of 22q11 deletion syndrome with typical clinical features associated with urogenital manifestations suspected at the first trimester ultrasound.

  6. The effect of potassium and mycorrhiza on growth of vanilla (Vanilla planifolia Andrew

    Directory of Open Access Journals (Sweden)

    I GEDE TIRTA

    2006-04-01

    Full Text Available The few and shallow roots caused slow growth of vanilla seedling. Mycorrhiza may increased the absorption of water and nutrients, while potassium may increased the rate of growth and strength of seedlings. This study was conducted at Sambangan Village, Buleleng, Bali in 2003 (April-Agustus 2003. The experiment was done in polybag and was arranged in Randomized Block Design with three replications. The treatments were consisted of two factors. The first factor was the rates of KCl fertilizer ( 0, 100 and 200 kg ha-1 or 0, 0,10 and 0,20 9 plant-1 and the second factor was the rates of mycorrhiza (0, 20 and 30 g plant-1. The aim of the research to study interactions between potassium and mycorrhiza and The optimum dosage the mycorrhiza on growth of vanilla (Vanilla planifolia Andrew. The resultes showed that there were interactions between potassium and mycorrhiza on fresh weight of the new shoot, root length and fresh root weight. The optimum dosage of the mycorrhiza was 20 g plant-1 with new shoot fresh weight was 25.63 g plant-1. The longest root (24.67 cm plant-1 was observed at the treatment without potasium with 20 g plant-1 mycorrhiza and this was 23% longer than control (19.93 cm plant-1. The highest fresh root weight (2.48 g plant-1 was observed at the dosage of 200 kg KCl ha-1 and 20 g mycorrhiza plant-1 and that was 55% heavier than control (1.60 g plant-1. The leaf number of the plant with 20 g plant-1 mycorrhiza was 6.22 and that was 18% more than control with leaf number 5.25. The total fresh weight of the seedling with 20 g plant-1 mycorrhiza was 86.74 g plant-1or 15% higher compared with control (75.18 g plant-1. The dosage of 100 kg KCl ha-1 increased the K content of the plant (2.45%K or 35% higher than control (1.81%K.

  7. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992. [Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hebdon, F.J. [Institute of Nuclear Power Operations, Atlanta, GA (United States)

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility`s actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities.

  8. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992

    International Nuclear Information System (INIS)

    Hebdon, F.J.

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility's actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities

  9. Don't Take Marketing for "Grant"ed: Building Marketing Efforts into Library Grant Initiatives

    Science.gov (United States)

    Germain, Carol Anne

    2009-01-01

    Libraries frequently apply for grants to help fund special projects and resources, such as purchases for library collections, innovative instructional technologies, and research subscription databases. Grants provide support for cultural events, professional development sessions, new construction, and building renovations. Like other library…

  10. The Andrews' Principles of Risk, Need, and Responsivity as Applied in Drug Abuse Treatment Programs: Meta-Analysis of Crime and Drug Use Outcomes.

    Science.gov (United States)

    Prendergast, Michael L; Pearson, Frank S; Podus, Deborah; Hamilton, Zachary K; Greenwell, Lisa

    2013-09-01

    The purpose of the present meta-analysis was to answer the question: Can the Andrews principles of risk, needs, and responsivity, originally developed for programs that treat offenders, be extended to programs that treat drug abusers? Drawing from a dataset that included 243 independent comparisons, we conducted random-effects meta-regression and ANOVA-analog meta-analyses to test the Andrews principles by averaging crime and drug use outcomes over a diverse set of programs for drug abuse problems. For crime outcomes, in the meta-regressions the point estimates for each of the principles were substantial, consistent with previous studies of the Andrews principles. There was also a substantial point estimate for programs exhibiting a greater number of the principles. However, almost all of the 95% confidence intervals included the zero point. For drug use outcomes, in the meta-regressions the point estimates for each of the principles was approximately zero; however, the point estimate for programs exhibiting a greater number of the principles was somewhat positive. All of the estimates for the drug use principles had confidence intervals that included the zero point. This study supports previous findings from primary research studies targeting the Andrews principles that those principles are effective in reducing crime outcomes, here in meta-analytic research focused on drug treatment programs. By contrast, programs that follow the principles appear to have very little effect on drug use outcomes. Primary research studies that experimentally test the Andrews principles in drug treatment programs are recommended.

  11. 78 FR 64574 - Grant Guideline, Notice

    Science.gov (United States)

    2013-10-29

    ... Training (CAT) Grants, Partner Grants, Strategic Initiatives Grants (SIG) Program, and the Education... found in section IV.D. E. Strategic Initiatives Grants The Strategic Initiatives Grants (SIG) program...) Library and Digital Archive. Applicants are required to conduct a search of the NCSC Library and Digital...

  12. [A posthumous tribute to Gustavo V. Pineda, MD].

    Science.gov (United States)

    Reyes Budelovsky, Humberto

    2002-08-01

    Gustavo V Pineda, MD, was born in Santiago, in December 7th 1935 and died in August 17th, 2001. After studying medicine at the University of Chile School of Medicine (MD title in 1960) he was Resident in Internal Medicine at the Hospital del Salvador, in Santiago, where he later on spent his professional career, specializing in Endocrinology. Dr. Pineda was a keen clinical investigator and a leading specialist in Latinamerica, mainly in the field of thyroid diseases. Several generations of undergraduate and postgraduate students grew up under his tutorship, both as an internist and as an endocrinologist. An active member and a leader in professional and scientific organizations, he presided successively the Chilean Society of Endocrinology, the Chilean Society of Internal Medicine (Sociedad Médica de Santiago) and the Latinamerican Society for the Study of Thyroid Diseases. In 1999 he was elected Member of the Chilean Academy of Medicine. A friendly and supportive teacher and colleague, his name will remain associated with the progress of medicine in Chile during the second half of the 20th Century.

  13. Full-Scale Crash Test of an MD-500 Helicopter

    Science.gov (United States)

    Littell, Justin

    2011-01-01

    A full-scale crash test was successfully conducted in March 2010 of an MD-500 helicopter at NASA Langley Research Center s Landing and Impact Research Facility. The reasons for conducting this test were threefold: 1 To generate data to be used with finite element computer modeling efforts, 2 To study the crashworthiness features typically associated with a small representative helicopter, and 3 To compare aircraft response to data collected from a previously conducted MD-500 crash test, which included an externally deployable energy absorbing (DEA) concept. Instrumentation on the airframe included accelerometers on various structural components of the airframe; and strain gages on keel beams, skid gear and portions of the skin. Three Anthropomorphic Test Devices and a specialized Human Surrogate Torso Model were also onboard to collect occupant loads for evaluation with common injury risk criteria. This paper presents background and results from this crash test conducted without the DEA concept. These results showed accelerations of approximately 30 to 50 g on the airframe at various locations, little energy attenuation through the airframe, and moderate to high probability of occupant injury for a variety of injury criteria.

  14. MD1878: Operation with primary collimators at tighter settings

    CERN Document Server

    AUTHOR|(CDS)2078850; Amorim, David; Biancacci, Nicolo; Bruce, Roderik; Buffat, Xavier; Carver, Lee Robert; Fiascaris, Maria; Mereghetti, Alessio; Redaelli, Stefano; Rossi, Roberto; Salvachua Ferrando, Belen Maria; Soderen, Martin; Trad, Georges; CERN. Geneva. ATS Department

    2017-01-01

    Primary (TCP) collimators of the betatron cleaning insertion determine the betatron cut of the LHC beam. During the 2016 they were set at 5.5 nominal beam sigmas at 6.5 TeV (i.e. by using a normalized emittance ε* = 3:5 μm is used). Reducing their settings is a possible way to push the ß* at the LHC, which depends on the collimation hierarchy. This study aims at understanding possible limitations of operating the LHC with tighter settings of the primary collimators. This is a crucial input to the choice of operational configuration in terms of ß* at the LHC as well as at the HL-LHC. This study follows a successful MD done in block 3 to understand limitations from TCP impedance [1]. The outcome of this MD can also have an impact for the design of the FCC collimation system, which is currently based on the present TCP gaps. Studies of beam stability as a function of octupole current, transverse feedback gain (ADT) and transverse separation at the IPs were also carried out.

  15. Namibia - Vocational Training Grant Fund

    Data.gov (United States)

    Millennium Challenge Corporation — The impact evaluation of the Vocational Training Grant Fund (VTGF) subactivity in Namibia used a random assignment design to determine the effects of VTGF-funded...

  16. ACED Federal Grant Contractor Tracking

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — Dataset includes grant, project, and contractor awarded which are tracked for ensuring Davis-Bacon Act compliance where applicable. The 1931 Davis-Bacon Act...

  17. Grant Closeout Requirements and Reports

    Science.gov (United States)

    Requirements and reports to comply with grant closeout, including Final Federal Financial Report (FFR, SF425); Final Research Performance Progress Report (FRPPR); Interim Research Performance Progress Report (IRPPR); Final Invention Statement (FIS, HHS

  18. Office of Grants Administration (OGA)

    Science.gov (United States)

    OGA manages all NCI business-related activities associated with the negotiation, award, and administration of NCI grants and cooperative agreements to help financially support cancer research activities throughout the United States and around the world.

  19. Mangroves, hurricanes, and lightning strikes: Assessment of Hurricane Andrew suggests an interaction across two differing scales of disturbance

    Science.gov (United States)

    Smith, Thomas J.; Robblee, Michael B.; Wanless, Harold R.; Doyle, Thomas W.

    1994-01-01

    The track of Hurricane Andrew carried it across one of the most extensive mangrove for ests in the New World. Although it is well known that hurricanes affect mangrove forests, surprisingly little quantitative information exists concerning hurricane impact on forest structure, succession, species composition, and dynamics of mangrove-dependent fauna or on rates of eco-system recovery (see Craighead and Gilbert 1962, Roth 1992, Smith 1992, Smith and Duke 1987, Stoddart 1969).After Hurricane Andrew's passage across south Florida, we assessed the environmental damage to the natural resources of the Everglades and Biscayne National Parks. Quantitative data collected during subsequent field trips (October 1992 to July 1993) are also provided. We present measurements of initial tree mortality by species and size class, estimates of delayed (or continuing) tree mortality, and observations of geomorphological changes along the coast and in the forests that could influence the course of forest recovery. We discuss a potential interaction across two differing scales of disturbance within mangrove forest systems: hurricanes and lightning strikes.

  20. Evaluation of long-term community recovery from Hurricane Andrew: sources of assistance received by population sub-groups.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-12-01

    Two three-stage cluster surveys were conducted in South Dade County, Florida, 14 months apart, to assess recovery following Hurricane Andrew. Response rates were 75 per cent and 84 per cent. Sources of assistance used in recovery from Hurricane Andrew differed according to race, per capita income, ethnicity, and education. Reports of improved living situation post-hurricane were not associated with receiving relief assistance, but reports of a worse situation were associated with loss of income, being exploited, or job loss. The number of households reporting problems with crime and community violence doubled between the two surveys. Disaster relief efforts had less impact on subjective long-term recovery than did job or income loss or housing repair difficulties. Existing sources of assistance were used more often than specific post-hurricane relief resources. The demographic make-up of a community may determine which are the most effective means to inform them after a disaster and what sources of assistance may be useful.

  1. Federal health services grants, 1985.

    Science.gov (United States)

    Zwick, D I

    1986-01-01

    Federal health services grants amounted to about $1.8 billion in fiscal year 1985. The total amount was about $100 million less, about 6 percent, than in 1980. Reductions in the health planning program accounted for most of the decline in absolute dollars. The four formula grants to State agencies amounted to about $1.0 billion in 1985, about 60 percent of the total. The largest formula grants were for maternal and child health services and for alcohol, drug abuse, and mental health services. Project grants to selected State and local agencies amounted to about $.8 billion. There was 12 such grants in 1985 (compared with 34 in 1980). The largest, for community health services, equaled almost half the total. In real, inflation-adjusted dollars, the decline in Federal funds for these programs exceeded a third during the 5-year period. The overall dollar total in real terms in 1985 approximated the 1970 level. The ratio of formula grants to project grants in 1985 was similar to that in 1965. Studies of the impact of changes in Federal grants have found that while the development of health programs has been seriously constrained in most cases, their nature has not been substantially altered. In some cases broader program approaches and allocations have been favored. Established modes of operations and administration have generally been strengthened. Some efficiencies but few savings in administration have been identified. Replacement of reduced Federal funding by the States has been modest but has increased over time, especially for direct service activities. These changes reflect the important influence of professionalism in the health fields and the varying strengths of political interest and influence among program supporters. The long-term impact on program innovation is not yet clear.

  2. Wetland Program Development Grants (WPDGs) Case Studies

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Wetland Grant Database (WGD) houses grant data for Wetland Program Development Grants (created by EPA in 1990 under the Clean Water Act Section 104(b)(3)...

  3. [Professor Frantisek Por MD and Professor Robert Klopstock MD, students at Budapest and Prague Faculties of Medicine].

    Science.gov (United States)

    Mydlík, M; Derzsiová, K

    2010-11-01

    Professor Frantisek Por MD and Professor Robert Klopstock MD were contemporaries, both born in 1899, one in Zvolen, the other in Dombovar, at the time of Austro-Hungarian Monarchy. Prof. Por attended the Faculty of Medicine in Budapest from 1918 to 1920, and Prof. Klopstock studied at the same place between 1917 and 1919. From 1920 until graduation on 6th February 1926, Prof. Por continued his studies at the German Faculty of Medicine, Charles University in Prague. Prof. Klopstock had to interrupt his studies in Budapest due to pulmonary tuberculosis; he received treatment at Tatranske Matliare where he befriended Franz Kafka. Later, upon Kafka's encouragement, he changed institutions and continued his studies at the German Faculty of Medicine, Charles University in Prague, where he graduated the first great go. It is very likely that, during their studies in Budapest and Prague, both professors met repeatedly, even though their life paths later separated. Following his graduation, Prof. Por practiced as an internist in Prague, later in Slovakia, and from 1945 in Kosice. In 1961, he was awarded the title of university professor of internal medicine at the Faculty of Medicine, Pavol Jozef Safarik University in Kosice, where he practiced until his death in 1980. Prof. Klopstock continued his studies in Kiel and Berlin. After his graduation in 1933, he practiced in Berlin as a surgeon and in 1938 left for USA. In 1962, he was awarded the title of university professor of pulmonary surgery in NewYork, where he died in 1972.

  4. LHC β*-reach MD: aperture measurements at small β*

    CERN Document Server

    Fuster Martinez, Nuria; Redaelli, Stefano; CERN. Geneva. ATS Department

    2017-01-01

    During this MD, performed on the 25th of July 2017, we measured the LHC aperture at top energy for β*=30 cm using the Transverse Damper (ADT) blow-up method. These measurements are part of the standard commissioning of an optics and have been performed in order to provide early on inputs for a possible change of β* later in 2017, as envisaged previously to fully profit from the additional margins introduced by the rematched phase advance between dump kickers and the TCTs (Target Collimator Tertiary). In addition to the aperture measurements, two other commissioning important tests were performed: loss maps for the nominal TCTs settings and an asynchronous dump validation with tighter TCT gaps.

  5. Report from LHC MD 2158: IR-nonlinear studies

    CERN Document Server

    Maclean, Ewen Hamish; Dilly, Joschua Werner; Fol, Elena; Giovannozzi, Massimo; Hofer, Michael; Malina, Lukas; Persson, Tobias Hakan Bjorn; Coello De Portugal - Martinez Vazquez, Jaime Maria; Skowronski, Piotr Krzysztof; Tomas Garcia, Rogelio; Garcia-Tabares Valdivieso, Ana; Wegscheider, Andreas; CERN. Geneva. ATS Department

    2017-01-01

    For the first time the LHC is running for luminosity-production with local corrections for nonlinear errors in the ATLAS and CMS insertions. While a major step forward in LHC optics commissioning strategy (and one which has yielded clear operational benefits) considerable challenges remain to be overcome, both in regard to the optimization of LHC optics and in order to ensure successful commissioning of the High-Luminosity LHC. MD 2158 sought to follow up several aspects of the 2017 nonlinear optics commissioning which are not yet understood, and by enhancing sextupole and dodecapole sources in the ATLAS and CMS insertions explore the prospects for linear and nonlinear optics commissioning in the HL-LHC.

  6. A workshop on leadership for MD/PhD students

    Directory of Open Access Journals (Sweden)

    Mark D. Cannon

    2011-08-01

    Full Text Available Success in academic medicine requires scientific and clinical aptitude and the ability to lead a team effectively. Although combined MD/PhD training programs invest considerably in the former, they often do not provide structured educational opportunities in leadership, especially as applied to investigative medicine. To fill a critical knowledge gap in physician-scientist training, the Vanderbilt Medical Scientist Training Program (MSTP developed a biennial two-day workshop in investigative leadership. MSTP students worked in partnership with content experts to develop a case-based curriculum and deliver the material. In its initial three offerings in 2006, 2008, and 2010, the workshop was judged by MSTP student attendees to be highly effective. The Vanderbilt MSTP Leadership Workshop offers a blueprint for collaborative student-faculty interactions in curriculum design and a new educational modality for physician-scientist training.

  7. Impact of Carbon Nanotube on Homocysteine Clusters: MD Simulation

    Science.gov (United States)

    Raczyński, Przemysław; Górny, Krzysztof; Gburski, Zygmunt

    The role of homocysteine in the human body is not well known but its level is associated with cardiovascular disease. The pure clusters composed of n = 65 and 2500 homocysteine molecules have been studied by the computer simulation molecular dynamics (MD) method. Among the anticipated applications of the carbon nanotubes is their use in biological sensors, particularly homocysteine nanosensor. We have also examined the impact of a carbon nanotube on the homocysteine clusters. The mean square displacement, diffusion coefficient, and radial distribution function of homocysteine have been calculated for several temperatures, including the physiological (T = 310 K). We interpret the behavior of homocysteine molecules in the pure clusters and in the clusters with carbon nanotube by a qualitative interpretation of physical observables and snapshots of instantaneous configurations.

  8. Transport and characterization of ambient biological aerosol near Laurel, MD

    Science.gov (United States)

    Santarpia, J. L.; Cunningham, D.; Gilberry, J.; Kim, S.; Smith, E. E.; Ratnesar-Shumate, S.; Quizon, J.

    2010-09-01

    Bacterial aerosol have been observed and studied in the ambient environment since the mid nineteenth century. These studies have sought to provide a better understanding of the diversity, variability and factors that control the biological aerosol population. In this study, we show comparisons between diversity of culturable bacteria and fungi, using culture and clinical biochemical tests, and 16S rRNA diversity using Affymetrix PhyloChips. Comparing the culturable fraction and surveying the total 16S rRNA of each sample provides a comprehensive look at the bacterial population studied and allows comparison with previous studies. Thirty-six hour back-trajectories of the air parcels sampled, over the two day period beginning 4 November 2008, provide information on the sources of aerosol sampled on the campus of Johns Hopkins University Applied Physics Laboratory in Laurel, MD. This study indicates that back-trajectory modeling of air parcels may provide insights into the observed diversity of biological aerosol.

  9. Report from LHC MD 2158: IR-nonlinear studies

    CERN Document Server

    Maclean, Ewen Hamish; Cruz Alaniz, Emilia; Dalena, Barbara; Dilly, Joschua Werner; Fol, Elena; Giovannozzi, Massimo; Hofer, Michael; Malina, Lukas; Persson, Tobias Hakan Bjorn; Coello De Portugal - Martinez Vazquez, Jaime Maria; Skowronski, Piotr Krzysztof; Solfaroli Camillocci, Matteo; Tomas Garcia, Rogelio; Garcia-Tabares Valdivieso, Ana; Wegscheider, Andreas; CERN. Geneva. ATS Department

    2018-01-01

    For the first time the LHC is running for luminosity-production with local corrections for nonlinear errors in the ATLAS and CMS insertions. While a major step forward in LHC optics commissioning strategy (and one which has yielded clear operational benefits) considerable challenges remain to be overcome, both in regard to the optimization of LHC optics and in order to ensure successful commissioning of the High-Luminosity LHC. MD 2158 sought to follow up several aspects of the 2017 nonlinear optics commissioning which are not yet understood, and by enhancing sextupole and dodecapole sources in the ATLAS and CMS insertions explore the prospects for linear and nonlinear optics commissioning in the HL-LHC.

  10. MD 979: Beta-beating measurements on colliding beams

    CERN Document Server

    Goncalves Jorge, Patrik; Pieloni, Tatiana; Buffat, Xavier; Carlier, Felix Simon; Coello De Portugal - Martinez Vazquez, Jaime Maria; Fol, Elena; Langner, Andy Sven; Medina Medrano, Luis Eduardo; Olexa, Jakub; Tomas Garcia, Rogelio; Valuch, Daniel; Wegscheider, Andreas; CERN. Geneva. ATS Department

    2017-01-01

    The HL-LHC high brightness beams will give a large β-beating due to the head-on and long-range interactions since a beam-beam parameter of 0.01 per Interaction Point (IP) is expected. The β-heating induced by two head-on collision reaches 15%. A third IP, i.e. IP8, could bring the β-heating up to 24%. The aim of the Machine Development (MD) study was to test optics measurements with AC dipole and ADT on colliding beams at injection and to implement a correction of the β-heating due to to head-on collision in the two experiments IP1&5. Int his note, we summarize the first results of this test performed in the LHC.

  11. Commentary on Muscle dysmorphia as an addiction: a response to Grant (2015) and Nieuwoudt (2015).

    Science.gov (United States)

    Griffiths, Mark D; Foster, Andrew C; Shorter, Gillian W

    2015-03-01

    Following the publication of our paper ‘Muscle Dysmorphia: Could it be classified as an addiction to body image?’ in the Journal of Behavioral Addictions, two commentaries by Jon Grant and Johanna Nieuwoudt were published in response to our paper. Using the ‘addiction components model’, our main contention is that muscle dysmorphia (MD) actually comprises a number of different actions and behaviors and that the actual addictive activity is the maintaining of body image via a number of different activities such as bodybuilding, exercise, eating certain foods, taking specific drugs (e.g., anabolic steroids), shopping for certain foods, food supplements, and purchase or use of physical exercise accessories. This paper briefly responds to these two commentaries. While our hypothesized specifics relating to each addiction component sometimes lack empirical support (as noted explicitly by both Nieuwoudt and Grant), we still believe that our main thesis (that almost all the thoughts and behaviors of those with MD revolve around the maintenance of body image) is something that could be empirically tested in future research by those who already work in the area. We hope that the ‘Addiction to Body Image’ model we proposed provides a new framework for carrying out work in both empirical and clinical settings. The idea that MD could potentially be classed as an addiction cannot be negated on theoretical grounds as many people in the addiction field are turning their attention to research in new areas of behavioral addiction.

  12. Structural analysis of molten salt systems by XAFS, XRD and MD

    International Nuclear Information System (INIS)

    Okamoto, Yoshihiro; Minato, Kazuo

    2001-01-01

    Combinational use of X-ray absorption fine structure (XAFS), X-ray diffraction (XRD) and molecular dynamics (MD) simulation has been applied to investigate the structural analysis of high-temperature molten salt systems. The XRD data of molten rare earth trihalides and uranium trichloride were reproduced by the MD with polarizable ionic model. We proposed that the XAFS function is calculated by combinational use of the MD output and the multiscattering XAFS code FEFF. (author)

  13. Grants for Employment--2012 Digital Edition

    Science.gov (United States)

    Foundation Center, 2011

    2011-01-01

    This publication is only available as a downloadable file. See who's giving and getting grants in your field. Strengthen your search for funds with the Foundation Center's digital edition of "Grants for Employment." This new "Grant Guide" reveals the scope of current foundation giving in the field. You'll find descriptions of 4,129 grants of…

  14. MD-2 Determinants of Nickel and Cobalt-Mediated Activation of Human TLR4

    Science.gov (United States)

    Oblak, Alja; Pohar, Jelka; Jerala, Roman

    2015-01-01

    Recent findings unexpectedly revealed that human TLR4 can be directly activated by nickel ions. This activation is due to the coordination of nickel by a cluster of histidine residues on the ectodomain of human TLR4, which is absent in most other species. We aimed to elucidate the role of MD-2 in the molecular mechanism of TLR4/MD-2 activation by nickel, as nickel binding site on TLR4 is remote from MD-2, which directly binds the endotoxin as the main pathological activator of TLR4. We identified MD-2 and TLR4 mutants which abolished TLR4/MD-2 receptor activation by endotoxin but could nevertheless be significantly activated by nickel, which acts in synergy with LPS. Human TLR4/MD-2 was also activated by cobalt ions, while copper and cadmium were toxic in the tested concentration range. Activation of TLR4 by cobalt required MD-2 and was abolished by human TLR4 mutations of histidine residues at positions 456 and 458. We demonstrated that activation of TLR4 by nickel and cobalt ions can trigger both the MyD88-dependent and the –independent pathway. Based on our results we propose that predominantly hydrophobic interactions between MD-2 and TLR4 contribute to the stabilization of the TLR4/MD-2/metal ion complex in a conformation that enables activation. PMID:25803856

  15. Analysis of MD5 authentication in various routing protocols using simulation tools

    Science.gov (United States)

    Dinakaran, M.; Darshan, K. N.; Patel, Harsh

    2017-11-01

    Authentication being an important paradigm of security and Computer Networks require secure paths to make the flow of the data even more secure through some security protocols. So MD-5(Message Digest 5) helps in providing data integrity to the data being sent through it and authentication to the network devices. This paper gives a brief introduction to the MD-5, simulation of the networks by including MD-5 authentication using various routing protocols like OSPF, EIGRP and RIPv2. GNS3 is being used to simulate the scenarios. Analysis of the MD-5 authentication is done in the later sections of the paper.

  16. Evidence for ProTα-TLR4/MD-2 binding: molecular dynamics and gravimetric assay studies.

    Science.gov (United States)

    Omotuyi, Olaposi; Matsunaga, Hayato; Ueda, Hiroshi

    2015-01-01

    During preconditioning, lipopolysaccharide (LPS) selectively activates TLR4/MD-2/Toll/IL-1 receptor-domain-containing adaptor inducing IFN-β (TRIF) pathway instead of pro-inflammatory myeloid differentiation protein-88 (MyD88)/MyD88-adaptor-like protein (MAL) pathway. Extracellular prothymosin alpha (ProTα) is also known to selectively activate the TLR4/MD2/TRIF-IRF3 pathway in certain diseased conditions. In the current study, biophysical evidence for ProTα/TLR4/MD-2 complex formation and its interaction dynamics have been studied. Gravimetric assay was used to investigate ProTα/TLR4/MD-2 complex formation while molecular dynamics (MD) simulation was used to study its interaction dynamics. Through electrostatic interaction, full-length ProTα (F-ProTα) C-terminal peptide (aa 91 - 111) superficially interacts with similar TLR4/MD-2 (KD = 273.36 nm vs 16.07 μg/ml [LPS]) conformation with LPS at an overlapping three-dimensional space while F-ProTα is hinged to the TLR4 scaffold by one-amino acid shift-Mosoian domain (aa-51 - 90). Comparatively, F-ProTα better stabilizes MD-2 metastable states transition and mediates higher TLR4/MD-2 interaction than LPS. ProTα via its C-terminal peptide (aa 91 - 111) exhibits in vitro biophysical contact with TLR4/MD-2 complex conformation recognized by LPS at overlapping LPS-binding positions.

  17. MD-2 determinants of nickel and cobalt-mediated activation of human TLR4.

    Directory of Open Access Journals (Sweden)

    Alja Oblak

    Full Text Available Recent findings unexpectedly revealed that human TLR4 can be directly activated by nickel ions. This activation is due to the coordination of nickel by a cluster of histidine residues on the ectodomain of human TLR4, which is absent in most other species. We aimed to elucidate the role of MD-2 in the molecular mechanism of TLR4/MD-2 activation by nickel, as nickel binding site on TLR4 is remote from MD-2, which directly binds the endotoxin as the main pathological activator of TLR4. We identified MD-2 and TLR4 mutants which abolished TLR4/MD-2 receptor activation by endotoxin but could nevertheless be significantly activated by nickel, which acts in synergy with LPS. Human TLR4/MD-2 was also activated by cobalt ions, while copper and cadmium were toxic in the tested concentration range. Activation of TLR4 by cobalt required MD-2 and was abolished by human TLR4 mutations of histidine residues at positions 456 and 458. We demonstrated that activation of TLR4 by nickel and cobalt ions can trigger both the MyD88-dependent and the -independent pathway. Based on our results we propose that predominantly hydrophobic interactions between MD-2 and TLR4 contribute to the stabilization of the TLR4/MD-2/metal ion complex in a conformation that enables activation.

  18. Enhancing breast projection in autologous reconstruction using the St Andrew's coning technique and 3D volumetric analysis.

    Science.gov (United States)

    Chae, Michael P; Rozen, Warren Matthew; Patel, Nakul Gamanlal; Hunter-Smith, David J; Ramakrishnan, Venkat

    2017-12-01

    An increasing number of women undergo mastectomy for breast cancer and post-mastectomy autologous breast reconstruction has been shown to significantly improve the psychosexual wellbeing of the patients. A goal of treatment is to achieve symmetry and projection to match the native breast, and/or the contralateral breast in the case of a unilateral reconstruction. Autologous reconstruction, particularly with the deep inferior epigastric artery perforator (DIEP) flap, is particularly advantageous as it can be manipulated to mimic the shape and turgor of the native breast. However, very few techniques of shaping the breast conus when insetting the DIEP flap to enhance aesthetic outcome have been reported to date. With the aide of three-dimension (3D) photography and 3D-printed mirrored image of the contralateral breast as a guide intraoperatively, we describe our St Andrew's coning technique to create a personalized flap projection. We report a prospective case series of 3 delayed unilateral breast reconstructions where symmetrization procedure to the contralateral breast was not indicated. Using a commercial 3D scanner (VECTRA XR, Canfield Scientific), the breast region was imaged. The mirrored image was 3D-printed in-house using a desktop 3D printer. In all cases, projection of the breast mound was able to be safely achieved, with a demonstrated central volume (or 'cone') able to be highlighted on imaging and a 3D printed breast. A 3D print of the contralateral breast was able to be used intraoperatively to guide the operative approach. The St Andrew's coning technique is a useful aesthetic maneuver for achieving breast projection during DIEP flap breast reconstruction, with 3D imaging techniques able to assist in perioperative assessment of breast volume.

  19. 78 FR 76812 - In the Matter of: Andrew Vincent O'Donnell, Inmate Number-62355-019, USP Atlanta, U.S...

    Science.gov (United States)

    2013-12-19

    ... DEPARTMENT OF COMMERCE Bureau of Industry and Security In the Matter of: Andrew Vincent O'Donnell... the Internal Security Act of 1950 (50 U.S.C. 783(b)), or section 38 of the Arms Export Control Act (22... 750.8 of the Regulations states that the Bureau of Industry and Security's Office of Exporter Services...

  20. Invertebrates of The H.J. Andrews Experimental Forest, western Cascade Range, Oregon. V: An annotated list of insects and other arthropods.

    Science.gov (United States)

    Gary L. Parson; Gerasimos Cassis; Andrew R. Moldenke; John D. Lattin; Norman H. Anderson; Jeffrey C Miller; Paul Hammond; Timothy D. Schowalter

    1991-01-01

    An annotated list of species of insects and other arthropods that have been collected and studies on the H.J. Andrews Experimental forest, western Cascade Range, Oregon. The list includes 459 families, 2,096 genera, and 3,402 species. All species have been authoritatively identified by more than 100 specialists. Information is included on habitat type, functional group...

  1. Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia

    OpenAIRE

    Chung Ming CHIN; Punggol Secondary School

    2014-01-01

    Book Review of the edited compilation: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia, Washington DC: The World Bank, ISBN: 978-0-8213-8626-2, 264 pages

  2. Segmentation and Accretionary Processes Near the Andrew Bain Mega-Transform Fault: The Southwest Indian Ridge 25°-35°E

    Science.gov (United States)

    Takeuchi, C. S.; Sclater, J. G.; Grindlay, N. R.; Madsen, J. A.; Rommevaux-Jestin, C.

    2008-12-01

    The ultra-slow spreading Southwest Indian Ridge (SWIR) separates the Antarctic and African plates. We present results from two surveys covering the SWIR between 26° and 27°30'E and between 32° and 35°E, lying on either side of the long-offset Andrew Bain transform fault. The objectives of the surveys were to characterize the segmentation of an ultra-slow spreading ridge on either side of a long-offset transform fault and to examine the structure of the individual segments. Four transform faults, the Du Toit, Andrew Bain, Marion, and Prince Edward, and one non-transform discontinuity bound four accretionary segments in the survey areas. Two segments lie northeast of the Andrew Bain (32°-35°E). Large central axial volcanoes, deep, broad mantle Bouguer anomaly (MBA) lows, and high magnetization intensities centered on the spreading axis result from high magmatic activity. Increased magmatism on the ridge axis is likely caused by high mantle temperatures produced by the close proximity of the Marion Plume, which abuts the northern end of the Andrew Bain. Two segments lie southwest of the Andrew Bain (26°-27°30'E). Discrepancies in the locations of the axial rift valley, central magnetization high, and an irregularly-shaped MBA low suggest complex accretionary processes at the western segment (~26°-27° E). The eastern segment (~27°-27°30'E), which abuts the southwest end of the Andrew Bain, shows a deep axial valley, MBA values which increase to the east, and nearly nonexistent magnetization intensity. These features are probably the result of amagmatic accretion caused by the transform edge effect of the Andrew Bain. A transition in the character of topography at 26°45'E suggests that the current segment configuration may not be temporally stable. High-relief (~1 km) ridge-trough structures south of the spreading axis may be the result of an episodic interplay between accretion, both magmatic and amagmatic, and tectonic extension.

  3. Ten steps to successful grant writing.

    Science.gov (United States)

    Richards, D

    1990-01-01

    Major changes in the allocation of health care funds requires that nurse administrators develop excellent grant writing skills. However, many nurse managers indicate they need assistance in developing grant proposals. A step-by-step approach to writing a grant proposal is presented. While it is targeted primarily to the novice grant writer, the seasoned grant writer will particularly benefit from the discussion of the common mistakes.

  4. Sun Grant Initiative Regional Biomass Feedstock Partnership Competitive Grants Program

    Energy Technology Data Exchange (ETDEWEB)

    Owens, Vance [South Dakota State Univ., Brookings, SD (United States). North Central Regional Sun Grant Center

    2016-12-30

    The Sun Grant Initiative partnered with the US Department of Energy (DOE) in 2008 to create the Regional Biomass Feedstock Partnership Competitive Grants Program. The overall goal of this project was to utilize congressionally directed funds to leverage the North Central Regional Sun Grant’s Competitive Grant program at South Dakota State University (SDSU) to address key issues and research gaps related to development of the bioeconomy. Specific objectives of this program were to: 1. Identify research projects through a Regional Competitive Grants program that were relevant to the sustainable production, harvest, transport, delivery, and processing/conversion of cost-competitive, domestically grown biomass. 2. Build local expertise and capacity at the North Central Regional Sun Grant Center at SDSU through an internal selection of key bioenergy research projects. To achieve these, three nationwide Request for Applications (RFA) were developed: one each in 2008, 2009, and 2010. Internal, capacity building projects at SDSU were also selected during each one of these RFAs. In 2013 and 2015, two additional Proof of Concept RFAs were developed for internal SDSU projects. Priority areas for each RFA were 1) Biomass feedstock logistics including biomass harvesting, handling, transportation, storage, and densification; 2) Sustainable biomass feedstock production systems including biomass crop development, production, and life-cycle analysis; 3) Biomass production systems that optimize biomass feedstock yield and economic return across a diverse landscape while minimizing negative effects on the environment and food/feed production; and 4) Promotion of knowledge-based economic development in science and technology and to advance commercialization of inventions that meet the mission of the Sun Grant Initiative. A total of 33 projects were selected for funding through this program. Final reports for each of these diverse projects are included in this summary report

  5. MD#1182: Calibration of diamond particle detectors in IP6

    CERN Document Server

    Valette, Matthieu; Lindstrom, Bjorn Hans Filip; Wiesner, Christoph

    2017-01-01

    In case of an asynchronous beam dump with a fully filled LHC machine it is expected that all standard ionisation chamber Beam Loss Monitors (IC BLM) around the LHC dumping region in IP6 will be saturated. Diamond Beam Loss Monitors (dBLM) were therefore installed next to the movable dump protection absorber (TCDQ) downstream of the extraction kickers. These detectors allow resolving losses at a nanosecond timescale and with an dynamic range of several orders of magnitude; thus, allowing to know the number of nominal bunches impacting the TCDQ. After a first series of calibrations using asynchronous beam dump tests, an experiment was conducted during MD#1182 to demonstrate the possibility of resolving a nominal bunch hitting the TCDQ. The impact parameter of the bunches on the TCDQ was first scanned using probe bunches with lower intensity then tests were done with nominal bunches (1.1e11 p/bunch) at injection energy. High energy calibration of the losses was also attempted unsuccessfully. Due to different beh...

  6. MD-11 PCA - View of aircraft on ramp

    Science.gov (United States)

    1995-01-01

    This McDonnell Douglas MD-11 is taxiing to a position on the flightline at NASA's Dryden Flight Research Center, Edwards, California, following its completion of the first and second landings ever performed by a transport aircraft under engine power only (on Aug. 29, 1995). The milestone flight, with NASA research pilot and former astronaut Gordon Fullerton at the controls, was part of a NASA project to develop a computer-assisted engine control system that enables a pilot to land a plane safely when its normal control surfaces are disabled. The Propulsion-Controlled Aircraft (PCA) system uses standard autopilot controls already present in the cockpit, together with the new programming in the aircraft's flight control computers. The PCA concept is simple. For pitch control, the program increases thrust to climb and reduces thrust to descend. To turn right, the autopilot increases the left engine thrust while decreasing the right engine thrust. The initial Propulsion-Controlled Aircraft studies by NASA were carried out at Dryden with a modified twin-engine F-15 research aircraft.

  7. MD-11 PCA - Closeup view of aircraft on ramp

    Science.gov (United States)

    1995-01-01

    This McDonnell Douglas MD-11 has taxied to a position on the flightline at NASA's Dryden Flight Research Center, Edwards, California, following its completion of the first and second landings ever performed by a transport aircraft under engine power only (on Aug. 29, 1995). The milestone flight, with NASA research pilot and former astronaut Gordon Fullerton at the controls, was part of a NASA project to develop a computer-assisted engine control system that enables a pilot to land a plane safely when its normal control surfaces are disabled. The Propulsion-Controlled Aircraft (PCA) system uses standard autopilot controls already present in the cockpit, together with the new programming in the aircraft's flight control computers. The PCA concept is simple. For pitch control, the program increases thrust to climb and reduces thrust to descend. To turn right, the autopilot increases the left engine thrust while decreasing the right engine thrust. The initial Propulsion-Controlled Aircraft studies by NASA were carried out at Dryden with a modified twin-engine F-15 research aircraft.

  8. Using MD Simulations To Calculate How Solvents Modulate Solubility.

    Science.gov (United States)

    Liu, Shuai; Cao, Shannon; Hoang, Kevin; Young, Kayla L; Paluch, Andrew S; Mobley, David L

    2016-04-12

    Here, our interest is in predicting solubility in general, and we focus particularly on predicting how the solubility of particular solutes is modulated by the solvent environment. Solubility in general is extremely important, both for theoretical reasons - it provides an important probe of the balance between solute-solute and solute-solvent interactions - and for more practical reasons, such as how to control the solubility of a given solute via modulation of its environment, as in process chemistry and separations. Here, we study how the change of solvent affects the solubility of a given compound. That is, we calculate relative solubilities. We use MD simulations to calculate relative solubility and compare our calculated values with experiment as well as with results from several other methods, SMD and UNIFAC, the latter of which is commonly used in chemical engineering design. We find that straightforward solubility calculations based on molecular simulations using a general small-molecule force field outperform SMD and UNIFAC both in terms of accuracy and coverage of the relevant chemical space.

  9. 76 FR 15214 - Special Local Regulations for Marine Events; Potomac River, Charles County, MD

    Science.gov (United States)

    2011-03-21

    ...-AA08 Special Local Regulations for Marine Events; Potomac River, Charles County, MD AGENCY: Coast Guard... for Marine Events; Potomac River, Charles County, MD'' in the Federal Register (76 FR 1381). We... follows: Sec. 100.35-T05-1113 Special Local Regulations for Marine Events; Potomac River, Charles County...

  10. 77 FR 6708 - Special Local Regulations for Marine Events; Potomac River, Charles County, MD

    Science.gov (United States)

    2012-02-09

    ...-AA08 Special Local Regulations for Marine Events; Potomac River, Charles County, MD AGENCY: Coast Guard... River, Charles County, MD. (a) Regulated area. The following location is a regulated area: All waters of... local regulations during the ``Potomac River Sharkfest Swim'' amateur swim, a marine event to be held on...

  11. 76 FR 1381 - Special Local Regulations for Marine Events; Potomac River, Charles County, MD

    Science.gov (United States)

    2011-01-10

    ...-AA08 Special Local Regulations for Marine Events; Potomac River, Charles County, MD AGENCY: Coast Guard... Regulations for Marine Events; Potomac River, Charles County, MD. (a) Regulated area. The following location... local regulations during the ``Potomac River Sharkfest Swim'' amateur swim, a marine event to be held on...

  12. Functional Characterization of the Apple RING E3 Ligase MdMIEL1 in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jianping AN

    2017-03-01

    Full Text Available E3 ubiquitin ligases are involved in various physiological processes, and they play pivotal roles in growth and development. In this study, we identified a previously unknown gene in the apple fruit (Malus × domestica and named it MdMIEL1. The MdMIEL1 gene encoded a protein that contained a zinc-finger domain at its N-terminus and a RING-finger motif at its C-terminus. To investigate MdMIEL1 functions, we generated transgenic Arabidopsis lines expressing the MdMIEL1 gene under the control of the Cauliflower mosaic virus 35S promoter. Interestingly, ectopic expression of MdMIEL1 in Arabidopsis produced multiple phenotypes, including early germination, early flowering and a lateral root number increase relative to wild-type plants. Further analysis indicated that MdMIEL1 regulated lateral root initiation by increasing auxin accumulation in the roots. In a word, these results suggest that, MdMIEL1 as a novel RING-finger ubiquitin ligase influences plant growth and development, and highlight that MdMIEL1 regulates lateral root growth.

  13. 75 FR 66138 - George Mathew, M.D.; Denial of Application

    Science.gov (United States)

    2010-10-27

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 06-8] George Mathew, M.D... Administration, issued an Order to Show Cause and Immediate Suspension of Registration to George Mathew, M.D... investigation, on December 9, 2004, DEA investigators conducted a ``trash run'' at CHS/ISG. Tr. 24. Among the...

  14. 76 FR 17694 - Scott C. Bickman, M.D.; Revocation of Registration

    Science.gov (United States)

    2011-03-30

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 09-40] Scott C. Bickman, M.D..., Drug Enforcement Administration, issued an Order to Show Cause to Scott C. Bickman, M.D. (Respondent... credit application (which listed Respondent's DEA registration number and listed ``Bickman, Coleman Scott...

  15. 78 FR 52802 - Tin T. Win, M.D., Dismissal of Proceeding

    Science.gov (United States)

    2013-08-26

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Tin T. Win, M.D., Dismissal of Proceeding On... Cause and Immediate Suspension of Registration to Tin T. Win, M.D. (hereinafter, Registrant), of Lake... precludes a finding of mootness, see Robert Charles Ley, 76 FR 20033, 20034 (2011), I directed the...

  16. 78 FR 62676 - Anthony E. Wicks, M.D. Decision and Order

    Science.gov (United States)

    2013-10-22

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Anthony E. Wicks, M.D. Decision and Order On... Administration, issued an Order to Show Cause to Anthony E. Wicks, M.D. (Applicant), of Tampa, Florida. Show.... See 28 CFR 0.100(b). ``[T]hese factors are considered in the disjunctive.'' Robert A. Leslie, 68 FR...

  17. ESMD Space Grant Faculty Report

    Science.gov (United States)

    Guo, Jiang; Whitmore, Stephen; Radcliff, Roger; Misra, Prabhakar; Prasad, Nadipuram; Conrad, James; Lackey, Ellen; Selby, Gregory; Wersinger, Jean-Marie; Lambright, Jonathan

    2008-01-01

    The strength of the Exploration Systems Mission Directorate ESMD Faculty Project lies in its ability to meet National Aeronautics Space Administration NASA's Strategic Educational Outcome 1 by developing a sustainable and long-term integration of student involvement at academic institutions with all NASA Centers. This outcome is achieved by a three-fold approach: 1) by collecting Senior Design projects pertaining to Constellation work performed at each of the ten NASA Centers, 2) by engaging students at Minority Serving Institutions in the art of systems engineering and systems design of technologies required for space exploration, and 3) by identifying potential internships at each Center relative to exploration that provide students who are supported by their institutional Space Grant to engage in on-going mission-level and explorative systems designs. The objectives of the ESMD Faculty Project are to: 1. Aid the Centers (both Education Offices and associated technical organizations) in providing relevant opportunities for the ESMD Space Grant Program to support student and faculty in Senior Design projects 2. Enable better matches between the ESMD work required and what the Space Grant Consortia can do to effectively contribute to NASA programs 3. Provide the Space Grant Consortia an opportunity to strengthen relations with the NASA Centers 4. Develop better collective understanding of the U.S. Space Exploration Policy by the Center, Space Grant, faculty, Education Office, and students 5. Enable Space Grant institution faculty to better prepare their students to meet current and future NASA needs 6. Enable the Center Education Offices to strengthen their ties to their technical organizations and Space Grant Consortia 7. Aid KSC in gaining a greater and more detailed understanding of each of the Center activities Senior Design projects are intended to stimulate undergraduate students on current NASA activities related to lunar, Mars, and other planetary missions

  18. Plasma Colloquium Travel Grant Program

    International Nuclear Information System (INIS)

    Hazeltine, R.D.

    1998-01-01

    OAK B188 Plasma Colloquium Travel Grant Program. The purpose of the Travel Grant Program is to increase the awareness of plasma research. The new results and techniques of plasma research in fusion plasmas, plasma processing space plasmas, basic plasma science, etc, have broad applicability throughout science. The benefits of these results are limited by the relatively low awareness and appreciation of plasma research in the larger scientific community. Whereas spontaneous interactions between plasma scientists and other scientists are useful, a focused effort in education and outreach to other scientists is efficient and is needed. The academic scientific community is the initial focus of this effort, since that permits access to a broad cross-section of scientists and future scientists including undergraduates, graduate students, faculty, and research staff

  19. Grant Support and Exporting Activity

    OpenAIRE

    Holger Görg; Michael Henry; Eric Strobl

    2008-01-01

    This paper investigates whether government support can act to increase exporting activity. We use a uniquely rich data set on Irish manufacturing plants and employ an empirical strategy that combines a nonparametric matching procedure with a difference-in-differences estimator in order to deal with the potential selection problem inherent in the analysis. Our results suggest that if grants are large enough, they can encourage already exporting firms to compete more effectively on the internat...

  20. FEMA Grants Program Directorate - Preparedness (Non-Disaster) and Assistance to Firefighter Grants

    Data.gov (United States)

    Department of Homeland Security — The Grant Programs Directorate (GPD) strategically and effectively administers and manages FEMA grants to ensure critical and measurable results for customers and...

  1. FEMA Hazard Mitigation Grants Program Summary - API

    Data.gov (United States)

    Department of Homeland Security — The Hazard Mitigation Grant Program (HMGP, CFDA Number: 97.039) provides grants to States and local governments to implement long-term hazard mitigation measures...

  2. FEMA Hazard Mitigation Grants Program Summary

    Data.gov (United States)

    Department of Homeland Security — The Hazard Mitigation Grant Program (HMGP, CFDA Number: 97.039) provides grants to States and local governments to implement long-term hazard mitigation measures...

  3. Healthy Communities Grant Program | Urban Environmental ...

    Science.gov (United States)

    2018-03-06

    The Healthy Communities Grant Program is EPA New England's main competitive grant program to work directly with communities to reduce environmental risks to protect and improve human health and the quality of life.

  4. CINRG: Infrastructure for Clinical Trials in Duchenne Dystrophy

    Science.gov (United States)

    2013-09-01

    National Med- ical Center: Robert Leshner, MD, Carolina Tesi - Rocha, MD; Royal Children’s Hospital: Andrew Korn- berg, MD, Monique Ryan, MD; Hadassah...Robert Leshner, MD, Carolina Tesi -Rocha, MD; Royal Children’s Hospital: Andrew Kornberg, MD, Monique Ryan, MD; Hadassah Hebrew University Hos- pital

  5. Welfare financing : Grant allocation and efficiency

    NARCIS (Netherlands)

    Toolsema-Veldman, Linda; Allers, M.A.

    2012-01-01

    Welfare is often administered locally, but financed through grants from the central government. This raises the question how the central government can prevent local governments from spending more than necessary. Block grants are more efficient than matching grants, because the latter reduce the

  6. Grants for Children & Youth--2012 Digital Edition

    Science.gov (United States)

    Foundation Center, 2011

    2011-01-01

    This publication is only available as a downloadable file. See who's giving and getting grants in your field. Strengthen your search for funds with the Foundation Center's digital edition of "Grants for Children & Youth." This new "Grant Guide" reveals the scope of current foundation giving in the field. You'll find descriptions of 37,992 grants…

  7. Grants for Higher Education. 2012 Digital Edition

    Science.gov (United States)

    Foundation Center, 2011

    2011-01-01

    This publication is only available as a downloadable file. See who's giving and getting grants in your field. Strengthen your search for funds with the Foundation Center's digital edition of "Grants for Higher Education." This new "Grant Guide" reveals the scope of current foundation giving in the field. You'll find descriptions of 19,705 grants…

  8. 24 CFR 761.30 - Grant administration.

    Science.gov (United States)

    2010-04-01

    ... OMB circulars, HUD fiscal and audit controls, grant agreements, grant special conditions, the grantee... of the grant. This also includes the performance and resolution of audit findings in a timely manner... being taken to initiate the plan and timetable, the reason for the delay, and the expected starting date...

  9. 40 CFR 35.109 - Consolidated grants.

    Science.gov (United States)

    2010-07-01

    ... grants. (a) Any applicant eligible to receive funds from more than one environmental program may submit... consolidated budget must identify each environmental program to be included, the amount of each program's funds... consolidated grants must account for grant funds in accordance with the funds' environmental program sources...

  10. 40 CFR 35.509 - Consolidated grants.

    Science.gov (United States)

    2010-07-01

    ... Consolidated grants. Any applicant eligible to receive funds from more than one environmental program may... consolidated budget must identify each environmental program to be included, the amount of each program's funds... consolidated grants must account for grant funds in accordance with the funds' environmental program sources...

  11. Apple F-box Protein MdMAX2 Regulates Plant Photomorphogenesis and Stress Response

    Directory of Open Access Journals (Sweden)

    Jian-Ping An

    2016-11-01

    Full Text Available MAX2 (MORE AXILLARY GROWTH2 is involved in diverse physiological processes, including photomorphogenesis, the abiotic stress response, as well as karrikin and strigolactone signaling-mediated shoot branching. In this study, MdMAX2, an F-box protein that is a homolog of Arabidopsis MAX2, was identified and characterized. Overexpression of MdMAX2 in apple calli enhanced the accumulation of anthocyanin. Ectopic expression of MdMAX2 in Arabidopsis exhibited photomorphogenesis phenotypes, including increased anthocyanin content and decreased hypocotyl length. Further study indicated that MdMAX2 might promote plant photomorphogenesis by affecting the auxin signaling as well as other plant hormones. Transcripts of MdMAX2 were noticeably up-regulated in response to NaCl and Mannitol treatments. Moreover, compared with the wild type, the MdMAX2-overexpressing apple calli and Arabidopsis exhibited increased tolerance to salt and drought stresses. Taken together, these results suggest that MdMAX2 plays a positive regulatory role in plant photomorphogenesis and stress response.

  12. Milestone report on MD potential development for uranium silicide

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Jianguo [Idaho National Lab. (INL), Idaho Falls, ID (United States). Fuel Modeling and Simulation Dept.; Zhang, Yongfeng [Idaho National Lab. (INL), Idaho Falls, ID (United States). Fuel Modeling and Simulation Dept.; Hales, Jason Dean [Idaho National Lab. (INL), Idaho Falls, ID (United States). Fuel Modeling and Simulation Dept.

    2016-03-01

    This report summarizes the progress on the interatomic potential development of triuranium-disilicide (U3Si2) for molecular dynamics (MD) simulations. The development is based on the Tersoff type potentials for single element U and Si. The Si potential is taken from the literature and a Tersoff type U potential is developed in this project. With the primary focus on the U3Si2 phase, some other U-Si systems such as U3Si are also included as a test of the transferability of the potentials for binary U-Si phases. Based on the potentials for unary U and Si, two sets of parameters for the binary U-Si system are developed using the Tersoff mixing rules and the cross-term fitting, respectively. The cross-term potential is found to give better results on the enthalpy of formation, lattice constants and elastic constants than those produced by the Tersoff mixing potential, with the reference data taken from either experiments or density functional theory (DFT) calculations. In particular, the results on the formation enthalpy and lattice constants for the U3Si2 phase and lattice constants for the high temperature U3Si (h-U3Si) phase generated by the cross-term potential agree well with experimental data. Reasonable agreements are also reached on the elastic constants of U3Si2, on the formation enthalpy for the low temperature U3Si (m-U3Si) and h-U3Si phases, and on the lattice constants of m-U3Si phase. All these phases are predicted to be mechanically stable. The unary U potential is tested for three metallic U phases (α, β, γ). The potential is found capable to predict the cohesive energies well against experimental data for all three phases. It matches reasonably with previous experiments on the lattice constants and elastic constants of αU.

  13. Characterization of an Autophagy-related Gene MdATG8i from apple

    Directory of Open Access Journals (Sweden)

    Ping eWang

    2016-05-01

    Full Text Available Nutrient deficiencies restrict apple (Malus sp. tree growth and productivity in Northwest China. The process of autophagy, a conserved degradation pathway in eukaryotic cells, has important roles in nutrient-recycling and helps improve plant performance during periods of nutrient-starvation. Little is known about the functioning of autophagy-related genes (ATGs in apple. In this study, one of the ATG8 gene family members MdATG8i was isolated from M. domestica. MdATG8i has conserved putative tubulin binding sites and ATG7 interaction domains. A 1865-bp promoter region cloned from apple genome DNA was predicated to have cis-regulatory elements responsive to light, environmental stresses and hormones. MdATG8i transcriptions were induced in response to leaf senescence, nitrogen depletion, and oxidative stress. At cellular level, MdATG8i protein was expressed in the nucleus and cytoplasm of onion epidermal cells. Yeast two-hybrid tests showed that MdATG8i could interact with MdATG7a and MdATG7b. In Arabidopsis, its heterologous expression was associated with enhanced vegetative growth, leaf senescence, and tolerance to nitrogen- and carbon-starvation. MdATG8i-overexpressing ‘Orin’ apple callus lines also displayed improved tolerance to nutrient-limited conditions. Our results demonstrate that MdATG8i protein could function in autophagy in a conserved way, as a positive regulator in the response to nutrient-starvation.

  14. Inhibition of the gastric H+,K+ -ATPase by plectrinone A, a diterpenoid isolated from Plectranthus barbatus Andrews.

    Science.gov (United States)

    Schultz, Carla; Bossolani, Myllene P; Torres, Luce M B; Lima-Landman, Maria Teresa R; Lapa, Antonio J; Souccar, Caden

    2007-04-20

    This work assessed the mechanism underlying the antisecretory gastric acid effect of Plectranthus barbatus Andrews (Lamiaceae) and active constituents. Popularly known as "false-boldo", this plant is used in Brazilian folk medicine to treat gastrointestinal and hepatic ailments. The plant aqueous extract (AE) and isolated compounds were assayed in vivo in pylorus-ligated mice, and in vitro on acid secretion measured as [(14)C]-aminopyrine ([(14)C]-AP) accumulation in rabbit gastric glands and gastric H(+),K(+)-ATPase preparations. Injected into the duodenal lumen, the AE of the plant leaves (0.5 and 1.0 g/kg) decreased the volume (62 and 76%) and total acidity (23 and 50%) of gastric acid secretion in pylorus-ligated mice. Bioguided purification of the AE yielded an active fraction (IC(50)=24 microg/ml) that inhibited acid secretion in rabbit gastric glands with a potency 10 to 18 times greater than that of the originating extract, on both the basal and stimulated acid secretion by histamine (His) (1 microM) or bethanechol (100 microM). At the same concentrations the gastric H(+),K(+)-ATPase activity was also inhibited. The active constituent was chemically identified as the abietanoid dienedione plectrinone A which reduced the H(+),K(+)-ATPase activity with IC(50)=171 microM. The results indicate that inhibition of the gastric proton pump by this diterpenoid may account for the antisecretory acid effect and reputed anti ulcer activity of Plectranthus barbatus.

  15. Genetic fidelity of long-term micropropagated shoot cultures of vanilla (Vanilla planifolia Andrews) as assessed by molecular markers.

    Science.gov (United States)

    Sreedhar, Reddampalli V; Venkatachalam, Lakshmanan; Bhagyalakshmi, Neelwarne

    2007-08-01

    Occurrence of genetic variants during micropropagation is occasionally encountered when the cultures are maintained in vitro for long period. Therefore, the micropropagated multiple shoots of Vanilla planifolia Andrews developed from axillary bud explants established 10 years ago were used to determine somaclonal variation using random amplified polymorphic DNA (RAPD) and intersimple sequence repeats markers (ISSR). One thousand micro-plants were established in soil of which 95 plantlets (consisting of four phenotypes) along with the mother plant were subjected to genetic analyses using RAPD and ISSR markers. Out of the 45 RAPD and 20 ISSR primers screened, 30 RAPD and 7 ISSR primers showed 317 clear, distinct and reproducible band classes resulting in a total of 30 115 bands. However, no difference was observed in banding patterns of any of the samples for a particular primer, indicating the absence of variation among the micropropagated plants. Our results allow us to conclude that the micropropagation protocol that we have used for in vitro proliferation of vanilla plantlets for the last 10 years might be applicable for the production of clonal plants over a considerable period of time.

  16. Lessons learned from Hurricane Andrew: recommendations for care of the elderly in long-term care facilities.

    Science.gov (United States)

    Silverman, M A; Weston, M; Llorente, M; Beber, C; Tam, R

    1995-06-01

    We report on the experience of a 500-bed, long-term care facility in Miami, Fla, which provides housing and nursing care units for patients--ranging from those who are independently ambulatory to those who are acutely ill and feeble--in preparing for, during, and in the immediate aftermath of Hurricane Andrew, which struck on August 24, 1992. The problems encountered included a massive influx of evacuated elderly to the facility, facility isolation, loss of electrical power, loss of running water, special dietary needs, and limited professional staffing due to personal property losses or loss of transportation. Overwhelmed county emergency medical services, limited access to hospitals and patient care, and difficulty in procuring supplies exacerbated the already complicated situation resulting from the storm. As a result of these catastrophic conditions, a number of challenges specific to the care of the elderly were identified. In conjunction with the Florida Department of Elder Affairs, we drafted a comprehensive blueprint that could serve as a disaster plan for other long-term care facilities facing a similar threat during the hurricane season.

  17. Apocalyptic Kingship, Harmony and Political Expediency: the Challenges and Paradoxes of Andrew Marvell’s “First Anniversary”

    Directory of Open Access Journals (Sweden)

    Jajtner Tomáš

    2015-07-01

    Full Text Available The following paper deals with the interpretation of one of the major “Cromwellian” poems of Andrew Marvell (1621-1678, “The First Anniversary of the Government under His Highness the Lord Protector”, 1655. The poem is first set in the context of Marvell’s poetry and his public career in the period between 1637 and 1660. The article then identifies and analyses three main themes of “The First Anniversary”: the notion of a new aeon starting with Cromwell’s rule and the apocalyptical imagery related to his Protectorate, the concept of his power and authority between liberty and tyranny, and the relation between the harmony established by Cromwell and classical Pythagorean harmonious lore. The author argues that the imagery Marvell uses to describe the nature of the regime (especially the concept of Cromwell’s “no-kingship” shows a deeply paradoxical structure, which uncovers the frailty and insecurity of Cromwell’s dictatorship as well as the circular logic of its justification. In that sense, the poem can be read as a vivid manifestation of the dilemmas and tensions of this period.

  18. Molecular Cloning and Expression Analysis of a Hexokinase Gene, MdHXK1 in Apple

    Directory of Open Access Journals (Sweden)

    Jin Zhao

    2016-03-01

    Full Text Available A hexokinase gene named MdHXK1 (MDP0000309677 was cloned from ‘Gala’ apple (Malus × domestica Borkh.. Sequence analysis showed that the MdHXK1 gene was 1 497 bp long and encoded 499 amino acids. The predicted molecular mass of this protein was 54.05 kD, and the pI was 5.76. A phylogenetic tree indicated apple MdHXK1 exhibited the highest sequence similarity to Pyrus bretschneideri PbHXK1. Analysis of the functional domain showed that the MdHXK1 protein included two conserved kinase domains. The prediction of subcellular localization suggested that the MdHXK1 protein was mainly localized in the cytoplasm. There was an indication that MdHXK1 existed as one copy in the apple genome by Southern blotting. Silico analysis suggested that the promoter sequence contained several typical cis-acting elements, including defense, sugar signaling and phytohormone responsive elements. Quantitative real-time PCR analysis demonstrated that the MdHXK1 gene was mainly expressed in stem and flower tissues. During the development of apple fruits, the expression of the MdHXK1 gene initially increased and then decreased. The changes on Glc phosphorylation relative activity and glucose concentration showed the same trend. In addition, the expression of this gene was induced by salt stress, low temperature, and abscisic acid (ABA. Finally, we obtained and purified the fused MdHXK1 protein by recombinant prokaryotic expression. Studies have demonstrated that MdHXK1 may participate in sugar metabolism in apple fruits. Enzyme encoded by MdHXK1 is a key factor in the mediation of sugar accumulation. Recently, researchers on hexokinase at home and abroad mainly focused on model plants, such as Arabidopsis, tobacco and rice, but orchard fruit like apple were underresearched. Our research established the foundation for the further study of the functions of MdHXK1.

  19. MD 2485: Active halo control using narrowband and colored noise excitations

    CERN Document Server

    Garcia Morales, Hector; Kotzian, Gerd; Maclean, Ewen Hamish; Redaelli, Stefano; Valuch, Daniel; Wagner, Joschka; CERN. Geneva. ATS Department

    2018-01-01

    This MD note summarizes the actions carried out during the MD 2485 on Active halo control using narrowband and colored noise excitations. The goal of the MD was to repeat some promising cases already tested in the past and introduce a new excitation type based on applying a colored noise. Although we were able to repeat some cases using a narrowband excitation, due to a problem with the waveform generator, the colored noise excitation could not be accomplished as expected. In any case, we provide some results that may be useful for future MDs.

  20. DMPD: Innate recognition of lipopolysaccharide by Toll-like receptor 4-MD-2. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15051069 Innate recognition of lipopolysaccharide by Toll-like receptor 4-MD-2. Miyake K. Trends Microbiol...de by Toll-like receptor 4-MD-2. Authors Miyake K. Publication Trends Microbiol.

  1. Osmotically and thermally isolated forward osmosis-membrane distillation (fo-md) integrated module for water treatment applications

    KAUST Repository

    Ghaffour, Noreddine

    2016-09-01

    An integrated forward osmosis-membrane distillation (FO-MD) module and systems and methods incorporating the module is disclosed providing higher efficiencies and using less energy. The FO-MD module is osmotically and thermally isolated. The isolation can prevent mixing of FO draw solution/FO permeate and MD feed, and minimize dilution of FO draw solution and cooling of MD feed. The module provides MD feed solution and FO draw solution streams that flow in the same module but are separated by an isolation barrier. The osmotically and thermally isolated FO-MD integrated module, systems and methods offer higher driving forces of both FO and MD processes, higher recovery, and wider application than previously proposed hybrid FO- MD systems.

  2. The Impact of Structural Break(s on the Validity of Purchasing Power Parity in Turkey: Evidence from Zivot-Andrews and Lagrange Multiplier Unit Root Tests

    Directory of Open Access Journals (Sweden)

    Hakan Kum

    2012-01-01

    Full Text Available This study examines the validity of the purchasing power parity (PPP in Turkey for annual data from 1953 to 2009. While results from both the ADF unit root and the DF-GLS unit root test indicate mixed results, PPP holds for Turkey with the presence of structural breaks which are obtained by Zivot and Andrews and Lagrange Multiplier unit root tests.

  3. 30 CFR 285.316 - What payments are required for ROW grants or RUE grants?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What payments are required for ROW grants or RUE grants? 285.316 Section 285.316 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Rights-of-Way Grants and Rights-of-Use and Easement Grants for Renewable Energy Activities Financial...

  4. Final Report for OJI grant

    International Nuclear Information System (INIS)

    This document is a final report for DOE grant DE-FG02-00ER41147. The research described herein was funded in large part by this grant with additional support from the National Science Foundation. The primary focus of Averett's research effort is centered around the polarized 3 He target in Hall A at Jefferson Lab. The close proximity of the College of William and Mary to Jefferson Lab has provided an outstanding opportunity to maintain a very active research program which still satisfying the demands of the college. Our research group includes four faculty, two post-doctoral fellows and eight graduate students. Averett also maintains a fully functional polarized 3 e target lab at William and Mary which allows him to support the research program at Jefferson Lab while also doing research on polarized targets themselves. Since 1998, seven experiments using polarized 3 He have been completed by the Jefferson Lab Hall A Polarized 3 He Collaboration. Ten publications have been produced on this research and analysis of the two most recently completed experiments is underway. A description of the recent experiments and results is given below. In addition to target expertise, Averett has remained one of the most active collaborators in the data analysis of these experiments and maintains the largest on-site user group for this purpose as well

  5. In-situ Air Temperature and Relative Humidity in Greenbelt, MD, 2013-2015

    Data.gov (United States)

    National Aeronautics and Space Administration — This data set describes the temperature and relative humidity at 12 locations around Goddard Space Flight Center in Greenbelt MD at 15 minute intervals between...

  6. A Mathematic Model That Describes Modes of MdSGHV Transmission within House Fly Populations

    Directory of Open Access Journals (Sweden)

    Celeste R. Vallejo

    2013-11-01

    Full Text Available In this paper it is proposed that one potential component by which the Musca domestica salivary gland hypertrophy virus (MdSGHV infects individual flies is through cuticular damage. Breaks in the cuticle allow entry of the virus into the hemocoel causing the infection. Male flies typically have a higher rate of infection and a higher rate of cuticular damage than females. A model for the transmission of MdSGHV was formulated assuming several potential and recognized means of transmission. The model yields results that are in agreement with field data that measured the infection rate in house flies on dairy farms in Florida. The results from this model indicate that MdSGHV will be maintained at a stable rate within house fly populations and support the future use of MdSGHV as a birth control agent in house fly management.

  7. Metabolic engineering of apple by overexpression of the MdMyb10 gene

    Directory of Open Access Journals (Sweden)

    Khaled A.L. Rihani

    2017-06-01

    In the present study, the flavonoid pathway was successfully modified in apple by overexpressing the MdMyb10 transcription factor to validate the hypothesis of increased effect on plant disease resistance.

  8. Image fusion in craniofacial virtual reality modeling based on CT and 3dMD photogrammetry.

    Science.gov (United States)

    Xin, Pengfei; Yu, Hongbo; Cheng, Huanchong; Shen, Shunyao; Shen, Steve G F

    2013-09-01

    The aim of this study was to demonstrate the feasibility of building a craniofacial virtual reality model by image fusion of 3-dimensional (3D) CT models and 3 dMD stereophotogrammetric facial surface. A CT scan and stereophotography were performed. The 3D CT models were reconstructed by Materialise Mimics software, and the stereophotogrammetric facial surface was reconstructed by 3 dMD patient software. All 3D CT models were exported as Stereo Lithography file format, and the 3 dMD model was exported as Virtual Reality Modeling Language file format. Image registration and fusion were performed in Mimics software. Genetic algorithm was used for precise image fusion alignment with minimum error. The 3D CT models and the 3 dMD stereophotogrammetric facial surface were finally merged into a single file and displayed using Deep Exploration software. Errors between the CT soft tissue model and 3 dMD facial surface were also analyzed. Virtual model based on CT-3 dMD image fusion clearly showed the photorealistic face and bone structures. Image registration errors in virtual face are mainly located in bilateral cheeks and eyeballs, and the errors are more than 1.5 mm. However, the image fusion of whole point cloud sets of CT and 3 dMD is acceptable with a minimum error that is less than 1 mm. The ease of use and high reliability of CT-3 dMD image fusion allows the 3D virtual head to be an accurate, realistic, and widespread tool, and has a great benefit to virtual face model.

  9. Dynamic lipopolysaccharide transfer cascade to TLR4/MD2 complex via LBP and CD14

    OpenAIRE

    Kim, Soo Jin; Kim, Ho Min

    2017-01-01

    Toll-like receptor 4 (TLR4) together with MD2, one of the key pattern recognition receptors for a pathogen-associated molecular pattern, activates innate immunity by recognizing lipopolysaccharide (LPS) of Gram-negative bacteria. Although LBP and CD14 catalyze LPS transfer to the TLR4/MD2 complex, the detail mechanisms underlying this dynamic LPS transfer remain elusive. Using negative-stain electron microscopy, we visualized the dynamic intermediate complexes during LPS transfer?LBP/LPS mice...

  10. STRATEGI PEMASARAN PUBLIC RELATIONS MD ENTERTAINMENT PADA PEMASARAN FILM HABIBIE & AINUN

    OpenAIRE

    Trisna Adi Permana; Lilis Puspitasari

    2015-01-01

    Tujuan penelitian ini adalah untuk mengetahui perencanaan, implementasi serta evaluasi dari strategi Marketing Public Relations yang ditetapkan PR MD Entertainment pada film Habibie & Ainun pada tahun 2012-2013. Metode yang dilakukan adalah metode deskriptif yang bertujuan melukiskan secara sistematis fakta atau karakteristik populasi tertentu atau bidang tertentu secara faktual dan cermat. Hasil penelitian menunjukan PR MD Entertainment telah melakukan tahapan-tahapan atau Teknik...

  11. Strategi Pemasaran Public Relations Md Entertainment Pada Pemasaran Film Habibie & Ainun

    OpenAIRE

    Permana, Trisna Adi; Puspitasari, Lilis

    2015-01-01

    Tujuan penelitian ini adalah untuk mengetahui perencanaan, implementasi serta evaluasi dari strategiMarketing Public Relations yang ditetapkan PR MD Entertainment pada film Habibie & Ainun pada tahun2012-2013. Metode yang dilakukan adalah metode deskriptif yang bertujuan melukiskan secara sistematisfakta atau karakteristik populasi tertentu atau bidang tertentu secara faktual dan cermat. Hasil penelitianmenunjukan PR MD Entertainment telah melakukan tahapan-tahapan atau Teknik PR pada film Ha...

  12. Sustainable water recovery from oily wastewater via forward osmosis-membrane distillation (FO-MD).

    Science.gov (United States)

    Zhang, Sui; Wang, Peng; Fu, Xiuzhu; Chung, Tai-Shung

    2014-04-01

    This study proposed and investigated a hybrid forward osmosis - membrane distillation (FO-MD) system for sustainable water recovery from oily wastewater by employing lab-fabricated FO and MD hollow fiber membranes. Stable oil-in-water emulsions of different concentrations with small droplet sizes (membranes. Moreover, slight increment of fouling was observed in the first few hours and the water flux was then stabilized over 24 h. The characterizations of water flux and solute rejection in separate FO and MD processes revealed that a high water flux, good NaCl rejection, impressively high retention of oil droplets and partial permeation of acetic acid could be achieved. Finally, an integrated FO-MD system was developed to treat the oily wastewater containing petroleum, surfactant, NaCl and acetic acid at 60 °C in the batch mode. The water flux in FO undergoes three-stage decline due to fouling and reduction in osmotic driving force, but is quite stable in MD regardless of salt concentration. Oily wastewater with relatively high salinity could be effectively recovered by the FO-MD hybrid system while maintaining large water flux, at least 90% feed water recovery could be readily attained with only trace amounts of oil and salts, and the draw solution was re-generated for the next rounds of FO-MD run. Interestingly, significant amount of acetic acid was also retained in the permeate for further reuse as a chemical additive during the production of crude oil. The work has demonstrated that not only water but also organic additives in the wastewater could be effectively recovered by FO-MD systems for reuse or other utilizations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. MdCOP1 Ubiquitin E3 Ligases Interact with MdMYB1 to Regulate Light-Induced Anthocyanin Biosynthesis and Red Fruit Coloration in Apple1[W][OA

    Science.gov (United States)

    Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

    2012-01-01

    MdMYB1 is a crucial regulator of light-induced anthocyanin biosynthesis and fruit coloration in apple (Malus domestica). In this study, it was found that MdMYB1 protein accumulated in the light but degraded via a ubiquitin-dependent pathway in the dark. Subsequently, the MdCOP1-1 and MdCOP1-2 genes were isolated from apple fruit peel and were functionally characterized in the Arabidopsis (Arabidopsis thaliana) cop1-4 mutant. Yeast (Saccharomyces cerevisiae) two-hybrid, bimolecular fluorescence complementation, and coimmunoprecipitation assays showed that MdMYB1 interacts with the MdCOP1 proteins. Furthermore, in vitro and in vivo experiments indicated that MdCOP1s are necessary for the ubiquitination and degradation of MdMYB1 protein in the dark and are therefore involved in the light-controlled stability of the MdMYB1 protein. Finally, a viral vector-based transformation approach demonstrated that MdCOP1s negatively regulate the peel coloration of apple fruits by modulating the degradation of the MdMYB1 protein. Our findings provide new insight into the mechanism by which light controls anthocyanin accumulation and red fruit coloration in apple and even other plant species. PMID:22855936

  14. Experiences in the continuous improvement of quality assurance of the dosimetry services of SLDC-MD-ININ

    International Nuclear Information System (INIS)

    Tovar M, V. M.; Vergara M, F.; Perez M, V.; Anaya M, R.; Cejudo A, J.; Alvarez R, J. T.; Arenas O, A.; Cruz F, C.

    2010-09-01

    From 2003 the Secondary Laboratory of Dosimetric Calibration (SLDC) of Metrology Department of Ionizing Radiations (MD), has complemented the Quality Manual of National Institute of Nuclear Research (ININ) according to the standard ISO 9001: 2000. However, due to that the National Center of Metrology of Mexico delegates its functions in the dosimetry and activity area for the field of the ionizing radiations to the ININ: one of the requirements so that the ININ has been designated as -Declared Institute- before the International Office of Weights and Measurements, it is to demonstrate before the Inter-American System of Metrology that the quality system of the SLDC fulfills the standard ISO/IEC 17025: 2005, satisfied this requirement the Inter-American System of Metrology in their meeting of evaluation of quality systems, Ottawa (2007) grants a certification document to the SLDC that guarantees their capacities of calibration measurements for dosimetry services. Concretely, inside the standard activities ISO 9000 with respect to the point 8 on measurement, analysis and improvement the Management of Quality Assurance of ININ carries out at year two interns auditing and every month is given continuation to the non conformities detected in the procedures that support the services of the SLDC for dosimetry with purposes of radiological protection and clinical dosimetry. (Author)

  15. University Reactor Matching Grants Program

    International Nuclear Information System (INIS)

    John Valentine; Farzad Rahnema; Said Abdel-Khalik

    2003-01-01

    During the 2002 Fiscal year, funds from the DOE matching grant program, along with matching funds from the industrial sponsors, have been used to support research in the area of thermal-hydraulics. Both experimental and numerical research projects have been performed. Experimental research focused on two areas: (1) Identification of the root cause mechanism for axial offset anomaly in pressurized water reactors under prototypical reactor conditions, and (2) Fluid dynamic aspects of thin liquid film protection schemes for inertial fusion reactor chambers. Numerical research focused on two areas: (1) Multi-fluid modeling of both two-phase and two-component flows for steam conditioning and mist cooling applications, and (2) Modeling of bounded Rayleigh-Taylor instability with interfacial mass transfer and fluid injection through a porous wall simulating the ''wetted wall'' protection scheme in inertial fusion reactor chambers. Details of activities in these areas are given

  16. Hurricane Andrew causes major oil spill at Florida Power ampersand Light Company's Turkey Point Power Plant, Homestead, Florida

    International Nuclear Information System (INIS)

    Jones, M.A.; Butts, R.L.; Lindsay, J.R.; McCully, B.S.; Pickering, T.H.

    1993-01-01

    On August 24, 1992, Hurricane Andrew slammed into South Florida with wind gusts in excess of 160 mph. At 4:00 a.m. that day, the eye of this category four storm passed over Florida Power ampersand Light Company's Turkey Point power plant, south of Miami. Although the plant's two nuclear units escaped any significant damage, the storm caused extensive destruction to buildings and transmission facilities, and damaged two 400 foot tall emission stacks associated with the site's two fossil fuel generating units. In addition, a 90,000 to 110,000 gallon spill of No. 6 fuel oil resulted when a piece of wind-blown debris punctured the steel of the unit One 12,000 barrel fuel oil metering tank approximately 30 feet up from the tank bottom. Despite the presence of a secondary containment structure around the tank, the intense wind blew oil throughout the plant site. The damage to the metering tank apparently occurred during the first half hour of the hurricane. As the tank's oil level fell due to the puncture, transfer pumps from the bulk oil storage tanks received a low level alarm which automatically began transferring oil to the damaged metering tank. To prevent the further discharge of oil, plant personnel entered the power block and secured the pumps during the passage of the hurricane eye. Immediately following the storm, facility personnel deployed booms across the barge canal and the Units 1 and 2 intake canal to contain the oil which had entered the water. The response strategy and implementation is described in detail. The remediation costs were approximately $14/gallon spilled, including 54,000 gallons recovered for electricity generation

  17. Daily Public Assistance Grants Award Activity

    Data.gov (United States)

    Department of Homeland Security — Daily activity of Public Assistance Grant Awards, including FEMA Region, State, Disaster Declaration Number, Event description, Mission Assigned agency, Assistance...

  18. Effect of salinity and temperature on treatment of concentrated wastewater from RO by FO-MD

    Science.gov (United States)

    Zhou, Yingru; Huang, Manhong; Deng, Qian

    2018-02-01

    In this study the appropriate temperature of the membrane distillation (MD) hot side (the permeation flux of MD was controlled by adjusting the hot side temperature) was selected according to the water flux of FO process so that the water transfer rate on both sides of FO and MD was consistent and the FO-MD process could be stable operation. When the salt concentration of feed solution was 30, 55, 80 and 100 g/L, the desalination rates changed little, which were 99.1%, 98.4%, 98.9% and 98.7%, respectively. The removal rate of COD was 93.8%, 94.2%, 91.6% and 92.7% which also changed little like the desalination rates. The removal rate of chromaticity increased with the increase of salinity, which attained 96.6%, 97.0%, 97.2% and 97.9%, respectively. This study proved that salinity of the feed solution affected little on the removal rate of contaminants but great on the water flux, with the increase of salinity from 30 to 100 g/L, the water flux was 6.05, 4.81, 4.33 and 3.87 LMH with the appropriate temperature (67.5±0.5, 64.5±0.5, 62.5±0.5 and 60.5±0.5 °C) of MD hot side. In a word, FO-MD was first used to treat the high salinity RO water with over 30 g/L total dissolved solids (TDS), FO-MD was a promising new process for high salinity wastewater treatment, and the hybrid system can solve the problem of lower draw solution concentration, and the high-quality production water will be obtained directly by this hybrid system with low membrane fouling tendency.

  19. The small ubiquitin-like modifier E3 ligase MdSIZ1 promotes anthocyanin accumulation by sumoylating MdMYB1 under low-temperature conditions in apple.

    Science.gov (United States)

    Zhou, Li-Jie; Li, Yuan-Yuan; Zhang, Rui-Fen; Zhang, Chun-Ling; Xie, Xing-Bin; Zhao, Cheng; Hao, Yu-Jin

    2017-10-01

    MdMYB1 acts as a crucial component of the MYB-bHLH-WD40 complex to regulate anthocyanin biosynthesis in red-skinned apples (Malus domestica), but little is known about its post-translational regulation. Here, a small ubiquitin-like modifier E3 ligase MdSIZ1 was screened out as an MdMYB1-interacting protein with a yeast two-hybridization approach. The interaction between MdSIZ1 and MdMYB1 was further verified with pull-down and CoIP assays. Furthermore, it was found that MdSIZ1 directly sumoylated MdMYB1 proteins in vivo and in vitro, especially under moderately low temperature (17 °C) conditions, and that this sumoylation was required for MdMYB1 protein stability. Moreover, the transcription level of MdSIZ1 gene was remarkably induced by low temperature and phosphorus deficiency, and MdSIZ1 overexpression exerted a large positive influence on anthocyanin accumulation and red fruit coloration, suggesting its important role in the regulation of anthocyanin biosynthesis under stress conditions. Our findings reveal an important role for a small ubiquitin-like modifier modification of MYB transcription factors in regulation of anthocyanin biosynthesis in plants. © 2017 John Wiley & Sons Ltd.

  20. The molecular mechanism underlying anthocyanin metabolism in apple using the MdMYB16 and MdbHLH33 genes.

    Science.gov (United States)

    Xu, Haifeng; Wang, Nan; Liu, Jingxuan; Qu, Changzhi; Wang, Yicheng; Jiang, Shenghui; Lu, Ninglin; Wang, Deyun; Zhang, Zongying; Chen, Xuesen

    2017-05-01

    MdMYB16 forms homodimers and directly inhibits anthocyanin synthesis via its C-terminal EAR repressor. It weakened the inhibitory effect of MdMYB16 on anthocyanin synthesis when overexpressing MdbHLH33 in callus overexpressing MdMYB16. MdMYB16 could interact with MdbHLH33. Anthocyanins are strong antioxidants that play a key role in the prevention of cardiovascular disease, cancer, and diabetes. The germplasm of Malus sieversii f. neidzwetzkyana is important for the study of anthocyanin metabolism. To date, only limited studies have examined the negative regulatory mechanisms underlying anthocyanin synthesis in apple. Here, we analyzed the relationship between anthocyanin levels and MdMYB16 expression in mature Red Crisp 1-5 apple (M. domestica) fruit, generated an evolutionary tree, and identified an EAR suppression sequence and a bHLH binding motif of the MdMYB16 protein using protein sequence analyses. Overexpression of MdMYB16 or MdMYB16 without bHLH binding sequence (LBSMdMYB16) in red-fleshed callus inhibited MdUFGT and MdANS expression and anthocyanin synthesis. However, overexpression of MdMYB16 without the EAR sequence (LESMdMYB16) in red-fleshed callus had no inhibitory effect on anthocyanin. The yeast one-hybrid assay showed that MdMYB16 and LESMdMYB16 interacted the promoters of MdANS and MdUFGT, respectively. Yeast two-hybrid, pull-down, and bimolecular fluorescence complementation assays showed that MdMYB16 formed homodimers and interacted with MdbHLH33, however, the LBSMdMYB16 could not interact with MdbHLH33. We overexpressed MdbHLH33 in callus overexpressing MdMYB16 and found that it weakened the inhibitory effect of MdMYB16 on anthocyanin synthesis. Together, these results suggested that MdMYB16 and MdbHLH33 may be important part of the regulatory network controlling the anthocyanin biosynthetic pathway.

  1. [MD PhD programs: Providing basic science education for ophthalmologists].

    Science.gov (United States)

    Spaniol, K; Geerling, G

    2015-06-01

    Enrollment in MD PhD programs offers the opportunity of a basic science education for medical students and doctors. These programs originated in the USA where structured programs have been offered for many years, but now German universities also run MD PhD programs. The MD PhD programs provided by German universities were investigated regarding entrance requirements, structure and financing modalities. An internet and telephone-based search was carried out. Out of 34 German universities 22 offered MD PhD programs. At 15 of the 22 universities a successfully completed course of studies in medicine was required for enrollment, 7 programs admitted medical students in training and 7 programs required a medical doctoral thesis, which had to be completed with at least a grade of magna cum laude in 3 cases. Financing required scholarships in many cases. Several German universities currently offer MD PhD programs; however, these differ considerably regarding entrance requirements, structure and financing. A detailed analysis investigating the success rates of these programs (e.g. successful completion and career paths of graduates) would be of benefit.

  2. Dynamic lipopolysaccharide transfer cascade to TLR4/MD2 complex via LBP and CD14.

    Science.gov (United States)

    Kim, Soo Jin; Kim, Ho Min

    2017-02-01

    Toll-like receptor 4 (TLR4) together with MD2, one of the key pattern recognition receptors for a pathogen-associated molecular pattern, activates innate immunity by recognizing lipopolysaccharide (LPS) of Gram-negative bacteria. Although LBP and CD14 catalyze LPS transfer to the TLR4/MD2 complex, the detail mechanisms underlying this dynamic LPS transfer remain elusive. Using negative-stain electron microscopy, we visualized the dynamic intermediate complexes during LPS transfer-LBP/LPS micelles and ternary CD14/LBP/LPS micelle complexes. We also reconstituted the entire cascade of LPS transfer to TLR4/MD2 in a total internal reflection fluorescence (TIRF) microscope for a single molecule fluorescence analysis. These analyses reveal longitudinal LBP binding to the surface of LPS micelles and multi-round binding/unbinding of CD14 to single LBP/LPS micelles via key charged residues on LBP and CD14. Finally, we reveal that a single LPS molecule bound to CD14 is transferred to TLR4/MD2 in a TLR4-dependent manner. These discoveries, which clarify the molecular mechanism of dynamic LPS transfer to TLR4/MD2 via LBP and CD14, provide novel insights into the initiation of innate immune responses. [BMB Reports 2017; 50(2): 55-57].

  3. PuReMD-GPU: A reactive molecular dynamics simulation package for GPUs

    International Nuclear Information System (INIS)

    Kylasa, S.B.; Aktulga, H.M.; Grama, A.Y.

    2014-01-01

    We present an efficient and highly accurate GP-GPU implementation of our community code, PuReMD, for reactive molecular dynamics simulations using the ReaxFF force field. PuReMD and its incorporation into LAMMPS (Reax/C) is used by a large number of research groups worldwide for simulating diverse systems ranging from biomembranes to explosives (RDX) at atomistic level of detail. The sub-femtosecond time-steps associated with ReaxFF strongly motivate significant improvements to per-timestep simulation time through effective use of GPUs. This paper presents, in detail, the design and implementation of PuReMD-GPU, which enables ReaxFF simulations on GPUs, as well as various performance optimization techniques we developed to obtain high performance on state-of-the-art hardware. Comprehensive experiments on model systems (bulk water and amorphous silica) are presented to quantify the performance improvements achieved by PuReMD-GPU and to verify its accuracy. In particular, our experiments show up to 16× improvement in runtime compared to our highly optimized CPU-only single-core ReaxFF implementation. PuReMD-GPU is a unique production code, and is currently available on request from the authors

  4. PuReMD-GPU: A reactive molecular dynamics simulation package for GPUs

    Energy Technology Data Exchange (ETDEWEB)

    Kylasa, S.B., E-mail: skylasa@purdue.edu [Department of Elec. and Comp. Eng., Purdue University, West Lafayette, IN 47907 (United States); Aktulga, H.M., E-mail: hmaktulga@lbl.gov [Lawrence Berkeley National Laboratory, 1 Cyclotron Rd, MS 50F-1650, Berkeley, CA 94720 (United States); Grama, A.Y., E-mail: ayg@cs.purdue.edu [Department of Computer Science, Purdue University, West Lafayette, IN 47907 (United States)

    2014-09-01

    We present an efficient and highly accurate GP-GPU implementation of our community code, PuReMD, for reactive molecular dynamics simulations using the ReaxFF force field. PuReMD and its incorporation into LAMMPS (Reax/C) is used by a large number of research groups worldwide for simulating diverse systems ranging from biomembranes to explosives (RDX) at atomistic level of detail. The sub-femtosecond time-steps associated with ReaxFF strongly motivate significant improvements to per-timestep simulation time through effective use of GPUs. This paper presents, in detail, the design and implementation of PuReMD-GPU, which enables ReaxFF simulations on GPUs, as well as various performance optimization techniques we developed to obtain high performance on state-of-the-art hardware. Comprehensive experiments on model systems (bulk water and amorphous silica) are presented to quantify the performance improvements achieved by PuReMD-GPU and to verify its accuracy. In particular, our experiments show up to 16× improvement in runtime compared to our highly optimized CPU-only single-core ReaxFF implementation. PuReMD-GPU is a unique production code, and is currently available on request from the authors.

  5. Desain Aplikasi Algoritma MD5 (Message Digest 5 Pada Media SMS Berbasis Android Mobile

    Directory of Open Access Journals (Sweden)

    Zaiful Bahri

    2017-11-01

    Full Text Available AbstrakTulisan ini membahas tentang disain Aplikasi Algoritma MD5. Dalam desain ini dibuat model kirim dan terima SMS aman. Dari model ini bisa dibuat desain aplikasi berbasis objek menggunakan Unified Modeling Language (UML, State Machine untuk menggambarkan status pengiriman pesan dan Graphical User Interface (GUI yang user friendly menggunakan Android Studio 2.3.3 dan  gradle 3.3. Desain ini juga memerlukan sebuah database. Hasil desain ini dapat digunakan untuk membangun aplikasi mengirim dan menerima pesan aman secara umum dan khususnya aplikasi algoritma MD5 menggunakan Android. Kata kunci : Aplikasi, algoritma MD5, Android, SMS aman AbstractThis paper discusses the design of MD5 Algorithm application. In design is created a model to send and receive secured SMS. From this model is made an application design which is based on object using Unified Modeling Language (UML, State machine to give describing state of send and recive massage and Graphical User Interface (GUI which is user friendly using Android Studio 2.3.3 and Gradle 3.3. The application design also uses a database. The result of  design can be used to create an application to send and receive a secure message in general and especially message digest 5 algorithm using Android.  Keywords : Application, MD5 algorithm, Android, secure SMS

  6. P3MD Poverty Reduction Program Viewed From the Sharia Economic Perspective

    Directory of Open Access Journals (Sweden)

    Zakiyah Zakiyah

    2017-08-01

    ekonomi dan sosial. Pemerintahan di Indonesia yang sekarang berjalan silih berganti ternyata belum mampu membangun sebuah perekonomian kesejahteran dan ternyata belum bisa membangun perekonomian yang kokoh, memakmurkan, mensejahterakan dan adil bagi seluruh rakyat. Tujuan dari penelitian ini untuk mengetahui Program Pengentasan Kemiskinan dalam P3MD pembangunan perekonomian desa. Dalam penelitian menggunakan metode penelitian kualitatif. Dalam metode kualitatif menggunakan pengumpulan data dengan cara wawancara mengenai P3MD dalam pengentasan kemiskinan dengan melalui pembangunan sarana dan prasarana, pendidikan, dan kesehatan. Data primer dalam penelitian ini berupa data yang diperoleh dilapangan, hasil wawancara dengan pimpinan atau pejabat yang ditunjuk dikantor kelurahan dan kecamatan. Sedangkan data sekunder diperoleh melalui studi dokumen terkait dengan Program Pengetasan Kemiskinan. Di samping itu data sekunder juga diperoleh melalui studi kepustakaan (library research berupa buku panduan, literature kepustakaan dan catatan-catatan yang berhubungan dengan program Perencanaan Partisipasi Pembangunan Masyarakat Desa (P3MD. Hasil dari Penelitian ini menunjukan Program-program kegiatannya berupa pembangunan sarana dan prasarana maupun pembangunan perekonomi lewat kegiatan Bumdesa seperti pelatihan-pelatihan kreativitas seperti tata boga, tata rias, budidaya lele dumbo, membatik, dan lain-lain. Rangkaian konsep perencanaan P3MD terdiri dari sosialisasi, musyawarah program/Musrenbang desa, penyusunan program, pelaksanaan kegiatan dan partisipasi masyarakat di Kecamatan Salam Babaris. Dalam penyelenggaraan program P3MD pemerintah harus menentukan kebijakan mengenai proses pencairan dana desa melalui APBD untuk pembangunan masyarakat desa tertinggal tersalurkan dengan benar dan tepat waktu sesuai dengan ketentuan UU Desa.

  7. Crystal twinning of human MD-2 recognizing endotoxin cores of lipopolysaccharide

    International Nuclear Information System (INIS)

    Ohto, Umeharu; Satow, Yoshinori

    2008-01-01

    Twinned crystals of humaan MD-2 are transformed into single crystals with cryoprotectant optimization. Twinning of crystals causes overlapping of two or more reciprocal lattice points, and hence structure amplitudes for a single crystalline domain are hardly obtained from X-ray diffraction intensities. MD-2 protein forms a stable complex with Toll-like receptor 4 and recognizes bacterial lipopolysaccharide (LPS). Excessive immune responses activated by LPS cause septic shocks. Saccharide-trimmed human MD-2 crystallizes in the tetragonal form with apparent Laue symmetry of 4/mmm, and diffraction intensities from these crystals indicate crystal twinning. The crystal consists of two different domains, A and B. The c A axis of domain A coincides with the c B axis of domain B with a smaller lattice, and the a A axis corresponds to the (a B + b B ) axis. This twinning severely imposes difficulty in structure determination. Through optimization of cryoprotectant, domain A was thoroughly transformed into domain B. The crystal containing only domain B is in space group P4 1 2 1 2 with one MD-2 molecule in the asymmetric unit. The structure of this form of MD-2 as well as its complex with antiendotoxic lipid IVa was successfully determined using the multiple isomorphous replacement method

  8. An unusual dimeric structure and assembly for TLR4 regulator RP105-MD-1

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Sung-il; Hong, Minsun; Wilson, Ian A [Scripps

    2011-11-16

    RP105-MD-1 modulates the TLR4-MD-2-mediated, innate immune response against bacterial lipopolysaccharide (LPS). The crystal structure of the bovine 1:1 RP105-MD-1 complex bound to a putative endogenous lipid at 2.9 Å resolution shares a similar overall architecture to its homolog TLR4-MD-2 but assembles into an unusual 2:2 homodimer that differs from any other known TLR-ligand assembly. The homodimer is assembled in a head-to-head orientation that juxtaposes the N-terminal leucine-rich repeats (LRRs) of the two RP105 chains, rather than the usual tail-to-tail configuration of C-terminal LRRs in ligand-activated TLR dimers, such as TLR1-TRL2, TLR2-TLR6, TLR3-TLR3 and TLR4-TLR4. Another unusual interaction is mediated by an RP105-specific asparagine-linked glycan, which wedges MD-1 into the co-receptor binding concavity on RP105. This unique mode of assembly represents a new paradigm for TLR complexes and suggests a molecular mechanism for regulating LPS responses.

  9. Opinion of stakeholders on existing curriculum for postgraduate (MD) course in Pharmacology: A survey.

    Science.gov (United States)

    Badyal, Dinesh K; Daniel, Sujit R

    2016-10-01

    To survey the opinion about various curricular components of Doctor of Medicine (MD) pharmacology curriculum in India by stakeholders, including faculty and students. An online survey was done to evaluate the various curricular components of MD pharmacology curriculum being used in India. A total of 393 respondents including faculty, MD students, and other stakeholders completed the survey. The survey was developed using SurveyMonkey platform and link to survey was E-mailed to stakeholders. The results were expressed as percentages. There was a balanced representation of respondents from various designations, teaching experience, regions, and age groups. Most of the respondents (83%) were aware of the MD pharmacology curriculum. However, they reported that it is more inclined to knowledge domain. About half of respondents (53%) said that animal experiments are being used. The most common teaching methods mentioned are seminars (98.5%), journal clubs (95%), and practical exercises by postgraduates (73%), but there is less use of newer methods (25%) in theory and less of clinical pharmacology exercise (39%) in practical classes. The log books are maintained but not assessed regularly. Internal assessment is sparingly used. The MD pharmacology curriculum needs to be made uniform at the national level and updated to include the newer methods in teaching-learning and assessment. There should be sharing of newer methods at a common platform implemented at the national level.

  10. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    et al 2000). CMV is a multicomponent virus with a single stranded positive sense RNA. .... sense primer 5′ ATGGACAAATCTGAATCAAC 3′ was derived from the beginning of the first 20 bases of the ..... Pappu S S, Brand R, Pappu H R, Rybicki E, Gough K H, Frenkel. M J and Niblett C L 1993 A polymerase chain reaction.

  11. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    species including cereals, fruits, vegetables and ornamentals. (Roossinck 1999). CMV is readily transmitted in a non-per- sistent manner by more than 75 species of aphids (Palukaitis et al 1992). Weed hosts function as a reservoir for the virus and serve as sources of inoculum for the development of disease epidemics.

  12. Ubiquitination-Related MdBT Scaffold Proteins Target a bHLH Transcription Factor for Iron Homeostasis1[OPEN

    Science.gov (United States)

    Zhao, Qiang; Wang, Qing-Jie; Wang, Xiao-Fei; You, Chun-Xiang

    2016-01-01

    Iron (Fe) homeostasis is crucial for plant growth and development. A network of basic helix-loop-helix (bHLH) transcription factors positively regulates Fe uptake during iron deficiency. However, their up-regulation or overexpression leads to Fe overload and reactive oxygen species generation, thereby damaging the plants. Here, we found that two BTB/TAZ proteins, MdBT1 and MdBT2, interact with the MbHLH104 protein in apple. In addition, the function of MdBT2 was characterized as a regulator of MdbHLH104 degradation via ubiquitination and the 26S proteasome pathway, thereby controlling the activity of plasma membrane H+-ATPases and the acquisition of iron. Furthermore, MdBT2 interacted with MdCUL3 proteins, which were required for the MdBT2-mediated ubiquitination modification of MdbHLH104 and its degradation. In sum, our findings demonstrate that MdBT proteins interact with MdCUL3 to bridge the formation of the MdBTsMdCUL3 complex, which negatively modulates the degradation of the MdbHLH104 protein in response to changes in Fe status to maintain iron homeostasis in plants. PMID:27660166

  13. Evaluation of hydroacid complex in the forward osmosis–membrane distillation (FO–MD) system for desalination

    KAUST Repository

    Wang, Peng

    2015-11-01

    The incorporation of membrane distillation (MD) into forward osmosis (FO) provides process sustainability to regenerate the draw solution and to produce clean water simultaneously. However, the reverse salt flux is the major hurdle in the FO-MD system because it not only reduces the effective osmotic driving force across the membrane but also increases the replenishment cost and scaling issue. For the first time, a hydroacid complex with abundant hydrophilic groups and ionic species is evaluated as the draw solutes in the hybrid FO-MD system consisting of multi-bore PVDF MD membranes for seawater/brackish desalination. In order to evaluate the practicality of the hydroacid complex in the FO-MD system, FO and MD experiments were conducted at elevated temperatures and concentrations. The hydroacid complex has displayed desired properties such as high solubility, low viscosity, excellent thermal stability and minimal reverse salt flux suitable for FO and MD operations. FO-MD desalination process was demonstrated with a highest seawater desalination flux of 6/32 LMH (FO/MD). This study may open up the prospective of employing the hydroacid complex as the draw solute in FO-MD hybrid systems for seawater /brackish desalination. © 2015 Elsevier B.V.

  14. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews

    Directory of Open Access Journals (Sweden)

    Haryuni Haryuni

    2016-09-01

    Full Text Available Vanilla (Vanilla planifolia Andrews is one of the important exported commodities in Indonesia. Indonesia is one of top five major vanilla exporters in the world, that produce the high quality of Indonesian vanilla with high vanillin content (2.75%. The aims of this research were to determine the effects of dose binukleat Rhizoctonia (BNR and phosphorus as well as the interaction of the nitrate reductase activity (NRA and chlorophyll of the vanilla seedling (Vanilla planifolia Andrew. Method in this research used completely randomized factorial design, by involving two factors (dose of BNR inoculation and Phosphor. The first factor is without inoculation and inoculation BNR (M0, M1, M2, M3 wich consists of (0,5, 10, 15 g/polybag, the second factor is the dose of phosphorus fertilizer (P0, P1, P2, P3 which consists of (0, 3, 6, 9 g/polibag. The results showed that the inoculation dose of BNR and doses of phosphorus not significant and lower levels of NRA and chlorophyll while the interaction dose of BNR and phosphorus significantly and increase levels of NRA and chlorophyll of vanilla seedling. Nitrate Reductase Activity and chlorophyll has important role in metabolism process as a plant growth indicator.How to CiteHaryuni, H., & Dewi, T. S. K. (2016. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews. Biosaintifika: Journal of Biology & Biology Education, 8(2, 141-147.

  15. MdHB1 down-regulation activates anthocyanin biosynthesis in the white-fleshed apple cultivar 'Granny Smith'.

    Science.gov (United States)

    Jiang, Yonghua; Liu, Cuihua; Yan, Dan; Wen, Xiaohong; Liu, Yanli; Wang, Haojie; Dai, Jieyu; Zhang, Yujie; Liu, Yanfei; Zhou, Bin; Ren, Xiaolin

    2017-02-01

    Coloration in apple (Malus×domestica) flesh is mainly caused by the accumulation of anthocyanin. Anthocyanin is biosynthesized through the flavonoid pathway and regulated by MYB, bHLH, and WD40 transcription factors (TFs). Here, we report that the HD-Zip I TF MdHB1 was also involved in the regulation of anthocyanin accumulation. MdHB1 silencing caused the accumulation of anthocyanin in 'Granny Smith' flesh, whereas its overexpression reduced the flesh content of anthocyanin in 'Ballerina' (red-fleshed apple). Moreover, flowers of transgenic tobacco (Nicotiana tabacum 'NC89') overexpressing MdHB1 showed a remarkable reduction in pigmentation. Transient promoter activation assays and yeast one-hybrid results indicated that MdHB1 indirectly inhibited expression of the anthocyanin biosynthetic genes encoding dihydroflavonol-4-reductase (DFR) and UDP-glucose:flavonoid 3-O-glycosyltransferase (UFGT). Yeast two-hybrid and bimolecular fluorescence complementation determined that MdHB1 acted as a homodimer and could interact with MYB, bHLH, and WD40 in the cytoplasm, consistent with its cytoplasmic localization by green fluorescent protein fluorescence observations. Together, these results suggest that MdHB1 constrains MdMYB10, MdbHLH3, and MdTTG1 to the cytoplasm, and then represses the transcription of MdDFR and MdUFGT indirectly. When MdHB1 is silenced, these TFs are released to activate the expression of MdDFR and MdUFGT and also anthocyanin biosynthesis, resulting in red flesh in 'Granny Smith'. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. 42 CFR 38.5 - Grant assistance.

    Science.gov (United States)

    2010-10-01

    ... nonprofit agencies and organizations which are located or do business primarily in the area affected by the... part 16—Procedures of the Departmental Grant Appeals Board 45 CFR part 74—Administration of grants 45... regulations of this part, the terms and the conditions of the award, and the applicable cost principles...

  17. Welfare Financing : Grant Allocation and Efficiency

    NARCIS (Netherlands)

    Toolsema, L.A.; Allers, Maarten A.

    Welfare is often administered locally, but financed through grants from the central government. This raises the question how the central government can prevent local governments from spending more than necessary. We analyze block grants used in The Netherlands, which depend on exogenous spending

  18. Local government grants for private schools

    Directory of Open Access Journals (Sweden)

    Justyna Orlikowska

    2016-03-01

    Full Text Available This article aims to analyze the educational grants from budget of local government. Author presented procedures about establish private schools and educational institutions and explained selected concepts about units of education. The article presents selected judgment from SN and NSA in disputes about grants for private schools.

  19. DOE/Industry Matching Grant Program

    International Nuclear Information System (INIS)

    Lee, John C.

    2003-01-01

    For the academic year 2001-2002, the Department of Nuclear Engineering and Radiological Sciences received $50,000 of industrial contributions, matched by a DOE grant of $35,000. We used the combined DOE/Industry Matching Grant of $85,000 toward (a) undergraduate merit scholarships and research support, (b) graduate student support, and (c) partial support of a research scientist

  20. 42 CFR 52d.6 - Grant awards.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Grant awards. 52d.6 Section 52d.6 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL CANCER INSTITUTE CLINICAL... cancer biology, epidemiology, detection, diagnosis, prevention, treatment and control; (ii) To interest...

  1. Writing a successful fellowship or grant application.

    Science.gov (United States)

    Gemayel, Rita; Martin, Seamus J

    2017-11-01

    Writing a competitive grant application is an essential skill for any scientist who wants to embark on an independent career. This instalment of the Words of Advice series provides a comprehensive guide to preparing a successful grant or personal fellowship application. © 2017 Federation of European Biochemical Societies.

  2. 75 FR 60205 - Grant Guideline; Notice

    Science.gov (United States)

    2010-09-29

    ... reference in this Grant Guideline, grant funds may not be used to purchase alcoholic beverages. a.... (matching requirements) and Section VI.16.a. (non-supplantation) of the Guideline prior to beginning the... is either a national non-profit organization controlled by, operating in conjunction with, and...

  3. Maaleht soovitab : Anu Tali dirigeerib Vanemuises "Toscat". Vivaldi, Casanova ja Veneetsia. "Uinuv kaunitar" Vanemuises. Andrew Lloyd Webberi juubelikontserdid. Pärimusmuusika lõiluspidu

    Index Scriptorium Estoniae

    2008-01-01

    27. sept. juhatab Anu Tali Vanemuise teatris Mikk Mikiveri lavastatud ja Ervin Õunapuu taastatud Puccini ooperilavastust "Tosca". Barokkansambel Corelli Consort ja Raivo Järvi esitavad kava "Vivaldi, Casanova ja Veneetsia" 15. okt. Maardu mõisa muusikasalongis, 18. okt. Pärnus sarjas "Café Grand muusikasalong" ja 19. okt. Eesti Teaduste Akadeemia majas sarjas "Toompea muusikasalong". Vanemuisees esietendub 4. okt. Pjotr Tshaikovski ballett "Uinuv kaunitar". Tallinnas Saku Suurhallis toimuvad 18. okt. briti muusikalihelilooja Andrew Lloyd Webberi 60. sünnipäevale pühendatud juubelikontserdid. Viljandi Pärimusmuusika Aidas peetakse 10.-11. okt. "Pärimusmuusika lõikuspidu"

  4. Fuel to the nuclear debate : [Rezension von:] Nuclear power in crisis, Andrew Blowers and David Pepper (editors), New York, Nichols; London ..., Croom Helm, 1987

    OpenAIRE

    Renn, Ortwin

    1988-01-01

    Nuclear energy is one of the most popular topics of today’s publication market. The literature about the pros and cons of nuclear power may easily fill a whole library. Is there anything new to add to this voluminous body of arguments and contra-arguments that would justify editing another book on nuclear energy? Andrew Blowers and David Pepper obviously felt that way and published a reader on Nuclear Power in Crisis. The book consists of 13 articles covering mainly the political, social and ...

  5. Nomina nova in Platyhelminthes pro Macrorhynchus von Graff, 1882 (non [Gmelin, 1801]; non Dunker, 1843), and Leptocleidus Mueller, 1936 (non Andrews, 1922).

    Science.gov (United States)

    Hornung, Jahn J

    2016-08-19

    Two genus-group names of flat-worms-Leptocleidus Mueller, 1936 and Macrorhynchus von Graff, 1882-are junior homonyms that are preoccupied by fossil diapsid reptile genera-Leptocleidus Andrews, 1922, and Macrorhynchus Dunker, 1843-and an extant teleost fish genus-Macrorhynchus [Gmelin, 1801] ex La Cépède, 1800. These are replaced by nomina nova (Pharyngodytes nom. nov.; Graffiellus nom. nov.). Macrorhynchus [Gmelin, 1801] is an objective senior synonym of Macrorhyncus Dumeríl, 1805 ex La Cépède, 1800 (syn. nov.), and a senior homonym of Macrorhynchus Dunker, 1843, and Macrorhynchus von Graff, 1882.

  6. Organization and management of space grant programs

    Science.gov (United States)

    Sheppard, Sallie; Nichols, Steve

    1990-01-01

    The 21 Space Grant Programs represent a broad range of organizational structures which operate programs ranging in size from single university organizations to organizations including up to 41 members involving a composite of industrial organizations such as state agencies, and universities. Some of the space grant awards were made to organizations already in existence with on-going programs while other awards were made to consortia newly formed for the purpose of applying to the Space Grant Program. The workshop on organization and management of Space Grant Programs provided an opportunity for directors and program representatives to discuss and compare the relative advantages and disadvantages of the various models being used. This paper offers examples of the diversity of organizations, summarizes the common concerns to be met by each organizational model, and provides a case study of the Texas Space Grant Consortium organization.

  7. MD1271: Effect of low frequency noise on the evolution of the emittance and halo population

    CERN Document Server

    Fitterer, Miriam; Valishev, Alexander; Bruce, Roderik; Hofle, Wolfgang; Hostettler, Michi; Papadopoulou, Parthena Stefania; Papotti, Giulia; Papaphilippou, Yannis; Pellegrini, Dario; Trad, Georges; Valuch, Daniel; Valentino, Gianluca; Wagner, Joschka; Cai, Xu; CERN. Geneva. ATS Department

    2018-01-01

    For the High Luminosity upgrade the β* in IR1 and IR5 will be further reduced compared to the current LHC. As the β* decreases the β-functions in the inner triplet (IT) increase resulting in a higher sensitivity of the HL-LHC to ground motion in the IT region or to increases of the low frequency noise. Noise can in general lead to emittance growth and higher halo population and diffusion rate. However, it is usually assumed in the literature that only frequencies close to the betatron frequencies and sidebands have an effect on the emittance and tail population. To test this theory, an MD was carried out to observe if also low frequency noise can lead to emittance growth and stronger halo population and diffusion. This MD conducted on 24.08.2016 follows a previous MD on 05.11.2015/06.11.2015

  8. MD/MBA programs in the United States: evidence of a change in health care leadership.

    Science.gov (United States)

    Larson, David B; Chandler, Maria; Forman, Howard P

    2003-03-01

    Managerial sciences are playing an increasingly prominent role in the organization and delivery of health care. Despite popular media reports that a rising number of physicians are acquiring a background in this discipline through MD/MBA (medical and master of business administration) programs, no recent study has verified this. This study measured changes in the number and nature of the affiliations between management and medicine in the form of MD/MBA programs in the United States. Surveys of admission officers of 125 U.S. allopathic medical schools and of the overseers of each joint MD/MBA degree program were administered in May-October 2001. Main outcome measures included program growth, curriculum and degree requirements, application and admission requirements, and program leadership and organization. The number of MD/MBA programs grew from six to 33 between 1993 and 2001, and 17 more medical schools were considering establishing the joint-degree program. Ten, 15, and 20 programs produced 27, 42, and 61 graduates in 1999, 2000, and 2001, respectively, and over 100 students were expected to graduate per year when all 33 programs matured. Program structures and oversight indicate a spectrum of philosophies regarding the appropriate level of integration of the two degrees. MD/MBA programs apparently attempt to complement medical education with management education rather than the converse. The growth in the numbers of MD/MBA programs and participants indicates rising cooperation between medical and business schools and increasing interest in management education early in the careers of graduating physicians.

  9. The AINTEGUMENTA genes, MdANT1 and MdANT2, are associated with the regulation of cell production during fruit growth in apple (Malus × domestica Borkh.).

    Science.gov (United States)

    Dash, Madhumita; Malladi, Anish

    2012-06-25

    Fruit growth in apple (Malus × domestica Borkh.) is mediated by cell production and expansion. Genes involved in regulating these processes and thereby fruit growth, are not well characterized. We hypothesized that the apple homolog(s) of AINTEGUMENTA (ANT), an APETALA2-repeat containing transcription factor, regulates cell production during fruit growth in apple. Two ANT genes, MdANT1 and MdANT2, were isolated from apple and their expression was studied during multiple stages of fruit development. MdANT1 and MdANT2 expression was high during early fruit growth coincident with the period of cell production, rapidly declined during exit from cell production, and remained low during the rest of fruit development. The effects of increase in carbohydrate availability during fruit growth were characterized. Increase in carbohydrate availability enhanced fruit growth largely through an increase in cell production. Expression of MdANT1 and MdANT2 increased sharply by up to around 5-fold in response to an increase in carbohydrate availability. Expression of the ANT genes was compared across two apple genotypes, 'Gala' and 'Golden Delicious Smoothee' (GS), which differ in the extent of fruit growth, largely due to differences in cell production. In comparison to 'Gala', the larger fruit-size genotype, GS, displayed higher levels and a longer duration of MdANT1 and MdANT2 expression. Expression of the ANTs and cell cycle genes in the fruit core and cortex tissues isolated using laser capture microdissection was studied. During early fruit growth, expression of the MdANTs was higher within the cortex, the tissue that constitutes the majority of the fruit. Additionally, MdANT1 and MdANT2 expression was positively correlated with that of A- and B-type CYCLINS, B-type CYCLIN-DEPENDENT-KINASES (CDKBs) and MdDEL1. Multiple lines of evidence from this study suggest that MdANT1 and MdANT2 regulate cell production during fruit growth in apple. ANTs may coordinate the expression of

  10. The AINTEGUMENTA genes, MdANT1 and MdANT2, are associated with the regulation of cell production during fruit growth in apple (Malus × domestica Borkh.

    Directory of Open Access Journals (Sweden)

    Dash Madhumita

    2012-06-01

    Full Text Available Abstract Background Fruit growth in apple (Malus × domestica Borkh. is mediated by cell production and expansion. Genes involved in regulating these processes and thereby fruit growth, are not well characterized. We hypothesized that the apple homolog(s of AINTEGUMENTA (ANT, an APETALA2–repeat containing transcription factor, regulates cell production during fruit growth in apple. Results Two ANT genes, MdANT1 and MdANT2, were isolated from apple and their expression was studied during multiple stages of fruit development. MdANT1 and MdANT2 expression was high during early fruit growth coincident with the period of cell production, rapidly declined during exit from cell production, and remained low during the rest of fruit development. The effects of increase in carbohydrate availability during fruit growth were characterized. Increase in carbohydrate availability enhanced fruit growth largely through an increase in cell production. Expression of MdANT1 and MdANT2 increased sharply by up to around 5-fold in response to an increase in carbohydrate availability. Expression of the ANT genes was compared across two apple genotypes, ‘Gala’ and ‘Golden Delicious Smoothee’ (GS, which differ in the extent of fruit growth, largely due to differences in cell production. In comparison to ‘Gala’, the larger fruit-size genotype, GS, displayed higher levels and a longer duration of MdANT1 and MdANT2 expression. Expression of the ANTs and cell cycle genes in the fruit core and cortex tissues isolated using laser capture microdissection was studied. During early fruit growth, expression of the MdANTs was higher within the cortex, the tissue that constitutes the majority of the fruit. Additionally, MdANT1 and MdANT2 expression was positively correlated with that of A- and B-type CYCLINS, B-type CYCLIN-DEPENDENT-KINASES (CDKBs and MdDEL1. Conclusions Multiple lines of evidence from this study suggest that MdANT1 and MdANT2 regulate cell production

  11. LHC Transvers Profile Monitors studies (MD on May 6th, 2011)

    CERN Document Server

    Bravin, E; Dehning, B; Emery, J; Lefevre, T; Gras, JJ; Jeff, A; Rabiller, A; Roncarolo, F; Sapinski, M; Kain, V; Pojer, M; Bartosik, H; Salvant, B

    2011-01-01

    This note contains the preliminary results of the LHC MD that took place on 6-May-2011 (from 2 to 10 a.m.), dedicated to study Wire Scanners (WS), Synchrotron Radiation Monitors (BSRT) and Beam Gas Ionization Monitors (BGI). The MD aimed at performing different studies on the individual monitors as well as at cross calibrating them with beams composed of bunches with different transverse emittances in stable conditions. At the same time, it was possible to perform calibration studies with the Abort Gap Monitor (AGM) and Longitudinal Density Monitor (LDM) that share the extracted light with the BSRT.

  12. Computation of shear viscosity of colloidal suspensions by SRD-MD

    Energy Technology Data Exchange (ETDEWEB)

    Laganapan, A. M. K.; Videcoq, A., E-mail: arnaud.videcoq@unilim.fr; Bienia, M. [SPCTS, UMR 7315, ENSCI, CNRS, Centre Européen de la Céramique, 12 rue Atlantis, 87068 Limoges Cedex (France); Ala-Nissila, T. [COMP CoE at the Department of Applied Physics, Aalto University School of Science, P.O. Box 11000, FIN-00076 Aalto, Espoo (Finland); Department of Physics, Brown University, Providence, Rhode Island 02912-1843 (United States); Bochicchio, D.; Ferrando, R. [Dipartimento di Fisica and CNR-IMEM, via Dodecaneso 33, Genova I-16146 (Italy)

    2015-04-14

    The behaviour of sheared colloidal suspensions with full hydrodynamic interactions (HIs) is numerically studied. To this end, we use the hybrid stochastic rotation dynamics-molecular dynamics (SRD-MD) method. The shear viscosity of colloidal suspensions is computed for different volume fractions, both for dilute and concentrated cases. We verify that HIs help in the collisions and the streaming of colloidal particles, thereby increasing the overall shear viscosity of the suspension. Our results show a good agreement with known experimental, theoretical, and numerical studies. This work demonstrates the ability of SRD-MD to successfully simulate transport coefficients that require correct modelling of HIs.

  13. Molecular cloning and functional analysis of a blue light receptor gene MdCRY2 from apple (Malus domestica).

    Science.gov (United States)

    Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Rui-Fen; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

    2013-04-01

    MdCRY2 was isolated from apple fruit skin, and its function was analyzed in MdCRY2 transgenic Arabidopsis. The interaction between MdCRY2 and AtCOP1 was found by yeast two-hybrid and BiFC assays. Cryptochromes are blue/ultraviolet-A (UV-A) light receptors involved in regulating various aspects of plant growth and development. Investigations of the structure and functions of cryptochromes in plants have largely focused on Arabidopsis (Arabidopsis thaliana), tomato (Solanum lycopersicum), pea (Pisum sativum), and rice (Oryza sativa). However, no data on the function of CRY2 are available in woody plants. In this study, we isolated a cryptochrome gene, MdCRY2, from apple (Malus domestica). The deduced amino acid sequences of MdCRY2 contain the conserved N-terminal photolyase-related domain and the flavin adenine dinucleotide (FAD) binding domain, as well as the C-terminal DQXVP-acidic-STAES (DAS) domain. Relationship analysis indicates that MdCRY2 shows the highest similarity to the strawberry FvCRY protein. The expression of MdCRY2 is induced by blue/UV-A light, which represents a 48-h circadian rhythm. To investigate the function of MdCRY2, we overexpressed the MdCRY2 gene in a cry2 mutant and wild type (WT) Arabidopsis, assessed the phenotypes of the resulting transgenic plants, and found that MdCRY2 functions to regulate hypocotyl elongation, root growth, flower initiation, and anthocyanin accumulation. Furthermore, we examined the interaction between MdCRY2 and AtCOP1 using a yeast two-hybrid assay and a bimolecular fluorescence complementation assay. These data provide functional evidence for a role of blue/UV-A light-induced MdCRY2 in controlling photomorphogenesis in apple.

  14. Humanized TLR4/MD-2 mice reveal LPS recognition differentially impacts susceptibility to Yersinia pestis and Salmonella enterica.

    Directory of Open Access Journals (Sweden)

    Adeline M Hajjar

    Full Text Available Although lipopolysaccharide (LPS stimulation through the Toll-like receptor (TLR-4/MD-2 receptor complex activates host defense against Gram-negative bacterial pathogens, how species-specific differences in LPS recognition impact host defense remains undefined. Herein, we establish how temperature dependent shifts in the lipid A of Yersinia pestis LPS that differentially impact recognition by mouse versus human TLR4/MD-2 dictate infection susceptibility. When grown at 37°C, Y. pestis LPS is hypo-acylated and less stimulatory to human compared with murine TLR4/MD-2. By contrast, when grown at reduced temperatures, Y. pestis LPS is more acylated, and stimulates cells equally via human and mouse TLR4/MD-2. To investigate how these temperature dependent shifts in LPS impact infection susceptibility, transgenic mice expressing human rather than mouse TLR4/MD-2 were generated. We found the increased susceptibility to Y. pestis for "humanized" TLR4/MD-2 mice directly paralleled blunted inflammatory cytokine production in response to stimulation with purified LPS. By contrast, for other Gram-negative pathogens with highly acylated lipid A including Salmonella enterica or Escherichia coli, infection susceptibility and the response after stimulation with LPS were indistinguishable between mice expressing human or mouse TLR4/MD-2. Thus, Y. pestis exploits temperature-dependent shifts in LPS acylation to selectively evade recognition by human TLR4/MD-2 uncovered with "humanized" TLR4/MD-2 transgenic mice.

  15. Humanized TLR4/MD-2 mice reveal LPS recognition differentially impacts susceptibility to Yersinia pestis and Salmonella enterica.

    Science.gov (United States)

    Hajjar, Adeline M; Ernst, Robert K; Fortuno, Edgardo S; Brasfield, Alicia S; Yam, Cathy S; Newlon, Lindsay A; Kollmann, Tobias R; Miller, Samuel I; Wilson, Christopher B

    2012-01-01

    Although lipopolysaccharide (LPS) stimulation through the Toll-like receptor (TLR)-4/MD-2 receptor complex activates host defense against Gram-negative bacterial pathogens, how species-specific differences in LPS recognition impact host defense remains undefined. Herein, we establish how temperature dependent shifts in the lipid A of Yersinia pestis LPS that differentially impact recognition by mouse versus human TLR4/MD-2 dictate infection susceptibility. When grown at 37°C, Y. pestis LPS is hypo-acylated and less stimulatory to human compared with murine TLR4/MD-2. By contrast, when grown at reduced temperatures, Y. pestis LPS is more acylated, and stimulates cells equally via human and mouse TLR4/MD-2. To investigate how these temperature dependent shifts in LPS impact infection susceptibility, transgenic mice expressing human rather than mouse TLR4/MD-2 were generated. We found the increased susceptibility to Y. pestis for "humanized" TLR4/MD-2 mice directly paralleled blunted inflammatory cytokine production in response to stimulation with purified LPS. By contrast, for other Gram-negative pathogens with highly acylated lipid A including Salmonella enterica or Escherichia coli, infection susceptibility and the response after stimulation with LPS were indistinguishable between mice expressing human or mouse TLR4/MD-2. Thus, Y. pestis exploits temperature-dependent shifts in LPS acylation to selectively evade recognition by human TLR4/MD-2 uncovered with "humanized" TLR4/MD-2 transgenic mice.

  16. Fragment Molecular Orbital method-based Molecular Dynamics (FMO-MD) as a simulator for chemical reactions in explicit solvation.

    Science.gov (United States)

    Komeiji, Yuto; Ishikawa, Takeshi; Mochizuki, Yuji; Yamataka, Hiroshi; Nakano, Tatsuya

    2009-01-15

    Fragment Molecular Orbital based-Molecular Dynamics (FMO-MD, Komeiji et al., Chem Phys Lett 2003, 372, 342) is an ab initio MD method suitable for large molecular systems. Here, FMO-MD was implemented to conduct full quantum simulations of chemical reactions in explicit solvation. Several FMO-MD simulations were performed for a sphere of water to find a suitable simulation protocol. It was found that annealing of the initial configuration by a classical MD brought the subsequent FMO-MD trajectory to faster stabilization, and also that use of bond constraint in the FMO-MD heating stage effectively reduced the computation time. Then, the blue moon ensemble method (Sprik and Ciccotti, J Chem Phys 1998, 109, 7737) was implemented and was tested by calculating free energy profiles of the Menschutkin reaction (H3N + CH3Cl --> +H3NCH3 + Cl-) in the presence and absence of the solvent water via FMO-MD. The obtained free energy profiles were consistent with the Hammond postulate in that stabilization of the product by the solvent, namely hydration of Cl-, shifted the transition state to the reactant-side. Based on these FMO-MD results, plans for further improvement of the method are discussed. Copyright 2008 Wiley Periodicals, Inc.

  17. Overexpression of a repressor MdMYB15L negatively regulates anthocyanin and cold tolerance in red-fleshed callus.

    Science.gov (United States)

    Xu, Haifeng; Yang, Guanxian; Zhang, Jing; Wang, Yicheng; Zhang, Tianliang; Wang, Nan; Jiang, Shenghui; Zhang, Zongying; Chen, Xuesen

    2018-04-14

    The cold-induced metabolic pathway and anthocyanin biosynthesis play important roles in plant growth. In this study, we identified a bHLH binding motif in the MdMYB15L protein using protein sequence analyses. Yeast two-hybrid and pull-down assays showed that MdMYB15L could interact with MdbHLH33. Overexpressing MdMYB15L in red-fleshed callus inhibited the expression of MdCBF2 and resulted in reduced cold tolerance but did not affect anthocyanin levels. Chip-PCR and EMSA analysis showed that MdMYB15L could bind the type II cis-acting element found in the MdCBF2 promoter. Overexpressing MdMYB15L in red-fleshed callus overexpressing MdbHLH33 also reduced cold tolerance and reduced MdbHLH33-induced anthocyanin biosynthesis. Knocking out the bHLH binding sequence of MdMYB15L (LBSMdMYB15L) prevented LBSMdMYB15L from interacting with MdbHLH33. Overexpressing LBSMdMYB15L in red-fleshed callus overexpressing MdbHLH33 also reduced cold tolerance and reduced MdbHLH33-induced anthocyanin biosynthesis. Together, these results suggested that an apple repressor MdMYB15L might play a key role in the cold signaling and anthocyanin metabolic pathways. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Utilizing NASA Earth Observations to Assess Impacts of Hurricanes Andrew and Irma on Mangrove Forests in Biscayne Bay National Park, FL

    Science.gov (United States)

    Kumar, A.; Weber, S.; Remillard, C.; Escobar Pardo, M. L.; Hashemi Tonekaboni, N.; Cameron, C.; Linton, S.; Rickless, D.; Rivero, R.; Madden, M.

    2017-12-01

    Extreme weather events, such as hurricanes, pose major threats to coastal communities around the globe. However, mangrove forests along coastlines act as barriers and subdue the impacts associated with these catastrophic events. The Biscayne Bay National Park mangrove forest located near the city of Miami Beach was recently affected by the category four hurricane Irma in September of 2017. This study analyzed the impact of Hurricane Irma on Biscayne Bay National Park mangroves. Several remote sensing datasets including Landsat 8 Operational Land Imager (OLI), Sentinel 2-Multi Spectral Imager (MSI), PlanetScope, and aerial imagery were utilized to assess pre-and post-hurricane conditions. The high-resolution aerial imagery and PlanetScope data were used to map damaged areas within the national park. Additionally, Landsat 8 OLI and Sentinel-2 MSI data were utilized to estimate changes in biophysical parameters, including gross primary productivity (GPP), before and after Hurricane Irma. This project also examined damages associated with Hurricane Andrew (1992) using historical Landsat 5 Thematic Mapper (TM) data. These results were compared to GPP estimates following Hurricane Irma and suggested that Hurricane Andrew's impact was greater than that of Irma in Biscayne Bay National Park. The results of this study will help to enhance the mangrove health monitoring and shoreline management programs led by officials at the City of Miami Beach Public Works Department.

  19. ATLAS PhD Grants 2015

    CERN Multimedia

    Marcelloni De Oliveira, Claudia

    2015-01-01

    ATLAS PHd Grants - We are excited to announce the creation of a dedicated grant scheme (thanks to a donation from Fabiola Gianotti and Peter Jenni following their award from the Fundamental Physics Prize foundation) to encourage young and high-caliber doctoral students in particle physics research (including computing for physics) and permit them to obtain world class exposure, supervision and training within the ATLAS collaboration. This special PhD Grant is aimed at graduate students preparing a doctoral thesis in particle physics (incl. computing for physics) to spend one year at CERN followed by one year support also at the home Institute.

  20. 38 CFR 61.41 - Special needs grants application.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Special needs grants... (CONTINUED) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.41 Special needs grants application. (a) To apply for a special needs grant, an applicant must obtain from VA a special needs grant application...

  1. MdATG18a overexpression improves tolerance to nitrogen deficiency and regulates anthocyanin accumulation through increased autophagy in transgenic apple.

    Science.gov (United States)

    Sun, Xun; Jia, Xin; Huo, Liuqing; Che, Runmin; Gong, Xiaoqing; Wang, Ping; Ma, Fengwang

    2018-02-01

    Nitrogen (N) availability is an essential factor for plant growth. Recycling and remobilization of N have strong impacts on crop yield and quality under N deficiency. Autophagy is a critical nutrient-recycling process that facilitates remobilization under starvation. We previously showed that an important AuTophaGy (ATG) protein from apple, MdATG18a, has a positive role in drought tolerance. In this study, we explored its biological role in response to low-N. Overexpression of MdATG18a in both Arabidopsis and apple improved tolerance to N-depletion and caused a greater accumulation of anthocyanin. The increased anthocyanin concentration in transgenic apple was possibly due to up-regulating flavonoid biosynthetic and regulatory genes (MdCHI, MdCHS, MdANS, MdPAL, MdUFGT, and MdMYB1) and higher soluble sugars concentration. MdATG18a overexpression enhanced starch degradation with up-regulating amylase gene (MdAM1) and up-regulated sugar metabolism related genes (MdSS1, MdHXKs, MdFK1, and MdNINVs). Furthermore, MdATG18a functioned in nitrate uptake and assimilation by up-regulating nitrate reductase MdNIA2 and 3 high-affinity nitrate transporters MdNRT2.1/2.4/2.5. MdATG18a overexpression also elevated other important MdATG genes expression and autophagosomes formation under N-depletion, which play key contributions to above changes. Together, these results demonstrate that overexpression of MdATG18a enhances tolerance to N-deficiencies and plays positive roles in anthocyanin biosynthesis through greater autophagic activity. © 2017 John Wiley & Sons Ltd.

  2. 77 FR 42179 - Safety Zone; Fireworks Display, Potomac River, Charles County, Newburg, MD

    Science.gov (United States)

    2012-07-18

    ... 1625-AA00 Safety Zone; Fireworks Display, Potomac River, Charles County, Newburg, MD AGENCY: Coast... Potomac River, adjacent to Gilligan's Pier Restaurant, at Newburg in Charles County, Maryland scheduled on... Potomac River, located at Newburg in Charles County, Maryland from 8 p.m. through 10:30 p.m. on July 21...

  3. 75 FR 49979 - Tony T. Bui, M.D.; Revocation of Registration

    Science.gov (United States)

    2010-08-16

    ... found that Respondent had ``failed to abstain from the consumption of dangerous drugs or [[Page 49982... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 09-8] Tony T. Bui, M.D... that on, or about, December 13, 2007, the Texas Medical Board ordered Respondent to provide a urine...

  4. Heat Flow Data Cruise MD72 RV Marion Dufresne over the Mascarene Ridge

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data were gathered by the R/V Marion Dufresne in May and June of 1992 over the Mascarene Ridge in the Indian Ocean on cruise MD72/MASCAFLUX. Heat flow measurements...

  5. 33 CFR 334.140 - Chesapeake Bay; U.S. Army Proving Ground Reservation, Aberdeen, Md.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Chesapeake Bay; U.S. Army Proving....140 Chesapeake Bay; U.S. Army Proving Ground Reservation, Aberdeen, Md. (a) Restricted area defined..., Maryland. (1) Beginning at a point on the westerly side of Chesapeake Bay, at the south side of the mouth...

  6. MD#2183: Calibration of the IR6 B2 diamond BLMs

    CERN Document Server

    Valette, Matthieu; Lindstrom, Bjorn Hans Filip

    2018-01-01

    In case of an asynchronous beam dump with a fully filled LHC machine, causing ~40 bunches to impact on the movable dump protection absorber (TCDQ), it is expected that all standard ionisation chamber Beam Loss Monitors (IC BLM) around the LHC dumping region in IR6 will be saturated. Diamond Beam Loss Monitors (dBLM) were therefore installed next to the TCDQ downstream of the extraction kickers. These detectors allow resolving losses at a nanosecond timescale and with a dynamic range of several orders of magnitude; thus, allowing to derive the number of nominal bunches impacting the TCDQ. After a first series of calibrations using asynchronous beam dump tests, an experiment was conducted during MD#1182 to demonstrate the possibility of resolving a nominal bunch hitting the TCDQ. During this first MD only the Beam 1 dBLM was calibrated appropriately, a second calibration MD was therefore performed in 2017 for the B2 system. Results from this MD and conclusions regarding dBLM saturation with a top energy nominal...

  7. 78 FR 67086 - Safety Zone, Submarine Cable Replacement Operations, Kent Island Narrows; Queen Anne's County, MD

    Science.gov (United States)

    2013-11-08

    ... 1625-AA00 Safety Zone, Submarine Cable Replacement Operations, Kent Island Narrows; Queen Anne's County... vessels on navigable waters during submarine cable replacement operations at the Kent Island Narrows (MD... involves the installation of a submarine cable within a federal navigation channel requiring divers, a...

  8. 76 FR 65118 - Drawbridge Operation Regulation; Bear Creek, Sparrows Point, MD

    Science.gov (United States)

    2011-10-20

    ...-AA09 Drawbridge Operation Regulation; Bear Creek, Sparrows Point, MD AGENCY: Coast Guard, DHS. ACTION... regulation. The Baltimore County Revenue Authority (Dundalk Avenue) highway toll drawbridge across Bear Creek... applicable or necessary. Basis and Purpose The drawbridge across Bear Creek, mile 1.5 was removed and...

  9. 75 FR 18056 - Safety Zone; Fireworks Display, Patuxent River, Solomons Island Harbor, MD

    Science.gov (United States)

    2010-04-09

    ... the event, and enhancing public and maritime safety. Basis and Purpose Fireworks displays are... promote public and maritime safety during a fireworks display, and to protect mariners transiting the area...-AA00 Safety Zone; Fireworks Display, Patuxent River, Solomons Island Harbor, MD AGENCY: Coast Guard...

  10. MD-SeeGH: a platform for integrative analysis of multi-dimensional genomic data

    Directory of Open Access Journals (Sweden)

    Ng Raymond T

    2008-05-01

    Full Text Available Abstract Background Recent advances in global genomic profiling methodologies have enabled multi-dimensional characterization of biological systems. Complete analysis of these genomic profiles require an in depth look at parallel profiles of segmental DNA copy number status, DNA methylation state, single nucleotide polymorphisms, as well as gene expression profiles. Due to the differences in data types it is difficult to conduct parallel analysis of multiple datasets from diverse platforms. Results To address this issue, we have developed an integrative genomic analysis platform MD-SeeGH, a software tool that allows users to rapidly and directly analyze genomic datasets spanning multiple genomic experiments. With MD-SeeGH, users have the flexibility to easily update datasets in accordance with new genomic builds, make a quality assessment of data using the filtering features, and identify genetic alterations within single or across multiple experiments. Multiple sample analysis in MD-SeeGH allows users to compare profiles from many experiments alongside tracks containing detailed localized gene information, microRNA, CpG islands, and copy number variations. Conclusion MD-SeeGH is a new platform for the integrative analysis of diverse microarray data, facilitating multiple profile analyses and group comparisons.

  11. 75 FR 18778 - Safety Zone; Ocean City Air Show 2010, Atlantic Ocean, Ocean City, MD

    Science.gov (United States)

    2010-04-13

    ...-AA00 Safety Zone; Ocean City Air Show 2010, Atlantic Ocean, Ocean City, MD AGENCY: Coast Guard, DHS... zone on the Atlantic Ocean in the vicinity of Ocean City, Maryland to support the Ocean City Air Show. This action is intended to restrict vessel traffic movement on the Atlantic Ocean to protect mariners...

  12. Going Concern Opinions and Management's Forward Looking Disclosures: Evidence from the MD&A

    NARCIS (Netherlands)

    Enev, M.; Geiger, Marshall; Gold, A.H.; Wallage, P.

    In this study we examine the relationship between the auditor’s going concern opinion and management’s forward-looking disclosures in the Management’s Discussion and Analysis (MD&A) section of 10-K filings. The research objective is two-fold and addresses whether the presence of a going concern

  13. A mathematic model that describes modes of MdSGHV transmission within house fly populations

    Science.gov (United States)

    In this paper it is proposed that one potential component by which the Musca domestica salivary gland hypertrophy virus (MdSGHV) infects individual flies is through cuticular damage. Breaks in the cuticle allow entry of the virus into the hemocoel causing the infection. Male flies typically have a h...

  14. 76 FR 48898 - Robert Leigh Kale, M.D., Decision and Order

    Science.gov (United States)

    2011-08-09

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Robert Leigh Kale, M.D., Decision and Order... his address] does not relieve the State of its constitutional obligation.'' ' '' Id. at 232 (quoting... unclaimed, the Government could have satisfied its constitutional obligation simply by mailing the Show...

  15. 76 FR 20034 - Calvin Ramsey, M.D.; Revocation of Registration

    Science.gov (United States)

    2011-04-11

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 10-25] Calvin Ramsey, M.D.; Revocation of Registration On December 18, 2009, the Deputy Assistant Administrator, Office of Diversion... constitutional right to appointed counsel in a proceeding under 21 U.S.C. 824(a). See Goldberg v. Kelly, 397 U.S...

  16. 76 FR 78695 - Barry M. Schultz, M.D.; Decision and Order

    Science.gov (United States)

    2011-12-19

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 11-49] Barry M. Schultz, M.D.; Decision and Order On June 17, 2011, Administrative Law Judge (ALJ) Gail A. Randall issued the attached... process via the state hearing, and accordingly, under the facts of this case, has no constitutional right...

  17. Comparative MD analysis of the stability of transthyretin providing insight into the fibrillation mechanism

    DEFF Research Database (Denmark)

    Sørensen, Jesper; Hamelberg, Donald; Schiøtt, Birgit

    2007-01-01

    used all-atom MD simulation and free energy calculations to study the initial phase of this process. We have calculated the free energy changes of the initial tetramer dissociation under different conditions and in the presence of thyroxine. We show that tetramer formation is indeed only...

  18. 76 FR 4940 - Algirdas J. Krisciunas, M.D.; Revocation of Registration

    Science.gov (United States)

    2011-01-27

    ... Order to Show Cause and Immediate Suspension of Registration (Order) to Algirdas J. Krisciunas, M.D... taking because it could cause memory loss. Id. Registrant then stated that he could not provide that much... medicines.'' Id. at 24. Registrant replied: ``If you could be thinking, insomnia.'' Id. Although Rix stated...

  19. 76 FR 71369 - Robert G. Crummie, M.D.; Decision and Order

    Science.gov (United States)

    2011-11-17

    ... agencies to perform meaningless tasks. See Layfe Robert Anthony, M.D., 67 FR 35582 (DEA 2002); Michael G.... Kirk v. Mullen, 749 F.2d 297 (6th Cir. 1984); Puerto Rico Aqueduct and Sewer Auth. v. EPA, 35 F.3d 600...

  20. Domestic wastewater treatment by forward osmosis-membrane distillation (FO-MD) integrated system.

    Science.gov (United States)

    Li, Jie; Hou, Deyin; Li, Kuiling; Zhang, Yong; Wang, Jun; Zhang, Xiwang

    2018-03-01

    In this study, real domestic wastewater treatment by forward osmosis-membrane distillation (FO-MD) integrated system was investigated in laboratory scale. The integrated membrane system presented a good separation performance and the removal efficiency of most contaminants in the domestic wastewater was higher than 90%. High molecular weight contaminants were completely removed, while a few low molecular weight contaminants permeated through the membrane. The FO membrane fouling layer mainly consisted of organic substances like polysaccharides and proteins, and was very loose and could be effectively removed by rinsing the membrane surface with tap water. By comparison, the MD membrane fouling was mainly induced by inorganic salts and was not as severe as that of the FO membrane. During 120 h continuous operation, the FO-MD integrated system exhibited satisfying performance stability and maintained a high water yield and high product water quality. The results indicated the potential of the FO-MD integrated system for municipal wastewater treatment in coastal cities, water purification and desalination.

  1. 76 FR 20008 - Notice of Temporary Concession Contract for Assateague Island National Seashore, MD

    Science.gov (United States)

    2011-04-11

    ... pre-packaged food and beverage. This action is necessary to avoid interruption of visitor services... DEPARTMENT OF THE INTERIOR National Park Service [NPS-WASO-CONC-0111-6544; 2410-OYC] Notice of Temporary Concession Contract for Assateague Island National Seashore, MD AGENCY: National Park Service...

  2. Property values, parks, and crime: a hedonic analysis in Baltimore, MD

    Science.gov (United States)

    Austin Troy; J. Morgan Grove

    2008-01-01

    While urban parks are generally considered to be a positive amenity, past research suggests that some parks are perceived as a neighborhood liability. Using hedonic analysis of property data in Baltimore, MD, we attempted to determine whether crime rate mediates how parks are valued by the housing market. Transacted price was regressed against park proximity, area-...

  3. 76 FR 71371 - James L. Hooper, M.D.; Decision and Order

    Science.gov (United States)

    2011-11-17

    ....; Decision and Order On August 9, 2011, Chief Administrative Law Judge (ALJ) John J. Mulrooney, II, issued... for Summary Disposition and Recommended Decision John J. Mulrooney, II, Chief Administrative Law Judge... is contrary to logic. In Calvin Ramsey, M.D., 76 FR 20034, 20036 (2011), the Agency stated its...

  4. Identification of key residues that confer Rhodobacter sphaeroides LPS activity at horse TLR4/MD-2.

    Directory of Open Access Journals (Sweden)

    Katherine L Irvine

    Full Text Available The molecular determinants underpinning how hexaacylated lipid A and tetraacylated precursor lipid IVa activate Toll-like receptor 4 (TLR4 are well understood, but how activation is induced by other lipid A species is less clear. Species specificity studies have clarified how TLR4/MD-2 recognises different lipid A structures, for example tetraacylated lipid IVa requires direct electrostatic interactions for agonism. In this study, we examine how pentaacylated lipopolysaccharide from Rhodobacter sphaeroides (RSLPS antagonises human TLR4/MD-2 and activates the horse receptor complex using a computational approach and cross-species mutagenesis. At a functional level, we show that RSLPS is a partial agonist at horse TLR4/MD-2 with greater efficacy than lipid IVa. These data suggest the importance of the additional acyl chain in RSLPS signalling. Based on docking analysis, we propose a model for positioning of the RSLPS lipid A moiety (RSLA within the MD-2 cavity at the TLR4 dimer interface, which allows activity at the horse receptor complex. As for lipid IVa, RSLPS agonism requires species-specific contacts with MD-2 and TLR4, but the R2 chain of RSLA protrudes from the MD-2 pocket to contact the TLR4 dimer in the vicinity of proline 442. Our model explains why RSLPS is only partially dependent on horse TLR4 residue R385, unlike lipid IVa. Mutagenesis of proline 442 into a serine residue, as found in human TLR4, uncovers the importance of this site in RSLPS signalling; horse TLR4 R385G/P442S double mutation completely abolishes RSLPS activity without its counterpart, human TLR4 G384R/S441P, being able to restore it. Our data highlight the importance of subtle changes in ligand positioning, and suggest that TLR4 and MD-2 residues that may not participate directly in ligand binding can determine the signalling outcome of a given ligand. This indicates a cooperative binding mechanism within the receptor complex, which is becoming increasingly

  5. Connecticut Environmental Chapter Awarded EPA Education Grant

    Science.gov (United States)

    The National Audubon Society has been awarded a $91,000 Environmental Education Grant by the US Environmental Protection Agency to support its work in addressing a range of topics in classrooms to support schoolyard habitats.

  6. FEMA Hazard Mitigation Grant Program - Property Acquisitions

    Data.gov (United States)

    Department of Homeland Security — HMGP provides grants to states and local governments to implement long-term hazard mitigation measures after a major disaster declaration. The HMGP is one of three...

  7. Grants Reporting and Tracking System (GRTS)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Grants Reporting and Tracking System (GRTS) is the primary tool for management and oversight of EPA's Nonpoint Source (NPS) Pollution Control Program. GRTS pulls...

  8. School Integrated Pest Management (IPM) Grants

    Science.gov (United States)

    EPA's IPM in schools grant program supports projects that include research, development, monitoring, public education, training, demonstrations, or studies to support recipients’ efforts to increase IPM adoption by public and tribal schools (K-12).

  9. Air Pollution Monitoring for Communities Grants

    Science.gov (United States)

    EPA, through its Science to Achieve Results (STAR) grants program is providing funding to six institutions that will advance air monitoring technology while helping communities address unique air quality challenges.

  10. Gallup, NM, CARE Grant Success Story

    Science.gov (United States)

    A CARE Grant, Level II award, was made to Gallup, NM to focus on cleaning up the waste stream, reuse and recycling of materials, and reclaiming land for these purposes through outreach, education and organization.

  11. Administrative Discretionary Grants (FY 1996-2014)

    Data.gov (United States)

    Institute of Museum and Library Services — Review the administrative records for discretionary grant recipients who were awarded funds by IMLS from FY 1996 to FY 2014. Data include information on the...

  12. 77 FR 51610 - Distracted Driving Grant Program

    Science.gov (United States)

    2012-08-24

    ... employed as a commercial motor vehicle driver or a school bus driver who uses a personal wireless... DEPARTMENT OF TRANSPORTATION National Highway Traffic Safety Administration Distracted Driving Grant Program AGENCY: Department of Transportation (DOT), National Highway Traffic Safety Administration...

  13. FY2010 CoC Competition Grants

    Data.gov (United States)

    Department of Housing and Urban Development — This report displays the homeless assistance projects being awarded by HUD under the 2010 Continuum of Care (CoC) competitive grants process. Approximately $1.411...

  14. Grant-Funded Research in Environmental Economics

    Science.gov (United States)

    This database contains summaries of these awards, as well as project reports and publications, developed under environmental economics-related grants made by EPA's Office of Research and Development, NCEE and their partners since 1990.

  15. About the Office of Grants Administration

    Science.gov (United States)

    OGA supports grants and cooperative agreements awarded to scientific institutions, small businesses, and individuals to help build, maintain, and enhance a cohesive and comprehensive cancer research agenda. Learn more about OGA and its program structure.

  16. 78 FR 35288 - Discretionary Grant Program

    Science.gov (United States)

    2013-06-12

    ... competition and appropriately continue these grants without a break in the grant. MCHB proposes to extend the... Voices of Alabama Inc.... H84MC12901 AL 95,700 31-May-2014. Arkansas Disability Coalition... H84MC12900...,700 31-May-2014. Center. PATH Parent to Parent/Family H84MC21663 CT 95,700 31-May-2014. Voices of CT...

  17. Granting silence to avoid wireless collisions

    KAUST Repository

    Choi, Jung Il

    2010-10-01

    We describe grant-to-send, a novel collision avoidance algorithm for wireless mesh networks. Rather than announce packets it intends to send, a node using grant-to-send announces packets it expects to hear others send. We present evidence that inverting collision avoidance in this way greatly improves wireless mesh performance. Evaluating four protocols from 802.11 meshes and 802.15.4 sensor networks, we find that grant-to-send matches or outperforms CSMA and RTS/CTS in all cases. For example, in a 4-hop UDP flow, grantto- send can achieve 96% of the theoretical maximum throughput while maintaining a 99.9% packet delivery ratio. Grant-tosend is also general enough to replace protocol-specific collision avoidance mechanisms common to sensor network protocols. Grant-to-send is simple. For example, incorporating it into 802.11 requires only 11 lines of driver code and no hardware changes. Furthermore, as it reuses existing 802.11 mechanisms, grant-to-send inter-operates with current networks and can be incrementally deployed. © 2010 IEEE.

  18. 2012 Eco-Logical grant program annual report

    Science.gov (United States)

    2012-01-01

    Since 2007 the Eco-Logical grant program has funded 15 projects nationwide; twelve grant recipients completed their projects prior to 2012, two grant recipients completed their projects in the 2012 calendar year, and one anticipates finishing its pro...

  19. 77 FR 9228 - AP Gas & Electric (MD), LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes...

    Science.gov (United States)

    2012-02-16

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission AP Gas & Electric (MD), LLC; Supplemental Notice That Initial Market-Based... above-referenced proceeding of AP Gas & Electric (MD), LLC's application for market-based rate authority...

  20. 33 CFR 207.100 - Inland waterway from Delaware River to Chesapeake Bay, Del. and Md. (Chesapeake and Delaware...

    Science.gov (United States)

    2010-07-01

    ... River to Chesapeake Bay, Del. and Md. (Chesapeake and Delaware Canal); use, administration, and... Chesapeake Bay, Del. and Md. (Chesapeake and Delaware Canal); use, administration, and navigation. (a...) [Reserved] (m) Refuse and oil. The depositing of trash, refuse, debris, oil, or other material in the...

  1. Usefulness of multidetector-row computed tomography (MD-CT) for diagnosis and evaluation of cardiovascular anomalies in infants

    International Nuclear Information System (INIS)

    Kani, Hiroyuki; Narabayashi, Isamu; Tanikake, Masato; Matsuki, Mitsuru; Uesugi, Yasuo

    2005-01-01

    We examined the effectiveness of multidetector-row CT (MD-CT) in the diagnosis and evaluation of cardiovascular anomalies in infants. MD-CT was performed 34 times on 21 patients with cardiovascular anomalies. We performed three evaluations: 1) The assessment of the specificity of MD-CT in detecting the morphological features of cardiovascular anomalies. 2) The diameters of aortae with coronary artery (CoA), and the diameters of pulmonary artery, measured by using MD-CT were compared with those by angiography. 3) The amount of exposure to radiation was measured. 1) MD-CT can detect CoA, pulmonary arteriovenous anomalies among extracardiac anomalies in all the patients. The diagnostic accuracy for intracardiac anomalies was poor as only six of the 15 anomalies could be accurately diagnosed. 2) The diameters of aortae and pulmonary artery obtained using MD-CT showed a good correlation with those obtained using arteriography (r=0.97, 0.95). 3) The average dose-length product was 269.2 mGy·cm. And the average effective dose was 5.1 mSv. MD-CT is not suitable for the evaluation of intracardiac anomalies, but is extremely effective in the evaluation of extracardiac major vascular anomalies. On the basis of the amount of information and noninvasive nature, MD-CT should be used first before angiography. (author)

  2. 78 FR 72001 - Amendment of Class D and E Airspace, and Establishment of Class E Airspace; Salisbury, MD

    Science.gov (United States)

    2013-12-02

    ... Class E Airspace; Salisbury, MD AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Final rule. SUMMARY: This action amends Class D and Class E airspace, and establishes Class E airspace at Salisbury-Ocean City Wicomico Regional Airport, Salisbury, MD, due to the decommissioning of the Salisbury VHF...

  3. 78 FR 52109 - Proposed Amendment of Class D and E Airspace, and Establishment of Class E Airspace; Salisbury, MD

    Science.gov (United States)

    2013-08-22

    ... Establishment of Class E Airspace; Salisbury, MD AGENCY: Federal Aviation Administration (FAA), DOT. ACTION..., and establish Class E airspace at Salisbury-Ocean City Wicomico Regional Airport, Salisbury, MD, due to the decommissioning of the Salisbury VHF Omnidirectional Radio Range Tactical Air Navigation Aid...

  4. The Convergence of Business and Medicine: A Study of MD/MBA Programs in the United States

    Science.gov (United States)

    Keogh, Timothy J.; Martin, William Marty

    2011-01-01

    The purpose of this paper is to identify the convergence of business and medical education and describe the curricula of MD/MBA (Medical Doctor/Master of Business Administration) programs in the US. The focus of this study is to provide a guide to dual MD/MBA programs for physicians, aspiring physicians, policy makers and healthcare organizations.…

  5. 33 CFR 165.556 - Regulated Navigation Area; Chesapeake and Delaware Canal, Chesapeake City Anchorage Basin, MD.

    Science.gov (United States)

    2010-07-01

    ...; Chesapeake and Delaware Canal, Chesapeake City Anchorage Basin, MD. 165.556 Section 165.556 Navigation and..., Chesapeake City Anchorage Basin, MD. (a) Location. The following area is a regulated navigation area: All waters of the Chesapeake and Delaware (C & D) Canal within the anchorage basin at Chesapeake City...

  6. Md Naimuddin

    Indian Academy of Sciences (India)

    A KUMAR A M VINOD KUMAR ABHIK JASH AJIT K MOHANTY ALEENA CHACKO ALI AJMI AMBAR GHOSAL AMINA KHATUN AMITAVA RAYCHAUDHURI AMOL DIGHE ANIMESH CHATTERJEE ANKIT GAUR ANUSHREE GHOSH ASHOK KUMAR ASMITA REDIJ B SATYANARAYANA B S ACHARYA BRAJESH C ...

  7. The presidents Drs. Carolyn Britton, MD, MS, of the NMA and Nancy Nielsen, MD, PhD, of the AMA: an interview by George Dawson.

    Science.gov (United States)

    Nielsen, Nancy; Britton, Carolyn

    2009-06-01

    In this edition, we are privileged to have interviewed the current presidents of the National Medical Association (NMA), founded in 1895, and the American Medical Association (AMA), founded in 1847. Drs. Carolyn Britton of the NMA and Nancy Nielsen of the AMA are the 109th and 163rd presidents of their respective organizations. As part of the reconciliation efforts begun by the issuance of a formal apology by the AMA to the nations' African American physicians and the NMA, as they relate to our collective American racial history, we felt it important to include in this process the views of both organizations' presidents. And it just so happens that in this time both presidents happen to be women. The NMA elected its first female president (Edith Erby-Jones, MD) in 1985 and, as of today, they have selected 9 female presidents. The AMA selected its first female president (Nancy Dickey, MD) in 1998, with Dr. Nielsen serving as the second female president ever in AMA history.

  8. The R2R3-MYB transcription factor MdMYB73 is involved in malate accumulation and vacuolar acidification in apple.

    Science.gov (United States)

    Hu, Da-Gang; Li, Yuan-Yuan; Zhang, Quan-Yan; Li, Ming; Sun, Cui-Hui; Yu, Jian-Qiang; Hao, Yu-Jin

    2017-08-01

    Malate, the predominant organic acid in many fruits, is a crucial component of the organoleptic quality of fruit, including taste and flavor. The genetic and environmental mechanisms affecting malate metabolism in fruit cells have been studied extensively. However, the transcriptional regulation of malate-metabolizing enzymes and vacuolar transporters remains poorly understood. Our previous studies demonstrated that MdMYB1 modulates anthocyanin accumulation and vacuolar acidification by directly activating vacuolar transporters, including MdVHA-B1, MdVHA-E, MdVHP1 and MdtDT. Interestingly, we isolated and identified a MYB transcription factor, MdMYB73, a distant relative of MdMYB1 in this study. It was subsequently found that MdMYB73 protein bound directly to the promoters of MdALMT9 (aluminum-activated malate transporter 9), MdVHA-A (vacuolar ATPase subunit A) and MdVHP1 (vacuolar pyrophosphatase 1), transcriptionally activating their expression and thereby enhancing their activities. Analyses of transgenic apple calli demonstrated that MdMYB73 influenced malate accumulation and vacuolar pH. Furthermore, MdCIbHLH1 interacted with MdMYB73 and enhanced its activity upon downstream target genes. These findings help to elucidate how MdMYB73 directly modulates the vacuolar transport system to affect malate accumulation and vacuolar pH in apple. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  9. Applicability of effective fragment potential version 2 - Molecular dynamics (EFP2-MD) simulations for predicting excess properties of mixed solvents

    Science.gov (United States)

    Kuroki, Nahoko; Mori, Hirotoshi

    2018-02-01

    Effective fragment potential version 2 - molecular dynamics (EFP2-MD) simulations, where the EFP2 is a polarizable force field based on ab initio electronic structure calculations were applied to water-methanol binary mixture. Comparing EFP2s defined with (aug-)cc-pVXZ (X = D,T) basis sets, it was found that large sets are necessary to generate sufficiently accurate EFP2 for predicting mixture properties. It was shown that EFP2-MD could predict the excess molar volume. Since the computational cost of EFP2-MD are far less than ab initio MD, the results presented herein demonstrate that EFP2-MD is promising for predicting physicochemical properties of novel mixed solvents.

  10. PoopMD, a Mobile Health Application, Accurately Identifies Infant Acholic Stools.

    Directory of Open Access Journals (Sweden)

    Amy Franciscovich

    Full Text Available Biliary atresia (BA is the leading cause of pediatric end-stage liver disease in the United States. Education of parents in the perinatal period with stool cards depicting acholic and normal stools has been associated with improved time-to-diagnosis and survival in BA. PoopMD is a mobile application that utilizes a smartphone's camera and color recognition software to analyze an infant's stool and determine if additional follow-up is indicated. PoopMD was developed using custom HTML5/CSS3 and wrapped to work on iOS and Android platforms. In order to define the gold standard regarding stool color, seven pediatricians were asked to review 45 photographs of infant stool and rate them as acholic, normal, or indeterminate. Samples for which 6+ pediatricians demonstrated agreement defined the gold standard, and only these samples were included in the analysis. Accuracy of PoopMD was assessed using an iPhone 5s with incandescent lighting. Variability in analysis of stool photographs as acholic versus normal with intermediate rating weighted as 50% agreement (kappa was compared between three laypeople and one expert user. Variability in output was also assessed between an iPhone 5s and a Samsung Galaxy S4, as well as between incandescent lighting and compact fluorescent lighting. Six-plus pediatricians agreed on 27 normal and 7 acholic photographs; no photographs were defined as indeterminate. The sensitivity was 7/7 (100%. The specificity was 24/27 (89% with 3/27 labeled as indeterminate; no photos of normal stool were labeled as acholic. The Laplace-smoothed positive likelihood ratio was 6.44 (95% CI 2.52 to 16.48 and the negative likelihood ratio was 0.13 (95% CI 0.02 to 0.83. kappauser was 0.68, kappaphone was 0.88, and kappalight was 0.81. Therefore, in this pilot study, PoopMD accurately differentiates acholic from normal color with substantial agreement across users, and almost perfect agreement across two popular smartphones and ambient light

  11. MdMYB1 Regulates Anthocyanin and Malate Accumulation by Directly Facilitating Their Transport into Vacuoles in Apples1[OPEN

    Science.gov (United States)

    Hu, Da-Gang; Sun, Cui-Hui; Ma, Qi-Jun; You, Chun-Xiang; Hao, Yu-Jin

    2016-01-01

    Tonoplast transporters, including proton pumps and secondary transporters, are essential for plant cell function and for quality formation of fleshy fruits and ornamentals. Vacuolar transport of anthocyanins, malate, and other metabolites is directly or indirectly dependent on the H+-pumping activities of vacuolar H+-ATPase (VHA) and/or vacuolar H+-pyrophosphatase, but how these proton pumps are regulated in modulating vacuolar transport is largely unknown. Here, we report a transcription factor, MdMYB1, in apples that binds to the promoters of two genes encoding the B subunits of VHA, MdVHA-B1 and MdVHA-B2, to transcriptionally activate its expression, thereby enhancing VHA activity. A series of transgenic analyses in apples demonstrates that MdMYB1/10 controls cell pH and anthocyanin accumulation partially by regulating MdVHA-B1 and MdVHA-B2. Furthermore, several other direct target genes of MdMYB10 are identified, including MdVHA-E2, MdVHP1, MdMATE-LIKE1, and MdtDT, which are involved in H+-pumping or in the transport of anthocyanins and malates into vacuoles. Finally, we show that the mechanism by which MYB controls malate and anthocyanin accumulation in apples also operates in Arabidopsis (Arabidopsis thaliana). These findings provide novel insights into how MYB transcription factors directly modulate the vacuolar transport system in addition to anthocyanin biosynthesis, consequently controlling organ coloration and cell pH in plants. PMID:26637549

  12. MdMYB1 Regulates Anthocyanin and Malate Accumulation by Directly Facilitating Their Transport into Vacuoles in Apples.

    Science.gov (United States)

    Hu, Da-Gang; Sun, Cui-Hui; Ma, Qi-Jun; You, Chun-Xiang; Cheng, Lailiang; Hao, Yu-Jin

    2016-03-01

    Tonoplast transporters, including proton pumps and secondary transporters, are essential for plant cell function and for quality formation of fleshy fruits and ornamentals. Vacuolar transport of anthocyanins, malate, and other metabolites is directly or indirectly dependent on the H(+)-pumping activities of vacuolar H(+)-ATPase (VHA) and/or vacuolar H(+)-pyrophosphatase, but how these proton pumps are regulated in modulating vacuolar transport is largely unknown. Here, we report a transcription factor, MdMYB1, in apples that binds to the promoters of two genes encoding the B subunits of VHA, MdVHA-B1 and MdVHA-B2, to transcriptionally activate its expression, thereby enhancing VHA activity. A series of transgenic analyses in apples demonstrates that MdMYB1/10 controls cell pH and anthocyanin accumulation partially by regulating MdVHA-B1 and MdVHA-B2. Furthermore, several other direct target genes of MdMYB10 are identified, including MdVHA-E2, MdVHP1, MdMATE-LIKE1, and MdtDT, which are involved in H(+)-pumping or in the transport of anthocyanins and malates into vacuoles. Finally, we show that the mechanism by which MYB controls malate and anthocyanin accumulation in apples also operates in Arabidopsis (Arabidopsis thaliana). These findings provide novel insights into how MYB transcription factors directly modulate the vacuolar transport system in addition to anthocyanin biosynthesis, consequently controlling organ coloration and cell pH in plants. © 2016 American Society of Plant Biologists. All Rights Reserved.

  13. Grant Application Development, Submission, Review, & Award

    Science.gov (United States)

    This infographic shows the National Cancer Institute general timeline progression through Grant Application Development, Submission, Review, and Award Infographic. In the first month, Applicant prepares and submits Grant Application to Grants.gov in response to FOA. In month two, The Center for Scientific Review (CSR) assigns applications that fall under the category of R01s, etc. to a Scientific Review Group (SRG) or the CSR assigns applications that fall under the category of Program Projects and Center Grants to NCI Division of Extramural Activities (DEA). Months four through five: First-level review by Scientific Review Group (SRG) for Scientific Merit: SRG assigns Impact Scores. Month five Summary Sstatements are prepared and are available to NCI Program staff and applicants. Month six, second-level review by National Cancer Advisory board (NCAB) for NCI Funding determination begins. NCAB makes recommendation to NCI Director, NCI develops funding plan, Applications selected for Funding, “Paylists” forwarded to Office of Grant Administration (OGA). Month ten, Award Negotiations and Issuance: Award issued, Award received by Institution, and Investigator begins work. www.cancer.gov Icons made by Freepik from http://www.flaticon.com is licensed by CC BY3.0

  14. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-β -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae

    Directory of Open Access Journals (Sweden)

    Roberta T. dos Santos

    2012-01-01

    Full Text Available MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae, showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG, after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC50 value of 67 µM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature.

  15. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    International Nuclear Information System (INIS)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia

    2012-01-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC 50 value of 67 μM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  16. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia [Universidade Federal de Sao Paulo (UNIFESP), Diadema, SP (Brazil). Inst. de Ciencias Ambientais, Quimicas e Farmaceuticas; Tempone, Andre G.; Pinto, Erika G. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil). Dept. de Parasitologia; Lorenzi, Harri, E-mail: psartorelli@unifesp.br [Instituto Plantarum de Estudos da Flora, Nova Odessa, SP (Brazil)

    2012-07-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-{beta}-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC{sub 50} value of 67 {mu}M, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  17. Public health assessment for Wheeling Disposal Service Company Landfill, Amazonia, Andrew County, Missouri, Region 7, CERCLIS number MOD000830554. Final report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-08-25

    The Wheeling Disposal Service Company, Inc., (Wheeling Disposal) site is a closed municipal and industrial waste landfill, approximately 1 mile southeast of Amazonia, Andrew County, Missouri. On-site shallow groundwater is contaminated with Volatile Organic Compounds (VOCs) (methylene chloride, carbon tetrachloride, trichloroethylene) and metals; however, no one is using that water for potable purposes at present. Isolated farm houses are situated in the vicinity of the site, but the houses that would most likely be affected are connected to the public water system. From the information reviewed, DOH concludes that the Wheeling Disposal site currently poses no apparent public health hazard. No exposures are known to be occurring at this time. Potential exposure pathways have been identified, but remedial actions eliminated them.

  18. The impact of Hurricane Andrew on deviant behavior among a multi-racial/ethnic sample of adolescents in Dade County, Florida: a longitudinal analysis.

    Science.gov (United States)

    Khoury, E L; Warheit, G J; Hargrove, M C; Zimmerman, R S; Vega, W A; Gil, A G

    1997-01-01

    Findings from a longitudinal study are presented on the relationships between the problems and stresses resulting from Hurricane Andrew and posthurricane minor deviant behavior. The sample (N = 4,978) included Hispanic, African-American, and White non-Hispanic middle school students enrolled in Dade County, Florida public schools. Two waves of data were collected prior to the hurricane; a third was obtained approximately 6 months following the storm. Results indicated that females were likely to report higher levels of hurricane-related stress symptoms than males. After controlling for prehurricane levels of minor deviance, family support, and race/ethnicity, hurricane stress symptom level remained a significant predictor of posthurricane minor deviant behavior. The findings lend support to stress theories of social deviance.

  19. Die erediens as fees of die fees as erediens?: �n Andrew Murray pryswenner �n kwarteeu later herlees

    Directory of Open Access Journals (Sweden)

    Cas Wepener

    2014-08-01

    Full Text Available Worship as feast or feast as worship? Re-reading an Andrew Murray prizewinner one quarter of a century later. The aim of this contribution is to bring the book Die erediens as fees into discussion with the surrounding culture almost one quarter of a century after its publication. The surrounding culture, we shall call, following Martin Stringer and his so-called discourse of globalisation and consumerism, �the feast as worship service�. Based on this discussion, our research question pertains to the value of Die erediens as fees for the field of Liturgical Studies today. An answer is attempted by, firstly, sketching the liturgical landscape as well as national and international liturgical-scientific developments in our day and, secondly, providing a liturgical-aesthetical exploration and positioning Die erediens as fees within these developments and exploration.

  20. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    Energy Technology Data Exchange (ETDEWEB)

    Moniz, Ernest [U.S. Energy Secretary

    2014-02-03

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  1. An Analysis and Comparison of Two Short Writings: "Inaugural Address at the University of St. Andrew's" by J.S. Mill and "The University of Utopia" by R.M. Hutchins, Based on Five Criteria.

    Science.gov (United States)

    Poirier, Jeannine M.

    Focusing on the concept of education for work vs. education for living, the author presents a comparative analysis of two works on liberal education, each of which was originally delivered orally to university students: "The Inaugural Address at the University of St. Andrew" by John Stuart Mill and "The University of Utopia" by…

  2. Book Review: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia

    OpenAIRE

    Chung Ming CHIN

    2014-01-01

    Book Review of the edited compilation: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia, Washington DC: The World Bank, ISBN: 978-0-8213-8626-2, 264 pages

  3. Environmental Assessment for the Construction and Operation of a New Shoppette/Gas Station, Class Six Store, and Name-Brand Fast Food Store at Joint Base Andrews Camp Springs, Prince George’s County, Maryland

    Science.gov (United States)

    2010-02-01

    construction standards to mitigate antiterrorism vulnerabilities and terrorist threats. These requirements are incorporated in the Andrews AFB General...Regulation .03B(7) of this chapter, shall: (1) Use a method approved by the Department to: (a) Test all spill catchment basins and containment sumps in

  4. MD-portal: Highly Effective Website for Nuclear Materials Information Management

    International Nuclear Information System (INIS)

    Kil, Soyeon; Lee, Gyeonggeun; Kwon, Junhyun

    2014-01-01

    A web-based system is widespread in not only everyday activities but also business fields. In past years, the systematic information of various properties of materials usually has been provided as tabulated documents; however it recently has been provided as web-based DB. There are many websites providing material properties information, representative examples include MatWeb from the United States, Granta MI from England and MatNavi from Japan. In 2003, the nuclear materials division in KAERI established a website about nuclear materials property DB, called MatDB. To inherit it, a website called MD-portal has been recently set up to release degradation information and various properties of nuclear materials. In this presentation, the structure and characteristics of MD-portal will be mentioned, and comments on its application will be given

  5. LHC MD 652: Coupled-Bunch Instability with Smaller Emittance (all HOMs)

    CERN Document Server

    AUTHOR|(CDS)2081238; Timko, Helga; CERN. Geneva. ATS Department

    2017-01-01

    The aim of the MD was to measure the coupled-bunch stability from all HOM impedances, with a reduced longitudinal emittance in order to explore the HL-LHC conditions. The acceleration ramp was performed with the nominal beams of 2016, but a reduced target bunch length and RF voltage. With this reduced emittance, the beam remained close but above the single-bunch stability threshold. No coupled-bunch oscillations were observed, so we can conclude that the stability threshold for coupled-bunch instability is not lower than the single-bunch threshold. An interesting observation in the MD was the long-lasting injection oscillations, whose traces can still be seen at arrival to flat top; in agreement with observations in earlier MDs. The measurements took place between 28th October 20:00 and 29th October 05:10.

  6. Towards the Structural Characterization of Intrinsically Disordered Proteins by SAXS and MD Simulation

    Science.gov (United States)

    Oroguchi, Tomotaka; Ikeguchi, Mitsunori; Sato, Mamoru

    2011-01-01

    Dynamical structures of intrinsically disordered proteins (IDPs) and multi-domain proteins that include large ID regions between the domains are unable to be determined by such conventional methods as X-ray crystallography and electron microscopy. Small-angle X-ray scattering (SAXS) is suitable to determine low-resolution structures of proteins and protein complexes in solution, but the structural data on protein dynamics are averaged over the structural ensemble in protein solution. To overcome this problem, we have developed a novel method, named MD-SAXS, of the combined use of SAXS and molecular dynamics (MD) simulation to analyze protein dynamics in solution of multi-subunit protein complexes and multi-domain proteins toward the structural characterization of IDPs. Here we show validity of the method through the structural characterization of restriction Endonuclease EcoO109I.

  7. MD-CTS: An integrated terminology reference of clinical and translational medicine

    Directory of Open Access Journals (Sweden)

    Will Ray

    2016-01-01

    Full Text Available New vocabularies are rapidly evolving in the literature relative to the practice of clinical medicine and translational research. To provide integrated access to new terms, we developed a mobile and desktop online reference—Marshfield Dictionary of Clinical and Translational Science (MD-CTS. It is the first public resource that comprehensively integrates Wiktionary (word definition, BioPortal (ontology, Wiki (image reference, and Medline abstract (word usage information. MD-CTS is accessible at http://spellchecker.mfldclin.edu/. The website provides a broadened capacity for the wider clinical and translational science community to keep pace with newly emerging scientific vocabulary. An initial evaluation using 63 randomly selected biomedical words suggests that online references generally provided better coverage (73%-95% than paper-based dictionaries (57–71%.

  8. Cholesterol solubility limit in lipid membranes probed by small angle neutron scattering and MD simulations.

    Science.gov (United States)

    Garg, Sumit; Castro-Roman, Francisco; Porcar, Lionel; Butler, Paul; Bautista, Pedro Jesus; Krzyzanowski, Natalie; Perez-Salas, Ursula

    2014-12-14

    The solubility limits of cholesterol in small unilamellar vesicles made of POPS and POPC were probed using Small Angle Neutron Scattering (SANS) and coarse grained (CG) molecular dynamics (MD) simulations. SANS, being non-invasive, allowed the direct and quantitative measurement of cholesterol in intact vesicles. Our experimental measurements reveal a 61% mole fraction solubility limit of cholesterol in POPC, consistent with previous studies. However, in POPS the solubility limit of cholesterol is found to be 73% mole fraction. Previous work reports solubility limits of cholesterol in POPS varying significantly, ranging from 36% up to 66%. The CG MD simulations are in remarkable quantitative agreement with our experimental results showing similar solubility limits. Further, neither experiments nor simulations show evidence of stable nanodomains of cholesterol in POPS membranes as suggested in some previous reports.

  9. A virtual observatory for photoionized nebulae: the Mexican Million Models database (3MdB).

    Science.gov (United States)

    Morisset, C.; Delgado-Inglada, G.; Flores-Fajardo, N.

    2015-04-01

    Photoionization models obtained with numerical codes are widely used to study the physics of the interstellar medium (planetary nebulae, HII regions, etc). Grids of models are performed to understand the effects of the different parameters used to describe the regions on the observables (mainly emission line intensities). Most of the time, only a small part of the computed results of such grids are published, and they are sometimes hard to obtain in a user-friendly format. We present here the Mexican Million Models dataBase (3MdB), an effort to resolve both of these issues in the form of a database of photoionization models, easily accessible through the MySQL protocol, and containing a lot of useful outputs from the models, such as the intensities of 178 emission lines, the ionic fractions of all the ions, etc. Some examples of the use of the 3MdB are also presented.

  10. Discovering and Developing Successful Cardiovascular Therapeutics: A Conversation With James N. Topper, MD, PhD.

    Science.gov (United States)

    Topper, James N; Rutherford, John D

    2016-11-15

    Dr James (also known as Jamie) N. Topper, MD, PhD, serves as Managing General Partner at Frazier Healthcare Partners, where he leads the Life Science Venture practice. In 2011, and 2016, he was named to the Midas List of leading venture capitalists, and, in 2013, he was recognized by Forbes as one of the top 10 healthcare investors. He has >25 years of experience working with entrepreneurs to found and build successful therapeutics-focused companies. Dr Topper holds a BS from the University of Michigan. He received an MD and PhD (in biophysics) from Stanford University School of Medicine. He completed postgraduate training in internal medicine and cardiovascular disease at the Brigham and Women's Hospital in Boston and is board certified in both disciplines. © 2016 American Heart Association, Inc.

  11. MD-CTS: An integrated terminology reference of clinical and translational medicine.

    Science.gov (United States)

    Ray, Will; Finamore, Joe; Rastegar-Mojarad, Majid; Kadolph, Chris; Ye, Zhan; Bohne, Jacquie; Xu, Yin; Burish, Dan; Sondelski, Joshua; Easker, Melissa; Finnegan, Brian; Bartkowiak, Barbara; Smith, Catherine Arnott; Tachinardi, Umberto; Mendonca, Eneida A; Weichelt, Bryan; Lin, Simon M

    2016-01-01

    New vocabularies are rapidly evolving in the literature relative to the practice of clinical medicine and translational research. To provide integrated access to new terms, we developed a mobile and desktop online reference-Marshfield Dictionary of Clinical and Translational Science (MD-CTS). It is the first public resource that comprehensively integrates Wiktionary (word definition), BioPortal (ontology), Wiki (image reference), and Medline abstract (word usage) information. MD-CTS is accessible at http://spellchecker.mfldclin.edu/. The website provides a broadened capacity for the wider clinical and translational science community to keep pace with newly emerging scientific vocabulary. An initial evaluation using 63 randomly selected biomedical words suggests that online references generally provided better coverage (73%-95%) than paper-based dictionaries (57-71%).

  12. 76 FR 34297 - Low Income Taxpayer Clinic Grant Program; Availability of 2012 Grant Application Package

    Science.gov (United States)

    2011-06-13

    ... with the IRS or inform individuals for whom English is a second language of their taxpayer rights and... education to taxpayers who speak English as a second language, and by identifying and advocating for issues... second language, or both, can apply for a grant for the 2012 grant cycle. Examples of Qualifying...

  13. 75 FR 30108 - Low Income Taxpayer Clinic Grant Program; Availability of 2011 Grant Application Package

    Science.gov (United States)

    2010-05-28

    ... services to taxpayers who speak English as a second language (ESL). An overriding goal of the IRS is to... responsibilities to taxpayers for whom English is a second language can apply for a grant for the 2011 grant cycle... taxpayers in controversies with the IRS or inform individuals for whom English is a second language of their...

  14. Tagging system for scattered electrons in two-photon reactions at the MD-1 detector

    International Nuclear Information System (INIS)

    Aul'chenko, V.M.; Baru, S.E.; Blinov, A.E.

    1994-01-01

    The Tagging System of the MD-1 detector at the VEPP-4 collider used for studying of two-photon reactions is described. A transverse magnetic field enables one to detect scattered electrons and positrons even at zero scattering angles. The system energy resolution for scattered electron is 1.75% at the beam energy 4.7 GeV. 32 refs.; 21 figs.; 1 tabs

  15. Report from LHC MD 1399: Effect of linear coupling on nonlinear observables in the LHC.

    CERN Document Server

    Maclean, Ewen Hamish; Giovannozzi, Massimo; Persson, Tobias Hakan Bjorn; Tomas Garcia, Rogelio; CERN. Geneva. ATS Department

    2017-01-01

    Simulation work during Run 1 established that linear coupling had a large impact on nonlinear observables such as detuning with amplitude and dynamic aperture. Linear coupling is generally taken to be the largest single source of uncertainty in the modelling of the LHC’s nonlinear single particle dynamics. ThisMD sought to verify that such behaviour, to this point only observed in simulation, translated into the real machine.

  16. Prevalence of mood disorders and utility of the PRIME-MD in patients undergoing radiation therapy

    International Nuclear Information System (INIS)

    Leopold, Kenneth A.; Ahles, Tim A.; Walch, Susan; Amdur, Robert J.; Mott, Leila A.; Wiegand-Packard, Linda; Oxman, Thomas E.

    1998-01-01

    Purpose: To validate a short, structured interview procedure that allows practicing oncologists to quickly and reliably identify mood disorders in their patients, and to estimate the prevalence and types of mood disorders in a radiation therapy patient setting, noting relationships between mood disorders and patient characteristics. Methods: Consecutive, eligible adult patients from the practices of two radiation oncologists were administered the Primary Care Evaluation of Mental Disorders (PRIME-MD) by the treating physician. A subset of these patients was also evaluated with the SCID, administered by trained mental health care personnel. Agreement between the two instruments was examined using the kappa statistic. Prevalence of mood disorders was determined from the PRIME-MD. The significance of relationships between patient characteristics and mood disorders was examined by chi-square and ANOVA analysis, and subsequently by multivariate logistic regression analysis. Results: One hundred twenty-two patients were studied. Fifty-three of these were administered the SCID. Agreement between the two instruments was very good (kappa = 0.70). A diagnosis of a depressive or anxiety disorder by the PRIME-MD was made in 59 of the 122 patients (48%, 95% confidence interval = 39%, 58%). Multivariate analysis showed that a diagnosis of a depressive mood disorder was significantly related to pain intensity and prior history of depression. Conclusion: We have demonstrated the validity and feasibility of the PRIME-MD administered by oncologists in making diagnoses of mood disorders. The prevalence of mood disorders in our set of patients undergoing a course of RT was nearly 50%. Future studies should describe the natural history of these disorders, and determine optimal intervention strategies

  17. Modeling and imaging land-cover influences on air-temperature in and near Baltimore, MD

    Science.gov (United States)

    Gordon Heisler; Alexis Ellis; David J. Nowak; Ian. Yesilonis

    2015-01-01

    Over the course of 1681 hours between May 5 and September 30, 2006, air temperatures measured at the 1.5-m height at seven sites in and near the city of Baltimore, MD were used to empirically model Δ Tˆ R-p , the difference in air temperature between a site in downtown Baltimore and the six other sites. Variables in the...

  18. Queueing systems with constant service time and evaluation of M/D/1,k

    DEFF Research Database (Denmark)

    Iversen, Villy Bæk

    1997-01-01

    Systems with constant service times have the particular property that the customers leave the servers in the same order in which they areaccepted for service. Probabilitites of integral waiting times can be expressed by the state probabilities, and non-integral waiting timescan be expressed by in...... by integral waiting times. This in combination by a result by Keilson results in an effective algorithm for evaluating M/D/1,k....

  19. β∗ levelling using the LHC Lumi Server (MD 2427)

    CERN Document Server

    Hostettler, Michi; Fuchsberger, Kajetan; Gabriel, Mathieu; Hemelsoet, Georges-Henry; Hruska, Marek; Jacquet, Delphine; Wenninger, Jorg; CERN. Geneva. ATS Department

    2018-01-01

    Luminosity levelling by β∗ is the baseline scenario for HL-LHC and will possibly be used in 2018 LHC operation. In this MD, we commissioned a novel controls approach to β∗ levelling using improved LSA trims and automatic orchestration. Compared to the regular squeeze using sequences, this approach is aimed to be minimally invasive to LHC operation in Stable Beams. Using this tool, we demonstrated the feasibility of β∗ levelling between 1 m and 30 cm.

  20. An Efficient Hybrid DSMC/MD Algorithm for Accurate Modeling of Micro Gas Flows

    KAUST Repository

    Liang, Tengfei

    2013-01-01

    Aiming at simulating micro gas flows with accurate boundary conditions, an efficient hybrid algorithmis developed by combining themolecular dynamics (MD) method with the direct simulationMonte Carlo (DSMC)method. The efficiency comes from the fact that theMD method is applied only within the gas-wall interaction layer, characterized by the cut-off distance of the gas-solid interaction potential, to resolve accurately the gas-wall interaction process, while the DSMC method is employed in the remaining portion of the flow field to efficiently simulate rarefied gas transport outside the gas-wall interaction layer. A unique feature about the present scheme is that the coupling between the two methods is realized by matching the molecular velocity distribution function at the DSMC/MD interface, hence there is no need for one-toone mapping between a MD gas molecule and a DSMC simulation particle. Further improvement in efficiency is achieved by taking advantage of gas rarefaction inside the gas-wall interaction layer and by employing the "smart-wall model" proposed by Barisik et al. The developed hybrid algorithm is validated on two classical benchmarks namely 1-D Fourier thermal problem and Couette shear flow problem. Both the accuracy and efficiency of the hybrid algorithm are discussed. As an application, the hybrid algorithm is employed to simulate thermal transpiration coefficient in the free-molecule regime for a system with atomically smooth surface. Result is utilized to validate the coefficients calculated from the pure DSMC simulation with Maxwell and Cercignani-Lampis gas-wall interaction models. ©c 2014 Global-Science Press.

  1. A comparative study of Message Digest 5(MD5) and SHA256 algorithm

    Science.gov (United States)

    Rachmawati, D.; Tarigan, J. T.; Ginting, A. B. C.

    2018-03-01

    The document is a collection of written or printed data containing information. The more rapid advancement of technology, the integrity of a document should be kept. Because of the nature of an open document means the document contents can be read and modified by many parties so that the integrity of the information as a content of the document is not preserved. To maintain the integrity of the data, it needs to create a mechanism which is called a digital signature. A digital signature is a specific code which is generated from the function of producing a digital signature. One of the algorithms that used to create the digital signature is a hash function. There are many hash functions. Two of them are message digest 5 (MD5) and SHA256. Those both algorithms certainly have its advantages and disadvantages of each. The purpose of this research is to determine the algorithm which is better. The parameters which used to compare that two algorithms are the running time and complexity. The research results obtained from the complexity of the Algorithms MD5 and SHA256 is the same, i.e., ⊖ (N), but regarding the speed is obtained that MD5 is better compared to SHA256.

  2. MD-portal Materials Database: Effective Materials Property Information Management in Nuclear Energy Systems

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Gyeonggeun; Kil, Soyeon; Kwon, Junhyun [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-05-15

    The collective properties of the nuclear materials are defined as standard industrial codes such as ASME codes. While in service, the materials are aged and degraded, and the initial properties are changed according to the operating environments. These changes are a matter of substantial concern of the operators, regulators, and researchers in nuclear fields. Hence, the material property database considering the degradation is required, and the successful management and use of material property information must be responsive to the continuing changes and increasing complexity in nuclear engineering materials. Recently, the nuclear materials division in the Korea Atomic Energy Research Institute (KAERI) launched a comprehensive portal website for nuclear material information, which is known as the MD-portal. The MD-portal contains various technical documents on the degradation and development of nuclear materials. Additionally, the nuclear materials database (MatDB) is incorporated in it. The MatDB covers the mechanical properties of various nuclear structural materials used as the components: a reactor pressure vessel, steam generator, and primary and secondary piping. In this study, we introduced the MD-portal MatDB briefly, and showed an application of the MatDB to the real case of material degradations in NPPs.

  3. Theoretical investigation of loratadine reactivity in order to understand its degradation properties: DFT and MD study.

    Science.gov (United States)

    Armaković, Stevan; Armaković, Sanja J; Abramović, Biljana F

    2016-10-01

    Antihistamines are frequently used pharmaceuticals that treat the symptoms of allergic reactions. Loratadine (LOR) is an active component of the second generation of selective antihistaminic pharmaceutical usually known as Claritin. Frequent usage of this type of pharmaceuticals imposes the need for understanding their fundamental reactive properties. In this study we have theoretically investigated reactive properties of LOR using both density functional theory (DFT) calculations and molecular dynamics (MD) simulations. DFT study is used for collecting information related to the molecule stability, structure, frontier molecular orbitals, quantum molecular descriptors, charge distribution, molecular electrostatic potential surfaces, charge polarization, and local reactivity properties according to average local ionization energy surfaces. Based on these results, N24 atom of pyridine ring and oxygen atom O1 were identified with nucleophilic nature. In order to collect the information necessary for the proposition of degradation compounds we also calculated bond dissociation energies (BDE) for hydrogen abstraction and single acyclic bonds as well. According to BDE, the oxidation is likely to occur in the piperidine and cycloheptane rings. MD simulations were used in order to understand the interactions with water through radial distribution functions (RDF). Based on RDFs the most important interactions with solvent are determined for carbon atom C5, chlorine atom Cl15, and oxygen atom O1. Collected results based on DFT calculations and MD simulations provided information important for suggestion of possible degradation compounds. Covalent and noncovalent interactions between LOR and (•)OH have also been investigated.

  4. Recent trends in diagnosis and control of Marek's disease (MD) in poultry.

    Science.gov (United States)

    Singh, Shambhu Dayal; Barathidasan, Rajamani; Kumar, Asok; Deb, Rajib; Verma, Amit Kumar; Dhama, Kuldeep

    2012-10-15

    Marek's Disease (MD), caused by Marek's Disease Virus (MDV) is a highly contagious oncogenic and neuropathic disease of chickens responsible for great economic losses to the poultry industry all around the world and characterized by development of CD4+T cell lymphomas as well as infiltration of nerves and visceral organs by lymphocytes. MD is one of the most common lymphoproliferative diseases of chickens which cause mononuclear cell infiltration in one or more of the following tissues: peripheral nerves, gonads, lymphoid organs, iris, muscle, skin and other visceral organs resulting into development of tumours in visceral organs, paralysis of legs, wings and neck, grey eye (iris) or irregular pupil, vision impairment, blindness, skin lesions and immunosuppression, all of which can be accompanied by non-specific signs such as anorexia, weight loss and poor performance. Today there are evolving highly pathogenic isolates of MDV around the world capable of overwhelming the protection from currently employed vaccines. Thus MD poses a big challenge to the welfare and wellbeing of the poultry with increased condemnation of carcass, loss of productivity and quality products, leading to huge economic losses. It is also an immunosuppressive disease and causes increased susceptibility to other infections. The present review discusses in brief about the Marek's disease, its etiology, conventional and advance tools and techniques being used for its diagnosis, prevention and control strategies in poultry.

  5. Dorsal and median Raphe nuclei projection to MD of Thalamus in rat: A retrograde tracer study

    Directory of Open Access Journals (Sweden)

    Pas Bakhsh P

    2000-06-01

    Full Text Available In order to understand the function of mammalians serotonin system, we have to know the anatomical structure, because physiological changes are influenced through the anatomical changes. A number of thalamic nuclei are associated with functions known to be influenced by serotonergic input in brainstem, among them mediodorsal thalamic nucleus has relationship with limbic system and prefrontal cortex. The precise topographical projections of mesencephalic raphe nuclei to the MD nucleus of thalamus were identified in the rat using horseradish peroxidase (HRP retrograde tracing substance. Injection of HRP in MD labeled a large number of neurons in rostral to caudal part of dorsal raphe nucleus. It exhibited a strong number of neurons in ipsilateral part of DR and a few cells in its contralateral part. Numerously labeled cells were also observed ipsilateral in rostral and medial part of MnR (86% and a few cells in it's contralateral part. The present study has provided that the MD innervation by DR is more greater in density than that observed at the MnR. Upon these results and previous study, mesencephalic raphe nuclei are involved in several specific functions of thalamus as limbic system behavioral mechanism. A much more detailed knowledge is needed to show topographic relationships between mesencephalic raphe nuclei and forebrain.

  6. Institutional Conservation Program: Grants compliance monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Jaffe, L.B.; Purpura, A.

    1991-09-01

    The Institutional Conservation Program (ICP) is a grant program for the States and certain eligible institutions (primarily schools and hospitals) to assist in administrating and funding energy conservation projects. These projects range from studies of building energy use conducted by engineers and architects, termed technical assistance reports, to actual acquisition and installation of equipment and materials to improve the efficiency of energy use in selected buildings. This document represents the final annual report on compliance monitoring of ICP grants and incorporates the findings of previous progress and other reports submitted under the contracts.

  7. 25 CFR 23.51 - Grant carry-over authority.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Grant carry-over authority. 23.51 Section 23.51 Indians... Uniform Grant Administration Provisions and Requirements § 23.51 Grant carry-over authority. Unless... two years beyond the initial grant funding period and must be utilized only for the intent, purpose...

  8. 34 CFR 75.236 - Effect of the grant.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Effect of the grant. 75.236 Section 75.236 Education... Make A Grant § 75.236 Effect of the grant. The grant obligates both the Federal Government and the... reference: See 34 CFR part 74, Subpart L—Programmatic Changes and Budget Revisions. Approval of Multi-Year...

  9. Grants for Religion, Religious Welfare & Religious Education--2012 Digital Edition

    Science.gov (United States)

    Foundation Center, 2011

    2011-01-01

    This publication is only available as a downloadable file. See who's giving and getting grants in your field. Strengthen your search for funds with the Foundation Center's digital edition of "Grants for Religion." This new "Grant Guide" reveals the scope of current foundation giving in the field. You'll find descriptions of 18,483 grants of…

  10. 42 CFR 57.2208 - Payment of scholarship grant.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Payment of scholarship grant. 57.2208 Section 57... CONSTRUCTION OF TEACHING FACILITIES, EDUCATIONAL IMPROVEMENTS, SCHOLARSHIPS AND STUDENT LOANS Physician Shortage Area Scholarship Grants § 57.2208 Payment of scholarship grant. The portion of a scholarship grant...

  11. 42 CFR 57.2209 - Conditions of scholarship grant.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Conditions of scholarship grant. 57.2209 Section 57... CONSTRUCTION OF TEACHING FACILITIES, EDUCATIONAL IMPROVEMENTS, SCHOLARSHIPS AND STUDENT LOANS Physician Shortage Area Scholarship Grants § 57.2209 Conditions of scholarship grant. (a) Any scholarship grant made...

  12. 38 CFR 61.40 - Special needs grants-general.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.40 Special needs grants—general. (a) VA provides special needs grants to capital grant and per diem recipients under this part to assist with... that would change significantly the scope of the project for which a capital grant or per diem was...

  13. 38 CFR 61.16 - Matching funds for capital grants.

    Science.gov (United States)

    2010-07-01

    ... capital grants. 61.16 Section 61.16 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.16 Matching funds for capital grants. The amount of a capital grant may not exceed 65 percent of the total cost of the project for which the...

  14. 38 CFR 61.11 - Applications for capital grants.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.11 Applications for capital grants. (a) To apply for a capital grant, an applicant must obtain from VA a capital grant application package and... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Applications for capital...

  15. Hybrid Pressure Retarded Osmosis−Membrane Distillation (PRO−MD) Process for Osmotic Power and Clean Water Generation

    KAUST Repository

    Han, Gang

    2015-05-20

    A novel pressure retarded osmosis−membrane distillation (PRO−MD) hybrid process has been experimentally conceived for sustainable production of renewable osmotic power and clean water from various waters. The proposed PRO−MD system may possess unique advantages of high water recovery rate, huge osmotic power generation, well controlled membrane fouling, and minimal environmental impacts. Experimental results show that the PRO−MD hybrid process is promising that not only can harvest osmotic energy from freshwater but also from wastewater. When employing a 2 M NaCl MD concentrate as the draw solution, ultrahigh power densities of 31.0 W/m2 and 9.3 W/m2 have been demonstrated by the PRO subsystem using deionized water and real wastewater brine as the feeds, respectively. Simultaneously, high purity potable water with a flux of 32.5−63.1 L/(m2.h) can be produced by the MD subsystem at 40−60 °C without any detrimental effects of fouling. The energy consumption in the MD subsystem might be further reduced by applying a heat exchanger in the hybrid system and using low-grade heat or solar energy to heat up the feed solution. The newly developed PRO−MD hybrid process would provide insightful guidelines for the exploration of alternative green technologies for renewable osmotic energy and clean water production.

  16. An assessment of communication skills of the MD/MS students of institute of medicine in Nepal

    Directory of Open Access Journals (Sweden)

    Jagdish Prasad Agrawal

    2013-01-01

    Full Text Available Introduction The main objective of this study was to assess the level of interpersonal communication skills of MD/MS resident doctors and to provide recommendations for the future. Methods Descriptive,crosssectional,qualitativeandquantitativeresearch design was used. 7- point Likert scale (0 to 6 MAAS-Global scoring instrument was used. The subjects of the research were the MD/MS residents from various departments of Maharajgunj Medical Campus (MMC of Institute of Medicine, Maharajgunj, Kathmandu. Out of 162 MD/MS residents, only 30 (18.5% MD/MS residents were selected for the sample size for the study from 1st, 2nd and 3rd year. One MD/MS resident was required four video recording to conduct four interviews with patients coming to the outpatient department. Results There was high degree of positive correlation between Information sharing and Management (r=0.746 whereas weak negative correlation on clarification and diagnosis (r=-0.011. Inter-rater correlation was established before hand and was satisfactory (p < 0.05. Conclusions ThisbaselinestudyofMD/MSresidentsshowsthatoverallMD/MSresidentsaredeficientin almost all the components of interpersonal communication skills. A communication skills training course in postgraduate medical education could improve the existing communication skills of the doctors in Nepal.

  17. An assessment of communication skills of the MD/MS students of institute of medicine in Nepal

    Directory of Open Access Journals (Sweden)

    Jagdish Prasad Agrawal

    2013-09-01

    Full Text Available Introduction The main objective of this study was to assess the level of interpersonal communication skills of MD/MS resident doctors and to provide recommendations for the future. Methods Descriptive, cross sectional, qualitative and quantitative research design was used. 7- point Likert scale (0 to 6 MAAS-Global scoring instrument was used. The subjects of the research were the MD/MS residents from various departments of Maharajgunj Medical Campus (MMC of Institute of Medicine, Maharajgunj, Kathmandu. Out of 162 MD/MS residents, only 30 (18.5% MD/MS residents were selected for the sample size for the study from 1st, 2nd and 3rd year. One MD/MS resident was required four video recording to conduct four interviews with patients coming to the outpatient department. Results There was high degree of positive correlation between Information sharing and Management (r=0.746 whereas weak negative correlation on clarification and diagnosis (r=-0.011. Inter-rater correlation was established before hand and was satisfactory (p < 0.05. Conclusions This base line study of MD/MS residents shows that over all MD/MS residents are deficient in almost all the components of interpersonal communication skills. A communication skills training course in postgraduate medical education could improve the existing communication skills of the doctors in Nepal.

  18. Academic Talent Selection in Grant Review Panels

    NARCIS (Netherlands)

    Arensbergen, P. van; Weijden, I. van der; Besselaar, P van den

    2014-01-01

    Career grants are an important instrument for selecting and stimulating the next generation of leading researchers. Earlier research has mainly focused on the relation between past performance and success. In this study we investigate the evidence of talent and how the selection process takes place.

  19. Science Granting Councils Initiative: Research uptake | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Such activities include use of electronic media, branding and promotional materials, and engagement by experts such as the chief executive officers of science granting councils and science, technology, and innovation thought leaders at strategic events. This project will support implementation of the communication and ...

  20. Science Granting Councils Initiative: Research uptake | CRDI ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Such activities include use of electronic media, branding and promotional materials, and engagement by experts such as the chief executive officers of science granting councils and science, technology, and innovation thought leaders at strategic events. This project will support implementation of the communication and ...

  1. Manager, Grant Administration | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Job Summary As a key resource person, the Manager is responsible to provide expert advice related to grant administration, administrative risk assessments of recipient institutions, financial management and drafting of legal agreements throughout the life-cycle of projects/programs. The Manager oversees all activities ...

  2. Manager, Grant Administration | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The incumbent is a full member of the Division's management team and participates in key strategic and operational discussions and decisions on grant administration issues, priorities, systems, processes, performance indicators, human resources. The Manager provides strategic direction, contributes to the development ...

  3. 78 FR 65341 - Discretionary Grant Funds

    Science.gov (United States)

    2013-10-31

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Health Resources and Services Administration Discretionary Grant Funds AGENCY: Health Resources and Services Administration (HRSA), HHS. ACTION: Notice of... will be issuing a non-competitive award to the Children's Hospital of Alabama's Regional Poison Control...

  4. 28 CFR 93.4 - Grant authority.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Grant authority. 93.4 Section 93.4 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PROVISIONS IMPLEMENTING THE VIOLENT CRIME CONTROL... violent offenders, and (2) The integrated administration of other sanctions and services, which shall...

  5. The Treasury Grants, 1833-1839

    Science.gov (United States)

    Alexander, J.; Paz, D. G.

    1974-01-01

    Recent studies on the education program unveiled by Lord John Russell in 1839 suggest that evaluation of that program is too simple, and a systematic consideration of the education grant, which was a part of that program, in the period of its administration by the Treasury confirms the need for some revision. (Author/RK)

  6. The Bread Loaf Writing Grants Program.

    Science.gov (United States)

    Middlebury Coll., VT. Bread Loaf School of English

    Illustrating that the Bread Loaf Grants Program is cost-effective and beneficial, this collection presents reports and articles by and about teachers and students involved in staff and curriculum development projects funded by the program. The collection concludes that the projects demonstrate that literacy flourishes in settings where children…

  7. Extramural Research Grants and Scientists’ Funding Strategies

    DEFF Research Database (Denmark)

    Grimpe, Christoph

    2012-01-01

    ), government, foundation, and industry grants. Based on a sample of more than 800 scientists at universities and public research institutes in Germany, the results indicate that scientist productivity measured in terms of publication and patent stock is a statistically significant determinant only...

  8. 22 CFR 210.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 210.650 Section 210.650 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE... to transfer a thing of value to the recipient to carry out a public purpose of support or stimulation...

  9. 42 CFR 457.630 - Grants procedures.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Grants procedures. 457.630 Section 457.630 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... health assistance, other child health assistance, special health initiatives, outreach and administration...

  10. Grant Administrator | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Job Summary A Grant Administrator is responsible to provide financial and administrative advice and support services to designated program staff, awardees, proponents, recipients, contractors and travel participants in areas such as project development, implementation and monitoring as applied to a wide-variety of ...

  11. 7 CFR 3400.6 - Grant awards.

    Science.gov (United States)

    2010-01-01

    ..., the results of which are expected to have a significant impact on the food and agricultural sciences... research project grant to fund an initial or succeeding budget period does not constitute an obligation to... Regulations of the Department of Agriculture (Continued) COOPERATIVE STATE RESEARCH, EDUCATION, AND EXTENSION...

  12. 7 CFR 4280.110 - Grant funding.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) RURAL BUSINESS-COOPERATIVE SERVICE AND RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE LOANS AND GRANTS Renewable Energy Systems and Energy Efficiency... renewable energy system or energy efficiency improvement. (1) Post-application purchase and installation of...

  13. Grant Writing without Blowing a Gasket

    Science.gov (United States)

    Vandenbroek, Alicia

    2010-01-01

    In today's economic downturn budget cut is becoming more and more common. Even libraries seen as a vital part of the educational process are subject to reductions because districts are suffering financially. The answer? Grants. They aren't a perfect solution, but there is a lot of financial support available for those who ask. Besides the monetary…

  14. William T. Grant Foundation 2012 Annual Report

    Science.gov (United States)

    William T. Grant Foundation, 2013

    2013-01-01

    The William T. Grant Foundation was founded in 1936 to support strong social science research focused on "the enrichment of life, with a primary interest in people and in their adjustment to the world in which they live." Today, its funding priorities reflect this interest in research that affects young people's lives. This Annual Report…

  15. Carleton to oversee $40 million lab grant

    CERN Multimedia

    Singer, Zev

    2003-01-01

    "Carleton University got a major gift yesterday, as the federal government announced the university will oversee a $40-million grant to run the world's deepest underground lab at the Sudbury Neutrino Observatory. Five other universities are partners in the project" (1/2 page).

  16. IDEA FOR AN IDRC RESEARCH GRANT

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC CRDI

    Participating institutions are those that will participate directly in the conduct of the research, but will not receive funds directly from. IDRC. In this case, the proposing institution is responsible for disbursement of funds and for ensuring that all institutions abide by the standard terms and conditions that apply to the IDRC grant.

  17. Grants to Institutions: Frequently Asked Questions

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC CRDI

    Do I have to use the IDRC forms to submit the financial report? Does IDRC require submission of receipts with financial reports? How long do we need to keep receipts for? How can .... The generally accepted accounting principles that are applicable in your jurisdiction must be used by your institution to administer the grant.

  18. Grant Administration Officer | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Being a subject matter expert, the Grant Administration Officer provides expert advice and recommendations for the continuous improvement of business processes, tools and systems to improve the ... Participate in the testing of system enhancements to ensure proper integration between systems and business processes.

  19. African Tobacco Situational Analysis : Development Grants | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC's Research for International Tobacco Control (RITC) is partnering with the Bill & Melinda Gates Foundation (BMGF) in the African Tobacco Situational Analyses (ATSA), an initiative to understand the critical determinants for tobacco control in Africa. This grant will allow up to 15 national teams or consortiums whose ...

  20. 31 CFR 20.650 - Grant.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Grant. 20.650 Section 20.650 Money and Finance: Treasury Office of the Secretary of the Treasury GOVERNMENTWIDE REQUIREMENTS FOR DRUG... assistance that, consistent with 31 U.S.C. 6304, is used to enter into a relationship— (a) The principal...